Patent Grant
11072806
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Nov. 22, 2019, is named 127789-250275_SL.txt and is 125,217 bytes in size.
The present disclosure is in the field of molecular biology and is related to engineered microorganisms and the production of gadusol by genetically engineered microorganisms.
Exposure to sun is believed to cause many of the skin changes associated with aging and contributes to pre-cancerous and cancerous skin lesions, benign tumors, wrinkling, mottle pigmentations, and other important challenges to human health and well-being.
Despite the wide availability of sun protectant sunscreens and general knowledge of the dangers of too much sun exposure and sun burn, skin cancer rates continue to grow. Each year more and more cases of skin cancer are diagnosed, and every fifty-seven minutes someone dies from melanoma. Unfortunately, consumer's choice in sunscreens remain limited, especially for sunscreens and formulations derived from naturally occurring sun protective compounds.
Gadusol is a natural sunscreen/antioxidant found in marine fish, is derived from 4-deoxygadusol, the precursor of mycosporine-like amino acids produced by cyanobacteria, some Gram-positive bacteria, fungi, macroalgae, and marine invertebrates. These UV-protective compounds appear to be critical for the survival of reef-building corals and other marine organisms exposed to high solar irradiance.
Despite a continued need for better UV protectants and sunscreens, there remains a lack of means for producing sufficient amounts of such compounds. The present disclosure meets those needs.
Disclosed is a transgenic yeast cell, or population thereof, the transgenic yeast cell including a nucleotide sequence capable of expressing 2-epi-5-valione synthase (EEVS) protein integrated in a genome of the transgenic yeast cell, and a nucleotide sequence capable of expressing methyltransferase/oxidoreductase (MT-Ox) protein integrated in the genome of the transgenic yeast cell.
In embodiments, the yeast cell comprises one or more disrupted transaldolase genes of the transgenic yeast cell, wherein the disruption results in a reduction of transaldolase activity in the transgenic yeast cell as compared to a wild-type yeast cell.
In embodiments, the one or more disrupted transaldolase genes comprises TAL1.
In embodiments, the one or more disrupted transaldolase genes comprises NQM1.
In embodiments, the one or more disrupted transaldolase genes comprises both TAL1 and NQM1.
In embodiments, the yeast cell is engineered to over express ZWF1.
In embodiments, the at least one of the nucleotide sequence capable of expressing EEVS protein and the nucleotide sequence capable of expressing MT-Ox protein are codon optimized for expression in yeast.
In embodiments, the yeast cell comprises a Saccharomyces cerevisiae yeast cell.
In embodiments, the nucleotide sequence capable of expressing EEVS protein comprises a yeast promoter operably connected to a nucleic acid sequence encoding a EEVS protein.
In embodiments, the nucleic acid sequence encoding the EEVS protein comprises a nucleic acid sequence that encodes a protein having an amino acid sequence at least 95% identical to SEQ ID NO: 21.
In embodiments, the nucleic acid sequence encoding the EEVS protein comprises a nucleic acid sequence at least 95% identical to any one of SEQ ID NOs 1-8.
In embodiments, the yeast promoter is a yeast TEF1 promoter.
In embodiments, the nucleotide sequence capable of expressing MT-Ox protein comprises a yeast promoter operably connected to a nucleic acid sequence encoding a MT-Ox protein.
In embodiments, the nucleic acid sequence encoding the MT-Ox protein comprises a nucleic acid sequence that encodes a protein having an amino acid sequence at least 95% identical to SEQ ID NO: 22.
In embodiments, the nucleic acid sequence encoding the MT-Ox protein comprises a nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 9-16.
In embodiments, the yeast promoter is a yeast PGK1 promoter.
In embodiments, the nucleotide sequence capable of expressing EEVS and the nucleotide sequence capable of expressing MT-Ox are integrated into the yeast genome at chromosome 15 at the his3Δ1 locus.
In embodiments, the nucleotide sequence capable of expressing EEVS and the nucleotide sequence capable of expressing MT-Ox are stably integrated.
In embodiments, the nucleotide sequence capable of expressing EEVS and the nucleotide sequence capable of expressing MT-Ox are stably integrated for at least 20 generations.
Disclosed is a bioreactor comprising a population of transgenic yeast cells.
Disclosed is a method for the production of the gadusol, the method comprising culturing a transgenic yeast cell in growth media.
In embodiments, at least a portion of the gadusol in secreted into the growth media.
In embodiments, the method further comprises isolating gadusol.
Embodiments will be readily understood by the following detailed description in conjunction with the accompanying drawings. Embodiments are illustrated by way of example and not by way of limitation in the figures of the accompanying drawings.
In the following detailed description, reference is made to the accompanying drawings which form a part hereof, and in which are shown by way of illustration embodiments that may be practiced. It is to be understood that other embodiments may be utilized and structural or logical changes may be made without departing from the scope. Therefore, the following detailed description is not to be taken in a limiting sense, and the scope of embodiments is defined by the appended claims and their equivalents.
Various operations may be described as multiple discrete operations in turn, in a manner that may be helpful in understanding embodiments; however, the order of description should not be construed to imply that these operations are order dependent.
The terms “coupled” and “connected,” along with their derivatives, may be used. It should be understood that these terms are not intended as synonyms for each other. Rather, in particular embodiments, “connected” may be used to indicate that two or more elements are in direct physical contact with each other. “Coupled” may mean that two or more elements are in direct physical contact. However, “coupled” may also mean that two or more elements are not in direct contact with each other, but yet still cooperate or interact with each other.
For the purposes of the description, a phrase in the form “A/B” or in the form “A and/or B” means (A), (B), or (A and B). For the purposes of the description, a phrase in the form “at least one of A, B, and C” means (A), (B), (C), (A and B), (A and C), (B and C), or (A, B and C). For the purposes of the description, a phrase in the form “(A)B” means (B) or (AB) that is, A is an optional element.
The description may use the terms “embodiment” or “embodiments,” which may each refer to one or more of the same or different embodiments. Furthermore, the terms “comprising,” “including,” “having,” and the like, as used with respect to embodiments, are synonymous, and are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.).
With respect to the use of any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity.
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology can be found in Benjamin Lewin, Genes IX, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); and other similar references.
Suitable methods and materials for the practice or testing of this disclosure are described below. Such methods and materials are illustrative only and are not intended to be limiting. Other methods and materials similar or equivalent to those described herein can be used. For example, conventional methods well known in the art to which this disclosure pertains are described in various general and more specific references, including, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
By “bioreactor” is meant a vessel comprising a liquid medium in which biological reactions are carried out by microorganisms, or the enzymes they produce, contained within the vessel itself. The term “bioreactor” is used throughout the specification to describe any vessel or container wherein the biological production and/or isolation of gadusol is carried out in a controlled fashion. The main objective in the design of a bioreactor is to generate an optimal environment for the desired biological process to take place on a large and economic scale. Bioreactors can be made from an inert material such as stainless steel or glass. An exemplary bioreactor may comprise a vertical Pyrex (glass) column that is adapted with at least two inlets for medium and air at the bottom of the column and at least one outlet port at the top of the column to accommodate expunged medium and/or air. See, for example, Hamdy, et al., Biomass., 21, 189-206 (1990).
As used herein, “disrupted gene” refers to an insertion, substitution, or deletion either in a gene of interest or in the vicinity of the gene, i.e., upstream (5′) or downstream (3′) of the gene, which results in the reduction of the biological activity or the loss of substantially all of the biological activity associated with the gene's product. For example, a disrupted TAL1 gene would be unable to express a protein having substantial TAL1 activity. A gene can be disrupted by any one of a number of methods known to the art, for example, by site-directed mutagenesis or homologous recombination.
“Expression” refers to the transcription and translation of an endogenous gene or a transgene in a host cell. For example, in the case of antisense constructs, expression may refer to the transcription of the antisense DNA only. In addition, expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. Expression may also refer to the production of protein.
The term “gene” is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and/or the regulatory sequences required for their expression. For example, gene refers to a nucleic acid fragment that expresses mRNA, or specific protein, including regulatory sequences. Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
A “mutation” refers to an insertion, deletion or substitution of one or more nucleotide bases of a nucleic acid sequence, so that the nucleic acid sequence differs from the wild-type sequence. For example, a ‘point’ mutation refers to an alteration in the sequence of a nucleotide at a single base position from the wild type sequence.
The term “nucleic acid molecule” refers to a polymer of DNA or RNA that can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers. The terms “nucleic acid” or “nucleic acid sequence” may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene (Batzer et al., 1991; Ohtsuka et al., 1985; Rossolini et al., 1999).
“Operably linked” when used with respect to nucleic acid, means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is under transcriptional initiation regulation of the promoter. Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.
“Overexpression” refers to the level of expression in transgenic cells or organisms that exceeds levels of expression in corresponding normal or untransformed cells or organisms.
“Promoter” refers to a nucleotide sequence, usually upstream (5′) to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. An “inducible promoter” is a regulated promoter that can be turned on in a cell by an external stimulus, such as a chemical, light, hormone, stress, or a pathogen.
The terms “protein,” “peptide” and “polypeptide” are used interchangeably herein.
As used herein, a “transgenic”, “transformed”, or “recombinant” cell refers to a genetically modified or genetically altered cell, the genome of which comprises a recombinant DNA molecule or sequence (“transgene”). For example, a “transgenic cell” can be a cell transformed with a “vector.” A “transgenic”, “transformed”, or “recombinant” cell thus refers to a host cell such as yeast cell into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome by methods generally known in the art (e.g., disclosed in Sambrook and Russell, 2001). For example, “transformed,” “transformant,” and “transgenic” cells have been through the transformation process and contain a foreign or exogenous gene. The term “untransformed” refers to cells that have not been through the transformation process.
The term “transformation” refers to the transfer of a nucleic acid fragment into the genome of a host cell, or the transfer into a host cell of a nucleic acid fragment that is maintained extrachromosomally. A “transgene” refers to a gene that has been introduced into the genome by transformation. Transgenes may include, for example, genes that are heterologous or endogenous to the genes of a particular cell to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes. The term “endogenous gene” refers to a native gene in its natural location in the genome of an organism. Such genes can be hyperactivated in some cases by the introduction of an exogenous strong promoter into operable association with the gene of interest. A “foreign” or an “exogenous” gene refers to a gene not normally found in the host cell but that is introduced by gene transfer.
“Vector” is defined to include, inter alia, any plasmid, cosmid, phage or other construct in double or single stranded linear or circular form that may or may not be self transmissible or mobilizable, and that can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally, e.g., autonomous replicating plasmid with an origin of replication. A vector can comprise a construct such as an expression cassette having a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest that also is operably linked to termination signals. An expression cassette also typically comprises sequences required for proper translation of the nucleotide sequence. The expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus.
The term “wild type” refers to an untransformed cell, i.e., one where the genome has not been altered by the presence of the recombinant DNA molecule or sequence or by other means of mutagenesis. A “corresponding” untransformed cell is a typical control cell, i.e., one that has been subjected to transformation conditions, but has not been exposed to exogenous DNA.
In addition, a “wild type” gene refers to a gene, e.g., a recombinant gene, with its original or native DNA sequence, in contrast to a “mutant” gene.
