Patent Grant
8506964
The present disclosure relates to fusion proteins and related compositions, methods and systems for treatment and/or prevention of atherosclerosis.
Atherosclerosis is currently viewed as a chronic lipid-related and immune-mediated inflammatory disease of the arterial walls. Many immune components have been identified that participate in atherogenesis and pre-clinical studies have yielded promising results suggesting that immuno-modulatory therapies targeting these components can reduce atherosclerosis.
Provided herein, are methods and systems for inducing immunomodulatory responses in an individual. In several embodiments, the immunomodulatory responses induced by the methods and systems of the present disclosure are associated to a therapeutic or preventive effect related to atherosclerosis in the individual or a condition associated thereto.
According a first aspect a fusion protein is described. The fusion protein comprises an antigenic fragment of apoB-100 protein or a derivative thereof and a protein carrier, the antigenic fragment and the carrier comprised in the fusion protein in a fragment:carrier 1:1 molar ratio the fusion protein capable of inducing antigen specific regulatory T cells, the antigen specific regulatory T cells specific for the antigenic fragment of apoB-100.
According to a second aspect, a method to treat and/or prevent atherosclerosis in an individual is described. The method comprises administering to the individual an effective amount of a fusion protein herein described, the effective amount eliciting an antigen specific Treg immunomodulatory response in the individual, the antigen specific Treg immunomodulatory response specific for the antigenic fragments of apoB-100 or a derivative thereof.
According to a third aspect, a composition is described. The composition comprises a fusion protein herein described and an adjuvant and/or excipient. In several embodiments the adjuvant and/or excipients are pharmaceutically acceptable and the composition is pharmaceutical composition
According to a fourth aspect, a method to produce a fusion protein is described. The method comprises conjugating a fragment of apoB-100 or a derivative thereof with a suitable protein carrier to provide a fusion protein capable of inducing antigen specific regulatory T cells, the antigen specific regulatory T cells specific for the fragment of apoB-100 or the derivative thereof.
According to a fifth aspect, a method to induce an antigen specific Tregulatory cell is described. The method comprises contacting a Tregulatory cell with a fusion protein herein described for a time and under conditions to allow induction of a Tregulatory response, wherein the contacting results in an antigen-specific induction of a Tregulatory cell that is specific for the fragment of apoB-100 or derivative thereof comprised in the fusion protein.
The methods and systems herein described can be used in connection with applications wherein reduction of plaque, attenuation of plaque growth and/or a therapeutic or preventive effect for atherosclerosis in an individual is desired.
The details of one or more embodiments of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages will be apparent from the description and drawings, and from the claims.
The accompanying drawings, which are incorporated into and constitute a part of this specification, illustrate one or more embodiments of the present disclosure and, together with the detailed description and examples sections, serve to explain the principles and implementations of the disclosure.
Provided herein are fusion proteins, compositions, methods and systems that in several embodiments are suitable to be used for immunoprotection against atherosclerosis.
The term “fusion protein” as used herein indicates a protein created through the attaching of two or more polypeptides which originated from separate proteins. In particular fusion proteins can be created by recombinant DNA technology and are typically used in biological research or therapeutics. Fusion proteins can also be created through chemical covalent conjugation with or without a linker between the polypeptides portion of the fusion proteins.
The term “attach” or “attached” as used herein, refers to connecting or uniting by a bond, link, force or tie in order to keep two or more components together, which encompasses either direct or indirect attachment such that for example where a first polypeptide is directly bound to a second polypeptide or material, and the embodiments wherein one or more intermediate compounds, and in particular polypeptides, are disposed between the first polypeptide and the second polypeptide or material.
The term “protein” or “polypeptide” as used herein indicates an organic polymer composed of two or more amino acid monomers and/or analogs thereof. The term “polypeptide” includes amino acid polymers of any length including full length proteins and peptides, as well as analogs and fragments thereof. A polypeptide of three or more amino acids is also called an oligopeptide. As used herein the term “amino acid”, “amino acidic monomer”, or “amino acid residue” refers to any of the twenty naturally occurring amino acids including synthetic amino acids with unnatural side chains and including both D and L optical isomers. The term “amino acid analog” refers to an amino acid in which one or more individual atoms have been replaced, either with a different atom, isotope, or with a different functional group but is otherwise identical to its natural amino acid analog.
In particular in several embodiments, fusion proteins, compositions methods and systems are described that in several embodiments are suitable for eliciting an antigen specific T regulatory cells response in an individual.
The term “antigen”, as it is used herein, relates to any substance that, when introduced into the body can stimulate an immune response. Antigens comprise exogenous antigens (antigens that have entered the body from the outside, for example by inhalation, ingestion, or injection) and endogenous antigens or autoantigens (antigens that have been generated within the body). In particular, an “autoantigen” is an antigen that despite being a normal tissue constituent is the target of a humoral or cell-mediated immune response. Exemplary autoantigens comprise autoantigens associated to atherogenesis and/or atherosclerosis provided by low-density lipoprotein and its constituent protein, ApoB100.
The term “regulatory T cell” or “Treg” as used herein indicates a component of the immune system that suppress immune responses of other cells, and comprises T cells that express the CD8 transmembrane glycoprotein (CD8+ T cells); T cells that express CD4, CD25, and Foxp3 (CD4+CD25+ regulatory T cells); and other T cell types that have suppressive function identifiable by a skilled person. Treg comprise both naturally occurring T cells and T cells generated in vitro.
The term “antigen-specific” as used indicates an immunitary response, and in particular, immunological tolerance, for a certain antigen which is characterized by a substantially less or no immune response (and in particular, immunological tolerance) for another antigen. Accordingly, an antigen specific regulatory T cell, specific for one or more autoantigens is able, under appropriate conditions to minimize to the specific immune response to the one or more autoantigens with substantially less or no minimizing effect on the immune response towards other antigens or autoantigens.
Fusion proteins comprising autoantigen associated with atherogenesis and/or atherosclerosis and related methods and systems are herein described that are capable of eliciting an autoantigen specific Treg response and that in several embodiments can be used for treating and/or preventing atherosclerosis or a condition associated thereto in an individual.
The term “atherosclerosis” as used herein indicates an inflammatory condition, and in particular the condition in which an artery wall thickens as the result of a build-up of fatty materials such as cholesterol. In some cases, atherosclerosis is treated with statin therapy (1). In several cases, atherosclerosis is a syndrome affecting arterial blood vessels, a chronic inflammatory response in the walls of arteries, in large part due to the accumulation of macrophage white blood cells and promoted by Low-density lipoproteins (plasma proteins that carry cholesterol and triglycerides) without adequate removal of fats and cholesterol from the macrophages by functional high density lipoproteins (HDL), (see apoA-1 Milano). Lipid retention and modification in the arterial intima in some cases elicit a chronic inflammatory process with autoimmune responses and the development of atherosclerotic lesions (2). Both adaptive and innate immune mechanisms have been described as contributors to this process (3-6). While pattern recognition receptors of innate immunity are believed to account for cholesterol uptake and contribute to activation of macrophages and endothelial cells, antigen-specific T cells recognizing low density lipoprotein (LDL) particles in the intima provide strong proinflammatory stimuli that accelerate atherogenesis. Atherosclerosis is commonly referred to as a hardening or furring of the arteries. It is believed to be caused by the formation of multiple plaques within the arteries. Typically, autoimmune responses to low-density lipoproteins (LDL) contribute to its progression, while immunization with LDL may induce atheroprotective or proatherogenic responses.
