Gene and protein applicable to the preparation of vaccines for rickettsia prowazekii and rickettsia typhi and the detection of both

Information

  • Patent Grant
  • 5783441
  • Patent Number
    5,783,441
  • Date Filed
    Monday, December 20, 1993
    31 years ago
  • Date Issued
    Tuesday, July 21, 1998
    26 years ago
Abstract
All or part of the DNA sequence of the gene which encodes the S-layer protein of R. prowazekii as illustrated in Sequence ID No. 1 as well as a truncated identical piece of this gene in R. typhi as well as the 5' and 3' noncoding regions can be used for vaccination against typhus and spotted fever rickettsial infection or to diagnose the diseases caused by these bacteria. The invention is also accomplished by the deduced amino acid sequence of the S-layer protein of R. prowazekii derived from the DNA sequence of the encoding gene. Further, the invention includes the peptide or protein products based on all or parts of this gene.
Description

BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to a gene and protein which can be used for vaccination against and/or for the detection and identification of R. typhi and R. prowazekii. More particularly, the invention relates to the DNA sequence of the gene encoding the protective S-layer protein antigen of Rickettsia prowazekii and the products of this gene.
2. Description of the Prior Art
R. prowazekii is the etiological agent of epidemic typhus and is well established in its primary host, man. The human body louse is the primary vector. The occurrence of typhus parallels the history of war and famine. Thirty million cases of typhus occurred in Eastern Europe and Russia during World War I and during the years immediately following. In addition, during World War II, typhus was widespread in concentration camps in Eastern Europe and in North Africa. There are still foci of epidemic typhus infection throughout the world including the Andes region of South America, Ethiopia, Mexico, Eastern Europe, China, the Soviet Union, the Middle East, and parts of Southeast Asia. In addition, the flying squirrel and its louse and flea ectoparasites has been identified as a carrier of R. prowazekii in Southeast portions of the United States.
The etiologic agent of epidemic typhus, Rickettsia prowazekii, is an obligate intracellular bacterium. The disease is usually transmitted from person to person by the human body louse (Pediculus humanus corporis). The actual disease source is louse feces. This can be introduced to a host by scarification of the louse feces into a bite wound, aerosol inhalation or open wound contact with louse feces and other similar or related pathways. Following local growth at the site of entry, the organism spreads and causes a vasculitis by infecting the endothelial cells of capillaries, small arteries, and veins. Mortality has been reported to be as high as 60%.
Vaccination against rickettsial disease has a long history, Topping et al., Ann. Rev. Microbiol., 1, pp.333-350 (1947). Weigl and Castaneda prepared vaccines against epidemic typhus in the 1930s from infected lice and infected rodent lungs. Mass production of vaccines followed. These types of vaccines are not used today because they no longer meet modern standards for bacterial vaccines. If safety and efficacy standards can be satisfied, vaccination would be a cost effective and desirable means of protecting defined populations.
Abundant evidence has been obtained that the crystalline surface layer protein antigens (SPAs) of the typhus group rickettsiae, R. prowazekii and Rickettsia typhi, and of the spotted fever group rickettsiae can serve as effective immunogens in animal models (Bourgeois et al, Rickettsiae and rickettsial diseases, pp.71-80, Academic Press, Inc., New York (1981); Ching et al, Ann. N.Y. Acad. Sci., 590, pp.334-351 (1990); Dasch, J. Clin. Microbiol., 14, pp.333-341 (1981); Dasch et al, Rickettsiae and rickettsial diseases, pp.61-70, Academic Press, Inc., New York (1981); Dasch et al, Rickettsiae and rickettsial diseases, pp.54-61, Publishing House of the Slovak Academy of Sciences, Bratislava (1985); Dasch et al, Microbiology, pp.251-256, American Society for Microbiology, Washington, D.C. (1984); Dasch et al, Infect. Immun., 31, pp.276-288 (1981); McDonald et al, Science, 235, pp.83-85 (1987); McDonald et al, J. Infect. Dis., 158, pp.228-231 (1988); Vishwanath et al, Infect. Immun., 58, pp.646-653 (1990)). In addition, the SPAs can elicit both antibody and cell-mediated immune responses in both experimental animal models and in man (Carl et al, J. Immunol., 136, pp.2654-2658 (1986): Carl et al, J. Immunol., 139, pp.4203-4207 (1987): Carl et al, J. Autoimmunity, 2, pp.81-91 (1989): Carl et al, Infect. Immun., 57, pp.1276-1280 (1989): Misiti et al, J. Immunol., 134, pp.2689-2694 (1985)).
The major problem with SPA vaccines to be surmounted is the large scale production of the antigen. Although non-toxic and efficacious lots of antigen can be obtained directly from typhus rickettsiae (Bourgeois et al, Rickettsiae and rickettsial diseases, pp.71-80, (1981): Dasch, J. Clin. Microbiol., 14, pp.333-341 (1981): Dasch et al, Rickettsiae and rickettsial diseases, pp.61-70 (1981)), the cost and hazard of manufacturing vaccine directly from the rickettsiae is formidable. Vaccine development would therefore be greatly facilitated by expressing the SPA in vectors capable of expressing large quantities of antigen.
In addition, the prognosis in rickettsial infections depend largely on the initiation of appropriate antibiotic therapy early in the course of the illness. Therefore, methods and materials which would lead to the more rapid diagnosis of rickettsial infections would presumably result in improved prognosis.
SUMMARY OF THE INVENTION
Accordingly, an object of this invention is to provide large quantities of S-layer protein.
Another object of this invention is to provide large quantities of S-layer protein in a form in which it can be used for vaccination against endemic rickettsial infection.
An additional object of this invention are tests designed to diagnose epidemic and endemic typhus.
Yet another object of this invention is to provide sufficient quantities of materials having DNA sequences of the gene which encodes the S-layer protein of R. prowazekii.
A further object of this invention is to provide the 5' and 3' non-coding regions of the S-layer protein from which primers may be generated to be used in the polymerase chain reaction for the rapid diagnosis of both epidemic and endemic typhus.
These and additional objects of the invention are accomplished by providing all or part of the DNA sequence of the gene which encodes the S-layer protein of R. prowazekii as illustrated in Sequence Listing I and an identical truncated portion of this gene in R. typhi as well as the 5' and 3' noncoding regions. The invention is also accomplished by the deduced amino acid sequence of the S-layer protein of R. prowazekii derived from the DNA sequence of the encoding gene homologs, and variants together with a suitable vector. Further, the invention includes the protein products of all or parts of this gene.





BRIEF DESCRIPTION OF THE DRAWINGS
A more complete appreciation of the invention will be readily obtained by reference to the following Description of the Preferred Embodiments and the accompanying drawings in which like numerals in different figures represent the same structures or elements. The representations in each of the figures is diagrammatic and no attempt is made to indicate actual scales or precise ratios. Proportional relationships are shown as approximations.
FIG. 1 shows restriction maps of the rickettsial inserts of recombinant pUC plasmids.
FIG. 2 is a western blot of fractions of control lambda gtWES (C) and recombinant lambda gtWES/PB3.2 phage expressing R. prowazekii SPA gene (R).
FIG. 3A, FIG. 3B and FIG. 3C are the theoretical structure analysis of the R. prowazekii SPA based on the deduced amino acid sequence.
FIG. 3A depicts the Hydropathy profile.
FIG. 3B depicts the alpha helical structure.
FIG. 3C depicts beta sheet structure.





SEQUENCE LISTING
Seq. ID #1--DNA sequence of the gene which encodes the S-layer protein of R. prowazekii as well as 5' and 3' non-coding regions.
Seq. ID #2--Deduced amino acid sequence of the S-layer protein of R. prowazekii.
DEPOSIT INFORMATION
The Escherichia coli DH5.alpha. carrying plasmid pMDL7, MD 192 has been deposited on 18 Oct. 1993 and has been accepted at the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, USA under the terms of the Budapest Treaty for a period of thirty (30) years. The ATCC Designation number is 69473. Under the terms of the deposit, access to the culture will be available during pendency of the patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. 1.14 and 35 U.S.C. .sctn. 122, and all restrictions on the availability to the public of the culture so deposited will be irrevocably removed upon granting of the patent.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
Gene libraries from R. prowazekii Breinl and R. typhi Wilmington were constructed in the expression vector, lambda gt11. In addition, recombinant lambda gtWES bacteriophages containing either a 10.1 kb R. prowazekii Breinl-derived DNA fragment or an 8.7 kb R. typhi Wilmington-derived DNA fragment were also constructed. Recombinant phages expressing fragments or the entire rickettsial crystalline surface layer protein antigen (SPA) of either R. prowazekii or R. typhi were identified on plaque lifts using a mixture of monoclonal antibodies directed against different linear epitopes present on the SPA.