Introduction
Gadusol (
The zebrafish (Danio rerio) EEVS-like gene having the sequence shown in SEQ ID NO. 1 was codon-optimized to provide SEQ ID NO. 2 for heterologous expression in Escherichia coli and synthesized commercially. Incubation of the recombinant protein with SHIP gave a product, which was confirmed by TLC, GC-MS, ESI-MS and 1H NMR to be 2-epi-5-epi-valiolone (EEV) (
MT-Ox gene sequence shown in SEQ ID NO: 9 (zgc:113054) is predicted to encode a protein that contains two possible domains: the N-terminal domain is similar to SAM-dependent methyltransferases and the C-terminal domain is similar to NAD+-dependent oxidoreductases. The MT-Ox gene is a bifunctional protein involved in modifying EEV to yield a reduced and methylated product (
Gadusol or 3,5,6-trihydroxy-5-hydroxymethyl-2-methoxycyclohex-2-en-1-one is a cyclohexanone tautomer. Gadusol shifts between enol and enolate forms as a function of pH as shown in
Gadusol is synthesized from sedoheptulose 7-phosphate (SH7P), a pentose phosphate pathway (PPP) intermediate. As shown in
While chemical data for gadusol suggest a role as a sunscreen and antioxidant, in vivo studies are less clear. Gadusol's high molar absorptivity in the UV-B range first led to suggestions for a role as a sunscreen (Plack et al. 1981). Sunscreens like gadusol protect tissues by absorbing UV light before it can damage cells. UV-B causes damage through at least two known mechanisms. It induces pyrimidine dimer formation in DNA, leading to mutations and can also generate free radicals which lead to oxidation of lipids and proteins (Sinha and Hader 2002). The photostability of the gadusolate tautomer found at physiological pH supports a sunscreen role (Arbeloa et al. 2011). However, gadusol is found in relatively low concentrations in fish tissues except in the roe (Plack et al. 1981). In order for a sunscreen to be effective, it must be sufficiently concentrated to prevent UV irradiation from penetrating the periphery of the cell and reaching molecular targets. Sunscreens like gadusol, which are soluble in the cytosol, must reach a high-intracellular concentration to provide such protection (Garcia-Pichel 1994; Gao and Garcia-Pichel 2011). While gadusol has also been shown to exhibit antioxidant activity in vitro, it is unknown to what extent it contributes to such activity in vivo where NADPH and GSH play prominent roles. Gadusol may also have protective and tuning roles in animal vision, as it has been found in the lenses of the eyes of several marine animals. In addition to protecting sensitive tissues from UV-B-damage (Dunlap et al. 1989), gadusol also helps tune the UV vision of mantis shrimp by absorbing light in the 296-nm range, preventing activation of receptors that absorb light at that wavelength (Bok et al. 2014).
While it would be possible to harvest gadusol from naturally occurring sources, this would not be economical for producing the quantities of gadusol needed for commercially relevant sunscreen products. To overcome this and other problems, the inventors have developed methods and compositions that allow for the high efficiency production of gadusol in microorganism host cells, such as yeast. Expressing the biosynthetic genes for gadusol in microorganisms, such as yeast, provides an opportunity to leverage in-depth knowledge of yeast biochemistry to generate a sustainable process. Yeast possesses a robust pentose phosphate pathway, and by removing the transaldolase enzyme, which normally metabolizes SH7P, and adding EEVS and MT-Ox facilitated an effective shunt pathway from SH7P to gadusol. The mutant was cultured in YNB+2% glucose supplemented with leucine and lysine at 30° C. for 2 days. Analysis of the culture broth by HPLC, ESI-MS, and UV spectrophotometry revealed the presence of gadusol (
Sedoheptulose 7-phosphate (SH7P) is the natural precursor of gadusol and is a central intermediate in the pentose phosphate pathway, but is also derived from glycolytic intermediates (
The oxidative phase of the pentose phosphate pathway (PPP) is composed of three steps that generate two NADPH, a CO2 and the SH7P precursor, ribulose 5-phosphate. For emphasis, the oxidative phase of the pentose phosphate pathway originally shown in
The non-oxidative phase of the pentose phosphate pathway shuffles carbons between intermediates to generate a variety of phosphosugars, including SH7P, the precursor for gadusol. The non-oxidative phase of the pentose phosphate pathway originally shown in
An alternative SH7P biosynthetic pathway was recently described based on a previously unknown activity of Fba1 described above, and a newly-discovered phosphatase, Shb17 (Clasquin et al. 2011). This pathway originally shown in
The combined deletion of TAL1 and PGI1 was reported to increase accumulation of SH7P 4-fold, relative to a tal1 mutant (Schaaff et al. 1990). Phosphoglucoisomerase (PGI1) catalyzes the isomerization of glucose 6-phosphate to fructose 6-phosphate. One characteristic of pgi1Δ mutants is an inability to grow on glucose as sole carbon source (Aguilera 1987; Schaaff et al. 1990). Schaaff et al. (1990) isolated pgi1Δ mutants on growth medium containing 2% fructose and 0.1% glucose. pgi1Δ mutants must rely on the SH7P shunt or Tal1 activity to generate ribose 5-phosphate for growth because they cannot generate glucose 6-phosphate from fructose. tal1 pgi1 double mutants are forced to route carbon exclusively through the SHB17-shunt pathway to meet the cell's need for ribose 5-phosphate. Because pgi1 mutants are also unable to generate NADPH via the oxidative portion of the pentose phosphate pathway, they oxidize more acetaldehyde via an NADP+-dependent cytosolic aldehyde dehydrogenase (ALD6) and/or oxidize more isocitrate via NADP+-dependent cytosolic isocitrate dehydrogenase (IDP2) (Grabowska and Chelstowska 2003; Minard and McAlister-Henn 2005). Although pgi1Δ mutants cannot grow on glucose, a small amount (0.1%) is required for growth on fructose (Aguilera 1987). This requirement may arise from the role of glucose as a signaling molecule needed to induce expression of ribosomal protein genes (Pernambuco et al. 1996).
The present disclosure provides genetically engineered microorganisms and methods for the production of gadusol, for example using the 2-epi-5-valione synthase (EEVS) and methyltransferase-oxidoreductase (MT-Ox) encoding nucleotide sequences of EEVS and MTOx proteins that are used by the microorganisms in the production of gadusol. Gadusol produced by the engineered microorganisms and methods disclosed herein is useful as a UV protectant, and thus the present disclosure contributes significantly to the improvement of human health and well-being. The engineered microorganisms present a new avenue for large-scale production of a UV protectant for possible commercial and clinical uses. Large-scale production allows for the use of gadusol in pharmaceuticals, formulations, cosmetics, or dietary formulations and products. By way of example, formulations may include pills/capsules, creams, lotions, or the like.
Disclosed is a transgenic yeast cell (or population thereof) that includes a nucleotide sequence capable of expressing EEVS integrated in a genome of the transgenic yeast cell and a nucleotide sequence capable of expressing MT-Ox integrated in the genome of the transgenic yeast cell. During the development of the disclosed genetically engineered microorganisms and methods, the inventors discovered that integration of the EEVS and MT-Ox genes into the genome of a yeast cell had the effect of increasing the production on gadusol over yeast strains where the two genes were carried on one or more plasmids, for example as integrated into yeast chromosome 15 at the his3Δ1 locus. Furthermore, such integration increased the stability of gadusol production from the yeast. For example, a yeast cell containing a linearized and modified construct with EEVS under the control of the yeast TEF1 promoter and CYC1 terminator, MT-Ox under the control of the yeast PGK1 promoter and terminator was found to stably produce 64 mg/L vs 30 mg/L of gadusol. It was also found that integration resulted in yeast cells without significant loss of stability over time, for example, in tests no reduction in gadusol yields was noticed in cultures stored for weeks or months at storage conditions of 4° C. or over longer periods at −70° C. Additional advantages were also observed. For example, in a synthetic YNB-based medium, it had a doubling time of 1.7 hr vs 3.5 hr. In addition, this stable integration required no selection to maintain the genes, for example, one of the early plasmid expression systems tested required a medium lacking histidine and tryptophan. Absent such a selection requirement the yeast cells can be grown in a rich, histidine- and tryptophan-containing medium such as YEPD that will result in a much higher cell titer, and more gadusol. Gadusol production was found to be much more stable. That is, the ability to produce gadusol was lost within a few generations of growth by cells containing the plasmid-based expression system, whereas with the integrated genes, loss of gadusol production was only observed to drop after about 32 generations. By way of example, the yeast Saccharomyces cerevisiae may be engineered to include EEVS and MT-Ox sequences that are codon optimized for expression in yeast.
The yeast may be further engineered such that the EEVS and MT-Ox encoding sequences are under the control of at least one yeast promoter. In embodiments, the yeast cell comprises a Saccharomyces cerevisiae yeast cell. In embodiments, the nucleotide sequence capable of expressing EEVS comprises a yeast promoter operably connected to a nucleic acid sequence encoding a EEVS protein. In embodiments, the nucleic acid sequence encoding the EEVS protein comprises a nucleic acid sequence that encodes a protein having an amino acid sequence at least 95% identical to SEQ ID NO: 21, such as at least 95%, 96%, 97%, 98% 99% or even 100% identical. In embodiments, the nucleic acid sequence encoding the EEVS protein comprises a nucleic acid sequence at least 95% identical to any one of SEQ ID NOs 1-8, such as at least 95%, 96%, 97%, 98% 99% or even 100% identical. In embodiments, the yeast promoter is a yeast TEF1 promoter. In embodiments, nucleotide sequence capable of expressing MT-Ox protein comprises a yeast promoter operably connected to a nucleic acid sequence encoding a MT-Ox protein. In embodiments, the nucleic acid sequence encoding the MT-Ox protein comprises a nucleic acid sequence that encodes a protein having an amino acid sequence at least 95% identical to SEQ ID NO: 22, such as at least 95%, 96%, 97%, 98% 99% or even 100% identical. In embodiments, the nucleic acid sequence encoding the MT-Ox protein comprises a nucleic acid sequence at least 95% identical to any one of any one of SEQ ID NOs: 9-16, such as at least 95%, 96%, 97%, 98% 99% or even 100% identical. In embodiments, the yeast promoter is a yeast PGK1 promoter. In embodiments, the nucleotide sequence capable of expressing EEVS and the nucleotide sequence capable of expressing MT-Ox are integrated into the genome of the yeast at chromosome 15 at the his3Δ1 locus. In embodiments, the nucleotide sequence capable of expressing EEVS and the nucleotide sequence capable of expressing MT-Ox are stably integrated. In embodiments, the nucleotide sequence capable of expressing EEVS and the nucleotide sequence capable of expressing MT-Ox are stably integrated for at least 20 generations, such as at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more. In embodiments, at least one of the nucleotide sequence capable of expressing EEVS and the nucleotide sequence capable of expressing MT-Ox are codon optimized for expression in yeast.
In embodiments, the yeast cell includes one or more disrupted transaldolase genes of the transgenic yeast cell, wherein the disruption results in a reduction of transaldolase activity in the transgenic yeast cell as compared to a wild-type yeast cell. In embodiments, the one or more disrupted transaldolase genes comprises TALL In embodiments, the one or more disrupted transaldolase genes comprises NQM1. In embodiments, the one or more disrupted transaldolase genes comprises both TAL1 and NQM1.
The inventors further discovered that over expression of ZWF1 further increased the gadusol production. In embodiments, the transgenic yeast cell is engineered to over express ZWF1. This strain carries an overexpressed yeast gene called ZWF1 that encodes glucose 6-P dehydrogenase. This enzyme catalyzes the first step in the oxidative phase of the pentose phosphate pathway (PPP). This step is also believed to be rate-limiting for the PPP (Ralser et al., 2007; Stincone et al., 2015). Because the PPP generates the gadusol precursor sedoheptulose 7-P (S7P), it was thought that overexpression of ZWF1 would lead to more gadusol by increasing the pool of S7P. In fact, in tests it produced 37 mg/L gadusol vs 22 mg/L for which was isogenic except for the overexpressed ZWF1 gene.
A method for producing gadusol, the method comprising culturing transgenic yeast cell disclosed herein, for example in growth media. In embodiments, at least a portion of the gadusol is secreted into the growth media, for example, were it can be collected. The growth media may be a Yeast Nitrogen Base (YNB) that supports the growth of an engineered strain of yeast. Alternatively, the growth media may support the growth of an engineered bacterial strain. Generally, the method includes culturing a recombinant microorganism harboring functional EEVS and MT-OX genes at a sufficient temperature under sufficient conditions and for a sufficient period of time to allow for the production of gadusol. By way of example, the culturing temperature may be approximately 30° C. Preferably, the temperature is adjusted to match the optimal temperature for the type of microorganism being used, such a yeast strain.
In some embodiments, a starter culture may be used. For example, an engineered microorganism may be cultured for approximately 24-48 hours in YNB. The YNB may include approximately 2% glucose and necessary essential amino acids or nucleic acid bases that the strain itself cannot make. The starter culture may be used to inoculate a larger volume of the same or similar medium that is then cultured at an appropriate temperature for a period of time sufficient for maximum production of gadusol. By way of example, the engineered microorganism may be cultured up to 5 days. After the microorganism is cultured the gadusol containing broth may be subject to centrifugation (≥1,000×g) to provide a cell pellet and a cell-free broth that contains the produced gadusol. The cell-free broth may be extracted and the produced gadusol may be substantially purified from the cell-free broth. By way of example, extracting the cell-free broth may be accomplished with an equal volume of n-butanol. The resulting butanol phase may be recovered using a separatory funnel and the n-butanol removed by rotoevaporation to provide for a gadusol containing residue. The residue may be dissolved in methanol or distilled water or other polar solvent and subjected to various standard chromatographic steps to remove unwanted impurities and provide for substantially pure gadusol. In some embodiments, methods for producing gadusol are carried out in an engineered yeast strain configured for producing gadusol. The engineered yeast may secrete the produced gadusol.