The term “treating” or “treatment” as used herein indicates any activity that is part of a medical care for, or that deals with, a condition medically or surgically. The term “preventing” or “prevention” as used herein indicates any activity, which reduces the burden of mortality or morbidity from a condition in an individual. This takes place at primary, secondary and tertiary prevention levels, wherein: a) primary prevention avoids the development of a disease; b) secondary prevention activities are aimed at early disease treatment, thereby increasing opportunities for interventions to prevent progression of the disease and emergence of symptoms; and c) tertiary prevention reduces the negative impact of an already established disease by restoring function and reducing disease-related complications.
The term “condition” as used herein indicates as usually the physical status of the body of an individual (as a whole or of one or more of its parts) that does not conform to a physical status of the individual (as a whole or of one or more of its parts) that is associated with a state of complete physical, mental and possibly social well-being. Conditions herein described include but are not limited to disorders and diseases wherein the term “disorder” indicates a condition of the living individual that is associated to a functional abnormality of the body or of any of its parts, and the term “disease” indicates a condition of the living individual that impairs normal functioning of the body or of any of its parts and is typically manifested by distinguishing signs and symptoms. Exemplary conditions include but are not limited to injuries, disabilities, disorders (including mental and physical disorders), syndromes, infections, deviant behaviors of the individual and atypical variations of structure and functions of the body of an individual or parts thereof.
The wording “associated to” as used herein with reference to two items indicates a relation between the two items such that the occurrence of a first item is accompanied by the occurrence of the second item, which includes but is not limited to a cause-effect relation and sign/symptoms-disease relation.
The term “individuals” as used herein indicates a single biological organism such as higher animals and in particular vertebrates such as mammals and more particularly human beings.
In several embodiments, induction of an antigen specific Tregulatory cell response is provided by a fusion protein comprising an antigenic fragment of apoB-100 and a protein carrier attached directly or through a linker in an fragment:carrier 1:1 proportion.
The term “fragment” as used herein indicates a portion of a polypeptide of any length. A skilled person will understand that the term encompasses peptides of any origin which have a sequence corresponding to the portion of the polypeptide at issue. An antigenic fragment of apoB100 is accordingly a portion of apoB-100 that presents antigenic properties. Antigenic fragments of apoB-100 herein described also include possible derivatives thereof.
The term “derivative” as used herein with reference to a first polypeptide (e.g., apoB-100 antigenic fragment), indicates a second polypeptide that is structurally related to the first polypeptide and is derivable from the first polypeptide by a modification that introduces a feature that is not present in the first polypeptide, while retaining functional properties of the first polypeptide. Accordingly, a derivative polypeptide of an antigenic fragment of apoB-100, usually differs from the original polypeptide or portion thereof by modification of the amino acidic sequence that might or might not be associated with an additional function not present in the original polypeptide or portion thereof. A derivative polypeptide of an antigenic fragment of apoB-100 retains however antigenic properties comparable to the ones described in connection with apoB-100 or the antigenic fragment thereof. Retaining of one or more antigenic properties can be verified with methods identifiable by a skilled person upon reading of the present disclosure, on the basis of the specific antigenic property of the fragment at issue. Exemplary methods comprise immunizing an animal (e.g. mouse) with a candidate derivative, determining production of antibody specific for the derivative in the animal (e.g. by ELISA such as immunometric ELISA) and comparing the determined antibody production for the candidate derivative with a corresponding antibody production of the fragment. Additional methods to determine further antigenic properties can be identified by a skilled person upon reading of the present disclosure.
The term “protein carrier” as used herein indicates proteins that transport a specific substance or group of substances through intracellular compartments or in extracellular fluids (e.g. in the blood) or else across the cell membrane. Exemplary carrier proteins comprise subunit B of cholera toxin, Avidin, BTG protein, Bovine G globulin, Bovine Immunoglobulin G, Bovine Thyroglobulin, Bovine Serum Albumin (BSA), Conalbumin, Edestein, Exoprotein A from Pseudomonas aeruginosa, HC (Hemocyanin from crab Paralithodes camtschatica), Helix Promatia Haemocyanin (HPH), Human Serum Albumin (HSA), KTI (Kunits trypsin inhibitor from soybeans), Keyhole Limpet Heamocyanin (KLH), LPH (Haemocyanin from Limulus polyphemus), Ovalbumin, Pam3Cys-Th, Polylysine, porcine Thyroglobulin (PTG), Purified Protein Derivative (PPD), Rabbit Serum Albumin (RSA), Soybean Trypsin Inhibitor (STI) Sunflower Globulin (SFG) and additional molecules identifiable by a skilled person. Additional carriers comprise molecule having immunogenic activities including cytokines such as IL-10, IL12, IL-4 IL-16 and Transforming Growth Factor Beta (TGFβ).
In some embodiments, attachment of the carrier is performed at the C-terminus or N-terminus of the fragment. In an embodiment the fusion protein can be provided as a single polypeptide through recombinant DNA technology and related processes, such as cloning, chimeric constructs, Polymerase Chain Reaction and additional procedures identifiable by a skilled person. In some embodiments, attachment can be performed through chemical linkage of the fragment to the carrier using methods also identifiable by a skilled person.
In some embodiments, the antigenic fragment of apoB-100 comprises amino acids 3136-3155 of human apoB-100 (p210) and/or additional fragments selected from the peptides illustrated in the Examples section.
In particular in some embodiments the fragment portion of the fusion product can comprise one or more of peptides P2, P11, P25, P32, P45, P74, P102, P129, P143, P148, P154, P162, P210, P219, P240. More particularly, in some embodiments the fragment portion of the fusion products can comprise one or more of peptides P2, P45, P102 and P210.
In an embodiment, wherein the fragment portion of the fusion protein comprise more than one peptide, the fragment portion can comprise up to 10 peptides in a construct that, at least in some of those embodiments, is expected to have effects analogous to those of cancer or infectious vaccines, such as the ones described in (35) herein incorporated by reference in its entirety. As skilled person will be able to identify suitable combination of peptides for a desired immunogenic, preventive and/or therapeutic effect upon reading of the present disclosure.
