Gene expression markers for predicting response to chemotherapy

Information

  • Patent Application
  • 20050260646
  • Publication Number
    20050260646
  • Date Filed
    April 07, 2005
    19 years ago
  • Date Published
    November 24, 2005
    18 years ago
Abstract
The present invention provides sets of genes the expression of which is important in the prognosis of cancer. In particular, the invention provides gene expression information useful for predicting whether cancer patients are likely to have a beneficial treatment response to chemotherapy.FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C; GSTM1, BCL2, ESR1; or the corresponding expression product, is determined, said report includes a prediction that said subject has a decreased likelihood of response to chemotherapy.
Description
BACKGROUND OF THE INVENTION

1. Field of the Invention


The present invention provides sets of genes the expression of which is important in the prognosis of cancer. In particular, the invention provides gene expression information useful for predicting whether cancer patients are likely to have a beneficial treatment response to chemotherapy.


2. Description of the Related Art


Oncologists have a number of treatment options available to them, including different combinations of chemotherapeutic drugs that are characterized as “standard of care,” and, a number of drugs that do not carry a label claim for particular cancer, but for which there is evidence of efficacy in that cancer. Best likelihood of good treatment outcome requires that patients be assigned to optimal available cancer treatment, and that this assignment be made as quickly as possible following diagnosis. In particular, it is important to determine the likelihood of patient response to “standard of care” chemotherapy because chemotherapeutic drugs such as anthracyclines and taxanes have limited efficacy and are toxic. The identification of patients who are most or least likely to respond thus could increase the net benefit these drugs have to offer, and decrease the net morbidity and toxicity, via more intelligent patient selection.


Currently, diagnostic tests used in clinical practice are single analyte, and therefore do not capture the potential value of knowing relationships between dozens of different markers. Moreover, diagnostic tests are frequently not quantitative, relying on immunohistochemistry. This method often yields different results in different laboratories, in part because the reagents are not standardized, and in part because the interpretations are subjective and cannot be easily quantified. RNA-based tests have not often been used because of the problem of RNA degradation over time and the fact that it is difficult to obtain fresh tissue samples from patients for analysis. Fixed paraffin-embedded tissue is more readily available and methods have been established to detect RNA in fixed tissue. However, these methods typically do not allow for the study of large numbers of genes (DNA or RNA) from small amounts of material. Thus, traditionally fixed tissue has been rarely used other than for immunohistochhemistry detection of proteins.


In the last few years, several groups have published studies concerning the classification of various cancer types by microarray gene expression analysis (see, e.g. Golub et al., Science 286:531-537 (1999); Bhattacharjae et al., Proc. Natl. Acad. Sci. USA 98:13790-13795 (2001); Chen-Hsiang et al., Bioinformatics 17 (Suppl. 1):S316-S322 (2001); Ramaswamy et al., Proc. Natl. Acad. Sci. USA 98:15149-15154 (2001)). Certain classifications of human breast cancers based on gene expression patterns have also been reported (Martin et al., Cancer Res. 60:2232-2238 (2000); West et al., Proc. Natl. Acad. Sci. USA 98:11462-11467 (2001); Sorlie et al., Proc. Natl. Acad. Sci. USA 98:10869-10874 (2001); Yan et al., Cancer Res. 61:8375-8380 (2001)). However, these studies mostly focus on improving and refining the already established classification of various types of cancer, including breast cancer, and generally do not provide new insights into the relationships of the differentially expressed genes, and do not link the findings to treatment strategies in order to improve the clinical outcome of cancer therapy.


Although modern molecular biology and biochemistry have revealed hundreds of genes whose activities influence the behavior of tumor cells, state of their differentiation, and their sensitivity or resistance to certain therapeutic drugs, with a few exceptions, the status of these genes has not been exploited for the purpose of routinely making clinical decisions about drug treatments. One notable exception is the use of estrogen receptor (ER) protein expression in breast carcinomas to select patients to treatment with anti-estrogen drugs, such as tamoxifen. Another exceptional example is the use of ErbB2 (Her2) protein expression in breast carcinomas to select patients with the Her2 antagonist drug Herceptin® (Genentech, Inc., South San Francisco, Calif.).


Despite recent advances, the challenge of cancer treatment remains to target specific treatment regimens to pathogenically distinct tumor types, and ultimately personalize tumor treatment in order to maximize outcome. Hence, a need exists for tests that simultaneously provide predictive information about patient responses to the variety of treatment options. This is particularly true for breast cancer, the biology of which is poorly understood. It is clear that the classification of breast cancer into a few subgroups, such as the ErbB2 positive subgroup, and subgroups characterized by low to absent gene expression of the estrogen receptor (ER) and a few additional transcriptional factors (Perou et al., Nature 406:747-752 (2000)), does not reflect the cellular and molecular heterogeneity of breast cancer, and does not allow the design of treatment strategies maximizing patient response. Breast cancer is the most common type of cancer among women in the United States and is the leading cause of cancer deaths among women ages 40-59. Therefore, there is a particularly great need for a clinically validated breast cancer test predictive of patient response to chemotherapy.


SUMMARY OF THE INVENTION

The present invention provides gene sets useful in predicting the response of cancer, e.g. breast cancer patients to chemotherapy. In addition, the invention provides a clinically validated cancer, e.g. breast cancer, test, predictive of patient response to chemotherapy, using multi-gene RNA analysis. The present invention accommodates the use of archived paraffin-embedded biopsy material for assay of all markers in the relevant gene sets, and therefore is compatible with the most widely available type of biopsy material.


In one aspect, the present invention concerns a method for predicting the response of a subject diagnosed with cancer to chemotherapy comprising determining the expression level of one or more prognostic RNA transcripts or their expression products in a biological sample comprising cancer cells obtained from said subject, wherein the predictive RNA transcript is the transcript of one or more genes selected from the group consisting of TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31, COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; TK1, ErbB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2, CD68, GSTM1, BCL2, ESR1 wherein

    • (a) for every unit of increased expression of one or more of ILT.2; CD18; GBP1; CD3z; fas1; MCM6; E2F1; ID2; FBXO5; CDC20; HLA.DPB1; CGA; MMP12; CDC25B; IL6; CYBA; DR4; CRABP1; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; MCM2; GBP2; CD31; ER2; STAT1; TK1; ERBB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2 and CD68; or the corresponding expression product, said subject is predicted to have an increased likelihood of response to chemotherapy; and
    • (b) for every unit of increased expression of one or more of TBP; ABCC5; GATA3; DICER1; MSH3; IRS1; TUBB; BAD; ERCC1; PR; APC; GGPS1; KRT18; ESRRG; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; G.Catenin; FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C; GSTM1, BCL2, ESR1; or the corresponding expression product, said subject is predicted to have a decreased likelihood of response to chemotherapy.


In a particular embodiment, in the above method the predictive RNA transcript is the transcript of one or more genes selected from the group consisting of TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31; COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; and TK1.


In another embodiment, the response is a complete pathological response.


In a preferred embodiment, the subject is a human patient.


The cancer can be any types of cancer but preferably is a solid tumor, such as breast cancer, ovarian cancer, gastric cancer, colon cancer, pancreatic cancer, prostate cancer and lung cancer.


If the tumor is breast cancer, it can, for example, be invasive breast cancer, or stage II or stage III breast cancer.


In a particular embodiment, the chemotherapy is adjuvant chemotherapy.


In another embodiment, the chemotherapy is neoadjuvant chemotherapy.


The neoadjuvant chemotherapy may, for example, comprise the administration of a taxane derivativ, such as docetaxel and/or paclitaxel, and/or other anti-cancer agents, such as, members of the anthracycline class of anti-cancer agents, doxorubicin, topoisomerase inhibitors, etc.


The method may involve determination of the expression levels of at least two, or at least five, or at least ten, or at least 15 of the prognostic transcripts listed above, or their expression products.


The biological sample may be e.g. a tissue sample comprising cancer cells, where the tissue can be fixed, paraffin-embedded, or fresh, or frozen.


In a particular embodiment, the tissue is from fine needle, core, or other types of biopsy.


In another embodiment, the tissue sample is obtained by fine needle aspiration, bronchial lavage, or transbronchial biopsy.


The expression level of said prognostic RNA transcript or transcripts can be determined, for example, by RT-PCR or an other PCR-based method, immunohistochemistry, proteomics techniques, or any other methods known in the art, or their combination.


In an embodiment, the assay for the measurement of said prognostic RNA transcripts or their expression products is provided is provided in the form of a kit or kits.


In another aspect, the invention concerns an array comprising polynucleotides hybridizing to a plurality of the following genes: TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31; COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; TK1, ErbB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2, CD68, GSTM1, BCL2, ESR1.


In an embodiment, the array compises polynucleotides hybridizing to a plurality of the following genes: TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31; COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; TK1.


In another embodiment, the array comprises polynucleotides hybridizing to a plurality of the following genes: ILT.2; CD18; GBP1; CD3z; fas1; MCM6; E2F1; ID2; FBXO5; CDC20; HLA.DPB1; CGA; MMP12; CDC25B; IL6; CYBA; DR4; CRABP1; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; MCM2; GBP2; CD31; ER2; STAT1; TK1; ERBB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2 and CD68.


In yet another embodiment, the array comprises polynucleotides hybridizing to a plurality of the following genes: ILT.2; CD18; GBP1; CD3z; fas1; MCM6; E2F1; ID2; FBXO5; CDC20; HLA.DPB1; CGA; MMP12; CDC25B; IL6; CYBA; DR4; CRABP1; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; MCM2; GBP2; CD31; ER2; STAT1; TK1


In a still further embodiment, the array comprises polynucleotides hybridizing to a plurality of the following genes: TBP; ABCC5; GATA3; DICER1; MSH3; IRS1; TUBB; BAD; ERCC1; PR; APC; GGPS1; KRT18; ESRRG; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; G.Catenin; FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C; GSTM1, BCL2, ESR1.


In another embodiment, the array comprises polynucleotides hybridizing to a plurality of the following genes: TBP; ABCC5; GATA3; DICER1; MSH3; IRS1; TUBB; BAD; ERCC1; PR; APC; GGPS1; KRT18; ESRRG; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; G.Catenin; FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C.


In various embodiments, the array comprises at least five, or at least 10, or at least 15, or at least 10 of such polynucleotides.


In a particular embodiment, the array comprises polynucleotides hybridizing to all of the genes listed above.


In another particular embodiment, the array comprises more than one polynucleotide hybridizing to the same gene.


In another embodiment, at least one of the the polynucleotides comprises an intron-based sequence the expression of which correlates with the expression of a corresponding exon sequence.


In various embodiments, the polynucleotides can be cDNAs or oligonucleotides.


In another aspect, the invention concerns a method of preparing a personalized genomics profile for a patient comprising the steps of:

    • (a) determining the normalized expression levels of the RNA transcripts or the expression products of a gene or gene set selected from the group consisting of TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31; COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; TK1, ErbB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2, CD68, GSTM1, BCL2, ESR1, in a cancer cell obtained from said patient; and
    • (b) creating a report summarizing the data obtained by the gene expression analysis.


In a specific embodiment, if increased expression of one or more of ILT.2; CD18; GBP1; CD3z; fas1; MCM6; E2F1; ID2; FBXO5; CDC20; HLA.DPB1; CGA; MMP12; CDC25B; IL6; CYBA; DR4; CRABP1; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; MCM2; GBP2; CD31; ER2; STAT1; TK1; ERBB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2 and CD68; or the corresponding expression product, is determined, the report includes a prediction that said subject has an increased likelihood of response to chemotherapy. In this case, in a particular embodiment, the method includes the additional step of treating the patient with a chemotherapeutic agent.


In the foregoing method, if increased expression of one or more of TBP; ABCC5; GATA3; DICER1; MSH3; IRS1; TUBB; BAD; ERCC1; PR; APC; GGPS1; KRT18; ESRRG; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; G.Catenin; FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C; GSTM1, BCL2, ESR1; or the corresponding expression product, is determined, the report includes a prediction that said subject has a decreased likelihood of response to chemotherapy.


In another aspect, the invention concerns a method for determining the likelihood of the response of a patient to chemotherapy, comprising:

    • (a) determining the expression levels of the RNA transcripts of following genes .ACTB, BAG1, BCL2, CCNB1, CD68, SCUBE2, CTSL2, ESR1, GAPD, GRB7, GSTM1, GUSB, ERBB2, MKI67, MYBL2, PGR, RPLPO, STK6, MMP11, BIRC5, TFRC, or their expression products, and
    • (b) calculating the recurrence score (RS).


In an embodiment, patients having an RS>50 are in the upper 50 percentile of patients who are likely to respond to chemotherapy.


In enother embodiment, patients having an RS<35 are in the lower 50 percentile of patients who are likely to response to chemotherapy. In a further embodiment, RS is determined by creating the following gene subsets:

    • (i) growth factor subset: GRB7 and HER2;
    • (ii) estrogen receptor subset: ER, PR, Bcl2, and CEGP1;
    • (iii) proliferation subset: SURV, Ki.67, MYBL2, CCNB1, and STK15; and
    • (iv) invasion subset: CTSL2, and STMY3;
    • wherein a gene within any of subsets (i)-(iv) can be substituted by substitute gene which coexpresses with said gene in said tumor with a Pearson correlation coefficient of ≧0.40; and
    • (c) calculating the recurrence score (RS) for said subject by weighting the contributions of each of subsets (i)-(iv), to breast cancer recurrence.


