Patent Application
20120308569
The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: 223002106810SEQLIST.txt, date recorded: Jun. 6, 2012, size: 8,697 kilobytes).
The contents of the following submissions on ASCII text files are incorporated herein by reference in their entirety: Table 7 (70 kilobytes); Table 16 (254 kilobytes); Table 17 (407 kilobytes); Table 33 (603 kilobytes); Table 35 (379 kilobytes); Table 36 (985 kilobytes); and Table 37 (518 kilobytes). These tables were recorded on Feb. 23, 2010.
The present invention relates to polynucleotides of human origin in substantially isolated form and gene products that are differentially expressed in cancer cells, and uses thereof.
Cancer, like many diseases, is not the result of a single, well-defined cause, but rather can be viewed as several diseases, each caused by different aberrations in informational pathways, that ultimately result in apparently similar pathologic phenotypes. Identification of polynucleotides that correspond to genes that are differentially expressed in cancerous, pre-cancerous, or low metastatic potential cells relative to normal cells of the same tissue type, provides the basis for diagnostic tools, facilitates drug discovery by providing for targets for candidate agents, and further serves to identify therapeutic targets for cancer therapies that are more tailored for the type of cancer to be treated.
Identification of differentially expressed gene products also furthers the understanding of the progression and nature of complex diseases such as cancer, and is key to identifying the genetic factors that are responsible for the phenotypes associated with development of, for example, the metastatic phenotype. Identification of gene products that are differentially expressed at various stages, and in various types of cancers, can both provide for early diagnostic tests, and further serve as therapeutic targets. Additionally, the product of a differentially expressed gene can be the basis for screening assays to identify chemotherapeutic agents that modulate its activity (e.g. its expression, biological activity, and the like).
Early disease diagnosis is of central importance to halting disease progression, and reducing morbidity. Analysis of a patient's tumor to identify the gene products that are differentially expressed, and administration of therapeutic agent(s) designed to modulate the activity of those differentially expressed gene products, provides the basis for more specific, rational cancer therapy that may result in diminished adverse side effects relative to conventional therapies. Furthermore, confirmation that a tumor poses less risk to the patient (e.g., that the tumor is benign) can avoid unnecessary therapies. In short, identification of genes and the encoded gene products that are differentially expressed in cancerous cells can provide the basis of therapeutics, diagnostics, prognostics, therametrics, and the like.
For example, breast cancer is a leading cause of death among women. One of the priorities in breast cancer research is the discovery of new biochemical markers that can be used for diagnosis, prognosis and monitoring of breast cancer. The prognostic usefulness of these markers depends on the ability of the marker to distinguish between patients with breast cancer who require aggressive therapeutic treatment and patients who should be monitored.
While the pathogenesis of breast cancer is unclear, transformation of non-tumorigenic breast epithelium to a malignant phenotype may be the result of genetic factors, especially in women under 30 (Miki, et al., Science, 266: 66-71, 1994). However, it is likely that other, non-genetic factors are also significant in the etiology of the disease. Regardless of its origin, breast cancer morbidity increases significantly if a lesion is not detected early in its progression. Thus, considerable effort has focused on the elucidation of early cellular events surrounding transformation in breast tissue. Such effort has led to the identification of several potential breast cancer markers.
Thus, the identification of new markers associated with cancer, for example, breast cancer, and the identification of genes involved in transforming cells into the cancerous phenotype, remains a significant goal in the management of this disease. In exemplary aspects, the invention described herein provides cancer diagnostics, prognostics, therametrics, and therapeutics based upon polynucleotides and/or their encoded gene products.
The present invention provides methods and compositions useful in detection of cancerous cells, identification of agents that modulate the phenotype of cancerous cells, and identification of therapeutic targets for chemotherapy of cancerous cells. Cancerous prostate cells are of particular interest in each of these aspects of the invention. More specifically, the invention provides polynucleotides, as well as polypeptides encoded thereby, that are differentially expressed in prostate cancer cells. Also provided are antibodies that specifically bind the encoded polypeptides. These polynucleotides, polypeptides and antibodies are thus useful in a variety of diagnostic, therapeutic, and drug discovery methods. In some embodiments, a polynucleotide that is differentially expressed in prostate cancer cells can be used in diagnostic assays to detect prostate cancer cells. In other embodiments, a polynucleotide that is differentially expressed in prostate cancer cells, and/or a polypeptide encoded thereby, is itself a target for therapeutic intervention.
Accordingly, in one aspect the invention provides a method for detecting a cancerous prostate cell. In general, the method involves contacting a test sample obtained from a cell that is suspected of being a prostate cancer cell with a probe for detecting a gene product differentially expressed in prostate cancer. Many embodiments of the invention involve a gene identifiable or comprising a sequence selected from the group consisting of SEQ ID NOS: 1-13996, contacting the probe and the gene product for a time sufficient for binding of the probe to the gene product; and comparing a level of binding of the probe to the sample with a level of probe binding to a control sample obtained from a control prostate cell of known cancerous state. A modulated (i.e. increased or decreased) level of binding of the probe in the test prostate cell sample relative to the level of binding in a control sample is indicative of the cancerous state of the test prostate cell. In certain embodiments, the level of binding of the probe in the test cell sample, usually in relation to at least one control gene, is similar to binding of the probe to a cancerous cell sample. In certain other embodiments, the level of binding of the probe in the test cell sample, usually in relation to at least one control gene, is different, i.e. opposite, to binding of the probe to a non-cancerous cell sample. In specific embodiments, the probe is a polynucleotide probe and the gene product is nucleic acid. In other specific embodiments, the gene product is a polypeptide. In further embodiments, the gene product or the probe is immobilized on an array.
In another aspect, the invention provides a method for assessing the cancerous phenotype (e.g., metastasis, metatstatic potential, aberrant cellular proliferation, and the like) of a prostate cell comprising detecting expression of a gene product in a test prostate cell sample, wherein the gene comprises a sequence selected from the group consisting of SEQ ID NOS: 1-13996; and comparing a level of expression of the gene product in the test prostate cell sample with a level of expression of the gene in a control cell sample. Comparison of the level of expression of the gene in the test cell sample relative to the level of expression in the control cell sample is indicative of the cancerous phenotype of the test cell sample. In specific embodiments, detection of gene expression is by detecting a level of an RNA transcript in the test cell sample. In other specific embodiments detection of expression of the gene is by detecting a level of a polypeptide in a test sample.
In another aspect, the invention provides a method for suppressing or inhibiting a cancerous phenotype of a cancerous cell, the method comprising introducing into a mammalian cell an expression modulatory agent (e.g. an antisense molecule, small molecule, antibody, neutralizing antibody, inhibitory RNA molecule, etc.) to inhibition of expression of a gene identified by a sequence selected from the group consisting of SEQ ID NOS: 1-13996. Inhibition of expression of the gene inhibits development of a cancerous phenotype in the cell. In specific embodiments, the cancerous phenotype is metastasis, aberrant cellular proliferation relative to a normal cell, or loss of contact inhibition of cell growth. In the context of this invention “expression” of a gene is intended to encompass the expression of an activity of a gene product, and, as such, inhibiting expression of a gene includes inhibiting the activity of a product of the gene.
In another aspect, the invention provides a method for assessing the tumor burden of a subject, the method comprising detecting a level of a differentially expressed gene product in a test sample from a subject suspected of or having a tumor, the differentially expressed gene product comprising a sequence selected from the group consisting of SEQ ID NOS: 1-13996. Detection of the level of the gene product in the test sample is indicative of the tumor burden in the subject.
In another aspect, the invention provides a method for identifying a gene product as a target for a cancer therapeutic, the method comprising contacting a cancerous cell expressing a candidate gene product with an anti-cancer agent, wherein the candidate gene product corresponds to a sequence selected from the group consisting of SEQ ID NOS: 1-13996; and analyzing the effect of the anti-cancer agent upon a biological activity of the candidate gene product and/or upon a cancerous phenotype of the cancerous cell. Modulation of the biological activity of the candidate gene product and modulation of the cancerous phenotype of the cancerous cell indicates the candidate gene product is a target for a cancer therapeutic. In specific embodiments, the cancerous cell is a cancerous prostate cell. In other specific embodiments, the inhibitor is an antisense oligonucleotide. In further embodiments, the cancerous phenotype is aberrant cellular proliferation relative to a normal cell, or colony formation due to loss of contact inhibition of cell growth.
In another aspect, the invention provides a method for identifying agents that modulate (i.e. increase or decrease) the biological activity of a gene product differentially expressed in a cancerous cell, the method comprising contacting a candidate agent with a differentially expressed gene product, the differentially expressed gene product corresponding to a sequence selected from the group consisting of SEQ ID NOS: 1-13996; and detecting a modulation in a biological activity of the gene product relative to a level of biological activity of the gene product in the absence of the candidate agent. In specific embodiments, the detecting is by identifying an increase or decrease in expression of the differentially expressed gene product. In other specific embodiments, the gene product is mRNA or cDNA prepared from the mRNA gene product. In further embodiments, the gene product is a polypeptide.
In another aspect, the invention provides a method of inhibiting growth of a tumor cell by modulating expression of a gene product, where the gene product is encoded by a gene identified by a sequence selected from the group consisting of: SEQ ID NOS:1-13996.
The invention provides a method of determining the cancerous state of a cell, comprising detecting a level of a product of a gene in a test cell wherein said gene is defined by a sequence selected from a group consisting of SEQ ID NOS:1-13996 wherein the cancerous state of the test cell is indicated by detection of said level and comparison to a control level of said gene product. In certain embodiments of this method, the gene product is a nucleic acid or a polypeptide. In certain embodiments of this method, the gene product is immobilized on an array. In one embodiment of this method, the control level is a level of said gene product associated with a control cell of known cancerous state. In other embodiments of this method, the known cancerous state is a non-cancerous state. In another embodiment of this method, the level differs from the control level by at least two fold, indicating the test cell is not of the same cancerous state as that indicated by the control level.
The present invention provides polynucleotides, as well as polypeptides encoded thereby, that are differentially expressed in cancer cells. Methods are provided in which these polynucleotides and polypeptides are used for detecting and reducing the growth of cancer cells. Also provided are methods in which the polynucleotides and polypeptides of the invention are used in a variety of diagnostic and therapeutic applications for cancer. The invention finds use in the prevention, treatment, detection or research into any cancer, including prostrate, pancreas, colon, brain, lung, breast, bone, skin cancers. For example, the invention finds use in the prevention, treatment, detection of or research into endocrine system cancers, such as cancers of the thyroid, pituitary, and adrenal glands and the pancreatic islets; gastrointestinal cancers, such as cancer of the anus, colon, esophagus, gallbladder, stomach, liver, and rectum; genitourinary cancers such as cancer of the penis, prostate and testes; gynecological cancers, such as cancer of the ovaries, cervix, endometrium, uterus, fallopian tubes, vagina, and vulva; head and neck cancers, such as hypopharyngeal, laryngeal, oropharyngeal cancers, lip, mouth and oral cancers, cancer of the salivary gland, cancer of the digestive tract and sinus cancer; leukemia; lymphomas including Hodgkin's and non-Hodgkin's lymphoma; metastatic cancer; myelomas; sarcomas; skin cancer; urinary tract cancers including bladder, kidney and urethral cancers; and pediatric cancers, such as pediatric brain tumors, leukemia, lymphomas, sarcomas, liver cancer and neuroblastoma and retinoblastoma.
Before the present invention is described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications and patent applications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.
It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a polynucleotide” includes a plurality of such polynucleotides and reference to “the cancer cell” includes reference to one or more cells and equivalents thereof known to those skilled in the art, and so forth.
The publications and applications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
The terms “polynucleotide” and “nucleic acid”, used interchangeably herein, refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, these terms include, but are not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. These terms further include, but are not limited to, mRNA or cDNA that comprise intronic sequences (see, e.g., Niwa et al. (1999) Cell 99(7):691-702). The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidites and thus can be an oligodeoxynucleoside phosphoramidate or a mixed phosphoramidate-phosphodiester oligomer. Peyrottes et al. (1996) Nucl. Acids Res. 24:1841-1848; Chaturvedi et al. (1996) Nucl. Acids Res. 24:2318-2323. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars, and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support. The term “polynucleotide” also encompasses peptidic nucleic acids (Pooga et al Curr Cancer Drug Targets. (2001) 1:231-9).
A “gene product” is a biopolymeric product that is expressed or produced by a gene. A gene product may be, for example, an unspliced RNA, an mRNA, a splice variant mRNA, a polypeptide, a post-translationally modified polypeptide, a splice variant polypeptide etc. Also encompassed by this term is biopolymeric products that are made using an RNA gene product as a template (i.e. cDNA of the RNA). A gene product may be made enzymatically, recombinantly, chemically, or within a cell to which the gene is native. In many embodiments, if the gene product is proteinaceous, it exhibits a biological activity. In many embodiments, if the gene product is a nucleic acid, it can be translated into a proteinaceous gene product that exhibits a biological activity.
A composition (e.g. a polynucleotide, polypeptide, antibody, or host cell) that is “isolated” or “in substantially isolated form” refers to a composition that is in an environment different from that in which the composition naturally occurs. For example, a polynucleotide that is in substantially isolated form is outside of the host cell in which the polynucleotide naturally occurs, and could be a purified fragment of DNA, could be part of a heterologous vector, or could be contained within a host cell that is not a host cell from which the polynucleotide naturally occurs. The term “isolated” does not refer to a genomic or cDNA library, whole cell total protein or mRNA preparation, genomic DNA preparation, or an isolated human chromosome. A composition which is in substantially isolated form is usually substantially purified.
As used herein, the term “substantially purified” refers to a compound (e.g., a polynucleotide, a polypeptide or an antibody, etc.) that is removed from its natural environment and is usually at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally associated. Thus, for example, a composition containing A is “substantially free of” B when at least 85% by weight of the total A+B in the composition is A. Preferably, A comprises at least about 90% by weight of the total of A+B in the composition, more preferably at least about 95% or even 99% by weight. In the case of polynucleotides, “A” and “B” may be two different genes positioned on different chromosomes or adjacently on the same chromosome, or two isolated cDNA species, for example.
The terms “polypeptide” and “protein”, interchangeably used herein, refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. The term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like.
“Heterologous” refers to materials that are derived from different sources (e.g., from different genes, different species, etc.).
As used herein, the terms “a gene that is differentially expressed in a cancer cell,” and “a polynucleotide that is differentially expressed in a cancer cell” are used interchangeably herein, and generally refer to a polynucleotide that represents or corresponds to a gene that is differentially expressed in a cancerous cell when compared with a cell of the same cell type that is not cancerous, e.g., mRNA is found at levels at least about 25%, at least about 50% to about 75%, at least about 90%, at least about 1.5-fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, or at least about 50-fold or more, different (e.g., higher or lower). The comparison can be made in tissue, for example, if one is using in situ hybridization or another assay method that allows some degree of discrimination among cell types in the tissue. The comparison may also or alternatively be made between cells removed from their tissue source.
“Differentially expressed polynucleotide” as used herein refers to a nucleic acid molecule (RNA or DNA) comprising a sequence that represents a differentially expressed gene, e.g., the differentially expressed polynucleotide comprises a sequence (e.g., an open reading frame encoding a gene product; a non-coding sequence) that uniquely identifies a differentially expressed gene so that detection of the differentially expressed polynucleotide in a sample is correlated with the presence of a differentially expressed gene in a sample. “Differentially expressed polynucleotides” is also meant to encompass fragments of the disclosed polynucleotides, e.g., fragments retaining biological activity, as well as nucleic acids homologous, substantially similar, or substantially identical (e.g., having about 90% sequence identity) to the disclosed polynucleotides.