In some embodiments, the carrier protein can comprise at least one monomer of the subunit B of cholera toxin which can be formed by a recombinant pentameric B oligomer that is capable of binding GM-1 receptors (e.g. on the surface of intestinal epithelial cells). In particular, in some embodiments, the carrier protein can be formed by at least one of five identical monomers with a molecular weight of approximately 11.6 kDa recombinant pentameric B oligomer molecule. In some of those embodiments, the monomers are tightly linked into a trypsin-resistant pentameric ring-like structure with a molecular weight of approximately 58 kDa.
In some embodiments, the antigenic fragments can be attached to the carrier molecule using biological genetic engineering to produce a fusion protein (with single or multiple copies of the immunogenic peptide) and procedures identifiable by a skilled person upon reading of the present disclosure.
In some embodiments, the antigenic fragments can be attached to the carrier molecule using chemical covalent conjugation (with or without a linker group) and procedures identifiable by a skilled person upon reading of the present disclosure.
In some embodiments, fusion products or antigenic fragments can be used in the treatment of atherosclerosis and or for induction of regulatory T-cells
In some embodiments, antigen-specific immunomodulation by vaccination is an approach used to prevent or treat chronic inflammatory diseases associated to atherogenesis. In some of those cases, by mobilizing protective immune responses in an antigen-specific manner, side effects due to hampered host defense against infections can be avoided. Exemplary protocols comprise protocols described to treat atherosclerosis in mice and rabbits immunized with LDL, beta2-glycoprotein-1b, or heat-shock protein 60/65, and parenteral (7-10) as well as oral (11-14) immunization reduced atherosclerotic disease in hyperlipidemic animals.
In some embodiments, antigen-specific immunoprotection can be achieved through several different mechanisms, such as production of protective antibodies, deletion or inactivation (anergy) of pathogenic T cell clones, or induction of suppressive cellular immunity mediated by the family of regulatory T cells (Treg) (15-16). In some of those embodiments, immunization with immunodominant peptide sequences can be performed in several cases in alternative to immunization with LDL particles (17-18).
In an embodiment, an immunization protocol that facilitates selective targeting of antigen-specific regulatory T cells can be performed. The type of immune response triggered is largely determined by the route of immunization.
In several embodiments, fusion products or antigenic fragments herein described can be administered to an individual using various routes of administration including subcutaneous, intramuscular, parenteral, and systemic and mucosal administration such as oral and/or nasal. In particular, the mucosal linings of airways and intestines contain lymphatic tissue that, when exposed to antigen, elicits anti-inflammatory, immunosuppressive responses (19). Distinct immunological features of the respiratory and intestinal mucosa lead to partly different types of protective immunity upon antigen exposure by the nasal or oral route (20). In some embodiments, the B subunit of cholera toxin (CTB) promotes uptake of antigen via the nasal and oral mucosa and induction of protective immunity (21, 22).
In some embodiments, administration of carrier/adjuvant/peptide vaccines is performed for a time and under condition to activate regulatory T cells and down-regulate pathogenic autoimmunity against Apo B.
In particular, in some embodiments, administration of a fusion protein is performed by nasal administration of an apoB100 peptide-CTB fusion protein (p210-CTB). In some embodiments, treatment with p210-CTB significantly reduced atherosclerosis in apoe−/− mice and was associated with induction of antigen-specific Treg activity.
In some embodiments, intranasal immunization with an apoB-100 fusion protein induces antigen-specific regulatory T cells and reduces atherosclerosis.
In several embodiments, nasal administration of an apoB100 peptide fused to CTB attenuates atherosclerosis and induces regulatory Tr1 cells that inhibit T effector responses to apolipoprotein B-100.
In some embodiments, fusion products, compositions and/or methods compositions herein described can be used a novel strategy for induction of atheroprotective immunity involving antigen-specific regulatory T cells. In particular, in several By nasal administration of a fusion protein between an immunodominant peptide of apoB-100 and immunomodulatory CTB, we were able to induce an atheroprotective immune response to apoB-100 that involved expansion of antigen-specific regulatory CD4+ T cells and inhibition of aortic lesion development.
In several embodiments, induction of antigen-specific Treg with fusion protein methods and systems herein described provides atheroprotection using parenteral or oral routes for LDL immunization. Additionally, results illustrated in the Examples section concerning induction of antigen-specific atheroprotective immunity mucosal immunization in apoe−/− mice, which spontaneously develop atherosclerosis and are therefore already sensitized to plaque antigens such as LDL particles at the time of vaccination, supports the conclusion that a comparable approach in humans with pre-existing lesions is expected to provide immunization.
In some embodiments, herein described fusion proteins trigger a mechanism of atheroprotection where the atheroprotective effect paralleled an induction of Treg suppression of apoB-100-specific effector T cells and an increase in IL-10+ CD4+ T cells. In particular, in some embodiments, nasal immunization with p210-CTB protects against atherosclerosis by induction of antigen-specific, IL-10+ regulatory Tr1 cells. A possible explanation that is provided herein for guidance purpose only and it is not intended to be limiting is that atheroprotection in several cases does not involve the immunosuppressive cytokine TGF-β since nasal immunization with p210-CTB reduced atherosclerosis also in mice lacking functional TGF-β receptors on T cells.
In some embodiments, fusion protein herein described provide an antigen-specific as well as antigen-independent effects similar to what reported in studies of Treg (25). In particular, in some embodiments, Treg suppress conventional effector T cells with the same antigen specificity. In some embodiments, Treg exert major effects on antigen-presenting cells in an antigen-independent manner. In some embodiments, the antigen-specific atheroprotection is paralleled by inhibition of apoB100-specific effector T cells by Treg specific for p210 but not OVA. These findings support a protective role for autoantigen-specific Treg in atherosclerosis.
In some embodiments, two major types of Treg induced in the periphery by antigen exposure have been identified: FoxP3+ induced Treg (Th3)14 and Tr1 cells (26). Tr1 cells are FoxP3 negative, secrete IL-10, and are believed to play an important role when regulatory immunity is induced by nasal immunization (27), (28). In some embodiments, where atheroprotection is induced by nasal immunization and associated with suppressor T cell activity and IL-10 producing CD4+ T cells, administration of fusion protein herein described is associated with Tr1 induction by p210-CTB. CD4+ T cells with antigen-specific suppressor activity were derived from spleen, a known reservoir of Tr1 cells (26).
In some embodiments, FoxP3+ Treg can contribute to atheroprotection in this model following administration of a fusion protein herein described as indicated by an increase of FoxP3 mRNA was increased in the aorta of nasally immunized mice. In some embodiments, these cells can not only act directly to control proinflammatory effector T cells but also promote the activation of Tr1 cells (19). In some embodiments, wherein abrogation of TGF-β signaling is detected, Tr1 cells do not extinguish atheroprotection.
In some embodiments, where Treg markers are elevated also in OVA-CTB immunized mice, antigenically nonspecific effects can synergize with antigen-specific ones to confer protection.