The foregoing method may further comprise determining the RNA transcripts of CD68, GSTM1 and BAG1 or their expression products, or corresponding substitute genes or their expression products, and including the contribution of said genes or substitute genes to breast cancer recurrence in calculating the RS


RS may, for example, be determined by using the following equation:

RS=(0.23 to 0.70)×GRB7axisthresh−(0.17 to 0.55)×ERaxis+(0.52 to 1.56)×prolifaxisthresh+(0.07 to 0.21)×invasionaxis+(0.03 to 0.15)×CD68−(0.04 to 0.25)×GSTM1−(0.05 to 0.22)×BAG1

wherein

    • (i) GRB7 axis=(0.45 to 1.35)×GRB7+(0.05 to 0.15)×HER2;
    • (ii) if GRB7 axis<−2, then GRB7 axis thresh =−2, and if GRB7 axis≧−2, then GRB7 axis thresh=GRB7 axis;
    • (iii) ER axis=(Est1+PR+Bcl2+CEGP1)/4;
    • (iv) prolifaxis=(SURV+Ki.67+MYBL2+CCNB1+STK15)/5;
    • (v) if prolifaxis<−3.5, then prolifaxisthresh=−3.5, if prolifaxis≧−3.5, then prolifaxishresh=prolifaxis; and
    • (vi) invasionaxis=(CTSL2+STMY3)/2,
    • wherein the individual contributions of the genes in (iii), (iv) and (vi) are weighted by a factor of 0.5 to 1.5, and wherein a higher RS represents an increased likelihood of breast cancer recurrence.


In another embodiment, RS is determined by using the following equation:
RS(range,0-100)=+0.47×HER2GroupScore-0.34×ERGroupScore+1.04×ProliferationGroupScore+0.10×InvasionGroupScore+0.05×CD68-0.08×GSTM1-0.07×BAG1




BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 shows the relationship between recurrence score (RS) and likelihood of patient response to chemotherapy, based on results from a clinical trial with pathologic complete response endpoint.


Table 1 shows a list of genes, the expression of which correlates, positively or negatively, with breast cancer response to adriamycin and taxane neoadjuvant chemotherapy. Results from a clinical trial with pathologic complete response endpoint. Statistical analysis utilized univarite generalized linear models with a probit link function.


Table 2 presents a list of genes, the expression of which predicts breast cancer response to chemotherapy. Results from a retrospective clinical trial. The table includes accession numbers for the genes, sequences for the forward and reverse primers (designated by “f” and “r”, respectively) and probes (designated by “p”) used for PCR amplification.


Table 3 shows the amplicon sequences used in PCR amplification of the indicated genes.




DETAILED DESCRIPTION
A. DEFINITIONS

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994), and March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992), provide one skilled in the art with a general guide to many of the terms used in the present application.


One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.


The term “microarray” refers to an ordered arrangement of hybridizable array elements, preferably polynucleotide probes, on a substrate.


The term “polynucleotide,” when used in singular or plural, generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for instance, polynucleotides as defined herein include, without limitation, single- and double-stranded DNA, DNA including single- and double-stranded regions, single- and double-stranded RNA, and RNA including single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions. In addition, the term “polynucleotide” as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide. The term “polynucleotide” specifically includes cDNAs. The term includes DNAs (including cDNAs) and RNAs that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are “polynucleotides” as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritiated bases, are included within the term “polynucleotides” as defined herein. In general, the term “polynucleotide” embraces all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells.


The term “oligonucleotide” refers to a relatively short polynucleotide, including, without limitation, single-stranded deoxyribonucleotides, single- or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.


The terms “differentially expressed gene,” “differential gene expression” and their synonyms, which are used interchangeably, refer to a gene whose expression is activated to a higher or lower level in a subject suffering from a disease, specifically cancer, such as breast cancer, relative to its expression in a normal or control subject. The terms also include genes whose expression is activated to a higher or lower level at different stages of the same disease. It is also understood that a differentially expressed gene may be either activated or inhibited at the nucleic acid level or protein level, or may be subject to alternative splicing to result in a different polypeptide product. Such differences may be evidenced by a change in mRNA levels, surface expression, secretion or other partitioning of a polypeptide, for example. Differential gene expression may include a comparison of expression between two or more genes or their gene products, or a comparison of the ratios of the expression between two or more genes or their gene products, or even a comparison of two differently processed products of the same gene, which differ between normal subjects and subjects suffering from a disease, specifically cancer, or between various stages of the same disease. Differential expression includes both quantitative, as well as qualitative, differences in the temporal or cellular expression pattern in a gene or its expression products among, for example, normal and diseased cells, or among cells which have undergone different disease events or disease stages. For the purpose of this invention, “differential gene expression” is considered to be present when there is at least an about two-fold, preferably at least about four-fold, more preferably at least about six-fold, most preferably at least about ten-fold difference between the expression of a given gene in normal and diseased subjects, or in various stages of disease development in a diseased subject.


The term “normalized” with regard to a gene transcript or a gene expression product refers to the level of the transcript or gene expression product relative to the mean levels of transcripts/products of a set of reference genes, wherein the reference genes are either selected based on their minimal variation across, patients, tissues or treatments (“housekeeping genes”), or the reference genes are the totality of tested genes. In the latter case, which is commonly referred to as “global normalization”, it is important that the total number of tested genes be relatively large, preferably greater than 50. Specifically, the term ‘normalized’ with respect to an RNA transcript refers to the transcript level relative to the mean of transcript levels of a set of reference genes. More specifically, the mean level of an RNA transcript as measured by TaqMan® RT-PCR refers to the Ct value minus the mean Ct values of a set of reference gene transcripts.


The terms “expression threshold,”and “defined expression threshold” are used interchangeably and refer to the level of a gene or gene product in question above which the gene or gene product serves as a predictive marker for patient response or resistance to a drug. The threshold typically is defined experimentally from clinical studies. The expression threshold can be selected either for maximum sensitivity (for example, to detect all responders to a drug), or for maximum selectivity (for example to detect only responders to a drug), or for minimum error.


The phrase “gene amplification” refers to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. The duplicated region (a stretch of amplified DNA) is often referred to as “amplicon.” Often, the amount of the messenger RNA (mRNA) produced, i.e., the level of gene expression, also increases in the proportion to the number of copies made of the particular gene.


The term “prognosis” is used herein to refer to the prediction of the likelihood of cancer-attributable death or progression, including recurrence, metastatic spread, and drug resistance, of a neoplastic disease, such as breast cancer. The term “prediction” is used herein to refer to the likelihood that a patient will respond either favorably or unfavorably to a drug or set of drugs, and also the extent of those responses, or that a patient will survive, following surgical removal or the primary tumor and/or chemotherapy for a certain period of time without cancer recurrence. The predictive methods of the present invention can be used clinically to make treatment decisions by choosing the most appropriate treatment modalities for any particular patient. The predictive methods of the present invention are valuable tools in predicting if a patient is likely to respond favorably to a treatment regimen, such as surgical intervention, chemotherapy with a given drug or drug combination, and/or radiation therapy, or whether long-term survival of the patient, following surgery and/or termination of chemotherapy or other treatment modalities is likely.


The term “long-term” survival is used herein to refer to survival for at least 3 years, more preferably for at least 8 years, most preferably for at least 10 years following surgery or other treatment.


The term “tumor,” as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.


The terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, breast cancer, colon cancer, lung cancer, prostate cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, and brain cancer.


The “pathology” of cancer includes all phenomena that compromise the well-being of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, neoplasia, premalignancy, malignancy, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc.


“Patient response” can be assessed using any endpoint indicating a benefit to the patient, including, without limitation, (1) inhibition, to some extent, of tumor growth, including slowing down and complete growth arrest; (2) reduction in the number of tumor cells; (3) reduction in tumor size; (4) inhibition (i.e., reduction, slowing down or complete stopping) of tumor cell infiltration into adjacent peripheral organs and/or tissues; (5) inhibition (i.e. reduction, slowing down or complete stopping) of metastasis; (6) enhancement of anti-tumor immune response, which may, but does not have to, result in the regression or rejection of the tumor; (7) relief, to some extent, of one or more symptoms associated with the tumor; (8) increase in the length of survival following treatment; and/or (9) decreased mortality at a given point of time following treatment.


“Neoadjuvant therapy” is adjunctive or adjuvant therapy given prior to the primary (main) therapy. Neoadjuvant therapy includes, for example, chemotherapy, radiation therapy, and hormone therapy. Thus, chemotherapy may be administered prior to surgery to shrink the tumor, so that surgery can be more effective, or, in the case of previously unoperable tumors, possible.


“Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).


“Stringent conditions” or “high stringency conditions”, as defined herein, typically: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50° C.; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42° C.; or (3) employ 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5× Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2×SSC (sodium chloride/sodium citrate) and 50% formamide at 55° C., followed by a high-stringency wash consisting of 0.1×SSC containing EDTA at 55° C.


“Moderately stringent conditions” may be identified as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and % SDS) less stringent that those described above. An example of moderately stringent conditions is overnight incubation at 37° C. in a solution comprising: 20% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1×SSC at about 37-50° C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.


In the context of the present invention, reference to “at least one,” “at least two,” “at least five,” etc. of the genes listed in any particular gene set means any one or any and all combinations of the genes listed.


B. DETAILED DESCRIPTION

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, 2nd edition (Sambrook et al., 1989); “Oligonucleotide Synthesis” (M. J. Gait, ed., 1984); “Animal Cell Culture” (R. I. Freshney, ed., 1987); “Methods in Enzymology” (Academic Press, Inc.); “Handbook of Experimental Immunology”, 4th edition (D. M. Weir & C. C. Blackwell, eds., Blackwell Science Inc., 1987); “Gene Transfer Vectors for Mammalian Cells” (J. M. Miller & M. P. Calos, eds., 1987); “Current Protocols in Molecular Biology” (F. M. Ausubel et al., eds., 1987); and “PCR: The Polymerase Chain Reaction”, (Mullis et al., eds., 1994).


1. Gene Expression Profiling


Methods of gene expression profiling include methods based on hybridization analysis of polynucleotides, methods based on sequencing of polynucleotides, and proteomics-based methods. The most commonly used methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse protection assays (Hod, Biotechniques 13:852-854 (1992)); and PCR-based methods, such as reverse transcription polymerase chain reaction (RT-PCR) (Weis et al., Trends in Genetics 8:263-264 (1992)). Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS).


2. PCR-Based Gene Expression Profiling Methods


a. Reverse Transcriptase PCR (RT-PCR)


One of the most sensitive and most flexible quantitative PCR-based gene expression profiling methods is RT-PCR, which can be used to compare mRNA levels in different sample populations, in normal and tumor tissues, with or without drug treatment, to characterize patterns of gene expression, to discriminate between closely related mRNAs, and to analyze RNA structure.


The first step is the isolation of mRNA from a target sample. The starting material is typically total RNA isolated from human tumors or tumor cell lines; and corresponding normal tissues or cell lines, respectively. Thus RNA can be isolated from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis, ovary, uterus, etc., tumor, or tumor cell lines, with pooled DNA from healthy donors. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples.


General methods for mRNA extraction are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56:A67 (1987), and De Andrés et al., BioTechniques 18:42044 (1995). In particular, RNA isolation can be performed using purification kit, buffer set and protease from commercial manufacturers, such as Qiagen, according to the manufacturer's instructions. For example, total RNA from cells in culture can be isolated using Qiagen RNeasy mini-columns. Other commercially available RNA isolation kits include MasterPure™ Complete DNA and RNA Purification Kit (EPICENTRE®, Madison, Wis.), and Paraffin Block RNA Isolation Kit (Ambion, Inc.). Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel-Test). RNA prepared from tumor can be isolated, for example, by cesium chloride density gradient centrifugation.


As RNA cannot serve as a template for PCR, the first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction. The two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MMLV-RT). The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, CA, USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.


Although the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5′-3′ nuclease activity but lacks a 3′-5′ proofreading endonuclease activity. Thus, TaqMan® PCR typically utilizes the 5′-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5′ nuclease activity can be used. Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.


TaqMan® RT-PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7700™ Sequence Detection System™ (Perkin-Elmer-Applied Biosystems, Foster City, Calif., USA), or Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany). In a preferred embodiment, the 5′ nuclease procedure is run on a real-time quantitative PCR device such as the ABI PRISM 7700™ Sequence Detection System™. The system consists of a thermocycler, laser, charge-coupled device (CCD), camera and computer. The system amplifies samples in a 96-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data.


5′-Nuclease assay data are initially expressed as Ct, or the threshold cycle. As discussed above, fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction. The point when the fluorescent signal is first recorded as statistically significant is the threshold cycle (Ct).


To minimize errors and the effect of sample-to-sample variation, RT-PCR is usually performed using a reference RNA which ideally is expressed at a constant level among different tissues, and is unaffected by the experimental treatment. RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3-phosphate-dehydrogenase (GAPD) and β-actin (ACTB).