The nucleic acid sequences disclosed herein and/or used for the production of gadusol and the construction of such nucleic acid sequences and/or expression vectors that may be employed in conjunction with the present disclosure will be known to those of skill of the art in light of the present disclosure (see, e.g., Sambrook and Russell, 2001). The expression sequences of the disclosure may contain one or a plurality of restriction sites allowing for placement of the polynucleotide encoding functional EEVS and MT-OX genes under the regulation of a regulatory sequence. The expression cassette may also contain a termination signal operably linked to the polynucleotide as well as regulatory sequences required for proper translation of the polynucleotide. The expression cassette containing the polynucleotide of the disclosure may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of the other components. Expression of the polynucleotide in the expression cassette may be under the control of a constitutive promoter, inducible promoter, regulated promoter, viral promoter or synthetic promoter. The expression cassette may include, in the 5′-3′ direction of transcription, a transcriptional and translational initiation region, the polynucleotide of the disclosure and a transcriptional and translational termination region functional in vivo and/or in vitro. The termination region may be native with the transcriptional initiation region, may be native with the polynucleotide, or may be derived from another source. The regulatory sequences may be located upstream (5 non-coding sequences), within (intron), or downstream (3 non-coding sequences) of a coding sequence, and influence the transcription, RNA processing or stability, and/or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, enhancers, promoters, repressor binding sites, translation leader sequences, introns, and polyadenylation signal sequences. They may include natural and synthetic sequences as well as sequences that may be a combination of synthetic and natural sequences.
Propagation of yeast cells in culture has become a regular procedure in recent years, and the yeast cells of the present disclosure may be grown using conventional techniques. Yeast strains of the disclosure may be cultured in any appropriate medium known to the art for the particular strain (see, for example, Adams et al., 1998). For example, S. cerevisiae strains may be grown at 30° C. in complete yeast extract/peptone/dextrose (YPD) medium supplemented with 2% glucose. Alternatively, the minimal selective medium with 2% glucose supplemented with auxotrophic requirements can be used.
A transgenic yeast cell of the disclosure may contain a selective marker, thus requiring selective conditions for culture, e.g., conditions that require the expression of a plasmid encoded gene for growth. Most selective markers currently in use are genes coding for enzymes of amino acid or purine biosynthesis. This makes it necessary to use synthetic minimal media deficient in the corresponding amino acid or purine base. However, some genes conferring antibiotic resistance may be used as well (e.g. genes conferring resistance to cycloheximide or to the amino-glycoside G418). Yeast cells transformed with vectors containing antibiotic resistance genes may be grown in complex media containing the corresponding antibiotic whereby faster growth rates and higher cell densities can be reached. Yeast cells transformed with DNA integrating into the chromosomes do not require selective growth conditions. These transformed cells are sufficiently stable to allow growth without selective pressure. For the above reason, these cells are advantageously grown in complex media.
Further disclosed is a bioreactor comprising a population of the transgenic yeast cell disclosed herein. Any one of a number of bioreactors known to the art can be used with the transgenic yeast cell of the disclosure for the production of gadusol. In some embodiments, methods for producing gadusol are carried out in an engineered bacterial or yeast strain configured for producing gadusol. The engineered bacteria or yeast may secrete the produced gadusol. In some embodiments, the methods for producing gadusol are carried out in a microorganism that lacks, or is engineered to lack, a functional TAL1 gene.
Materials and Methods
Media and Growth Conditions
Cells were grown in 2X YEPD (2% yeast extract, 4% peptone, and 4% glucose) for transformations, and in minimal medium (M) (Bacto yeast nitrogen base [YNB] without amino acids) (6.7 g/L)+2% glucose supplemented with histidine (20 μg/ml), leucine (30 μg/ml), lysine (30 μg/ml), tryptophan (20 μg/ml), or uracil (10 μg/ml) as needed. pgi1 mutants were grown in YNB+2% fructose+0.1% glucose with supplements as needed. “YNB+NADPH nutr.” is YNB+2% glucose supplemented with 20 μg/ml ergosterol from a 2 mg/ml ergosterol stock dissolved in 1:1 (vol/vol) EtOH:Tween 80, lysine (30 μg/ml), tryptophan (20 μg/ml), histidine (20 μg/ml), phenylalanine (50 μg/ml), and tyrosine (30 μg/ml). Stocks of all antibiotics were stored at −20° C. Ampicillin was prepared as an aqueous sterile-filtered 1000× stock (100 mg/ml). G-418 was prepared as an aqueous sterile-filtered 500× stock (100 mg/ml). Hygromycin B was prepared as an aqueous sterile-filtered 500× stock (150 mg/ml). The stocks were filtered through a sterile 0.45-μm filter. Agar-based media were sterilized by autoclaving. Liquid cultures were grown at 30° C. and 200 rpm; plates were incubated statically at 30° C.
For growth and gadusol experiments, isolated colonies from selective media were used to inoculate 2 ml cultures. The 2 ml cultures were grown for either 16 or 48 h at 30° C. and 200 RPM. Cells were harvested by centrifugation, washed with sterile water, and counted using hemocytometer. Cells were inoculated into 75 ml of media that was then split into three 25 ml cultures in 125-ml Erlenmeyer flasks to yield an initial cell density=105 cell/ml. Cultures were incubated at 30° C. and 200 RPM. Cultures were sampled periodically to measure growth (A600) and gadusol (A296).
Transformations
Yeast was transformed using the lithium acetate method (Gietz and Woods 2001). Briefly, the strain to be transformed was grown overnight at 30° C. and 200 RPM in 1 ml of 2XYEPD in an incubator shaker. The overnight culture was used to inoculate 25 ml of 2XYEPD at a concentration of 5×106 cells/ml. The 25 ml 2XYEPD culture was kept at 30° C. and 200 RPM until at least two cell doublings had occurred. Cells were then harvested by centrifugation at 1,200 g and washed twice with sterile water. An aliquot of 2×108 cells was then transferred to a 1.5 ml Eppendorf tube and centrifuged at 16,000 RPM in a microcentrifuge. Supernatant was removed from the tube without disturbing cells. The following chemicals and DNAs were then added in this specific order: 240 μl 50% (w/v) polyethylene glycol 3500, 36 μl lithium acetate, 50 μl 2.0 mg/ml single-stranded carrier DNA, and 34 μl of plasmid or PCR amplicon DNA. The transformation mixture was then mixed by pipetting and incubated at 42° C. for 40 minutes. Cells were pelleted to remove the transformation mixture and then washed with 1 ml of sterile water before plating on selective media.
E. coli strains were transformed according to suppliers' directions for chemically competent TOP10 cells (Invitrogen) and NEB-2β cells (New England Biolabs). Suppliers' directions briefly stated that 50 μl aliquots of the cells were to be removed from −70° C. storage and thawed on ice for 10 minutes. A 1-5 μl aliquot of DNA was added to the thawed cells followed by a 30-minute incubation on ice. After the incubation, the DNA-treated cells were heat shocked for 30 sec at 42° C. followed by a second 5 min incubation on ice. Cells were resuspended in 950 μl of SOC medium before aliquots were plated on selective media and grown at 37° C.
Strain Construction
E. coli strains (Table 1) maintained on LB+amp at 37° C. Liquid cultures were grown at 37° C. and shaken at 200 RPM.
Yeast strains (Table 2) were constructed as described below.
G0 (BY4742 trp1/pXP416-MTOx, pXP420-EEVS)
TRP1 in BY4742 was deleted by replacement with a 1.8 Kb PCR amplicon encoding URA3. The URA3 amplicon was generated using the TRP1DisURA3UP/LO primers (SEQ ID NO. 23 and 24) according to standard methods (Baudin et al. 1993; Gietz and Woods 2001). Transformants were selected on M+his+trp+leu+lys. The deletion of TRP1 was confirmed by diagnostic PCR, using the TRP1DisUP/LO primers (SEQ ID NO. 27 and 28) to generate a unique PCR amplicon of the URA3 gene inserted at the TRP1 locus (1.9 Kb). The BY4742 trp1Δ strain was co-transformed with both pXP416-MTOx (SEQ ID NO. 10 from the original provisional to which a stop codon has now been added) and pXP420-EEVS (SEQ ID NO. 2 from the original provisional to which a stop codon has now been added) using the lithium acetate method (Gietz and Woods 2001). Transformants were selected and maintained on M+leu+lys.
G1 (BY4742 tal1Δ trp1Δ/pXP416-MTOx, pXP420-EEVS)
TRP1 in BY4742 tal1Δ::KanMX4 was deleted by replacement with a 1.8 Kb PCR amplicon encoding URA3. The URA3 amplicon was generated using the TRP1DisURA3UP/LO primers according to standard methods (Baudin et al. 1993; Gietz and Woods 2001). Transformants were selected on M+his+trp+leu+lys+G418. Deletion of TRP1 was confirmed by diagnostic PCR using the TRP1DisUP/LO primers (SEQ ID NO. 27 and 28) to generate a unique PCR amplicon of the URA3 gene inserted at the TRP1 locus (1.9 Kb). The BY4742 tal1Δ trp1Δ strain was co-transformed with both pXP416-MTOx (SEQ ID NO. 10) and pXP420-EEVS (SEQ ID NO. 2) using the lithium acetate method (Gietz and Woods 2001). Transformants were selected and maintained on M+leu+lys.
G2 (BY4742 tal1Δ nqm1Δ trp1Δ/pXP416-MTOx, pXP420-EEVS)
NQM1 in BY4742 tal1Δ::KanMX4 was deleted by replacement with a 3.1 Kb PCR amplicon encoding LEU2. The LEU2 amplicon was generated using the NQM1DisLEU2UP/LO primers (SEQ ID NO. 40 and 41) according to standard methods (Baudin et al. 1993; Gietz and Woods 2001). Transformants were selected on M+his+trp+lys. Deletion of NQM1 was confirmed by diagnostic PCR using NQM1UP/LO primers (SEQ ID NO. 42 and 43) to generate a unique 4.2 Kb PCR amplicon. The BY4742 tal1Δ trp1Δ nqm1Δ strain was co-transformed with both pXP416-MTOx (SEQ ID NO. 10) and pXP420-EEVS (SEQ ID NO. 2) using the lithium acetate method (Gietz and Woods 2001). Transformants were selected and maintained on M+leu+lys.
G2C (BY4742 tal1Δ nqm1Δ trp1Δ/pXP416, pXP420)
The BY4742 tal1Δ trp1Δ nqm1Δ strain was co-transformed with both pXP416 and pXP420 using the lithium acetate method (Gietz and Woods 2001). Transformants were selected and maintained on M+leu+lys.
G3 (tal1Δ nqm1Δ trp1Δ his3Δ::pGH420-EEVS-MTOx-2μΔ)
BY4742 tal1Δ::KanMX4 trp1Δ nqm1Δ was transformed with NdeI-linearized pGH420-EEVS-MTOx-2μΔ (SEQ ID NO. 79) to direct integration to the his3Δ locus according to standard methods (Gietz and Woods 2001). Transformants were selected on M+lys+trp. Integration of pGH420-EEVS-MTOx-2μΔ (SEQ ID NO. 79) at the his3Δ locus was confirmed by diagnostic PCR targeting the junction between HIS3 and the MTOx gene (SEQ ID NO. 10) to generate a 2.3 Kb amplicon using HIS3MTOx-F/R primers (SEQ ID NO. 86 and 87).
G4 (BY4742 tal1Δ nqm1Δ trp1Δ pgi1Δ his3Δ::pGH420-EEVS-MTOx)
PGI1 in BY4742 tal1Δ::KanMX4 trp1Δ nqm1Δ his3Δ::pGH420-EEVS-MTOx-20 was deleted by replacement with a 1.9 Kb PCR amplicon encoding TRP1. The TRP1 amplicon was generated using the PGI1DisTRP1UP/LO primers (SEQ ID NO. 44 and 45) according to standard protocols (Baudin et al. 1993; Gietz and Woods 2001). Transformants were selected and maintained on YNB+2% fructose+0.1% glucose+lys. Deletion of PGI1 was confirmed by diagnostic PCR using PGI1DisUP/LO primers (SEQ ID NO. 46 and 47) to generate a unique 3.2 Kb PCR amplicon.