In some embodiments, antibodies to the apoB100 peptide sequence are induced by nasal immunization, but do not crossreact with native mouse LDL particles. Furthermore, in some embodiments where particular antibody titers are not correlated with lesion size and no difference in lipoprotein profiles is detected between apoB-100-CTB immunized and OVA-CTB, immunized mice atheroprotection is associated to immunomodulation rather than antibody-dependent elimination of LDL.
In some embodiments, fusion proteins herein described are comprised in a composition together with suitable adjuvant and/or excipients.
The term adjuvant as used herein indicates a pharmacological or immunological agent that modify the effect of other agents (e.g., drugs, vaccines) while having few if any direct effects when given by themselves. They are often included in vaccines to enhance the recipient's immune response to a supplied antigen while keeping the injected foreign material at a minimum. Types of adjuvants include: Immunologic adjuvant that stimulate the immune system and increase the response to a vaccine, without having any specific antigenic effect in itself.
The term excipients as used herein indicates an inactive substance used as a carrier for the active ingredients of a medication. Exemplary excipients can also be used to bulk up formulations that contain very potent active ingredients, to allow for convenient and accurate dosage. In addition to their use in the single-dosage quantity, excipients can be used in the manufacturing process to aid in the handling of the active substance concerned. Depending on the route of administration, and form of medication, different excipients may be used that are identifiable by a skilled person.
In some embodiments, the compositions comprises selected (immunogenic) peptide fragments of apoB-100 (single or multiple copies) fused with a carrier molecule and possibly toxins/toxoids: tetanus toxin, diphtheria toxoid, B subunit of cholera toxin, as well as BSA, HAS, rHSA, KLH, ovalbumin
In some embodiments, the adjuvants and excipients are pharmaceutically acceptable and the resulting composition is a pharmaceutical composition. In some of those embodiments, the pharmaceutical composition is a vaccine.
In some embodiments, adjuvants are components of the vaccine formulation that enhance immunogenicity of the antigen, for instance by promoting their uptake by antigen-presenting cells (17, 29). Interestingly, two studies documented an atheroprotective effect of complete Freund's adjuvant in hypercholesterolemic ldlr−/− and apoe−/− mice (30-31). In a recent study, subcutaneous administration of alum adjuvant was shown to increase antigen uptake and activation of cellular immune responses in hypercholesterolemic mice (32). In some embodiments, a specific antibody response against the apoB-100 peptide and an immunomodulatory cytokine profile in aortas of mice immunized with OVA-CTB described herein is in line with such an adjuvant effect. This further underlines the importance of using optimal immunomodulatory components in vaccine preparations.
In several embodiments, atheroprotective vaccine is provided by targeting a peptide of the LDL protein constituent apolipoprotein B-100 to the nasal mucosa to induce a protective mucosal immune response.
Further details concerning the implementation of the fusion products methods herein described including systems for performance of the methods which can be in the form of kit of parts as well as related compositions including donors, acceptors, compounds and other reagents together with suitable carrier, agent or auxiliary agent of the compositions, and generally manufacturing and packaging of the kit, can be identified by the person skilled in the art upon reading of the present disclosure.
The fusion proteins and related compositions methods and systems herein described are further illustrated in the following examples, which are provided by way of illustration and are not intended to be limiting.
In particular, the following examples illustrate an exemplary immunization performed with a fusion protein comprising amino acids 3136-3155 of human apoB-100 (p210) fused with CTB identified also as p210-CTB. A person skilled in the art will appreciate the applicability of the features described in detail for P210-CTB for additional fusion protein comprising another antigenic peptide of apoB-100 and a carrier molecule according to the present disclosure.
More particular, in the following examples the recombinant protein, p210-CTB, was made from amino acids 3136-3155 of human apoB-100 (p210)15 fused with CTB. This sequence is identical to the corresponding murine sequence with the exception of a 2-residue insert at the C-terminal end in the mouse. As a control, amino acids 323-339 of ovalbumin were fused to CTB (OVA-CTB). 8-week-old female apoe−/− mice received a nasal spray with 15 μG (in 15 μL) p210-CTB or OVA-CTB twice weekly. Lesions and immune parameters were analyzed 12 weeks later. In another set of experiments, apoe−/−×CD4dnTGFbRII mice (23) were immunized using the same protocol. All experiments were approved by the Stockholm regional ethical board. Atherosclerotic lesions were analyzed in cryostat sections of the aortic root using a standardized protocol (24). Antibodies to p210 and to mouse LDL particles were analyzed by immunometric ELISA15.
Antigen-specific Treg activity was analyzed in the following way: apoe−/− mice were immunized subcutaneously with apoB-100 to generate effector T cells. CD4+ T cells from these mice were exposed to antigen and activation recorded as DNA synthesis. CD4+ T cells from apoe−/− mice immunized intranasally with p210-CTB were added to effector T cell preparations and Treg activity was recorded as inhibition of DNA synthesis. Intracellular staining was performed on CD4+ T cells to characterize cytokine production and T cell subtype.
Additional details concerning procedures used and results obtained are reported below.
Specific immunogenic epitopes by focusing on the single protein found in LDL, apolipoprotein B-100 (apo B) were characterized. A peptide library comprised of 302 peptides, 20 amino acid residues in length, covering the complete 4563 amino acid sequence of human apo B was produced. The peptides were produced with a 5 amino acid overlap to cover all sequences at break points. Peptides were numbered 1-302 starting at the N-terminal of apo B as indicated in Table 1 below.
Plasma samples were obtained from 10 patients with clinically evident atherosclerotic heart disease. In addition, 50 plasma samples were obtained from 25 men and 25 women with no evidence of atherosclerotic heart disease. Samples of the 20 amino acid long peptides were adsorbed to microtiter plates to perform enzyme-linked immunosorbent assay (ELISA) analyses of the plasma samples. Peptides were used in their native state or after oxidation by exposure to copper or after modification by malondialdehyde (MDA).
Plasma samples from patients and normal subjects contained antibodies to a large number of different peptides. Antibodies against both native and modified peptides were identified. A total of 38 peptide sequences were identified as potential targets for immune reactions that may be of importance for the development of atherosclerosis.
The peptide sequences against which the highest antibody levels were detected could be divided in six groups with certain common characteristics as indicated in Table 2 below.
Inhibition of atherosclerosis in apo E −/− mice by immunization with fifteen different test articles based on fifteen different peptide fragments of apo B was investigated.
In these experiments, apo E −/− mice received primary subcutaneous immunization at 6-7 weeks of age, followed by two boosters administered 3 and 5 weeks later. The mice were fed a high cholesterol diet from 1 week after the second injection (10 weeks of age) and continued until sacrifice at 25 weeks of age. The effect of immunization on atherosclerosis formation was assessed by measuring plaque size (percent area stained with Oil Red O) in an en face preparation of the aorta.
Based on the results from these and other experiments, four peptides were identified as particularly effective in reducing the progression of atherosclerosis.