A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TaqMan® probe). Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. For further details see, e.g. Held et al., Genome Research 6:986-994 (1996).


b. MassARRAY System


In the MassARRAY-based gene expression profiling method, developed by Sequenom, Inc. (San Diego, Calif.) following the isolation of RNA and reverse transcription, the obtained cDNA is spiked with a synthetic DNA molecule (competitor), which matches the targeted cDNA region in all positions, except a single base, and serves as an internal standard. The cDNA/competitor mixture is PCR amplified and is subjected to a post-PCR shrimp alkaline phosphatase (SAP) enzyme treatment, which results in the dephosphorylation of the remaining nucleotides. After inactivation of the alkaline phosphatase, the PCR products from the competitor and cDNA are subjected to primer extension, which generates distinct mass signals for the competitor- and cDNA-derives PCR products. After purification, these products are dispensed on a chip array, which is pre-loaded with components needed for analysis with matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis. The cDNA present in the reaction is then quantified by analyzing the ratios of the peak areas in the mass spectrum generated. For further details see, e.g. Ding and Cantor, Proc. Natl. Acad. Sci. USA 100:3059-3064 (2003).


c. Other PCR-Based Methods


Further PCR-based techniques include, for example, differential display (Liang and Pardee, Science 257:967-971 (1992)); amplified fragment length polymorphism (iAFLP) (Kawamoto et al., Genome Res. 12:1305-1312 (1999)); BeadArray™ technology (Illumina, San Diego, Calif.; Oliphant et al., Discovery of Markers for Disease (Supplement to Biotechniques), June 2002; Ferguson et al., Analytical Chemistry 72:5618 (2000)); BeadsArray for Detection of Gene Expression (BADGE), using the commercially available Luminex100 LabMAP system and multiple color-coded microspheres (Luminex Corp., Austin, Tex.) in a rapid assay for gene expression (Yang et al., Genome Res. 11:1888-1898 (2001)); and high coverage expression profiling (HiCEP) analysis (Fukumura et al., Nucl. Acids. Res. 31(16) e94 (2003)).


3. Microarrays


Differential gene expression can also be identified, or confirmed using the microarray technique. Thus, the expression profile of breast cancer-associated genes can be measured in either fresh or paraffin-embedded tumor tissue, using microarray technology. In this method, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are plated, or arrayed, on a microchip substrate. The arrayed sequences are then hybridized with specific DNA probes from cells or tissues of interest. Just as in the RT-PCR method, the source of mRNA typically is total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines. Thus RNA can be isolated from a variety of primary tumors or tumor cell lines. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples, which are routinely prepared and preserved in everyday clinical practice.


In a specific embodiment of the microarray technique, PCR amplified inserts of cDNA clones are applied to a substrate in a dense array. Preferably at least 10,000 nucleotide sequences are applied to the substrate. The microarrayed genes, immobilized on the microchip at 10,000 elements each, are suitable for hybridization under stringent conditions. Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array. After stringent washing to remove non-specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance. With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. The miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., Proc. Natl. Acad. Sci. USA 93(2):106-149 (1996)). Microarray analysis can be performed by commercially available equipment, following manufacturer's protocols, such as by using the Affymetrix GenChip technology, or Incyte's microarray technology.


The development of microarray methods for large-scale analysis of gene expression makes it possible to search systematically for molecular markers of cancer classification and outcome prediction in a variety of tumor types.


4. Serial Analysis of Gene Expression (SAGE)


Serial analysis of gene expression (SAGE) is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript. First, a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript. Then, many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously. The expression pattern of any population of transcripts can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Velculescu et al., Science 270:484-487 (1995); and Velculescu et al., Cell 88:243-51 (1997).


5. Gene Expression Analysis by Massively Parallel Signature Sequencing (MPSS)


This method, described by Brenner et al., Nature Biotechnology 18:630-634 (2000), is a sequencing approach that combines non-gel-based signature sequencing with in vitro cloning of millions of templates on separate 5 μm diameter microbeads. First, a microbead library of DNA templates is constructed by in vitro cloning. This is followed by the assembly of a planar array of the template-containing microbeads in a flow cell at a high density (typically greater than 3×106 microbeads/cm2). The free ends of the cloned templates on each microbead are analyzed simultaneously, using a fluorescence-based signature sequencing method that does not require DNA fragment separation. This method has been shown to simultaneously and accurately provide, in a single operation, hundreds of thousands of gene signature sequences from a yeast cDNA library.


6. Immunohistochemistry


Immunohistochemistry methods are also suitable for detecting the expression levels of the prognostic markers of the present invention. Thus, antibodies or antisera, preferably polyclonal antisera, and most preferably monoclonal antibodies specific for each marker are used to detect expression. The antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase. Alternatively, unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody. Immunohistochemistry protocols and kits are well known in the art and are commercially available.


7. Proteomics


The term “proteome” is defined as the totality of the proteins present in a sample (e.g. tissue, organism, or cell culture) at a certain point of time. Proteomics includes, among other things, study of the global changes of protein expression in a sample (also referred to as “expression proteomics”). Proteomics typically includes the following steps: (1) separation of individual proteins in a sample by 2-D gel electrophoresis (2-D PAGE); (2) identification of the individual proteins recovered from the gel, e.g. my mass spectrometry or N-terminal sequencing, and (3) analysis of the data using bioinformatics. Proteomics methods are valuable supplements to other methods of gene expression profiling, and can be used, alone or in combination with other methods, to detect the products of the prognostic markers of the present invention.


8. General Description of mRNA Isolation, Purification and Amplification


The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including mRNA isolation, purification, primer extension and amplification are given in various published journal articles (for example: T. E. Godfrey et al. J. Molec. Diagnostics 2: 84-91 [2000]; K. Specht et al., Am. J. Pathol. 158: 419-29 [2001]). Briefly, a representative process starts with cutting about 10 μm thick sections of paraffin-embedded tumor tissue samples. The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair and/or amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR. Finally, the data are analyzed to identify the best treatment option(s) available to the patient on the basis of the characteristic gene expression pattern identified in the tumor sample examined.


9. Cancer Chemotherapy


Chemotherapeutic agents used in cancer treatment can be divided into several groups, depending on their mechanism of action. Some chemotherapeutic agents directly damage DNA and RNA. By disrupting replication of the DNA such chemotherapeutics either completely halt replication, or result in the production of nonsense DNA or RNA. This category includes, for example, cisplatin (Platinol®), daunorubicin (Cerubidine®), doxorubicin (Adriamycin®), and etoposide (VePesid®). Another group of cancer chemotherapeutic agents interfere with the formation of nucleotides or deoxyribonucleotides, so that RNA synthesis and cell replication is blocked. Examples of drugs in this class include methotrexate (Abitrexate®), mercaptopurine (Purinethol®), fluorouracil (Adrucil®)), and hydroxyurea (Hydrea®). A third class of chemotherapeutic agents effects the synthesis or breakdown of mitotic spindles, and, as a result, interrupt cell division. Examples of drugs in this class include Vinblastine (Velban®), Vincristine (Oncovin®) and taxenes, such as, Pacitaxel (Taxol®), and Tocetaxel (Taxotere®) Tocetaxel is currently approved in the United States to treat patients with locally advanced or metastatic breast cancer after failure of prior chemotherapy, and patients with locally advanced or metastatic non-small cell lung cancer after failure of prior platinum-based chemotherapy.


A common problem with chemotherapy is the high toxicity of chemotherapeutic agents, such as anthracyclines and taxenes, which limits the clinical benefits of this treatment approach.


Most patients receive chemotherapy immediately following surgical removal of tumor. This approach is commonly referred to as adjuvant therapy. However, chemotherapy can be administered also before surgery, as so called neoadjuvant treatment. Although the use of neo-adjuvant chemotherapy originates from the treatment of advanced and inoperable breast cancer, it has gained acceptance in the treatment of other types of cancers as well. The efficacy of neoadjuvant chemotherapy has been tested in several clinical trials. In the multi-center National Surgical Adjuvant Breast and Bowel Project B-18 (NSAB B-18) trial (Fisher et al., J. Clin. Oncology 15:2002-2004 (1997); Fisher et al., J. Clin. Oncology 16:2672-2685 (1998)) neoadjuvant therapy was performed with a combination of adriamycin and cyclophosphamide (“AC regimen”). In another clinical trial, neoadjuvant therapy was administered using a combination of 5-fluorouracil, epirubicin and cyclophosphamide (“FEC regimen”) (van Der Hage et al., J. Clin. Oncol. 19:4224-4237 (2001)). Newer clinical trials have also used taxane-containing neoadjuvant treatment regiments. See, e.g. Holmes et al., J. Natl. Cancer Inst. 83:1797-1805 (1991) and Moliterni et al., Seminars in Oncology, 24:S17-10-S-17-14 (1999). For further information about neoadjuvant chemotherapy for breast cancer see, Cleator et al., Endocrine-Related Cancer 9:183-195 (2002).


10. Cancer Gene Set, Assayed Gene Subsequences, and Clinical Application of Gene Expression Data


An important aspect of the present invention is to use the measured expression of certain genes by breast cancer tissue to provide prognostic information. For this purpose it is necessary to correct for (normalize away) differences in the amount of RNA assayed, variability in the quality of the RNA used, and other factors, such as machine and operator differences. Therefore, the assay typically measures and incorporates the use of reference RNAs, including those transcribed from well-known housekeeping genes, such as GAPD and ACTB. A precise method for normalizing gene expression data is given in “User Bulletin #2” for the ABI PRISM 7700 Sequence Detection System (Applied Biosystems; 1997). Alternatively, normalization can be based on the mean or median signal (Ct) of all of the assayed genes or a large subset thereof (global normalization approach). In the study described in the following Example, a so called central normalization strategy was used, which utilized a subset of the screened genes, selected based on lack of correlation with clinical outcome, for normalization.


11. Recurrence and Response to Therapy Scores and Their Applications


Copending application Ser. No. 60/486,302, filed on Jul. 10, 2003, describes an algorithm-based prognostic test for determining the likelihood of cancer recurrence and/or the likelihood that a patient responds well to a treatment modality. Features of the algorithm that distinguish it from other cancer prognostic methods include: 1) a unique set of test mRNAs (or the corresponding gene expression products) used to determine recurrence likelihood, 2) certain weights used to combine the expression data into a formula, and 3) thresholds used to divide patients into groups of different levels of risk, such as low, medium, and high risk groups. The algorithm yields a numerical recurrence score (RS) or, if patient response to treatment is assessed, response to therapy score (RTS).


The test requires a laboratory assay to measure the levels of the specified mRNAs or their expression products, but can utilize very small amounts of either fresh tissue, or frozen tissue or fixed, paraffin-embedded tumor biopsy specimens that have already been necessarily collected from patients and archived. Thus, the test can be noninvasive. It is also compatible with several different methods of tumor tissue harvest, for example, via core biopsy or fine needle aspiration.


According to the method, cancer recurrence score (RS) is determined by:

    • (a) subjecting a biological sample comprising cancer cells obtained from said subject to gene or protein expression profiling;
    • (b) quantifying the expression level of multiple individual genes [i.e., levels of mRNAs or proteins] so as to determine an expression value for each gene;
    • (c) creating subsets of the gene expression values, each subset comprising expression values for genes linked by a cancer-related biological function and/or by co-expression;
    • (d) multiplying the expression level of each gene within a subset by a coefficient reflecting its relative contribution to cancer recurrence or response to therapy within said subset and adding the products of multiplication to yield a term for said subset;
    • (e) multiplying the term of each subset by a factor reflecting its contribution to cancer recurrence or response to therapy; and
    • (f) producing the sum of terms for each subset multiplied by said factor to produce a recurrence score (RS) or a response to therapy (RTS) score,
    • wherein the contribution of each subset which does not show a linear correlation with cancer recurrence or response to therapy is included only above a predetermined threshold level, and
    • wherein the subsets in which increased expression of the specified genes reduce risk of cancer recurrence are assigned a negative value, and the subsets in which expression of the specified genes increase risk of cancer recurrence are assigned a positive value.


In a particular embodiment, RS is determined by:

    • (a) determining the expression levels of GRB7, HER2, EstR1, PR, Bcl2, CEGP1, SURV, Ki.67, MYBL2, CCNB1, STK15, CTSL2, STMY3, CD68, GSTM1, and BAG1, or their expression products, in a biological sample containing tumor cells obtained from said subject; and
    • (b) calculating the recurrence score (RS) by the following equation:

      RS=(0.23 to 0.70)×GRB7axisthresh−(0.17 to 0.51)×ERaxis+(0.53 to 1.56)×prolifaxisthresh+(0.07 to 0.21)×invasionaxis+(0.03 to 0.15)×CD68−(0.04 to 0.25)×GSTM1−(0.05 to 0.22)×BAG1

      wherein
    • (i) GRB7 axis=(0.45 to 1.35)×GRB7+(0.05 to 0.15)×HER2;
    • (ii) if GRB7 axis<−2, then GRB7 axis thresh=−2, and if GRB7 axis≧−2, then GRB7 axis thresh=GRB7 axis;
    • (iii) ER axis=(Est1+PR+Bcl2+CEGP1)/4;
    • (iv) prolifaxis=(SURV+Ki.67+MYBL2+CCNB1+STK15)/5;
    • (v) if prolifaxis<−3.5, then prolifaxisthresh=−3.5, if prolifaxis≧−3.5, then prolifaxishresh=prolifaxis; and
    • (vi) invasionaxis=(CTSL2+STMY3)/2,
    • wherein the terms for all individual genes for which ranges are not specifically shown can vary between about 0.5 and 1.5, and wherein a higher RS represents an increased likelihood of cancer recurrence.


