Gene expression system comprising the promoter region of the .alpha.-amylase genes

FIELD OF THE INVENTION
This invention relates to a method for producing a gene product, in particular to a method for the mass production of a desired gene product by expressing a gene encoding said gene product in plant host cells, whereby said desired gene product can be recovered from the culture medium of said plant host cells.
BACKGROUND OF THE INVENTION
The plant cell culture expression system has several advantages over the bacterial, yeast or Baculovirus expression systems. Bacteria do not, and yeasts only limitedly, carry out post-translational modifications of the expressed proteins. Plant cells are eukaryotic and able to perform sophisticated protein modifications which are often necessary for the proper function of proteins.
Although Baculovirus is a potent transformation vehicle for higher eukaryotes and generally performs satisfactory modifications of proteins, the cost for culturing baculovirus is much higher than that for plant cells. In addition, the host Cells are eventually lysed by Baculovirus and thousands of host proteins along with the expressed transformation protein are mixed and released into the culture medium, which makes purification of the expressed transformation protein difficult.
The culture medium for plant cells contains mainly salts and vitamins and therefore, it costs much less than that used to culture insect cell lines which are used for the Baculovirus transfection. Moreover, the culture medium for plant cells will not need a supply of serum, whereas almost all animal cell cultures cannot survive without serum. In addition, since plant cells are eukaryotes, the expressed proteins therein will be appropriately post-translationally modified so as to render said proteins capable of functioning and being secreted out of the plant cells. Although no one has yet made a deeper understanding of the mechanism of protein secretion in plant cells, the common belief at present is that it could be similar to the secretory mechanism in animals.
Plant cell cultures are a potential commercial source of medicines, dyes, enzymes, flavoring agents and aromatic oils. Plant cell culture production of such compounds are sought when (1) they are produced by the plant in small quantities or in fleeting or unharvestable developmental stages of the plant's life cycle; (2) when they are produced by plants which are not amenable to agriculture or are native to vanishing or inaccessible environments; and (3) when the compounds cannot be satisfactorily synthesized in vitro or by other biosynthesis systems.
Attempts to produce products by plant cell culture, however, are often commercially unsuccessful due to such factors as insufficient production and secretion of the desired product, poor cell growth, and difficulties in maintaining the appropriate cell type in culture.
The callus alpha-amylase (.alpha.-amylase) expression system has features which make it of potential use to plant cell fermentation technology, namely its high level of expression, sustained expression, expression irrespective of either the tissue of origin of the cell culture or tissue formation in the cell culture, and its product secretion. Although rice callus itself may not be an ideal source of commercial .alpha.-amylase, the gene regulatory regions responsible for the high expression could be used, with the aid of recombinant DNA technology and plant transformation, to achieve high expression of other valuable proteins (Carl R. Simmons, et al (1991), Biotechnology and Bioengineering, 38: 545-551).
Starch includes straight-chain starch and branched starch, two types of polysacchardies, and is the basic stored nutrient component in cereal grains (T. Akazawa et al (1985), Ann. Rev. Plant Physiol., 36: 441-472). During the initial germinating period of cereal seeds, the aleurone layer cells will synthesize .alpha.-amylase. Alpha-amylase, .alpha.-glucosidase and enzymes restricting dextrinase are secreted into the endosperm and together hydrolyze starch to form glucose and maltose, so as to provide the nutrients needed for the growth of the germ (J. C. Rogers and C. Milliman, J. Biol. Chem., 259 (19): 12234-12240, 1984; Rogers, J. C., J. Biol. Chem., 260: 3731-3738, 1985). Other enzymes contributing to starch hydrolysis include .beta.-amylase which can hydrolyze starch to form maltose and a small amount of glucose. In a dry seed, .beta.-amylase normally exists in an inactive form in the endosperm due to protein disulfide bonding. When the seed germinates, the aleurone layer cells will be subjected to the induction by gibberellic acid (GA.sub.3) to produce protease, which can destroy the disulfide bond and release the active form of .beta.-amylase. The above four enzymes take part in the hydrolysis of starch during the germination of seeds. However, .alpha.-amylase is the most active and holds the most important role (Akazawa, T., et al (1985), Ann. Rev. Plant Physiol., 36: 441-472).
It is known that GA.sub.3 exerts a direct influence over the expression of .alpha.-amylase (Chandler, P. M., et al (1984), Mol. Biol., 3: 401-418). When rice seeds are treated with GA.sub.3, the new synthesis of .alpha.-amylase mRNA by the aleurone layer cells increases to 50 to 100-fold of the control value (no GA.sub.3) (O'Neill, S. D., et al (1990), Mol. Gene. Genet., 221: 235-244). In reality, the regulation of .alpha.-amylase gene expression by GA.sub.3 has provided a very ideal model for studying the mechanism of hormonal regulation of gene expression in plants (Ho, T. H. D., et al (1987), .-+.Regulation of gene expression in barley aleurone layers," In: Molecular Biology of Plant Growth Control, pp. 35-49. St. Louis, Mo.: Alan R. Liss, Inc.).
Hitherto, .alpha.-amylase genes from rice, barley and wheat have been cloned and subjected to further study and analysis. The results show that these cereal-type .alpha.-amylase isozymes or isoforms are all manufactured by several types of .alpha.-amylase genes (Baulcombe, D. C., et al (1987) Mol., Gen. Genet., 209: 33-40); Huang, N., et al (1990a), Plant Mol. Biol., 14: 655-668; Knox, C. A. P., et al (1987), Plant Mol. Biol., 9: 3-17).
The .alpha.-amylase secreted from the aleurone layer cells during the germinating period of the seed of barley and wheat comprises two classes, the high isoelectric point and low isoelectric point. In barley, there are around 7 .alpha.-amylase genes which belong to the high isoelectric point and 3-4 genes which belong to the low isoelectric point (B. Khursheed and J. C. Rogers, J. Biol. Chem., 263: 18593-18960, 1988).
Currently, 7 .alpha.-amylase cDNA and 9 .alpha.-amylase genomic DNA groups of barley have been cloned (Chandler, P. M., et al (1984), Plant. Mol. Biol., 3: 401-418; J. Deikman and R. L. Jones, Plant Physiol., 78: 192-198, 1985; Khrusheed & Rogers (1988), supra; Knox, C. A. P., et al (1987), supra). The .alpha.-amylase genes of wheat are grouped into .alpha.-Amy1, .alpha.-Amy2 and .alpha.-Amy3. Alpha-Amy1 has a high isoelectric point while .alpha.-Amy2 has a low isoelectric point, and each has more than 10 genes which are expressed in germinating seeds. Alpha-amylase .alpha.-Amy3 includes 3-4 genes which are expressed in immature seeds (Baulcombe et al (1987), supra).
With regard to the study of rice .alpha.-amylase genes, the .alpha.-amylase genes thereof have not been classified into the high isoelectric point group and the low isoelectric point group as was done in the study of barleys and wheats. In reality, MacGregor, A. W., et al (Cereal Chem., 65: 326, 1988) applied the analytical method of isoelectric point electrophoresis and found that rice .alpha.-amylase isomers had a pI value of less than 5.5.
Therefore, it is possible that rice does not have any isoform of high isoelectric point. Huang, N., et al (Nucl. Acids. Res., 18: 7007-7014, 1990b) grouped the 10 rice .alpha.-amylase genes into 5 groups by cross hybridization experiment and confirmed their distribution in 5 chromosomes (Ranjhan et al, the original manuscript is still under preparation). O'Neill et al (Mol. Gene. Genet. 221: 235-244, 1990) made the first more detailed study of the cDNA pOS103 and pOS137 of rice .alpha.-amylase. The .alpha.-amylase manufactured from pOS103 and pOS137 has a precursor protein of a molecular weight of 48 KDa.
When this enzyme is secreted out of the cell, the signal peptide chain of the precursor protein will be cleaved off. Accordingly, the molecular weight of mature .alpha.-amylase is about 45-46 KDa and the isoelectric point thereof is predicted to be about 6.0. However, Kumagai, M. H., et al (Gene, 94: 209-216, 1990) subcloned pOS103 into the cells of Saccharomyces, to allow the Saccharomyces to secrete .alpha.-amylase into the culture medium, and it was found that the molecular weight of .alpha.-amylase is about 44-45 KDa and that the isoelectric point is about 4.7 to 5.0.
On the other hand, transformation of dicotyledonous plants with Agrobacterium tumefaciens is well established and widely used. A number of foreign genes carried between the T-DNA borders of the Ti plasmid in Agrobacterium have been delivered to plant cells, integrated into the chromosome, and stably inherited by subsequent generations. This, however, has not been the case for monocotyledonous plants in general. In the past, the monocots and particularly the graminaceous crop species have been considered to be outside the Agrobacterium host range (Bevan, M. W., Nucl. Acids Res., 12: 8711-8721, 1984; Declene, M., Phytopathol. Z. 113: 81-89). Gene transfer methods developed from economically important monocotyledonous species have been restricted to the directed transfer of DNA into protoplasts, or particle discharge methods of direct DNA transfer into intact cells of embryomic callus or suspension cells.
In recent years, more and more data on the transformation of monocots using Agrobacterium have been accumulated. The demonstration of Agrobacterium T-DNA integration into genomic DNA of Asparagus officinalis (Bytebier., B., et al (1987), Proc. Natl. Acad. Sci. USA, 84:5345-5349) and Dioscorea bulbifera (Schafer, W., et al (1987), Nature, 327: 529-531) first indicated that some monocot species possess the potential to be transformed by Agrobacterium. Later, a report of T-DNA integration into the genomic DNA of rice, Oryzae sativa (Raineri, D. M., et al (1990), Biotechnology, 8: 33-38), further showed that graminaceous crop plants can be transformed by Agrobacterium. Recently, foreign genes have been successfully transferred into corn, and regeneration of plants and detection of the transferred genes in the F1 progeny have been demonstrated (Gould, J. et al (1991), Plant Physiol., 95: 426-434). Therefore, the Agrobacterium-mediated gene transfer system seems to be applicable for transformation of monocot plants.
Agrobacterium-mediated transformation is a complex process and several factors are involved (for review, see Hooykaas, P. J. J., Plant Mol. Biol., 13: 327-336, 1989). Activation of the virulence system is one of the early important steps in plant tumor induction (Garfinkrl, D. J., J. Bacteriol., 144: 732-743, 1980). The vir genes on the Ti plasmid are silent until they become induced by certain plant factors, which in tobacco have been identified as the phenolic compounds acetosyringone and .alpha.-hydroxy-acetosyringone (Stachel, S. E., et al (1985), Nature, 318: 624-629). These compounds are released from plant tissue, especially after wounding, which has long been known to be a prerequisite for plant tumorigenesis via Agrobacterium. Although initially, it was generally thought that monocot species were not susceptible to Agrobacterium, some monocot species (e.g., Asparagus) are prone to tumor formation after T-DNA transfer (Hernalsteens, J. P., et al (1984), EMBO J., 3: 3039-3041). Tumor formation on discs of the monocot Dioscorea (yam) by Agrobacterium requires a pre-incubation with exudates from dicot plants (Schafer, W., et al (1987), Nature, 327: 529-531), indicating that some monocots probably do not produce enough inducers to activate the expression of the vir gene on the Ti plasmid transferred by Agrobacterium.
Toxins or inhibitors which inhibit the growth of Agrobacterium tumefaciens and the expresion of vir genes on the Ti plasmid have been shown to be present in wheat (Usami, S., et al (1988), Proc. Natl. Acad. Sci. USA, 85: 3748-3752), and corn (Sahi, S. U., et al (1991), Proc. Natl. Acad. Sci. USA, 87: 3879-3883), and might cause problems during attempts to transform monocots with Agrobacterium. Nevertheless, wheat and oats have been shown to contain substances which induce the expression of the vir locus of the Ti plasmid and the T-DNA processing reaction, although the inducing substance of wheat differs from acetosyringone (Usami, S., et al (1988), supra).
Previously, it was reported that potato suspension culture (PSC) is essential for the Agiobacterium-mediated transformation of Indica type rice (Chan, M. T., et al, "Transformation of Indica rice (Oryza sativa L.) mediated by Agrobacterium," Plant Cell Physiol. (1992), 33: 577-583). PSC is rich in the phenolic compounds acetosyringone (AS) and sinapinic acid (SA). Although the role of these two compounds in the success or efficiency of transformation is not yet known, the results imply that transformation of monocots, at least rice, using Agrobacterium can be improved by the addition of certain substances.
The age and physiological states of plant tissues have been shown to be important for Agrobacterium-mediated transformation (An, G. et al (1986), Plant Physiol., 81: 301-305; Chan, M. T., et al (1992), supra); H. H. Chang and M. T. Chan, Bot. Bull. Academia Sinica, 32: 171-178, 1991; Dale, P. J., et al (1989), Plant Sci., 63: 237; Gould, J. et al (1991), supra; Hernalsteens J. P., et al (1984), supra).
Thes studies suggest that infection with Agrobacterium and T-DNA transfer should take place in monocots if suitable tissues are used for transformation. It was previously shown that young tissues of rice root have a greater potential to be transformed by Agrobacterium if appropriate conditions are applied (Chan, M. T., et al (1992), supra), and it was assumed that young tissues may contain relatively fewer inhibitors or more virulence inducers. Therefore, a combination of immuture, embryos and PSC for transformation of rice can be used in the present invention.
This invention is based on the inventors' discovery that, in addition to regulation by gibberellic acid (GA.sub.3) in germinating seeds of rice, the expression of .alpha.-amylase genes in suspension-cultured cells of rice is regulated by the level of carbohydrate present in the culture medium (Yu, Su-May et al. (1991), J. Biol. Chem., 266: 21131-21137).
The synthesis of .alpha.-amylases and levels of their mRNA are greatly induced under sucrose starvation. An increase of .alpha.-amylase synthesis is assumed to accelerate hydrolysis of cellular starch as an energy source when exogenous carbon source is depleted. Under normal growth condition with an adequate supply of sugars in the medium, the expression of .alpha.-amylase genes is subject to metabolite repression. It was further observed that .alpha.-amylases synthesized by the cultured rice cells are secreted into the culture medium and can account for about 15-20% of the total proteins present in the medium during periods of sugar depletion.
It would therefore be advantageous to develop a gene expression system in plant cell culture by constructing a vector expressible in plant host cells utilizing the. promoter and the signal peptide sequences of an .alpha.-amylase gene. Any foreign gene can be linked downstream of said promoter and signal peptide encoding sequences. This construct would then be used to transform a compatible plant host cell.
Theoretically, the .alpha.-amylase promoter would control the expression of foreign genes in said plant cells and the secretion of the proteins into the medium. Such an expression system therefore has a high potential to express and/or secrete large quantities of any important protein into the medium, greatly facilitating purification of the expressed protein.
To aid in the procedure of screening and/or to enhance further the expression efficiency of the gene expression system constructed above, said gene expression system may further comprise a suitable marker gene, a reporter gene, an antibiotic-resistance gene and/or an enhancer gene, all of which can be those well known by an artisan of ordinary skill in the relevant art (Maniatis, T., et al, "Molecular Cloning: A Laboratory Mannual," pressed by Cold Spring Harbor Laboratory, 2nd edi., 1989).
SUMMARY OF THE INVENTION
Accordingly, in one aspect of the present invention, a method is provided for producing a gene product by expressing a gene encoding said gene product in plant host cells, comprising the steps of: constructing a vector expressible in plant host cells, said vector comprising a promoter region derived from an .alpha.-amylase gene of a plant, and a gene encoding a desired gene product; transforming a compatible plant host cell with said vector; cultivating the resultant transformant host cell; subjecting said cultivated transformant host cell to a sugar-depleted or sugar-free condition to promote the expression of said gene under the control of said promoter region; and recovering the expressed gene product.
In another aspect of the present invention, a method is provided for producing a gene product by expressing a gene encoding said gene product in plant host cells, comprising the steps of constructing a vector expressible in plant host cells, said vector comprising a promoter region derived from an .alpha.-amylase gene of a plant, and a gene encoding a desired gene product, said promoter region including the promoter and a DNA sequence encoding the signal peptide; transforming a compatible plant host cell with said vector; cultivating the resultant transformant host cell in a suitable culture medium; and directly recovering the expressed gene product from said medium.
The rice .alpha.-amylases are encoded by a multigene family which contains at least ten distinct members. To understand how GA.sub.3 and sugars regulate .alpha.-amylase gene expression in rice, it is important to identify .alpha.-amylase cDNA clones representing different .alpha.-amylase genes. These clones, in turn, would be used to isolate their corresponding genomic clones.
In this invention, four of the .alpha.-amylase cDNA clones showing different restriction patterns were chosen for subcloning into the plasmid vector pBluescript (Invitrogen, San diego, Calif.). The resultant clones were designated as .alpha.Amy6-C (Oryza sativa .alpha.-amylase cDNA), .alpha.Amy7-C, .alpha.Amy8-C and .alpha.Amy10-C with insert sizes of 0.6, 1.0, 1.4 and 1.5 kb, respectively.