G5 (BY4742 tal1Δ trp1Δ pgi1Δhis3Δ::pGH420-EEVS-MTOx)
PGI1 in BY4742 tal1Δ::KanMX4 trp1Δ was deleted by replacement with a 1.9 Kb PCR amplicon encoding TRP1. The TRP1 amplicon was generated using the PGI1DisTRP1UP/LO primers according to standard protocols (Baudin et al. 1993; Gietz and Woods 2001). Transformants were selected and maintained on YNB+2% fructose+0.1% glucose+his+leu+lys. Deletion of PGI1 was confirmed by diagnostic PCR using PGI1DisUP/LO primers (SEQ ID NO. 44 and 45) to generate a unique 3.2 Kb PCR amplicon. BY4742 tal1Δ::KanMX4 trp1Δ pgi1Δ was transformed with NdeI-linearized pGH420-EEVS-MTOx-2μΔ (SEQ ID NO. 79) to direct integration to the his3Δ locus according to standard methods (Baudin et al. 1993). Transformants were selected on YNB+2% fructose+0.1% glucose+leu+lys. Integration of pGH420-EEVS-MTOx-2μΔ (SEQ ID NO. 79) at the his3Δ locus was confirmed by diagnostic PCR targeting the junction between the HIS3 marker and the MTOx gene (SEQ ID NO. 10) using HIS3MTOx-F/R primers (SEQ ID NO. 86 and 87) to generate a 2.3 Kb amplicon.
G6 (BY4742 tal1Δ trp1Δ nqm1Δ shb17Δ/pXP416-MTOx, pXP420-EEVS)
SHB17 in BY4742 tal1Δ trp1Δ nqm1Δ was deleted by replacement with a 1.6 Kb PCR amplicon encoding HphMX. HphMX was generated using SHB17disHphUP/LO primers (SEQ ID NO. 48 and 49) according to standard protocols (Baudin et al. 1993; Gietz and Woods 2001). Transformants were selected and maintained on YEPD+hygromycin B. Deletion of SHB17 (SEQ ID NO. 77) was confirmed by diagnostic PCR using SHB17DisUP/LO (SEQ ID NO. 50 and 51) to generate a unique 2 Kb PCR amplicon. BY4742 tal1Δ trp1Δ nqm1Δ shb17Δ was co-transformed with both pXP416-MTOx (SEQ ID NO. 10—MTOx only, not pXP416) and pXP420-EEVS (SEQ ID NO. 2—EEVS only, not pXP420) according to the lithium-acetate method. Transformants were selected and maintained on M+lys.
G7 (BY4742 tal1Δ trp1Δ nqm1Δ his3Δ::pGH420-EEVS-MTOx-2μΔ/pXP416-SHB17)
BY4742 tal1Δ trp1Δ nqm1Δ his3Δ::pGH420-EEVS-MTOx-2μΔ was transformed with pXP416-SHB17 (SEQ ID NO. 77—SHB17 only, not pXP416) according to the lithium-acetate method (Gietz and Woods 2001). Transformants were selected and maintained on M+lys.
G8 (BY4742 tal1Δ trp1Δ nqm1Δ his3Δ::pGH420-EEVS-MTOx TEF1::pXP416-SHB17-2μΔ)
BY4742 tal1Δ trp1Δ nqm1Δ his3Δ::pGH420-EEVS-MTOx was transformed with BbsI-linearized pXP416-SHB17-2μΔ (SEQ ID NO. 80) to direct integration to the TEF1 locus according to the lithium-acetate method (Gietz and Woods 2001). The 2μ yeast replicative origin was removed (−2 μA) to ensure construct integration. Transformants were selected and maintained on M+lys media. Integration of pXP416-SHB17-2μΔ (SEQ ID NO. 80) at the TEF1 locus could not be verified by PCR. However, growth on the selection medium indicates integration of at least the TRP1 gene with the genome.
G9 (BY4742 tal1Δ trp1Δ pho13Δ/pXP416-MTOx, pXP420-EEVS)
PHO13 (SEQ ID NO. 81) in BY4742 tal1Δ trp1Δ was deleted by replacement with a 1.6 Kb PCR amplicon encoding HphMX. The HphMX amplicon was generated using the PHO13HphUP/LO primers according to standard methods (Baudin et al. 1993; Gietz and Woods 2001). Transformants were selected on YEPD+hygromycin B. Deletion of PH013 (SEQ ID NO. 81) was confirmed by diagnostic PCR using PHO13UP/LO primers (SEQ ID NO. 54 and 55) to generate a unique 2.4 Kb PCR amplicon. The BY4742 tal1Δ trp1Δ pho13Δ strain was co-transformed with both pXP416-MTOx (SEQ ID NO. 10—MTOx only) and pXP420-EEVS (SEQ ID NO. 2—EEVS only) using the lithium acetate method (Gietz and Woods 2001). Transformants were selected and maintained on M+leu+lys.
G10 (BY4742 tal1Δ trp1Δ/pXP416-MTOx, pXP420-EEVS, pXP422-ZWF1)
BY4742 tal1Δ trp1Δ was transformed with pXP420-EEVS (SEQ ID NO. 2—EEVS only), pXP416-MTOx (SEQ ID NO. 10—MTOx only), and pXP422-ZWF1 (SEQ ID NO. 78—ZWF1 only) according to the lithium-acetate method (Gietz and Woods 2001). Transformants were selected and maintained on M+lys.
DNA Primers
DNA primers needed to construct yeast strains and plasmids are listed in Table 3.
GCGCC
TTGGA
ACCTA
CGGCCA
ATACC
TTTGT
GTCGCCC
TCGAGGC
GTCGCCC
TCGAGGC
TTCTTGCTCATTAGAAAGAAAGCAT
AGCAATCTAATCTAAGTTTTAATTA
CAAAACTAGTATGCCTTCGCTAACC
GAGCGGATGTGGGGGGAGGGCGTGA
ATGTAAGCGTGACATAACTAATTAC
ATGACTCGAGTTACACATCGCCATG
Construction of Plasmids
Plasmids (Table 4) were constructed as described below. Plasmid maps are shown in
E. coli carrier
pXP416-MTOx (SEQ ID NO. 10—MTOx only)
pXP416 plasmid was extracted and purified from a 1-ml culture of DH5a/pXP416 E. coli grown in LB+amp. An aliquot of pXP416 was digested with SpeI- and XhoI-restriction enzymes yielding a 5.8 Kb fragment. SpeI-, XhoI-digested plasmid was gel purified using a Qiagen gel-purification kit. The MTOx cDNA (SEQ ID NO. 10—MTOx only) was amplified by PCR from pRSETB-MTOx (SEQ ID NO. 10—MTOx only) yielding a 1.7 Kb amplicon. The MTOXUP/MTOXLO primers (SEQ ID NO. 34 and 35) used for amplification attached a SpeI site to the 5′-end and a XhoI site to the 3′-end of the cDNA. The MTOx PCR amplicon (SEQ ID NO. 10—MTOx with added 5′ SpeI site 3′ XhoI site) flanked by SpeI and XhoI sites was digested with SpeI and XhoI and gel purified using a gel-purification kit (Qiagen). The purified SpeI-XhoI-digested MTOx cDNA (SEQ ID NO. 10) was ligated into SpeI-XhoI-digested pXP416 using New England Biolab's T4 DNA ligase kit. The ligation mixture was used to transform competent TOP10 E. coli (Invitrogen). Transformants were selected and maintained on LB+amp plates. Construction of pXP420-MTOx (SEQ ID NO. 10—MTOx only) (
pXP416-SHB17
SHB17 (SEQ ID NO. 77) was cloned into pXP416 by homologous recombination to avoid disrupting the SHB17 ORF by cutting with XhoI. SHB17 was amplified using PTEF1-Spe1-SHB17/TCYC1-XhoI-SHB17 primers (SEQ ID NO. 56 and 57) that contained 60-bp of sequence homologous to both ends of SpeI-XhoI-linearized pXP416. BY4742 tal1Δ trp1Δ was transformed with SHB17 amplicon (SEQ ID NO. 77) and SpeI-XhoI linearized pXP416 plasmid according to standard methods (Gietz and Woods 2001). Transformants were selected and maintained on M+his+leu+lys. The plasmid was rescued from a yeast transformant by extracting DNA according to a genomic DNA extraction protocol and used to transform competent TOP10 E. coli (Schwartz and Sherlock 2016). Plasmid DNA was extracted and purified from E. coli transformants using a plasmid miniprep kit (Qiagen). Construction of pXP416-SHB17 (SEQ ID NO. 77—SHB17 only) was verified by digestion with BbsI and analysis by gel electrophoresis which yielded 2.8 and 3.8 Kb fragments as expected.
pXP416-SHB17-2μΔ
The yeast origin of replication (2 μA) sequence was removed from pXP416-SHB17 (SEQ ID NO. 77—SHB17 only) by digestion with EcoRI. Five nanograms of EcoRI-digested pXP416-SHB17 DNA (SEQ ID NO. 77—SHB17 only) were added to a T4 ligase-mediated ligation reaction after which competent TOP10 E. coli was transformed with 5 μl of the reaction mixture. Transformants were selected on LB+Amp. Construction of pXP416-SHB17-2μΔ (SEQ ID NO. 77—SHB17 only) (
pXP420-EEVS
pXP420 plasmid was extracted and purified from a 1-ml culture of DH5a/pXP420 E. coli grown in LB+amp. An aliquot of pXP420 was digested with SpeI- and XhoI-restriction enzymes yielding a 6.0 Kb fragment. SpeI-, XhoI-digested plasmid was gel purified using a Qiagen gel-purification kit. The EEVS cDNA (SEQ ID NO. 2) was amplified by PCR from pRSETB-EEVS (SEQ ID NO. 2—EEVS only) yielding a 1.4 Kb amplicon. The DEEVSUP/DEEVSLO primers (SEQ ID NO. 32 and 33) used for amplification attached a SpeI site to the 5′-end and a XhoI site to the 3′-end of the cDNA. The EEVS PCR amplicon (SEQ ID NO. 2—EEVS with added 5′SpeI and 3′XhoI sites) bordered by SpeI and XhoI sites was digested with SpeI and XhoI and gel purified using a Qiagen gel-purification kit. The purified SpeI-XhoI digested EEVS cDNA (SEQ ID NO. 2—EEVS with added 5′SpeI and 3′XhoI sites) was ligated into SpeI-XhoI digested pXP420 using New England Biolab's T4 DNA ligase kit. The ligation mixture was then used to transform competent TOP10 E. coli from Invitrogen. Transformants were selected and maintained on LB+amp plates. Construction of pXP420-EEVS (SEQ ID NO. 2—EEVS only) (
pGH420-EEVS-MTOx
A plasmid expressing both EEVS (SEQ ID NO. 2—EEVS only) and MTOx (SEQ ID NO. 10—MTOx only) was constructed using in vivo ligation. BY4742 tal1Δ trp1Δ nqm1Δ was co-transformed with seven PCR amplicons as described in Example 2. Yeast transformants were selected on M+trp+lys. Plasmid DNA was purified from a yeast transformant and used to transform E. coli. Transformants were selected on LB+amp and verified as described in the Example 2.