“Corresponds to” or “represents” when used in the context of, for example, a polynucleotide or sequence that “corresponds to” or “represents” a gene means that at least a portion of a sequence of the polynucleotide is present in the gene or in the nucleic acid gene product (e.g., mRNA or cDNA). A subject nucleic acid may also be “identified” by a polynucleotide if the polynucleotide corresponds to or represents the gene. Genes identified by a polynucleotide may have all or a portion of the identifying sequence wholly present within an exon of a genomic sequence of the gene, or different portions of the sequence of the polynucleotide may be present in different exons (e.g., such that the contiguous polynucleotide sequence is present in an mRNA, either pre- or post-splicing, that is an expression product of the gene). In some embodiments, the polynucleotide may represent or correspond to a gene that is modified in a cancerous cell relative to a normal cell. The gene in the cancerous cell may contain a deletion, insertion, substitution, or translocation relative to the polynucleotide and may have altered regulatory sequences, or may encode a splice variant gene product, for example. The gene in the cancerous cell may be modified by insertion of an endogenous retrovirus, a transposable element, or other naturally occurring or non-naturally occurring nucleic acid. In most cases, a polynucleotide corresponds to or represents a gene if the sequence of the polynucleotide is most identical to the sequence of a gene or its product (e.g. mRNA or cDNA) as compared to other genes or their products. In most embodiments, the most identical gene is determined using a sequence comparison of a polynucleotide to a database of polynucleotides (e.g. GenBank) using the BLAST program at default settings For example, if the most similar gene in the human genome to an exemplary polynucleotide is the protein kinase C gene, the exemplary polynucleotide corresponds to protein kinase C. In most cases, the sequence of a fragment of an exemplary polynucleotide is at least 95%, 96%, 97%, 98%, 99% or up to 100% identical to a sequence of at least 15, 20, 25, 30, 35, 40, 45, or 50 contiguous nucleotides of a corresponding gene or its product (mRNA or cDNA), when nucleotides that are “N” represent G, A, T or C.
An “identifying sequence” is a minimal fragment of a sequence of contiguous nucleotides that uniquely identifies or defines a polynucleotide sequence or its complement. In many embodiments, a fragment of a polynucleotide uniquely identifies or defines a polynucleotide sequence or its complement. In some embodiments, the entire contiguous sequence of a gene, cDNA, EST, or other provided sequence is an identifying sequence.
“Diagnosis” as used herein generally includes determination of a subject's susceptibility to a disease or disorder, determination as to whether a subject is presently affected by a disease or disorder, prognosis of a subject affected by a disease or disorder (e.g., identification of pre-metastatic or metastatic cancerous states, stages of cancer, or responsiveness of cancer to therapy), and use of therametrics (e.g., monitoring a subject's condition to provide information as to the effect or efficacy of therapy).
As used herein, the term “a polypeptide associated with cancer” refers to a polypeptide encoded by a polynucleotide that is differentially expressed in a cancer cell.
The term “biological sample” encompasses a variety of sample types obtained from an organism and can be used in a diagnostic or monitoring assay. The term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components. The term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples.
The terms “treatment”, “treating”, “treat” and the like are used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or (c) relieving the disease symptom, i.e., causing regression of the disease or symptom.
The terms “individual,” “subject,” “host,” and “patient,” used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans. Other subjects may include cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and the like.
A “host cell”, as used herein, refers to a microorganism or a eukaryotic cell or cell line cultured as a unicellular entity which can be, or has been, used as a recipient for a recombinant vector or other transfer polynucleotides, and include the progeny of the original cell which has been transfected. It is understood that the progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.
The terms “cancer”, “neoplasm”, “tumor”, and “carcinoma”, are used interchangeably herein to refer to cells which exhibit relatively autonomous growth, so that they exhibit an aberrant growth phenotype characterized by a significant loss of control of cell proliferation. In general, cells of interest for detection or treatment in the present application include precancerous (e.g., benign), malignant, pre-metastatic, metastatic, and non-metastatic cells. Detection of cancerous cells is of particular interest.
The term “normal” as used in the context of “normal cell,” is meant to refer to a cell of an untransformed phenotype or exhibiting a morphology of a non-transformed cell of the tissue type being examined.
“Cancerous phenotype” generally refers to any of a variety of biological phenomena that are characteristic of a cancerous cell, which phenomena can vary with the type of cancer. The cancerous phenotype is generally identified by abnormalities in, for example, cell growth or proliferation (e.g., uncontrolled growth or proliferation), regulation of the cell cycle, cell mobility, cell-cell interaction, or metastasis, etc.
“Therapeutic target” generally refers to a gene or gene product that, upon modulation of its activity (e.g., by modulation of expression, biological activity, and the like), can provide for modulation of the cancerous phenotype.
As used throughout, “modulation” is meant to refer to an increase or a decrease in the indicated phenomenon (e.g., modulation of a biological activity refers to an increase in a biological activity or a decrease in a biological activity).
As used herein a “Group I type tumor” is a tumor comprising cells that, relative to a non-cancer cell of the same tissue type, exhibit increased expression of a gene product encoded by at least one or more of the following genes: IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1.
As used herein a “Group II type tumor” is a tumor comprising cells that, relative to a non-cancer cell of the same tissue type, exhibit increased expression of a gene product encoded by at least one or more of the following genes: IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1.
As used herein a “Group I+II type tumor” is a tumor comprising cells that, relative to a non-cancer cell of the same tissue type, exhibit increased expression of 1) a gene product encoded by at least one or more of the following genes: IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and a gene product encoded by at least one or more of the following genes 2) IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1.
By “chondroitin 4-O sulfotransferase” is meant any polypeptide composition that exhibits chondroitin 4-O sulfotransferase activity. Examples of chondroitin 4-O sulfotransferases include chondroitin 4-O sulfotransferase-1, -2, -3, defined by NCBI accession numbers AAF81691, AAF81692, and AAM55481, respectively. Assays for determining whether a polypeptide has chondroitin 4-O sulfotransferase activity are described in Burkart & Wong (Anal Biochem 274:131-137 (1999)), and further described below. Variants of chondroitin 4-O sulfotransferase include enzymes that retain chondroitin 4-O sulfotransferase activity, i.e. a sulfotransferase activity that is specific for chondroitin over other substrates. Variants of chondroitin 4-O sulfotransferase-1, -2, -3 that retain biological activity may be produced by substituting amino acids that are in equivalent positions between two chondroitin 4-O sulfotransferases, such as chondroitin 4-O sulfotransferase-1 and chondroitin 4-O sulfotransferase-2. A chondroitin 4-O sulfotransferase activity of interest is chondroitin 4-O sulfotransferase 2, (C4S-2).
By “chondroitin 4-O sulfotransferase 2” is meant a polypeptide that has chondroitin 4-O sulfotransferase activity and has significant sequence identity to the chondroitin 4-O sulfotransferase 2 of humans (NCBI accession number NP—061111) or mouse (NCBI accession number NP—067503). The alignment between these two polypeptides (mouse C4S-2 at the top and human C4S-2 at the bottom) is shown in
With regard to chondroitin 4-O sulfotransferases, further references of interest include Hiraoaka at al JBC 2000 275: 20188-96, Ricciardelli et al. Cancer Res. 1999 May 15; 59(10):2324-8, Ricciardelli et al. Clin Cancer Res. 1997 June; 3(6):983-92, Lida et al. Semin Cancer Biol. 1996 June; 7(3):155-62, Yamori et al. J Cell Biochem. 1988 April; 36(4):405-16, Denholm et al. Eur J. Pharmacol. 2001 Mar. 30; 416(3):213-21 and Bowman and Bertozzi Chem. Biol. 1999 January; 6(1):R9-R22.
A “chondroitin 4-O sulfotransferase-related disorder” is a disorder that is associated with the abnormal expression (i.e. increased or decreased expression) of a chondroitin 4-O sulfotransferase or variant thereof. In certain embodiments, the “chondroitin 4-O sulfotransferase-related disorder” is a “chondroitin 4-O sulfotransferase-2-related disorder” associated with the abnormal expression of chondroitin 4-O sulfotransferase-2 or a variant thereof. These disorders are usually related to cancer, in particular cancers of the breast, colon, lung, brain, skin etc. In certain embodiments, the disorder relates to prostate cancer.
By “cyclin G associated kinase”, or “GAK” is meant any polypeptide composition that exhibits cyclin G associated kinase activity. Examples of cyclin G associated kinase include the polypeptide defined by NCBI accession number XM—003450, NM—005255, NP—005246 and NM—031030. Assays for determining whether a polypeptide has cyclin G associated kinase activity are described in Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY. Variants of the human cyclin G associated kinase that retain biological activity may be produced by, inter alia, substituting amino acids that are in equivalent positions between two cyclin G associated kinases, such as the cyclin G associated kinases from rat and humans.
With regard to cyclin G associated kinases, further references of interest include: Kanaoka et al, FEBS Lett. 1997 Jan. 27; 402(1):73-80; Kimura et al, Genomics. 1997 Sep. 1; 44(2):179-87; Greener et al, J Biol. Chem. 2000 Jan. 14; 275(2):1365-70; and Korolchuk et al, Traffic. 2002 June; 3(6):428-39.
“DKFZ
Alternatively, “DKFZ
In addition, “DKFZ
Polynucleotide Compositions
The present invention provides isolated polynucleotides that contain nucleic acids that are differentially expressed in cancer cells. The polynucleotides, as well as any polypeptides encoded thereby, find use in a variety of therapeutic and diagnostic methods.
The scope of the invention with respect to compositions containing the isolated polynucleotides useful in the methods described herein includes, but is not necessarily limited to, polynucleotides having (i.e., comprising) a sequence set forth in any one of the polynucleotide sequences provided herein, or fragment thereof; polynucleotides obtained from the biological materials described herein or other biological sources (particularly human sources) by hybridization under stringent conditions (particularly conditions of high stringency); genes corresponding to the provided polynucleotides; cDNAs corresponding to the provided polynucleotides; variants of the provided polynucleotides and their corresponding genes, particularly those variants that retain a biological activity of the encoded gene product (e.g., a biological activity ascribed to a gene product corresponding to the provided polynucleotides as a result of the assignment of the gene product to a protein family(ies) and/or identification of a functional domain present in the gene product). Other nucleic acid compositions contemplated by and within the scope of the present invention will be readily apparent to one of ordinary skill in the art when provided with the disclosure here. “Polynucleotide” and “nucleic acid” as used herein with reference to nucleic acids of the composition is not intended to be limiting as to the length or structure of the nucleic acid unless specifically indicated.
The invention features polynucleotides that represent genes that are expressed in human tissue, specifically polynucleotides that are differentially expressed in tissues containing cancerous cells. Nucleic acid compositions described herein of particular interest are at least about 15 bp in length, at least about 30 bp in length, at least about 50 bp in length, at least about 100 bp, at least about 200 bp in length, at least about 300 bp in length, at least about 500 bp in length, at least about 800 bp in length, at least about 1 kb in length, at least about 2.0 kb in length, at least about 3.0 kb in length, at least about 5 kb in length, at least about 10 kb in length, at least about 50 kb in length and are usually less than about 200 kb in length. These polynucleotides (or polynucleotide fragments) have uses that include, but are not limited to, diagnostic probes and primers as starting materials for probes and primers, as discussed herein.
The subject polynucleotides usually comprise a sequence set forth in any one of the polynucleotide sequences provided herein, for example, in the sequence listing, incorporated by reference in a table (e.g. by an NCBI accession number), a cDNA deposited at the A.T.C.C., or a fragment or variant thereof. A “fragment” or “portion” of a polynucleotide is a contiguous sequence of residues at least about 10 nt to about 12 nt, 15 nt, 16 nt, 18 nt or 20 nt in length, usually at least about 22 nt, 24 nt, 25 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt to at least about 150 nt, 200 nt, 250 nt, 300 nt, 350 nt, 400 nt, 500 nt, 800 nt or up to about 1000 nt, 1500 or 2000 nt in length. In some embodiments, a fragment of a polynucleotide is the coding sequence of a polynucleotide. A fragment of a polynucleotide may start at position 1 (i.e. the first nucleotide) of a nucleotide sequence provided herein, or may start at about position 10, 20, 30, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1500 or 2000, or an ATG translational initiation codon of a nucleotide sequence provided herein. In this context “about” includes the particularly recited value or a value larger or smaller by several (5, 4, 3, 2, or 1) nucleotides. The described polynucleotides and fragments thereof find use as hybridization probes, PCR primers, BLAST probes, or as an identifying sequence, for example.
The subject nucleic acids may be variants or degenerate variants of a sequence provided herein. In general, a variants of a polynucleotide provided herein have a fragment of sequence identity that is greater than at least about 65%, greater than at least about 70%, greater than at least about 75%, greater than at least about 80%, greater than at least about 85%, or greater than at least about 90%, 95%, 96%, 97%, 98%, 99% or more (i.e. 100%) as compared to an identically sized fragment of a provided sequence. as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular). For the purposes of this invention, a preferred method of calculating percent identity is the Smith-Waterman algorithm. Global DNA sequence identity should be greater than 65% as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1.
The subject nucleic acid compositions include full-length cDNAs or mRNAs that encompass an identifying sequence of contiguous nucleotides from any one of the polynucleotide sequences provided herein.
As discussed above, the polynucleotides useful in the methods described herein also include polynucleotide variants having sequence similarity or sequence identity. Nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50° C. and 10×SSC (0.9 M saline/0.09 M sodium citrate) and remain bound when subjected to washing at 55° C. in 1×SSC. Sequence identity can be determined by hybridization under high stringency conditions, for example, at 50° C. or higher and 0.1×SSC (9 mM saline/0.9 mM sodium citrate). Hybridization methods and conditions are well known in the art, see, e.g., U.S. Pat. No. 5,707,829. Nucleic acids that are substantially identical to the provided polynucleotide sequences, e.g. allelic variants, genetically altered versions of the gene, etc., bind to the provided polynucleotide sequences under stringent hybridization conditions. By using probes, particularly labeled probes of DNA sequences, one can isolate homologous or related genes. The source of homologous genes can be any species, e.g. primate species, particularly human; rodents, such as rats and mice; canines, felines, bovines, ovines, equines, yeast, nematodes, etc.
In one embodiment, hybridization is performed using a fragment of at least 15 contiguous nucleotides (nt) of at least one of the polynucleotide sequences provided herein. That is, when at least 15 contiguous nt of one of the disclosed polynucleotide sequences is used as a probe, the probe will preferentially hybridize with a nucleic acid comprising the complementary sequence, allowing the identification and retrieval of the nucleic acids that uniquely hybridize to the selected probe. Probes from more than one polynucleotide sequence provided herein can hybridize with the same nucleic acid if the cDNA from which they were derived corresponds to one mRNA.
Polynucleotides contemplated for use in the invention also include those having a sequence of naturally occurring variants of the nucleotide sequences (e.g., degenerate variants (e.g., sequences that encode the same polypeptides but, due to the degenerate nature of the genetic code, different in nucleotide sequence), allelic variants, etc.). Variants of the polynucleotides contemplated by the invention are identified by hybridization of putative variants with nucleotide sequences disclosed herein, preferably by hybridization under stringent conditions. For example, by using appropriate wash conditions, variants of the polynucleotides described herein can be identified where the allelic variant exhibits at most about 25-30% base pair (bp) mismatches relative to the selected polynucleotide probe. In general, allelic variants contain 15-25% by mismatches, and can contain as little as even 5-15%, or 2-5%, or 1-2% by mismatches, as well as a single by mismatch.
The invention also encompasses homologs corresponding to any one of the polynucleotide sequences provided herein, where the source of homologous genes can be any mammalian species, e.g., primate species, particularly human; rodents, such as rats; canines, felines, bovines, ovines, equines, yeast, nematodes, etc. Between mammalian species, e.g., human and mouse, homologs generally have substantial sequence similarity, e.g., at least 75% sequence identity, usually at least 80%%, at least 85, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity between nucleotide sequences. Sequence similarity is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc. A reference sequence will usually be at least about a fragment of a polynucleotide sequence and may extend to the complete sequence that is being compared. Algorithms for sequence analysis are known in the art, such as gapped BLAST, described in Altschul, et al. Nucleic Acids Res. (1997) 25:3389-3402, or TeraBLAST available from TimeLogic Corp. (Crystal Bay, Nev.).