The 3' end regions of these cDNA clones were further subcloned and sequenced. The sequenced 3' regions of .alpha.Amy6-C, .alpha.Amy7-C and .alpha.Amy8-C are found identical to those of the reported rice .alpha.-amylase genes RAmy3B (Sutliff et al., 1991), RAmy1A (Huang et al., 1990a), and RAmy3E (Huang et al., 1990b), respectively. The genomic DNA corresponding to .alpha.Amy10-C has not yet been reported.
The expression pattern of these four .alpha.-amylase genes in cultured suspension cells of rice was determined with the use of the constructed gene-specific probes. Expression of .alpha.Amy7-C and .alpha.Amy8-C was induced by sugar depletion 6- and 37-fold, respectively, at day 12 and continued to increase at day 14. Expression of .alpha.Amy10-C was induced later with a 5-fold increase at day 14. Expression of .alpha.Amy6-C also increased 4-fold at day 12, however, it decreased to basal level at day 14. Expression of another .alpha.-amylase gene, .alpha.Amy3-C, was increased 5-fold after sugar starvation (S. M. Yu, unpublished result).
Therefore, among the five .alpha.-amylase genes examined so far, .alpha.Amy8-C is the most abundantly expressed gene after sugar depletion. In addition, it is worthwhile noting that .alpha.Amy8-C is one of the major genes whose transcripts upon inducement by sugar depletion constitute the 40-fold increase of total amylase transcripts as detected with probe of OSamy-C. The results show that expression of the four .alpha.-amylase genes in response to carbohydrate starvation in the cultured cells is temporally and quantitatively regulated.
Consequently, an expression vector containing the promoter region of the rice .alpha.-amylase gene (.alpha.Amy8) was constructed in order to express .beta.-glucuronidase (GUS) in transformed rice cells. A hygromycin resistance gene hph placed downstream of the CaMV 35S RNA promoter is used as a selectable marker.
Different transformation methods, such as electroporation of protoplasts or intact cells, particle bombardment, micro-injection method, ultrasonic method, polyethylene glycol-mediated protoplast transformation, poly-L ornithine method, calcium phosphate method (Hain, R. et al (1985), Mol. Gen. Genet., 199: 161-168), and Agrobacterium-mediated transformation system can be applied to deliver the plasmid DNA into rice cells. GUS expression was detected in either bombarded or electroporated cells two days after transfection. The results indicate that the .alpha.-amylase promoter-GUS chimeric genes are functional in rice cells.
A reporter gene driven by an .alpha.-amylase promoter is further transferred and expressed in a Japonica type of rice (Oryzae sativa L. cv. Tainung 62) using the Agrobacterium-mediated gene transfer system. Said system comprises a plasmid containing chimeric genes of .beta.-glucuronidase (GUS) and neomycin phosphotransferase (NPTII). The transformation efficieny of said Agrobacterium was improved by Co-incubation with potato suspension culture (PSC). The GUS and and NPTII genes, which are under the control of promoters of a rice .alpha.-amylase gene (.alpha.Amy8) and Agrobacterium nopaline synthase gene (NOS), respectively, were both expressed in transgenic calli and plants. The experimental data demonstrate the successful gene transfer and sexual inheritance of the chimeric genes made in accordance with this invention.
Features and advantages of the present invention will become apparent in the following detailed description with references to the accompanying drawings, in which:

BRIEF DESCRIPTION OF THE DRAWINGS
The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
FIGS. 1A and 1B shows nucleotide sequences of the 3' regions of the rice .alpha.-amylase cDNA clones.
FIG. 2 shows the Southern blot analysis demonstrating specificity of the .alpha.-amylase gene-specific probes.
FIG. 3. shows the southern blot analysis of .alpha.-amylase genes in rice genome.
FIGS. 4A-B show the accumulation of .alpha.-amylase mRNA in germinating seeds and suspension cultured cells of rice. (4A) Time course of accumulation of .alpha.-amylase mRNA in GA.sub.3 -treated aleurone cells of rice. (4B) Relative mRNA levels of the .alpha.-amylase genes in the suspension cultured cells of rice during later growth stage.
FIGS. 5A-C show the binding of aleurone protein extract to the 5' specific DNA fragments of a rice .alpha.-amylase gene.
FIG. 6 shows the Binding of the GA.sub.3 -inducible aleurone proteins to the specific DNA fragment of HS501. +GA and -GA: protein extracts prepared from deembryoed rice seeds after 3 days of imbibition with or without GA.sub.3, respectively.
FIG. 7 shows the structure of the binary vector pAG8 containing the .alpha.Amy8 (1.2 kb)/GUS chimeric gene. The 1.2 kb 5'-upstream fragment of the .alpha.-amylase gene .alpha.Amy8 was joined to the coding region of the E. coli .beta.-glucuronidase gene (GUS) with the polyadenylation signals of nopaline synthase gene (NOS). This chimeric gene was inserted between the left border and the selectable marker gene of pBIN19. Abbreviations: RB and LB, right- and left-border of T-DNA, respectively; NPTII, neomycin phosphotransferase II gene; Pnos, promoter of NOS gene.
FIGS. 8A-F show the selection and regeneration of a transgenic rice plant. (8A) Nontransformed control calli on the selective medium (N6RF) containing 40 .mu.g/ml G418 three weeks after plating; (8B) Regeneration of shoot and roots from G418-resistant calli 8 weeks after inoculation with Agrobacterium; (8C) Transgenic plant grown on N6/G418 medium 9 weeks after inoculation; (8D) The transgenic plant grown in pot soil in greenhouse 16 weeks after inoculation; (8E) Tillering of the transgenic plant 18 weeks after inoculation; (8F) Seed-setting of the transgenic plant 24 weeks after inoculation.
FIG. 9 shows a DNA blot analysis for detection of GUS gene in the transgenic rice plants. Genomic DNA was isolated from young leaves of wild type and transgenic plants. Five .mu.g of DNA digested with various restriction enzymes were loaded On each lane. The Sst I/BamH I fragment containing GUS gene in pBI221 was used as the probe. Lane 1:pAG8 digested with BamH I; Lanes 2 to 5: DNA from transgenic plant T1; Lanes 6 to 8: DNA from transgenic plant T2; Lanes 9 to 10: DNA from transgenic plant T3; Lane 11: DNA from transgenic plant T4; and Lane 12: DNA from a non-transformed control plant. Abbreviations of restriction enzymes: B, BamH I; H, Hind III; P, Pst I; Unc, undigested.
FIGS. 10A-B show the analysis of GUS and NPTII activities in the transgenic calli and plants. (10A) Analysis of GUS activity in transgenic rice. Protein extracts from transformed and non-transformed rice plants and calli were separated using 7.5% SDS-PAGE. The gel was reacted with 1 mM methyl umbelliferyl glucuronide (MUG) and photographed as described in "Materials and methods." Lane 1: standard E. coli .beta.-glucuronidase; Lanes 2-5: protein extract from transformed plants; Lanes 6-7: protein extract from transformed calli; Lane 8: protein extract from non-transformed callus. Twenty .mu.g per lane of protein was loaded in lanes 2 to 8. (10B) Analysis of neomycin phosphotransferase II activity in transgenic rice. Thirty .mu.g protein extracts from transformed or non-transformed rice plants and calli were reacted with [F-.sup.32 P]-ATP, dot blotted on Whatman P81 papers and autoradiographed as described in "Materials and methods." Row A: reactions with kanamycin; Row B: reactions without kanamycin; Lanes 1-3: protein extracts from transgenic plants; Lanes 5-6: protein extracts from transformed calli; Lane 4 and 7: protein extracts from non-transformed plants and callus, respectively.
FIGS. 11A-J show expression of the .alpha.Amy8 (1.2 kb)/GUS gene in various tissues of transgenic rice plant T1. Thin sections of each organ from transformed or non-transformed plants of 100 cm in height were stained with X-gluc as described in Materials and methods. (11A) Cross section of a leaf blade from a non-transformed plant; (11B) Cross section of a leaf blade from transgenic plant T1; (11C) Higher magnification of the boxed area in (11B); (11D) Cross section of stem of one of the tillers from a non-transformed plant; (11E) Cross section of stem of one the tillers from transgenic plant T1; (11F) Higher magnification of the boxed area in (11E); (11G) Cross section of a leaf sheath from transgenic plant T1; (11H) Cross section of young leaves embedded inside the leaf sheaths of one of the tillers from transgenic plant T1; (11I) Cross section of a root of transgenic plant T1; (11J) Unsectioned root hair from transgenic plant T1. Abbreviations: ph, phloem; mx, metaxylem tracheary element; sc, sclerenchyma; par, parenchyma.
FIG. 12 shows the analysis of GUS activity in R1 seeds of transgenic plant T1. The seeds were germinated in MS medium containing kanamycin and 2,4-D to induce callus formation. The calli were subjected to GUS histochemical staining assay as described in "Materials and methods." CK: callus derived from a seed of non-transformed plant; T: calli derived from seeds of transgenic plant T1.
FIGS. 13A-B shows the PCR amplification of a 410 bp GUS DNA fragment from R1 progeny of transgenic rice plant T1. DNA was isolated from young leaves of R1 progeny of transgenic plant T1. PCR was performed as described in. "Materials and methods." (13A) Amplified DNAs were electrophoresed in 1% agarose gel and detected by ethidium bromide staining. (13B) Same DNAs as in (13A) were blotted on Gene Screen membrane (Du Pont, Wilmington, Del.), hybridized with a .sup.32 P-labeled GUS DNA probe, and autoradiographed. Lane 1: DNA template from non-transformed plant (NT) was used as a negative control; Lane 2: DNA template from plasmid pAG8; Lanes 3-10: DNA template from R1 progenies (no. 1-1 to 1-8) of transgenic rice plant T1.
FIG. 14 shows the expression of GUS in transgenic rice calli.
FIG. 15 shows the accumulation of GUS protein in transgenic rice cells and medium.

DETAILED DESCRIPTION OF THE INVENTION
This invention relates to the gene expression regulation of .alpha.-amylase promoter, more specifically rice .alpha.-amylase promoter, in plant cells and the application thereof.
Alpha-amylases are major amylolytic enzymes for the hydrolysis of stored starch in the endosperm during germination of cereal grains. Previously, we have shown that the expression of .alpha.-amylase genes in rice is under two different modes of regulation: I) hormonal regulation in germinating seeds, and II) metabolic repression in cultured cells by available carbohydrate nutrients (Yu, S. M., et al (1991), J. Biol. Chem., 266:21131-21137). Our previous observations suggested a potentially important control-mechanism of carbohydrate metabolism in higher plants, which might account for the repression of .alpha.-amylase gene expression in the embryo of germinating rice seeds (Karrer, E. E., et al (1991), Plant Mol. Biol., 16: 797-805).
Thus, to understand the molecular mechanisms which regulate the expression of .alpha.-amylase genes in rice, we have used transgenic rice carrying a reporter gene under the control of an .alpha.-amylase promoter for fuctional analysis of regulatory element in the .alpha.-amylase genes.
To do this, four .alpha.-amylase cDNA clones were isolated from a cDNA library derived from poly(A).sup.+ RNA of giberellic acid (GA.sub.3)-treated rice aleurone layers. Nucleotide sequence analysis indicates that the four cDNAs were derived from different .alpha.-amylase genes. Expression of the individual .alpha.-amylase gene in germinating seeds and suspension-cultured cells of rice was studied using gene-specific probes.
In germinating seeds, expression of the .alpha.-amylase genes is positively regulated by GA.sub.3 in a temporally coordinated but quantitatively distinct manner. In cultured suspension cells, in contrast, expression of the .alpha.-amylase genes is negatively and differentially regulated by sugars present in medium. In addition, one strong and one weak carbohydrate-starvation responsive .alpha.-amylase genes are identified.
The interactions between the-promoter region (HS501) of a rice .alpha.-amlylase gene and GA.sub.3 -inducible DNA binding proteins in rice aleurone cells are also studied. DNA mobility-shift assay results showed that aleurone proteins interact with two specific DNA fragments within HS501. One fragment, located between nucleotide residues -131 and -170, contains two imperfect directly-repeated pyrimidine boxes and a putative gibberellin response element. The other fragment, located between residues -92 to -130, contains a putative enhancer sequence. The interactions between aleurone proteins and these two fragments are sequence specific and GA.sub.3 responsive.
We further successfully transferred and expressed a reporter gene driven by an .alpha.-amylase promoter in a Japonica type of rice (Oryzae sativa L. cv. Tainung 62) using the Agrobacterium-mediated gene transfer system. Immature rice embryos (10-12 days post-anthesis) were infected with Agrobacterium strains carrying a plasmid containing chimeric genes of .beta.-glucuronidase (GUS) and neomycin phosphotransferase (NPTII). Co-incubation of potato suspension culture (PSC) with the Agrobacterium inoculum significantly improved the transformation efficiency of rice.
The GUS and NPTII genes, which are under the control of promotors of a rice .alpha.-amylase gene (.alpha.Amy8) and Agrobacterium nopaline synthase gene (NOS), respectively, were both expressed in transgenic calli and plants. Integration of foreign genes into the genomes of transgenic plants was confirmed by Southern blot analysis. Histochemical localization of GUS activity in one transgenic plant (T1) revealed that the rice .alpha.-amylase promoter functions in all cell types of the mature leaves, stems, sheaths and roots, but not in the very young leaves. This transgenic plant grew more slowly and produced less seeds than the wild type plant. GUS activity was also detected in calli derived from progeny (R1) of this plant. The GUS gene fragment was amplified by polymerase chain reaction using DNA isolated from the R1 progeny of the same transgenic plant. These data demonstrate successful gene transfer and sexual inheritance of the chimeric genes.
Accordingly, in the present invention we describe the transformation of rice with Agrobacterium and the successful expression of an .alpha.-amylase promoter-driven reporter gene in a regenerated plant and R1 progeny of a japonica type transgenic rice. To our knowledge, this is the first report to show Agrobacterium-mediated transformation of rice and to demonstrate inheritance of the transferred DNA by the progeny of the transgenic rice. It should therefore be comprehended that the chosen foreign gene (GUS) used in the present invention plays two roles in the present gene expression system: as a foreign gene to be inserted into the present gene expression system and as a reporting gene for indicating the successful transformation of said gene expression system.
EXAMPLE I
Methods
a) Conditions for preparation of aleurone RNA, construction of the cDNA library, and screening for .alpha.-amylase cDNA clones were performed as follows:
Rice (Oryzae sativa cv. Labelle) seeds were surface sterilized in 2.5% sodium hypochloride for 20 min., washed extensively with sterile distilled H.sub.2 O, and incubated in sterile 10 .mu.M GA.sub.3 /20 mM CACl.sub.2 /20 mM sodium succinate for different lengths of time. The germinating embryos were cut off and the aleurone layers were peeled off the endosperm. The collected aleurone layers were immediately frozen in liquid N.sub.2 and stored at -70.degree. C. until use. Total RNA was isolated from the frozen aleurone layers according to the method of Belanger, F. C., et al (Proc. Natl. Acad. Sci. USA, 83: 1354-1358, 1986). Poly (A).sup.+ RNA was purified with HYBOND-mAP affinity paper (Amersham). One microgram of poly(A).sup.+ RNA was used to construct a cDNA library in lamda-gt11 using Amersham's cDNA synthesis and cloning systems. The cDNA library consisted of approximately 2.times.10.sup.7 independent recombinant clones. Approximately 2.times.10.sup.4 plaques were screened using the .sup.32 P-labeled 1.5 kb fragment of the rice genomic clone, OSamy-C (J. K. Kim and R. Wu (1992), Plant Mol. Biol., 18: 399-402). The cDNA clones in lamda-gt11 were cleaved with EcoR I and subcloned into EcoR I site of pBluescript and maintained in E. coli strain XL1-B (Stratagene).
DNA sequencing was performed with the dideoxy nucleotide chain termination technique. Referring to FIGS. 1A and 1B, nucleotide sequence analysis and comparisons were carried out using programs from the Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin, Version 5.0, June 1987. Nucleotide sequences are aligned and gaps (dash lines) are introduced to maximize sequence similarity. The homologous sequences among the four clones are indicated by asterisks(*). The translation stop codons and polyadenylation signals are underlined. The 5' boundaries of the gene-specific regions are indicated by arrows and the restriction enzymes used for DNA truncation are indicated below their corresponding sites. The nucleotide sequence is numbered from the first base of the sequenced regions. Accession number for .alpha.Amy10-C in GeneBank, EMBL, and DDBJ is M81143.
b) Conditions for preparation of .sup.32 P-labeled gene-specific probes were performed as follows:
The four .alpha.-amylase cDNAs were truncated at the 5' ends of the gene-specific regions using restriction enzymes indicated in FIGS. 1A and 1B. In vitro transcription of the four truncated cDNAs with the T3 RNA polymerase yields antisense-strand transcripts of sizes 210, 112, 119, and 50 nucleotides, representing .alpha.Amy6-C-3', .alpha.Amy7-C-3', .alpha.Amy8-C-3' and .alpha.Amy10-C-3' respectively. .sup.32 P-UTP (Amersham, SP-6 tested) was used to label the probe.