Further details of the invention will be described in the following non-limiting Example.


EXAMPLE
A Retrospective Study of Neoadjuvant Chemotherapy in Invasive Breast Cancer: Gene Expression Profiling of Paraffin-Embedded Core Biopsy Tissue

This was a collaborative study involving Genomic Health, Inc., (Redwood City Calif.), and Institute Tumori, Milan, Italy. The primary objective of the study was to explore the correlation between pre-treatment molecular profiles and pathologic complete response (pCR) to neoadjuvant chemotherapy in locally advanced breast cancer.


Patient Inclusion Criteria:


Histologic diagnosis of invasive breast cancer (date of surgery 1998-2002); diagnosis of locally advanced breast cancer defined by skin infiltration and or N2 axillary status and or homolateral supraclavicular positive nodes; core biopsy, neoadjuvant chemotherapy and surgical resection performed at Istituto Nazionale Tumori, Milan; signed informed consent that the biological material obtained for histological diagnosis or diagnostic procedures would be used for research; and histopathologic assessment indicating adequate amounts of tumor tissue for inclusion in this research study.


Exclusion Criteria:


Distant metastases; no tumor block available from initial core biopsy or from the surgical resection; or no tumor or very little tumor (<5% of the overall tissue on the slide) in block as assessed by examination of the H&E slide by the Pathologist.


Study Design


Eighty-nine evaluable patients (from a set of 96 clinically evaluable patients) were identified and studied. The levels of 384 mRNA species were measured by RT-PCR, representing products of candidate cancer-related genes that were selected from the biomedical research literature. Only one gene was lost due to inadequate signal.


Patient characteristics were as follows: Mean age: 50 years; Tumor grades: 24% Well, 55% Moderate, and 21% Poor; Sixty-three % of patients were ER positive {by immunohistochemistry}; Seventy % of patients had positive lymph nodes.


All patients were given primary neoadjuvant chemotherapy: Doxorubicin plus Taxol 3weeks/3 cycles followed by Taxol® (paclitaxel) 1 week/12 cycles. Surgical removal of the tumor followed completion of chemotherapy. Core tumor biopsy specimens were taken prior to start of chemotherapy, and served as the source of RNA for the RT-PCR assay.


Materials and Methods


Fixed paraffin-embedded (FPE) tumor tissue from biopsy was obtained prior to and after chemotherapy. Core biopsies were taken prior to chemotherapy. In that case, the pathologist selected the most representative primary tumor block, and submitted nine 10 micron sections for RNA analysis. Specifically, a total of 9 sections (10 microns in thickness each) were prepared and placed in three Costar Brand Microcentrifuge Tubes (Polypropylene, 1.7 mL tubes, clear; 3 sections in each tube) and pooled.


Messenger RNA was extracted using the MasterPure™ RNA Purification Kit (Epicentre Technologies) and quantified by the RiboGreen® fluorescence method (Molecular probes). Molecular assays of quantitative gene expression were performed by RT-PCR, using the ABI PRISM 7900™ Sequence Detection System™ (Perkin-Elmer-Applied Biosystems, Foster City, Calif., USA). ABI PRISM 7900™ consists of a thermocycler, laser, charge-coupled device (CCD), camera and computer. The system amplifies samples in a 384-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time for all 384 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data.


Analysis and Results


Tumor tissue was analyzed for 384 genes. The threshold cycle (CT) values for each patient were normalized based on the median of a subset of the screened genes for that particular patient, selected based on lack of correlation with clinical outcome (central normalization strategy). Patient beneficial response to chemotherapy was defined as pathologic complete response (pCR). Patients were formally assessed for response at the completion of all chemotherapy.


A clinical complete response (cCR) requires complete disappearance of all clinically detectable disease, either by physical examination or diagnostic breast imaging.


A pathologic complete response (pCR) requires absence of residual breast cancer on histologic examination of biopsied breast tissue, lumpectomy or mastectomy specimens following primary chemotherapy. Residual ductal carcinoma in situ (DCIS) may be present. Residual cancer in regional nodes may not be present. Of the 89 evaluable patients 11 (12%) had a pathologic complete response (pCR). Seven of these patients were ER negative.


A partial clinical response was defined as a ≧50% decrease in tumor area (sum of the products of the longest perpendicular diameters) or a ≧50% decrease in the sum of the products of the longest perpendicular diameters of multiple lesions in the breast and axilla. No area of disease may increase by >25% and no new lesions may appear.


Analysis was performed by comparing the relationship between normalized gene expression and the binary outcomes of pCR or no pCR. Univariate generalized models were used with probit or logit link functions. See, e.g. Van K. Borooah, LOGIT and PROBIT, Ordered Multinominal Models, Sage University Paper, 2002.


Table 1 presents pathologic response correlations with gene expression, and lists the 86 genes for which the p-value for the differences between the groups was <0.1. The second column (with the heading “Direction”) denotes whether increased expression correlates with decreasing or increasing likelihood of response to chemotherapy. The statistical significance of the predictive value for each gene is given by P-value (right hand column)

Probit LinkGeneDirectionInterceptSlopeP-valueTBPDecreasing0.05752.43540.0000ILT.2Increasing0.5273−0.94890.0003ABCC5Decreasing0.98720.81810.0003CD18Increasing3.4735−1.07870.0007GATA3Decreasing0.61750.29750.0008DICER1Decreasing−0.91491.48750.0013MSH3Decreasing2.68750.92700.0013GBP1Increasing1.7649−0.54100.0014IRS1Decreasing1.35760.52140.0016CD3zIncreasing0.1567−0.51620.0018FaslIncreasing−0.6351−0.40500.0019TUBBDecreasing1.27450.82670.0025BADDecreasing0.99931.13250.0033ERCC1Decreasing0.03271.07840.0039MCM6Increasing0.1371−0.80080.0052PRDecreasing1.60790.17640.0054APCDecreasing0.72641.09720.0061GGPS1Decreasing1.09060.81240.0062KRT18Decreasing−0.80290.45060.0063ESRRGDecreasing2.01980.22620.0063E2F1Increasing0.2188−0.52770.0068AKT2Decreasing−1.35661.19020.0074A. CateninDecreasing−0.68590.92790.0079CEGP1Decreasing1.33550.18750.0091NPD009Decreasing1.39960.29710.0092MAPK14Decreasing2.62531.60070.0093RUNX1Decreasing−0.41380.72140.0103ID2Increasing1.7326−0.70320.0104G. CateninDecreasing−0.12210.59540.0110FBXO5Increasing0.3421−0.49350.0110FHITDecreasing1.99660.49890.0113MTA1Decreasing0.31270.60690.0133ERBB4Decreasing1.45910.14360.0135FUSDecreasing−0.61500.94150.0137BBC3Decreasing2.47960.64950.0138IGE1RDecreasing1.19980.31160.0147CD9Decreasing−0.92920.57470.0156TP53BP1Decreasing1.43250.81220.0169MUC1Decreasing0.88810.21400.0175IGFBP5Decreasing−0.61800.48800.0181rhoCDecreasing−0.17260.68600.0184RALBP1Decreasing0.23830.95090.0185CDC20Increasing1.3204−0.43900.0186STAT3Decreasing−0.97630.70230.0194ERK1Decreasing0.85770.64960.0198HLA.DPB1Increasing3.6300−0.60350.0202SGCBDecreasing0.61710.78230.0208CGAIncreasing0.0168−0.14500.0209DHPSDecreasing0.29570.78400.0216MGMTDecreasing0.92380.68760.0226CRIP2Decreasing0.55240.43940.0230MMP12Increasing0.4208−0.24190.0231ErbB3Decreasing0.94380.27980.0233RAP1GDS1Decreasing0.26170.76720.0235CDC25BIncreasing1.6965−0.53560.0264IL6Increasing0.0592−0.23880.0272CCND1Decreasing0.22600.29920.0272CYBAIncreasing2.6493−0.51750.0287PRKCDDecreasing0.21250.67450.0291DR4Increasing0.3039−0.53210.0316HepsinDecreasing1.92110.18730.0318CRABP1Increasing1.0309−0.12870.0320AK055699Decreasing2.04420.17650.0343Contig.51037Increasing0.7857−0.11310.0346VCAM1Increasing1.1866−0.35600.0346FYNIncreasing1.5502−0.56240.0359GRB7Increasing1.3592−0.16460.0375AKAP.2Increasing1.7946−0.70080.0382RASSF1Increasing1.1972−0.03900.0384MCP1Increasing1.3700−0.38050.0388ZNF38Decreasing1.79570.49930.0395MCM2Increasing1.0574−0.46950.0426GBP2Increasing1.4095−0.45590.0439SEMA3FDecreasing1.27060.37250.0455CD31Increasing1.9913−0.59550.0459COL1A1Decreasing−1.98610.38120.0466ER2Increasing−0.5204−0.26170.0471BAG1Decreasing0.67310.50700.0472AKT1Decreasing−0.44670.57680.0480COL1A2Decreasing−1.02330.38040.0490STAT1Increasing1.9447−0.40620.0498Wnt.5aDecreasing2.22440.29830.0518PTPD1Decreasing1.29500.48340.0552RAB6CDecreasing0.48410.56350.0717TK1Increasing0.6127−0.36250.0886Bcl2Decreasing1.14590.25090.0959


Based on the data set forth in Table 1, increased expression of the following genes correlates with increased likelihood of complete pathologic response to treatment: ILT.2; CD18; GBP1; CD3z; fas1; MCM6; E2F1; ID2; FBXO5; CDC20; HLA.DPB1; CGA; MMP12; CDC25B; IL6; CYBA; DR4; CRABP1; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; MCM2; GBP2; CD31; ER2; STAT1; TK1; while increased expression of the following genes correlates with decreased likelihood of complete pathologic response to treatment: TBP; ABCC5; GATA3; DICER1; MSH3; IRS1; TUBB; BAD; ERCC1; PR; APC; GGPS1; KRT18; ESRRG; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; G.Catenin; FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C; Bcl2.


The relationship between the recurrence risk algorithm (described in copending U.S. application Ser. No. 60/486,302) and pCR was also investigated. The algorithm incorporates the measured levels of 21 mRNA species. Sixteen mRNAs (named below) were candidate clinical markers and the remaining 5 (ACTB, GAPD, GUSB, RPLPO, and TFRC) were reference genes. Reference-normalized expression measurements range from 0 to 15, where a one unit increase reflects a 2-fold increase in RNA.


The Recurrence Score (RS) is calculated from the quantitative expression of four sets of marker genes (an estrogen receptor group of 4 genes—ESR1, PGR, BCL2, and SCUBE2; a proliferation set of 5 genes—MKI67, MYBL2, BIRC5, CCNB1, and STK6; a HER2 set of 2 genes—ERBB2 and GRB7, an invasion group of 2 genes—MMP11 and CTSL2) and 3 other individual genes—GSTM1, BAG1, and CD68.


Although the genes and the multiplication factors used in the equation may vary, in a typical embodiment, the following equation may be used to calculate RS:
RS(range,0-100)=+0.47×HER2GroupScore-0.34×ERGroupScore+1.04×ProliferationGroupScore+0.10×InvasionGroupScore+0.05×CD68-0.08×GSTM1-0.07×BAG1


Application of this algorithm to study clinical and gene expression data sets yields a continuous curve relating RS to pCR values, as shown in FIG. 1. Examination of these data shows that patients with RS>50 are in the upper 50 percentile of patients in terms of likelihood of response to chemotherapy, and that patients with RS<35 are in the lower 50 percentile of patients in terms of likelihood of response to chemotherapy.


All references cited throughout the disclosure are hereby expressly incorporated by reference.


While the invention has been described with emphasis upon certain specific embodiments, it is be apparent to those skilled in the art that variations and modification in the specific methods and techniques are possible. Accordingly, this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the following claims.