pGH420-EEVS-MTOx-2μΔ
To facilitate stable integration of the pGH420-EEVS-MTOx plasmid (SEQ ID NOs. 2 and 10—EEVS and MTOx only) into the yeast genome the yeast origin of replication (2μ) was first digested with EcoRI restriction enzyme for 30 min at 37° C. EcoRI-digested pGH420-EEVS-MTOx (SEQ ID NOs. 2 and 10—EEVS and MTOx only) was then heated to 65° C. for 20 min to inactivate enzyme. Digested plasmid was diluted 20-fold in a T4 DNA ligase reaction to circularize the construct without the 2μ sequence (
pXP422-ZWF1 (SEQ ID No. 78)
pXP422 plasmid was extracted and purified from a 1-ml culture of TOP10/pXP420 E. coli grown in LB+amp. An aliquot of pXP422 was digested with SpeI- and XhoI-restriction enzymes yielding a 6.3 Kb fragment. SpeI-, XhoI-digested plasmid was gel purified using a Qiagen gel-purification kit. The ZWF1 gene (SEQ ID NO. 78) was amplified by PCR from BY4742 yielding a 1.5 Kb amplicon. The ZWF1SpeIUP/ZWF1XhoILO primers (SEQ ID NOs. 88 and 89) used for amplification attached a SpeI site to the 5′-end and a XhoI site to the 3′-end of the gene. The ZWF1 PCR amplicon (SEQ ID NO. 78 with added 5′ XhoI and 3′ SpeI sites) bordered by SpeI and XhoI sites was digested with SpeI and XhoI and gel purified using a Qiagen gel-purification kit. The purified SpeI-XhoI digested ZWF1 gene (SEQ ID NO. 78 with added 5′ XhoI and 3′ Spa sites) was ligated into SpeI-XhoI digested pXP422 using New England Biolab's T4 DNA ligase kit. The ligation mixture was then used to transform competent TOP10 E. coli from Invitrogen. Transformants were selected and maintained on LB+amp plates. Construction of pXP422-ZWF1 (SEQ ID NO. 78—ZWF1 only) (
Measurements of Biomass and Gadusol
Yeast biomass was monitored spectrophotometrically at A600 using a UV-visible spectrophotometer (Shimadzu UV-1601). Cultures were diluted with distilled water such that the measured values did not exceed 0.3 because previous measurements had shown this to be the limit of linearity for this spectrophotometer. Actual A600 values were calculated by multiplying by the dilution factor. Exit from log phase was determined to estimate when gadusol production was relative to growth. Exit from log phase was estimated by finding the intersection of an exponential growth trend line fitted to cultures in log phase and a polynomial trend line fitted to cultures exiting log phase (Microsoft Excel, Redmond, Wash.). An example featuring strain G2 may be found in
To measure extracellular gadusol from a culture, yeast cells were spun down and a sample of culture supernatant was diluted to 50 mM phosphate, pH 7. The absorbance of the supernatant was measured at 296 nm using distilled water as a blank. Gadusol concentrations were calculated according to Beer's law using gadusol's extinction coefficient, 21,800 M−1 cm−1 at pH 7 in 50 mM phosphate. This value was determined previously for a gadusol sample of undefined purity (Plack et al. 1981). The formula below accounts for background absorbance at 296 nm due to non-gadusol components in the fermentation. The average A296/A600 ratio (0.0537) of a control strain (G2C) grown in triplicate for three days at 30° C. and 200 RPM, was subtracted from the A296/A600 ratio of a sample to correct for background A296 absorbance. The difference in ratios was then multiplied by the sample's A600, giving absorbance from gadusol which was then divided by gadusol's extinction coefficient (21,800 M−1 cm−1) to determine molarity.
(A296)Gad=The A296 of a yeast culture supernatant as described in the preceding section.
(A600)Gad=The A600 of a yeast culture as described in the preceding section.
Statistical Analysis
Statistical significance (p<0.05) of differences was determined using Student's two-tailed, paired t test (Microsoft Excel, Redmond, Wash.).
Results and Discussion
The gadusol biosynthetic pathway in vertebrates was recently shown to originate from the pentose phosphate pathway intermediate SHIP and to require two enzymes: EEVS and bifunctional MT-Ox (Osborn et al. 2015). cDNAs encoding the two genes from zebrafish (Danio rerio) were expressed in E. coli and were shown to mediate the in vitro conversion of S7P to EEV, and the SAM- and NAD+-dependent conversion of EEV to gadusol, respectively. In order to explore the possibility of producing gadusol in yeast, the cDNAs were sub-cloned into the yeast expression vectors pXP420 and pXP416 to yield pXP420-EEVS (SEQ ID NO. 2—EEVS only) and pXP416-MTOx (SEQ ID NO. 10—MTOx only), respectively. Both vectors contained the same strong constitutive S. cerevisiae promoter, TEF1, but different selectable markers. Table 5 lists a set of gadusol-producing strains that were constructed and provides characteristics related to growth and gadusol yields. Although the strains have been numbered, no relationship is necessarily implied based on the numerical designation. Strains and interventions that increased gadusol yields are presented earlier in the table and reflect their position in the text, while the remaining strains and interventions follow.
EEVS (SEQ ID NO. 2) and MTOx (SEQ ID NO. 10) Expression is Sufficient for Gadusol Synthesis in S. cerevisiae
A trp1 A derivative of the laboratory haploid BY4742 was co-transformed with both plasmids to generate strain G0 that was found to produce 12 mg/L of gadusol after 110 h (
Overexpression of ZWF1 Increases Gadusol Production
ZWF1 (SEQ ID NO. 78) encodes glucose 6-P dehydrogenase which catalyzes the first step in the oxidative phase of the PPP (Stincone et al. 2015). A ZWF1-overexpressing mutant (G10) was constructed in the G1 background (tal1Δ) because it is thought to be the rate-limiting step in the PPP (Raiser et al. 2007; Stincone et al. 2015). Overexpression of ZWF1 was therefore expected to divert more glucose 6-P from glycolysis to the PPP to form more S7P, the gadusol precursor.
The G10 strain produced 37 mg/L of gadusol compared to 22 mg/L for G1, a 68% increase (
Elimination of a Second Transaldolase Gene NQM1 Increases Gadusol Yield
NQM1 encodes a paralogue of TAL1 (Huang et al. 2008). While the encoded enzyme is not active during fermentative growth on glucose, it is heavily transcribed during respiratory growth on glycerol (21, 31). Deletion of NQM1 was expected to eliminate all known transaldolase activity and therefore increase gadusol yields. To this end, the G2 strain (tal1Δ nqm1A) was constructed and compared to G1 (tal1Δ).
The G2 strain produced 30 vs 22 mg/L of gadusol or 36% more than G1, but required 130 h to reach this level. While the two strains grew at about the same rate (td˜3.5 h), G2 produced twice as much biomass as G1 (A600=3.1 vs 1.4). It is likely that decreased throughput in the PPP blocked by a lack of transaldolase activity elevated levels of ribose 5-P which in turn fueled greater carbon assimilation. G2 produced more than twice the gadusol made by G1 during stationary phase.
Chromosomal Integration of a Plasmid Carrying EEVS (SEQ ID NO. 2) and MTOx (SEQ ID NO. 10) Leads to Increased Gadusol Production
The limited number of genetic markers available in the G2 strain necessitated redesigning the gadusol expression system. In order to eliminate the need for two plasmids (and two genetic markers), both EEVS (SEQ ID NO. 2) and MTOx (SEQ ID NO. 10) genes were cloned into a single plasmid by in vivo ligation to generate pGH420-EEVS-MTOx (SEQ ID NO. 2 and 10—EEVS and MTOx only). The plasmid was then converted into an integrative construct by excision of the 2μ yeast origin of replication. The pGH420-EEVS-MTOx-2μΔ construct (SEQ ID NO. 79) was digested with NdeI and used to transform a tal1Δ nqm1Δ yeast mutant. Prior digestion with NdeI was meant to facilitate integration of the construct at the NdeI site in the his3Δ1 locus. The resultant strain was designated G3 (
The G3 strain produced 64 vs 30 mg/L of gadusol or 113% more than G2, but required 169 h to reach this concentration. In contrast, G2 reached 30 mg/L by 130 h. G3 grew much faster than G2 (td=1.6 vs 3.5 h), but did not produce significantly more biomass, (A600=3.5 vs 3.1). The observation that G3 grew more than two times faster than G2 and that the only difference between the strains was the integrated construct vs two high copy plasmids suggests that the plasmids caused growth inhibition. Inclusion of constitutive glycolytic promoters on plasmids has been reported to reduce yeast growth rates by 12-15% (Görgens et al. 2001). In this particular case, the authors speculated that multiple copies of plasmid-borne constitutive promoters could attenuate the transcriptional machinery by titrating a limited number of transcription factors and RNA polymerases which would normally exist in excess.
Supplementation with the Growth-Limiting Nutrients Tryptophan and Lysine has No Effect on Gadusol Yield
Supplementing growth medium with the nutrients lysine (Lys) and tryptophan (Trp) was tested as a means to increase gadusol production. Supplementation had no significant effect on gadusol production by G3 (64 vs 63-67 mg/L).
The culture treated with 2XLys+2XTrp (
Doubling the concentration of lysine alone had no effect on peak A600 (3.5 vs 3.5) or gadusol levels, however it was found to reduce the time to reach final gadusol by 38 h compared to the standard YNB+2% glucose+lys+trp medium (
Deletion of PHO13 Decreases Gadusol Production
PHO13 (SEQ ID NO. 81) encodes a phosphatase whose deletion was found to upregulate the second and third steps of the PPP, 6-phosphogluconolactonase (SOL3) and 6-phosphogluconate dehydrogenase (GND1) (Kim et al. 2015). pho13Δ's upregulation of the PPP was originally identified during a screen for mutants with enhanced xylose fermentation rates (Ni et al. 2007). It was thought that a pho13Δ mutation would enhance gadusol yield by increasing expression of two enzymes that provide precursors for S7P biosynthesis. A pho13Δ mutant in the tal1Δ, gadusol-producing background was designated G9 (
G9 produced 36% less gadusol (14 vs 22 mg/L) than G1, but required 185.6 h to reach this concentration. In contrast, G1 reached 22 mg/L by 110 h. G9 and G1 reached comparable cell densities (A600=1.6 vs 1.4). G9 grew at the same rate as G1 (td=3.6 h). It is unclear why pho13Δ lead to a substantial decrease in gadusol yield. Increased expression of the two steps after glucose 6-P dehydrogenase was expected to cause accumulation of PPP intermediates. However, if such accumulation occurred it did not result in improved gadusol yield and hindered production.
The SHB17 Shunt is a Key Source of S7P for Gadusol Biosynthesis
Sedoheptulose 7-P can be generated from the PPP and glycolytic intermediates erythrose 4-P and DHAP by a two-step pathway. Erythrose 4-P and DHAP combine to form sedoheptulose 1,7-P via an additional activity of Fba1 (Clasquin et al. 2011). Sedoheptulose 1,7-P is then dephosphorylated by the phosphatase Shb17 to generate S7P. SHB17 (SEQ ID NO. 77) was deleted to determine if the SHB17 (SEQ ID NO. 77) shunt is a significant source of S7P.
As shown in
Overexpression of SHB17 (SEQ ID NO. 77) does not Increase Gadusol Yield
Because deletion of SHB17 (SEQ ID NO. 77) reduced gadusol yield, it was reasoned that overexpression of SHB17 (SEQ ID NO. 77) would lead to an increase. SHB17 (SEQ ID NO. 77) was overexpressed in the transaldolase mutant strain G3 (tal1Δ nqm1Δ) and designated G7. Contrary to expectations, overexpression of SHB17 (SEQ ID NO. 77) decreased gadusol production as shown in
It is unclear why overexpression of SHB17 (SEQ ID NO. 77) failed to increase gadusol yield. Based on the improvement in gadusol production observed when the gadusol construct was integrated it was decided to integrate the SHB17 construct to determine if eliminating plasmid burden would improve yield. The resultant strain was designated G8.
As shown in
Supplementation with Nutrients to Increase Activity of Shb17 does not Increase Gadusol Yield
Previous work has shown that growing yeast in YNB+2% glucose medium with nutrients that require NADPH for biosynthesis increased production of ribose 5-P via the SHB17 (SEQ ID NO. 77) shunt while repressing the PPP reactions that generate NADPH (Clasquin et al. 2011). Supplementing the growth medium for G3 was rationalized to increase gadusol yield by forcing more glycolytic intermediates to enter the PPP via the SHB17 (SEQ ID NO. 77) shunt and increase the amount of available S7P. Supplementation was expected to reduce the requirement for NADPH while maintaining the need for ribose 5-P. Biosynthetic requirements for ribose 5-P were expected to draw intermediates from the SHB17 (SEQ ID NO. 77) shunt towards S7P, providing a source of precursor for gadusol biosynthesis.
As shown in
Eliminating Phosphoglucoisomerase Activity in Transaldolase Mutants does not Increase Gadusol Yield.