Southern blot analysis which demonstrates the specificity of the .alpha.-amylase gene-specific probes was carried out as shown in FIG. 2, in which: Panel 1: the .alpha.-amylase cDNA was digested with EcoR I and OSamy-c was digested with BamH I and EcoR I, then electrophoresised on 1% agarose gel, and stained with ethidium bromide. Panels 2-5: four replicates of the same gel as shown in Panel 1 were blotted to GeneScreen membranes, hybridized with the .sup.32 P-labeled gene-specific probes at 42.degree. C. for 12 hr. After hybridization, the membranes were washed in 0.1 X SSC and 0.1% SDS at 55.degree. C. for 40 min. The vectors were also hybridized because the antisense RNA probes contained a sketch of 62 bp sequences of the multiple cloning sites of pBluescript between the T3 promoter and EcoR I site where the cDNAs were inserted. Molecular weight markers are shown on the left.
c) Southern blot analysis of .alpha.-amylase genes in rice genome was carried out as followes
With referrence to FIG. 3, total rice genomic DNA was isolated from two month old greenhouse-grown plants. Rice leaves were ground in liquid N.sub.2 to fine powder, extracted with urea extraction buffer [42 g/ml urea, 5 M NaCl, 1 M Tris-Cl (pH 8.0), 0.5 M EDTA (pH 8.0), and 20% sarkosine] and equal volumes of phenolchloroform at room temperature for 15 min. After centrifugation, ammonium acetate (pH 5.2) and isopropanol were added to the supernatant. DNA precipitated immediately and was spooled with a glass hook, rinsed in 75% and 100% ethanol, and air-dried. DNA was resuspended in TE buffer and stored at 4.degree. C. Ten micrograms of genomic DNA was digested with six restriction enzymes, fractionated by electrophoresis using 0.8% agarose gels, and transferred to GeneScreen membrane (DuPont). The membrane was probed with the .sup.32 P-labeled 1.5 kb .alpha.-amylase cDNA insert of .alpha.Amy10-C. Molecular weight markers are shown on the left.
d) Accumulation of .alpha.-amylase mRNA in germinating seeds and suspension cultured cells of rice.
With referrence to FIGS. 4A and 4B, rice seeds were germinated in 10 .mu.M GA.sub.3 for different lengths of time. The germinating embryos were cut off and total aleurone RNA was purified from the embryoless seeds according to the method of Belanger, F. C., et al. (Proc. Natl. Acad. Sci. USA, 83: 1354-1358, 1986). Rice suspension cells were cultured as described previously (Yu, S. M., et al (1991), J. Biol. Chem., 266: 21131-21137). RNA was purified from cells grown in the sucrose-containing medium for 8, 10, 12 and 14 days. Five micrograms of total RNA was applied to each lane. The RNA blot analysis was performed according to the method of Thomas P. S. (Methods Enzymol., 100: 255-266, 1983). The plasmid pOSamy-c containing an entire .alpha.-amylase coding region in pBluescript was originally subcloned from a rice genomic clone OSamy-c (J. K. Kim and R. Wu (1992), Plant Mol. Biol., 18: 399-402). The 1.5 kb .alpha.-amylase DNA insert of OSamy-c was excised from the plasmid vector by restriction enzymes BamH I and EcoR I, gel-purified as described by Maniatis et al. (Molecular Cloning: A Laboratory Mannual, pressed by Cold Spring Harbor Laboratory, 1982), and labeled with [.alpha.-.sup.32 P]dCTP using the random primer method (A-P. Feinberg and B. Vogelstein (1983), Anal. Biochem., 132: 6-13). The gene-specific probes corresponding to each of the four rice .alpha.-amylase cDNAs were prepared and labeled as described above with referrence to FIG. 1 and FIG. 2. Size of mRNA detected by all of the probes is 1.6 kb.
e) Binding of aleurone protein extract to the 5' specific DNA fragments of a rice .alpha.-amylase gene, in which methods for preparation of aleurone layer extract and DNA mobility-shift (gel retardation) assay were as described previously (Yu., S. M., et al (1990), supra).
The results were shown in FIG. 5A, 5B and 5C, in which: (5A) Fragments A, B and C were three consecutive 40 bp synthetic DNA fragments at the 5' end of HS501. Filled box indicates the position of two imperfect directly-repeated pyrimidine boxes and a GARE-like element. Open box indicates the position of the 11 bp putative enhancer like element.
(5B) Interaction of aleurone proteins to fragments A, B, and C. The symbols (+) and (-) indicate reactions with or without protein extract, respectively. B1, B2, and B3 indicate positions of the three protein-DNA complexes. F indicates position of the free DNA probe. (5C) The nucleotide sequences of fragments A, B, and C. Numbers indicate positions of the three fragments relative to the transcription start site. Underlines indicate positions of the pyrimidine boxes., Asterisks (*) indicate position of the GARE-like element. Dash line indicates position of the enhancer-like element.
Results
(A) Cloning and characterization of the rice cDNA
The rice cDNA library was screened with the .alpha.-amylase gene OSamy-c (J. K. Kim and R. Wu (1992), Plant Mol. Biol., 18: 399-402) as the probe. Four of the .alpha.-amylase cDNA clones showing different restriction patterns were chosen for subcloning into the plasmid vector pBluescript. The resultant clones were designated as .alpha.Amy6-C (Oryzae sativa .alpha.-amylase cDNA), .alpha.Amy7-C, .alpha.Amy8-C and .alpha.Amy10-C with insert sizes of 0.6, 1.0, 1.4, and 1.5 Kb, respectively. The 3' end regions of these cDNA clones were further subcloned and sequenced (FIGS. 1A and 1B). The sequenced 3' regions of .alpha.Amy6-C, .alpha.Amy7-C and .alpha.AmyS-C are found identical to those of the reported rice .alpha.-amylase genes RAmy3B (Sutliff, T. D., et al (1991) , Plant Mol. Biol., 16: 579-591), RAmy1A (Huang, N., et al (1990a) Plant Mol. Biol., 14: 655-668), and RAmy3E (Huang, N., et al (1990b), Nucl. Acids Res., 18: 7007-7014), respectively. The genomic DNA corresponding to .alpha.Amy10-C has not yet been reported. The DNA and deduced amino acid sequence of genomic rice .alpha.-amylase genes corresponding to .alpha.Amy6-C, .alpha.Amy7-C, .alpha.AmyS-C and .alpha.Amy10-C are respectively set out in detail in SEQ. ID. NO's.: 1 and 2, 3 and 4, and 5 and 6, respectively. The DNA sequence of .alpha.Amy10-C is set out in SEQ. ID. NO:7, in which .alpha.Amy10-C was sequenced once only.
(B) Construction of the rice .alpha.-amylase gene-specific probes
Comparison of nucleotide sequences of the 3' untranslated regions shows very low identity (23-27%) among the four .alpha.-amylase cDNA clones (FIGS. 1A and 1B), except .alpha.Amy7-C and .alpha.Amy10-C which showed 69% identity. Restriction sites were selected for separation of the nonhomologous (gene-specific) regions from the homologous regions of these four cDNA clones and for the preparation of antisense RNA probes. The restriction enzymes used and the nucleotide sequences of the gene-specific regions are shown in FIGS. 1A and 1B.
The gene-specific sequences-corresponding to each of the four cDNAs are designated as .alpha.Amy6-C-3', .alpha.Amy7-C3', .alpha.Amy8-C-3' and .alpha.Amy10-C-3'. Appropriate regions were selected for .alpha.Amy10-C-3' in which there is very low homology with .alpha.Amy7-C-3'. Cross-hybridizations were then performed to determine the gene-specificity and the results showed that each probe only hybridized to their respective parental cDNA (FIG. 2). None of these gene-specific probes hybridized to OSamy-c, which was originally used as the probe to screen the cDNA library. The results demonstrated that the four gene-specific probes are able to discriminate different .alpha.-amylase genes.
(C) The rice .alpha.-amylases are encoded by a gene family
Identification of the four distinct a-amylase cDNAs indicates that the rice .alpha.-amylases are encoded by a gene family. To determine the number of .alpha.-amylase genes in rice, total genomic DNA isolated from rice leaves was digested with various restriction enzymes and probed with the entire .alpha.Amy10-C sequences at low stringency (FIG. 3). Eight or nine restriction fragments were observed when total DNA was digested with EcoR I. The result generally is in agreement with the reported restriction maps of the rice .alpha.-amylase genes (Huang, N., et al (1990a), supra). Since two .alpha.-amylase genes were shown to be linked on one EcoR I fragment (Huang, N., et al (1990b), supra), the entire rice genome is estimated to contain at least 10 genes. Parallel genomic DNA blots were also hybridized with the four rice .alpha.-amylase gene-specific probes. Each gene-specific probe hybridized specifically to only one restriction fragment (data not shown) further confirming that each probe is derived from one .alpha.-amylase gene.
(D) Expression of .alpha.-amylase genes in rice germinating seeds
To determine whether the expression of different members of a .alpha.-amylase gene family are regulated in a same manner during seed germination, gene-specific probes were used to study the expression of individual .alpha.-amylase genes in GA.sub.3 -treated germinating seeds. The accumulation of .alpha.-amylase mRNA in aleurones as a function of time after GA.sub.3 addition was determined by RNA blot analysis (FIG. 4A). Probe made from pOSamy-c containing the coding region of a rice .alpha.-amylase gene was expected to hybridize to mRNAs of most, if not all, .alpha.-amylase genes. The .alpha.-amylase mRNA was barely detectable at day 1, rapidly accumulated and reached their maximal levels at day 4, then rapidly turned over between day 4 and day 5. A rice actin cDNA clone, pcRAc1.3 (McElroy, D., et al (1990), Plant Mol. Biol., 14: 163-171), whose expression was not affected by GA.sub.3 was used as an internal control.
Level of mRNA showm in FIG. 4A was quantified by measuring the signal intensity of the autoradiogram using a densitometer. The relative mRNA accumulation of each .alpha.-amylase gene at each day was determined by comparison of mRNA levels with their peak level at day 4 (Table 1). The mRNA of each .alpha.-amylase gene accumulated at a similar rate, except that of .alpha.Amy8-C, which almost reached peak level at day 3. However, the mRNAs of .alpha.Amy6-C and .alpha.Amy8-C were turned over at higher (2-fold) rates than those of .alpha.Amy7-C and .alpha.Amy10-C. The mRNA levels of .alpha.Amy7-C and .alpha.Amy10-C were reduced to 1/2, in contrast, those of .alpha.Amy6-C and .alpha.Amy8-C were reduced to 1/4, of their highest levels at day 5. Afterward all the mRNA levels were reduced at similar low rates. The results show that expression of the four .alpha.-amylase geens in germinating seeds are temporally coordinated but quantitively distinct.
(E) Expression of .alpha.-amylase genes in cultured suspension cells of rice
Previously, we have shown that the expression of amylase genes in cultured suspension cells of rice is induced by the deprivation of carbohydrate nutrient (Yu, S. M., et al (1991), supra). In that report, OSamy-c was used as a probe to study the expression of the entire .alpha.-amylase gene family in suspension-cultured cells. Here, gene-specific probes were used to determine the expression pattern of different .alpha.-amylase genes. We have shown that the sugars (analyzed by the anthrone reaction) in the sucrose-containing medium were depleted to almost undetectable levels at day 12. A concomitant increase in .alpha.-amylase mRNA was observed at day 12 (Yu, S. M., et al (1991), supra). Therefore, RNA's purified from cells grown in the sucrose-containing medium for 8, 10, 12, and 14 days were used for the RNA blot analysis (FIG. 4B). A cDNA clone, pOScx, which was randomly chosen from the same cDNA library, and whose expression was not affected by sugar depletion, was used as an internal control.
Level of mRNA shown in FIG. 4B was also quantified and the relative mRNA accumulation of each .alpha.-amylase gene at each day was determined by comparison of mRNA levels with their basal level at day 8 (Table 2). Expression of .alpha.Amy7-C and .alpha.Amy8-C was induced 6- and 37-fold, respectively, at day 12 and continued to increase at day 14. Expression of .alpha.Amy10-C was induced later with a 5-fold increase at day 14. Expression of .alpha.Amy6-C also increase 4-fold at day 12, however, it decreased to basal level at day 14. Expression of another .alpha.-amylase gene, .alpha.Amy3-C, was increased 5-fold after sugar starvation (Yu, S. M., unpublished result). Therefore, among the five .alpha.-amylase genes examined so far, .alpha.Amy8-C is the most abundantly expressed gene after sugar depletion.
In addition, it is worthwhile noting that .alpha.Amy8-C is one of the major genes whose transcripts constitute the 40-fold increase of total .alpha.-amylase transcripts as detected with probe of OSamy-c. The results show that expression of the four .alpha.-amylase genes in response to carbohydrate starvation in the cultured cells is temporally and quantitatively regulated.
(F) Specific regions of the promoter of a rice .alpha.-amylase gene interacting with protein factors in the GA-treated aleurone layer
HS501 is a DNA fragment which is located at the 5' end promoter region of a rice .alpha.-amylase gene, OSAmy-b (Ou-Lee, T. M., et al. (1988), supra), and its DNA sequences have been presented (Yu, S. M., et al. (1990), supra). Nucleotide sequence of HS501 was later found identical to that of RAmy3C which encodes a complete rice .alpha.-amylase isozyme (Sutliff, T. D., et al. (1991), supra). DNA sequence of HS501 includes 260 nucleotides of the 5' non-coding region, and 270 nucleotides in the first and part of the second exons. HK350 is a 3' end-deleted derivative of HS501 and contains the entire 5' non-coding (260 bp) and the first exon regions (90 bp) of HS501. RNA blot analysis showed that .alpha.-amylase mRNA of aleurone cells, detected by probing with HK350, was also increased after GA.sub.3 treatment (FIG. 4A).
Previously, we have shown that the 5' end of HS501 is important for stable formation of a protein-DNA complex (Ou-Lee, T. M., et al. (1988), supra; Yu, S. M., et al. (1990), supra). To more precisely localize the protein binding sites in HS501, we synthesized three consecutive double-stranded 40 bp oligonucleotides, designated as A, B and C, corresponding to the 5' end of HS501 (FIG. 5A). Proteins were extracted from the aleurone tissues of GA.sub.3 -treated germinating seeds and interactions between aleurone proteins and the synthetic DNA fragments were detected by the gel retardation assay (FIG. 5B). Interaction of the extract with fragments B and C resulted in the formation of complexes B1, B2 and B3 (FIG. 5B, lanes 4 and 6). Very weak, if any, binding could be detected between the protein extract and fragment A (FIG. 5B, lane 2). Comparison of DNA fragments A, B and C reveals that the three fragments shared some similarity (FIG. 5C). It is not clear whether the weak binding of fragment A to the proteins was due to low affinity or non-specific binding. Nevertheless, the result indicates that there are protein binding sites within fragments B and C.
(G) GA.sub.3 -dependent and sequence-specific protein factors which bind to HS501
We carried out another protein/DNA binding assay to determine whether or not the DNA-binding protein is GA.sub.3 -inducible. Proteins were extracted from the aleurone tissues of de-embryoed seeds which had been treated either with or without GA.sub.3 for three days. Only the aleurone extract from GA.sub.3 -treated seeds gave rise to three complexes using fragment B (FIG. 6, lane 4) or C (data not shown). The aleurone extract did not bind to fragment A (data not shown). No DNA/protein interaction was detected between the aleurone extract from seeds untreated with GA.sub.3 and fragment B (FIG. 6, lane 2). The results indicate that the aleurone proteins which bind to fragments B and C are GA.sub.3 dependent.
Conclusions
(1) The availability of gene-specific probes corresponding to each of the four .alpha.-amylase cDNAs has enabled us to examine the abundance of mRNA encoding specific .alpha.-amylase isozymes. Expression of the individual .alpha.-amylase gene was found to be coordinately regulated and their mRNAs were accumulated at similar rates and levels in the aleurone layer of germinating seeds of rice. However, differences in the turnover rates of mRNA of different .alpha.-amylase genes indicate a possible differential regulation on the expression of different .alpha.-amylase genes in germinating seeds. The four .alpha.-amylase genes expressed in germinating seeds were expressed constitutively at low levels in cultured cells when sugars were still present in medium. Expression of three of the four .alpha.-amylase genes were induced after sugars are depleted from the medium, and only .alpha.Amy6-C displays a different expression pattern from the other three genes. It is not known whether different .alpha.-amylase isozymes perform different functions in the starch hydrolysis in rice, or whether the regulatory machinery is differentially acting on a set of .alpha.-amylase genes which have similar structures and/or functions. Further investigations on the regulation and expression of different members of the .alpha.-amylase gene family in different tissues, and their structural and functional relationships, should help us to better understand the physiological roles of .alpha.-amylases in rice.