TABLE 2A-CateninNM_00190S2138/A-Cate.f2CGTTCCGATCCTCTATACTGCAT23A-CateninNM_00190S2139/A-Cate.r2AGGTCCCTGTTGGCCTTATAGG22A-CateninNM_00190S4725/A-Cate.p2ATGCGTACAGCACCCTGATGTCGCA25ABCC5NM_00568S5605/ABCC5.f1TGCAGACTGTACCATGCTGA20ABCC5NM_00568S5606/ABCC5.r1GGCCAGCACCATAATCCTATA20BCC5NM_00568S5607/ABCC5.p1CTGCACACGGTTCTAGGCTCCG22AK055699AK055699S2097/AK0556.f1CTGCATGTGATTGAATAAGAAACAAGA27AK055699AK055699S2098/AK0556.r1TGTGGACCTGATCCCTGTACAC22AK055699AK055699S5057/AK0556.p1TGACCACACCAAAGCCTCCCTGG23AKAP-2NM_00720S1374/AKAP-2.f1ACGAATTGTCGGTGAGGTCT20AKAP-2NM_00720S1375/AKAP-2.r1GTCCATGCTGAAATCATTG20AKAP-2NM_00720S4934/AKAP-2.p1CAGGATACCACAGTCCTGGAGACCC25AKT1NM_00516S0010/AKT1.f3CGCTTCTATGGCGCTGAGAT20AKT1NM_00516S0012/AKT1.r3TCCCGGTACACCACGTTCTT20AKT1NM_00516S4776/AKT1.p3CAGCCCTGGACTACCTGCACTCGG24AKT2NM_00162S0828/AKT2.f3TCCTGCCACCCTTCAAACC19AKT2NM_00162S0829/AKT2.r3GGCGGTAAATTCATCATCGAA21AKT2NM_00162S4727/AKT2.p3CAGGTCACGTCCGAGGTCGACACA24APCNM_00003S0022/APC.f4GGACAGCAGGAATGTGTTTC20APCNM_00003S0024/APC.r4ACCCACTCGATTTGTTTCTG20APCNM_00003S4888/APC.p4CATTGGCTCCCCGTGACCTGTA22BADNM_03298S2011/BAD.f1GGGTCAGGTGCCTCGAGAT19BADNM_03298S2012/BAD.r1CTGCTCACTCGGCTCAAACTC21BADNM_03298S5058/BAD.p1TGGGCCCAGAGCATGTTCCAGATC24BAG1NM_00432S1386/BAG1.f2CGTTGTCAGCACTTGGAATACAA23BAG1NM_00432S1387/BAG1.r2GTTCAACCTCTTCCTGTGGACTGT24BAG1NM_00432S4731/BAG1.p2CCCAATTAACATGACCCGGCAACCAT26BBC3NM_01441S1584/BBC3.f2CCTGGAGGGTCCTGTACAAT20BBC3NM_01441S1585/BBC3.r2CTAATTGGGCTCCATCTCG19BBC3NM_01441S4890/BBC3.p2CATCATGGGACTCCTGCCCTTACC24Bcl2NM_00063S0043/Bcl2.f2CAGATGGACCTAGTACCCACTGAGA25Bcl2NM_00063S0045/Bcl2.r2CCTATGATTTAAGGGCATTTTTCC24Bcl2NM_00063S4732/Bcl2.p2TTCCACGCCGAAGGACAGCGAT22CCND1NM_00175S0058/CCND1.f3GCATGTTCGTGGCCTCTAAGA21CCND1NM_00175S0060/CCND1.r3CGGTGTAGATGCACAGCTTCTC22CCND1NM_00175S4986/CCND1.p3AAGGAGACCATCCCCCTGACGGC23CD18NM_00021S0061/GD18.f2CGTCAGGACCCACCATGTCT20CD18NM_00021S0063/CD18.r2GGTTAATTGGTGACATCCTCAAGA24CD18NM_00021S4987/CD18.p2CGCGGCCGAGACATGGCTTG20CD31NM_00044S1407/CD31.f3TGTATTTCAAGACCTCTGTGCACTT25CD31NM_00044S1408/CD31.r3TTAGCCTGAGGAATTGCTGTGTT23CD31NM_00044S4939/CD31.p3TTTATGAACCTGCCCTGCTCCCACA25CD3zNM_00073S0064/CD3z.f1AGATGAAGTGGAAGGCGCTT20CD3zNM_00073S0066/CD3z.r1TGCCTCTGTAATCGGCAACTG21CD3zNM_00073S4988/CD3z.p1CACCGCGGCCATCGTGCA18CD9NM_00176S0686/CD9.f1GGGCGTGGAACAGTTTATCT20CD9NM_00176S0687/CD9.r1CACGGTGAAGGTTTCGAGT19CD9NM_00176S4792/CD9.p1AGACATCTGCCCCAAGAAGGACGT24CDC20NM_00125S4447/CDC20.f1TGGATTGGAGTTCTGGGAATG21CDC20NM_00125S4448/CDC20.r1GCTTGCACTCCACAGGTACACA22CDC20NM_00125S4449/CDC20.p1ACTGGCCGTGGCACTGGACAACA23CDC25BNM_02187S1160/CDC25B.f1AAACGAGCAGTTTGCCATCAG21CDC25BNM_02187S1161/CDC25B.r1GTTGGTGATGTTCCGAAGCA20CDC25BNM_02187S48421CDC25B.p1CCTCACCGGCATAGACTGGAAGCG24CEGP1NM_02097S1494/CEGP1.f2TGACAATCAGCACACCTGCAT21CEGP1NM_02097S1495/CEGP1.r2TGTGACTACAGCCGTGATCCTTA23CEGP1NM_02097S4735/CEGP1.p2CAGGCCCTCTTCCGAGCGGT20CGA (CHGNM_00127S3221/CGA (C.f3CTGAAGGAGCTCCAAGACCT20CGA (CHGNM_00127S3222/CGA (C.r3CAAAACCGCTGTGTTTCTTC20CGA (CHGNM_00127S3254/CGA (C.p3TGCTGATGTGCCCTCTCCTTGG22COL1A1NM_00008S4531/COL1A1.f1GTGGCCATCCAGCTGACC18COL1A1NM_00008S4532/COL1A1.r1CAGTGGTAGGTGATGTTCTGGGA23COL1A1NM_00008S4533/COL1A1.p1TCCTGCGCCTGATGTCCACCG21COL1A2NM_00008S4534/COL1A2.f1CAGCCAAGAACTGGTATAGGAGCT24COL1A2NM_00008S4535/COL1A2.r1AAACTGGCTGCCAGCATTG19COL1A2NM_00008S4536/COL1A2.p1TCTCCTAGCCAGACGTGTTTCTTGTCCTTG30Contig 510XM_05894S2070/Contig.f1CGACAGTTGCGATGAAAGTTCTAA24Contig 510XM_05894S2071/Contig.r1GGCTGCTAGAGACCATGGACAT22Contig 510XM_05894S5059/Contig.p1CCTCCTCCTGTTGCTGCCACTAATGCT27CRABP1NM_00437S5441/CRABP1.f3AACTTCAAGGTCGGAGAAGG20CRABP1NM_00437S5442/CRABP1.r3TGGCTAAACTCCTGCACTTG20CRABP1NM_00437S5443/CRABP1.p3CCGTCCACGGTCTCCTCCTCA21CRIP2NM_00131S5676/CRIP2.f3GTGCTACGCCACCCTGTT18CRIP2NM_00131S5677/CRIP2.r3CAGGGGCTTCTCGTAGATGT20CRIP2NM_00131S5678/CRIP2.p3CCGATGTTCACGCCTTTGGGTC22CYBANM_00010S5300/CYBA.f1GGTGCCTACTCCATTGTGG19CYBANM_00010S5301/CYBA.r1GTGGAGCCCTTCTTCCTCTT20CYBANM_00010S5302/CYBA.p1TACTCCAGCAGGCACACAAACACG24DHPSNM_01340S4519/DHPS.f3GGGAGAACGGGATCAATAGGAT22DHPSNM_01340S4520/DHPS.r3GCATCAGCCAGTCCTCAAACT21DHPSNM_01340S4521/DHPS.p3CTCATTGGGCACCAGCAGGTTTCC24DICER1NM_17743S5294/DICER1.f2TCCAATTCCAGCATCACTGT20DICER1NM_17743S5295/DICER1.r2GGCAGTGAAGGCGATAAAGT20DICER1NM_17743S5296/DICER1.p2AGAAAAGCTGTTTGTCTCCCCAGCA25DR4NM_00384S2532/DR4.f2TGCACAGAGGGTGTGGGTTAC21DR4NM_00384S2533/DR4.r2TCTTCATCTGATTTACAAAGCTGTACATG28DR4NM_00384S4981/DR4.p2CAATGCTTCCAACAATTTGTTTGCTTGCC29E2F1NM_00522S3063/E2F1.f3ACTCCCTCTACCCTTGAGCA20E2F1NM_00522S3064/E2F1.r3CAGGCCTCAGTTCCTTCAGT20E2F1NM_00522S4821/E2F1.p3CAGAAGAACAGCTCAGGGACCCCT24ER2NM_00143S0109/ER2.f2TGGTCCATCGCCAGTTATCA20ER2NM_00143S0111/ER2.r2TGTTCTAGCGATCTTGCTTCACA23ER2NM_00143S5001/ER2.p2ATCTGTATGCGGAACCTCAAAAGAGTCCCT30ErbB3NM_00198S0112/ErbB3.f1CGGTTATGTCATGCCAGATACAC23ErbB3NM_00198S0114/ErbB3.r1GAACTGAGACCCACTGAAGAAAGG24ErbB3NM_00198S5002/ErbB3.p1CCTCPAAGGTACTCCCTCCTCCCGG25ERBB4NM_00523S1231/ERBB4.f3TGGCTCTTAATCAGTTTCGTTACCT25ERBB4NM_00523S1232/ERBB4.r3CAAGGCATATCGATCCTCATAAAGT25ERBB4NM_00523S4891/ERBB4.p3TGTCCCACGAATAATGCGTAAATTCTCCAG30ERCC1NM_00198S2437/ERCC1.f2GTCCAGGTGGATGTGAAAGA20ERCC1NM_00198S2438/ERCC1.r2CGGCCAGGATACACATCTTA20ERCC1NM_00198S4920/ERCC1.p2CAGCAGGCCCTCAAGGAGCTG21ERK1Z11696S1560/ERK1.f3ACGGATCACAGTGGAGGAAG20ERK1Z11696S1561/ERK1.r3CTCATCCGTCGGGTCATAGT20ERK1Z11696S4882/ERK1.p3CGCTGGCTCACCCCTACCTG20ESRRGNM_00143S6130/ESRRG.f3CCAGCACCATTGTTGAAGAT20ESRRGNM_00143S6131/ESRRG.r3AGTCTCTTGGGCATCGAGTT20ESRRGNM_00143S6132/ESRRG.p3CCCCAGACCAAGTGTGAATACATGCT26faslNM_00063S0121/fasl.f2GCACTTTGGGATTCTTTCCATTAT24faslNM_00063S0123/fasl.r2GCATGTAAGAAGACCCTCACTGAA24faslNM_00063S5004/fasl.p2ACAACATTCTCGGTGCCTGTAACAAAGAA29FBXO5NM_01217S2017/FBXO5.r1GGATTGTAGACTGTCACCGAAATTC25FBXO5NM_01217S2018/FBXO5.f1GGCTATTCCTCATTTTCTCTACAAAGTGFBXO5NM_01217S5061/FBXO5.p1CCTCCAGGAGGCTACCTTCTTCATGTTCAC30FHITNM_00201S2443/FHIT.f1CCAGTGGAGCGCTTCCAT18FHITNM_00201S2444/FHIT.r1CTCTCTGGGTCGTCTGAAACAA22FHITNM_00201S4921/FHIT.p1TCGGCCACTTCATCAGGACGCAG23FUSNM_00496S2936/FUS.f1GGATAATTCAGACAACPACACCATCT26FUSNM_00496S2937/FUS.r1TGAAGTAATCAGCCACAGACTCAAT25FUSNM_00496S4801/FUS.p1TCAATTGTAACATTCTCACCCAGGCCTTG29FYNNM_00203S5695/FYN.f3GAAGCGCAGATCATGAAGAA20FYNNM_00203S5696/FYN.r3CTCCTCAGACACCACTGCAT20FYNNM_00203S5697/FYN.p3CTGAAGCACGACAAGCTGGTCCAG24G-CateninNM_00223S2153/G-Cate.f1TCAGCAGCAAGGGCATCAT19G-CateninNM_00223S2154/G-Cate.r1GGTGGTTTTCTTGAGCGTGTACT23G-CateninNM_00223S5044/G-Cate.p1CGCCCGCAGGCCTCATCCT19GATA3NM_00205S0127/GATA3.f3CAAAGGAGCTCACTGTGGTGTCT23GATA3NM_00205S0129/GATA3.r3GAGTCAGAATGGCTTATTCACAGATG26GATA3NM_00205S5005/GATA3.p3TGTTCCAACCACTGAATCTGGACC24GBP1NM_00205S5698/GBP1.f1TTGGGAAATATTTGGGCATT20GBP1NM_00205S5699/GBP1.r1AGAAGCTAGGGTGGTTGTCC20GBP1NM_00205S5700/GBP1.p1TTGGGACATTGTAGACTTGGCCAGAC26GBP2NM_00412S5707/GBP2.f2GCATGGGAACCATCAACCA19GBP2NM_00412S5708/GBP2.r2TGAGGAGTTTGCCTTGATTCG21GBP2NM_00412S5709/GBP2.p2CCATGGACCAACTTCACTATGTGACAGAGC30GGPS1NM_00483S1590/GGPS1.f1CTCCGACGTGGCTTTCCA18GGPS1NM_00483S1591/GGPS1.r1CGTAATTGGCAGAATTGATGACA23GGPS1NM_00483S4896/GGPS1.p1TGGCCCACAGCATCTATGGAATCCC25GRB7NM_00531S0130/GRB7.f2CCATCTGCATCCATCTTGTT20GRB7NM_00531S0132IGRB7.r2GGCCACCAGGGTATTATCTG20GRB7NM_00531S4726/GRB7.p2CTCCCCACCCTTGAGAAGTGCCT23HepsinNM_00215S2269/Hepsin.f1AGGCTGCTGGAGGTCATCTC20HepsinNM_00215S2270/Hepsin.r1CTTCCTGCGGCCACAGTCT19HepsinNM_00215S2271/Hepsin.p1CCAGAGGCCGTTTCTTGGCCG21HLA-DPB1NM_00212S4573/HLA-DP.f1TCCATGATGGTTCTGCAGGTT21HLA-DPB1NM_00212S4574/HLA-DP.r1TGAGCAGCACCATCAGTAACG21HLA-DPB1NM_00212S4575/HLA-DP.p1CCCCGGACAGTGGCTCTGACG21ID2NM_00216S0151/1D2.f4AACGACTGCTACTCCAAGCTCAA23ID2NM_00216S0153/1D2.r4GGATTTCCATCTTGCTCACCTT22ID2NM_00216SS009/1D2.p4TGCCCAGCATCCCCCAGAACAA22IGF1RNM_00087S1249/IGF1R.f3GCATGGTAGCCGAAGATTTCA21IGF1RNM_00087S1250/IGF1R.r3TTTCCGGTAATAGTCTGTCTCATAGATATC30IGF1RNM_00087S4895/IGF1R.p3CGCGTCATACCAAAATCTCCGATTTTGA28IL6NM_00060S0760/IL6.f3CCTGAACCTTCCAAAGATGG20IL6NM_00060S0761/IL6.r3ACCAGGCAAGTCTCCTCATT20IL6NM_00060S4800/IL6.p3CCAGATTGGAAGCATCCATCTTTTTCA27ILT-2NM_00666S1611/ILT-2.f2AGCCATCACTCTCAGTGCAG20ILT-2NM_00666S1612/ILT-2.r2ACTGCAGAGTCAGGGTCTCC20ILT-2NM_00666S4904/ILT-2.p2CAGGTCCTATCGTGGCCCCTGA22IRS1NM_00554S1943/IRS1.f3CCACAGCTCACCTTCTGTCA20IRS1NM_00554S1944/IRS1.r3CCTCAGTGCCAGTCTCTTCC20IRS1NM_00554S5050/IRS1.p3TCCATCCCAGCTCCAGCCAG20KRT18NM_00022S1710/KRT18.f2AGAGATCGAGGCTCTCAAGG20KRT18NM_00022S1711/KRT18.r2GGCCTTTTACTTCCTCTTCG20KRT18NM_00022S4762/KRT18.p2TGGTTCTTCTTCATGAAGAGCAGCTCC27MAPK14NM_13901S5557/MAPK14.f2TGAGTGGAAAAGCCTGACCTATG23MAPK14NM_13901S5558/MAPK14.r2GGACTCCATCTCTTCTTGGTCAA23MAPK14NM_13901S5559/MAPK14.p2TGAAGTCATCAGCTTTGTGCCACCACC27MCM2NM_00452S1602/MCM2.f2GACTTTTGCCCGCTACCTTTC21MCM2NM_00452S1603/MCM2.r2GCCACTAACTGCTTCAGTATGAAGAG26MCM2NM_00452S4900/MCM2.p2ACAGCTCATTGTTGTCACGCCGGA24MCM6NM_00591S1704/MCM6.f3TGATGGTCCTATGTGTCACATTCA24MCM6NM_00591S1705/MCM6.r3TGGGACAGGAAACACACCAA20MCM6NM_00591S4919/MCM6.p3CAGGTTTCATACCAACACAGGCTTCAGCAC30MCP1NM_00298S1955/MCP1.f1CGCTCAGCCAGATGCAATC19MCP1NM_00298S1956/MCP1.r1GCACTGAGATCTTCCTATTGGTGAA25MCP1NM_00298S5052/MCP1.p1TGCCCCAGTCACCTGCTGTTA21MGMTNM_00241S1922/MGMT.f1GTGAAATGAAACGCACCACA20MGMTNM_00241S1923/MGMT.r1GACCCTGCTCACAACCAGAC20MGMTNM_00241S5045/MGMT.p1CAGCCCTTTGGGGAAGCTGG20MMP12NM_00242S4381/MMP12.f2CCAACGCTTGCCAAATCCT19MMP12NM_00242S4382/MMP12.r2ACGGTAGTGACAGCATCAAAACTC24MMP12NM_00242S4383/MMP12.p2AACCAGCTCTCTGTGACCCCAATT24MSH3NM_00243S5940/MSH3.f2TGATTACCATCATGGCTCAGA21MSH3NM_00243S5941/MSH3.r2CTTGTGAAAATGCCATCCAC20MSH3NM_00243S5942/MSH3.p2TCCCAATTGTCGCTTCTTCTGCAG24MTA1NM_00468S2369/MTA1.f1CCGCCCTCACCTGAAGAGA19MTA1NM_00468S2370/MTA1.r1GGAATAAGTTAGCCGCGCTTCT22MTA1NM_00468S4855/MTA1.p1CCCAGTGTCCGCCAAGGAGCG21MUC1NM_00245S0782/MUC1.f2GGCCAGGATCTGTGGTGGTA20MUC1NM_00245S0783/MUC1.r2CTCCACGTCGTGGACATTGA20MUC1NM_00245S4807/MUC1.p2CTCTGGCCTTCCGAGAAGGTACC23NPD009 (ANM_02068S4474/NPD009.f3GGCTGTGGCTGAGGCTGTAG20NPD009 (ANM_02068S4475/NPD009.r3GGAGCATTCGAGGTCAAATCA21NPD009 (ANM_02068S4476/NPD009.p3TTCCCAGAGTGTCTCACCTCCAGCAGAG28PRNM_00092S1336/PR.f6GCATCAGGCTGTCATTATGG20PRNM_00092S1337/PR.r6AGTAGTTGTGCTGCCCTTCC20PRNM_00092S4743/PR.p6TGTCCTTACCTGTGGGAGCTGTAAGGTC28PRKCDNM_00625S1738/PRKCD.f2CTGACACTTGCCGCAGAGAA20PRKCDNM_00625S1739/PRKCD.r2AGGTGGTCCTTGGTCTGGAA20PRKCDNM_00625S4923/PRKCD.p2CCCTTTCTCACCCACCTCATCTGCAC26PTPD1NM_00703S3069/PTPD1.f2CGCTTGCCTAACTCATACTTTCC23PTPD1NM_00703S3070/PTPD1.r2CCATTCAGACTGCGCCACTT20PTPD1NM_00703S4822/PTPD1.p2TCCACGCAGCGTGGCACTG19RAB6CNM_03214S5535/RAB6C.f1GCGACAGCTCCTCTAGTTCCA21RAB6CNM_03214S5537/RAB6C.p1TTCCCGAAGTCTCCGCCCG19RAB6CNM_03214S5538/RAB6C.r1GGAACACCAGCTTGAATTTCCT22RALBP1NM_00678S5853/RALBP1.f1GGTGTCAGATATAAATGTGCAAATGC26RALBP1NM_00678S5854/RALBP1.r1TTCGATATTGCCAGCAGCTATTAA24RALBP1NM_00678S5855/RALBP1.p1TGCTGTCCTGTCGGTCTCATTACGTCA28RAP1GDSNM_02115S5306/RAP1GD.f2TGTGGATGCTGGATTGATTT20RAP1GDSNM_02115S5307/RAP1GD.r2AAGCAGCACTTCCTGGTCTT20RAP1GDSNM_02115S5308/RAP1GD.p2CCACTGGTGCAGCTGCTAAATAGCA25RASSF1NM_00718S2393/RASSF1.f3AGTGGGAGACACCTGACCTT20RASSF1NM_00718S2394/RASSE1.r3TGATCTGGGCATTGTACTCC20RASSF1NM_00718S4909/RASSF1.p3TTGATCTTCTGCTCAATCTCAGCTTGAGA29rhoCNM_00516S2162/rhoC.f1CCCGTTCGGTCTGAGGAA18rhoCNM_00516S2163/rhoC.r1GAGCACTCAAGGTAGCCAAAGG22rhoCNM_00516S5042/rhoC.p1TCCGGTTCGCCATGTCCCG19RUNX1NM_00175S4588/RUNX1.f2AACAGAGACATTGCCAACCA20RUNX1NM_00175S4589/RUNX1.r2GTGATTTGCCCAGGAAGTTT20RUNX1NM_00175S4590/RUNX1.p2TTGGATCTGCTTGCTGTCCAAACC24SEMA3FNM_00418S2857/SEMA3F.f3CGCGAGCCCCTCATTATACA20SEMA3FNM_00418S2858/SEMA3F.r3CACTCGCCGTTGACATCCT19SEMA3FNM_00418S4972/SEMA3F.p3CTCCCCACAGCGCATCGAGGAA22SGCBNM_00023S5752/SGCB.f1CAGTGGAGACCAGTTGGGTAGTG23SGCBNM_00023S5753/SGCB.r1CCTTGAAGAGCGTCCCATCA20SGCBNM_00023S5754/SGCB.p1CACACATGCAGAGCTTGTAGCGTACCCA28STAT1NM_00731S1542/STAT1.f3GGGCTCAGCTTTCAGAAGTG20STAT1NM_00731S1543/STAT1.r3ACATGTTCAGCTGGTCCACA20STAT1NM_00731S4878/STAT1.p3TGGCAGTTTTCTTCTGTCACCAAAA25STAT3NM_00315S1545/STAT3.f1TCACATGCCACTTTGGTGTT20STAT3NM_00315S1546/STAT3.r1CTTGCAGGAAGCGGCTATAC20STAT3NM_00315S4881/STAT3.p1TCCTGGGAGAGATTGACCAGCA22TBPNM_00319S0262/TBP.f1GCCCGAAACGCCGAATATA19TBPNM 00319S0264/TBP.r1CGTGGCTCTCTTATCCTCATGAT23TBPNM_00319S4751/TBP.p1TACCGCAGCAACCGCTTGGG21TK1NM_00325S0866/TK1.f2GCCGGGAAGACCGTAATTGT20TK1NM_00325S0927/TK1.r2CAGCGGCACCAGGTTCAG18TK1NM_00325S4798/TK1.p2CAAATGGCTTCCTCTGGAAGGTCCCA26TP53BP1NM_00565S1747/TP53BP.f2TGCTGTTGCTGAGTCTGTTG20TP53BP1NM_00565S1748/TP53BP.r2CTTGCCTGGCTTCACAGATA20TP53BP1NM_00565S4924/TP53BP.p2CCAGTCCCCAGAAGACCATGTCTG24TUBBNM_00106S5826/TUBB.f3TGTGGTGAGGAAGGAGTCAG20TUBBNM_00106S5827/TUBB.r3CCCAGAGAGTGGGTCAGC18TUBBNM_00106SS828/TUBB.p3CTGTGACTGTCTCCAGGGCTTCCA24VCAM1NM_00107S3505/VCAM1.f1TGGCTTCAGGAGCTGAATACC21VCAM1NM_00107S3506/VCAM1.r1TGCTGTCGTGATGAGAAAATAGTG24VCAM1NM_00107S3507/VCAM1.p1CAGGCACACACAGGTGGGACACATAT26Wnt-5aNM_00339S6183/Wnt-5a.f1GTATCAGGACCACATGCAGTACATC25Wnt-5aNM_00339S6184/Wnt-5a.r1TGTCGGAATTGATACTGGCATT22Wnt-5aNM_00339S618S/Wnt-5a.p1TTGATGCCTGTCTTCGCGCCTTCT24ZNF38NM_14591S5593/ZNF38.f3TTTCCAAACATCAGCGAGTC20ZNF38NM_14591S5594/ZNF38.r3AACAGGAGCGCTTGAAAGTT20ZNF38NM_1459155595/ZNF38.p3ACGGTGCTTCTCCCTCTCCAGTG23