Deletion of PGI1 was rationalized to increase gadusol yields in the transaldolase mutant background based on a report showing a tal1Δ pgi1Δ mutant accumulating up to 4-fold more S7P than a tal1Δ strain (Schaaff et al. 1990). PGI1 encodes a phosphoglucoisomerase that converts glucose 6-P to fructose 6-P. Phosphoglucoisomerase-transaldolase double mutants (pgi1Δ tal1Δ) are unable to grow on glucose as the sole carbon source because glycolysis is interrupted after glucose 6-P formation (Aguilera 1986). These mutants must rely on the SHB17 (SEQ ID NO. 77) shunt to generate S7P and ribose 5-P. PGI1 mutants in both the tal1Δ nqm1Δ (G4) and tal1Δ (G5) backgrounds were generated. Gadusol production was evaluated in YNB+2% fructose+0.1% glucose medium supplemented with lysine for G4 and both lysine and tryptophan for G5.
As shown in
Promoter Titration May Inhibit Gadusol Production
Simultaneous integration of the gadusol biosynthesis genes into yeast chromosome XV and promoter swapping led to a doubling in gadsuol yield from 30 to 64 mg/L. Although the integrated construct used a different promoter for MTOx (Ppm), this change is unlikely to explain the increase in gadusol yield because PPGK1 possess roughly half of the activity of PTEF1 as estimated using a GFP assay (Sun et al. 2012). Promoters on high-copy plasmids can deplete transcription factors, and RNA polymerase activity leading to competition for transcription machinery that is normally in excess. Because constitutive promoters typically derive from genes encoding essential functions (e.g., translation or glycolysis), promoter titration can lead to growth defects (Görgens et al. 2001). Integration of EEVS (SEQ ID NO. 2) and MTOx (SEQ ID NO. 10) decreased the doubling time of G3 compared to G2 (td=1.7 vs 3.5 h). Integrating EEVS (SEQ ID NO. 2) and MTOx (SEQ ID NO. 10) would leave limited copies of the promoters in each cell, reducing competition for transcription factors. Using the same promoter (PTEF1) to express both EEVS (SEQ ID NO. 2) and MTOx (SEQ ID NO. 10) in G2 could have led to reduced expression of these genes in addition to growth defects. Determining expression levels for EEVS (SEQ ID NO. 2) and MTOx (SEQ ID NO. 10) in the G2 and G3 strains would help determine if gene expression increased after integration or if gadusol yield improved because of changes in growth from plasmid integration.
Observations from the SHB17 (SEQ ID NO. 77) overexpression experiments support a role for promoter titration in gadusol production. Introduction of the high-copy plasmid pXP416-SHB17 (PTEF1) (SEQ ID NO. 77—SHB17 only) into the G3 strain led to a sharp decrease in gadusol production (64 vs 28 mg/L). Integration of a construct derived from pXP416-SHB17 (SEQ ID NO. 77—SHB17 only) resulted in the near complete restoration of gadusol production in strain G8 (60 vs 64 mg/L). This difference suggests that high-copy plasmids have an inhibitory effect on gadusol production that should be recognized when testing further interventions. Measuring gadusol production and expression of EEVS (SEQ ID NO. 2) and MTOx (SEQ ID NO. 10) in G3 derivative strains carrying empty PTEF1-expression vector or integrated PTEF1-expression vector would help support this conclusion.
Conclusion
This study demonstrated that rational genetic interventions were able to increase gadusol yields approximately 5-fold. Deleting both transaldolase genes (TAL1 and NQM1) resulted in a 2.5-fold increase in gadusol yield compared to the tal1Δ mutant. Overexpressing the glucose 6-P dehydrogenase gene (ZWF1) (SEQ ID NO. 78) in a tal1Δ strain caused a 64% increase in gadusol yield. Integrating the gadusol genes and switching the promoter for MTOx (SEQ ID NO. 10) doubled gadsuol production relative to a tal1Δ nqm1Δ strain expressing the gadusol genes from free plasmids. In most of the strains studied, 83-98% of gadusol was made after exiting log phase.
Construction of pGH420-EEVS-MTOx (SEQ ID NO. 82)
A plasmid expressing both EEVS (SEQ ID NO. 2) and MTOx (SEQ ID NO. 10) was constructed using in vivo ligation as described, according to the scheme outlined in
PCR primers designed to amplify DNA sequences containing the HIS3 marker, PGK1 promoter, MTOx ORF (SEQ NO. 10), PGK1 terminator, 2μ yeast ORI, E. coli AMPr-ORI sequence, and the EEVS (SEQ NO. 2) expression cassette are listed in Table 3. Primers containing 5′-60-bp barcode sequences were designed using the sequences described in Table 7. The barcode sequences lacked homology to the yeast genome, limiting the risk of chromosomal recombination. In the case of MTOx (SEQ NO. 10) (3) a portion of the ORF sequence was used to target recombination. Specifically, the downstream end of fragment 2 contained 60-bp of homology to the 5′-region of the MTOx ORF (SEQ NO. 10) while the upstream region of fragment 4 contained 60-bp of homology to 3′-region of the MTOx ORF (SEQ NO. 10).
The PCR conditions used to amplify the components of the plasmid construct were modified from the manufacturer's instructions for the polymerase (Thermofisher Phusion Hot Start II). Primer concentrations were lowered from 500 to 200 nM and polymerase concentration was raised from 0.02 to 0.03 U/μl. Amplicons were gel-purified using a Qiagen gel purification kit. To improve DNA extraction, after a PCR amplicon was excised from a horizontal gel, the slice was cut into a top layer (A) and a bottom layer (B) (
References Cited in Examples 1 and 2 and Specifically Incorporated Herein by
EEVS and MT-Ox
The inventors made the discovery that gadusol is synthesized de novo in zebrafish (Danio rerio) from a pentose phosphate pathway intermediate, sedoheptulose 7-phosphate, by a 2-epi-5-epi-valiolone synthase (EEVS) and a methyltransferase-oxidoreductase (MT-Ox). The EEVS and MT-Ox genes are clustered with a suite of conserved transcription factor genes. Homologous gene clusters have been identified in the genomes of some other fish, amphibians, reptiles, and birds. Mammals do not have the EEVS and MT-Ox genes, but do have a homologous transcription factor gene cluster in their genomes. It has been postulated that these ancient genes were lost during the evolution of mammals circa 220 million years ago. The applicant's discovery revealed the molecular basis for gadusol formation in fish and other vertebrates.
Construction of LOC100003999 and ZGC:113054 Gene Expression Vectors
The LOC100003999 gene was codon optimized for Escherichia coli and synthesized commercially (GeneScript USA Inc.). The optimized gene was cloned into EcoRV site of pUC57-Kan vector. The plasmid was digested with BglII and EcoRI and ligated into BamHI and EcoRI site of pRSET-B (Invitrogen) for the expression of N-terminal hexa-histidine-tagged protein (“hexa-histidine” disclosed as SEQ ID NO: 90). The zgc:113054 gene was also codon optimized for E. coli and commercially synthesized (GeneScript USA Inc.). The optimized gene was cloned into EcoRV site of pUC57-amp vector. The plasmid was digested with BglII and EcoRI and ligated into BamHI and EcoRI site of pRSET-B (Invitrogen) for the expression of N-terminal hexa-histidine-tagged protein (“hexa-histidine” disclosed as SEQ ID NO: 90).
Expression of VALA, LOC100003999 AND ZGC:113054 Genes in Escherichia coli
pRSETB-valA, pRSETB-LOC100003999 and pRSETB-zgc:113054 plasmids were individually used to transform E. coli BL21 GOLD (DE3) pLysS. Transformants were grown overnight at 37° C. on LB agar plate containing ampicillin (100 μg/mL) and chloramphenicol (25 μg/mL). A single colony was inoculated into LB medium (2 mL) containing the above antibiotics and cultured at 37° C. for 8 h. The seed culture (1 mL) was transferred into LB medium (100 mL) in a 500 mL flask and grown at 30° C. until OD600 reached 0.6. Then, the temperature was reduced to 18° C. After 1 h adaptation, isopropyl-D-1-thiogalactopyranoside (IPTG) (0.1 mM) was added to induce the N-terminal hexa-histidine-tagged proteins (“hexa-histidine” disclosed as SEQ ID NO: 90). After further growth for 16 h, the cells were harvested by centrifugation (5000 rpm, 10 min, 4° C.), washed twice with cold water and stored at −80° C. until used.
Purification of Recombinant VALA, LOC100003999 AND ZGC:113054
Cell pellets from a 400 ml culture of E. coli BL21 GOLD (DE3) pLysS containing pRSETB-valA, pRSETB-LOC100003999 or pRSETB-zgc:113054 plasmids was resuspended in 20 ml of B buffer (40 mM Tris-HCl, 300 mM NaCl, 10 mM imidazole, pH 7.5). Cells were disrupted by sonication for 1 min (4 times, 2 min interval) at 13 watts on ice (Probe sonicator, Misonix). Twenty mL of lysate was divided into 2 mL tubes and centrifuged (14,500 rpm, 20 min, 4° C.). Soluble fractions were collected and transferred into a 50 ml tube. Ni-NTA (QIAGEN) resin (5 mL) was applied into 10 ml volume empty column and the Ni-NTA resin was equilibrated with B buffer (50 ml, 10 CV). About 20 mL of supernatant from cell lysate was applied to the column (flow rate; 0.8 ml/min). The column was then washed with 100 ml (20 CV) of W buffer (40 mM Tris-HCl, 300 mM NaCl, 20 mM imidazole, pH 7.5) at 0.8 ml/min. The hexa-histidine-tagged proteins (“hexa-histidine” disclosed as SEQ ID NO: 90) were eluted by imidazole addition using a gradient mixer containing 100 ml of W buffer and 100 ml of E buffer (40 mM Tris-HCl, 300 mM NaCl, 300 mM imidazole, pH 7.5). The fractions (150 drops or about 5 mL) were collected and checked by SDS-PAGE (Coomassie Blue staining). Fractions containing pure proteins were combined (25 ml) and dialyzed against 2 L of D buffer (10 mM Tris-HCl, pH 7.5) 3 times (every 3 h). Dialyzed protein solution was concentrated by ultrafiltration (MWCO 10 K) to 200 μM and flash frozen in liquid N2 prior to storage at −80° C.
LOC100003999 assay condition
Each reaction mixture (25 μL) contained Tris-HCl buffer (20 mM, pH 7.5), NAD+ (1 mM), CoCl2 or ZnSO4 (0.1 mM), sedoheptulose 7-phosphate (4 mM), and enzymes (0.12 mM). The mixture was incubated at 30° C. for 2 h. ValA (instead of LOC100003999) was used as a positive control. No enzyme (buffer only) was used as a negative control.
Coupled LOC100003999 AND ZGC:113054 assay condition
Each reaction mixture (50 μL) contained potassium phosphate buffer (10 mM, pH 7.4), NAD+ (2 mM), CoCl2 (0.2 mM), sedoheptulose 7-phosphate (4 mM), and LOC100003999 cell-free extracts (20 μL) was incubated at 30° C. After 6 h, S-adenosylmethionine (5 mM) and zgc:113054 cell-free extracts (30 μL) were added. The mixture was incubated at 30° C. for another 6 h. ValA was used (instead of LOC100003999) as a positive control. Extract of E. coli harboring pRSET B empty vector was used as a negative control.
ZGC:113054 Assay Using [6,6-2H2]-EEV as Substrate
A reaction mixture (25 μL) containing potassium phosphate buffer (10 mM, pH 7.4), NAD+ (2 mM), CoCl2 (0.2 mM), S-adenosylmethionine (5 mM), [6,6-2H2]-EEV (4 mM), and zgc:113054 cell-free extract (20 μL) was incubated at 30° C. for 2 h. An extract of E. coli harboring pRSET B empty vector was used as a negative control.
TLC Analysis of EEV AND Gadusol
Analytical thin-layer chromatography (TLC) was performed using silica gel plates (60 Å) with a fluorescent indicator (254 nm), which were visualized with a UV lamp and ceric ammonium molybdate (CAM) or 5% FeCl3 in MeOH—H2O (1:1) solutions.
GC-MS Analysis of EEV
The enzymatic reaction mixtures were lyophilized and the products were extracted with MeOH. The MeOH extract was then dried and Tri-Sil HTP (Thermo Scientific) (100 μL) was added and left stand for 20 min. The solvent was removed in a flow of Argon gas and the silylated products were extracted with hexanes (100 μL) and injected into the GC-MS (Hewlett Packard 5890 SERIES II Gas chromatograph).