The subject nucleic acids can be cDNAs or genomic DNAs, as well as fragments thereof, particularly fragments that encode a biologically active gene product and/or are useful in the methods disclosed herein (e.g., in diagnosis, as a unique identifier of a differentially expressed gene of interest, etc.). The term “cDNA” as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons and 3′ and 5′ non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns, when present, being removed by nuclear RNA splicing, to create a continuous open reading frame encoding a polypeptide. mRNA species can also exist with both exons and introns, where the introns may be removed by alternative splicing. Furthermore it should be noted that different species of mRNAs encoded by the same genomic sequence can exist at varying levels in a cell, and detection of these various levels of mRNA species can be indicative of differential expression of the encoded gene product in the cell.
A genomic sequence of interest comprises the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It can further include the 3′ and 5′ untranslated regions found in the mature mRNA. It can further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc., including about 1 kb, but possibly more, of flanking genomic DNA at either the 5′ and 3′ end of the transcribed region. The genomic DNA can be isolated as a fragment of 100 kbp or smaller; and substantially free of flanking chromosomal sequence. The genomic DNA flanking the coding region, either 3′ and 5′, or internal regulatory sequences as sometimes found in introns, contains sequences required for proper tissue, stage-specific, or disease-state specific expression.
The nucleic acid compositions of the subject invention can encode all or a part of the naturally-occurring polypeptides. Double or single stranded fragments can be obtained from the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc.
Probes specific to the polynucleotides described herein can be generated using the polynucleotide sequences disclosed herein. The probes are usually a fragment of a polynucleotide sequences provided herein. The probes can be synthesized chemically or can be generated from longer polynucleotides using restriction enzymes. The probes can be labeled, for example, with a radioactive, biotinylated, or fluorescent tag. Preferably, probes are designed based upon an identifying sequence of any one of the polynucleotide sequences provided herein. More preferably, probes are designed based on a contiguous sequence of one of the subject polynucleotides that remain unmasked following application of a masking program for masking low complexity (e.g., XBLAST, RepeatMasker, etc.) to the sequence, i.e., one would select an unmasked region, as indicated by the polynucleotides outside the poly-n stretches of the masked sequence produced by the masking program.
The polynucleotides of interest in the subject invention are isolated and obtained in substantial purity, generally as other than an intact chromosome. Usually, the polynucleotides, either as DNA or RNA, will be obtained substantially free of other naturally-occurring nucleic acid sequences that they are usually associated with, generally being at least about 50%, usually at least about 90% pure and are typically “recombinant”, e.g., flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome.
The polynucleotides described herein can be provided as a linear molecule or within a circular molecule, and can be provided within autonomously replicating molecules (vectors) or within molecules without replication sequences. Expression of the polynucleotides can be regulated by their own or by other regulatory sequences known in the art. The polynucleotides can be introduced into suitable host cells using a variety of techniques available in the art, such as transferrin polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome-mediated DNA transfer, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, gene gun, calcium phosphate-mediated transfection, and the like.
The nucleic acid compositions described herein can be used to, for example, produce polypeptides, as probes for the detection of mRNA in biological samples (e.g., extracts of human cells) or cDNA produced from such samples, to generate additional copies of the polynucleotides, to generate ribozymes or antisense oligonucleotides, and as single stranded DNA probes or as triple-strand forming oligonucleotides. The probes described herein can be used to, for example, determine the presence or absence of any one of the polynucleotide provided herein or variants thereof in a sample. These and other uses are described in more detail below.
Polypeptides and Variants Thereof
The present invention further provides polypeptides encoded by polynucleotides that represent genes that are differentially expressed in cancer cells. Such polypeptides are referred to herein as “polypeptides associated with cancer.” The polypeptides can be used to generate antibodies specific for a polypeptide associated with cancer, which antibodies are in turn useful in diagnostic methods, prognostics methods, therametric methods, and the like as discussed in more detail herein. Polypeptides are also useful as targets for therapeutic intervention, as discussed in more detail herein.
The polypeptides contemplated by the invention include those encoded by the disclosed polynucleotides and the genes to which these polynucleotides correspond, as well as nucleic acids that, by virtue of the degeneracy of the genetic code, are not identical in sequence to the disclosed polynucleotides. Further polypeptides contemplated by the invention include polypeptides that are encoded by polynucleotides that hybridize to polynucleotide of the sequence listing. Thus, the invention includes within its scope a polypeptide encoded by a polynucleotide having the sequence of any one of the polynucleotide sequences provided herein, or a variant thereof.
In general, the term “polypeptide” as used herein refers to both the full length polypeptide encoded by the recited polynucleotide, the polypeptide encoded by the gene represented by the recited polynucleotide, as well as portions or fragments thereof. “Polypeptides” also includes variants of the naturally occurring proteins, where such variants are homologous or substantially similar to the naturally occurring protein, and can be of an origin of the same or different species as the naturally occurring protein (e.g., human, murine, or some other species that naturally expresses the recited polypeptide, usually a mammalian species). In general, variant polypeptides have a sequence that has at least about 80%, usually at least about 90%, and more usually at least about 98% sequence identity with a differentially expressed polypeptide described herein, as measured by BLAST 2.0 using the parameters described above. The variant polypeptides can be naturally or non-naturally glycosylated, i.e., the polypeptide has a glycosylation pattern that differs from the glycosylation pattern found in the corresponding naturally occurring protein.
The invention also encompasses homologs of the disclosed polypeptides (or fragments thereof) where the homologs are isolated from other species, i.e. other animal or plant species, where such homologs, usually mammalian species, e.g. rodents, such as mice, rats; domestic animals, e.g., horse, cow, dog, cat; and humans. By “homolog” is meant a polypeptide having at least about 35%, usually at least about 40% and more usually at least about 60% amino acid sequence identity to a particular differentially expressed protein as identified above, where sequence identity is determined using the BLAST 2.0 algorithm, with the parameters described supra.
In general, the polypeptides of interest in the subject invention are provided in a non-naturally occurring environment, e.g. are separated from their naturally occurring environment. In certain embodiments, the subject protein is present in a composition that is enriched for the protein as compared to a cell or extract of a cell that naturally produces the protein. As such, isolated polypeptide is provided, where by “isolated” or “in substantially isolated form” is meant that the protein is present in a composition that is substantially free of other polypeptides, where by substantially free is meant that less than 90%, usually less than 60% and more usually less than 50% of the composition is made up of other polypeptides of a cell that the protein is naturally found.
Also within the scope of the invention are variants; variants of polypeptides include mutants, fragments, and fusions. Mutants can include amino acid substitutions, additions or deletions. The amino acid substitutions can be conservative amino acid substitutions or substitutions to eliminate non-essential amino acids, such as to alter a glycosylation site, a phosphorylation site or an acetylation site, or to minimize misfolding by substitution or deletion of one or more cysteine residues that are not necessary for function. Conservative amino acid substitutions are those that preserve the general charge, hydrophobicity/hydrophilicity, and/or steric bulk of the amino acid substituted.
Variants can be designed so as to retain or have enhanced biological activity of a particular region of the protein (e.g., a functional domain and/or, where the polypeptide is a member of a protein family, a region associated with a consensus sequence). For example, muteins can be made which are optimized for increased antigenicity, i.e. amino acid variants of a polypeptide may be made that increase the antigenicity of the polypeptide. Selection of amino acid alterations for production of variants can be based upon the accessibility (interior vs. exterior) of the amino acid (see, e.g., Go et al, Int. J. Peptide Protein Res. (1980) 15:211), the thermostability of the variant polypeptide (see, e.g., Querol et al., Prot. Eng. (1996) 9:265), desired glycosylation sites (see, e.g., Olsen and Thomsen, J. Gen. Microbiol. (1991) 137:579), desired disulfide bridges (see, e.g., Clarke et al., Biochemistry (1993) 32:4322; and Wakarchuk et al., Protein Eng. (1994) 7:1379), desired metal binding sites (see, e.g., Toma et al., Biochemistry (1991) 30:97, and Haezerbrouck et al., Protein Eng. (1993) 6:643), and desired substitutions with in proline loops (see, e.g., Masul et al., Appl. Env. Microbiol. (1994) 60:3579). Cysteine-depleted muteins can be produced as disclosed in U.S. Pat. No. 4,959,314. Variants also include fragments of the polypeptides disclosed herein, particularly biologically active fragments and/or fragments corresponding to functional domains. Fragments of interest will typically be at least about 10 aa to at least about 15 aa in length, usually at least about 50 aa in length, and can be as long as 300 aa in length or longer, but will usually not exceed about 1000 aa in length, where the fragment will have a stretch of amino acids that is identical to a polypeptide encoded by a polynucleotide having a sequence of any one of the polynucleotide sequences provided herein, or a homolog thereof. The protein variants described herein are encoded by polynucleotides that are within the scope of the invention. The genetic code can be used to select the appropriate codons to construct the corresponding variants.
A fragment of a subject polypeptide is, for example, a polypeptide having an amino acid sequence which is a portion of a subject polypeptide e.g. a polypeptide encoded by a subject polynucleotide that is identified by any one of the sequence of SEQ ID NOS: 1-13996 or its complement. The polypeptide fragments of the invention are preferably at least about 9 aa, at least about 15 aa, and more preferably at least about 20 aa, still more preferably at least about 30 aa, and even more preferably, at least about 40 aa, at least about 50 aa, at least about 75 aa, at least about 100 aa, at least about 125 aa or at least about 150 aa in length. A fragment “at least 20 aa in length,” for example, is intended to include 20 or more contiguous amino acids from, for example, the polypeptide encoded by a cDNA, in a cDNA clone contained in a deposited library, or a nucleotide sequence shown in SEQ ID NOS: 1-13996 or the complementary stand thereof. In this context “about” includes the particularly recited value or a value larger or smaller by several (5, 4, 3, 2, or 1) amino acids. These polypeptide fragments have uses that include, but are not limited to, production of antibodies as discussed herein. Of course, larger fragments (e.g., at least 150, 175, 200, 250, 500, 600, 1000, or 2000 amino acids in length) are also encompassed by the invention.
Moreover, representative examples of polypeptides fragments of the invention (useful in, for example, as antigens for antibody production), include, for example, fragments comprising, or alternatively consisting of, a sequence from about amino acid number 1-10, 5-10, 10-20, 21-31, 31-40, 41-61, 61-81, 91-120, 121-140, 141-162, 162-200, 201-240, 241-280, 281-320, 321-360, 360-400, 400-450, 451-500, 500-600, 600-700, 700-800, 800-900 and the like. In this context “about” includes the particularly recited range or a range larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either terminus or at both termini. In some embodiments, these fragments has a functional activity (e.g., biological activity) whereas in other embodiments, these fragments may be used to make an antibody.
In one example, a polynucleotide having a sequence set forth in the sequence listing, containing no flanking sequences (i.e., consisting of the sequence set forth in the sequence listing), may be cloned into an expression vector having ATG and a stop codon (e.g. any one of the pET vector from Invitrogen, or other similar vectors from other manufactures), and used to express a polypeptide of interest encoded by the polynucleotide in a suitable cell, e.g., a bacterial cell. Accordingly, the polynucleotides may be used to produce polypeptides, and these polypeptides may be used to produce antibodies by known methods described above and below. In many embodiments, the sequence of the encoded polypeptide does not have to be known prior to its expression in a cell. However, if it desirable to know the sequence of the polypeptide, this may be derived from the sequence of the polynucleotide. Using the genetic code, the polynucleotide may be translated by hand, or by computer means. Suitable software for identifying open reading frames and translating them into polypeptide sequences are well know in the art, and include: Lasergene™ from DNAStar (Madison, Wis.), and Vector NTI™ from Informax (Frederick Md.), and the like.
Further polypeptide variants may are described in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429
Vectors, Host Cells and Protein Production
The present invention also relates to vectors containing the polynucleotide of the present invention, host cells, and the production of polypeptides by recombinant techniques. The vector may be, for example, a phage, plasmid, viral, or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
The polynucleotides of the invention may be joined to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
The polynucleotide insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan. The expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
As indicated, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)); insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNHSA, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc.; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia Biotech, Inc. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Preferred expression vectors for use in yeast systems include, but are not limited to pYES2, pYD1, pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, and PAO815 (all available from Invitrogen, Carload, Calif.). Other suitable vectors will be readily apparent to the skilled artisan.
Nucleic acids of interest may be cloned into a suitable vector by route methods. Suitable vectors include plasmids, cosmids, recombinant viral vectors e.g. retroviral vectors, YACs, BACs and the like, phage vectors.
Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology (1986). It is specifically contemplated that the polypeptides of the present invention may in fact be expressed by a host cell lacking a recombinant vector.
A polypeptide of this invention can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
Polypeptides of the present invention can also be recovered from: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast higher plant, insect, and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host mediated processes. Thus, it is well known in the art that the N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.
Suitable methods and compositions for polypeptide expression may be found in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429, and suitable methods and compositions for production of modified polypeptides may be found in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429.
Antibodies and Other Polypeptide or Polynucleotide Binding Molecules
The present invention further provides antibodies, which may be isolated antibodies, that are specific for a polypeptide encoded by a polynucleotide described herein and/or a polypeptide of a gene that corresponds to a polynucleotide described herein. Antibodies can be provided in a composition comprising the antibody and a buffer and/or a pharmaceutically acceptable excipient. Antibodies specific for a polypeptide associated with cancer are useful in a variety of diagnostic and therapeutic methods, as discussed in detail herein.
Gene products, including polypeptides, mRNA (particularly mRNAs having distinct secondary and/or tertiary structures), cDNA, or complete gene, can be prepared and used for raising antibodies for experimental, diagnostic, and therapeutic purposes. Antibodies may be used to identify a gene corresponding to a polynucleotide. The polynucleotide or related cDNA is expressed as described above, and antibodies are prepared. These antibodies are specific to an epitope on the polypeptide encoded by the polynucleotide, and can precipitate or bind to the corresponding native protein in a cell or tissue preparation or in a cell-free extract of an in vitro expression system.
Antibodies
Further polypeptides of the invention relate to antibodies and T-cell antigen receptors (TCR) which immunospecifically bind a subject polypeptide, subject polypeptide fragment, or variant thereof, and/or an epitope thereof (as determined by immunoassays well known in the art for assaying specific antibody-antigen binding). Antibodies of the invention include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab′) fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the above. The term “antibody,” as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule. Most preferably the antibodies are human antigen-binding antibody fragments of the present invention and include, but are not limited to, Fab. Fab′ and F(ab′)2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain. Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entirety or a portion of the following: hinge region, CH1, CH2, and CH3 domains. Also included in the invention are antigen-binding fragments also comprising any combination of variable region(s) with a hinge region, CH1, CH2, and CH3 domains. The antibodies of the invention may be from any animal origin including birds and mammals. Preferably, the antibodies are human, murine (e.g., mouse and rat), donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken. As used herein, “human” antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from, human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin and that do not express endogenous immunoglobulins, as described infra and, for example in, U.S. Pat. No. 5,939,598 by Kucherlapati et al.
The antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553 (1992).
Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which they recognize or specifically bind. The epitope(s) or polypeptide portion(s) may be specified as described herein, e.g., by N-terminal and C-terminal positions, or by size in contiguous amino acid residues. Antibodies which specifically bind any epitope or polypeptide of the present invention may also be excluded. Therefore, the present invention includes antibodies that specifically bind polypeptides of the present invention, and allows for the exclusion of the same.
Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. Antibodies that do not bind any other analog, ortholog, or homolog of a polypeptide of the present invention are included. Antibodies that bind polypeptides with at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In specific embodiments, antibodies of the present invention cross-react with murine, rat and/or rabbit homologs of human proteins and the corresponding epitopes thereof. Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In a specific embodiment, the above-described cross-reactivity is with respect to any single specific antigenic or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or more of the specific antigenic and/or immunogenic polypeptides disclosed herein. Further included in the present invention are antibodies which bind polypeptides encoded by polynucleotides which hybridize to a polynucleotide of the present invention under stringent hybridization conditions (as described herein). Antibodies of the present invention may also be described or specified in terms of their binding affinity to a polypeptide of the invention. Preferred binding affinities include those with a dissociation constant or Kd less 5×10−5M, 10−5M, 5×10−6 M, 10−6M, 5×10−7 M, 10−7M, 5×10−8M, 10−8 M, 5×10−9 M, 10−9 M, 5×10−1° M, 10−10 M, etc.
The invention also provides antibodies that competitively inhibit binding of an antibody to an epitope of the invention as determined by any method known in the art for determining competitive binding, for example, the immunoassays described herein. In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%.
Methods for making screening, assaying, humanizing, and modifying different types of antibody are well known in the art and may be found in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429.
In addition, the invention further provides polynucleotides comprising a nucleotide sequence encoding an antibody of the invention and fragments thereof. The invention also encompasses polynucleotides that hybridize under stringent or alternatively, under lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides that encode an antibody, preferably, that specifically binds to a polypeptide of the invention, preferably, an antibody that binds to a subject polypeptide.
The antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques. Recombinant expression of an antibody of the invention, or fragment, derivative or analog thereof, (e.g., a heavy or light chain of an antibody of the invention or a single chain antibody of the invention), requires construction of an expression vector containing a polynucleotide that encodes the antibody. Once a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof (preferably containing the heavy or light chain variable domain), of the invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The invention, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, or a heavy or light chain thereof, or a heavy or light chain variable domain, operably linked to a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy or light chain.
The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention. Thus, the invention includes host cells containing a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter. In preferred embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.
A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ. These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).
Antibodies production is well known in the art. Exemplary methods and compositions for making antibodies may be found in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429.
Immunophenotyping
The antibodies of the invention may be utilized for immunophenotyping of cell lines and biological samples. The translation product of the gene of the present invention may be useful as a cell specific marker, or more specifically as a cellular marker that is differentially expressed at various stages of differentiation and/or maturation of particular cell types. Monoclonal antibodies directed against a specific epitope, or combination of epitopes, will allow for the screening of cellular populations expressing the marker. Various techniques can be utilized using monoclonal antibodies to screen for cellular populations expressing the marker(s), and include magnetic separation using antibody-coated magnetic beads, “panning” with antibody attached to a solid matrix (i.e., plate), and flow cytometry (See, e.g., U.S. Pat. No. 5,985,660; and Morrison et al. Cell, 96:737-49 (1999)).
These techniques allow for the screening of particular populations of cells, such as might be found with hematological malignancies (i.e. minimal residual disease (MRD) in acute leukemic patients) and “non-self cells in transplantations to prevent Graft-versus-Host Disease (GVHD). Alternatively, these techniques allow for the screening of hematopoietic stem and progenitor cells capable of undergoing proliferation and/or differentiation, as might be found in human umbilical cord blood.
Also provided by the subject invention are kits for practicing the subject methods, as described above. The subject kits include at least one or more of: a subject nucleic acid, isolated polypeptide or an antibody thereto. Other optional components of the kit include: restriction enzymes, control primers and plasmids; buffers, cells, carriers adjuvents etc. The nucleic acids of the kit may also have restrictions sites, multiple cloning sites, primer sites, etc to facilitate their ligation other plasmids. The various components of the kit may be present in separate containers or certain compatible components may be precombined into a single container, as desired. In many embodiments, kits with unit doses of the active agent, e.g. in oral or injectable doses, are provided. In certain embodiments, controls, such as samples from a cancerous or non-cancerous cell are provided by the invention. Further embodiments of the kit include an antibody for a subject polypeptide and a chemotherapeutic agent to be used in combination with the polypeptide as a treatment.
In addition to above-mentioned components, the subject kits typically further include instructions for using the components of the kit to practice the subject methods. The instructions for practicing the subject methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging) etc. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc. In yet other embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
In general, a library of polynucleotides is a collection of sequence information, which information is provided in either biochemical form (e.g., as a collection of polynucleotide molecules), or in electronic form (e.g., as a collection of polynucleotide sequences stored in a computer-readable form, as in a computer system and/or as part of a computer program). The sequence information of the polynucleotides can be used in a variety of ways, e.g., as a resource for gene discovery, as a representation of sequences expressed in a selected cell type (e.g., cell type markers), and/or as markers of a given disease or disease state. For example, in the instant case, the sequences of polynucleotides and polypeptides corresponding to genes differentially expressed in cancer, as well as the nucleic acid and amino acid sequences of the genes themselves, can be provided in electronic form in a computer database.
In general, a disease marker is a representation of a gene product that is present in all cells affected by disease either at an increased or decreased level relative to a normal cell (e.g., a cell of the same or similar type that is not substantially affected by disease). For example, a polynucleotide sequence in a library can be a polynucleotide that represents an mRNA, polypeptide, or other gene product encoded by the polynucleotide, that is either overexpressed or underexpressed in a cancerous cell affected by cancer relative to a normal (i.e., substantially disease-free) cell.
The nucleotide sequence information of the library can be embodied in any suitable form, e.g., electronic or biochemical forms. For example, a library of sequence information embodied in electronic form comprises an accessible computer data file (or, in biochemical form, a collection of nucleic acid molecules) that contains the representative nucleotide sequences of genes that are differentially expressed (e.g., overexpressed or underexpressed) as between, for example, i) a cancerous cell and a normal cell; ii) a cancerous cell and a dysplastic cell; iii) a cancerous cell and a cell affected by a disease or condition other than cancer; iv) a metastatic cancerous cell and a normal cell and/or non-metastatic cancerous cell; v) a malignant cancerous cell and a non-malignant cancerous cell (or a normal cell) and/or vi) a dysplastic cell relative to a normal cell. Other combinations and comparisons of cells affected by various diseases or stages of disease will be readily apparent to the ordinarily skilled artisan. Biochemical embodiments of the library include a collection of nucleic acids that have the sequences of the genes in the library, where the nucleic acids can correspond to the entire gene in the library or to a fragment thereof, as described in greater detail below.
The polynucleotide libraries of the subject invention generally comprise sequence information of a plurality of polynucleotide sequences, where at least one of the polynucleotides has a sequence of any of sequence described herein. By plurality is meant at least 2, usually at least 3 and can include up to all of the sequences described herein. The length and number of polynucleotides in the library will vary with the nature of the library, e.g., if the library is an oligonucleotide array, a cDNA array, a computer database of the sequence information, etc.
Where the library is an electronic library, the nucleic acid sequence information can be present in a variety of media. “Media” refers to a manufacture, other than an isolated nucleic acid molecule, that contains the sequence information of the present invention. Such a manufacture provides the genome sequence or a subset thereof in a form that can be examined by means not directly applicable to the sequence as it exists in a nucleic acid. For example, the nucleotide sequence of the present invention, e.g. the nucleic acid sequences of any of the polynucleotides of the sequences described herein, can be recorded on computer readable media, e.g. any medium that can be read and accessed directly by a computer. Such media include, but are not limited to: magnetic storage media, such as a floppy disc, a hard disc storage medium, and a magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media.
One of skill in the art can readily appreciate how any of the presently known computer readable mediums can be used to create a manufacture comprising a recording of the present sequence information. “Recorded” refers to a process for storing information on computer readable medium, using any such methods as known in the art. Any convenient data storage structure can be chosen, based on the means used to access the stored information. A variety of data processor programs and formats can be used for storage, e.g. word processing text file, database format, etc. In addition to the sequence information, electronic versions of libraries comprising one or more sequence described herein can be provided in conjunction or connection with other computer-readable information and/or other types of computer-readable files (e.g., searchable files, executable files, etc, including, but not limited to, for example, search program software, etc.).
By providing the nucleotide sequence in computer readable form, the information can be accessed for a variety of purposes. Computer software to access sequence information (e.g. the NCBI sequence database) is publicly available. For example, the gapped BLAST (Altschul et al., Nucleic Acids Res. (1997) 25:3389-3402) and BLAZE (Brutlag et al., Comp. Chem. (1993) 17:203) search algorithms on a Sybase system, or the TeraBLAST (TimeLogic, Crystal Bay, Nev.) program optionally running on a specialized computer platform available from TimeLogic, can be used to identify open reading frames (ORFs) within the genome that contain homology to ORFs from other organisms.
As used herein, “a computer-based system” refers to the hardware means, software means, and data storage means used to analyze the nucleotide sequence information of the present invention. The minimum hardware of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means, and data storage means. A skilled artisan can readily appreciate that any one of the currently available computer-based system are suitable for use in the present invention. The data storage means can comprise any manufacture comprising a recording of the present sequence information as described above, or a memory access means that can access such a manufacture.
“Search means” refers to one or more programs implemented on the computer-based system, to compare a target sequence or target structural motif, or expression levels of a polynucleotide in a sample, with the stored sequence information. Search means can be used to identify fragments or regions of the genome that match a particular target sequence or target motif. A variety of known algorithms are publicly known and commercially available, e.g. MacPattern (EMBL), TeraBLAST (TimeLogic), BLASTN and BLASTX (NCBI). A “target sequence” can be any polynucleotide or amino acid sequence of six or more contiguous nucleotides or two or more amino acids, preferably from about 10 to 100 amino acids or from about 30 to 300 nt. A variety of means for comparing nucleic acids or polypeptides may be used to compare accomplish a sequence comparison (e.g., to analyze target sequences, target motifs, or relative expression levels) with the data storage means. A skilled artisan can readily recognize that any one of the publicly available homology search programs can be used to search the computer based systems of the present invention to compare of target sequences and motifs. Computer programs to analyze expression levels in a sample and in controls are also known in the art.
A “target structural motif,” or “target motif,” refers to any rationally selected sequence or combination of sequences in which the sequence(s) are chosen based on a three-dimensional configuration that is formed upon the folding of the target motif, or on consensus sequences of regulatory or active sites. There are a variety of target motifs known in the art. Protein target motifs include, but are not limited to, enzyme active sites and signal sequences, kinase domains, receptor binding domains, SH2 domains, SH3 domains, phosphorylation sites, protein interaction domains, transmembrane domains, etc. Nucleic acid target motifs include, but are not limited to, hairpin structures, promoter sequences and other expression elements such as binding sites for transcription factors.
A variety of structural formats for the input and output means can be used to input and output the information in the computer-based systems of the present invention. One format for an output means ranks the relative expression levels of different polynucleotides. Such presentation provides a skilled artisan with a ranking of relative expression levels to determine a gene expression profile. A gene expression profile can be generated from, for example, a cDNA library prepared from mRNA isolated from a test cell suspected of being cancerous or pre-cancerous, comparing the sequences or partial sequences of the clones against the sequences in an electronic database, where the sequences of the electronic database represent genes differentially expressed in a cancerous cell, e.g., a cancerous breast cell. The number of clones having a sequence that has substantial similarity to a sequence that represents a gene differentially expressed in a cancerous cell is then determined, and the number of clones corresponding to each of such genes is determined. An increased number of clones that correspond to differentially expressed gene is present in the cDNA library of the test cell (relative to, for example, the number of clones expected in a cDNA of a normal cell) indicates that the test cell is cancerous.
As discussed above, the “library” as used herein also encompasses biochemical libraries of the polynucleotides of the sequences described herein, e.g., collections of nucleic acids representing the provided polynucleotides. The biochemical libraries can take a variety of forms, e.g., a solution of cDNAs, a pattern of probe nucleic acids stably associated with a surface of a solid support (i.e., an array) and the like. Of particular interest are nucleic acid arrays in which one or more of the genes described herein is represented by a sequence on the array. By array is meant an article of manufacture that has at least a substrate with at least two distinct nucleic acid targets on one of its surfaces, where the number of distinct nucleic acids can be considerably higher, typically being at least 10 nt, usually at least 20 nt and often at least 25 nt. A variety of different array formats have been developed and are known to those of skill in the art. The arrays of the subject invention find use in a variety of applications, including gene expression analysis, drug screening, mutation analysis and the like, as disclosed in the above-listed exemplary patent documents.
In addition to the above nucleic acid libraries, analogous libraries of polypeptides are also provided, where the polypeptides of the library will represent at least a portion of the polypeptides encoded by a gene corresponding to a sequence described herein.
Diagnostic and Other Methods Involving Detection of Differentially Expressed Genes
The present invention provides methods of using the polynucleotides described herein in, for example, diagnosis of cancer and classification of cancer cells according to expression profiles. In specific non-limiting embodiments, the methods are useful for detecting cancer cells, facilitating diagnosis of cancer and the severity of a cancer (e.g., tumor grade, tumor burden, and the like) in a subject, facilitating a determination of the prognosis of a subject, and assessing the responsiveness of the subject to therapy (e.g., by providing a measure of therapeutic effect through, for example, assessing tumor burden during or following a chemotherapeutic regimen). Detection can be based on detection of a polynucleotide that is differentially expressed in a cancer cell, and/or detection of a polypeptide encoded by a polynucleotide that is differentially expressed in a cancer cell (“a polypeptide associated with cancer”). The detection methods of the invention can be conducted in vitro or in vivo, on isolated cells, or in whole tissues or a bodily fluid, e.g., blood, plasma, serum, urine, and the like).
In general, methods of the invention involving detection of a gene product (e.g., mRNA, cDNA generated from such mRNA, and polypeptides) involve contacting a sample with a probe specific for the gene product of interest. “Probe” as used herein in such methods is meant to refer to a molecule that specifically binds a gene product of interest (e.g., the probe binds to the target gene product with a specificity sufficient to distinguish binding to target over non-specific binding to non-target (background) molecules). “Probes” include, but are not necessarily limited to, nucleic acid probes (e.g., DNA, RNA, modified nucleic acid, and the like), antibodies (e.g., antibodies, antibody fragments that retain binding to a target epitope, single chain antibodies, and the like), or other polypeptide, peptide, or molecule (e.g., receptor ligand) that specifically binds a target gene product of interest.
The probe and sample suspected of having the gene product of interest are contacted under conditions suitable for binding of the probe to the gene product. For example, contacting is generally for a time sufficient to allow binding of the probe to the gene product (e.g., from several minutes to a few hours), and at a temperature and conditions of osmolarity and the like that provide for binding of the probe to the gene product at a level that is sufficiently distinguishable from background binding of the probe (e.g., under conditions that minimize non-specific binding). Suitable conditions for probe-target gene product binding can be readily determined using controls and other techniques available and known to one of ordinary skill in the art.
In this embodiment, the probe can be an antibody or other polypeptide, peptide, or molecule (e.g., receptor ligand) that specifically binds a target polypeptide of interest.
The detection methods can be provided as part of a kit. Thus, the invention further provides kits for detecting the presence and/or a level of a polynucleotide that is differentially expressed in a cancer cell (e.g., by detection of an mRNA encoded by the differentially expressed gene of interest), and/or a polypeptide encoded thereby, in a biological sample. Procedures using these kits can be performed by clinical laboratories, experimental laboratories, medical practitioners, or private individuals. The kits of the invention for detecting a polypeptide encoded by a polynucleotide that is differentially expressed in a cancer cell comprise a moiety that specifically binds the polypeptide, which may be a specific antibody. The kits of the invention for detecting a polynucleotide that is differentially expressed in a cancer cell comprise a moiety that specifically hybridizes to such a polynucleotide. The kit may optionally provide additional components that are useful in the procedure, including, but not limited to, buffers, developing reagents, labels, reacting surfaces, means for detection, control samples, standards, instructions, and interpretive information.