(2) GA.sub.3 and sugars regulate expression of the same .alpha.-amylase genes. Whether the two modes of regulation operate through an identical or different molecular mechanism is not known. As expression of .alpha.Amy8-C was GA.sub.3 regulated in germinating seeds and is one of the major metabolite-regulated genes in suspension-cultured cells, it would be a good model gene for such studies. Molecular mechanisms underlying the two different modes of regulation and interactions between them will be the focus for further studies.
(3) Aleurone tissues contain proteins that interact with fragments B and C of HS501 only in the presence of GA.sub.3. Fragment C contains an 11 bp fragment (GTTGCGTTTCT) from positions -108 to -118 which is similar to the animal core enhancer ##STR1## (Gillies, S. D., et al., Cell (1983), 33: 717-728; Weiher, H., et al (1983) Science, 219: 629-631). Fragment B contains two pyrimidine boxes ##STR2## from positions -145 to -152 and positions -157 to -164 which are similar to the consensus sequences ##STR3## found in several .alpha.-amylase genes of rice, wheat, barley and other GA-inducible genes such as .beta.-glucanase, carboxypeptidase and aleurain (Huang, N., et al (1990a), supra). Promoter deletion analysis demonstrated that sequences encompassing two of the three pyrimidine boxes in the promoter region of a wheat .alpha.-amylase gene, .alpha.Amy2/54, are required for high level expression and GA.sub.3 regulation of this gene (A. K. Huttly and D. C. Baulcombe (1989), supra). Mutation of the pyrimidine box in the promoter region of a barley .alpha.-amylase gene, Amy32b, significantly decrease both the absolute level of expression and the effect of GA.sub.3 on expression (Lanahan, M. V., et al (1992), Plant Cell, 4: 203-211). In addition, sequence immediately 3' to the second pyrimidine box in fragment B of HS501, reads TAAATGAG from positions -138 to -145, sharing conservation with the putative GARE element TAACAGAG (Huang, N., et al (1990a), supra; Lanahan, M. V., et al (1992), supra) which is shown to mediate hormonal regulation of the .alpha.-amylase gene (Lanahan, M. V., et al (1992), supra; Skriver, K., et al (1991), supra). Whether or not the GA-responsive proteins, the pyrimidine boxes, and the putative GARE element represent the trans- and cis-regulatory elements responsible for GA stimulation of the rice .alpha.-amylase genes remain to be determined.
EXAMPLE II
In this experiment, the .alpha.Amy8 gene was selected from the foregoing four .alpha.-amylase genes for further studying the construction of a chimeric gene containing GUS/NPTII, the expression of which was under the control of the promoter region of said .alpha.Amy8 gene, and nopaline synthase gene (NOS), respectively.
A) Materials and Methods
1) Plant materials
The rice variety used for transformation was Oryzae sativa L. cv. Tainung 62. At 10-12 days post-anthesis, seeds were dehulled, sterilized with 1% NaOCl and 1 drop of Tween-20 for 90 min., and washed extensively with sterile distilled water. Immature embryos were excised aseptically in a lamina flow bench. Excised embryos were placed on N6RD medium (Chan, M. T., et al (1992), supra) containing N6 salts (Chu, C. C., et al, Scientia Sinica 18: 659-668, 1975), N6 vitamins, 3% sucrose, 0.8% agarose (w/v), 2 .mu.g/l 2,4-D, and cultured at 25.degree. C. for 16 hours under light (1000 lux). Two days later, the immature embryos were inoculated with Agrobacterium.
2) Bacterial strain and plasmid:
An isolated 1.2 kb fragment, just upstream of the coding region of a rice .alpha.-amylase gene .alpha.Amy8, was joined to the E. coli .beta.-glucuronidase (GUS) (Jefferson, R. A., Plant Mol. Biol. Rptr., 5: 387-405, 1987) with a nopaline synthase (NOS) gene terminator to test the promoter's activity. This chimeric gene [.alpha.Amy8 (1.2 kb)/GUS] was inserted between restriction sites Xba I and Sal I of multicloning regions of the binary vector plasmid pBIN19 (Bevan, MOW., Nucl. Acids Res., 12: 8711-8721, 1984) to generate a new plasmid pAG8 (FIG. 7). Plasmid pAG8 was transfected into Agrobacterium tumefaciens strain A281 (Hood, E. F., Bio/technology 2: 702-709, 1984) using the freeze-thaw method (Holster, M., et al (1978), Mol. Gen. Genet., 163: 181-187). Agrobacterium tumefaciens was grown overnight at 28.degree. C. in YEB medium (Zaenen, J., J. Mo. Biol., 86: 109-127, 1974) containing 100 mg/l kanamycin.
B) Transformation
Twenty-five immature embryos were wounded by sterilized forceps and scalpels and co-cultivated overnight with 25 .mu.l of overnight Agrobacterium culture in a petri dish containing 10 ml of potato suspension culture (PSC), then incubated at 26.degree. C. in the dark for 3 days. For the control, 10 ml of fresh potato suspension culture medium (Chang, H. H., (1991), supra) without addition of potato suspension cells was used. Conditions for potato suspension culture have been described previously (Chang, H. H., (1991), supra).
The infected immature embryos were washed once with potato suspension culture medium containing 500 .mu.g/ml cefotaxime to kill the Agrobacterium and then transferred to N6RF medium containing N6 salts, N6 vitamins, 42.5 .mu.g/ml 4-fluorophenoxyacetic acid (4-FPA), 3% sucrose, 0.8% (w/v) agarose, 40 .mu.g/ml G-418, and 500 .mu.g/ml cefotaxime. The pH of the medium was adjusted to 5.7 before autoclaving. The embryos were cultured at 25.degree. C. for 16 hours under light (2000 lux) and subcultured at weekly intervals.
C) Selection and regeneration of transformants
Calli were formed from the cultured embryos 3 weeks after Agrobacterium inoculation. The calli were transferred to N6RFB medium (similar to N6RF but containing 13 .mu.g/ml 4-FPA, 1 .mu.g/ml 6-benzylamino-purine (6-BAP), 40 .mu.g/ml G-418 and 200 mg/ml cefotaxime) for selection of transformants. After selection for 3 weeks, calli were transferred to N6 medium for shoot regeneration and root development. Regenerated plants were eventually transferred to pot soil in the greenhouse and grown to self-pollination. Segregation of the kanamycin resistant phenotype in the progeny was analysed by germinating the R1 seeds on MS medium containing 300 .mu.g/ml kanamycin.
D) DNA isolation and analysis of gene incorporation
DNA from transgenic plants was isolated according to the CTAB method (M. G. Murry and W. F. Thompson, Nucl. Acids Res., 8: 4321-4325, 1980). DNA bolt analysis was performed as described by Maniatis et al (Molecular Cloning: A Laboratory Mannual, pressed by Cold Spring Harbor Laboratory, 1982). The probe for GUS was made from the BamH I-Sst I restriction fragment of the pBI221 plasmid (Clontech, Palo Alto, Calif.). The DNA probe was labeled with [.alpha..sup.32 P]dCTP using the random primer method (A. P. Feinberg and B. Vogelstein, Anal. Biochem., 132: 6-13, 1983).
To demonstrate the absence of any Agrobacterium contamination in the transformed plants, the same nylon filters hybridized with GUS DNA were stripped and rehybridized with the probe made from the Hind III 18 and Hind III 27 DNA fragment containing the vir B and vir D regions of pTiC58 (Depicker, A., et al (1980), Plasmid, 3: 193-211; Janssens, A., et al (1986), Plant Sci., 47: 185-193).
E) Assay for neomycin phosphotransferase II (NPTII) activity
The NPTII activity in the putatively transformed calli and plants was assayed in at least four replicates using a modification of a method described by Radke, S. E., et al (Theor. Appl. Genet., 75: 685694, 1988). Leaf tissue (100 mg fresh weight) was ground in a 1.5 ml Eppendorf tube with an equal volume (100 .mu.l) of extraction buffer (2.5 mM Tris (pH 6.8), 0.143 mM .beta.-mercaptoethanol, 0.27 mM leupeptin), and centrifuged for 15 min. at 4.degree. C. Thirty .mu.g protein were mixed with 10 ml of reaction buffer A (67 mM Trismaleate, 42 mM MgCl.sub.2, 400 mM NH.sub.4 Cl, 1.7 mM dithiothreitol, and 0.4 mg/ml kanamycin sulfate) or reaction buffer B (identical to reaction buffer A but without kanamycin).
Five .mu.l of ATP solution (1.0 uCi [F-32P]ATP and 0.75 mM ATP in reaction buffer B) was added. The samples were incubated in a 30.degree. C. water bath for 30 min., then blotted onto three layers of Whatman P81 ion exchange paper placed on top of one piece of Whatman 3 MM paper using a "Hybri-Dot" blotting apparatus (BRL). All the ion exchange papers were washed twice with distilled water for a total of 4 min. and incubated in a 10 ml solution containing 1 mg/ml) proteinase K and 1% SDS at 65.degree. C. for 60 min. The papers were then washed once with distilled water at room temperature for 4 min. and three times with distilled water at 85.degree. C. for 4 min. The 3 pieces of paper were air-dried, stacked in their original positions, and exposed to X-ray film (Kodak) with an intensifying screen.
F) Assay of .beta.-glucuronidase (GUS) activity
To measure GUS activity in the putatively transformed calli and plants, at least two replicates of each sample were assayed according to R. A. Jefferson's method ("Analysis of gene organization and expression in plants," In: Plant Genetic Transformation and Gene Expression, A Laboratory Manaul, Blackwell Scientific Publications, Oxford, Draper, J., et al (eds) pp. 263-339, 1988). Samples were homogenized with GUS extraction buffer (50 nM sodium phosphate (pH 7.0), 10 mM EDTA, 10 mM Triton X-100, 0.1% sarkosyl, and 10 mM .beta.-mercaptoethanol). Twenty .mu.g protein with an equal volume of SDS sample buffer (62.5% mM Tris-HCl, 0.23% SDS, 10% glycerol, 50 mM .beta.-mercaptoethanol, and 0.001% bromophenol blue) were incubated at room temperature for 15 min. Electrophoresis was run overnight at room temperature at 3 V/cm.
The gel was washed with 100 ml of GUS extraction buffer four times within 2 hours, incubated with GUS fluorometric buffer (1 mM methyl umbelli-ferylglucuronide in GUS extrac-tion buffer) on ice for 30 min., and incubated at 37.degree. C. in the dark for 30 min. The reaction was stopped with 0.2 M Na.sub.2 CO.sub.3. The gel was illuminated by a 365 nm UV lamp with a Kodak 2E Wratten filter and photographed.
Localization of GUS expression in the transformed plants was evaluated by 5-bromo-4-chloro-3-indolyl glucuronide (X-gluc) histochemical assay (Benfey, P. N., et al (1989), EMBO J., 8: 2195-2202). Sections of leaf blade, sheath, stem or root of nontransformed or transformed 4-month-old plants were cut with a Vibratome (Oxford) sectioning device. Sections of 100 to 200 microns were incubated in a solution containing 1 mM X-gluc, 10 mM EDTA, 100 nM NaH.sub.2 PO.sub.4.H.sub.2 O (pH 7.0), and 0.1% Triton X-100 at 37.degree. C. for 12 to 17 hrs. After staining, sections were rinsed in 70% ethanol for 5 min and chlorophyll in the sections was cleared by incubation for 10 min. in a solution of 5% formaldehyde, 5% acetic acid and 20% ethanol, followed by incubation for 2 min. in 50% ethanol, 2 min. in 100% ethanol, and two washings in distilled water. The sections were examined under a microscope. GUS activity in the R1 progeny was assayed by staining.
The R1 seeds were first germinated in MS medium containing 2 .mu.g/ml 2,4-D and 300 .mu.g/ml kanamycin to induce callus formation. Calli were formed from the germinating seeds after 1 week. A portion of each callus was removed and subjected to a modified GUS histochemical staining assay (Benfey, P. N., et al (1989), supra). Briefly, calli of the R1 progeny or control were incubated at 37.degree. C. for 12 to 17 hrs. in a solution containing 1 mM X-gluc, 10 mM EDTA, 100 mM NaH.sub.2 PO.sub.4.H.sub.2 O (pH 7.0), and 0.1% Triton X-100. Photographs were taken with a Kodacolor 64 film under a dissecting Microscope (Olympus).
G) PCR
Two sequences in the GUS coding region were chosen to amplify a 410 bp fragment within the gene: The 5' primer (ACGTCCTGTAGAAACCCCAA) and the 3' primer (AGTTCAGTTCGTTGTTCACACA) located in the GUS coding region 3 bp and 417 bp downstream of the translation initiation site (ATG), respectively. One hundred .mu.g of pAG8 were used as positive control; 100 ng of total rice DNA from young leaves of the R1 progeny were used. PCR was carried out in a 50 .mu.l solution containing 50 mM KCl, 10 mM Tris-HCl, 15 mM MgCl.sub.2, 0.1% gelatin (w/v), 1% Triton X-100, 0.2 mM of each deoxynucleoside triphosphate (dATP, dCTP, dGTP, dTTP), 2.5 units of Taq DNA polymerase (Promega), and 0.25 mM of each primer.
The sample was preheated at 94.degree. C. for 5 min. and subjected to PCR amplification for 27 cycles. Cycling was controlled by a programmable thermal cycler (MJ Research, Inc.) programmed with the following conditions: denaturation, 94.degree. C. for 1 min.; annealing, 58.degree. C. for 2 min.; extension, 72.degree. C. for 3 min. The sample was then incubated at 58.degree. C. for 2 min. and 72.degree. C. for 10 min. Five .mu.l of the PCR product was electrophoresed in a 1% agarose gel and detected by staining with ethidium bromide. Southern blots of PCR products were hybridized with a probe made from the BamH I-Sst I GUS restriction fragment.
Results
A) Transformation of immature rice embryos by Agrobacterium tumefaciens
Previously, we have shown that transformation of rice using Agrobacterium can be improved by the addition of PSC (Chan, M. T., et al (1992), supra). Here, presence of PSC with the Agrobacterium inoculum increased the transformation efficiency almost 3-fold (Table 3). Approximately 6.8% of immature rice embryos inoculated with Agrobacterium formed calli and proliferated on selective medium. The uninoculated or inoculated but non-transformed immature embryos turned brown and died within 3 weeks (FIG. 8A).
After culture of calli, shoots developed rapidly and roots formed spontaneously after 4 weeks (FIG. 8B). Among the 250 immature embryos inoculated, 17 calli and 4 plants were recovered from culture. The four transgenic plants were designated T1, T2, T3 and T4. These plants were ready to be transplanted into soil after 9 weeks of culture (FIG. 8C). Only one plant, T1, survived to flower and produce progeny (FIG. 8D-8F). This transgenic plant exhibited-normal phenotype and was fertile, except that it grew more slowly (about 14 weeks from being a 121 cm long plant to flowering) and produced less seeds (total 75 seeds) than a wild type plant. The other three transgenic plants were also transplanted into soil but did not survive.
B) DNA analysis of transformants
To provide physical evidence for the integration of foreign DNA into the genome, Southern blot analysis of restriction digests of genomic DNA from leaves of the 4 transgenic plants (T1, T2, T3 and T4) was performed using the GUS DNA from pBI221 as a probe (FIG. 9). The size of the undigested rice genomic DNA (Unc) was about 50 kb (FIG. 9, lanes 2 and 6). After digestion with BamH I (B), GUS DNA was detected as a fragment of the expected size 2.3 kb (FIG. 9, lanes 3, 7 and 9), the same size as that present in pAG8 (FIG. 9, lane 1). After digestion with Hind III (H) or Pst I (P), the 50 kb band disappeared and the lower molecular weight DNA fragments appeared (FIG. 9, lanes 4, 5, 8, 10 and 11).
Transgenic plant T4 appeared to have two integration sites for the GUS gene as two hybridization bands were detected when DNA was digested with Hind III (FIG. 9, lane 11). Since the GUS DNA probe only hybridized to DNA from the 4 transgenic plants but not to the non-transformed control plant (NT) (FIG. 9, lane 12), this indicates that the GUS gene was integrated into the rice genome.
To prove that the GUS DNA detected in FIG. 9 did not result from contamination with Agrobacterium in the transgenic plants, the same nylon filter was reprobed with vir B and vir D DNA. As the vir genes are not located on the Ti-plasmid, Southern blot analysis using vir DNA as a probe should provide a reliable way to detect Agrobacterium contamination. The Agrobacterium strain A281 used in this experiment was derived from strain C58 which carries pTiC58. A probe made from the Hind III 18 and Hind III 27 DNA fragments containing the vir B and vir D regions of pTiC58 should thus hybridize to DNA of Agrobacterium. However, no hybridization band was observed when using the vir DNA as a probe (data not shown), clearly demonstrating that the GUS DNA detected in the genome of the transgenic plants was not due to persisting Agrobacterium cells in the rice tissues.