Enzymatic Synthesis, Purification, and Analysis of Gadusol
Fifty eppendorf tubes containing reaction mixtures (100 μL each), which consist of potassium phosphate buffer (10 mM, pH 7.4), SH7P (5 mM), NAD+ (2 mM), CoCl2 (0.2 mM), and LOC100003999 cell-free extract (40 μL) was incubated at 30° C. After 6 h, S-adenosylmethionine (5.5 mM) and zgc:113054 cell-free extracts (30 μL) were added. The reaction mixtures were incubated at 30° C. for another 6 h. The reaction mixtures were quenched with 2 volumes of MeOH, held at −20° C. for 20 min, then centrifuged at 14,500 rpm for 20 min. The supernatants were pooled and dried under vacuum. The residual water was frozen and lyophilized. The crude sample was dissolved in water (1 mL) and subjected to Sephadex LH-20 column chromatography using phosphate buffer (2.5 mM, pH 7) as an eluent. Fractions containing the product as judged by MS were combined and lyophilized. Furthermore, the product was purified by HPLC [Shimadzu LC-20AD, C18 column (YMC), 250×10 mm, 4 μm, flow rate 1 mL/min]. Solvent system: MeOH—phosphate buffer (5 mM, pH 7), gradient 1%-100% of MeOH (0-40 min). Peak at 12.74 min was collected and dried to give gadusol (0.4 mg). 1H NMR (700 MHz, D2O, cryo-probe): δ 4.10 (s, 1H, H-4), 3.71 (d, J=12 Hz, H-7a), 3.56 (d, J=12 Hz, H-7β), 3.49 (s, 3H, OCH3), 2.68 (d, J=17 Hz, H-6a), 2.38 (d, J=17 Hz, H-6β). HR-MS (ESI-TOF) m/z 205.0709 (calculated for C8H13O6 [M+H]+: 205.0707).
Zebrafish Lines and Embryos
Adult wild type 5D zebrafish were housed at the Sinnhuber Aquatic Research Laboratory on a recirculating system maintained at 28±1° C. with a 14 h light/10 h dark schedule. Embryos were collected from group spawns of adult zebrafish as described previously and all experiments were conducted with fertilized embryos. Embryos were staged and collected by hand for all experiments. Embryos were reared in media consisting of 15 mM NaCl, 0.5 mM KCl, 1 mM MgSO4, 0.15 mM KH2PO4, 0.05 mM Na2HPO4 and 0.7 mM NaHCO3.
Polymerase Chain Reaction (PCR)
All PCR reactions were performed according to manufacturer's specifications.
Cycling conditions: 96° C. for 3 minutes, 95° C. for 1 minute, 65° C. for 1 minute, and 72° C. for 1 minute per kB DNA; 35 cycles were used followed by 10 minutes at 72° C. All PCR products were characterized on an agarose gel. If needed, the PCR product was excised from the gel and purified using the E.Z.N.A. Gel Extraction Kit from Omega Bio-tek.
Quantitative PCR of Zebrafish Samples
qPCR was performed on an Applied Biosystems StepOnePlus machine. The super mix PerfeCTa® SYBR® Green FastMix®, ROX™ by Quanta biosciences was used. cDNA (100 ng) from time points at 6, 12, 24, 48, 72, 96, and 120 hpf were used. Super mix (18 μL) were added to bring the final volume to 20 μL. PCR conditions suggested by the supplier were used. For total RNA isolation, 30 embryos were homogenized in RNAzol (Molecular Research Center); RNA was purified according to the manufacturer's protocol. RNA was quantified by A260/280 ratios measured using a SynergyMx microplate reader (Biotek) and analyzed with the Gen5 Take3 module. One μg of RNA was used for cDNA synthesis. Superscript III First-Strand Synthesis (Invitrogen) and oligo d(T) primers were used to synthesize cDNA from the total RNA.
Isolation of Gadusol from Zebrafish
Embryos were collected and euthanized at 72 hpf by induced hypoxia through rapid chilling on ice for 30 minutes. Embryo media was removed until about 5 mL were left and frozen at −80° C. Embryos were lyophilized overnight. The freeze-dried embryos were then ground with a pestle and mortar under liquid nitrogen. The powder was collected and placed in a pre-weighed glass vial. The mortar was washed with MeOH—H2O (80:20) and the solvent was added to the powder. The solvent was evaporated and powder was weighed. The embryo powder was extracted twice with MeOH—H2O (80:20). The two extracts were combined, dried, and weighed. The extract was suspended in MeOH—H2O (80:20) (1 mL) and extracted twice with hexane. The aqueous layer was recovered, dried, and weighed. The extract was suspended in MeOH for analysis by mass spectrometry. The extract was dissolved in phosphate buffer pH 7.0 for identification by HPLC (Shimadzu SPD-20A system, YMC ODS-A column (4.6 id×250 mm), MeOH—5 mM phosphate buffer (1% MeOH for 20 min followed by a gradient from 1 to 95% MeOH in 20 min), flow rate 0.3 mL/min, 296 nm. The isolated gadusol was analyzed by MS (ThermoFinnigan LCQ Advantage system) and NMR [in D2O; Bruker Unity 300 (300.15 MHz) spectrometer].
Yeast Strains, Media and Growth Conditions
The yeast strains used are listed in Table 8. For cases in which the yeast strain was newly generated to carry out the work described in this disclosure, the source is listed an “N/A”.
The TRP1 gene was replaced in BY4742 tal1Δ::KanMX4 with a wild-type URA3 allele from S288c by standard methods. The deletion was confirmed by PCR using primer pairs TRP1DisUP/TRP1DisLO and URA3DisUP/TRP1DisLO. The BY4742 tal1Δ::KanMX4 trp1Δ::URA3 strain was then co-transformed5 with pXP416 and pXP420 to generate an empty vector control strain, and with pXP420-EEVS and pXP416-MT-Ox to generate a gadusol-producing strain. The EEVS and MT-Ox genes introduced into yeast were codon-optimized for expression in E. coli. The RAD1 gene was replaced in BY4742 tal1Δ::KanMX4 trp1Δ::URA3 with a wild-type LEU2 allele from S288c by standard methods. The deletion was confirmed by PCR using primer pairs RAD1UP/RAD1LO. The resultant BY4742 tal1Δ::KanMX4 trp1Δ::URA3 rad1Δ::LEU2 strain was then co-transformed with pXP416 and pXP420. Cells were pre-grown in YEPD (1% yeast extract, 2% peptone, and 2% glucose) for transformations, and in YNB (Bacto yeast nitrogen base without amino acids)+2% glucose supplemented with 30 μg/ml leucine and 30 μg/ml lysine to select for transformants and to produce gadusol. Liquid media were sterilized by filtration using a 0.45 μm filter and agar-based media were sterilized by autoclaving. Liquid cultures were grown at 30° C. for 48 h and 200 rpm; plates were incubated at 30° C.
Yeast Overexpression Plasmid Construction
Plasmids are listed in Table 11. Primers used for PCR are listed in Table 12. PCR amplicons with SpeI and XhoI terminal restriction sites were generated for the EEVS gene and MT-Ox gene using pRSETB-EEVS and pRSETB-MTOx as templates, respectively. The EEVS and MT-Ox amplicons were then digested with SpeI and XhoI and ligated into SpeI- and XhoI-digested pXP420 and pXP416, respectively, and introduced into competent E. coli (Top 10; Invitrogen) by transformation. E. coli transformants were selected on LB plates supplemented with ampicillin (100 μg/ml). Transformants were then screened by digesting plasmid DNA with SpeI and XhoI restriction enzymes and analyzing fragments by agarose gel electrophoresis.
Identification of Gadusol Production in S. cerevisiae
S. cerevisiae cell pellets from 5 mL cultures were extracted with MeOH and the supernatant was extracted with nBuOH. Extracts were concentrated and analyzed by HPLC (Shimadzu SPD-20A system, YMC ODS-A column (4.6 id×250 mm), MeOH—5 mM phosphate buffer (1% MeOH for 20 min followed by a gradient from 1 to 95% MeOH in 20 min), flow rate 0.3 mL/min, 296 nm.
Irradiation Protocol
A rad1Δ mutant (MATα his3Δ1 leu2Δ0 lys2Δ0 trp1Δ::URA3 ura3Δ0 rad1Δ::LEU2 tal1Δ::KanMX4/pXP416, pXP420) or wild-type RAD1 strain (S288c, MATα SUC2 gal2 malt mel flo1 flo8-1 hap1 ho bio1 bio6) was grown at 30° C. and 200 rpm in YNB+2% glucose+30 μg/mL leu+30 mg/mL lys. Cells were harvested after 24 h by centrifugation, washed twice in the 9-fold concentrated supernatant of either the gadusol-producing strain BY4742 tal1Δ trp1 A/pXP416-MTOx, pXP420-EEVS or of the control strain BY4742 tal1Δ trp1Δ/pXP416, pXP420, and suspended in the respective supernatants at 107 cells/mL. Cells (375 μL) were irradiated with UVB (302 nm) at the indicated doses in wells of a 24-well microtiter plate shaken at 900 rpm. Three μL aliquots of cells were then spotted onto a YEPD plate which was incubated 24 h at 30° C. prior to being photographed. The supernatants of the gadusol-producing and control strains were obtained by centrifugation following 5 days of growth in YNB+2% glucose+30 mg/mL leucine+30 mg/mL lysine at 30° C. and 200 rpm. Supernatants were freeze-dried, dissolved in a volume of distilled water 1/10 of the initial culture volume, and stored at 4° C. until use. Just prior to suspension of cells, the concentrated supernatant was adjusted to 50 mM phosphate, pH 7.0 resulting in a final 9-fold concentrate.
Sugar Phosphate Cyclases
Table 9 lists Sugar Phosphate Cyclases, including EEVS proteins.
Actinoplanes sp. SE50/110
Amycolatopsis azurea DSM 43854
Amycolatopsis nigrescens
Candidatus Burkholderia kirkii
Candidatus Burkholderia kirkii UZHbot1
Cellvibrio japonicus Ueda107
Clostridium botulinum B1 str. Okra
Clostridium papyrosolvens DSM 2782
Cystobacter fuscus DSM 2262
gamma proteobacterium HdN1
Gordania araii NBRC 100433
Mesorhizobium sp. STM 4661
Mycobacterium marinum
Mycobacterium marinum M
Mycobacterium marinum MB2
Mycobacterium marinum str. Europe
Nocardia asteroides
Nocardia seriolae N-2927
Nonomuraea spiralis
Pseudomonas aeruginosa
Pseudomonas fluorescens A506
Pseudomonas sp. CFT9
Rhodanobacter denitrificans
Rhodanobacter thiooxydans
Rhodanobacter thiooxydans LCS2
Rhodococcus 114MFTsu3.1
Rhodococcus 29MFTsu3.1
Rhodococcus erythropolis
Rhodococcus erythropolis CCM2595
Rhodococcus erythropolis DN1
Rhodococcus erythropolis PR4
Rhodococcus sp. P27
Saccharothrix espanaensis DSM 44229
Stigmatella aurantiaca DW4/3-1
Streptomyces acidiscabies 84-104
Streptomyces albus
Streptomyces auratus
Streptomyces auratus AGR0001
Streptomyces bottropensis ATCC 25435
Streptomyces chartreusis
Streptomyces clavuligerus ATCC 27064
Streptomyces coelicoflavus ZG0656
Streptomyces glaucescens GLA.O
Streptomyces hygroscopicus subsp. limoneus
Streptomyces hygroscopicus subsp.