Detecting a Polypeptide Encoded by a Polynucleotide that is Differentially Expressed in a Cancer Cell
In some embodiments, methods are provided for a detecting cancer cell by detecting in a cell, a polypeptide encoded by a gene differentially expressed in a cancer cell. Any of a variety of known methods can be used for detection, including, but not limited to, immunoassay, using an antibody specific for the encoded polypeptide, e.g., by enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and the like; and functional assays for the encoded polypeptide, e.g., binding activity or enzymatic activity.
For example, an immunofluorescence assay can be easily performed on cells without first isolating the encoded polypeptide. The cells are first fixed onto a solid support, such as a microscope slide or microtiter well. This fixing step can permeabilize the cell membrane. The permeablization of the cell membrane permits the polypeptide-specific probe (e.g, antibody) to bind. Alternatively, where the polypeptide is secreted or membrane-bound, or is otherwise accessible at the cell-surface (e.g., receptors, and other molecule stably-associated with the outer cell membrane or otherwise stably associated with the cell membrane, such permeabilization may not be necessary.
Next, the fixed cells are exposed to an antibody specific for the encoded polypeptide. To increase the sensitivity of the assay, the fixed cells may be further exposed to a second antibody, which is labeled and binds to the first antibody, which is specific for the encoded polypeptide. Typically, the secondary antibody is detectably labeled, e.g., with a fluorescent marker. The cells which express the encoded polypeptide will be fluorescently labeled and easily visualized under the microscope. See, for example, Hashido et al. (1992) Biochem. Biophys. Res. Comm. 187:1241-1248.
As will be readily apparent to the ordinarily skilled artisan upon reading the present specification, the detection methods and other methods described herein can be varied. Such variations are within the intended scope of the invention. For example, in the above detection scheme, the probe for use in detection can be immobilized on a solid support, and the test sample contacted with the immobilized probe. Binding of the test sample to the probe can then be detected in a variety of ways, e.g., by detecting a detectable label bound to the test sample.
The present invention further provides methods for detecting the presence of and/or measuring a level of a polypeptide in a biological sample, which polypeptide is encoded by a polynucleotide that represents a gene differentially expressed in cancer, particularly in a polynucleotide that represents a gene differentially cancer cell, using a probe specific for the encoded polypeptide. In this embodiment, the probe can be a an antibody or other polypeptide, peptide, or molecule (e.g., receptor ligand) that specifically binds a target polypeptide of interest.
The methods generally comprise: a) contacting the sample with an antibody specific for a differentially expressed polypeptide in a test cell; and b) detecting binding between the antibody and molecules of the sample. The level of antibody binding (either qualitative or quantitative) indicates the cancerous state of the cell. For example, where the differentially expressed gene is increased in cancerous cells, detection of an increased level of antibody binding to the test sample relative to antibody binding level associated with a normal cell indicates that the test cell is cancerous.
Suitable controls include a sample known not to contain the encoded polypeptide; and a sample contacted with an antibody not specific for the encoded polypeptide, e.g., an anti-idiotype antibody. A variety of methods to detect specific antibody-antigen interactions are known in the art and can be used in the method, including, but not limited to, standard immunohistological methods, immunoprecipitation, an enzyme immunoassay, and a radioimmunoassay.
In general, the specific antibody will be detectably labeled, either directly or indirectly. Direct labels include radioisotopes; enzymes whose products are detectable (e.g., luciferase, β-galactosidase, and the like); fluorescent labels (e.g., fluorescein isothiocyanate, rhodamine, phycoerythrin, and the like); fluorescence emitting metals, e.g., 152Eu, or others of the lanthanide series, attached to the antibody through metal chelating groups such as EDTA; chemiluminescent compounds, e.g., luminol, isoluminol, acridinium salts, and the like; bioluminescent compounds, e.g., luciferin, aequorin (green fluorescent protein), and the like.
The antibody may be attached (coupled) to an insoluble support, such as a polystyrene plate or a bead. Indirect labels include second antibodies specific for antibodies specific for the encoded polypeptide (“first specific antibody”), wherein the second antibody is labeled as described above; and members of specific binding pairs, e.g., biotin-avidin, and the like. The biological sample may be brought into contact with and immobilized on a solid support or carrier, such as nitrocellulose, that is capable of immobilizing cells, cell particles, or soluble proteins. The support may then be washed with suitable buffers, followed by contacting with a detectably-labeled first specific antibody. Detection methods are known in the art and will be chosen as appropriate to the signal emitted by the detectable label. Detection is generally accomplished in comparison to suitable controls, and to appropriate standards.
In some embodiments, the methods are adapted for use in vivo, e.g., to locate or identify sites where cancer cells are present. In these embodiments, a detectably-labeled moiety, e.g., an antibody, which is specific for a cancer-associated polypeptide is administered to an individual (e.g., by injection), and labeled cells are located using standard imaging techniques, including, but not limited to, magnetic resonance imaging, computed tomography scanning, and the like. In this manner, cancer cells are differentially labeled.
Detecting a Polynucleotide that Represents a Gene Differentially Expressed in a Cancer Cell
In some embodiments, methods are provided for detecting a cancer cell by detecting expression in the cell of a transcript or that is differentially expressed in a cancer cell. Any of a variety of known methods can be used for detection, including, but not limited to, detection of a transcript by hybridization with a polynucleotide that hybridizes to a polynucleotide that is differentially expressed in a cancer cell; detection of a transcript by a polymerase chain reaction using specific oligonucleotide primers; in situ hybridization of a cell using as a probe a polynucleotide that hybridizes to a gene that is differentially expressed in a cancer cell and the like.
In many embodiments, the levels of a subject gene product are measured. By measured is meant qualitatively or quantitatively estimating the level of the gene product in a first biological sample either directly (e.g. by determining or estimating absolute levels of gene product) or relatively by comparing the levels to a second control biological sample. In many embodiments the second control biological sample is obtained from an individual not having not having cancer. As will be appreciated in the art, once a standard control level of gene expression is known, it can be used repeatedly as a standard for comparison. Other control samples include samples of cancerous tissue.
The methods can be used to detect and/or measure mRNA levels of a gene that is differentially expressed in a cancer cell. In some embodiments, the methods comprise: a) contacting a sample with a polynucleotide that corresponds to a differentially expressed gene described herein under conditions that allow hybridization; and b) detecting hybridization, if any. Detection of differential hybridization, when compared to a suitable control, is an indication of the presence in the sample of a polynucleotide that is differentially expressed in a cancer cell. Appropriate controls include, for example, a sample that is known not to contain a polynucleotide that is differentially expressed in a cancer cell. Conditions that allow hybridization are known in the art, and have been described in more detail above.
Detection can also be accomplished by any known method, including, but not limited to, in situ hybridization, PCR (polymerase chain reaction), RT-PCR (reverse transcription-PCR), and “Northern” or RNA blotting, arrays, microarrays, etc, or combinations of such techniques, using a suitably labeled polynucleotide. A variety of labels and labeling methods for polynucleotides are known in the art and can be used in the assay methods of the invention. Specific hybridization can be determined by comparison to appropriate controls.
Polynucleotides described herein are used for a variety of purposes, such as probes for detection of and/or measurement of, transcription levels of a polynucleotide that is differentially expressed in a cancer cell. Additional disclosure about preferred regions of the disclosed polynucleotide sequences is found in the Examples. A probe that hybridizes specifically to a polynucleotide disclosed herein should provide a detection signal at least 2-, 5-, 10-, or 20-fold higher than the background hybridization provided with other unrelated sequences. It should be noted that “probe” as used in this context of detection of nucleic acid is meant to refer to a polynucleotide sequence used to detect a differentially expressed gene product in a test sample. As will be readily appreciated by the ordinarily skilled artisan, the probe can be detectably labeled and contacted with, for example, an array comprising immobilized polynucleotides obtained from a test sample (e.g., mRNA). Alternatively, the probe can be immobilized on an array and the test sample detectably labeled. These and other variations of the methods of the invention are well within the skill in the art and are within the scope of the invention.
Labeled nucleic acid probes may be used to detect expression of a gene corresponding to the provided polynucleotide. In Northern blots, mRNA is separated electrophoretically and contacted with a probe. A probe is detected as hybridizing to an mRNA species of a particular size. The amount of hybridization can be quantitated to determine relative amounts of expression, for example under a particular condition. Probes are used for in situ hybridization to cells to detect expression. Probes can also be used in vivo for diagnostic detection of hybridizing sequences. Probes are typically labeled with a radioactive isotope. Other types of detectable labels can be used such as chromophores, fluorophores, and enzymes. Other examples of nucleotide hybridization assays are described in WO92/02526 and U.S. Pat. No. 5,124,246.
PCR is another means for detecting small amounts of target nucleic acids, methods for which may be found in Sambrook, et al. Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp. 14.2-14.33.
A detectable label may be included in the amplification reaction. Suitable detectable labels include fluorochromes, (e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein, 6-carboxy-X-rhodamine (ROX), 6-carboxy-2′,4′,7′,4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA)), radioactive labels, (e.g. 32P, 35S, 3H, etc.), and the like. The label may be a two stage system, where the polynucleotides is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label. The label may be conjugated to one or both of the primers. Alternatively, the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.
Arrays
Polynucleotide arrays provide a high throughput technique that can assay a large number of polynucleotides or polypeptides in a sample. This technology can be used as a tool to test for differential expression.
A variety of methods of producing arrays, as well as variations of these methods, are known in the art and contemplated for use in the invention. For example, arrays can be created by spotting polynucleotide probes onto a substrate (e.g., glass, nitrocellulose, etc.) in a two-dimensional matrix or array having bound probes. The probes can be bound to the substrate by either covalent bonds or by non-specific interactions, such as hydrophobic interactions.
Samples of polynucleotides can be detectably labeled (e.g., using radioactive or fluorescent labels) and then hybridized to the probes. Double stranded polynucleotides, comprising the labeled sample polynucleotides bound to probe polynucleotides, can be detected once the unbound portion of the sample is washed away. Alternatively, the polynucleotides of the test sample can be immobilized on the array, and the probes detectably labeled. Techniques for constructing arrays and methods of using these arrays are described in, for example, Schena et al. (1996) Proc Natl Acad Sci USA. 93(20):10614-9; Schena et al. (1995) Science 270(5235):467-70; Shalon et al. (1996) Genome Res. 6(7):639-45, U.S. Pat. No. 5,807,522, EP 799 897; WO 97/29212; WO 97/27317; EP 785 280; WO 97/02357; U.S. Pat. No. 5,593,839; U.S. Pat. No. 5,578,832; EP 728 520; U.S. Pat. No. 5,599,695; EP 721 016; U.S. Pat. No. 5,556,752; WO 95/22058; and U.S. Pat. No. 5,631,734. In most embodiments, the “probe” is detectably labeled. In other embodiments, the probe is immobilized on the array and not detectably labeled.
Arrays can be used, for example, to examine differential expression of genes and can be used to determine gene function. For example, arrays can be used to detect differential expression of a gene corresponding to a polynucleotide described herein, where expression is compared between a test cell and control cell (e.g., cancer cells and normal cells). For example, high expression of a particular message in a cancer cell, which is not observed in a corresponding normal cell, can indicate a cancer specific gene product. Exemplary uses of arrays are further described in, for example, Pappalarado et al., Sem. Radiation Oncol. (1998) 8:217; and Ramsay, Nature Biotechnol. (1998) 16:40. Furthermore, many variations on methods of detection using arrays are well within the skill in the art and within the scope of the present invention. For example, rather than immobilizing the probe to a solid support, the test sample can be immobilized on a solid support which is then contacted with the probe.
Diagnosis, Prognosis, Assessment of Therapy (Therametrics), and Management of Cancer
The polynucleotides described herein, as well as their gene products and corresponding genes and gene products, are of particular interest as genetic or biochemical markers (e.g., in blood or tissues) that will detect the earliest changes along the carcinogenesis pathway and/or to monitor the efficacy of various therapies and preventive interventions.
For example, the level of expression of certain polynucleotides can be indicative of a poorer prognosis, and therefore warrant more aggressive chemo- or radio-therapy for a patient or vice versa. The correlation of novel surrogate tumor specific features with response to treatment and outcome in patients can define prognostic indicators that allow the design of tailored therapy based on the molecular profile of the tumor. These therapies include antibody targeting, antagonists (e.g., small molecules), and gene therapy.
Determining expression of certain polynucleotides and comparison of a patient's profile with known expression in normal tissue and variants of the disease allows a determination of the best possible treatment for a patient, both in terms of specificity of treatment and in terms of comfort level of the patient. Surrogate tumor markers, such as polynucleotide expression, can also be used to better classify, and thus diagnose and treat, different forms and disease states of cancer. Two classifications widely used in oncology that can benefit from identification of the expression levels of the genes corresponding to the polynucleotides described herein are staging of the cancerous disorder, and grading the nature of the cancerous tissue.
The polynucleotides that correspond to differentially expressed genes, as well as their encoded gene products, can be useful to monitor patients having or susceptible to cancer to detect potentially malignant events at a molecular level before they are detectable at a gross morphological level. In addition, the polynucleotides described herein, as well as the genes corresponding to such polynucleotides, can be useful as therametrics, e.g., to assess the effectiveness of therapy by using the polynucleotides or their encoded gene products, to assess, for example, tumor burden in the patient before, during, and after therapy.
Furthermore, a polynucleotide identified as corresponding to a gene that is differentially expressed in, and thus is important for, one type of cancer can also have implications for development or risk of development of other types of cancer, e.g., where a polynucleotide represents a gene differentially expressed across various cancer types. Thus, for example, expression of a polynucleotide corresponding to a gene that has clinical implications for cancer can also have clinical implications for metastatic breast cancer, colon cancer, or ovarian cancer, etc.
Staging.
Staging is a process used by physicians to describe how advanced the cancerous state is in a patient. Staging assists the physician in determining a prognosis, planning treatment and evaluating the results of such treatment. Staging systems vary with the types of cancer, but generally involve the following “TNM” system: the type of tumor, indicated by T; whether the cancer has metastasized to nearby lymph nodes, indicated by N; and whether the cancer has metastasized to more distant parts of the body, indicated by M. Generally, if a cancer is only detectable in the area of the primary lesion without having spread to any lymph nodes it is called Stage I. If it has spread only to the closest lymph nodes, it is called Stage II. In Stage III, the cancer has generally spread to the lymph nodes in near proximity to the site of the primary lesion. Cancers that have spread to a distant part of the body, such as the liver, bone, brain or other site, are Stage IV, the most advanced stage.
The polynucleotides and corresponding genes and gene products described herein can facilitate fine-tuning of the staging process by identifying markers for the aggressiveness of a cancer, e.g. the metastatic potential, as well as the presence in different areas of the body. Thus, a Stage II cancer with a polynucleotide signifying a high metastatic potential cancer can be used to change a borderline Stage II tumor to a Stage III tumor, justifying more aggressive therapy. Conversely, the presence of a polynucleotide signifying a lower metastatic potential allows more conservative staging of a tumor.
One type of breast cancer is ductal carcinoma in situ (DCIS): DCIS is when the breast cancer cells are completely contained within the breast ducts (the channels in the breast that carry milk to the nipple), and have not spread into the surrounding breast tissue. This may also be referred to as non-invasive or intraductal cancer, as the cancer cells have not yet spread into the surrounding breast tissue and so usually have not spread into any other part of the body.
Lobular carcinoma in situ breast cancer (LCIS) means that cell changes are found in the lining of the lobules of the breast. It can be present in both breasts. It is also referred to as non-invasive cancer as it has not spread into the surrounding breast tissue.