C) Expression of GUS and NPTII in the transgenic calli and plants
The GUS coding sequence in pAG8 was placed downstream of the putative 5' promoter region of an .alpha.-amylase gene (.alpha.Amy8) so as to make a transcriptional fusion. To investigate the promoter function of the 1.2 kb long 5' region of this .alpha.-amylase gene, expression of the GUS gene was determined by the presence of GUS activity in the transgenic calli and plants.
GUS present in the cell extracts migrated in an SDS-polyacrylamide gel with an apparent molecular weight of 69 kDa (FIG. 10A). The levels of GUS activity that could be detected in the four transgenic plants and callus C1 were similar (FIG. 10A, lanes 2-6). The lower level of GUS activity in transgenic callus C2 (FIG. 10A, lane 7) seems to be coupled with its lower level of NPTII activity (FIG. 10B, lane 6. No GUS activity was detected in the non-transformed callus (NT) (FIG. 10A, lane 8). The results suggest that the 1.2 kb 5' region of .alpha.Amy8 contains an efficient promoter for regulating GUS gene expression.
Plasmid pAG8 contains the NPTII coding region driven by the nopaline synthase promoter. Consequently, selection for plants carrying foreign genes should be achieved using media containing G418. The NPTII activity was further determined in 8 randomly chosen transformed calli (R0) and 3 transgenic plants (T1, T2, and T3). All of the 8 transgenic calli expressed NPTII activity and data for 2 of them (C1 and C2) are presented (FIG. 10B, lanes 5 and 6). NPTII activity was also detected in the 3 transgenic plants (FIG. 10B, lanes 1, 2, and 3). No activity was observed in the non-transformed callus (FIG. 10B, lane 7) and plant (FIG. 10B, lane 4).
D) Histochemical localization of GUS in transgenic rice plant
To localize the cellular expression pattern of the GUS gene driven by the 5' region of .alpha.Amy8, various tissues of the transgenic plant (T1) were sectioned and subjected to histochemical staining (FIGS. 11A-11J). Blue staining of sections appeared 17 hr after incubation in the substrate. GUS expression was observed in all cell types of leaf blade (FIG. 11B, 11C), stem (FIG. 11E, 11F), and sheath (FIG. 11G). Tissue sections of leaf blade and stem from non-transformed control plants displayed no staining (FIG. 11A, 11D). Transverse sections of root revealed that the epidermal cells were stained blue and the cortex cells were stained lightly (FIG. 11I). Unsectioned root hairs showed intense staining in the vascular cylinder and light staining in the cortex cells (FIG. 11J). No GUS expression was found in the sections of very young leaf blades which were embedded inside sheaths (FIG. 11H).
E) Analysis of R1 progeny
Of the 75 seeds harvested from the transgenic plant T1, 36 seeds were germinated on selective media (containing 300 .mu.g/ml kanamycin) to induce callus formation. Within 10 days, 32 germinating seeds formed calli and continued to grow and were identified as resistant. The other 4 germinating seeds also formed calli, but turned brown and died later. About half of each kanamycin resistant callus was removed and assayed for GUS activity.
Of the 32 calli assayed, 28 showed blue staining and 4 calli remained yellow, similar to the non-transformed control (data for 4 of them are presented in FIG. 12). Calli derived from different transgenic R1 seeds showed considerabie variation in GUS activity, as revealed by different degrees of blue staining (FIG. 12).
Among the remaining 39 seeds of T1, 18 seeds were germinated and grown in a greenhouse. DNA was isolated from young leaves of 13 of these R1 plants when they were 10 cm tall. The DNA was subjected to PCR amplification of a 410 bp fragment within the GUS coding region (FIG. 13A). Identification of the amplified DNA was established by blot hybridization to a .sup.32 P-labeled GUS DNA probe (FIG. 13B). These results further confirmed the presence of GUS genes in the R1 progeny of the original transformant.
Discussion
Although several methods for the transformation of rice using protoplasts or suspension cells are available at present, attempts to regenerate mature plants from the transformed protoplasts or suspension cells of many rice varieties have been unsuccessful. Methods based on the use of the soil bacterium Agrobacterium tumefaciens are still preferred in many instances, as Agrobacterium-mediated transformation does not require protoplasts and, in general, results in higher transformation efficiency and a more predictable pattern of foreign DNA integration than other transformation techniques (Czernilofsky, A. P., et al (1986), DNA, 5: 101-113). Here we show that transgenic rice plants are successfully produced using an Agrobacterium-mediated DNA transfer system.
Two factors may have contributed to the success in rice transformation and regeneration. The first factor is the addition of PSC during the co-cultivation of Agrobacterium with the immature rice embryos. PSC probably contains substances which enhance the Agrobacterium-mediated T-DNA transfer process, since PSC induced the formation of calli one week earlier and enhanced the frequency of transformation about 3-fold (Table 3). PSC is rich in acetosyringone and sinapinic acid (Chang, H. H., et al (1991), supra), which are generally believed to enhance transformation of various plant species (Stafer, W., et al (1985), supra). However, the role of these two compounds in the success or efficiency of transformation is not clear at this time. The transformation percentage of 1.6% that we obtained for producing transgenic plants would render the use of Agrobacterium to transfer genes into rice more feasible.
The second factor for successful transformation and regeneration is the use of immature rice embryos (10 to 12 days after pollination) as the transformation materials, since they may contain less inhibitors or more virulence inducers than mature embryos to T-DNA transfer. Immature embryos of maize have also been shown to be competent for Agrobacterium-mediated gene transfer and that competence depends on genotype and developmental stage. Meristematic tissue of the immature embryo becomes competent at developmental stages that correlate with the differentiation of the first one to two leaf initials.(M. Schlappi and B. Horn (1992), Plant Cell, 4: 7-16).
Therefore, the immature embryos at some developmental stages may produce conditions which increase the success of T-DNA transfer, such as (a) the availability of vir gene-inducing substances, (b) low production of bacteriotoxic substances, (c) favorable endogenous hormone levels, and (d) the availability of receptors for attachment of Agrobacterium (M. Schlappi and B. Horn (1992), supra).
Although only four plants could be regenerated from the transformed calli in this experiment, all these plants were proved to be real transformants. Integration of chimeric genes into the genomes of the four transgenic plants was confirmed by hybridization of the restricted genomic DNA. In addition, our experiments ruled out the possibility of Agrobacterium contamination of the rice tissues as a possible source of the hybridization bands.
Detection of NPTII and GUS activities in the transgenic plants indicates that the integrated foreign genes were expressed. Our results also indicate that kanamycin can be used to select transformed rice cells from a mixed population of transformed and non-transformed cells. To avoid the occurrence of kanamycin escapees, it is important that selection be applied immediately after the co-cultivation.
Of the 4 regenerated transgenic plants, only one plant (T1) survived to flower and produce progeny. Transgenic plant T1 flowered in December, when the room temperature in the greenhouse was below 20.degree. C., but we don't know whether this was one of the reasons for its low yield (75 seeds). The transgenic R1 progeny inherited and expressed the NPTII and GUS genes, as shown by their resistance to kanamycin and expression of GUS activity. A 3:1 ratio was expected in the progeny from self-pollination, assuming that the gene was transmitted as a single dominant locus.
In the GUS staining assay in conjunction with kanamycin selection of calli derived from immature embryos of 32 R1 progeny, 28 were GUS positive and kanamycin resistant, 4 were GUS negative but kanamycin resistant, and 4 were GUS negative and kanamycin sensitive. This 28:8 or 3.5: 1 ratio indicates that GUS segregation in the R1 progeny of transgenic plant T1 is consistent with the predicted 3:1 Mendelian inheritance pattern in a heterozygous x heterozygeous cross.
The lack of GUS activity in the 4 kanamycin-selected R1 may indicate that the GUS gene was either absent or present but nonfunctional. Absence of the GUS gene in the kanamycin-resistant R1 could be due to deletion of the GUS gene via DNA rearrangement. PCR amplification of GUS DNA fragments was achieved from DNA of 13 out of 18 R1 plants tested. The 13:5 or 2.6:1 ratio is also close to the theoretical Mendelian segregation pattern.
The rice .alpha.-amylases are encoded by a multigene family which contains at least ten distinct members (Huang, N. et al (1990), Plant Mol. Biol., 14: 655-668). Genomic and cDNA clones representing different members of the .alpha.-amylase gene family have been isolated in our laboratory. Expression of the .alpha.-amylase gene, .alpha.Amy8, is GA.sub.3 -regulated in germinating seeds. This gene is also one of the major metabolite-regulated genes in cultured suspension cells of rice (Yu, S. M., et al., unpublished result). In our experiments, the DNA resulting from fusion of the 1.2 kb 5' flanking region of .alpha.Amy8 to the reporter gene GUS was transformed into rice. Expression of GUS in the transgenic rice indicates that this 1.2 kb fragment contains a functional promoter.
Thus, use of transgenic rice carrying a reporter gene under the control of an .alpha.-amylase promoter has provided a new tool for analyzing the regulatory elements in the .alpha.-amylase promoters. Such studies should lead to an understanding of the regulation of .alpha.-amylase gene expression in rice.
To our surprise, the histochemical localization of GUS activity indicated that the .alpha.Amy8 promoter was functional in all cell types of the mature leaves, stems, sheaths and roots of the transgenic rice plants. The only tissues which did not express GUS were the very young leaves embedded inside the sheaths. GUS was active in cells of the epidermis, mesophyll and vascular bundles of leaves. It was also active in the epidermis, cortex, and vascular cylinder of the roots. Therefore, the expression of .alpha.Amy8/GUS is not tissue-specific. Rather, it is temporally regulated in the transgenic plant, though it is not known at which growth stage of leaves .alpha.Amy8 begins its expression. Our histochemical studies were performed only with T1, the single transgenic plant that survived after being transferred to soil.
The possibility that .alpha.Amy8/GUS was inserted close to a very active enhancer in the rice genome, which could render high-level expression or loss of tissue-specific expression of the foreign gene cannot be ruled out. However, .alpha.Amy8 is apparently one of the major metabolite-regulated genes in cultured suspension cells (Yu, S. M., et al. (1992), Gene, inpress) and thus probably plays an important role in the carbohydrate metabolism of the vegetative tissues of rice.
Therefore, it is not totally surprising that the GUS gene driven by .alpha.Amy8 promoter is constitutively expressed in every cell type of different tissues of the transgenic plant. If this is also true for the naturally existing .alpha.-amylase gene in wild type plants, it would be interesting to know the physiological function of .alpha.Amy8 promoter in rice. The general distribution and levels of GUS activity obtained in different tissues of stably transformed rice plants indicate the potential of .alpha.Amy8 promoter as a positive control for studies in gene activity in transgenic rice.
In conclusion, this experiment demonstrates that immature rice embryos are susceptible to Agrobacterium-mediated transformation and that the foreign genes transferred are inherited by the next generation of the transformant.
In addition to the rice variety Tainung 62 (Japonica type) used in this experiment, T-DNA has also been successfully transferred into genomes of other rice varieties including Tainan 5 (Japonica type) and Taichung Native no. 1 (Indica type) using the same approach (M. T. Chan, H. H. Chang and S. M. Yu, unpublished result). Therefore, it is proposed that this simple approach can be applied to transform other rice varieties and, with modification, other monocot species.
EXAMPLE III
As noted from the beginning, an objective of the present invention is to provide a new gene expression system functional in plant host cells, thereby rendering the expressed gene product capable of being directly recovered from medium. To achieve this purpose, based upon the results obtained in Example II, further experiments were carried out to investigate the regulation of the promoter region of .alpha.Amy8 with respect to the expression of the foreign gene GUS in the present transgenic rice cells.
More specifically, it was studied whether or not the expression of said GUS gene under the control of said promoter will be influenced by a sugar-depleted or sugar-free condition. The following experiments adopted the materials and methods described in Example II.
Immature embryos of rice were transformed with Agrobacterium tumefaciens which carried the .alpha.AmFS/GUS chimeric gene (pAGS). Calli derived from the transformed embryos were then grown in liquid MS medium containing 2 .mu.M 2,4-D to establish a suspension culture of rice. The cell cultures were subcloned every 5 days. For this experiment, suspension cells were transferred to medium with (+) or without (-) sucrose for two days- RNA was purified from the treated cells and the GUS mRNA was detected by Northern blot analysis using .sup.32 P-labeled GUS DNA as probe. 10 .mu.g of total RNA was loaded in each lane. The results are shown in FIG. 14. To detect whether the expressed GUS protein was maintained in the transformed cells or secreted into the culture medium, rice suspension cells were grown and treated under conditions identical to the above experiment. Proteins were extracted from the treated cells or collected from the medium, subjected to Western blot analysis and detected with the GUS antibody. 20 .mu.g of total proteins were loaded in each lane. The results are shown in FIG. 15.
Results and Discussions
Referring to FIG. 14, NT indicates the non-transformed cells; C3, C7 and C11 are three independent transformed cell lines. The C11 cell line was deposited in the Fermentation Research Institute Agency of Industrial Science and Technology (FERM), Japan on Nov. 4, 1992, with the accession number of FERM BP-4064 under the Budapest Treaty. No GUS mRNA was detected in the non-transformed cells, either in the presence or absence of sucrose (lane 1 and 2). GUS mRNA was detected in cells of the three cell lines grown in medium containing sucrose (lanes 3, 5 and 7). The mRNA levels increased in cells grown in sucrose-free medium (lanes 4, 6 and 8).
In FIG. 15, arrow (.rarw.) indicates the position of GUS protein. No GUS protein was detected in the non-transformed cells or their culture media, either in the presence or absence of sucrose (lanes 1, 2, 8 and 9). No GUS protein could be detected in the transformed cells or media in the presence of sucrose (lanes 3, 5, 10 and 12), either. As expected, the GUS protein could be easily detected in the transformed cells and media in the absence of sucrose (lanes 4, 6, 11 and 13).
Accordingly, it can be confirmed from the above obtained results that the present gene expression system can achieve at least two main advantages. First, the expression of the .alpha.Amy8/GUS chimetic gene is well controlled by the promoter region of .alpha.Amy8, especially under the sugar-depleted or sugar-free condition of the culture medium. Hence, the present gene expression system comprising the promoter of an .alpha.-amylase gene can promote the quantitative production, under sugar-depleted or sugar-free condition, of a desired gene product, such as the GUS protein exemplified here. Second, inasmuch as the promoter region of said chimetic gene also includes a DNA sequence encoding the signal sequence of .alpha.-amylase, the expressed gene product (GUS) will be secreted into the culture medium, rendering said gene product recoverable from the culture medium. As a result, the procedures for recovery and purification of the desired gene product can be simplified, and the contamination therein can also be diminished.
From the above teachings, it is apparent that various modifications and variations can be made without daparting from the spirit and scope of the present invention. It is therefore to be understood that this invention may be practiced otherwise than as specifically described.
TABLE 1______________________________________Relative accumulation of .alpha.-amylase mRNA in germinating riceseeds as detected by .alpha.-amylase gene-specific probes. Days after germinationProbes 1 2 3 4 5 6______________________________________OSamy-c .sup. 0.sup.a 25 73 100 67 47.alpha.Amy6-C-3' 0 23 73 100 27 26.alpha.Amy7-C-3' 0 26 72 100 50 48.alpha.Amy8-C-3' 0 31 98 100 27 23.alpha.Amy10-C-3' 0 23 64 100 47 44______________________________________ .sup.a Level of amylase mRNA was determined by densitometric scanning of the autoradiograms shown in FIG. 6A, and corrected with the mRNA level of pcRAc1.3. The relative mRNA accumulation for each amylase gene was then determined by dividing the amylase mRNA level of each day by the mRNA level (peak level) of day 4.
TABLE 2______________________________________Relative accumulation of .alpha.-amylase mRNA in cultured suspensioncells of rice at later growth stages as detected by .alpha.-amylasegene-specific probes. Days in cultureProbes 8 10 12 14______________________________________OSamy-c .sup. 1.0.sup.a 3.8 39.5 38.8.alpha.Amy6-C-3' 1.0 1.3 4.1 1.2.alpha.Amy7-C-3' 1.0 1.8 6.2 9.8.alpha.Amy8-C-3' 1.0 2.2 37.0 44.5.alpha.Amy10-C-3' 1.0 1.3 1.2 5.0______________________________________ .sup.a Level of amylase mRNA was determined by densitometric scanning of the autoradiograms shown in FIG. 6B, and corrected with the mRNA level of pOScx3'. The relative mRNA accumulation for each amylase gene was then determined by dividing the amylase mRNA level of each day by the mRNA level (basal level) of day 8.