TABLE 3








Sequence


















A-Catenin
NM_00190
CGTTCCGATCCTCTATACTGCATCCCAGGCATGCCTACAGCACCCTGATGTCGCAGCCTATAAGGCCAACAGGGACCT






ABCC5
NM_00568
TGCAGACTGTACCATGCTGACCATTGCCCATCGCCTGCACACGGTTCTAGGCTCCGATAGGATTATGGTGCTGGCC





AK055699
AK055699
CTGCATGTGATTGAATAAGAAACAAGAAAGTGACCACACCAAAGCCTCCCTGGCTGGTGTACAGGGATCAGGTCACA





AKAP-2
NM_00720
ACGAATTGTCGGTGAGGTCTCAGGATACCACAGTCCTGGAGACCCTATCCAATGATTTCAGCATGGAC





AKT1
NM_00516
CGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGA





AKT2
NM_00162
TCCTGCCACCCTTCAAACCTCAGGTCACGTCCGAGGTCGACACAAGGTACTTCGATGATGAATTTACCGCC





APC
NM_00003
GGACAGCAGGAATGTGTTTCTCCATACAGGTCACGGGGAGCCAATGGTTCAGAAACAAATCGAGTGGGT





BAD
NM_03298
GGGTCAGGTGCCTCGAGATCGGGCTTGGGCCCAGAGCATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAG





BAG1
NM_00432
CGTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTCCACAGGAAGAGGTTGAAC





BBC3
NM_01441
CCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG





Bcl2
NM_00063
CAGATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGG





CCND1
NM_00175
GCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCG





CD18
NM_00021
CGTCAGGACCCACCATGTCTGCCCCATCACGCGGCCGAGACATGGCTTGGCCACAGCTCTTGAGGATGTCACCAATTAALCC





CD31
NM_00044
TGTATTTCAAGACCTCTGTGCACTTATTTATGAACCTGCCCTGCTCCCACAGAACACAGCAATTCCTCAGGCTAA





CD3z
NM_00073
AGATGAAGTGGAAGGCGCTTTTCACCGCGGCCATCCTGCAGGCACAGTTGCCGATTACAGAGGCA





CD9
NM_00176
GGGCGTGGAACAGTTTATCTCAGACATCTGCCCCAAGAAGGACGTACTCGAAACCTTCACCGTG





CDC20
NM_00125
TGGATTGGAGTTCTGGGAATGTACTGGCCGTGGCACTGGACAACAGTGTGTACCTGTGGAGTGCAAGC





CDC25B
NM_02187
AAACGAGCAGTTTGCCATCAGACGCTTCCAGTCTATGCCGGTGAGGCTGCTGGGCCACAGCCCCGTGCTTCGGAACATCACCA




AC





CEGP1
NM_02097
TGACAATCAGCACACCTGCATTCACCGCTCGGAAGAGGGCCTGAGCTGCATGAATAAGGATCACGGCTGTAGTCACA





CGA (CHG
NM_00127
CTGAAGGAGCTCCAAGACCTCGCTCTCCAAGGCGCCAAGGAGAGGGCACATCAGCAGAAGAAACACAGCGGTTTTG





COL1A1
NM_00008
GTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCCAGAACATCACCTACCACTG





COL1A2
NM_00008
CAGCCAAGAACTGGTATAGGAGCTCCAAGGACAAGAAACACGTCTGGCTAGGAGAAACTATCAATGCTGGCAGCCAGTTT





Contig 510
XM_05894
CGACAGTTGCGATGAAAGTTCTAATCTCTTCCCTCCTCCTGTTGCTGCCACTAATGCTGATGTCCATGGTCTCTAGCAGCC





CRABP1
NM_00437
AACTTCAAGGTCGGAGAAGGCTTTGAGGAGGAGACCGTGGACGGACGCAAGTGCAGGAGTTTAGCCA





CRIP2
NM_00131
GTGCTACGCCACCCTGTTCGGACCCAAAGGCGTGAACATCGGGGGCGCGGGCTCCTACATCTACGAGAAGCCCCTG





CYBA
NM_00010
GGTGCCTACTCCATTGTGGCGGGCGTGTTTGTGTGCCTGCTGGAGTACCCCCGGGGGAAGAGGAAGAAGGGCTCCAC





DHPS
NM_01340
GGGAGAACGGGATCAATAGGATCGGAAACCTGCTGGTGCCCAATGAGAATTACTGCAAGTTTGAGGACTGGCTGATGC





DICER1
NM_17743
TCCAATTCCAGCATCACTGTGGAGAAAAGCTGTTTGTCTCCCCAGCATACTTTATCGCCTTCACTGCC





DR4
NM_00384
TGCACAGAGGGTGTGGGTTACACCAATGCTTCCAACAATTTGTTTGCTTGCCTCCCATGTACAGCTTGTTTCAGATGAAGA





E2F1
NM_00522
ACTCCCTCTACCCTTGAGCTGGGCAGGGGTCCCTGAGCTGTTCTTCTGCCCCATACTGAGGACTGAGGCCTG





ER2
NM_00143
TGGTCCATCGCCAGTTATCACATCTGTATGCGGAACCTCAAAAGAGTCCCTGGTGTGTGCTGATCGCTAGTCA





ErbB3
NM_00198
CGGTTATGTCATGCCAGATACACACCTCAAAGGTACTCCCTCCTCCCGGGTGGCACCCTTCACAGTGGGTCTCAGTC





ERBB4
NM_00523
TGGCTCTTAATCAGTTTCGTTACCTGCCTCTGGAGAATTTACGCATTAACGTGGGACACAATGAGGATCGATATGCCTTG





ERCC1
NM 00198
GTCCAGGTGGATGTGAAAGATCCCCAGCAGGCCCTCAAGGAGCTGGCTTGATGTGTATCCTGGCCG





ERK1
Z11696
ACGGATCACAGTGGAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAG





ESRRG
NM_00143
CCAGCACCATTGTTGAAGATCCCCAGACCAAGTGTGAATACATGCTCAACTCGATGCCCAAGAGACT





fasl
NM_00063
GCACTTTGGGATTCTACCAAATGATTCATGTTACAGGCACCGAGAATGTTGTATTCAGTGAGGGTCTTCAACATGC





FBXO5
NM_01217
GGCTATTCCTCATTTTCTCTACAAAGTGGCCTCAGTGAACATGAAGAAGGTAGCCTCCTGGAGGAGAAAACGGTGACAGTCT




ACAATCC





FHIT
NM_00201
CCAGTGGAGCGCTTCCATGACCTGCGTCCTGATGAAGTGGCCGAAAGTTCAGACGACCCAGAGAG





FUS
NM_00496
GGATAATTCAGACAACAACACCATCTAGTGCAAGGCCTGGGTGAGTTGTTACTTGAGTCTGTGGCTGATTACTTCA





FYN
NM_00203
GAAGCGCAGATCATGAAGAAGCTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAG





G-Catenin
NM_00223
TCAGCAGCAAGGGCATCATGGAGGAGGATGAGGCCTGCGGGCGCCAGTACACGCTCAAGTTCCACC





GATA3
NM_00205
CAAAGGAGCTCACTGTGGTGTCTGTGTTCCAACCACTGAATCTGGACCCCATCTGTGAATAAGCCATTCTGACTC





GBP1
NM_00205
TTGGGAAATATTTGGGCATTGGTCTGGCCAAGTCTACAATGTCCCAATATCAAGGACAACCACCCTAGCTTCT





GBP2
NM_00412
GCATGGGAACCATCAACCAGCAGGCCATGGACCAACTTCACTATGTGACAGAGCTGACAGATCGAATCAAGGCTCTCCTCA





GGPS1
NM_00483
CTCCGACGTGGCTTTCCAGTGGCCCACAGCATCTATGGAATCCCATCTGTCATCTCTGCCTTACG





GRB7
NM_00531
CCATCTGCATCCATCTTGTTTGGGCTCCCCACCCTTGAGAAGTGCCTCAGATAATACCCTGGTGGCC





Hepsin
NM_00215
AGGCTGCTGGAGGTCATCTCCGTGTGTGATTGCCCCAGAGGCCGTTTCTTTGGCCGCCATCTGCCAAGACTGTGGCCGCAGGA




AG





HLA-DPB1
NM_00212
TCCATGATGGTTCTGCAGGTTTCTGCGGCCCCCCGGACAGTGGCTCTGACGGCGTTACTGATGGTGCTGCTCA





ID2
NM_00216
AACGACTGCTACTCCAAGCTCAAGGAGCTGGTGCCCAGCATCCCCCAGAACAAGAAGGTGAGCAAGATGGAAATCC





IGF1R
NM_00087
GCATGGTAGCCGAAGATTTCACAGTCAAAATCGGAGATTTTTGGTATGACGCGAGATATCTATGAGACAGACTATTACCGGAT




TA





IL6
NM_00060
CCTGAACCTTCCAAAGATGGCTGAAAAAGATGGATGCACCAATCTGGAACAATGAGGAGACTTGCCTGGT





ILT-2
NM_00666
AGCCATCACTCTCAGTGCAGCCAGGTCCTATCGTGGCCCCTGAGGAGACCCTGACTCTGCAGT





IRS1
NM_00554
CCACAGCTCACCTTCTGTCAGGTGTCCATCCCAGCTCCAGCCAGCTCCCAGAGAGGAGAGACTGGCACTGAGG





KRT18
NM_00022
AGAGATCGAGGCTCTCAAGGAGGAGCTGCTCTTCATGAAGAAGAACCACGAAGAGGAAGTAAAAGGCC





MAPK14
NM_13901
TGAGTGGAAAAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC





MCM2
NM_00452
GACTTTGCCCGCTACCTTTCATTCCGGCGTGACAACAATGAGCTGTTGCTCACATACTGTGCAGTTAGTGGC





MCM6
NM_00591
TGATGGTCCTATGTGTCACATTCATCACAGGTTTCATACCAACACAGGCTTCAGCACTCCTTTGGTGTGTTCCTGTCCCA





MCP1
NM_00298
CGCTCAGCCAGATGCAATCAATGCCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGC





MGMT
NM_00241
GTGAAATGAAACGCACCACACTGGACAGCCCTTTGGGGAAGCTGGAGCTGTCTGGTTGTGAGCAGGGTC





MMP12
NM_00242
CCAACGCTTGCCAAATCCTGACAATTCAGAACCAGCTCTCTGTGACCCCAATTTGAGTTTTGATGCTGTCACTACCGT





MSH3
NM_00243
TGATTACCATCATGGCTCAGATTGGCTCCTATGTTCCTGCAGAAGAAGCGACAATTGGGATTTGTGGATGGCATCACAG





MTA1
NM_00468
CCGCCCTCACCTGAAGAGAAACGCGCTCCTTGGCGGACACTGGGGGAGGAGAGGAAGAAGCGCGGCTAACTTAACC





MUC1
NM_00245
GGCCAGGATCTGTGGTGGTACAATTGACTCTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGGAG





NPD009 (A
NM_02068
GGCTGTGGCTGAGGCTGTAGCATCTCTGCTGGAGGTGAGACACTCTGGGAACTGATTTGACCTCGAATGCTCC





PR
NM_00092
GCATCAGGCTGTCATTATGGTGTCCTTACCTGTGGGAGCTGTAAGGTCTTCTTTAAGAGGGCAATGGAAGGGCAGCACAACTA




CT





PRKCD
NM_00625
CTGACACTTGCCGCAGAGAATCCCTTTCTCACCCACCTCATCTGCACCTTCCAGACCAAGGACCACCT





PTPD1
NM_00703
CGCTTGCCTAACTCATACTTTCCCGTTGACACTTGATCCACGCAGCGTGGCACTGGGACGTAAGTGGCGCAGTCTGAATGG





RAB6C
NM_03214
GCGACAGCTCCTCTAGTTCCACCATGTCCGCGGGCGGAGACTTCGGGAATCCGCTGAGGAAATTTCAAGCTGGTGTTCC





RALBP1
NM_00678
GGTGTCAGATATAAATGTGCAAATGCCTTCTTGCTGTCCTGTCGGTCTCAGTACGTTCACTTTATAGCTGCTGGCAATATCG




AA





RAP1GDS
NM_02115
TGTGGATGCTGGATTGATTTCACCACTGGTGCAGCTGCTAAATAGCAAAGACCAGGAAGTGCTGCTT





RASSF1
NM_00718
AGTGGGAGACACCTGACCTTTTCTCAAGCTGAGATTGAGCAGAAGATCAAGGAGTACAATGCCCAGATCA





rhoC
NM_00516
CCCGTTCGGTCTGAGGAAGGCCGGGACATGGCGAACCGGATCAGTGCCTTTGGCTACCTTGAGTGCTC





RUNX1
NM_00175
AACAGAGACATTGCCAACCATATTGGATCTGCTTGCTGTCCAAACCAGCAAACTTCCTGGGCAAATCAC





SEMA3F
NM_00418
CGCGAGCCCCTCATTATACACTGGGCAGCCTCCCCACAGCGCATCGAGGAATGCGTGCTCTCAGGCAAGGATGTCAAACGGCG




AGTG





SGCB
NM_00023
CAGTGGAGACCAGTTGGGTAGTGGTGACTGGGTACGCTACAAGCTCTGCATGTGTGCTGATGGGACGCTCTTCAAGG





STAT1
NM_00731
GGGCTCAGCTTTCAGAAGTGCTGAGTTGGCAGTTTTCTTCTGTCACCAAAAGAGGTCTCAATGTGGACCAGCTGAACATGT





STAT3
NM_00315
TCACATGCCACTTTGGTGTTTCATAATCTCCTGGGAGAGATTGACCAGCAGTATAGCCGCTTCCTGCAAG





TBP
NM_00319
GCCCGAAACGCCGAATATAATCCCAAGCGGTTTGCTGCGGTAATCATGAGGATAAGAGAGCCACG





TK1
NM_00325
GCCGGGAAGACCGTAATTGTGGCTGCACTGGATGGGACCTTCCAGAGGAAGCCATTTTGGGGCCATCCTGAACCTGGTGCCGC




TG





TP53BP1
NM_00565
TGCTGTTGCTGAGTCTG1TGCCAGTCCCCAGAAGACCATGTCTGTGTTGAGCTGTATCTGTGAAGCCAGGCAAG





TUBB
NM_00106
TGTGGTGAGGAAGGAGTCAGAGAGCTGTGACTGTCTCCAGGGCTTCCAGCTGACCCACTCTCTGGG





VCAM1
NM_00107
TGGCTTCAGGAGCTGAATACCCTCCCAGGCACACACAGGTGGGACACAAATAAGGGTTTTGGAACCACTATTTTCTCATCACG




ACAGCA





Wnt-5a
NM_00339
GTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGCATCAAAGAATGCCAGTATCAATTCCGACA