Invasive breast cancer can be staged as follows: Stage 1 tumours: these measure less than two centimetres. The lymph glands in the armpit are not affected and there are no signs that the cancer has spread elsewhere in the body; Stage 2 tumours: these measure between two and five centimetres, or the lymph glands in the armpit are affected, or both. However, there are no signs that the cancer has spread further; Stage 3 tumours: these are larger than five centimetres and may be attached to surrounding structures such as the muscle or skin. The lymph glands are usually affected, but there are no signs that the cancer has spread beyond the breast or the lymph glands in the armpit; Stage 4 tumours: these are of any size, but the lymph glands are usually affected and the cancer has spread to other parts of the body. This is secondary breast cancer.
Grading of Cancers.
Grade is a term used to describe how closely a tumor resembles normal tissue of its same type. The microscopic appearance of a tumor is used to identify tumor grade based on parameters such as cell morphology, cellular organization, and other markers of differentiation. As a general rule, the grade of a tumor corresponds to its rate of growth or aggressiveness, with undifferentiated or high-grade tumors generally being more aggressive than well-differentiated or low-grade tumors.
The polynucleotides of the Sequence Listing, and their corresponding genes and gene products, can be especially valuable in determining the grade of the tumor, as they not only can aid in determining the differentiation status of the cells of a tumor, they can also identify factors other than differentiation that are valuable in determining the aggressiveness of a tumor, such as metastatic potential.
Low grade means that the cancer cells look very like the normal cells. They are usually slowly growing and are less likely to spread. In high grade tumors the cells look very abnormal. They are likely to grow more quickly and are more likely to spread.
Assessment of Proliferation of Cells in Tumor.
The differential expression level of the polynucleotides described herein can facilitate assessment of the rate of proliferation of tumor cells, and thus provide an indicator of the aggressiveness of the rate of tumor growth. For example, assessment of the relative expression levels of genes involved in cell cycle can provide an indication of cellular proliferation, and thus serve as a marker of proliferation.
Detection of Cancer.
The polynucleotides corresponding to genes that exhibit the appropriate expression pattern can be used to detect cancer in a subject. The expression of appropriate polynucleotides can be used in the diagnosis, prognosis and management of cancer. Detection of cancer can be determined using expression levels of any of these sequences alone or in combination with the levels of expression of other known cancer genes. Determination of the aggressive nature and/or the metastatic potential of a cancer can be determined by comparing levels of one or more gene products of the genes corresponding to the polynucleotides described herein, and comparing total levels of another sequence known to vary in cancerous tissue, e.g., expression of p53, DCC, ras, FAP (see, e.g., Fearon E R, et al., Cell (1990) 61(5):759; Hamilton S R et al., Cancer (1993) 72:957; Bodmer W, et al., Nat. Genet. (1994) 4(3):217; Fearon ER, Ann N Y Acad. Sci. (1995) 768:101). For example, development of cancer can be detected by examining the level of expression of a gene corresponding to a polynucleotides described herein to the levels of oncogenes (e.g. ras) or tumor suppressor genes (e.g. FAP or p53). Thus expression of specific marker polynucleotides can be used to discriminate between normal and cancerous tissue, to discriminate between cancers with different cells of origin, to discriminate between cancers with different potential metastatic rates, etc. For a review of other markers of cancer, see, e.g., Hanahan et al. (2000) Cell 100:57-70.
Treatment of Cancer
The invention further provides methods for reducing growth of cancer cells. The methods provide for decreasing the expression of a gene that is differentially expressed in a cancer cell or decreasing the level of and/or decreasing an activity of a cancer-associated polypeptide. In general, the methods comprise contacting a cancer cell with a substance that modulates (1) expression of a gene that is differentially expressed in cancer; or (2) a level of and/or an activity of a cancer-associated polypeptide.
“Reducing growth of cancer cells” includes, but is not limited to, reducing proliferation of cancer cells, and reducing the incidence of a non-cancerous cell becoming a cancerous cell. Whether a reduction in cancer cell growth has been achieved can be readily determined using any known assay, including, but not limited to, [3H]-thymidine incorporation; counting cell number over a period of time; detecting and/or measuring a marker associated with breast cancer (e.g., PSA).
The present invention provides methods for treating cancer, generally comprising administering to an individual in need thereof a substance that reduces cancer cell growth, in an amount sufficient to reduce cancer cell growth and treat the cancer. Whether a substance, or a specific amount of the substance, is effective in treating cancer can be assessed using any of a variety of known diagnostic assays for cancer, including, but not limited to, proctoscopy, rectal examination, biopsy, contrast radiographic studies, CAT scan, and detection of a tumor marker associated with cancer in the blood of the individual (e.g., PSA (breast-specific antigen)). The substance can be administered systemically or locally. Thus, in some embodiments, the substance is administered locally, and cancer growth is decreased at the site of administration. Local administration may be useful in treating, e.g., a solid tumor.
A substance that reduces cancer cell growth can be targeted to a cancer cell. Thus, in some embodiments, the invention provides a method of delivering a drug to a cancer cell, comprising administering a drug-antibody complex to a subject, wherein the antibody is specific for a cancer-associated polypeptide, and the drug is one that reduces cancer cell growth, a variety of which are known in the art. Targeting can be accomplished by coupling (e.g., linking, directly or via a linker molecule, either covalently or non-covalently, so as to form a drug-antibody complex) a drug to an antibody specific for a cancer-associated polypeptide. Methods of coupling a drug to an antibody are well known in the art and need not be elaborated upon herein.
Tumor Classification and Patient Stratification
The invention further provides for methods of classifying tumors, and thus grouping or “stratifying” patients, according to the expression profile of selected differentially expressed genes in a tumor. Differentially expressed genes can be analyzed for correlation with other differentially expressed genes in a single tumor type or across tumor types. Genes that demonstrate consistent correlation in expression profile in a given cancer cell type (e.g., in a cancer cell or type of cancer) can be grouped together, e.g., when one gene is overexpressed in a tumor, a second gene is also usually overexpressed. Tumors can then be classified according to the expression profile of one or more genes selected from one or more groups.
The tumor of each patient in a pool of potential patients can be classified as described above. Patients having similarly classified tumors can then be selected for participation in an investigative or clinical trial of a cancer therapeutic where a homogeneous population is desired. The tumor classification of a patient can also be used in assessing the efficacy of a cancer therapeutic in a heterogeneous patient population. In addition, therapy for a patient having a tumor of a given expression profile can then be selected accordingly.
In another embodiment, differentially expressed gene products (e.g., polypeptides or polynucleotides encoding such polypeptides) may be effectively used in treatment through vaccination. The growth of cancer cells is naturally limited in part due to immune surveillance. Stimulation of the immune system using a particular tumor-specific antigen enhances the effect towards the tumor expressing the antigen. An active vaccine comprising a polypeptide encoded by the cDNA of this invention would be appropriately administered to subjects having an alteration, e.g., overabundance, of the corresponding RNA, or those predisposed for developing cancer cells with an alteration of the same RNA. Polypeptide antigens are typically combined with an adjuvant as part of a vaccine composition. The vaccine is preferably administered first as a priming dose, and then again as a boosting dose, usually at least four weeks later. Further boosting doses may be given to enhance the effect. The dose and its timing are usually determined by the person responsible for the treatment.
The invention also encompasses the selection of a therapeutic regimen based upon the expression profile of differentially expressed genes in the patient's tumor. For example, a tumor can be analyzed for its expression profile of the genes corresponding to SEQ ID NOS: 1-13996 as described herein, e.g., the tumor is analyzed to determine which genes are expressed at elevated levels or at decreased levels relative to normal cells of the same tissue type. The expression patterns of the tumor are then compared to the expression patterns of tumors that respond to a selected therapy. Where the expression profiles of the test tumor cell and the expression profile of a tumor cell of known drug responsivity at least substantially match (e.g., selected sets of genes at elevated levels in the tumor of known drug responsivity and are also at elevated levels in the test tumor cell), then the therapeutic agent selected for therapy is the drug to which tumors with that expression pattern respond.
Pattern Matching in Diagnosis Using Arrays
In another embodiment, the diagnostic and/or prognostic methods of the invention involve detection of expression of a selected set of genes in a test sample to produce a test expression pattern (TEP). The TEP is compared to a reference expression pattern (REP), which is generated by detection of expression of the selected set of genes in a reference sample (e.g., a positive or negative control sample). The selected set of genes includes at least one of the genes of the invention, which genes correspond to the polynucleotide sequences described herein. Of particular interest is a selected set of genes that includes gene differentially expressed in the disease for which the test sample is to be screened.
Identification of Therapeutic Targets and Anti-Cancer Therapeutic Agents
The present invention also encompasses methods for identification of agents having the ability to modulate activity of a differentially expressed gene product, as well as methods for identifying a differentially expressed gene product as a therapeutic target for treatment of cancer.
Identification of compounds that modulate activity of a differentially expressed gene product can be accomplished using any of a variety of drug screening techniques. Such agents are candidates for development of cancer therapies. Of particular interest are screening assays for agents that have tolerable toxicity for normal, non-cancerous human cells. The screening assays of the invention are generally based upon the ability of the agent to modulate an activity of a differentially expressed gene product and/or to inhibit or suppress phenomenon associated with cancer (e.g., cell proliferation, colony formation, cell cycle arrest, metastasis, and the like).
Screening of Candidate Agents
Screening assays can be based upon any of a variety of techniques readily available and known to one of ordinary skill in the art. In general, the screening assays involve contacting a cancerous cell with a candidate agent, and assessing the effect upon biological activity of a differentially expressed gene product. The effect upon a biological activity can be detected by, for example, detection of expression of a gene product of a differentially expressed gene (e.g., a decrease in mRNA or polypeptide levels, would in turn cause a decrease in biological activity of the gene product). Alternatively or in addition, the effect of the candidate agent can be assessed by examining the effect of the candidate agent in a functional assay. For example, where the differentially expressed gene product is an enzyme, then the effect upon biological activity can be assessed by detecting a level of enzymatic activity associated with the differentially expressed gene product. The functional assay will be selected according to the differentially expressed gene product. In general, where the differentially expressed gene is increased in expression in a cancerous cell, agents of interest are those that decrease activity of the differentially expressed gene product.
Assays described infra can be readily adapted in the screening assay embodiments of the invention. Exemplary assays useful in screening candidate agents include, but are not limited to, hybridization-based assays (e.g., use of nucleic acid probes or primers to assess expression levels), antibody-based assays (e.g., to assess levels of polypeptide gene products), binding assays (e.g., to detect interaction of a candidate agent with a differentially expressed polypeptide, which assays may be competitive assays where a natural or synthetic ligand for the polypeptide is available), and the like. Additional exemplary assays include, but are not necessarily limited to, cell proliferation assays, antisense knockout assays, assays to detect inhibition of cell cycle, assays of induction of cell death/apoptosis, and the like. Generally such assays are conducted in vitro, but many assays can be adapted for in vivo analyses, e.g., in an animal model of the cancer.
Identification of Therapeutic Targets
In another embodiment, the invention contemplates identification of differentially expressed genes and gene products as therapeutic targets. In some respects, this is the converse of the assays described above for identification of agents having activity in modulating (e.g., decreasing or increasing) activity of a differentially expressed gene product.
In this embodiment, therapeutic targets are identified by examining the effect(s) of an agent that can be demonstrated or has been demonstrated to modulate a cancerous phenotype (e.g., inhibit or suppress or prevent development of a cancerous phenotype). Such agents are generally referred to herein as an “anti-cancer agent”, which agents encompass chemotherapeutic agents. For example, the agent can be an antisense oligonucleotide that is specific for a selected gene transcript. For example, the antisense oligonucleotide may have a sequence corresponding to a sequence of a differentially expressed gene described herein, e.g., a sequence of one of SEQ ID NOS: 1-13996.
Assays for identification of therapeutic targets can be conducted in a variety of ways using methods that are well known to one of ordinary skill in the art. For example, a test cancerous cell that expresses or overexpresses a differentially expressed gene is contacted with an anti-cancer agent, the effect upon a cancerous phenotype and a biological activity of the candidate gene product assessed. The biological activity of the candidate gene product can be assayed be examining, for example, modulation of expression of a gene encoding the candidate gene product (e.g., as detected by, for example, an increase or decrease in transcript levels or polypeptide levels), or modulation of an enzymatic or other activity of the gene product. The cancerous phenotype can be, for example, cellular proliferation, loss of contact inhibition of growth (e.g., colony formation), tumor growth (in vitro or in vivo), and the like. Alternatively or in addition, the effect of modulation of a biological activity of the candidate target gene upon cell death/apoptosis or cell cycle regulation can be assessed.
Inhibition or suppression of a cancerous phenotype, or an increase in cell death or apoptosis as a result of modulation of biological activity of a candidate gene product indicates that the candidate gene product is a suitable target for cancer therapy. Assays described infra can be readily adapted for assays for identification of therapeutic targets. Generally such assays are conducted in vitro, but many assays can be adapted for in vivo analyses, e.g., in an appropriate, art-accepted animal model of the cancer.
Candidate Agents
The term “agent” as used herein describes any molecule, e.g. protein or pharmaceutical, with the capability of modulating a biological activity of a gene product of a differentially expressed gene. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.
Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons. Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including, but not limited to: peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts (including extracts from human tissue to identify endogenous factors affecting differentially expressed gene products) are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
Exemplary candidate agents of particular interest include, but are not limited to, antisense and RNAi polynucleotides, and antibodies, soluble receptors, and the like. Antibodies and soluble receptors are of particular interest as candidate agents where the target differentially expressed gene product is secreted or accessible at the cell-surface (e.g., receptors and other molecule stably-associated with the outer cell membrane).
For method that involve RNAi (RNA interference), a double stranded RNA (dsRNA) molecule is usually used. The dsRNA is prepared to be substantially identical to at least a segment of a subject polynucleotide (e.g. a cDNA or gene). In general, the dsRNA is selected to have at least 70%, 75%, 80%, 85% or 90% sequence identity with the subject polynucleotide over at least a segment of the candidate gene. In other instances, the sequence identity is even higher, such as 95%, 97% or 99%, and in still other instances, there is 100% sequence identity with the subject polynucleotide over at least a segment of the subject polynucleotide. The size of the segment over which there is sequence identity can vary depending upon the size of the subject polynucleotide. In general, however, there is substantial sequence identity over at least 15, 20, 25, 30, 35, 40 or 50 nucleotides. In other instances, there is substantial sequence identity over at least 100, 200, 300, 400, 500 or 1000 nucleotides; in still other instances, there is substantial sequence identity over the entire length of the subject polynucleotide, i.e., the coding and non-coding region of the candidate gene.
Because only substantial sequence similarity between the subject polynucleotide and the dsRNA is necessary, sequence variations between these two species arising from genetic mutations, evolutionary divergence and polymorphisms can be tolerated. Moreover, as described further infra, the dsRNA can include various modified or nucleotide analogs.
Usually the dsRNA consists of two separate complementary RNA strands. However, in some instances, the dsRNA may be formed by a single strand of RNA that is self-complementary, such that the strand loops back upon itself to form a hairpin loop. Regardless of form, RNA duplex formation can occur inside or outside of a cell.
The size of the dsRNA that is utilized varies according to the size of the subject polynucleotide whose expression is to be suppressed and is sufficiently long to be effective in reducing expression of the subject polynucleotide in a cell. Generally, the dsRNA is at least 10-15 nucleotides long. In certain applications, the dsRNA is less than 20, 21, 22, 23, 24 or 25 nucleotides in length. In other instances, the dsRNA is at least 50, 100, 150 or 200 nucleotides in length. The dsRNA can be longer still in certain other applications, such as at least 300, 400, 500 or 600 nucleotides. Typically, the dsRNA is not longer than 3000 nucleotides. The optimal size for any particular subject polynucleotide can be determined by one of ordinary skill in the art without undue experimentation by varying the size of the dsRNA in a systematic fashion and determining whether the size selected is effective in interfering with expression of the subject polynucleotide.
dsRNA can be prepared according to any of a number of methods that are known in the art, including in vitro and in vivo methods, as well as by synthetic chemistry approaches.
In Vitro Methods.