TABLE 3______________________________________Effect of PSC on the efficiency of rice-transformation byAgrobacterium Frequency No. of for inductionAgro- Addi- immature No. of of transgenicbacterium tion embryos Transgenic callus plantsStrains of PSC inoculated callus plant (%) (%)______________________________________A281 + 250 17 4 6.8 1.6(pAG8)A281 - 80 2 0 2.5 0(pAG8)______________________________________ *PSC = potato suspension culture
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 7(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2086 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE: (A) ORGANISM: Rice (Oryzae sativa)(B) STRAIN: CV. M202(vii) IMMEDIATE SOURCE:(A) LIBRARY: (EMBL) genomic(B) CLONE: .alpha.-Amy6-C(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: join(481..495, 572..1510, 1610..1891)(ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: join(481..495, 572..1510, 1610..1891) (x) PUBLICATION INFORMATION:(A) AUTHORS: Yu et al., Su-May(B) TITLE: Regulation of .alpha.-amylase- encoding gene expressionin germinating seeds and cultured cells of rice(C) JOURNAL: Gene(D) VOLUME: in press(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:AAGCTTCTGAAGCTGATGCGATCAAACCTCAAAAGACCATGGGCAGCAGCACGGAAGTT A60CAAACCGAAGCCGCGCGGCGCGCATACGCATCAGAAAGGCGCGCAATAACGGACCACCCA120TACGGCGGCCGCGCTCTGTTCGCGGCGTCCCTGCGCCTGCATCGCACGCCATCCAAGGCT180GCATAGCACGACGCATACATATCTCACGCGCCC TTTTTATCTGCTTATAAATGAGATAGC240CCACATAGCAGCGCTGCCGTTTCTCCTCTTCTCTCGTTGGGGGCAACCGAACTTATCCAA300CAACGATCCATCCATTGGCCAAGTGGCTGCCGTGCTGCACCTATAAATTCACATGCACCG360GCATGCCA CTCCACACAAGTGAGCTACTCGAAAGAAGCAGCAATGGCAAAGCGC414MetAlaLysArg-26-25ATAGCC TCAATGAGCAGCCTCCTCCTTATCGCCTTGCTCTGTCTGAGC462IleAlaSerMetSerSerLeuLeuLeuIleAlaLeuLeuCysLeuSer-20-15-10TCTCACT TGGCCCAAGCCCAGGTCCTCTTCCAGGTAAGCATCCTGTAGTACAA515SerHisLeuAlaGlnAlaGlnValLeuPheGln-515TGTCACATTACATAAAAAAAAATGACTTGCGTTTGAC ATGACTGTTCTTGGTGTAG571GGGTTCAACTGGGAGTCGTGGAAGAAGCAGGGCGGGTGGTACAACTTC619GlyPheAsnTrpGluSerTrpLysLysGlnGlyGlyTrpTyrAsnPhe10 1520CTCCATGGCCACGTCGACGACATCGCCGCGACCGGTGTCACGCACGTC667LeuHisGlyHisValAspAspIleAlaAlaThrGlyValThrHisVal25 3035TGGCTCCCACCGCCGTCGCACTCCGTCGCCCCGCAGGGATACATGCCG715TrpLeuProProProSerHisSerValAlaProGlnGlyTyrMetPro40 4550GGCCGGCTCTACGACCTGGACGCTTCCAAGTACGGCACGGGGGCAGAG763GlyArgLeuTyrAspLeuAspAlaSerLysTyrGlyThrGlyAlaGlu55 6065CTCAGGTCGCTGATCGCCGCCTTCCACAGCAAAGGCATCAAGTGCGTC811LeuArgSerLeuIleAlaAlaPheHisSerLysGlyIleLysCysVal7075 8085GCCGACATCGTCATCAACCACCGGTGCGCGGATTACAAGGATAGCCGT859AlaAspIleValIleAsnHisArgCysAlaAspTyrLysAspSerArg90 95100GGCATCTACTGCATTTTCGAGGGTGGCACGCCGGACAGCCGCCTCGAC907GlyIleTyrCysIlePheGluGlyGlyThrProAspSerArgLeuAsp105 110115TGGGGCCCCGACATGATCTGCAGCGACGACACGCAGTACTCCAACGGC955TrpGlyProAspMetIleCysSerAspAspThrGlnTyrSerAsnGly120 125130CGCGGTCACCGCGACACCGGCGCAGACTTCGGCGCGGCGCCCGACATC1003ArgGlyHisArgAspThrGlyAlaAspPheGlyAlaAlaProAspIle135 140145GACCACCTCAACACGCGTGTGCAGACAGAGCTGTCCGACTGGCTCAAT1051AspHisLeuAsnThrArgValGlnThrGluLeuSerAspTrpLeuAsn150155 160165TGGCTCAAGTCCGACGTCGGCTTCGACGGCTGGCGCCTCGACTTCGCC1099TrpLeuLysSerAspValGlyPheAspGlyTrpArgLeuAspPheAla170 175180AAGGGATACTCGGCGGCCGTCGCCAAGACGTACGTCGACAACACCGAC1147LysGlyTyrSerAlaAlaValAlaLysThrTyrValAspAsnThrAsp185 190195CCGTCCTTCGTCGTCGCCGAGATATGGAGCAACATGCGTTACGACGGC1195ProSerPheValValAlaGluIleTrpSerAsnMetArgTyrAspGly200 205210AACGGTGAGCCGTCGTGGAACCAGGACGGTGACCGGCAGGAGCTGGTG1243AsnGlyGluProSerTrpAsnGlnAspGlyAspArgGlnGluLeuVal215 220225AACTGGGCGCAGGCCGTCGGTGGCCCTGCGTCAGCGTTCGACTTCACG1291AsnTrpAlaGlnAlaValGlyGlyProAlaSerAlaPheAspPheThr230235 240245ACCAAGGGCGAGCTGCAGGCGGCGGTGCAAGGTGAGCTGTGGCGGATG1339ThrLysGlyGluLeuGlnAlaAlaValGlnGlyGluLeuTrpArgMet250 255260AAGGACGGCAACGGCAAGGCGCCGGGGATGATTGGCTGGCTGCCAGAG1387LysAspGlyAsnGlyLysAlaProGlyMetIleGlyTrpLeuProGlu265 270275AAGGCCGTCACCTTCATCGACAACCATGACACTGGCTCCACACAGAAC1435LysAlaValThrPheIleAspAsnHisAspThrGlySerThrGlnAsn280 285290TCATGGCCGTTCCCCTCCGACAAGGTCATGCAGGGCTACGCCTACATC1483SerTrpProPheProSerAspLysValMetGlnGlyTyrAlaTyrIle295 300305CTCACACACCCTGGAGTACCCTGCATTGTGAGTCCTCAGCTGCATGA1530LeuThrHisProGlyValProCysIle310315ATACGAATGCCATAAAGAAAAATCTAATTT TCTCAACCAGTTTCTCCGACTAAATTCTGT1590TTATTGACTATGTGTGCAGTTCTACGACCATGTATTTGACTGGAACCTGAAG1642PheTyrAspHisValPheAspTrpAsnLeuLys 320325CAGGAGATCAGCACATTAGCTGCAGTGAGATCAAGAAATGAGATTCAT1690GlnGluIleSerThrLeuAlaAlaValArgSerArgAsnGluIleHis3303 35340345CCCGGGAGCAAGCTGAAAATCCTTGCTGCTGAGGGAGACGTCTATGTC1738ProGlySerLysLeuLysIleLeuAlaAlaGluGlyAspValTyrVal 350355360GCCATGATCGATGATAAGGTCATAACAAAGATTGGGACACGGTATGAC1786AlaMetIleAspAspLysValIleThrLysIleGlyThrArgTyrAsp 365370375GTGGGCAACTTAATCCCGTCAGACTTCCATGTCGTTGCTCACGGCAAC1834ValGlyAsnLeuIleProSerAspPheHisValValAlaHisGlyAsn3 80385390AATTACTGCATTTGGGAAAAGAGCGGTCTCAGAGTTCCTGCAGGGCGG1882AsnTyrCysIleTrpGluLysSerGlyLeuArgValProAlaGlyArg395 400405CACCACTATTAGGCGAAGAAAATTTTTCAGGACTATTTGGTGCCTGGAA1931HisHisTyr410TAAGATTTGAATTATATCCTAAATAACCAGATTATGATTGTATGAGATTTCTTAATCTGA 1991GCAAAGCGTTGAGCATTGCTCCGATATTTCTATGTATTCTACCTGCCTGGGGATATGATA2051TTTGTATCCTCTAGAAGTAAAGATGATTTTAACTC2086(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A ) LENGTH: 438 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAlaLysArgIleAlaSerMetSerSerLeuLeuLeuIleAlaLeu-26-25-20-15L euCysLeuSerSerHisLeuAlaGlnAlaGlnValLeuPheGlnGly-10-515PheAsnTrpGluSerTrpLysLysGlnGlyGlyTrpTyrAsnPheLeu 101520HisGlyHisValAspAspIleAlaAlaThrGlyValThrHisValTrp253035LeuProProProSerHis SerValAlaProGlnGlyTyrMetProGly404550ArgLeuTyrAspLeuAspAlaSerLysTyrGlyThrGlyAlaGluLeu5560 6570ArgSerLeuIleAlaAlaPheHisSerLysGlyIleLysCysValAla758085AspIleValIleAsnHisArgCysAlaAspTyrL ysAspSerArgGly9095100IleTyrCysIlePheGluGlyGlyThrProAspSerArgLeuAspTrp105110115 GlyProAspMetIleCysSerAspAspThrGlnTyrSerAsnGlyArg120125130GlyHisArgAspThrGlyAlaAspPheGlyAlaAlaProAspIleAsp135 140145150HisLeuAsnThrArgValGlnThrGluLeuSerAspTrpLeuAsnTrp155160165LeuLysSerAspVal GlyPheAspGlyTrpArgLeuAspPheAlaLys170175180GlyTyrSerAlaAlaValAlaLysThrTyrValAspAsnThrAspPro1851 90195SerPheValValAlaGluIleTrpSerAsnMetArgTyrAspGlyAsn200205210GlyGluProSerTrpAsnGlnAspGlyAspArgGlnGluLeuV alAsn215220225230TrpAlaGlnAlaValGlyGlyProAlaSerAlaPheAspPheThrThr23524024 5LysGlyGluLeuGlnAlaAlaValGlnGlyGluLeuTrpArgMetLys250255260AspGlyAsnGlyLysAlaProGlyMetIleGlyTrpLeuProGluLys 265270275AlaValThrPheIleAspAsnHisAspThrGlySerThrGlnAsnSer280285290TrpProPheProSerAspLysVal MetGlnGlyTyrAlaTyrIleLeu295300305310ThrHisProGlyValProCysIlePheTyrAspHisValPheAspTrp315 320325AsnLeuLysGlnGluIleSerThrLeuAlaAlaValArgSerArgAsn330335340GluIleHisProGlySerLysLeuLysIleLeuA laAlaGluGlyAsp345350355ValTyrValAlaMetIleAspAspLysValIleThrLysIleGlyThr360365370ArgTyr AspValGlyAsnLeuIleProSerAspPheHisValValAla375380385390HisGlyAsnAsnTyrCysIleTrpGluLysSerGlyLeuArgValPro 395400405AlaGlyArgHisHisTyr410(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4276 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:(A) ORGANISM: Rice (Oryzae sativa)(B) STRAIN: CV. M202(vii) IMMEDIATE SOURCE:(A) LIBRARY: (EMBL) genomic(B) CLONE: .alpha.-Amy7-C(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: join(2459..2473, 2582..2713, 2807..3619, 3704..3952) (ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: join(2459..2473, 2582..2713, 2807..3619, 3704..3952)(x) PUBLICATION INFORMATION:(A) AUTHORS: Yu et al., Su-May(B) TITLE: Regulation of .alpha.-amylase- encoding gene expressionin germinating seeds and cultured cells of rice(C) JOURNAL: Gene(D) VOLUME: in press(x i) SEQUENCE DESCRIPTION: SEQ ID NO:3:GCATGCGAGAGGCACGGGGTTCGATTCCCCGCGTCTCCATCGGCACTGTTTTTTAACATC60AAACGCTGTTCGATCCACTATCTGTTAATTTCGCAAACACAACTAAATCTTTTTTTTTTT120TTGCCGGTGCGTGCAGTGTGACGTCCAAGGCATG GCGCATTGGCGCCTCCCCTCTTTCCC180TTGATCTTTTCATCAGTTCGTTCTTCTTGCAGAAAAGCTGTTCTGTTAAGTCGGTTCCGA240TCTGCTCTTGGGCTCTTGCCAGAAACAACCTGTGTACGCCAGACTTATCAAGCCAACCAT300CCTGATGAG CCTCTGCTTATACAAGCCTTTGACTCCAAAAAGGACGAGGCGGCTTGCAGC360CGCACGGAAATAAGCCGACCGATCCTTTATTGCTCTATCTTTTTCCCTTGGAATAAAAAA420CAGCCCAATTAAAATCTGGGATGAAACTATGGCTAGCTGTTCGCGGTGTCAG TTCTCGGG480ACGCTACCGTTGTTTTGTTTGAACCGGAATGTTCAGGGCGGTTCACACCATAGACTTGGA540GCCAAGTGGTTCCATCCACAAAATTTTCTCATCTTGAATATTCTGTTATCTGCCTCGACA600GACGCGCCATATCCTGTGTTCAGGAAT GAATGTGCTACAGCCAACGTGCTGCATGAAATT660TGCTGAAATCGTGCTAAAATGTGCATGGCAACAGGAACCTGATGCCCTGGTCCTGTGGAA720CTGCCACGGGAAAGTATTTTTTATAGCTAGGTGCAATCGTATCTAGGTGTATACATGTCA780C CTACATAGCTACTCCCCTTTATCTTAAAATATAATAATTTTTAACTCTCAGTATTTGTC840CTAAAATATAACAAATTCTCCATCAACATTATCTTCCCAACCAATCACAACCCTTCATCA900TTAATTTTTTCCCCCTACCTCCACTACTCATCTAATCACAACCCT CCAACACTCACTTCT960ATCTACTTTCTTAATAACTGTCTTCAACCCTAAAACTTCTTATATTTTAGGACGGAGGGA1020GTATCTAAATATTTCATAAAAAAAATGTTAAGATAGATAAAGAAGATATAAACCCACTAT1080GCAAACATGCACATCAAAAT TTAATTTACAGTAAAGAAACAGAAATAACATATTCTATTT1140GTGCTGGAGATGTACTGTTCACAATATTGTTTTTTTATTTTTTATTTATCTGATTATATA1200TCTGTTTCAGCCTTGCATGGTTGTGTATGTTTGTGTATAGACTTATGCCATTGTGATTGA1 260TGCTACCAATTATTTTCAGACTATTTTTTTATAGAGGAATTTTATAGTTCTTGAGAAAAT1320ACCTTGAAGTATCTAAATTTTACACTAAAATTGTTGGTACCTTGAGGTACAAAGTACCTA1380GAGGTACCAAATTTTACTAGAAAATTGTGGCACCTTTA GGTACCTTCTCAAAAATAGTAC1440AATTATGGGCCGTTTTGGATTTAGTGCCAAAACGTGCTCTACAAATATTTTGATAGTTTG1500AACAGTGCATAAGACGGGTTTGGTTTGAAGCCAAATCATTGGCATTGCCAATGTCCAATT1560TGATATTTTCTA TATTATGCTAAAAGCTTGGTTCTAAATTGGCCTCCAACCAAATACAAC1620TCTACTCTACCAAAAAATTTGTAGTGCCAAAACTTGCCTAGGTTTTGTCACTACCAACAT1680TTTGGTAAGTATTAAACCAAACAAGCCCTACATTTTTTTATGTACATTTAAGTTGT ATGT1740AAATGATGGGTGCGGTTGCACCTAGGTGAAAAAAAATACATATTCGCCACAACTCGCAAC1800ATGTACCAATTCAGCAGCAAGTGTAAGAGAGAAGATTTCTCTCGTTTTACACGCGCACGT1860TCAATTCCTGAACTACTAAACGGTATGATT TTTTGCAAAAATTTTCTATAGGAAAGTTAC1920TTAAAAATTATATTAATCTATTTTTAAAATTTAAAATAGTTAATACTCAATTAATTATAC1980GTTAATGGCTCAGCTCGTTTTGCGTACATTCTCAATCGATTCTTTTCCTCTGCTCTCAAA2040TGCTC TGTGTGCGATCAGGTATTCATGTTCAGCTCGCACAAGCACAAGCAAGACAGATGG2100AATTCCTACTGACCTGCGCCTTTTGCATCGCTCCAACTCTCAAAGTCTCAAGGCCATTAA2160ATTGCCTATGGGCTCACCAGCCAATAACAAACTCCGGCTGTTATCCATC CAATCCAGTGT2220CCCAAAGCAACATTCAAGCCCAGCCAGGCCTCCAAAAGTTGCAAGTTGAGCATGGCAAAA2280TCCCCGGCAATTCTCGACTATAAATACCTGACCAGACACACCCAGGAGCTTCATCAATCA2340TCCATCTCCGAAGTGTGTCTGCA GCATGCAGGTGCTGAACACCATGGTGAACAAA2395MetValAsnLys-25CACTTCTTGTCCCTTTCGGTC CTCATCGTCCTCCTTGGCCTCTCCTCC2443HisPheLeuSerLeuSerValLeuIleValLeuLeuGlyLeuSerSer-20-15-10AACTTGACAGCCGGGCAAGTCCTGT