From the R. prowazekii-derived library, three purified phage were used to stably lysogenize E. coli strain Y1089(r-). Two of the lysogens, MD103 and MD104, contained fusion proteins with apparent molecular weights of 135 and 160 kDa, respectively, since they contained bands which reacted with rabbit antibody against beta-galactosidase and the anti-SPA monoclonal antibody pool. The fusion proteins therefore contained approximately 25 and 50 kDa of SPA antigen. The remaining lysogen, MD101 did not react with the anti-SPA monoclonal antibody pool on Western blots although it was immunoreactive on plaque lifts. However, since the beta-galactosidase reactive bands of MD101 fractionated to the cell envelope like the MD103 and MD104 products, and all three extracts contained a 98 kDa truncated form of beta-galactosidase which did not react with anti-SPA antibodies, it appears that MD101 also expresses an SPA fusion protein. However, it seems to be weakly immunoreactive and very short since the fusion protein had a molecular weight quite comparable to control beta-galactosidase.
The R. prowazekii-derived lambda gtWES clone (lambda gtWES/PB3.2) was found to produce SPA products whose size distribution was greater than that of the SPA obtained from the rickettsiae. Recombinant plasmids pMD306 was created by subcloning the 3.7 kb insert derived from MD104 into pUC 8. Similarly, pMDL7 was created by subcloning the 10.1 kb insert derived from lambda gtWES/PB3.2 into pUC 8. Therefore, several strains of E. coli have been obtained which produce part or all of the S-layer protein antigen (SPA) of Rickettsia prowazekii, the major component of the rickettsial outer surface (Ching, W-M. et al; Ann. N. Y. Acad. Sci.; 590 p.334-351; 1990. Dasch, G. A.; J. Clin. Microbiol.; 14 p.333-341; 1981. Dasch, G. A. et al; Infect. Immun.; 31 p.276-288; 1981). The SPA epitopes were expressed as different sized fragments fused to the carboxy-terminal region of beta-galactosidase by lysogenized strains, MD101, MD103 and MD104, or as the entire protein by lambda gtWES/PB3.2. Initial evidence that the cloned gene was SPA included immunological reactivity of the products with several monoclonal antibodies with specificity for typhus SPA, and comparison of the size of the expressed protein with the rickettsia-derived SPA. Since the SPA is expressed in lambda gtWES/PB3.2 constitutively, it is clear that the full rickettsial promoter and ribosome binding sites are present. This is also clear after examining the complete nucleotide sequence for the R. prowazekii-derived SPA gene (spaP).
The complete nucleotide sequences of plasmids pMD306 and pMDL7 were determined for both strands of DNA. The entire sequence of pMD306 was contained within pMDL7. Sequencing of both strands of pMDL7 revealed a gene (spaP) with an open reading frame of 4,836 nucleotides between the ATG triplet at position 394 to 396 and the TAA stop codon at position 5230 to 5232. Presumptive ribosome-binding site and -10 and -35 regions were identified. A large inverted repeat forming a stem loop structure consisting of a 14 bp stem and an 11 bp loop is present downstream of the translational stop codons (nucleotides 5271-5309) and might function as a transcriptional termination signal. N-terminal amino acid sequences of eight CNBr fragments of purified R. prowazekii SPA were found within the open reading frame. The DNA sequence predicts the existence of an additional seven CNBr fragments at the carboxy end of the SPA with molecular weights of 0.87 to 8.14 kD. However, despite the fact that all other major CNBr fragments throughout the rest of the molecule were identified, no fragments corresponding to these seven predicted carboxy terminal fragments could be found. A 5.5 kD CNBr fragment beginning at amino acid 1255 (corresponding to nucleic acids 4216-4218) was closest to the putative SPA carboxy terminus.
The recombinant SPA products exhibited three unexpected properties. First, unlike the natural SPA which can be readily extracted from the rickettsia in aqueous media (Dasch, G. A.; 1981), the fused recombinant products and the lambda gtWES/PB3.2 SPA product were strongly associated with the envelope fraction. A computer generated hydropathy plot of the deduced amino acid sequence revealed several regions of hydrophobicity with little or no hydrophilic regions (Carl, M. et al; Proc. Nat. Acad. Sci.; 87, pp. 8237-8241, 1990). This might account for the observed localization of the fusion peptides although even the truncated beta-galactosidase molecule which is apparently derived by proteolytic processing of the recombinant proteins also partitioned into the envelope fraction and might be the cause of this unexpected partitioning. Neither explanation seems satisfactory for the full length recombinant protein. It is striking that all the recombinant SPA fragments derived from the full length recombinant protein also partitioned into the envelope fraction (data not shown). Most likely the SPA does not fold properly in its E. coli environment. Conformationally-sensitive anti-SPA monoclonal antibodies did not bind to either lambda gtWES/PB3.2 plaque lifts or envelope fractions containing recombinant SPA, even when the latter were examined by Western blotting under conditions which permit their binding to rickettsia-derived SPA (data not shown). Denatured or fragmented rickettsia-derived typhus SPA also has poor solubility properties (W-M. Ching and G. A. Dasch, unpublished properties).
A second surprising aspect of the recombinant SPA product was that it appeared larger than the majority fraction of rickettsial SPA detected by Coomassie staining or by Western blotting. This is consistent with the 169 kD protein which is encoded by the spaP gene (Carl, M.; 1990). Although R. prowazekii-derived SPA has an estimated molecular weight of 120 kD, the spaP gene encodes a protein with a molecular weight of 169.87 kD. Although widely disparate molecular weights for the SPA have been obtained by different methods and it migrates anomalously by PAGE (Ching, W-M. et al; Ann. N. Y. Acad. Sci.; 590 p.334-351; 1990. Smith, D. K. et al; J. Bact.; 137 p.963-971; 1979. Ching, W-M. et al; J. Cell. Biochem.; 13A p.51; 1989), this discrepancy is rather large. However, seven CNBr fragments predicted at the carboxy end of the molecule from the deduced amino acid sequence were not present in the rickettsia-derived SPA.
It is striking that the carboxy end of the SPA for R. prowazekii contains both a hydrophobic region with alpha-helical configuration consisting of 24 amino acids (amino acids 1356-1379 corresponding to nucleic acids 4519-4590), which could span the bacterial cell membrane, and an adjacent 16 hydrophilic amino acids in a beta turn region (amino acids 1382-1396 corresponding to nucleic acids 4597-4641) could serve respectively as a hydrophobic anchor and translocation stop. This is consistent with what is presently known about hydrophobic anchor sequences which have been identified in transmembrane proteins (Eisenberg, D. A., Ann. Rev. Biochem., 53 p.595-623 (1984). Davis, G. D. et al, J. Mol. Biol., 181 p.111-121, (1985). Cleavage of the SPA protein near this anchor region would then result in a soluble surface protein with approximately the same molecular weight (130 kD) and almost the identical amino acid composition as determined for R. prowazekii-derived SPA (Ching et al, 1990).
Although the calculated pI of 5.4 for the protein which results from this hypothesized cleavage would differ from the pI of 4.1 already determined for the SPA (Oaks, E. V. et al; in Rickettsiae and Rickettsial Diseases, eds. Burgdorfer, W. & Anacker, R. L.; Academic Press, New York, N.Y.; p.461-472; 1981), there are various modifications of the protein which might account for this difference. Multiple methylation of lysine residue has been detected on the rickettsial SPA (Ching, et al., Techniques in Protein Chemistry, Vol IV, pp 307-314, Academia Press, 1993). Other post translational modifications such as phosphorylation, deamidation, and methylation of other amino acid residues are also possible, but no glycosylation has been found. In the rickettsiae some SPA antigen which reacts with monoclonal antibodies is always detected at significantly higher molecular weights than the major SPA species (Ching, W-M. et al; Ann. N. Y. Acad. Sci.; 590 p.334-351; 1990). This high molecular weight SPA most likely represents unprocessed SPA. In spite of being grown in the protease deficient host, Y1090(r-), much of the recombinant SPA protein was present as fragments smaller than the major form of the native protein. Although such fragmentation is also observed with the rickettsia-derived SPA (Ching, W-M.; 1990), these fragments comprise a much smaller percentage of the total antigen present than they do in the recombinant strain. This SPA degradation could be a response of the host cell to a foreign protein product.