Certain methods generally involve inserting the segment corresponding to the candidate gene that is to be transcribed between a promoter or pair of promoters that are oriented to drive transcription of the inserted segment and then utilizing an appropriate RNA polymerase to carry out transcription. One such arrangement involves positioning a DNA fragment corresponding to the candidate gene or segment thereof into a vector such that it is flanked by two opposable polymerase-specific promoters that can be same or different. Transcription from such promoters produces two complementary RNA strands that can subsequently anneal to form the desired dsRNA. Exemplary plasmids for use in such systems include the plasmid (PCR 4.0 TOPO) (available from Invitrogen). Another example is the vector pGEM-T (Promega, Madison, Wis.) in which the oppositely oriented promoters are T7 and SP6; the T3 promoter can also be utilized.
In a second arrangement, DNA fragments corresponding to the segment of the subject polynucleotide that is to be transcribed is inserted both in the sense and antisense orientation downstream of a single promoter. In this system, the sense and antisense fragments are cotranscribed to generate a single RNA strand that is self-complementary and thus can form dsRNA.
Various other in vitro methods have been described. Examples of such methods include, but are not limited to, the methods described by Sadher et al. (Biochem. Int. 14:1015, 1987); by Bhattacharyya (Nature 343:484, 1990); and by Livache, et al. (U.S. Pat. No. 5,795,715), each of which is incorporated herein by reference in its entirety.
Single-stranded RNA can also be produced using a combination of enzymatic and organic synthesis or by total organic synthesis. The use of synthetic chemical methods enable one to introduce desired modified nucleotides or nucleotide analogs into the dsRNA.
In Vivo Methods.
dsRNA can also be prepared in vivo according to a number of established methods (see, e.g., Sambrook, et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed.; Transcription and Translation (B. D. Hames, and S. J. Higgins, Eds., 1984); DNA Cloning, volumes I and II (D. N. Glover, Ed., 1985); and Oligonucleotide Synthesis (M. J. Gait, Ed., 1984, each of which is incorporated herein by reference in its entirety).
Once the single-stranded RNA has been formed, the complementary strands are allowed to anneal to form duplex RNA. Transcripts are typically treated with DNAase and further purified according to established protocols to remove proteins. Usually such purification methods are not conducted with phenol:chloroform. The resulting purified transcripts are subsequently dissolved in RNAase free water or a buffer of suitable composition.
dsRNA is generated by annealing the sense and anti-sense RNA in vitro. Generally, the strands are initially denatured to keep the strands separate and to avoid self-annealing. During the annealing process, typically certain ratios of the sense and antisense strands are combined to facilitate the annealing process. In some instances, a molar ratio of sense to antisense strands of 3:7 is used; in other instances, a ratio of 4:6 is utilized; and in still other instances, the ratio is 1:1.
The buffer composition utilized during the annealing process can in some instances affect the efficacy of the annealing process and subsequent transfection procedure. While some have indicated that the buffered solution used to carry out the annealing process should include a potassium salt such as potassium chloride (e.g. at a concentration of about 80 mM). In some embodiments, the buffer is substantially potassium free. Once single-stranded RNA has annealed to form duplex RNA, typically any single-strand overhangs are removed using an enzyme that specifically cleaves such overhangs (e.g., RNAase A or RNAase T).
Once the dsRNA has been formed, it is introduced into a reference cell, which can include an individual cell or a population of cells (e.g., a tissue, an embryo and an entire organism). The cell can be from essentially any source, including animal, plant, viral, bacterial, fungal and other sources. If a tissue, the tissue can include dividing or nondividing and differentiated or undifferentiated cells. Further, the tissue can include germ line cells and somatic cells. Examples of differentiated cells that can be utilized include, but are not limited to, neurons, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, adipocytes, osteoblasts, osteoclasts, hepatocytes, cells of the endocrine or exocrine glands, fibroblasts, myocytes, cardiomyocytes, and endothelial cells. The cell can be an individual cell of an embryo, and can be a blastocyte or an oocyte.
Certain methods are conducted using model systems for particular cellular states (e.g., a disease). For instance, certain methods provided herein are conducted with a cancer cell lines that serves as a model system for investigating genes that are correlated with various cancers.
A number of options can be utilized to deliver the dsRNA into a cell or population of cells such as in a cell culture, tissue or embryo. For instance, RNA can be directly introduced intracellularly. Various physical methods are generally utilized in such instances, such as administration by microinjection (see, e.g., Zernicka-Goetz, et al. (1997) Development 124:1133-1137; and Wianny, et al. (1998) Chromosoma 107: 430-439).
Other options for cellular delivery include permeabilizing the cell membrane and electroporation in the presence of the dsRNA, liposome-mediated transfection, or transfection using chemicals such as calcium phosphate. A number of established gene therapy techniques can also be utilized to introduce the dsRNA into a cell. By introducing a viral construct within a viral particle, for instance, one can achieve efficient introduction of an expression construct into the cell and transcription of the RNA encoded by the construct.
If the dsRNA is to be introduced into an organism or tissue, gene gun technology is an option that can be employed. This generally involves immobilizing the dsRNA on a gold particle which is subsequently fired into the desired tissue. Research has also shown that mammalian cells have transport mechanisms for taking in dsRNA (see, e.g., Asher, et al. (1969) Nature 223:715-717). Consequently, another delivery option is to administer the dsRNA extracellularly into a body cavity, interstitial space or into the blood system of the mammal for subsequent uptake by such transport processes. The blood and lymph systems and the cerebrospinal fluid are potential sites for injecting dsRNA. Oral, topical, parenteral, rectal and intraperitoneal administration are also possible modes of administration.
The composition introduced can also include various other agents in addition to the dsRNA. Examples of such agents include, but are not limited to, those that stabilize the dsRNA, enhance cellular uptake and/or increase the extent of interference. Typically, the dsRNA is introduced in a buffer that is compatible with the composition of the cell into which the RNA is introduced to prevent the cell from being shocked. The minimum size of the dsRNA that effectively achieves gene silencing can also influence the choice of delivery system and solution composition.
Sufficient dsRNA is introduced into the tissue to cause a detectable change in expression of a target gene (assuming the candidate gene is in fact being expressed in the cell into which the dsRNA is introduced) using available detection methodologies. Thus, in some instances, sufficient dsRNA is introduced to achieve at least a 5-10% reduction in candidate gene expression as compared to a cell in which the dsRNA is not introduced. In other instances, inhibition is at least 20, 30, 40 or 50%. In still other instances, the inhibition is at least 60, 70, 80, 90 or 95%. Expression in some instances is essentially completely inhibited to undetectable levels.
The amount of dsRNA introduced depends upon various factors such as the mode of administration utilized, the size of the dsRNA, the number of cells into which dsRNA is administered, and the age and size of an animal if dsRNA is introduced into an animal. An appropriate amount can be determined by those of ordinary skill in the art by initially administering dsRNA at several different concentrations for example, for example. In certain instances when dsRNA is introduced into a cell culture, the amount of dsRNA introduced into the cells varies from about 0.5 to 3 μg per 106 cells.
A number of options are available to detect interference of candidate gene expression (i.e., to detect candidate gene silencing). In general, inhibition in expression is detected by detecting a decrease in the level of the protein encoded by the candidate gene, determining the level of mRNA transcribed from the gene and/or detecting a change in phenotype associated with candidate gene expression.
Use of Polypeptides to Screen for Peptide Analogs and Antagonists
Polypeptides encoded by differentially expressed genes identified herein can be used to screen peptide libraries to identify binding partners, such as receptors, from among the encoded polypeptides. Peptide libraries can be synthesized according to methods known in the art (see, e.g., U.S. Pat. No. 5,010,175 and WO 91/17823).
Agonists or antagonists of the polypeptides of the invention can be screened using any available method known in the art, such as signal transduction, antibody binding, receptor binding, mitogenic assays, chemotaxis assays, etc. The assay conditions ideally should resemble the conditions under which the native activity is exhibited in vivo, that is, under physiologic pH, temperature, and ionic strength. Suitable agonists or antagonists will exhibit strong inhibition or enhancement of the native activity at concentrations that do not cause toxic side effects in the subject. Agonists or antagonists that compete for binding to the native polypeptide can require concentrations equal to or greater than the native concentration, while inhibitors capable of binding irreversibly to the polypeptide can be added in concentrations on the order of the native concentration.
Such screening and experimentation can lead to identification of a polypeptide binding partner, such as a receptor, encoded by a gene or a cDNA corresponding to a polynucleotide described herein, and at least one peptide agonist or antagonist of the binding partner. Such agonists and antagonists can be used to modulate, enhance, or inhibit receptor function in cells to which the receptor is native, or in cells that possess the receptor as a result of genetic engineering. Further, if the receptor shares biologically important characteristics with a known receptor, information about agonist/antagonist binding can facilitate development of improved agonists/antagonists of the known receptor.
Vaccines and Uses
The differentially expressed nucleic acids and polypeptides produced by the nucleic acids of the invention can also be used to modulate primary immune response to prevent or treat cancer. Every immune response is a complex and intricately regulated sequence of events involving several cell types. It is triggered when an antigen enters the body and encounters a specialized class of cells called antigen-presenting cells (APCs). These APCs capture a minute amount of the antigen and display it in a form that can be recognized by antigen-specific helper T lymphocytes. The helper (Th) cells become activated and, in turn, promote the activation of other classes of lymphocytes, such as B cells or cytotoxic T cells. The activated lymphocytes then proliferate and carry out their specific effector functions, which in many cases successfully activate or eliminate the antigen. Thus, activating the immune response to a particular antigen associated with a cancer cell can protect the patient from developing cancer or result in lymphocytes eliminating cancer cells expressing the antigen.
Gene products, including polypeptides, mRNA (particularly mRNAs having distinct secondary and/or tertiary structures), cDNA, or complete gene, can be prepared and used in vaccines for the treatment or prevention of hyperproliferative disorders and cancers. The nucleic acids and polypeptides can be utilized to enhance the immune response, prevent tumor progression, prevent hyperproliferative cell growth, and the like. Methods for selecting nucleic acids and polypeptides that are capable of enhancing the immune response are known in the art. Preferably, the gene products for use in a vaccine are gene products which are present on the surface of a cell and are recognizable by lymphocytes and antibodies.
The gene products may be formulated with pharmaceutically acceptable carriers into pharmaceutical compositions by methods known in the art. The composition is useful as a vaccine to prevent or treat cancer. The composition may further comprise at least one co-immunostimulatory molecule, including but not limited to one or more major histocompatibility complex (MHC) molecules, such as a class I or class II molecule, preferably a class I molecule. The composition may further comprise other stimulator molecules including B7.1, B7.2, ICAM-1, ICAM-2, LFA-1, LFA-3, CD72 and the like, immunostimulatory polynucleotides (which comprise an 5′-CG-3′ wherein the cytosine is unmethylated), and cytokines which include but are not limited to IL-1 through IL-15, TNF-α, IFN-γ, RANTES, G-CSF, M-CSF, IFN-α, CTAP III, ENA-78, GRO, 1-309, PF-4, IP-10, LD-78, MGSA, MIP-1α, MIP-1β, or combination thereof, and the like for immunopotentiation. In one embodiment, the immunopotentiators of particular interest are those that facilitate a Th1 immune response.
The gene products may also be prepared with a carrier that will protect the gene products against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid, and the like. Methods for preparation of such formulations are known in the art.
In the methods of preventing or treating cancer, the gene products may be administered via one of several routes including but not limited to transdermal, transmucosal, intravenous, intramuscular, subcutaneous, intradermal, intraperitoneal, intrathecal, intrapleural, intrauterine, rectal, vaginal, topical, intratumor, and the like. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be by nasal sprays or suppositories. For oral administration, the gene products are formulated into conventional oral administration form such as capsules, tablets, elixirs and the like.
The gene product is administered to a patient in an amount effective to prevent or treat cancer. In general, it is desirable to provide the patient with a dosage of gene product of at least about 1 pg per Kg body weight, preferably at least about 1 ng per Kg body weight, more preferably at least about 1 μg or greater per Kg body weight of the recipient. A range of from about 1 ng per Kg body weight to about 100 mg per Kg body weight is preferred although a lower or higher dose may be administered. The dose is effective to prime, stimulate and/or cause the clonal expansion of antigen-specific T lymphocytes, preferably cytotoxic T lymphocytes, which in turn are capable of preventing or treating cancer in the recipient. The dose is administered at least once and may be provided as a bolus or a continuous administration. Multiple administrations of the dose over a period of several weeks to months may be preferable. Subsequent doses may be administered as indicated.
In another method of treatment, autologous cytotoxic lymphocytes or tumor infiltrating lymphocytes may be obtained from a patient with cancer. The lymphocytes are grown in culture, and antigen-specific lymphocytes are expanded by culturing in the presence of the specific gene products alone or in combination with at least one co-immunostimulatory molecule with cytokines. The antigen-specific lymphocytes are then infused back into the patient in an amount effective to reduce or eliminate the tumors in the patient. Cancer vaccines and their uses are further described in U.S. Pat. No. 5,961,978; U.S. Pat. No. 5,993,829; U.S. Pat. No. 6,132,980; and WO 00/38706.
Pharmaceutical Compositions and Uses
Pharmaceutical compositions can comprise polypeptides, receptors that specifically bind a polypeptide produced by a differentially expressed gene (e.g., antibodies, or polynucleotides (including antisense nucleotides and ribozymes) of the claimed invention in a therapeutically effective amount. The compositions can be used to treat primary tumors as well as metastases of primary tumors. In addition, the pharmaceutical compositions can be used in conjunction with conventional methods of cancer treatment, e.g., to sensitize tumors to radiation or conventional chemotherapy.
Where the pharmaceutical composition comprises a receptor (such as an antibody) that specifically binds to a gene product encoded by a differentially expressed gene, the receptor can be coupled to a drug for delivery to a treatment site or coupled to a detectable label to facilitate imaging of a site comprising cancer cells. Methods for coupling antibodies to drugs and detectable labels are well known in the art, as are methods for imaging using detectable labels.
The term “therapeutically effective amount” as used herein refers to an amount of a therapeutic agent to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect. The effect can be detected by, for example, chemical markers or antigen levels. Therapeutic effects also include reduction in physical symptoms, such as decreased body temperature.
The precise effective amount for a subject will depend upon the subject's size and health, the nature and extent of the condition, and the therapeutics or combination of therapeutics selected for administration. Thus, it is not useful to specify an exact effective amount in advance. However, the effective amount for a given situation is determined by routine experimentation and is within the judgment of the clinician. For purposes of the present invention, an effective dose will generally be from about 0.01 mg/kg to 50 mg/kg or 0.05 mg/kg to about 10 mg/kg of the DNA constructs in the individual to which it is administered.
A pharmaceutical composition can also contain a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent, such as antibodies or a polypeptide, genes, and other therapeutic agents. The term refers to any pharmaceutical carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition, and which can be administered without undue toxicity. Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in therapeutic compositions can include liquids such as water, saline, glycerol and ethanol. Auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, can also be present in such vehicles.
Typically, the therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. Liposomes are included within the definition of a pharmaceutically acceptable carrier. Pharmaceutically acceptable salts can also be present in the pharmaceutical composition, e.g., mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington: The Science and Practice of Pharmacy (1995) Alfonso Gennaro, Lippincott, Williams, & Wilkins.
Delivery Methods
Once formulated, the compositions contemplated by the invention can be (1) administered directly to the subject (e.g., as polynucleotide, polypeptides, small molecule agonists or antagonists, and the like); or (2) delivered ex vivo, to cells derived from the subject (e.g., as in ex vivo gene therapy). Direct delivery of the compositions will generally be accomplished by parenteral injection, e.g., subcutaneously, intraperitoneally, intravenously or intramuscularly, intratumoral or to the interstitial space of a tissue. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications, needles, and gene guns or hyposprays. Dosage treatment can be a single dose schedule or a multiple dose schedule.