ZNF38
NM_14591
TTTCCAAACATCAGCGAGTCCACACTGGAGAGGGAGAAGCACCGTAACTTTCAAGCGCTCCTGTT









Claims
  • 1. A method for predicting the response of a subject diagnosed with cancer to chemotherapy comprising determining the expression level of one or more prognostic RNA transcripts or their expression products in a biological sample comprising cancer cells obtained from said subject, wherein the predictive RNA transcript is the transcript of one or more genes selected from the group consisting of TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31; COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; TK1, ErbB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2, CD68, GSTM1, BCL2, ESR1 wherein (a) for every unit of increased expression of one or more of ILT.2; CD18; GBP1; CD3z;.fas1; MCM6; E2F1; ID2; FBXO5; CDC20; HLA.DPB1; CGA; MMP12; CDC25B; IL6; CYBA; DR4; CRABP1; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; MCM2; GBP2; CD31; ER2; STAT1; TK1; ERBB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2 and CD68; or the corresponding expression product, said subject is predicted to have an increased likelihood of response to chemotherapy; and (b) for every unit of increased expression of one or more of TBP; ABCC5; GATA3; DICER1; MSH3; IRS1; TUBB; BAD; ERCC1; PR; APC; GGPS1; KRT18; ESRRG; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; G.Catenin; FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C; GSTM1, BCL2, ESR1; or the corresponding expression product, said subject is predicted to have a decreased likelihood of response to chemotherapy.
  • 2. The method of claim 1 wherein the predictive RNA transcript is the transcript of one or more genes selected from the group consisting of TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31; COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; and TK1.
  • 3. The method of claim 2 wherein said response is a complete pathological response.
  • 4. The method of claim 2 wherein said subject is a human patient.
  • 5. The method of claim 2 wherein said cancer is selected from the group consisting of breast cancer, ovarian cancer, gastric cancer, colon cancer, pancreatic cancer, prostate cancer and lung cancer.
  • 6. The method of claim 5 wherein said cancer is breast cancer.
  • 7. The method of claim 6 wherein said cancer is invasive breast cancer.
  • 8. The method of claim 7 wherein said cancer is stage II or stage III breast cancer.
  • 9. The method of claim 2 wherein said chemotherapy is adjuvant chemotherapy.
  • 10. The method of claim 2 wherein said chemotherapy is neoadjuvant chemotherapy.
  • 11. The method of claim 10 wherein said neoadjuvant chemotherapy comprises the administration of a taxane derivative.
  • 12. The method of claim 11 wherein said taxane is docetaxel or paclitaxel.
  • 13. The method of claim 12 wherein said taxane is docetaxel.
  • 14. The method of claim 11 wherein said chemotherapy further comprises the administration of an additional anti-cancer agent.
  • 15. The method of claim 14 wherein said additional anti-cancer agent is a member of the anthracycline class of anti-cancer agents.
  • 16. The method of claim 15 wherein said additional anti-cancer agent is doxorubicin.
  • 17. The method of claim 15 wherein said additional anti-cancer agent is a topoisomerase inhibitor.
  • 18. The method of claim 2 comprising determining the expression levels of at least two of said prognostic transcripts or their expression products.
  • 19. The method of claim 2 comprising determining the expression levels of at least five of said prognostic transcripts or their expression products.
  • 20. The method of claim 2 comprising determining the expression levels of all of said prognostic transcripts or their expression products.
  • 21. The method of claim 2 wherein said biological sample is a tissue sample comprising cancer cells.
  • 22. The method of claim 21 wherein said tissue is fixed, paraffin-embedded, or fresh, or frozen.
  • 23. The method of claim 21 where the tissue is from fine needle, core, or other types of biopsy.
  • 24. The method of claim 21 wherein the tissue sample is obtained by fine needle aspiration, bronchial lavage, or transbronchial biopsy.
  • 25. The method of claim 2 wherein the expression level of said prognostic RNA transcript or transcripts is determined by RT-PCR or an other PCR-based method.
  • 26. The method of claim 2 wherein the expression level of said expression product or products is determined by immunohistochemistry.
  • 27. The method of claim 2 wherein the expression level of said expression product or products is determined by proteomics techniques.
  • 28. The method of claim 2 wherein the assay for the measurement of said prognostic RNA transcripts or their expression products is provided is provided in the form of a kit or kits.
  • 29. The method of claim 1, wherein said predictive transcript comprises an intron-based sequence the expression of which correlates with the expression of a corresponding exon sequence.
  • 30. An array comprising polynucleotides hybridizing to a plurality of the following genes: TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31; COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; TK1, ErbB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2, CD68, GSTM1, BCL2, ESR1.
  • 31. The array of claim 30 comprising polynucleotides hybridizing to a plurality of the following genes: TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31; COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; TK1.
  • 32. The array of claim 30 comprising polynucleotides hybridizing to a plurality of the following genes: ILT.2; CD18; GBP1; CD3z; fas1; MCM6; E2F1; ID2; FBXO5; CDC20; HLA.DPB1; CGA; MMP12; CDC25B; IL6; CYBA; DR4; CRABP1; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; MCM2; GBP2; CD31; ER2; STAT1; TK1; ERBB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2 and CD68.
  • 33. The array of claim 30 comprising polynucleotides hybridizing to a plurality of the following genes: ILT.2; CD18; GBP1; CD3z; fas1; MCM6; E2F1; ID2; FBXO5; CDC20; HLA.DPB1; CGA; MMP12; CDC25B; IL6; CYBA; DR4; CRABP1; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; MCM2; GBP2; CD31; ER2; STAT1; TK1.
  • 34. The array of claim 30 comprising polynucleotides hybridizing to a plurality of the following genes: TBP; ABCC5; GATA3; DICER1; MSH3; IRS1; TUBB; BAD; ERCC1; PR; APC; GGPS1; KRT18; ESRRG; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; G.Catenin; FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C; GSTM1, BCL2, ESR1.
  • 35. The array of claim 30 comprising polynucleotides hybridizing to a plurality of the following genes: TBP; ABCC5; GATA3; DICER1; MSH3; IRS1; TUBB; BAD; ERCC1; PR; APC; GGPS1; KRT18; ESRRG; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; G.Catenin; FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C.
  • 36. The array of claim 30 comprising at least five of said polynucleotides.
  • 37. The array of claim 30 comprising at least 10 of said polynucleotides.
  • 38. The array of claim 30 comprising at least 15 of said polynucleotides.
  • 39. The array of claim 30 comprising polynucleotides hybridizing to all of said genes.
  • 40. The array of claim 30 comprising more than one polynucleotide hybridizing to the same gene.
  • 41. The array of claim 30 wherein at least one of the said polynucleotides comprises an intron-based sequence the expression of which correlates with the expression of a corresponding exon sequence.
  • 42. The array of any one of claims 30-41 wherein said polynucleotides are cDNAs.
  • 43. The array of any one of claims 30-41 wherein said polynucleotides are oligonucleotides.
  • 44. A method of preparing a personalized genomics profile for a patient comprising the steps of: (a) determining the normalized expression levels of the RNA transcripts or the expression products of a gene or gene set selected from the group consisting of TBP; ILT.2; ABCC5; CD18; GATA3; DICER1; MSH3; GBP1; IRS1; CD3z; fas1; TUBB; BAD; ERCC1; MCM6; PR; APC; GGPS1; KRT18; ESRRG; E2F1; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; ID2; G.Catenin; FBXO5; FHIT; MTA1; ERBB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; CDC20; STAT3; ERK1; HLA.DPB1; SGCB; CGA; DHPS; MGMT; CRIP2; MMP12; ErbB3; RAP1GDS1; CDC25B; IL6; CCND1; CYBA; PRKCD; DR4; Hepsin; CRABP1; AK055699; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; ZNF38; MCM2; GBP2; SEMA3F; CD31; COL1A1; ER2; BAG1; AKT1; COL1A2; STAT1; Wnt.5a; PTPD1; RAB6C; TK1, ErbB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2, CD68, GSTM1, BCL2, ESR1, in a cancer cell obtained from said patient; and (b) creating a report summarizing the data obtained by said gene expression analysis.
  • 45. The method of claim 44 wherein said cancer cell is obtained from a solid tumor.
  • 46. The method of claim 45 wherein said solid tumor is selected from the group consisting of breast cancer, ovarian cancer, gastric cancer, colon cancer, pancreatic cancer, prostate cancer, and lung cancer.
  • 47. The method of claim 45 wherein said cancer cell is obtained from a fixed, paraffin-embedded biopsy sample of said tumor.
  • 48. The method of claim 47 wherein said RNA is fragmented.
  • 49. The method of claim 45 wherein said report includes recommendation for a treatment modality for said patient.
  • 50. The method of claim 45 wherein if increased expression of one or more of ILT.2; CD18; GBP1; CD3z; fas1; MCM6; E2F1; ID2; FBXO5; CDC20; HLA.DPB1; CGA; MM12; CDC25B; IL6; CYBA; DR4; CRABP1; Contig.51037; VCAM1; FYN; GRB7; AKAP.2; RASSF1; MCP1; MCM2; GBP2; CD31; ER2; STAT1; TK1; ERBB2, CCNB1, BIRC5, STK6, MKI67, MYBL2, MMP11, CTSL2 and CD68; or the corresponding expression product, is determined, said report includes a prediction that said subject has an increased likelihood of response to chemotherapy.
  • 51. The method of claim 50 further comprising the step of treating said patient with a chemotherapeutic agent.
  • 52. The method of claim 51 wherein said patient is subjected to adjuvant chemotherapy.
  • 53. The method of claim 51 wherein said patient is subjected to neoadjuvant chemotherapy.
  • 54. The method of claim 53 wherein said neoadjuvant chemotherapy comprises the administration of a taxane derivative.
  • 55. The method of claim 54 wherein said taxane is docetaxel or paclitaxel.
  • 56. The method of claim 55 wherein said taxane is docetaxel.
  • 57. The method of claim 54 wherein said chemotherapy further comprises the administration of an additional anti-cancer agent.
  • 58. The method of claim 57 wherein said additional anti-cancer agent is a member of the anthracycline class of anti-cancer agents.
  • 59. The method of claim 57 wherein said additional anti-cancer agent is doxorubicin.
  • 60. The method of claim 57 wherein said additional anti-cancer agent is a topoisomerase inhibitor.
  • 61. The method of claim 45 wherein if increased expression of one or more of TBP; ABCC5; GATA3; DICER1; MSH3; IRS1; TUBB; BAD; ERCC1; PR; APC; GGPS1; KRT18; ESRRG; AKT2; A.Catenin; CEGP1; NPD009; MAPK14; RUNX1; G.Catenin; FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C; GSTM1, BCL2, ESR1; or the corresponding expression product, is determined, said report includes a prediction that said subject has a decreased likelihood of response to chemotherapy.
  • 62. The method of claim 44, wherein the RNA transcript comprises an intron-based sequence the expression of which correlates with the expression of a corresponding exon sequence.
  • 63. A method for determining the likelihood of the response of a patient to chemotherapy, comprising: (a) determining the expression levels of the RNA transcripts of following genes .ACTB, BAG1, BCL2, CCNB1, CD68, SCUBE2, CTSL2, ESR1, GAPD, GRB7, GSTM1, GUSB, ERBB2, MKI67, MYBL2, PGR, RPLPO, STK6, MMP11, BIRC5, TFRC, or their expression products, and (b) calculating the recurrence score (RS).
  • 64. The method of claim 63 wherein patients having an RS>50 are in the upper 50 percentile of patients who are likely to respond to chemotherapy.
  • 65. The method of claim 63 wherein patients having an RS<35 are in the lower 50 percentile of patients who are likely to response to chemotherapy.
  • 66. The method of claim 63 wherein RS is determined by creating the following gene subsets: (i) growth factor subset: GRB7 and HER2; (ii) estrogen receptor subset: ER, PR, Bcl2, and CEGP1; (iii) proliferation subset: SURV, Ki.67, MYBL2, CCNB1, and STK15; and (iv) invasion subset: CTSL2, and STMY3; wherein a gene within any of subsets (i)-(iv) can be substituted by substitute gene which coexpresses with said gene in said tumor with a Pearson correlation coefficient of ≧0.40; and calculating the recurrence score (RS) for said subject by weighting the contributions of each of subsets (i)-(iv), to breast cancer recurrence.
  • 67. The method of claim 66 further comprising determining the RNA transcripts of CD68, GSTM1 and BAG1 or their expression products, or corresponding substitute genes or their expression products, and including the contribution of said genes or substitute genes to breast cancer recurrence in calculating the RS.
  • 68. The method of claim 66 wherein RS is determined by using the following equation:
  • 69. The method of claim 66 wherein RS is determined by using the following equation:
  • 70. The method of claim 63, wherein the RNA transcript comprises an intron-based sequence the expression of which correlates with the expression of a corresponding exon sequence.
Provisional Applications (1)
Number Date Country
60561035 Apr 2004 US