TTCAGGTAAGAGATCGCCATGAGTT2493AsnLeuThrAlaGlyGlnValLeuPheGln-515GGGTTTCAGGCTTCAGTGAACTGATCCGGTTTTGTACTGAGCCTAAGAGAATGATGCAGT2553GATGCTCTTGTGTTTGATGATGATGCAGGGATTCAACTGGGACTCGTGGAAG2605GlyPheAsnTrpAspSerTrpLys10GA GAATGGCGGGTGGTACAACTTCCTGATGGGCAAGGTGGACGACATC2653GluAsnGlyGlyTrpTyrAsnPheLeuMetGlyLysValAspAspIle152025GCCGCAGC CGGCATCACCCACGTCTGGCTCCCTCCGCCGTCTCACTCT2701AlaAlaAlaGlyIleThrHisValTrpLeuProProProSerHisSer30354045GT CGGCGAGCAAGGTGCGGTGCTCTGCTCTCTCGATCCCCTCGTCGTCGCAC2753ValGlyGluGlnCATTGCCGGCAAAATACATGCACAGGTCGTTGAATTGCTTGAATGCTTCTGCAGGC2809 Gly50TACATGCCTGGGCGGCTGTACGATCTGGACGCGTCTAAGTACGGCAAC2857TyrMetProGlyArgLeuTyr AspLeuAspAlaSerLysTyrGlyAsn556065GAGGCGCAGCTCAAGTCGCTGATCGAGGCGTTCCATGGCAAGGGCGTC2905GluAlaGlnLeuLysSer LeuIleGluAlaPheHisGlyLysGlyVal707580CAGGTCATCGCCGACATCGTCATCAACCACCGCACGGCGGAGCACAAG2953GlnValIleAlaAspIle ValIleAsnHisArgThrAlaGluHisLys859095GACGGCCGCGGCATCTACTGCCTCTTCGAGGGCGGGACGCCCGACTCC3001AspGlyArgGlyIleTyrCys LeuPheGluGlyGlyThrProAspSer100105110CGCCTCGACTGGGGCCCGCACATGATCTGCCGCGACGACCCCTACGGC3049ArgLeuAspTrpGlyProHisMetIle CysArgAspAspProTyrGly115120125130GATGGCACCGGCAACCCGGACACCGGCGCCGACTTCGCCGCCGCGCCG3097AspGlyThrGlyAsnProAsp ThrGlyAlaAspPheAlaAlaAlaPro135140145GACATCGACCACCTCAACAAGCGCGTCCAGCGGGACCTCATTGGCTGG3145AspIleAspHisLeuAsn LysArgValGlnArgAspLeuIleGlyTrp150155160CTCGACTGGCTCAAGATGGACATCGGCTTCGACGCGTGGCGCCTCGAC3193LeuAspTrpLeuLysMet AspIleGlyPheAspAlaTrpArgLeuAsp165170175TTCGCCAAGGGCTACTCCGCCGACATGGCAAAGATCTACATCGACGCC3241PheAlaLysGlyTyrSerAla AspMetAlaLysIleTyrIleAspAla180185190ACCGAGCCGAGCTTCGCCGTGGCCGAGATATGGACGTCCATGGCGAAC3289ThrGluProSerPheAlaValAlaGlu IleTrpThrSerMetAlaAsn195200205210GGCGGGGACGGCAAGCCGAACTACGACCAGAACGCGCACCGGCAGGAG3337GlyGlyAspGlyLysProAsn TyrAspGlnAsnAlaHisArgGlnGlu215220225CTGGTCAACTGGGTCGATCGTGTCGGCGGCGCCAACAGCAACGGCACG3385LeuValAsnTrpValAsp ArgValGlyGlyAlaAsnSerAsnGlyThr230235240GCGTTCGACTTCACCACCAAGGGCATCCTCAACGTCGCCGTGGAGGGC3433AlaPheAspPheThrThr LysGlyIleLeuAsnValAlaValGluGly245250255GAGCTGTGGCGCCTCCGCGGCGAGGACGGCAAGGCGCCCGGCATGATC3481GluLeuTrpArgLeuArgGly GluAspGlyLysAlaProGlyMetIle260265270GGGTGGTGGCCGGCCAAGGCGACGACCTTCGTCGACAACCACGACACC3529GlyTrpTrpProAlaLysAlaThrThr PheValAspAsnHisAspThr275280285290GGCTCGACGCAGCACCTGTGGCCGTTCCCCTCCGACAAGGTCATGCAG3577GlySerThrGlnHisLeuTrp ProPheProSerAspLysValMetGln295300305GGCTACGCATACATCCTCACCCACCCCGGCAACCCATGCATC3619GlyTyrAlaTyrIleLeu ThrHisProGlyAsnProCysIle310315320GTGAGTAGCCAACTCGATCAGAAATTCTGAATCATCCTGCAAACTGATCGATGAACTGAT3679GATAAATTCTGTAAAATTGTTCAGTTC TACGACCATTTCTTCGATTGGGGT3730PheTyrAspHisPhePheAspTrpGly325CTCAAGGAGGAGATCGAGCGCCTGGTGTCA ATCAGAAACCGGCAGGGG3778LeuLysGluGluIleGluArgLeuValSerIleArgAsnArgGlnGly330335340345ATCCACCCGGCGAGCGAGCTGCGC ATCATGGAAGCTGACAGCGATCTC3826IleHisProAlaSerGluLeuArgIleMetGluAlaAspSerAspLeu350355360TACCTCGCGGAGATCGATGGC AAGGTGATCACAAAGATTGGACCAAGA3874TyrLeuAlaGluIleAspGlyLysValIleThrLysIleGlyProArg365370375TACGACGTCGAACACCTCATC CCCGAAGGCTTCCAGGTCGTCGCGCAC3922TyrAspValGluHisLeuIleProGluGlyPheGlnValValAlaHis380385390GGTGATGGCTACGCAATCTGGGAG AAAATCTGAGCGCACGATGACGAGAC3972GlyAspGlyTyrAlaIleTrpGluLysIle395400TCTCAGTTTAGCAGATTTAACCTGCGATTTTTACCCTGACCGGTATACGTATATACGTGC4032CGGCAACG AGCTGTATCCGATCCGAATTACGGATGCAATTGTCCACGAAGTACTTCCTCC4092GTAAATAAAGTAGGATCAGGGACATACATTTGTATGGTTTTACGAATAATGCTATGCAAT4152AAAATTTGCACTGCTTAATGCTTATGCATTTTTGCTTGGTTCGATTCTACT GGTGAATTA4212TTGTTACTGTTCTTTTTACTTCTCGAGTGGCAGTATTGTTCTTCTACGAAAATTTGATGC4272GTAG4276(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 428 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetValAsnLysHisPheLeuSerLeuSerValLeuIleValLeuLeu-25-20-15 -10GlyLeuSerSerAsnLeuThrAlaGlyGlnValLeuPheGlnGlyPhe-515AsnTrpAspSerTrpLysGluAsnGlyGlyTrpTyrA snPheLeuMet101520GlyLysValAspAspIleAlaAlaAlaGlyIleThrHisValTrpLeu253035ProProPro SerHisSerValGlyGluGlnGlyTyrMetProGlyArg40455055LeuTyrAspLeuAspAlaSerLysTyrGlyAsnGluAlaGlnLeuLys 606570SerLeuIleGluAlaPheHisGlyLysGlyValGlnValIleAlaAsp758085IleValIleAsnHisArg ThrAlaGluHisLysAspGlyArgGlyIle9095100TyrCysLeuPheGluGlyGlyThrProAspSerArgLeuAspTrpGly105110 115ProHisMetIleCysArgAspAspProTyrGlyAspGlyThrGlyAsn120125130135ProAspThrGlyAlaAspPheAlaAlaAlaProAspIleA spHisLeu140145150AsnLysArgValGlnArgAspLeuIleGlyTrpLeuAspTrpLeuLys155160165 MetAspIleGlyPheAspAlaTrpArgLeuAspPheAlaLysGlyTyr170175180SerAlaAspMetAlaLysIleTyrIleAspAlaThrGluProSerPhe185 190195AlaValAlaGluIleTrpThrSerMetAlaAsnGlyGlyAspGlyLys200205210215ProAsnTyrAspGlnAsnAla HisArgGlnGluLeuValAsnTrpVal220225230AspArgValGlyGlyAlaAsnSerAsnGlyThrAlaPheAspPheThr2352 40245ThrLysGlyIleLeuAsnValAlaValGluGlyGluLeuTrpArgLeu250255260ArgGlyGluAspGlyLysAlaProGlyMetIleGlyTrpT rpProAla265270275LysAlaThrThrPheValAspAsnHisAspThrGlySerThrGlnHis280285290295Leu TrpProPheProSerAspLysValMetGlnGlyTyrAlaTyrIle300305310LeuThrHisProGlyAsnProCysIlePheTyrAspHisPhePheAsp 315320325TrpGlyLeuLysGluGluIleGluArgLeuValSerIleArgAsnArg330335340GlnGlyIleHisProAlaSer GluLeuArgIleMetGluAlaAspSer345350355AspLeuTyrLeuAlaGluIleAspGlyLysValIleThrLysIleGly360365370 375ProArgTyrAspValGluHisLeuIleProGluGlyPheGlnValVal380385390AlaHisGlyAspGlyTyrAlaIleTrpGluLysIle 395400(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3314 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:(A) ORGANISM: Rice (Oryzae sativa) (B) STRAIN: CV. M202(vii) IMMEDIATE SOURCE:(A) LIBRARY: (EMBL) genomic(B) CLONE: .alpha.-Amy8-C(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: join(1152..1241, 1385..2323, 2409..2690)(ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: join(1227..1241, 1385..2323, 2409..2690)(x) PUBLICATION INFORMATION:(A) AUTHORS: Yu et al., Su-May(B) TITLE: Regulation of .alpha.-amylase- encoding gene expressionin germinating seeds and cultured cells of rice(C) JOURNAL: Gene(D) VOLUME: in press(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:GATATCCCGCCAGCACAGTGCCGGAAACTTTAATGCCGATGGGGCTTTTAATGCCGGTTG60AGAGCATATCGATACG GTTACGAATTGGCGGCACCCACAGATTCGCCAGCCCCGGCAGCC120GCACGGTGTTATCCAGTTCCTCAATGATTTTGTCCATCGTCATGCCTGGCCGCCACTGCT180CCTGCGGCTTAAGCTGGATGGTCGTTTCTACCATCTCCAGCGGACAGAATCGGTGGCCGG 240TTTCCGTTTCCCGGTTTTGCCAAATACCCGCGCCACTTCAGGTACGCTCATAATTAGCTT300GTCGGTTTTTTGCAGCATACCGCCGCCTCTGCTGCGGAAATCCCCGGCAGCGTCGATGGC360ATATACACAAGTCGCCTTCATTGATCTGCGGTAA AAATTCCCGCCAACTTTATTGAGCGG420CCAGAGAANNGTAGCACCGAAAGCNCCGCCACCAGCAGCGTGGTTTTNNNCCAGTGCAGT480ACTTCAGCAACACGGATGATAAACACGAATCAAAAAGCGATTGTGCGGGTTACTGCTTTC540CGGCGGAAT TTTGCCACGGATCTCCTTTCCAAAGAAAGTTTCCCTGCCGGCGCTTGATCC600GTCACACCGATGACGCGACGCGGTAGAGGCCGGTACCTGTTCGAACAACCAACTGATCTG660CGGCTCCTCCGCTTGCGGCTTGCCTCTTATCAACGTATCGCCGTTTCCGTCA TGCGTGAT720CGGTGATCGATCACCGAGAGAGACCGGACGACGAGTCGAGAGAGCTCGCGCCGCCTCGAT780CGGCGCGGCGGTGACTCGAGCAGGGCCTGAAGTAGCTGCACGGCTCAAGGCGGCACTCCA840TCACCGGACACCGGGGTCCAGACTACT CGTTTCCGTTGGAGAAATAACCACCTTTATCCA900TGTTGCTTATCCGTGAATTGCAACAGCATTGATTGTTCGCGTTTAATTCGCCTCGGCCAT960GTAACCTCCGACCTGATCCTCTTGGACACTATAAATAGAGGCCAGTTCAGGCAATGCAAG1020A GCAGAGAAGCAGAGTACAGCAGGCAGCTCTTCTTCTCTTTGCGAAGGTTGGCTACTTGG1080CCAGCCATTAGGAAACAAGTTAGTTTGGAGAAGAAGCAGAGTTGAGACTGCATTTGCATT1140GCTCTGTAGCCATGGGCAAGCACCATGTCACCCTGTGT TGTGTCGTTTTT1190MetGlyLysHisHisValThrLeuCysCysValValPhe-25-20-15GCTGTGCTCTGCCTGGCGTCCAGCTTAGCACAA GCCCAAGTTCTCTTC1238AlaValLeuCysLeuAlaSerSerLeuAlaGlnAlaGlnValLeuPhe-10-51CAGGTAGTTTAATTTACTGACGCCTTGGTGAAAGTTTGTTAA TACTTGATAAT1291GlnAATAATCTTGCACGGCAATATAATGTACGCGCCGCAGTCAGGAAGCTTGATTTGACCATG1351GGTTGCGTTTGGGTGTTTTTGCCGTACGTGCAGGGGTTTAACTGGGAGTCGTGG1405 GlyPheAsnTrpGluSerTrp10AGGAAGCAAGGCGGGTGGTACAACTTTCTGCACGAGAAGGTGGAGGAG1453ArgL ysGlnGlyGlyTrpTyrAsnPheLeuHisGluLysValGluGlu152025ATCGCCAGCACGGGCGCCACCCACGTCTGGCTCCCGCCGCCGTCGCAC1501IleAlaS erThrGlyAlaThrHisValTrpLeuProProProSerHis303540TCTGTCTCGCCGCAGGGTTACATGCCGGGGCGGCTCTACGACCTGGAC1549SerValSerProG lnGlyTyrMetProGlyArgLeuTyrAspLeuAsp45505560GCGTCCAAGTACGGCACGGAGGCGGAGCTCAAGTCGCTGATCGAGGCA1597AlaSerL ysTyrGlyThrGluAlaGluLeuLysSerLeuIleGluAla657075TTCCACGACAAGAACGTCGAGTGCCTCGCCGACATCGTCATCAACCAC1645PheH isAspLysAsnValGluCysLeuAlaAspIleValIleAsnHis808590CGCTGCGCCGACTACAAGGACAGCCGCGGCGTGTACTGCGTGTTCGAG1693ArgC ysAlaAspTyrLysAspSerArgGlyValTyrCysValPheGlu95100105GGCGGCACGCCCGACGGCCGCCTCGACTGGGGCCCCGACATGATCTGC1741GlyGlyT hrProAspGlyArgLeuAspTrpGlyProAspMetIleCys110115120AGCGACGACACGCAGTACTCCAACGGCCGCGGCCACCGCGACACCGGC1789SerAspAspThrG lnTyrSerAsnGlyArgGlyHisArgAspThrGly125130135140GCCGGGTTCGGCGCCGCGCCCGACATCGACCACCTCAACCCGCGTGTC1837AlaGlyP heGlyAlaAlaProAspIleAspHisLeuAsnProArgVal145150155CAGCGGGAGCTCACCGACTGGCTCAACTGGCTCAGGACCCACCTCGGC1885GlnA rgGluLeuThrAspTrpLeuAsnTrpLeuArgThrHisLeuGly160165170TTCGACGGATGGCGCCTCGACTTCGCGAAGGGCTACTCCGCGCCGCTG1933PheA spGlyTrpArgLeuAspPheAlaLysGlyTyrSerAlaProLeu175180185GCGAGGATCTACGTCGACAACACCAACCCGACGTTCGTCGTCGGCGAG1981AlaArgI leTyrValAspAsnThrAsnProThrPheValValGlyGlu190195200ATCTGGAGCTCGCTCATCTACAACGGCGACGGCAAGCCGTCGACCAAC2029IleTrpSerSerL euIleTyrAsnGlyAspGlyLysProSerThrAsn205210215220CAGGACGCGGACAGGCAGGAGCTGGTGAACTGGGTGGAGGGCGTCGGC2077GlnAspA laAspArgGlnGluLeuValAsnTrpValGluGlyValGly225230235AAGCCGGCGACGGCGTTCGACTTCACCACCAAGGGCATCCTCCAGGCC2125LysP roAlaThrAlaPheAspPheThrThrLysGlyIleLeuGlnAla240245250GCCGTGCAGGGCGAGCTGTGGAGGCTCCACGACGGCAACGGCAAGGCG2173AlaV alGlnGlyGluLeuTrpArgLeuHisAspGlyAsnGlyLysAla255260265CCCGGCCTCATGGGGTGGATGCCCGATCAGGCCGTAACCTTCGTCGAC2221ProGlyL euMetGlyTrpMetProAspGlnAlaValThrPheValAsp270275280AACCACGACACCGGCTCGACCCAGTCGCTCTGGCCGTTCCCTTCCGAC2269AsnHisAspThrG lySerThrGlnSerLeuTrpProPheProSerAsp285290295300AAGGTCATGCAGGGCTACGCCTACATCCTCACTCACCCTGGCATCCCA2317LysValM etGlnGlyTyrAlaTyrIleLeuThrHisProGlyIlePro305310315TGCATCGTAAGTATCACCACCGAAATCTTTCTCATCAAATTCGTTCATATTGGTGA2373CysI leGCTCATTGCTGGTGCATGTGTACGTGTGTATGCAGTTCTACGACCATGTGTTC2426PheTyrAspHisValPhe320GAC TGGAACCTGCAGCACGAGATCGCGACGCTGGCTGAAATCCGGTCA2474AspTrpAsnLeuGlnHisGluIleAlaThrLeuAlaGluIleArgSer325330335340AGGAACGGGATCCATGCGGAGAGCACGCTGGACATCCTCAAGGCCGAG2522ArgAsnGlyIleHisAlaGluSerThrLeuAspIleLeuLysAlaGlu345350 355GGGGACATCTACGTCGCCATGATCGACGGCAAGGTGATCACCAAGCTC2570GlyAspIleTyrValAlaMetIleAspGlyLysValIleThrLysLeu360365 370GGGCCGAGGTACGACGCCGGCGGGATCATCCCCTCCGACTTCCATGTC2618GlyProArgTyrAspAlaGlyGlyIleIleProSerAspPheHisVal375380385GTGGCGCACGGCAACGACTACTGCGTCTGGGAGAAGGAAGGCCTCAGG2666ValAlaHisGlyAsnAspTyrCysValTrpGluLysGluGlyLeuArg390395400GTT