The gene fusions used in the present disclosure were constructed using a CTB expression vector essentially as described previously (Sadeghi H, Bregenholt S, Wegmann D, Petersen J S, Holmgren J, and Lebens M. Genetic fusion of human insulin B-chain to the B-subunit of cholera toxin enhances in vitro antigen presentation and induction of bystander suppression in vivo. Immunology. 2002; 106:237-245). Synthetic oligonucleotides from Innovagen (Lund, Sweden) were used to make double stranded DNA fragments encoding the peptide sequence of interest that could be inserted into the vector such that the added peptide formed a carboxyl extension of mature CTB. The unmodified peptide p210 corresponding to amino acids 3136-3155 of human apoB-100 (KTTKQSFDLSVKAQYKKKNKH-SEQ ID NO:210) was encoded by the DNA sequence:
5′CAAAACGACCAAGCAAAGCTTTGATCTGAGCGTGAAAGCGCAGTATAA
3′CATGGTTTTGCTGGTTCGTTTCGAAACTAGACTCGCACTTTCGCGTCA
This sequence is 90.9% identical to amino acids 3157-3185 of the murine apoB100 sequence, the exception being the insertion of a Serine (S) and an Asp (D) residue between N and KH in the C-terminal portion of the peptide:
Oligonucleotides were synthesized that encoded the p210 peptide corresponding to amino acids 3136-3155 of human apoB-100. The coding regions are flanked by sticky ends compatible with restriction enzymes KpnI and HindIII. Insertion into the expression vector leads to an in-frame extension to the carboxyl terminus of mature CTB.
The synthetic sequence was optimized for expression in E. coli. The single strands were annealed and ligated into the pML-CTB vector digested with KpnI and HindIII. Ligated DNA was used to transform E. coli B strain BL21. Transformants were selected initially on the basis of ampicillin resistance and plasmids were then screened using restriction analysis. Finally the sequence of the insert in selected clones was confirmed by DNA sequencing. Protein expression was induced by addition of IPTG to the growth medium. This resulted in the production of insoluble inclusion bodies containing the recombinant protein. The cells were disrupted by sonication following treatment with lysozyme and DNase. The inclusion bodies could be separated from the soluble cell protein and other insoluble cell debris by low speed centrifugation. LPS was removed by washing the inclusion bodies in three times in 0.1% triton X114 in PBS at 4° C. and subsequent extensive washing in PBS in order to remove the detergent. The inclusion bodies were dissolved in 6.5 M urea and reassembled into the biologically active pentameric form by removal of the urea by dialysis against 50 mM sodium carbonate buffer pH 9.0. The assembly and purity of the protein was assessed by SDS-PAGE. Receptor binding activity was confirmed by GM1 ELISA (Svennerholm A M, Holmgren J. Identification of Escherichia coli heat-labile enterotoxin by means of a ganglioside immunosorbent assay (GM1-ELISA) procedure. Curr Microbiol. 1978; 1:19-23). The protein was further partially purified by FPLC gel filtration using a sephadex 200 16/60 column. The OVA-CTB protein used as a control; also a fusion to the carboxyl terminus of mature CTB, was constructed and purified as previously described (George-Chandy A, Eriksson K, Lebens M, Nordström I, Schön E, Holmgren J. Cholera toxin B subunit as a carrier molecule promotes antigen presentation and increases CD40 and CD86 expression on antigen presenting cells. Infect Immun. 2001; 69:5716-5725).
Female apoe−/− mice were obtained from Taconic Europe (Ry, Denmark) and Apoe−/− CD4dnTGFβRIItg mice were previously generated in our laboratory (ref. 19). Starting at 8 weeks of age, mice were immunized intranasally twice per week for 12 weeks with either p210-CTB or OVA-CTB, both at 15 μg/dose (15 μl volume), or left untreated (PBS). Mice were fed a normal laboratory diet and sacrificed by CO2 asphyxiation. All experiments were approved by the regional board for animal ethics.
Lesion area per cross-section and fractional area of the lesion in the aortic root were quantified and the results expressed as the mean of 5 sections per mouse (ref. 22). In brief, fractional lesion area is calculated for each section as F %=(100×L/A) where L is lesion area (μm2) and A is area inside external elastic lamina (μm2). F % is averaged over all levels analyzed (200-600 μm2 above aortic cusps) and the mean calculated for each treatment group. This method eliminates artifacts caused by oblique sections.
Primary antibodies (CD4, CD68, VCAM-1, I-Ab; all rat anti-mouse from BD Biosciences (Franklin Lakes, N.J., U.S.A.) and FoxP3 by eBioscience (San Diego, Calif., U.S.A.) titrated to optimum performance on spleen sections were applied to acetone-fixed cryosections from the aortic root, followed by detection with the ABC alkaline phosphatase kit from Vector Laboratories (Burlingame, Calif., USA). A thresholding technique was implemented using computerized ImagePro analysis (Media Cybernetics, Bethesda, Md., U.S.A.) of immunostained sections. For RNA isolation the thoracic aortic arch distal of the aortic root was dissected and snap-frozen.
Flow cytometry was performed on a CyAn™ (Dako, Glostrup, Denmark) after staining with the appropriate antibodies; data were analyzed using Summit v4.3 software (Dako). Primary labeled antibodies used were from BD Biosciences (anti-CD4) or from eBioscience (anti-FoxP3). To characterize the cytokine expression profiles of CD4+ T cells from lung and spleen of nasally vaccinated mice, cell suspensions were prepared as described before and evaluated by intracellular cytokine staining and FACS analysis. Briefly, lung mononuclear cells were isolated by collagenase Type I digestion (324 U/ml; Sigma) for 1 h on a shaker and splenocytes were prepared by mechanical disruption followed by incubation in erythrocyte lysis buffer (Qiagen, USA) and extensively washed. CD4+ T cells were purified using MACS magnetic cell separation as described above. 2×105 spleen or lung cells previously stimulated with 10 ug/ml of human apoB-100 for 24 hours, were restimulated for 4 h at 37° C. in 7.5% CO2 with PMA (phorbol 12-myristate 13-acetate; 50 ng/ml), ionomycin (1 ug/ml; Sigma) and GolgiPlug (1 ul per 1 ml; BD Bioscience).
Alternatively, 2×105 CD4+ T cells previously stimulated with plate bound anti-CD3 (5 ug/ml) and anti-CD28 (2 ug/ml) for 3 days in culture together with recombinant mouse IL-2 (10 ng/ml; Peprotech) and IL-4 (1 ng/ml; Peprotech) followed by a 3 day incubation with only IL-2 and IL-4, were restimulated with plate bound anti-CD3 (5 ug/ml) and anti-CD28 (2 ug/ml) for 5 h in the presence of GolgiPlug. All cells were incubated with FcγR block (BD Bioscience) followed by surface (anti-CD4) and intracellular staining of IFNγ, IL-4, IL-17 or IL-10 (BD Bioscience) and FoxP3 (eBioscience) according to the manufacturer's instructions. Cells were analyzed on a CyAn™ flow cytometer (Dako).