A similar pattern of fragments has also been seen for the cloned large SPA of R. rickettsia (McDonald, G. A. et al; Science; 235 p.83-85; 1987). Although fragments of the rickettsial SPA might arise from proteases acting on the S-layer while the rickettsiae grow in the cytoplasm of their host cells, hypotonic-shock extracted SPA (Dasch, G. A.; 1981) is relatively insensitive to a variety of proteases unless it is heated to non-physiological conditions or treated with detergents or chaotropic agents (Dasch, unpublished observations).
The entire SPA or fragments of the SPA illustrated in FIGS. 2A and B (Seq. ID #2) serves as the basis for a subunit vaccine against typhus and possibly spotted fever rickettsia. The purified protein in the presence or absence of adjuvant is injected intramuscularly or intradermally. The plasmid is combined with a vector in the manor known in the art. The plasmid and vector can be formed from the entire material or from homologs, fragments and variants. Primers of at least one selected from the 5' end and one from the 3' end can be used in PCR and other known tests to rapidly identify the rickettsial disease.
Having described the invention, the following examples are given to illustrate specific applications of the invention including the best mode now known to perform the invention. These specific examples are not intended to limit the scope of the invention described in this application.
EXAMPLE 1
Preparation and Immunoreactivity of Lambda gt11 Library of Rickettsia prowazekii
The origin, passage history, and biological properties of Rickettsia prowazekii strain Breinl and Rickettsia typhi strain Wilmington have been described in detail elsewhere (Woodman, D. R. et al; Infect. Immun.; 16 p.853-860; 1977). The rickettsiae were grown in 6 day old embryonated chicken eggs and purified by Renografin density gradient centrifugation (Dasch, G. A.; 1981. Dasch, G. A. et al; Infect. Immun.; 15 p.280-286; 1977). DNA was prepared from 100 mg protein of purified rickettsiae as previously described (Maniatis, T. et al; Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; 1982). Purified rickettsial DNA (90 ug) was partially digested with a mixture of Alu I (0.01 U/ug), Hae III (0.04 U/ug), and Rsa I (0.01 U/ug), size fractionated in the 2-9 kb range on a sucrose gradient (Maniatis, T.; 1982), and ligated to Eco RI linkers with T4 DNA ligase after treatment with Eco RI methylase. Linkered DNA was then ligated into Eco RI digested, dephosphorylated lambda gt11 (Promega Biotech, Madison, Wis.). Portions of the ligation reaction were packaged into phage with PackaGene (Promega Biotech, Madison, Wis.) using protocols supplied by Promega. Recombinant lambda gt11 phage were grown and purified as previously described (Maniatis, T.; Lambdasorb, Promega Biotech, Madison, Wis.; 1982).
Phage were plated at approximately 10.sup.3 per 150 mm dish on maltose-induced E. coli Y1090(r-) grown on TB plates (1% tryptone, 0.5% NaCl) containing X-Gal (5-bromo-4-chloro-3-indolyl-beta-D-galactoside, 0.02%) (Davis, L. G. et al; Basic methods in molecular biology; Elsevier, N.Y.; 1986). Plaque lifts were screened using a mixture of 4 monoclonal antibodies (Raoult, D. et al; J. Immunol. Meth.; 125 p.57-65; 1989) (PT47-1C5.1, P53-2D7.1, P53-2D10.1, P53-5E12.1), affinity purified rabbit anti-mouse IgG, and .sup.125 I-labeled Staphylococcus protein A (New England Nuclear). Immunoreactive plaques were replated at 100-200 plaques per plate, rescreened as above, and replated until purified. Stable lysogens were selected in the hfl strain, Y1089(r-), and stored frozen at -70.degree. C.
The packaged DNA produced 3.times.10.sup.5 phage of which 92% contained recombinant inserts of 1-6 kb size. Assuming a genome size of 1.5 Mb (Myers, W. F. et al; Int. J. Syst. Bacteriol; 30 p.143-150; 1980) and an average insert size of 3 kb, a typical packaging of this size should contain 550 copies of the genome. One thousand recombinant phage plaques per plate were screened with a pool of monoclonal antibodies directed against a variety of linear epitopes present on the purified SPA of Rickettsia prowazekii. Eleven immuno-reactive plaques were obtained from 20,000 plaques containing an estimated 36 genomic copies. Nine of these phage were plaque purified without loss of immunoreactivity. The purified phage were used to stably lysogenize E. coli strain Y1089(r-). The recombinant products expressed by three lysogens following heat and isopropyl-beta-thiogalactopyranoside (IPTG) induction were characterized by SDS-PAGE and Western blotting. Two lysogens, MD103 and MD104, contained fusion proteins with apparent molecular weights of 135 and 160 kDa, respectively, since they contained bands which reacted with rabbit antibody against beta-galactosidase and the anti-SPA monoclonal antibody pool. The fusion proteins therefore contained approximately 25 and 50 kDa of SPA antigen. The SPA fusion proteins also localized in the cell envelope fraction but not in the cytoplasm or concentrated broth, unlike control extracts which contained soluble beta-galactosidase in both the medium and cytoplasmic extracts.
The remaining strain MD101 did not react with the anti-SPA monoclonal antibody pool on Western blots although it was immunoreactive on plaque lifts. However, since the beta-galactosidase reactive bands of MD101 fractionated to the cell envelope like the MD103 and MD104 products, and all three extracts contained a 98 kDa truncated form of beta-galactosidase which did not react with anti-SPA antibodies, it appears that MD101 also expresses an SPA fusion protein. However, it seems to be weakly immunoreactive and very short since the fusion protein had a molecular weight quite comparable to control beta-galactosidase.
Recombinant phage DNAs were analyzed by restriction digestion and agarose gel electrophoresis (Maniatis; 1982). The Eco RI inserts from recombinant lambda gt11 phage were prepared by Eco RI digestion, ligated into pUC8 (Maniatis; 1982) without purification, and used to transform E. coli DH5 (Bethesda Research Laboratories (BRL)). DNA from recombinant plasmids (Maniatis; 1982) were analyzed by agarose gel electrophoresis after restriction digestion. MD104, which expressed the largest fragment of SPA, contained a 3.7 kb DNA insert bounded by the Eco RI linkers that was subcloned into the Eco RI site of pUC 8. The resultant plasmid, pMD306 was partially mapped with several restriction enzymes (FIG. 1); FIG. 1 shows restriction maps of the rickettsial inserts of four recombinant pUC plasmids. The inserts from pMD306 and pMDL7 are derived from R. prowazekii. Boxes represent sequenced regions; a shaded area represents a continuous open reading frame. Restriction endonucleases used include Bgl II (B), Eco RI (E), Hind II (H), Pst I (P). The scale is in kilobases.
EXAMPLE 2
Southern Blotting
In order to identify a genomic fragment which might contain the entire gene encoding the R. prowazekii and the R. typhi SPA, pMD306 was labeled by nick translation and used as a probe of R. prowazekii and R. typhi genomic DNA digested with Eco RI, Hind III, Eco RV, Aha III, Hinf I, and Rsa I. Recombinant plasmid DNA was labeled with .sup.35 S-dATP by nick translation using a commercial kit (BRL). Alternatively, probes were generated using polymerase chain reaction-derived products labeled with digoxigenin (Carl, M. et al; J. Inf. Dis.; 161 p.791-794; 1990) and detection was accomplished using stringent conditions as recommended by the manufacturer (Boehringer-Mannheim). Rickettsial or recombinant phage DNAs were digested with the appropriate restriction enzymes, electrophoresed in 0.7% agarose gels, and transferred to nitrocellulose (Schleicher & Schuell). Hybridizations were carried out largely as described by Southern (Southern, E. M.; J. Mol. Biol.; 98 p.503-517; 1975). For R. prowazekii, hybridization was observed to a single, large, Eco RI fragment of about 10 Kb and less distinctly to a slightly larger Eco RV fragment. The other genomic fragments detected were smaller than the estimated 3.6 Kb needed to encode the entire SPA protein. Since pMD306 did not contain an internal Eco RI site, it was expected that a clone containing pMD306 on a 10 Kb Eco RI fragment would encode the entire SPA gene.
EXAMPLE 3
Construction and Screening of Eco R1 Lambda gtWES Library and Subcloning
A total Eco RI digested library of R. prowazekii DNA was constructed in lambda gtWES. The ligated DNA was packaged in vitro, and the recombinant phage were plated on the host strain, ED8654. Approximately 5.times.10.sup.4 phage (nearly 100% containing inserts) were obtained from an experiment where 0.1 .mu.g of phage arms were packaged. From screens of 6000 recombinant phage, 10 small R. prowazekii-derived plaques were obtained which reacted with the anti-SPA monoclonal antibodies. Since these phage proved difficult to plaque purify, only a single immunoreactive purified phage, lambda gtWES/PB3.2 was obtained. To confirm that the recombinant phage contained the desired 10 Kb Eco R1 fragment encoding the SPA gene, genomic R. prowazekii DNA and recombinant phage DNA were digested with restriction enzymes and Southern blotting was performed with radiolabeled pMD306 DNA as probe. The expected 10 Kb Eco RI fragment, the internal 2.9 Kb Hind III and 2.7 Kb Bgl II fragments present in pMD306 (FIG. 1) and additional 1.3 Kb Hind III and 4.8 Kb Bgl II fragments were all identical in both the recombinant and genomic DNAs, thus indicating the identity of the cloned Eco RI fragment with the desired genomic fragment.