CCTGCCGGTAGAAAGCACTATTAGCTTTAGCTATAGCGATCGAGTTGCATG2720ValProAlaGlyArgLysHisTyr405410GTGCTTTGCAACCCTAGATAATATATATACGTACGTGGCTCTAGCTATGAATCATGCAAT 2780TTTGCTGCGAGATGTGTACGAGCGAGCTTCGATCGATGTACGCTTCGTTATAACTAGCGT2840TCTTCGGAAATAAGTAATCGGAATGTACCCTGTTAATCCTGCAGAAATGTAGGATGAATG2900GAATTAACTAGCTACTGTTCGTTTCGATCCTCAAGAA AGACTTGCAAGATCTTGTCCAGT2960TGACTTCAGTTTTTTACTCCCGCTTTTAGCGTCTGGATACCGTGGTGGATTGAAAGCTCA3020ACTTGATCCCGTTTGGCCCAGCAATATTAGGCCGTAAGTAAAACGAATGACACCTGCATA3080TTCCGGCCCAA AGCGCACGCTCGTTGTCTCTCATTTAGCGGTCCAAAGATAATGGGACGA3140ATGTTCTTCACAGCAACGATTTAGCCTAACTATAATGGGGCACCTTTCCTTTATAACCCA3200AGGAATAAGTTCACTGGTCCCTTAATTTATCAGCGAGTCTGAAATTTATCCCTAA ACCGA3260AATACTGTATATAATTGGTCCCCCAATTTTCAAAACGGTTCACTTAGAGGACCC3314(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 437 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetGlyLysHisHisValThrLeuCysCysValValPheAlaValLeu-25-20-15-10CysLeuAlaSerSerLeuAlaGlnAlaGlnValLeuPheGln GlyPhe-515AsnTrpGluSerTrpArgLysGlnGlyGlyTrpTyrAsnPheLeuHis101520GluLys ValGluGluIleAlaSerThrGlyAlaThrHisValTrpLeu253035ProProProSerHisSerValSerProGlnGlyTyrMetProGlyArg4045 5055LeuTyrAspLeuAspAlaSerLysTyrGlyThrGluAlaGluLeuLys606570SerLeuIleGluAlaPheHisA spLysAsnValGluCysLeuAlaAsp758085IleValIleAsnHisArgCysAlaAspTyrLysAspSerArgGlyVal9095 100TyrCysValPheGluGlyGlyThrProAspGlyArgLeuAspTrpGly105110115ProAspMetIleCysSerAspAspThrGlnTyrSerAsnGlyArgGly 120125130135HisArgAspThrGlyAlaGlyPheGlyAlaAlaProAspIleAspHis140145150Leu AsnProArgValGlnArgGluLeuThrAspTrpLeuAsnTrpLeu155160165ArgThrHisLeuGlyPheAspGlyTrpArgLeuAspPheAlaLysGly170 175180TyrSerAlaProLeuAlaArgIleTyrValAspAsnThrAsnProThr185190195PheValValGlyGluIleTrpSerSerLeuI leTyrAsnGlyAspGly200205210215LysProSerThrAsnGlnAspAlaAspArgGlnGluLeuValAsnTrp220225 230ValGluGlyValGlyLysProAlaThrAlaPheAspPheThrThrLys235240245GlyIleLeuGlnAlaAlaValGlnGlyGluLeuTrpArgLe uHisAsp250255260GlyAsnGlyLysAlaProGlyLeuMetGlyTrpMetProAspGlnAla265270275ValThrPheVal AspAsnHisAspThrGlySerThrGlnSerLeuTrp280285290295ProPheProSerAspLysValMetGlnGlyTyrAlaTyrIleLeuThr3 00305310HisProGlyIleProCysIlePheTyrAspHisValPheAspTrpAsn315320325LeuGlnHisGluIleAlaThrL euAlaGluIleArgSerArgAsnGly330335340IleHisAlaGluSerThrLeuAspIleLeuLysAlaGluGlyAspIle345350 355TyrValAlaMetIleAspGlyLysValIleThrLysLeuGlyProArg360365370375TyrAspAlaGlyGlyIleIleProSerAspPheHisValValAl aHis380385390GlyAsnAspTyrCysValTrpGluLysGluGlyLeuArgValProAla395400405Gly ArgLysHisTyr410(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1519 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(vi) ORIGINAL SOURCE:(A) ORGANISM: Rice (Oryzae sativa)(B) STRAIN: CV. Labelle(vii) IMMEDIATE SOURCE:(A) LIBRARY: (Lambda gt-11) cDNA(B) CLONE: .alpha.-Amy10-C(x) PUBLICATION INFORMATION:(A) AUTHORS: Yu et al., Su-May(B) TITLE: Regulation of .alpha.-amylase- encoding gene expressionin germinating seeds and cultured cells of rice(C) JOURNAL: Gene(D) VOLUME: in press(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:AGCAA ACGCTTCTTGTCCCTGTCCCTGCTCATCCTCCTCCTCGGCTTCTCCTCCAGCTTG60GCAGCCGGGCAAGTCCTGTTTCAGGGCTTCAACTGGGAGTCGTGGAAGGAGAATGGCGGG120TGGTACAACATGCTGATGGGCAAGGTGGACGACATCGCCGCCGCCGGCA TCACCCACGTC180TGGCTCCCTCCGCCGTCTCAATCTGTCGCCGAACAAGGCTACATGCCGGGGCGGCTGTAC240GATCTGGACGCTTCCAAGTACGGCAACGAGGCGCAGCTCAAGTCGCTGATCGAGGCGTTC300CACGGCAAGGGCGTCCAGGTGAT CGCCGACATCGTCATCAACCACCGCACGGCGGCAGCA360AGCACAGGACGGCCGCGGCATCTACTGCCTCTTCGAGGGCGGGCAGCGCGACTCCCGCCT420CGACTGGGGCCCGCACATGATCTGCCGCGGCGACCCCTACGGCGACGGCACCGGCAACCG480ACACCGCTAGCCGACTTGGCCTGACATCGACCACCTCAACAAGCGCGTCACGAGCTCATC540GGCTGGCTCGACTGGCTCGACTGGCTCAAGCATAGGAACCAATTGGGCCTTCGACCCTGA600CTGGCCTCCTCGACTTCCGCCAACGCGCGCGTTACTCCCGC CGTACGTATCTGCAAAGAG660CTATCATCGACTGCCACCGAGACCGGACTATCGCCGATGGCCGAGACTATAGGACGTACG720CTGGCGTAGCGAGCTGCGGGACGGCTAAAGCCGGACTATGACCATGAACGCAACGACCGG780CAGTAGCTGGTCAACT GGGTCGACCGTGCGGCTGGACCAACATCATTCTAAATGCTTCGA840CTTCACCACCTAATGGGCATACTCAACGAATCGCCAGCTTGGTAGGTGCGAGCTATTGGC900GCCTCCTGGGCGTAGAGACGGCCAAGGCGCCACAGGCATGCATTACGGAGTAGTGGCCGG 960CTAAGGGACGACCTTTGATCTGACGAACCACTGACTACCAGGCGTCGATCCGCAGCATCA1020TGTGGCTGTTTCCCTCCGACAAGGTCATGCAGGGTACGCTACAGTACTCACCACCCGGCA1080ACCCATGCACTTTCTACGACCATTTCTTCGACTG GGGCCACAAGGAGGAGATCGAGCGCC1140TGGTATCGACTCAAGAAACCGCAGGGATCCACCCGGCGAGCGAGCTGCGTATCATGGAGG1200CTGACAGCGATCTCTACCTCGCCGAGATCGACGGAAAGGTCATCACGAAGGTCGGACCAA1260GATACGACG TCGAGCACCTCATCCCGAAGCTTCCAGGTCGTCGCGCACGTGACGGCTACC1320GTCTGGGAGAAATTGAGCGGTGGAGAGGCCATTAAAGCAGATTTATTTCCTGCATTTTCA1380CCTCGACGTATAACATATACATGTGATGGCAACGAGTTGTATGCTGTATCTG ATCTGAAC1440TATGTACGCGATTGTCCACAAAGTACTACCTCCGTAAATAAAGTGAGGATATGGAACATG1500CGTTTGCATGCATGGTTTT1519

Gene expression system comprising the promoter region of the .alpha.-amylase genes

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Foreign Referenced Citations (1)

Non-Patent Literature Citations (52)

Entry
Salisbury et al. (1978) Plant Physiology pp. 174-177.
Huang et al. (1990) Nucleic Acids Research 18:7007-7014.
Kumagai et al. (1990) Gene 94:209-216.
Horsch et al. (1985) Science 227:1229-1231.
Christou et al. (1992) Tibtech 10:239-246.
Akazawa et al., "Topographic Aspects of Biosynthesis, Extracellular Secretion, and Intracellular Storage of Proteins in Plant Cells", Ann. Rev. Psychol., 36:441-472 (1985).
An et al., "Transformation of Tobacco, Tomato, Potato and Arabidopsis thaliana Using a Binary Ti Vector System", Plant Physiol., 81:301-305 (1986).
Baulcombe et al., "A Novel Wheat .alpha.-amylase Gene (.alpha.-Amy3)," Mol. Gen. Genet., 209:33-40 (1987).
Belanger et al., "Heat Shock Causes Destabilization of Specific mRNAs and Destruction of Endoplasmic Reticulum in Barley Aleurone Cells", Proc. Nat'l. Acad. Sci. (USA), 83:1354-1358 (Mar. 1986).
Benfey et al., "The CaMV 35S Enhancer Contains at Least Two Domains Which can Confer Different Developmental and Tissue-Specific Expression Patterns", EMBO Journal, 8:2195-2202 (1989).
Bevan, "Binary Agrobacterium Vectors for Plant Transformation", Nucleic Acids Research, 12:8711-8721 (1984).
Bytebier et al., "T-DNA Organization in Tumor Cultures and Transgenic Plants of the Monocotyledon Asparagus officinalis", Proc. Nat'. Acad. Sci. (USA), 84:5345-5349 (Aug. 1987).
Chan et al., "Transformation of Indica Rice (Oryza sativa L.) Mediated by Agrobacterium tumefaciens", Plant Cell Physiol., 33(5):577-583 (1992).
Chandler et al., "The Effects of Gibberellic Acid and Abscisic Acid on .alpha.-amylase mRNA Lewis in Barley Aleurone Layers Studies Using an .alpha.-amylase cDNA Clone", Plant. Mol. Biol., 3:407-418 (1984).
Chang et al., "Agrobacterium tumefaciens-Mediated Transformation of Soybean (Glycine max (L.) Merr.) is Promoted by the Inclusion of Potato Suspension Culture", Bot. Bull. Academia Sinica, 32:171-178 (1991).
Dale et al., "Agroinfection of Wheat: Inoculation of In Vitro Grown Seedlings and Embryos", Plant Science, 63:237-245 (1989).
Deikman et al., "Control of .alpha.-Amylase mRNA Accumulation by Gibberellic Acid and Calcium in Barley Aleurone Layers", Plant Physiol., 78:192-198 (1985).
Depicker et al., "Molecular Cloning of Overlapping Segments of the Noplaine Ti-Plasmid pTiC58 as a Means to Restriction Endonuclease Mapping", Plasmid, 3:193-211 (1980).
Garfinkel et al., "Agrobacterium tumefaciens Mutants Affected in Crown Gall tumorigenesis and Octopine Catabolism", Journal of Bacter., 144(2):732-743 (Nov. 1980).
Gillies et al., "A Tissue-Specific Transcription Enhancer Element is Located in the Major Intron of a Rearranged Immunoglobulin Heavy Chain Gene", Cell, 33:717-728 (Jul. 1983).
Gould et al., "Transformation of Zea mays. Using Agrobacterium tumefaciens and the Shoot Apex", Plant Physiol., 95:426-434 (1991).
Hain et al., "Uptake, Integration, Expression and Genetic Transmission of a Selectable Chimaeric Gene by Plant Protoplasts", Mol. Gen. Genet., 199:161-168 (1985).
Hernalsteens et al., "An Agrobacterium-transformed Cell Culture from the Monocot Asparagus officinalis", EMBO Journal, 3(13):3039-3041 (1984).
Ho et al., "Regulation of Gene Expression in Barley Aleurone Layers", Mol. Biol. of Plant Growth Control, Alan R. Liss, Inc., pp. 35-49 (1987).
Holsters et al., "Transfection and Transformation of Agrobacterium tumefaciens", Molec. Gen. Genet. 163:181-187 (1978).
Hooykaas, "Transformation of Plant Cells via Agrobacterium", Plant Molecular Biology, 13:327-336 (1989).
Huang et al., "Classification and Characterization of the Rice .alpha.-Amylase Multigene Family", Plant Molecular Biology, 14:655-668 (1990).
Huang et al., "Structural Organization and Differential Expression of Rice .alpha.-Amylase Genes", Nucleic Acids Research, 18(23):7007-7014 (1990).
Janssens et al., "Plant Cells Induce Transcription of the Agrobacterium Tumefaciens Nopaline pTiC58 Virulence Region", Plant Science, 47:185-193 (1986).
Johnson et al., "Glycine Potentiates the NMDA Response in Cultured Mouse Brain Neurons", Nature, 325:529-533 (Feb. 1987).
Karrer et al., "Differential Expression of .alpha.-Amylase Genes in Germinating Rice and Barley Seeds", Plant Molecular Biology, 16:797-805 (1991).
Kursheed et al., "Barley .alpha.-Amylase Genes", J. Biol. Chem. 263(35):18953-18960 (Dec. 15, 1988).
Kim et al., "Nucleotide Sequence of a High-pI Rice (Oryza sativa)--Amylase Gene", Plant Molecular Biology, 18:399-402 (1992).
Knox et al., "Structure and Organization of Two Divergent .alpha.-amylase Genes from Barley", Plant Molecular Biology, 9:3-17 (1987).
Kumagai et al., "Expression and Secretion of Rice .alpha.-amylase by Saccharomyces cerevisiae", Gene, 94:209-216 (1990).
Lanahan et al., "A Gibberellin Response Complex in Cereal .alpha.-Amylase Gene Promoters", The Plant Cell, 4:203-211 (Feb. 1992).
McElroy et al., "Structural Characterization of a Rice Actin Gene", Plant Molecular Biology, 14:163-171 (1990).
O'Neill et al., "The a-amylase Genes in Oryza sativa: Characterization of cDNA Clones and mRNA Expression During Seed Germination", Mol. Gen. Genet., 221:235-244 (1990).
Radke et al., "Transformation of Brassica napus L. using Agrobacterium tumefaciens: Developmentally Regulated Expression of a Reintroduced Napin Gene", Theor. Appl. Genet., 75:685-694 (1988).
Rogers, "Two Barley .alpha.-Amylase Gene Families are Regulated Differently in Aleurone Cells", J. Biol. Chem., 260(6):3731-3738 (Mar. 25, 1985).