A first group of apoe−/− mice were immunized subcutaneously with HPLC-purified human apoB-100 in complete Freund's adjuvant (CFA) from Pierce (Rockford, Ill., U.S.A.) and boosted 4 weeks later with apoB-100 in incomplete Freund's adjuvant (IFA) from Pierce to generate spleen T cells sensitized to human apoB-100, which were harvested one week later. A second group of mice received the nasal vaccine over 2 weeks (4 doses total/mouse) and CD4+ T cells were harvested from the spleen 3 days after the last nasal administration of the vaccine. Spleen CD4+ T cells (>95% purity) were isolated by negative selection over a magnetic column using MACS microbeads (CD4+ negative selection kit, Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) according to the manufacturer's protocol. Splenocytes from apoB100-vaccinated apoe−/− mice were cocultured at varying dilution ratios with purified CD4+ T cells from spleens of mice that had received nasal p210-CTB, OVA-CTB or PBS. To exclude contaminating apoB-100 in cell culture media, FCS-free IMDM from Gibco (Invitrogen, Carlsbad, Calif., U.S.A.) was supplemented with ITS™ from BD Biosciences. Cells were incubated for 72 hours in the absence or presence of purified human apoB-100 (20 μg/mL) with incorporation of 3H-thymidine during the last 18 hours. Data are presented as stimulation index (ratio of apoB-100-challenged to unchallenged coculture assay). In a second approach splenocytes and purified CD4+ T cells were separated in transwell plates from Corning (Corning, N.Y., U.S.A.) to analyze whether cell-cell contact inhibition abrogated the suppressive effect of tolerized CD4+ T cells.
ELISA methods were used to quantitate serum Ig isotypes specific for the apoB-100 peptide as well as total IgG and IgM as previously described (ref. 19). Sera from immunized mice were tested for antibodies to mouse LDL by incubation (1/50, 1/150 and 1/450 dilutions) in plates coated with mouse LDL (10 μg/ml) and using alkaline phosphatase-conjugated anti-mouse-IgG as detector antibody. Sera from C57BL/6 mice immunized with OVA-CTB were assayed for reactivity to mouse or human LDL, or to apoB100, at dilutions of 1/25, 1/250 and 1/2500.
RNA was isolated from the aortic arch using the RNeasy kit from Qiagen (Hilden, Germany). Total RNA was analyzed by BioAnalyzer from Agilent Technologies (Waldbronn, Germany). Reverse transcription was performed with Superscript-II and random hexamers (both from Invitrogen) and cDNA amplified by real-time PCR using primers and probes for FoxP3, IL-10, TGF-β, IFN-γ and hypoxanthine guanidine ribonucleosyltransferase (HPRT) in an ABI 7700 Sequence Detector from Applied Biosystems. All primers and probes were obtained as “assays on demand” from Applied Biosystems (Foster City, Calif., U.S.A.) Data were analyzed on the basis of the relative expression method with the formula 2−ΔΔCT, where ΔΔCT=ΔCT (sample)−ΔCT (calibrator=average CT values of all samples within each group), and ΔCT is the CT of the housekeeping gene (HPRT) subtracted from the CT of the target gene.
Total serum triglycerides were determined with an enzymatic assay from Roche Diagnostics (Mannheim, Germany) using a TECAN InfiniTE M200 plate reader (TECAN Nordic, Täby Sweden). Total serum cholesterol and lipoprotein profiles were determined by FPLC separation of 2 μL serum of all individuals using a micro-FPLC column from GE Healthcare coupled to a system for online separation and subsequent detection of cholesterol as described, using human serum as reference (Parini P et al., Lipoprotein profiles in plasma and interstitial fluid analyzed with an automated gel-filtration system. Eur J Clin Invest 2006; 36:98-104). IL-10 ELISA from Mabtech (Nacka Strand, Sweden) and TGF-β ELISA from R&D Systems (Minneapolis, Minn., U.S.A.) was used to measure cytokine levels in supernatants.
Values are expressed as mean±standard error of the mean (SEM) unless otherwise indicated., Non-parametric Kruskal-Wallis test was used for multiple comparisons, Mann-Whitney U test was used for pairwise comparisons. A p-value of <0.05 was considered significant.
Nasal immunization with p210-CTB caused a significant 35% reduction in atherosclerotic lesion size (p=0.015; p=0.039) and fractional lesion area (p=0.012; p=0.007) in the aortic root as compared with OVA-CTB or untreated controls, respectively (FIG. 1A,B and
Immunization did not significantly affect body weight, serum cholesterol or triglycerides (Table 4). Plasma lipoprotein profiles were similar in mice immunized with p210-CTB or OVA-CTB, respectively (
Real-time reverse transcription-PCR analysis of the thoracic aorta of apoe−/− mice showed significant increases in FoxP3 and IL-10 mRNA levels in both CTB vaccine groups (p210-CTB and OVA-CTB) (
P210-CTB immunization induced significantly elevated titers of IgG antibodies to the p210 peptide of apoB-100 (
Analysis of the cellular immune response in the lung, the major organ targeted after nasal vaccination, showed a significant decrease in CD4+ T cells expressing interferon-γ (characteristic of Th1 cells) and IL-17 (characteristic of Th17 cells), respectively, in mice treated with p210-CTB (
Systemic cellular immune responses were monitored in spleen cell preparations. Nasal immunization with p210-CTB significantly increased the proportion of spleen CD4+ T cells expressing the anti-inflammatory cytokine IL-10 (
To assess whether functional Treg were induced by immunization, we exposed spleen CD4+ T cells from apoe−/− mice immunized subcutaneously with human apoB-100 (effector T cells), to CD4+ T cells from mice immunized nasally with either p210-CTB, OVA-CTB, or no antigen (
To determine whether the atheroprotective effect of nasal vaccination with p210-CTB depended on TGF-β signaling in T cells, we immunized apoe−/− mice lacking functional TGF-β receptors on T cells (CD4dnTGFβRII×apoe−/− mice). Nasal immunization with p210-CTB significantly reduced atherosclerotic lesion size by 30% in CD4dnTGFβRII×apoe−/− mice, as compared with littermates immunized with OVA-CTB (
In the above exemplary procedures, a peptide comprising amino acids 3136-3155 of apolipoprotein B-100 (p210) was fused to the B subunit of cholera toxin (CTB), which binds to a ganglioside on mucosal epithelia. The effect of nasal administration of the p210-CTB fusion protein on atherogenesis was compared with that of an ovalbumin peptide fused to CTB and with untreated controls. Immunization with p210-CTB for 12 weeks caused a 35% reduction in aortic lesion size of apoe−/− mice. This effect was accompanied by induction regulatory T cells that markedly suppressed effector T cells rechallenged with apoB-100 and increased numbers of IL-10+ CD4+ T cells. Furthermore, a peptide-specific antibody response was observed. Atheroprotection was also documented in apoe−/− mice lacking functional transforming growth factor-beta receptors on T cells.