yingchengensis
Streptomyces sp. AA4
Streptomyces sp. CNY228
Streptomyces sp. MMG1533
Streptomyces sp. S4
Streptomyces sviceus
Streptomyces sviceus ATCC 29083
Terriglobus saanensis SP1PR4
Anas platyrhynchos
Anolis carolinensis
Astyanax mexicanus
Chelonia mydas
Chrysemys picta bellii
Columba livia
Danio rerio
Dicentrarchus labrax
Falco cherrug
Falco peregrinus
Ficedula albicollis
Gadus morhua
Gallus gallus
Gasterosteus aculeatus
Geospiza fortis
Haplochromis burtoni
Lepisosteus oculatus
Maylandia zebra
Meleagris gallopavo
Melopsittacus undulatus
Neolamprologus brichardi
Oncorhynchus mykiss
Oreochromis niloticus
Oryzias latipes
Pelodiscus sinensis
Poecilia formosa
Pseudopodoces humilis
Pundamilia nyererei
Taeniopygia guttata
Xenopus (Silurana) tropicalis
Xiphophorus maculatus
Cyanidioschyzon merolae strain 10D
Ectocarpus siliculosus
Thalassiosira oceanica
Phaeodactylum tricornutum
Thalassiosira pseudonana
Chondrus crispus
Galdieria sulphuraria
Actinosynnema mirum DSM 43827
Stigmatella aurantiaca DW4/3-1
Cystobacter fuscus
Solirubrobacter soli
Actinosynnema mirum
Actinoplanes missouriensis
Streptomyces sp. AA0539
Streptomyces sp. MK498-98F14
Streptomyces scabrisporus
Acidianus hospitalis
Caldisphaera lagunensis
Caldivirga maquilingensis
Candidatus acidianus copahuensis
Ignicoccus hospitalis
Ignisphaera aggregans
Metallosphaera cuprina
Metallosphaera sedula
Metallosphaera yellowstonensis
Pyrobaculum arsenaticum
Pyrobaculum calidifontis
Sulfolobales archaeon AZ1
Sulfolobus islandicus
Sulfolobus solfataricus
Sulfolobus tokodaii
Thermoproteus tenax
Vulcanisaeta distributa
Vulcanisaeta moutnovskia
Streptomyces sp. FxanaC1
Actinosynnema mirum DSM 43827
Anabaena variabilis ATCC 29413
Aspergillus nidulans
Bacillus subtilis
Candidatus Contendobacter odensis
Escherichia coli str. K-12
Helicobacter pylori
Marinobacterium rhizophilum
Methylophaga lonarensis
Methylophaga thiooxydans
Mycobacterium tuberculosis H37Rv
Nostoc punctiforme PCC 73102 (ATCC 29133)
Pseudomonas chlororaphis
Pseudomonas denitrificans
Pseudomonas knackmussii B13
Pseudomonas monteilii
Pseudomonas pseudoalcaligenes AD6
Staphylococcus aureus
Stigmatella aurantiaca DW4/3-1
Streptomyces albulus
Streptomyces auratus
Streptomyces flavogriseus
Streptomyces mobaraensis
Streptomyces pristinaespiralis ATCC_25486
Streptomyces purpureus
Streptomyces rimosus
Streptomyces sp. ATexAB-D23
Streptomyces sp. DvalAA-83
Streptomyces sp. HPH0547
Streptomyces sp. FxanaC1
Streptomyces sp. MspMP-M5
Streptomyces sp. SirexAA-E
Thermus thermophilus HB8
Thioalkalivibrio sulfidophilus
Thioalkalivibrio thiocyanodenitrzficans
Actinidia chinensis
Arabidopsis thaliana
Brachypodium distachyon
Capsella rubella
Citrus sinensis
Coccomyxa subellipsoidea C-169
Eucalyptus grandis
Eutrema salsugineum
Morus notabilis
Oryza brachyantha
Oryza sativa Japonica
Picea sitchensis
Setaria italica
Solanum tuberosum
Zea mays
Actinomycetospora chiangmaiensis
Actinosynnema mirum DSM 43827
Anabaena variabilis ATCC 29413
Aphanothece halophytica
Aspergillus clavatus NRRL 1
Aspergillus nidulans FGSC A4
Baudoinia compniacensis UAMH 10762
Beauveria bassiana ARSEF 2860
Bipolaris maydis ATCC 48331
Bipolaris maydis C5
Bipolaris oryzae ATCC 44560
Bipolaris sorokiniana ND90Pr
Bipolaris victoriae FI3
Botryotinia fuckeliana B05.10
Botryotinia fuckeliana BcDW1
Botryotinia fuckeliana T4
Calothrix sp. PCC 6303
Calothrix sp. PCC 7103
Calothrix sp. PCC 7103
Calothrix sp. PCC 7103
Capronia coronata CBS 617.96
Chamaesiphon minutus
Chamaesiphon minutus PCC 6605
Chlorogloeopsis
Chroococcidiopsis thermalis PCC 7203
Cladophialophora carrionii CBS 160.54
Cladophialophora psammophila CBS 110553
Cladophialophora yegresii CBS 114405
Claviceps purpurea 20.1
Colletotrichum fioriniae PJ7
Colletotrichum gloeosporioides Cg-14
Colletotrichum gloeosporioides Nara gc5
Colletotrichum graminicola M1.001
Colletotrichum orbiculare MAFF 240422
Coniosporium apollinis CBS 100218
Cordyceps militaris CM01
Crinalium epipsammum PCC 9333
Cyanothece sp. PCC 7424
Cylindrospermum stagnale PCC 7417
Cyphellophora europaea CBS 101466
Dacryopinax sp. DJM-73I SSI
Dactylococcopsis sauna
Dothistroma septosporum NZE10
Endocarpon pusillum Z07020
Exophiala dermatitidis NIH/UT8656
Fischerella muscicola
Fusarium fufikuroi IMI 58289
Fusarium graminearum PH-1
Fusarium oxysporum f. sp. conglutinans
Fusarium oxysporum f. sp. cubense race 1
Fusarium oxysporum f. sp. cubense race 4
Fusarium oxysporum f. sp. lycopersici MN25
Fusarium oxysporum f. sp. melonis 26406
Fusarium oxysporum f. sp. pisi HDV247
Fusarium oxysporum f. sp. radicis-lycopersici
Fusarium oxysporum f. sp. raphani 54005
Fusarium oxysporum f. sp. vasinfectum 25433
Fusarium oxysporum Fo47
Fusarium oxysporum Fo5176
Fusarium oxysporum FOSC 3-a
Fusarium pseudograminearum CS3096
Fusarium verticillioides 7600
Glarea lozoyensis 74030
Glarea lozoyensis ATCC 20868
Gloeophyllum trabeum ATCC 11539
Leptolyngbya sp. Heron Island J
Leptolyngbya sp. PCC 7375
Leptosphaeria maculans JN3
Lyngbya aestuarii
Lyngbya sp. PCC 8106
Macrophomina phaseolina MS6
Magnaporthe oryzae 70-15
Magnaporthe oryzae Y34
Marssonina brunnea f. sp. multigermtubi MB_m1
Melampsora larici-populina 98AG31
Metarhizium acridum CQMa 102
Microchaete sp. PCC 7126
Microcystis aeruginosa
Microcystis aeruginosa DIANCHI905
Microcystis aeruginosa PCC 7806
Microcystis aeruginosa PCC 9443
Microcystis aeruginosa PCC 9717
Microcystis aeruginosa PCC 9807
Microcystis aeruginosa PCC 9808
Mixia osmundae IAM 14324
Mycobacterium chubuense
Mycobacterium chubuense NBB4
Nectria haematococca mpVI 77-13-4
Neofusicoccum parvum UCRNP2
Nodularia spumigena CCY9414
Nodularia spumigena
Nostoc punctiforme PCC 73102
Nostoc sp. PCC 7524
Ophiocordyceps sinensis CO18
Oscillatoria nigro-viridis PCC 7112
Penicillium oxalicum 114-2
Pestalotiopsis fici W106-1
Pleurocapsa sp. PCC 7319
Pseudocercospora fijiensis CIRAD86
Pseudonocardia sp. P1
Pseudozyma aphidis DSM 70725
Pseudozyma flocculosa PF-1
Pyrenophora teres f. teres 0-1
Pyrenophora tritici-repentis Pt-1C-BFP
Pyronema omphalodes CBS 100304
Rhodococcus sp. 114MFTsu3.1
Rhodococcus sp. 29MFTsu3.1
Rhodococcus sp. AW25M09
Rivularia sp. PCC 7116
Rubidibacter lacunae
Sclerotinia borealis F-4157
Sclerotinia sclerotiorum 1980 UF-70
Scytonema hofmanni
Setosphaeria turcica Et28A
Sphaerulina musiva SO2202
Sporisorium reilianum SRZ2
Stanieria cyanosphaera PCC 7437
Stereum hirsutum FP-91666 SS1
Togninia minima UCRPA7
Ustilago hordei
Verticillium alfalfae VaMs.102
Verticillium dahliae VdLs.17
Xenococcus sp. PCC 7305
Zymoseptoria tritici IPO323
Nostoc punctiforme PCC 73102 (ATCC 29133)
Nostoc punctiforme PCC 73102 (ATCC 29133)
Actinosynnema mirum DSM 43827
Actinosynnema pretiosum subsp. auranticum
Streptomyces hygroscopicus
Streptomyces lavendulae
Amycolatopsis mediterranei S699
Streptoalloteichus tenebrarius
Streptomyces kanamyceticus
Streptomyces ribosidificus
Streptornyces fradiae
Micromonospora echinospora
Bacillus circulans
MT-OX Proteins
Table 10 provides examples of MT-Ox proteins and lists a gene symbol, accession number, and source organism for each protein.
Alligator mississippiensis
Anas platyrhynchos
Anolis carolinensis
Astyanax mexicanus
Chrysemys picta bellii
Columba livia
Danio rerio
Dicentrarchus labrax
Falco cherrug
Falco peregrinus
Ficedula albicollis
Gadus morhua
Gallus gallus
Gasterosteus aculeatus
Geospiza fortis
Haplochromis burtoni
Lepisosteus oculatus
Maylandia zebra
Meleagris gallopavo
Melopsittacus undulatus
Neolamprologus brichardi
Oncorhynchus mykiss
Oreochromis niloticus
Oryzias latipes
Pelodiscus sinensis
Poecilia formosa
Pseudopodoces humilis
Pundamilia nyererei
Taeniopygia guttata
Xenopus (Silttrana) tropicalis
Xiphophorus maculatus
Zonotrichia albicollis
Primers
Table 11 lists primers useful in making or using the various embodiments of the disclosure disclosed herein. The function for each primer is also disclosed.
aSpeI and XhoI restriction sites are underlined
Plasmids
Table 12 lists plasmids that may be useful in making or using the various embodiments of the disclosure disclosed herein. The source of each plasmid is listed. For cases in which the plasmid was newly generated to carry out the work described in this disclosure, the source is listed an “N/A.”
DNA sequences of EEVS and MT-Ox genes, and vectors pUC57-Kan, pRSET-B, pXP416, pXP420.
Danio rerio EEVS cDNA (accession no. LOC100003999)
S. cerevisiae-optimized EEVS sequence #1
S. cerevisiae-optimized EEVS sequence #2
S. cerevisiae-optimized EEVS sequence #3
S. cerevisiae-optimized EEVS sequence #4
S. cerevisiae-optimized EEVS sequence #5
S. cerevisiae-optimized EEVS sequence #6
S. cerevisiae-optimized MT-Ox sequence #1
S. cerevisiae-optimized MT-Ox sequence #2
S. cerevisiae-optimized MT-Ox sequence #3
S. cerevisiae-optimized MT-Ox sequence #4
S. cerevisiae-optimized MT-Ox sequence #5
S. cerevisiae-optimized MT-Ox sequence #6
S. cerevisiae
S. cerevisiae
Although certain embodiments have been illustrated and described herein, it will be appreciated by those of ordinary skill in the art that a wide variety of alternate and/or equivalent embodiments or implementations calculated to achieve the same purposes may be substituted for the embodiments shown and described without departing from the scope. Those with skill in the art will readily appreciate that embodiments may be implemented in a very wide variety of ways. This application is intended to cover any adaptations or variations of the embodiments discussed herein. Therefore, it is manifestly intended that embodiments be limited only by the claims and the equivalents thereof.
This application claims priority to U.S. Patent Application 62/782,090 filed on Dec. 19, 2018, which is hereby incorporated by reference in its entirety.
| Entry |
|---|
| Osborn et al., “De novo synthesis of a sunscreen compound in vertebrates”, eLIFE, 2015, 4:e05919; pp. 1-15. DOI: 10.7554/eLife.05919.001. |
| Holzwarth, G. “Gadusol Production in Saccharomyces cerevisiae”, M.Sc. thesis, Oregon State University, Feb. 27, 2018. |
| Addgene plasmid maps for pXP416—retrieved from https://www.addgene.org/26842/ on Dec. 29, 2020. |
| Addgene plasmid maps for pXP420—retrieved fromhttps://www.addgene.org/26844/ on Dec. 29, 2020. |
| Number | Date | Country | |
|---|---|---|---|
| 20200199631 A1 | Jun 2020 | US |
| Number | Date | Country | |
|---|---|---|---|
| 62782090 | Dec 2018 | US |