Recombinant plasmid pMDL7 was created by subcloning the 10.1 kb insert (originally derived from R. prowazekii Breinl), from the recombinant lambda gtWES bacteriophages. The restriction maps of this plasmid insert is shown in FIG. 1. This data suggested that the pMD306 insert is identical to a region contained within pMDL7.
EXAMPLE 4
Western Blotting Characterization of Protein Expressed by Lambda gtWES/PB3.2
Phage replication and beta-galactosidase fusion peptides were induced in broth cultures of single colonies of recombinant lysogens as previously described (Maniatis, T.; 1982). To minimize host cell degradation of expressed recombinant protein, fractions of both control lambda gtWES and lambda gtWES/PB3.2 were prepared from lysates of the protease deficient lon strain, Y1090(r-).
Cell pellets were collected by centrifugation for 15 min at 7000.times. g and suspended in 10 ml of distilled water. The suspensions were broken by passage through a French pressure cell 3 times at 20,000 psi. The extracts were spun for 1 h at 200,000.times. g, yielding a pelleted envelope fraction and the supernatant cytoplasmic fraction.
The envelope was resuspended in 10 ml H.sub.2 O by homogenization. The spent media, resulting from the first low speed centrifugation, was concentrated 10-fold using Centricon-30 units (Amicon). Fractions were stored at -70.degree. C. Fractions were solubilized by boiling for 5 min in 2% SDS and 5% 2-mercaptoethanol, fractionated by SDS-PAGE on 8-16% gradient gels, and transferred to nitrocellulose in 25 mM NaH.sub.2 PO.sub.4, pH 7.5 as previously described (Raoult, D. et al; J Clin. Microbiol.; 27 p.2073-2079; 1989. Towbin, H. et al; Proc. Nat'l. Acad. Sci.; 76 p.4350-4354; 1979).
Immunoblot detection was accomplished with .sup.125 I-labelled Staphyloccus protein A or with horseradish peroxidase conjugated goat anti-mouse IgG antisera. Bound enzyme was detected with 0.015% 4-chloro-1-naphthol, 0.015% H.sub.2 O.sub.2, 16% methanol in TBS. Following fractionation of the extracts, the Western blots were immunodetected with monoclonal antibodies which differed in their reactivity toward linear epitopes of the SPAs of R. prowazekii and R. typhi (FIGS. 2A and B). FIGS. 2A and B reproduces Western blots of fractions of control lambda gtWES (C) and recombinant lambda gtWES/PB3.2 phage expressing R. prowazekii SPA gene (R). Lanes: whole cell lysates of Rickettsia typhi (RT) and R. prowazekii (RP); WC: whole phage lysates; S: Prestained molecular weight standards (kDa from top: 110, 84, 47, 33, and 24). Two sets of identical samples were separated on the same 8-16% SDS gel and transferred to nitrocellulose. The sheet was then divided using the prestained standards as a guide. Each half sheet was immunodetected by sequential reaction with either PT47-1C5.1 (I-8) or P53-3D1.1 (I-23) anti-SPA monoclonal antibody, horseradish peroxidase conjugated goat anti-mouse IgG, and 4-Cl-1-naphthol/H.sub.2 O.sub.2 stain. The highest molecular weight form of the recombinant SPA detected is indicated (*). Under these conditions the SPAs of rickettsial whole cell lysates migrate as a major Coomassie blue stainable band at 120 kDa. By Western blotting this major band is accompanied by a single band of greater size and by multiple fragments of lower molecular weight. The lambda gtWES/PB3.2 lysates, but not the control extracts, contained a similar complex array of immunoreactive peptides including material migrating significantly above the major native SPA band at approximately the position of the largest minor band of SPA present in the rickettsial lysates. Like the SPA fragments expressed as fusion proteins with beta-galactosidase, the lambda gtWES/PB3.2 lysates fractionated in the membrane fraction rather than as a soluble protein (data not shown). Unlike the fusion protein in which expression of the fusion protein required IPTG, the lambda gtWES/PB3.2 SPA product was expressed constitutively, presumably using a rickettsial promoter.
EXAMPLE 5
DNA Sequencing
Recombinant plasmids were sequenced directly from plasmid DNA by the chain termination method (Sanger, F. et al; Proc. Natl. Acad. Sci. USA; 74 p.5463-5467; 1977) with Sequenase (United States Biochemicals, Inc.) as the polymerase. Sequencing was initiated on both strands using M13 primers (Promega Inc., United States Biochemicals, Inc.). Subsequently, sequencing was continued on both strands using custom synthetic oligonucleotides as primers. The complete nucleotide sequence of plasmid pMD306 was determined for both strands of DNA. The entire sequence for this plasmid was contained within pMDL7. Further sequencing of both strands of pMDL7 revealed an open reading frame of 4,836 nucleotides between the ATG triplet at position 394 to 396 and the TAA stop codon at position 5230 to 5232. Presumptive ribosome-binding site and -10 and -35 regions are underlined. A large inverted repeat forming a stem loop structure consisting of a 14 bp stem and an 11 bp loop is present downstream of the translational stop codons (nucleotides 5271-5309) and might function as a transcriptional termination signal.
Cleavage of purified SPA protein at methionine residues with CNBr was carried out according to the method of Gross and Witkop (Gross, E. et al; J. Biol. Chem.; 237 p.1856-1860; 1962). Fragments were then separated by SDS-PAGE (Schagger, H. et al; Anal. Biochem.; 166 p.368-379; 1987), electroblotted onto PVDF paper (Millipore, Milford, Conn.), and stained directly with Coomassie blue. Amino acid sequence analysis was performed on a Model 477A sequencer with Model 120A automated on line PTH analyzer (Applied Biosystems, Foster City, Calif.). N-terminal amino acid sequences of eight CNBr fragments of purified R. prowazekii SPA were found within the open reading frame. The DNA sequence predicts the existence of an additional seven CNBr fragments at the carboxy end of the SPA with molecular weights of 0.87 to 8.14 kD. However, despite the fact that all other major CNBr fragments throughout the rest of the molecule were identified, no fragments corresponding to these seven predicted carboxy terminal fragments could be found. A 5.5 kD CNBr fragment beginning at amino acid 1255 (corresponding to nucleic acids 4216-4218) was closest to the putative SPA carboxy terminus.
The open reading frame of pMDL7 encoded a protein with a calculated molecular weight of 169,874 with a theoretical pI of 5.81. Codon usage in the spaP gene is similar to that described previously for the R. prowazekii citrate synthetase gene (Wood, D. O. et al; J. Bacteriol.; 169 p.3564-3572; 1987). The hydrophobicity profile, alpha helical structure, and beta sheet structure (Marck, C.; Nuc. Acids Res.; 16 p.1829-1836; 1988) are plotted in FIG. 3 A, B & C (Theoretical structure analysis of the R. prowazekii SPA). Hydropathy (FIG. 3A), alpha helical structure (FIG. 3B), and beta sheet structure (FIG. 3C) are based on the deduced amino acid sequence (DNA Strider, Institut de Recherche Fondamentale). Although most of the protein appears to be largely hydrophobic, the carboxy portion of the molecule appears to be more hydrophilic.