The above results confirm and extend previous reports on atheroprotective effects of immunization with LDL or its components5-8, 12, 15, 16. The use of complete LDL particles as immunogens is not attractive for clinical vaccination strategies since these particles may contain multiple pro-inflammatory and even potentially toxic molecules such as modified lipids and endotoxins. Recent studies have identified a set of apoB-100-derived peptides with significant atheroprotective effects15, 16, enabling development of a structurally defined vaccine candidate. Among them, specific native peptides were immunogenic in humans and mice and correlated with the extent of atherosclerotic disease (33-34). By combining a limited number of peptides in the vaccine, overcoming MHC restriction is expected. Combining peptide sequences with immunomodulatory components (adjuvants) such as CTB is an attractive approach to selectively induce protective immunity while avoiding side effects caused by non-peptide components in LDL particles. Unlike LDL, the vaccine formulation can be manufactured in a reproducible way and under Good Manufacturing Practice (GMP) conditions. The possibility to induce atheroprotective immunity by nasal administration of an LDL component is also attractive for clinical medicine.
In summary, the present disclosure provides fusion products and related compositions methods and systems that in several embodiments allow performing a strategy for atheroprotective immunization. A peptide sequence from apolipoprotein B-100 of low-density lipoprotein fused with a carrier such as the B subunit of cholera toxin is described and used for immunization of mices and in particular for intranasal immunization of Apoe−/− mice. Methods and systems herein described led to antigen-specific regulatory T cells and a 35% reduction of atherosclerosis.
The examples set forth above are provided to give those of ordinary skill in the art a complete disclosure and description of how to make and use the embodiments of the fusion proteins, compositions, systems and methods of the disclosure, and are not intended to limit the scope of what the inventors regard as their disclosure. Modifications of the above-described modes for carrying out the disclosure that are obvious to persons of skill in the art are intended to be within the scope of the following claims. All patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the disclosure pertains. All references cited in this disclosure are incorporated by reference to the same extent as if each reference had been incorporated by reference in its entirety individually.
The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, laboratory manuals, books, or other disclosures) in the Background, Summary, Detailed Description, and Examples is hereby incorporated herein by reference.
Further, the hard copy of the sequence listing submitted herewith and the corresponding computer readable form are both incorporated herein by reference in their entireties.
It is to be understood that the disclosures are not limited to particular compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. The term “plurality” includes two or more referents unless the content clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains.
When a Markush group or other grouping is used herein, all individual members of the group and all combinations and possible subcombinations of the group are intended to be individually included in the disclosure. Every combination of components or materials described or exemplified herein can be used to practice the disclosure, unless otherwise stated. One of ordinary skill in the art will appreciate that methods, device elements, and materials other than those specifically exemplified can be employed in the practice of the disclosure without resort to undue experimentation. All art-known functional equivalents, of any such methods, device elements, and materials are intended to be included in this disclosure. Whenever a range is given in the specification, for example, a temperature range, a frequency range, a time range, or a composition range, all intermediate ranges and all subranges, as well as, all individual values included in the ranges given are intended to be included in the disclosure. Any one or more individual members of a range or group disclosed herein can be excluded from a claim of this disclosure. The disclosure illustratively described herein suitably can be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein.
A number of embodiments of the disclosure have been described. The specific embodiments provided herein are examples of useful embodiments of the disclosure and it will be apparent to one skilled in the art that the disclosure can be carried out using a large number of variations of the fusion proteins, fusion protein components, compositions, methods steps, and systems set forth in the present description. As will be obvious to one of skill in the art, methods and devices useful for the present methods can include a large number of optional composition and processing elements and steps.
In particular, it will be understood that various modifications may be made without departing from the spirit and scope of the present disclosure. Accordingly, other embodiments are within the scope of the following claims.
The present application is related and claims priority of U.S. provisional application Ser. No. 61/302,051 entitled “Fusion Proteins and Related Compositions, Methods and Systems For Treatment and/or Prevention of Atherosclerosis” filed on Feb. 5, 2010 which is incorporated herein by reference in its entirety.
| Number | Name | Date | Kind |
|---|---|---|---|
| 4970144 | Fareed et al. | Nov 1990 | A |
| 5408038 | Smith et al. | Apr 1995 | A |
| 5972890 | Lees et al. | Oct 1999 | A |
| 7527795 | Nilsson et al. | May 2009 | B2 |
| 7528225 | Nilsson et al. | May 2009 | B2 |
| 7537758 | Nilsson et al. | May 2009 | B2 |
| 7544360 | Nilsson et al. | Jun 2009 | B2 |
| 7558611 | Arnold et al. | Jul 2009 | B2 |
| 7704499 | Nilsson et al. | Apr 2010 | B2 |
| 7785589 | Nilsson et al. | Aug 2010 | B2 |
| 8025876 | Nilsson et al. | Sep 2011 | B2 |
| 8029786 | Nilsson et al. | Oct 2011 | B2 |
| 8034336 | Nilsson et al. | Oct 2011 | B2 |
| RE43581 | Nilsson et al. | Aug 2012 | E |
| 20030105003 | Nilsson et al. | Jun 2003 | A1 |
| 20040002111 | Hansson et al. | Jan 2004 | A1 |
| 20060233817 | Hansson | Oct 2006 | A1 |
| 20080070265 | Hansson | Mar 2008 | A1 |
| 20090092618 | Hansson | Apr 2009 | A1 |
| 20090117137 | Nilsson et al. | May 2009 | A1 |
| 20090226475 | Nilsson et al. | Sep 2009 | A1 |
| 20100183706 | Nilsson et al. | Jul 2010 | A1 |
| 20110300172 | Nilsson et al. | Dec 2011 | A1 |
| Number | Date | Country |
|---|---|---|
| 1676602 | Jul 2006 | EP |
| 9743331 | Nov 1997 | WO |
| 9842751 | Oct 1998 | WO |
| 9946598 | Mar 1999 | WO |
| 0164008 | Sep 2001 | WO |
| 0168119 | Sep 2001 | WO |
| 02080954 | Oct 2002 | WO |
| 2004000884 | Dec 2003 | WO |
| 2012065133 | May 2012 | WO |
| 2012065135 | May 2012 | WO |
| Entry |
|---|
| Zhao et al. ,Circulation 120, S1018 (Nov. 2009). |
| Zhao et al. ,Circulation 114: II, p. 287 (Oct. 2006). |
| Caligiuri, G., et al., “Interleukin-10 deficiency increases atherosclerosis, thrombosis, and Low-density Lipoproteins in apolipoprotein E knockout mice.” Molecular Medicine 2003, 10-17. |
| Caligiuri, G., et al., Protective immunity against atherosclerosis carried by B cells of hypercholesterolemic mice. The Journal of Clinical Investigation, 2002, 109: 745-753. |
| Ameli, S., et al., “Effect of immunization with homologous LDL and oxidized LDL on early atherosclerosis in hypercholesterolemic rabbits.” Arteriosclerosis, Thrombosis and Vascular Biology 1996, 16: 1074-1079. |
| Anonymous, “APB—HUMAN.” Oct. 1, 2000, pp. 1-7 XP 55019488, retrieved from the internet URL: http:// www.Uniprot.org/uniprot/P04114.txt?version=23. |
| Klingenberg et al. “Intranasal immunization with apolipoprotein B-100 fusion protein induces antigen-specific regulatory T cells and reduces atherosclerosis.” Arteriosclerosis Thrombosis and Vascular Biology 30:, 2010. |
| Brown et al., “A vaccine against atherosclerosis.” Drug Discovery Today. 7(11):588-590, 2002. |
| Chen, S., et al., “Apolipoprotein B-48 is the product of a messenger RNA with organ-specific in frame stop codon.” Science 1987, 238: 363-366. |
| Chyu, K., et al., “Immunization using Apo B-100 related epitope reduces atherosclerosis and plaque inflammation in hypercholesterolemic apo E (-/-) mice.” Biochemical and Biophysical Research Communications 2005, 338: 1982-1989. |
| Fredrickson et al., “Treatment with apo B peptide vaccine inhitbits atherosclerosis in human apo B-100 transgenic mice without inducing an increase in peptide-specific antibodies.” J. Internal Med. 264: 563-570, 2008. |
| Fredrickson, G., et al., “Atheroprotective immunization with MDA-modified apo B-100 peptide sequence is associated with activation of Th2 specific antibody expression.” Autoimmunity 2005, 38: 171-179. |
| Fredrickson, G., et al., “Autoantibody against the amino acid sequence 661-680 in apo B-100 is associated with decreased carotid stenosis and cardiovascular events.” Atherosclerosis, 2007, 194: e188-e192. 194. |
| Fredrickson, G., et al., “Identification of immune responses against aldehyde-modified peptide sequences in ApoB associated with cardiovascular disease.” Arterioscler. Thomb. Vasc. Biol. 2003, 23: 872-878. |
| Fredrickson, G., et al., “Inhibition of atherosclerosis in Apo-E-null mice by immunization with Apo-B-100 peptide sequences.” Arterioscler. Thomb. Vasc. Biol. 2003: 23: 879-884. |
| Fredrickson, Gunilla Nordin et al., “Inhibition of atherosclerosis in apo E null mice by immunization with native and MDA-modified apo B peptide sequences.” Journal of the American College of Cardiology, Elsevier, New York, NY, US, vol. 39, No. 5; Supplement A; p. 240A; Mar. 2002. |
| Fredrikson et al. “Association Between IgM Against an Aldehyde-Modified Peptide in Apolipoprotein B-100 and Progression of Carotid Disease.” Stroke, May 2007, 38: 1495-1500. |
| Fredrikson et al., “Associations between autoantibodies against apolipoprotein B-100 peptides and vascular complications in patients with type 2 diabetes.” Diabetologia (2009), 52: 1426-1433. |
| Freigang, S., et al., “Immunization of LDL receptor-deficient mice with homologous malondialdehyde-modified and native LDL reduces progression of atherosclerosis by mechanisms other than induction of high titers of anitbodies to oxidative neoepitopes.” Arterioscler. Thomb. Vasc. Bio., 1998, 18: 1972-1982. |
| George, J. et al., “Hyperimmunization of apo-E-deficient mice homologous malondialdehyde low-denisity lipoprotein suppresses early atherogenesis.” Arteriosclerosis, 138:147-152, 1998. |
| George, J., et al., “Induction of early atherosclerosis in LDL-receptor deficient mice immuized with beta-glycoprotein I.” American Heart Association 1998, 1108-1115. |
| Halvoet, P. et al., “Oxidized LDL and malondialdehyde-modified LDL in patients with acute coronary syndromes and stable coronary artery disease.” Circulation 1998, 98: 1487-1494. |
| Hansson et al. “Vaccination against atherosclerosis? Induction of atheroprotective immunity.” Semin. Immunopathol. (2009). |
| Pedersen et al. “The proinflammatory effect or uraemia overrules the anti-atherogenic potentiation of immunization with oxidized LDL in apoE-/-mice” Nephrology Dialysis Transplantation 25:2486-2491, 2010. |
| Hansson, K., “Inflammation, atherosclerosis, and coronary artery disease.” The New England Journal of Medicine 2005, 352: 1685-1695. |
| Law, S.W., Proceedings National Academy of Sciences 83 (21), 8142-6, 1986. |
| Nilsson, J. et al., “Autoimmunity in atherosclerosis: a protective response losing control.” Journal of Internal Medicine 2008, 263: 464-478. |
| Nilsson, J. et al., “Immunization with homologous oxidized low density lipoprotein reduces neointimal formation after balloon injury in hypercholesterolemic rabbits.” Journal of American College of Cardiology 1997, 30: 1886-1891. |
| Nilsson, J. et al., “Immunomodulation of atherosclerosis.” Arteriosclerosis, Thrombosis, and Vascular Biology 2005, 25 : 18-28. |
| Palinski, W. et al., “Antisera and Monoclonal Antibodies Specific for Epitopes Generated during Oxidative Modification of Low Density Lipoprotein.” Arteriosclerosis, 10:325-335, 1990. |
| Palinski, W. et al., “Immunization of low density lipoprotein (LDL) receptor-deficient rabbits with homologous malondialdehyde-modified LDL reduces atherogenesis”, PNAS USA, 92:821-825, Jan. 1995. |
| Sjogren et al. “High plasma concentrations of autoantibodies against native peptide 210 of apoB-100 are related to less coronary atherosclerosis and lower risk of myocardial infarction.” European Heart Journal (2008) 29, 2218-2226. |
| Stemme et al., “T lymphocytes from human atherosclerotic plagues recognize oxidized low density lipoprotein.” pp. 3893-3897, PNAS, vol. 92, Apr. 1995 (USA). |
| Yang et al. “Sequence, structure, receptor-binding domains and internal repeats of human apolipoprotein B-100.” Nature, vol. 23, Oct. 1986, pp. 738-742. |
| Zhao et al. Circulation 114: 11, p. 287 (Oct. 2006). |
| Zhao et al., “Athero-protective effects of immunization with apoB-100 related peptide vaccine in apoE-/-mice is associated with enhanced CD8 Regulatory T Cell Response.” Circulation, 2009; 120: S1018. |
| Zhou, X. et al., “LDL immunization induces T-cell-dependent antibody formation and protection against atherosclerosis.” Arteriosclerosis, Thrombosis and Vascular Biology, 2001, 21: 108-114. |
| Chen et al., Primary sequence mapping of human apolipoprotein B-100 epitopes. Eur J Biochem 175: 111-118, 1988. |
| Number | Date | Country | |
|---|---|---|---|
| 20110300172 A1 | Dec 2011 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61302051 | Feb 2010 | US |