Obviously, many modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that, within the scope of the appended claims, the invention may be practiced otherwise than as specifically described.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 2(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 5319 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(v) FRAGMENT TYPE: internal(vi) ORIGINAL SOURCE:(A) ORGANISM: Rickettsia prowazekii(B) STRAIN: Breinl(ix) FEATURE:(A) NAME/KEY: -35.sub.-- signal(B) LOCATION: 340..345(ix) FEATURE:(A) NAME/KEY: -10.sub.-- signal(B) LOCATION: 363..368(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 391..5226(ix) FEATURE:(A) NAME/KEY: RBS(B) LOCATION: 379..386(ix) FEATURE:(A) NAME/KEY: stem.sub.-- loop(B) LOCATION: 5270..5306(x) PUBLICATION INFORMATION:(A) AUTHORS: Carl, M.Dobson, M. E.Ching, W. M.Dasch, G. A.(B) TITLE: Characterization of the gene encoding theprotective S- layer protein of Rickettsiaprowazekii; presence of a truncated identicalhomolog in rickettsia typhi(C) JOURNAL: Proc. Natl. Acad. Sci. U.S.A.(G) DATE: 1990(K) RELEVANT RESIDUES IN SEQ ID NO:1: FROM 1 TO 5319(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:TTAAGATACGTAATGACATATGTAAAATTGATATACAAACTCATCATCGCAATAACTGAT60TATTATTTCATAACACCAATGTGATAAAAATATAACATTTATTAAAACTTTATAAAAAAA120CTACTGTGATGCTTGTAATTATGTACAATATATAGTACACTTAGCCCGTAGTTTAGAAAC180TATTGAAACAAAATATTAGGTTATTTCCTTATCAAGTGTGGGATATCTTGACCTCGTATT240TGATTAATTTGTTTTAATACTAGATACTAAATTTTAACTTAAATATAGGAAAAAATTATG300GCTCAAAAACCATTTTCTAAAAAAATAATTTCCGCAGGATTGGTAACTGCTTCCACGGCT360ACTATAGTAGCTGGTTTCTCTGGTGTAGCAATGGGTGCTGCTATGCAATATAAT414MetGlyAlaAlaMetGlnTyrAsn15AGGACAACAAATGCAGCAGCTACAACCTTTGATGGTATAGGCTTTGAT462ArgThrThrAsnAlaAlaAlaThrThrPheAspGlyIleGlyPheAsp101520CAAGCTGCTGGTGCTAATATTCCTGTCGCTCCAAATTCAGTTATTACT510GlnAlaAlaGlyAlaAsnIleProValAlaProAsnSerValIleThr25303540GCTAATGCTAATAATCCTATTACTTTTAATACTCCAAACGGTCATTTA558AlaAsnAlaAsnAsnProIleThrPheAsnThrProAsnGlyHisLeu455055AATAGTTTATTTTTGGATACGGCAAATGATTTAGCAGTAACAATTAAT606AsnSerLeuPheLeuAspThrAlaAsnAspLeuAlaValThrIleAsn606570GAGGATACTACCTTAGGATTTATAACAAATATTGCTCAGCAGGCTAAG654GluAspThrThrLeuGlyPheIleThrAsnIleAlaGlnGlnAlaLys758085TTCTTTAATTTTACTGTTGCTGCTGGTAAAATTCTTAACATAACAGGG702PhePheAsnPheThrValAlaAlaGlyLysIleLeuAsnIleThrGly9095100CAGGGTATTACTGTTCAAGAAGCTTCTAATACAATAAATGCTCAAAAT750GlnGlyIleThrValGlnGluAlaSerAsnThrIleAsnAlaGlnAsn105110115120GCTCTTACAAAAGTGCATGGTGGCGCTGCTATTAACGCTAATGATCTT798AlaLeuThrLysValHisGlyGlyAlaAlaIleAsnAlaAsnAspLeu125130135AGCGGGCTAGGATCAATAACCTTTGCTGTGTGTCCTTCTGTATTAGAA846SerGlyLeuGlySerIleThrPheAlaValCysProSerValLeuGlu140145150TTTAATTTAATAAATCCTATCAACTCAAGAAGCTCCTCTTATCACTTG894PheAsnLeuIleAsnProIleAsnSerArgSerSerSerTyrHisLeu155160165GTGTCTAATTCTAAAATAGTTAATGGTGGTAATGGGATATTAAATATT942ValSerAsnSerLysIleValAsnGlyGlyAsnGlyIleLeuAsnIle170175180ACTAATGGATTTATTCAGGTTTCAGATAACACTTTTGCTGGTATTAAG990ThrAsnGlyPheIleGlnValSerAspAsnThrPheAlaGlyIleLys185190195200ACCATTAATATCGATGATTGTCAAGGTTTAATGTTTAATTCTACTCCT1038ThrIleAsnIleAspAspCysGlnGlyLeuMetPheAsnSerThrPro205210215GATGCCGCTAATACTTTAAATTTACAAGCAGGTGGTAATACTATTAAT1086AspAlaAlaAsnThrLeuAsnLeuGlnAlaGlyGlyAsnThrIleAsn220225230TTTAATGGAATAGACGGTACTGGTAAATTAGTATTAGTCAGTAAGAAT1134PheAsnGlyIleAspGlyThrGlyLysLeuValLeuValSerLysAsn235240245GGTGCTGCTACCGAATTTAATGTTACAGGAACTTTAGGTGGTAATCTA1182GlyAlaAlaThrGluPheAsnValThrGlyThrLeuGlyGlyAsnLeu250255260AAAGGTATTATTGAATTGAACACTGCAGCAGTAGCTGGTAAACTTATC1230LysGlyIleIleGluLeuAsnThrAlaAlaValAlaGlyLysLeuIle265270275280TCTCTTGGAGGTGCTGCTAATGCAGTAATAGGTACAGATAATGGAGCA1278SerLeuGlyGlyAlaAlaAsnAlaValIleGlyThrAspAsnGlyAla285290295GGTAGAGCTGCAGGATTTATTGTTAGTGTTGATAATGGTAATGCAGCA1326GlyArgAlaAlaGlyPheIleValSerValAspAsnGlyAsnAlaAla300305310ACAATTTCTGGACAAGTTTATGCTAAAAACATGGTGATACAAAGTGCT1374ThrIleSerGlyGlnValTyrAlaLysAsnMetValIleGlnSerAla315320325AATGCAGGTGGACAAGTCACTTTTGAACACATAGTTGATGTTGGTTTA1422AsnAlaGlyGlyGlnValThrPheGluHisIleValAspValGlyLeu330335340GGCGGTACCACCAACTTTAAAACTGCAGATTCTAAAGTTATAATAACA1470GlyGlyThrThrAsnPheLysThrAlaAspSerLysValIleIleThr345350355360GAAAACTCAAACTTTGGTTCTACTAATTTTGGTAATCTTGACACACAG1518GluAsnSerAsnPheGlySerThrAsnPheGlyAsnLeuAspThrGln365370375ATTGTAGTCCCTGATACTAAGATTCTTAAAGGTAACTTCATAGGTGAT1566IleValValProAspThrLysIleLeuLysGlyAsnPheIleGlyAsp380385390GTAAAAAATAACGGTAATACTGCAGGTGTGATTACTTTTAATGCTAAT1614ValLysAsnAsnGlyAsnThrAlaGlyValIleThrPheAsnAlaAsn395400405GGTGCTTTAGTAAGTGCTAGTACTGATCCAAATATTGCAGTAACAAAT1662GlyAlaLeuValSerAlaSerThrAspProAsnIleAlaValThrAsn410415420ATTAATGCAATTGAAGCAGAAGGGGCCGGGGTTGTAGAATTATCAGGA1710IleAsnAlaIleGluAlaGluGlyAlaGlyValValGluLeuSerGly425430435440ATACATATTGCAGAATTACGTTTAGGGAATGGTGGCTCTATCTTTAAA1758IleHisIleAlaGluLeuArgLeuGlyAsnGlyGlySerIlePheLys445450455CTTGCTGATGGCACAGTAATTAATGGTCCAGTTAACCAAAATGCTCTT1806LeuAlaAspGlyThrValIleAsnGlyProValAsnGlnAsnAlaLeu460465470ATGAATAATAATGCTCTTGCAGCTGGTTCTATTCAGTTAGATGGGAGT1854MetAsnAsnAsnAlaLeuAlaAlaGlySerIleGlnLeuAspGlySer475480485GCTATAATTACCGGTGATATAGGTAACGGTGGTGTTAATGCTGCGTTA1902AlaIleIleThrGlyAspIleGlyAsnGlyGlyValAsnAlaAlaLeu490495500CAACACATTACTTTAGCTAACGATGCTTCAAAAATATTAGCACTCGAT1950GlnHisIleThrLeuAlaAsnAspAlaSerLysIleLeuAlaLeuAsp505510515520GGCGCAAATATTATCGGGGCTAATGTTGGTGGTGCAATTCATTTTCAA1998GlyAlaAsnIleIleGlyAlaAsnValGlyGlyAlaIleHisPheGln525530535GCTAACGGTGGTACTATTAAATTAACAAATACTCAAAATAATATTGTA2046AlaAsnGlyGlyThrIleLysLeuThrAsnThrGlnAsnAsnIleVal540545550GTTAATTTTGATTTAGATATAACTACTGATAAAACAGGTGTTGTTGAT2094ValAsnPheAspLeuAspIleThrThrAspLysThrGlyValValAsp555560565GCAAGTAGTTTAACAAATAATCAAACTTTAACTATTAATGGTAGTATC2142AlaSerSerLeuThrAsnAsnGlnThrLeuThrIleAsnGlySerIle570575580GGTACTGTTGTAGCTAATACTAAAACACTTGCACAATTAAACATCGGG2190GlyThrValValAlaAsnThrLysThrLeuAlaGlnLeuAsnIleGly585590595600TCAAGTAAAACAATATTAAATGCTGGCGATGTCGCTATTAACGAGTTA2238SerSerLysThrIleLeuAsnAlaGlyAspValAlaIleAsnGluLeu605610615GTTATAGAAAATAATGGTTCAGTACAACTTAATCACAATACTTACTTA2286ValIleGluAsnAsnGlySerValGlnLeuAsnHisAsnThrTyrLeu620625630ATAACAAAAACTATCAATGCTGCAAACCAAGGTCAAATAATCGTTGCC2334IleThrLysThrIleAsnAlaAlaAsnGlnGlyGlnIleIleValAla635640645GCTGATCCTCTTAATACTAATACTACTCTTGCTGATGGTACAAATTTA2382AlaAspProLeuAsnThrAsnThrThrLeuAlaAspGlyThrAsnLeu650655660GGTAGTGCAGAAAATCCACTTTCTACTATTCATTTTGCCACTAAAGCT2430GlySerAlaGluAsnProLeuSerThrIleHisPheAlaThrLysAla665670675680GCTAATGCTGACTCTATATTAAATGTAGGTAAAGGAGTAAATTTATAT2478AlaAsnAlaAspSerIleLeuAsnValGlyLysGlyValAsnLeuTyr685690695GCTAATAATATTACTACTAACGATGCTAATGTAGGTTCTTTACACTTT2526AlaAsnAsnIleThrThrAsnAspAlaAsnValGlySerLeuHisPhe700705710AGGTCTGGTGGTACAAGTATAGTAAGTGGTACAGTTGGTGGACAGCAA2574ArgSerGlyGlyThrSerIleValSerGlyThrValGlyGlyGlnGln715720725GGTCATAAGCTTAATAATTTAATATTAGATAATGGTACTACTGTTAAG2622GlyHisLysLeuAsnAsnLeuIleLeuAspAsnGlyThrThrValLys730735740TTTTTAGGTGATACAACATTTAATGGTGGTACTAAAATTGAAGGTAAA2670PheLeuGlyAspThrThrPheAsnGlyGlyThrLysIleGluGlyLys745750755760TCCATCTTGCAAATTAGCAATAATTATACTACTGATCATGTTGAATCT2718SerIleLeuGlnIleSerAsnAsnTyrThrThrAspHisValGluSer765770775GCTGATAATACTGGTACATTAGAATTTGTTAACACTGATCCTATAACC2766AlaAspAsnThrGlyThrLeuGluPheValAsnThrAspProIleThr780785790GTAACATTAAATAAACAAGGTGCTTATTTTGGTGTTTTAAAACAAGTA2814ValThrLeuAsnLysGlnGlyAlaTyrPheGlyValLeuLysGlnVal795800805ATTATTTCTGGTCCAGGTAACATAGTATTTAATGAGATAGGTAATGTA2862IleIleSerGlyProGlyAsnIleValPheAsnGluIleGlyAsnVal810815820GGAATTGTACATGGTATAGCAGCTAATTCAATTTCTTTTGAAAATGCA2910GlyIleValHisGlyIleAlaAlaAsnSerIleSerPheGluAsnAla825830835840AGTTTAGGTACATCTTTATTCTTACCTAGTGGTACTCCATTAGATGTT2958SerLeuGlyThrSerLeuPheLeuProSerGlyThrProLeuAspVal845850855TTAACAATTAAAAGTACCGTAGGTAATGGTACAGTAGATAATTTTAAT3006LeuThrIleLysSerThrValGlyAsnGlyThrValAspAsnPheAsn860865870GCTCCTATTGTAGTTGTATCAGGTATTGATAGTATGATCAATAACGGT3054AlaProIleValValValSerGlyIleAspSerMetIleAsnAsnGly875880885CAAATCATCGGTGATAAAAAGAATATTATAGCTCTATCGCTTGGAAGT3102GlnIleIleGlyAspLysLysAsnIleIleAlaLeuSerLeuGlySer890895900GATAACAGTATTACTGTTAATGCTAATACATTATATTCAGGTATCAGA3150AspAsnSerIleThrValAsnAlaAsnThrLeuTyrSerGlyIleArg905910915920ACTACAAAAAATAATCAAGGTACTGTGACACTTAGTGGTGGTATGCCT3198ThrThrLysAsnAsnGlnGlyThrValThrLeuSerGlyGlyMetPro925930935AATAATCCTGGTACAATTTATGGTTTAGGTTTAGAGAATGGTAGTCCA3246AsnAsnProGlyThrIleTyrGlyLeuGlyLeuGluAsnGlySerPro940945950AAGTTAAAACAAGTGACATTTACTACAGATTATAACAACTTAGGTAGT3294LysLeuLysGlnValThrPheThrThrAspTyrAsnAsnLeuGlySer955960965ATTATTGCAAATAATGTAACAATTAATGATGATGTAACTCTTACTACA3342IleIleAlaAsnAsnValThrIleAsnAspAspValThrLeuThrThr970975980GGAGGTATAGCAGGGACAGATTTTGACGCTAAAATTACTCTTGGAAGT3390GlyGlyIleAlaGlyThrAspPheAspAlaLysIleThrLeuGlySer9859909951000GTTAACGGTAACGCTAACGTAAGGTTTGTTGATAGTACATTTTCTGAT3438ValAsnGlyAsnAlaAsnValArgPheValAspSerThrPheSerAsp100510101015CCTAGAAGTATGATTGTTGCTACTCAAGCTAATAAGGGTACTGTAACT3486ProArgSerMetIleValAlaThrGlnAlaAsnLysGlyThrValThr102010251030TATTTAGGTAATGCATTAGTTAGTAATATCGGTAGTTTAGATACTCCT3534TyrLeuGlyAsnAlaLeuValSerAsnIleGlySerLeuAspThrPro103510401045GTAGCTTCTGTTAGATTTACAGGTAATGATAGTGGGGCAGGATTACAA3582ValAlaSerValArgPheThrGlyAsnAspSerGlyAlaGlyLeuGln105010551060GGCAATATTTATTCACAAAATATAGATTTTGGTACTTATAATTTAACT3630GlyAsnIleTyrSerGlnAsnIleAspPheGlyThrTyrAsnLeuThr1065107010751080ATTCTAAATTCTAATGTCATTTTAGGTGGTGGTACTACTGCTATTAAT3678IleLeuAsnSerAsnValIleLeuGlyGlyGlyThrThrAlaIleAsn108510901095GGTGAAATCGATCTTCTGACAAATAATTTAATATTTGCAAATGGTACT3726GlyGluIleAspLeuLeuThrAsnAsnLeuIlePheAlaAsnGlyThr110011051110TCAACATGGGGTGATAATACTTCTATTAGTACAACGTTAAATGTATCA3774SerThrTrpGlyAspAsnThrSerIleSerThrThrLeuAsnValSer111511201125AGCGGTAATATAGGTCAAGTAGTCATTGCCGAAGATGCTCAAGTTAAC3822SerGlyAsnIleGlyGlnValValIleAlaGluAspAlaGlnValAsn113011351140GCAACAACTACAGGAACTACAACCATTAAAATACAAGATAATGCTAAT3870AlaThrThrThrGlyThrThrThrIleLysIleGlnAspAsnAlaAsn1145115011551160GCAAATTTCAGTGGCACACAAGCTTATACTTTAATTCAAGGTGGTGCT3918AlaAsnPheSerGlyThrGlnAlaTyrThrLeuIleGlnGlyGlyAla116511701175AGATTTAATGGTACTTTAGGAGCTCCTAACTTTGCTGTAACAGGAAGT3966ArgPheAsnGlyThrLeuGlyAlaProAsnPheAlaValThrGlySer118011851190AATATTTTCGTAAAATATGAACTAATACGTGATTCTAACCAGGATTAT4014AsnIlePheValLysTyrGluLeuIleArgAspSerAsnGlnAspTyr119512001205GTATTAACACGTACTAACGATGTATTAAACGTAGTTACAACAGCTGTT4062ValLeuThrArgThrAsnAspValLeuAsnValValThrThrAlaVal121012151220GGAAATAGTGCAATTGCAAATGCACCTGGTGTAAGTCAGAACATTTCT4110GlyAsnSerAlaIleAlaAsnAlaProGlyValSerGlnAsnIleSer1225123012351240AGATGCTTAGAATCAACAAATACAGCAGCTTATAATAATATGCTTTTA4158ArgCysLeuGluSerThrAsnThrAlaAlaTyrAsnAsnMetLeuLeu124512501255GCTAAAGATCCTTCTGATGTTGCAACATTTGTAGGAGCTATTGCTACA4206AlaLysAspProSerAspValAlaThrPheValGlyAlaIleAlaThr126012651270GATACAAGTGCGGCTGTAACTACAGTAAACTTAAATGATACACAAAAA4254AspThrSerAlaAlaValThrThrValAsnLeuAsnAspThrGlnLys127512801285ACTCAAGATCTACTTAGTAATAGGCTAGGTACACTTAGATATCTAAGT4302ThrGlnAspLeuLeuSerAsnArgLeuGlyThrLeuArgTyrLeuSer129012951300AATGCTGAAACTTCTGATGTTGCTGGATCTGCAACAGGTGCAGTGTCT4350AsnAlaGluThrSerAspValAlaGlySerAlaThrGlyAlaValSer1305131013151320TCAGGTGATGAAGCGGAAGTATCTTATGGTGTATGGGCTAAACCTTTC4398SerGlyAspGluAlaGluValSerTyrGlyValTrpAlaLysProPhe132513301335TATAACATTGCAGAACAAGACAAAAAAGGTGGTATAGCTGGTTATAAA4446TyrAsnIleAlaGluGlnAspLysLysGlyGlyIleAlaGlyTyrLys134013451350GCAAAAACTACTGGGGTTGTAGTTGGTTTAGATACTCTCGCTAGCGAT4494AlaLysThrThrGlyValValValGlyLeuAspThrLeuAlaSerAsp135513601365AACCTAATGATTGGGGCAGCTATTGGGATCACTAAAACTGATATAAAA4542AsnLeuMetIleGlyAlaAlaIleGlyIleThrLysThrAspIleLys137013751380CACCAAGATTATAAGAAAGGTGATAAAACTGATATTAATGGTTTATCA4590HisGlnAspTyrLysLysGlyAspLysThrAspIleAsnGlyLeuSer1385139013951400TTCTCTCTATATGGTTCCCAACAGCTTGTTAAGAATTTCTTTGCTCAA4638PheSerLeuTyrGlySerGlnGlnLeuValLysAsnPhePheAlaGln140514101415GGTAATTCAATCTTTACCTTAAACAAAGTCAAAAGTAAAAGTCAGCGT4686GlyAsnSerIlePheThrLeuAsnLysValLysSerLysSerGlnArg142014251430TACTTCTTCGAGTCTAATGGTAAGATGAGCAAGCAAATTGCTGCTGGT4734TyrPhePheGluSerAsnGlyLysMetSerLysGlnIleAlaAlaGly143514401445AATTACGATAACATGACATTTGGTGGTAATTTAATATTTGGTTATGAT4782AsnTyrAspAsnMetThrPheGlyGlyAsnLeuIlePheGlyTyrAsp145014551460TATAATGCAATGCCAAATGTATTAGTAACTCCAATGGCAGGACTTAGC4830TyrAsnAlaMetProAsnValLeuValThrProMetAlaGlyLeuSer1465147014751480TACTTAAAATCTTCTAATGAAAATTATAAAGAAACCGGTACAACAGTT4878TyrLeuLysSerSerAsnGluAsnTyrLysGluThrGlyThrThrVal148514901495GCAAATAAGCGCATTAATAGCAAATTTAGTGATAGAGTCGATTTAATA4926AlaAsnLysArgIleAsnSerLysPheSerAspArgValAspLeuIle150015051510GTAGGGGCTAAAGTAGCTGGTAGTACTGTGAATATAACTGATATTGTG4974ValGlyAlaLysValAlaGlySerThrValAsnIleThrAspIleVal151515201525ATATATCCGGAAATTCATTCTTTTGTGGTGCACAAAGTAAATGGTAAA5022IleTyrProGluIleHisSerPheValValHisLysValAsnGlyLys153015351540TTATCTAACTCTCAGTCTATGTTAGATGGACAAACTGCTCCATTTATC5070LeuSerAsnSerGlnSerMetLeuAspGlyGlnThrAlaProPheIle1545155015551560AGTCAACCTGATAGAACTGCTAAAACGTCTTATAATATAGGCTTAAGT5118SerGlnProAspArgThrAlaLysThrSerTyrAsnIleGlyLeuSer156515701575GCAAACATAAAATCTGATGCTAAGATGGAGTATGGTATCGGTTATGAT5166AlaAsnIleLysSerAspAlaLysMetGluTyrGlyIleGlyTyrAsp158015851590TTTAATTCTGCAAGTAAATATACTGCACATCAAGGTACTTTAAAAGTA5214PheAsnSerAlaSerLysTyrThrAlaHisGlnGlyThrLeuLysVal159516001605CGTGTAAACTTCTAATAATTATTTGTGATTTTAGTAAGTTTATAACTTGATT5266ArgValAsnPhe1610AAGAAAAAAAGCCCACTTTGAAAAAATGGGCTTTTTTTCTAGTTATGTAATAA5319(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1612 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetGlyAlaAlaMetGlnTyrAsnArgThrThrAsnAlaAlaAlaThr151015ThrPheAspGlyIleGlyPheAspGlnAlaAlaGlyAlaAsnIlePro202530ValAlaProAsnSerValIleThrAlaAsnAlaAsnAsnProIleThr354045PheAsnThrProAsnGlyHisLeuAsnSerLeuPheLeuAspThrAla505560AsnAspLeuAlaValThrIleAsnGluAspThrThrLeuGlyPheIle65707580ThrAsnIleAlaGlnGlnAlaLysPhePheAsnPheThrValAlaAla859095GlyLysIleLeuAsnIleThrGlyGlnGlyIleThrValGlnGluAla100105110SerAsnThrIleAsnAlaGlnAsnAlaLeuThrLysValHisGlyGly115120125AlaAlaIleAsnAlaAsnAspLeuSerGlyLeuGlySerIleThrPhe130135140AlaValCysProSerValLeuGluPheAsnLeuIleAsnProIleAsn145150155160SerArgSerSerSerTyrHisLeuValSerAsnSerLysIleValAsn165170175GlyGlyAsnGlyIleLeuAsnIleThrAsnGlyPheIleGlnValSer180185190AspAsnThrPheAlaGlyIleLysThrIleAsnIleAspAspCysGln195200205GlyLeuMetPheAsnSerThrProAspAlaAlaAsnThrLeuAsnLeu210215220GlnAlaGlyGlyAsnThrIleAsnPheAsnGlyIleAspGlyThrGly225230235240LysLeuValLeuValSerLysAsnGlyAlaAlaThrGluPheAsnVal245250255ThrGlyThrLeuGlyGlyAsnLeuLysGlyIleIleGluLeuAsnThr260265270AlaAlaValAlaGlyLysLeuIleSerLeuGlyGlyAlaAlaAsnAla275280285ValIleGlyThrAspAsnGlyAlaGlyArgAlaAlaGlyPheIleVal290295300SerValAspAsnGlyAsnAlaAlaThrIleSerGlyGlnValTyrAla305310315320LysAsnMetValIleGlnSerAlaAsnAlaGlyGlyGlnValThrPhe325330335GluHisIleValAspValGlyLeuGlyGlyThrThrAsnPheLysThr340345350AlaAspSerLysValIleIleThrGluAsnSerAsnPheGlySerThr355360365AsnPheGlyAsnLeuAspThrGlnIleValValProAspThrLysIle370375380LeuLysGlyAsnPheIleGlyAspValLysAsnAsnGlyAsnThrAla385390395400GlyValIleThrPheAsnAlaAsnGlyAlaLeuValSerAlaSerThr405410415AspProAsnIleAlaValThrAsnIleAsnAlaIleGluAlaGluGly420425430AlaGlyValValGluLeuSerGlyIleHisIleAlaGluLeuArgLeu435440445GlyAsnGlyGlySerIlePheLysLeuAlaAspGlyThrValIleAsn450455460GlyProValAsnGlnAsnAlaLeuMetAsnAsnAsnAlaLeuAlaAla465470475480GlySerIleGlnLeuAspGlySerAlaIleIleThrGlyAspIleGly485490495AsnGlyGlyValAsnAlaAlaLeuGlnHisIleThrLeuAlaAsnAsp500505510AlaSerLysIleLeuAlaLeuAspGlyAlaAsnIleIleGlyAlaAsn515520525ValGlyGlyAlaIleHisPheGlnAlaAsnGlyGlyThrIleLysLeu530535540ThrAsnThrGlnAsnAsnIleValValAsnPheAspLeuAspIleThr545550555560ThrAspLysThrGlyValValAspAlaSerSerLeuThrAsnAsnGln565570575ThrLeuThrIleAsnGlySerIleGlyThrValValAlaAsnThrLys580585590ThrLeuAlaGlnLeuAsnIleGlySerSerLysThrIleLeuAsnAla595600605GlyAspValAlaIleAsnGluLeuValIleGluAsnAsnGlySerVal610615620GlnLeuAsnHisAsnThrTyrLeuIleThrLysThrIleAsnAlaAla625630635640AsnGlnGlyGlnIleIleValAlaAlaAspProLeuAsnThrAsnThr645650655ThrLeuAlaAspGlyThrAsnLeuGlySerAlaGluAsnProLeuSer660665670ThrIleHisPheAlaThrLysAlaAlaAsnAlaAspSerIleLeuAsn675680685ValGlyLysGlyValAsnLeuTyrAlaAsnAsnIleThrThrAsnAsp690695700AlaAsnValGlySerLeuHisPheArgSerGlyGlyThrSerIleVal705710715720SerGlyThrValGlyGlyGlnGlnGlyHisLysLeuAsnAsnLeuIle725730735LeuAspAsnGlyThrThrValLysPheLeuGlyAspThrThrPheAsn740745750GlyGlyThrLysIleGluGlyLysSerIleLeuGlnIleSerAsnAsn755760765TyrThrThrAspHisValGluSerAlaAspAsnThrGlyThrLeuGlu770775780PheValAsnThrAspProIleThrValThrLeuAsnLysGlnGlyAla785790795800TyrPheGlyValLeuLysGlnValIleIleSerGlyProGlyAsnIle805810815ValPheAsnGluIleGlyAsnValGlyIleValHisGlyIleAlaAla820825830AsnSerIleSerPheGluAsnAlaSerLeuGlyThrSerLeuPheLeu835840845ProSerGlyThrProLeuAspValLeuThrIleLysSerThrValGly850855860AsnGlyThrValAspAsnPheAsnAlaProIleValValValSerGly865870875880IleAspSerMetIleAsnAsnGlyGlnIleIleGlyAspLysLysAsn885890895IleIleAlaLeuSerLeuGlySerAspAsnSerIleThrValAsnAla900905910AsnThrLeuTyrSerGlyIleArgThrThrLysAsnAsnGlnGlyThr915920925ValThrLeuSerGlyGlyMetProAsnAsnProGlyThrIleTyrGly930935940LeuGlyLeuGluAsnGlySerProLysLeuLysGlnValThrPheThr945950955960ThrAspTyrAsnAsnLeuGlySerIleIleAlaAsnAsnValThrIle965970975AsnAspAspValThrLeuThrThrGlyGlyIleAlaGlyThrAspPhe980985990AspAlaLysIleThrLeuGlySerValAsnGlyAsnAlaAsnValArg99510001005PheValAspSerThrPheSerAspProArgSerMetIleValAlaThr101010151020GlnAlaAsnLysGlyThrValThrTyrLeuGlyAsnAlaLeuValSer1025103010351040AsnIleGlySerLeuAspThrProValAlaSerValArgPheThrGly104510501055AsnAspSerGlyAlaGlyLeuGlnGlyAsnIleTyrSerGlnAsnIle106010651070AspPheGlyThrTyrAsnLeuThrIleLeuAsnSerAsnValIleLeu107510801085GlyGlyGlyThrThrAlaIleAsnGlyGluIleAspLeuLeuThrAsn109010951100AsnLeuIlePheAlaAsnGlyThrSerThrTrpGlyAspAsnThrSer1105111011151120IleSerThrThrLeuAsnValSerSerGlyAsnIleGlyGlnValVal112511301135IleAlaGluAspAlaGlnValAsnAlaThrThrThrGlyThrThrThr114011451150IleLysIleGlnAspAsnAlaAsnAlaAsnPheSerGlyThrGlnAla115511601165TyrThrLeuIleGlnGlyGlyAlaArgPheAsnGlyThrLeuGlyAla117011751180ProAsnPheAlaValThrGlySerAsnIlePheValLysTyrGluLeu1185119011951200IleArgAspSerAsnGlnAspTyrValLeuThrArgThrAsnAspVal120512101215LeuAsnValValThrThrAlaValGlyAsnSerAlaIleAlaAsnAla122012251230ProGlyValSerGlnAsnIleSerArgCysLeuGluSerThrAsnThr123512401245AlaAlaTyrAsnAsnMetLeuLeuAlaLysAspProSerAspValAla125012551260ThrPheValGlyAlaIleAlaThrAspThrSerAlaAlaValThrThr1265127012751280ValAsnLeuAsnAspThrGlnLysThrGlnAspLeuLeuSerAsnArg128512901295LeuGlyThrLeuArgTyrLeuSerAsnAlaGluThrSerAspValAla130013051310GlySerAlaThrGlyAlaValSerSerGlyAspGluAlaGluValSer131513201325TyrGlyValTrpAlaLysProPheTyrAsnIleAlaGluGlnAspLys133013351340LysGlyGlyIleAlaGlyTyrLysAlaLysThrThrGlyValValVal1345135013551360GlyLeuAspThrLeuAlaSerAspAsnLeuMetIleGlyAlaAlaIle136513701375GlyIleThrLysThrAspIleLysHisGlnAspTyrLysLysGlyAsp138013851390LysThrAspIleAsnGlyLeuSerPheSerLeuTyrGlySerGlnGln139514001405LeuValLysAsnPhePheAlaGlnGlyAsnSerIlePheThrLeuAsn141014151420LysValLysSerLysSerGlnArgTyrPhePheGluSerAsnGlyLys1425143014351440MetSerLysGlnIleAlaAlaGlyAsnTyrAspAsnMetThrPheGly144514501455GlyAsnLeuIlePheGlyTyrAspTyrAsnAlaMetProAsnValLeu146014651470ValThrProMetAlaGlyLeuSerTyrLeuLysSerSerAsnGluAsn147514801485TyrLysGluThrGlyThrThrValAlaAsnLysArgIleAsnSerLys149014951500PheSerAspArgValAspLeuIleValGlyAlaLysValAlaGlySer1505151015151520ThrValAsnIleThrAspIleValIleTyrProGluIleHisSerPhe152515301535ValValHisLysValAsnGlyLysLeuSerAsnSerGlnSerMetLeu154015451550AspGlyGlnThrAlaProPheIleSerGlnProAspArgThrAlaLys155515601565ThrSerTyrAsnIleGlyLeuSerAlaAsnIleLysSerAspAlaLys157015751580MetGluTyrGlyIleGlyTyrAspPheAsnSerAlaSerLysTyrThr1585159015951600AlaHisGlnGlyThrLeuLysValArgValAsnPhe16051610__________________________________________________________________________
Claims
  • 1. A plasmid consisting of a recombinant DNA insert having the nucleotide sequence of Sequence ID No. 1 (or FIG. 4) which encode the surface layer protein of R. prowazekii in a host selected from the group consisting of bacteria, viruses or fungi.
  • 2. The plasmid of claim 1 wherein the host is selected from the group consisting of Escherichia coli, attenuated strains of Salmonella typhi, Bacillus Camille - Guerin (BCG), vaccinia virus, baculovirus expression vectors, and yeast.
RELATED APPLICATIONS

This application is a continuation-in-part of U.S. patent application Ser. No. 07/742,128, filed 9 Aug. 1991, now abandoned.

Non-Patent Literature Citations (9)
Entry
Gilmore, R.D. et al. Mol. Macrobio. 3(11) : 1575-1586 (1989).
Lee, C. C. et al. Science 239 : 1288-1291 (1988).
McDonald, G. et al. Science 235 : 83-85 (1987).
Krause, D.C. et al. Infect Imimun. 47(1) : 157-165 (1985).
Raonlt, D. et al. J. Immunol. Meth. 125:57-65 (1989).
Ellis, R.W. "New Technologies for Making Vaccines" In Vaccines Plotkin & timer Eds., W.S. Saunders Co. (1988) pp. 568-575.
Boslego, J.W. et al. "Gonorrhea Vaccines" In Vaccines & Immunotherapy S.J. Cryz Ed., Pergrmon Press (1991) pp. 211-222.
Aniskovich, L.P. et al. Acta, Virol 35 :90-102 (1991)
Ching, W.M. et al. Ann. N.Y. Acad. Sci. 590: 334-351 (1990).
Continuation in Parts (1)
Number Date Country
Parent 742128 Aug 1991