Methods for the ex vivo delivery and reimplantation of transformed cells into a subject are known in the art and described in e.g., International Publication No. WO 93/14778. Examples of cells useful in ex vivo applications include, for example, stem cells, particularly hematopoetic, lymph cells, macrophages, dendritic cells, or tumor cells. Generally, delivery of nucleic acids for both ex vivo and in vitro applications can be accomplished by, for example, dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into nuclei, all well known in the art.
Once differential expression of a gene corresponding to a polynucleotide described herein has been found to correlate with a proliferative disorder, such as neoplasia, dysplasia, and hyperplasia, the disorder can be amenable to treatment by administration of a therapeutic agent based on the provided polynucleotide, corresponding polypeptide or other corresponding molecule (e.g., antisense, ribozyme, etc.). In other embodiments, the disorder can be amenable to treatment by administration of a small molecule drug that, for example, serves as an inhibitor (antagonist) of the function of the encoded gene product of a gene having increased expression in cancerous cells relative to normal cells or as an agonist for gene products that are decreased in expression in cancerous cells (e.g., to promote the activity of gene products that act as tumor suppressors).
The dose and the means of administration of the inventive pharmaceutical compositions are determined based on the specific qualities of the therapeutic composition, the condition, age, and weight of the patient, the progression of the disease, and other relevant factors. For example, administration of polynucleotide therapeutic composition agents includes local or systemic administration, including injection, oral administration, particle gun or catheterized administration, and topical administration. In general, the therapeutic polynucleotide composition contains an expression construct comprising a promoter operably linked to a polynucleotide of at least 12, 22, 25, 30, or 35 contiguous nt of the polynucleotide disclosed herein. Various methods can be used to administer the therapeutic composition directly to a specific site in the body. For example, a small metastatic lesion is located and the therapeutic composition injected several times in several different locations within the body of the tumor. Alternatively, arteries which serve a tumor are identified, and the therapeutic composition injected into such an artery, in order to deliver the composition directly into the tumor. A tumor that has a necrotic center is aspirated and the composition injected directly into the now empty center of the tumor. The antisense composition is directly administered to the surface of the tumor, for example, by topical application of the composition. X-ray imaging is used to assist in certain of the above delivery methods.
Targeted delivery of therapeutic compositions containing an antisense polynucleotide, subgenomic polynucleotides, or antibodies to specific tissues can also be used. Receptor-mediated DNA delivery techniques are described in, for example, Findeis et al., Trends Biotechnol. (1993) 11:202; Chiou et al., Gene Therapeutics: Methods And Applications Of Direct Gene Transfer (J. A. Wolff, ed.) (1994); Wu et al., J. Biol. Chem. (1988) 263:621; Wu et al., J. Biol. Chem. (1994) 269:542; Zenke et al., Proc. Natl. Acad. Sci. (USA) (1990) 87:3655; Wu et al., J. Biol. Chem. (1991) 266:338. Therapeutic compositions containing a polynucleotide are administered in a range of about 100 ng to about 200 mg of DNA for local administration in a gene therapy protocol. Concentration ranges of about 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100:g of DNA can also be used during a gene therapy protocol. Factors such as method of action (e.g., for enhancing or inhibiting levels of the encoded gene product) and efficacy of transformation and expression are considerations that will affect the dosage required for ultimate efficacy of the antisense subgenomic polynucleotides.
The therapeutic polynucleotides and polypeptides of the present invention can be delivered using gene delivery vehicles. The gene delivery vehicle can be of viral or non-viral origin (see generally, Jolly, Cancer Gene Therapy (1994) 1:51; Kimura, Human Gene Therapy (1994) 5:845; Connelly, Human Gene Therapy (1995) 1:185; and Kaplitt, Nature Genetics (1994) 6:148). Expression of such coding sequences can be induced using endogenous mammalian or heterologous promoters. Expression of the coding sequence can be either constitutive or regulated.
Viral-based vectors for delivery of a desired polynucleotide and expression in a desired cell are well known in the art. Exemplary viral-based vehicles include, but are not limited to, recombinant retroviruses (see, e.g., WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Pat. No. 5,219,740; WO 93/11230; WO 93/10218; U.S. Pat. No. 4,777,127; GB Patent No. 2,200,651; EP 0 345 242; and WO 91/02805), alphavirus-based vectors (e.g., Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532), and adeno-associated virus (AAV) vectors (see, e.g., WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655). Administration of DNA linked to killed adenovirus as described in Curiel, Hum. Gene Ther. (1992) 3:147 can also be employed.
Non-viral delivery vehicles and methods can also be employed, including, but not limited to, polycationic condensed DNA linked or unlinked to killed adenovirus alone (see, e.g., Curiel, Hum. Gene Ther. (1992) 3:147); ligand-linked DNA (see, e.g., Wu, J. Biol. Chem. (1989) 264:16985); eukaryotic cell delivery vehicles cells (see, e.g., U.S. Pat. No. 5,814,482; WO 95/07994; WO 96/17072; WO 95/30763; and WO 97/42338) and nucleic charge neutralization or fusion with cell membranes. Naked DNA can also be employed. Exemplary naked DNA introduction methods are described in WO 90/11092 and U.S. Pat. No. 5,580,859. Liposomes that can act as gene delivery vehicles are described in U.S. Pat. No. 5,422,120; WO 95/13796; WO 94/23697; WO 91/14445; and EP 0524968. Additional approaches are described in Philip, Mol. Cell. Biol. (1994) 14:2411, and in Woffendin, Proc. Natl. Acad. Sci. (1994) 91:1581.
The invention further provides for methods of classifying tumors, and thus grouping or “stratifying” patients, according to the expression profile of selected differentially expressed genes in a tumor. The expression patterns of differentially expressed genes can be analyzed for correlation with the expression patterns of other differentially expressed genes in a single tumor type or across tumor types. Genes that demonstrate consistent correlation can be grouped together, e.g., genes are grouped together where if one gene is overexpressed in a tumor, a second gene is also usually overexpressed. Tumors can then be classified according to the expression profile of one or more genes selected from one or more groups.
For example, a colon tumor can be classified according to expression level of a gene product of one or more genes selected from one or more of the following groups: 1) Group I, which comprises the genes IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and 2) Group II, which comprises the genes IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1.
A Group I-type colon tumor has increased expression of at least one, usually at least two, more usually at least three, even more usually at least four, preferably at least five, more preferably at least six or more, but usually not more than 12, 10, or 8, Group I genes relative to a non-cancerous colon cell, where the expression is increased at least about 1.5-fold, at least about 2-fold, at least about 5-fold, or at least about 10-fold, and can be as high 50-fold, but is usually not more than 20-fold or 30-fold.
A Group II-type colon tumor is increased in expression of at least one, usually at least two, more usually at least three, Group II genes relative to a non-cancerous colon cells, where the expression is increased at least about 1.5-fold, at least about 2-fold, at least about 5-fold, or at least about 10-fold, and can be as high 50-fold, but is usually not more than 20-fold or 30-fold.
A Group I+II-type colon tumor is increased in expression of at least one, usually at least two, more usually at least three, even more usually at least four, preferably at least five, more preferably at least six or more, but usually not more than 12, 10, or 8, Group I genes relative to a non-cancerous colon cell, and has increased expression of at least one, usually at least two, more usually at least three, Group II genes relative to a non-cancerous colon cells, where expression of both the Group I and Group II genes is increased at least about 1.5-fold, at least about 2-fold, at least about 5-fold, or at least about 10-fold, and can be as high 50-fold, but is usually not more than 20-fold or 30-fold.
The tumor of each patient in a pool of potential patients for a clinical trial can be classified as described above. Patients having similarly classified tumors can then be selected for participation in an investigative or clinical trial of a cancer therapeutic where a homogeneous population is desired. The tumor classification of a patient can also be used in assessing the efficacy of a cancer therapeutic in a heterogeneous patient population. Thus, comparison of an individual's expression profile to the population profile for a type of cancer, permits the selection or design of drugs or other therapeutic regimens that are expected to be safe and efficacious for a particular patient or patient population (i.e., a group of patients having the same type of cancer).
In addition, the ability to target populations expected to show the most clinical benefit, based on expression profile can enable: 1) the repositioning of already marketed drugs; 2) the rescue of drug candidates whose clinical development has been discontinued as a result of safety or efficacy limitations, which are patient subgroup-specific; and 3) an accelerated and less costly development for candidate therapeutics and more optimal drug labeling (e.g. since measuring the effect of various doses of an agent on patients with a particular expression profile is useful for optimizing effective dose).
A certain embodiment of the invention is based on the discovery of genes differentially expressed in cancerous colon cells relative to normal cells, particularly metastatic or pre-metastatic cancerous colon cells relative to normal cells of the same tissue type. The genes of particular interest are those described in the Examples below. The invention is further based on the discovery that colon tumors can be classified according to the expression pattern of one or more of genes, and that patients can thus be classified and diagnosed, and therapy selected accordingly, according to these expression patterns. The gene(s) for analysis of expression of a gene product encoded by at least one gene selected from at least one of the following groups: 1) Group I, which comprises the genes IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and 2) Group II, which comprises the genes IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1. A tumor can then be classified as a Group I-type, Group II-type, or Group I+II-type tumor based on the expression profile of the tumor. The expression patterns associated with colon cancer, and which provide the basis for tumor classification and patient stratification, are described in the Examples below.
The methods of the invention can be carried out using any suitable probe for detection of a gene product that is differentially expressed in colon cancer cells. For example, mRNA (or cDNA generated from mRNA) expressed from a differentially expressed gene can be detected using polynucleotide probes. In another example, the differentially expressed gene product is a polypeptide, which polypeptides can be detected using, for example, antibodies that specifically bind such polypeptides or an antigenic portion thereof.
The present invention relates to methods and compositions useful in diagnosis of colon cancer, design of rational therapy, and the selection of patient populations for the purposes of clinical trials. The invention is based on the discovery that colon tumors of a patient can be classified according to an expression profile of one or more selected genes, which genes are differentially expressed in tumor cells relative to normal cells of the same tissue. Polynucleotides that correspond to the selected differentially expressed genes can be used in diagnostic assays to provide for diagnosis of cancer at the molecular level, and to provide for the basis for rational therapy (e.g., therapy is selected according to the expression pattern of a selected set of genes in the tumor). The gene products encoded by differentially expressed genes can also serve as therapeutic targets, and candidate agents effective against such targets screened by, for example, analyzing the ability of candidate agents to modulate activity of differentially expressed gene products.
In one aspect, the selected gene(s) for tumor cell (and thus patient) analysis of expression of a gene product encoded by at least one gene selected from at least one of the following groups: 1) Group I, which comprises the genes IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and 2) Group II, which comprises the genes IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1.
In another aspect, the invention provides a method for classifying a tumor that shares selected characteristics with respect to a tumor expression profile. In one embodiment, the invention provides a method for classifying a tumor according to an expression profile of one or more genes comprising detecting expression of at least a first Group I gene in a test colon cell sample. Detection of increased expression of the first gene in the test colon cell sample relative to expression of the gene in a control non-cancer cell sample indicates that the tumor is a Group I-type tumor.
In one embodiment, the first Group I gene is an IGF2 gene. In other specific embodiments, the method further comprises detecting expression of a second Group I gene in the test colon cell sample. Detection of increased expression of the first and second genes in the test colon cell sample relative to expression of the first and second genes, respectively, in a control non-cancer cell sample indicates that the tumor is a Group I-type tumor.
In another embodiment, the method further comprises detecting expression of a second and third Group I gene in the test colon cell sample. Detection of increased expression of the first, second, and third genes in the test colon cell sample relative to expression of the first, second, and third genes, respectively, in a control non-cancer cell sample indicates that the tumor is a Group I-type tumor. In other embodiments, the expression of the gene(s) is increased about 1.5-fold, about 2-fold, about 5-fold, or about 10-fold in the test sample relative to the control sample.
In another embodiment, the invention provides a method for classifying a tumor according to an expression profile of one or more genes comprising detecting expression of at least a first Group II gene in a test colon cell sample. Detection of increased expression of the first gene in the test colon cell sample relative to expression of the gene in a control non-cancer cell sample indicates that the tumor is a Group II-type tumor.
In another embodiment, the first Group II gene is a member of the IFITM family of genes. In other specific embodiments, the method further comprises detecting expression of a second Group II gene in the test colon cell sample. Detection of increased expression of the first and second genes in the test colon cell sample relative to expression of the first and second genes, respectively, in a control non-cancer cell sample indicates that the tumor is a Group II-type tumor. In other embodiments, the expression of the gene(s) is increased about 1.5-fold, about 2-fold, about 5-fold, or about 10-fold in the test sample relative to the control sample. In yet other specific embodiments, the first Group II gene is 1-8U, 1-8D, or 9-27.
In another embodiment, the invention provides a method for classifying a tumor according to an expression profile of two or more genes, the method comprising analyzing a test colon cell sample for expression of at least one Group I gene and at least one Group II gene. Detection of increased expression of the at least one Group I gene and the at least one Group II gene in the test cell sample relative to expression of the at least one Group I gene and the at least one Group II gene, respectively, in a control non-cancer cell sample indicates the tumor is a Group I+II-type tumor. In other embodiments, the Group I gene is an IGF2 gene and the Group II gene is a member of the IFITM family of genes. In yet other embodiments, the expression of the genes is increased about 1.5-fold, about 2-fold, about 5-fold, or about 10-fold in the test sample relative to the control sample.
In another aspect, the invention provides methods for selection of a patient population having a tumor that shares selected characteristics with respect to a tumor expression profile. This method, referred to herein as “patient stratification,” can be used to improve the design of a clinical trial by providing a patient population that is more homogenous with respect to the tumor type that is to be tested for responsiveness to a new therapy; and in selecting the best therapeutic regiment for a patient in view of an expression profile of the subject's tumor (e.g., rational therapy).
In another aspect, the invention provides a method for selecting an individual for inclusion in a clinical trial, the method comprising the steps of: detecting a level of expression of a gene product in a test colon cell sample or serum obtained from a subject, the gene product being encoded by at least one gene selected from the group consisting of IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and comparing the level of expression of the gene product in the test sample to a level of expression in a normal colon cell; wherein detection of a level of expression of the gene product that is significantly higher in the test sample than in a normal cell is a positive indicator for inclusion of the subject in the test population for the clinical trial.
In another aspect the invention provides a method for selecting an individual for inclusion in a clinical trial, the method comprising the steps of: detecting a level of expression of a gene product in a test colon cell sample obtained from a subject, the gene product being encoded by at least one gene selected from the group consisting of: IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1; and comparing the level of expression of the gene product in the test sample to a level of expression in a normal colon cell; wherein detection of a level of expression of the gene product that is significantly higher in the test sample than in a normal cell is a positive indicator for inclusion of the subject in the test population for the clinical trial.
In related aspects the invention provides methods of reducing growth of cancerous colon cells by modulation of expression of one or more gene products corresponding to a gene selected from: 1) Group I, which comprises the genes IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and 2) Group II, which comprises the genes IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1. These methods are useful for treating colon cancer.
In another aspect, the present invention provides methods for disease detection by analysis of gene expression. In general, diagnostic and prognostic methods of the invention can involve obtaining a test cell from a subject, e.g., colon cells; detecting the level of expression of any one gene or a selected set of genes in the test cell, where the gene(s) are differentially expressed in a colon tumor cell relative to a normal colon cell; and comparing the expression levels of the gene(s) in the test cell to a control level (e.g., a level of expression in a normal (non-cancerous) colon cell). Detection of a level of expression in the test cell that differs from that found in a normal cell indicates that the test cell is a cancerous cell. The method of the invention permits, for example, detection of a small increase or decrease in gene product production from a gene whose overexpression or underexpression (compared to a reference gene) is associated with cancer or the predisposition for a cancer.
In another aspect the invention provides a method for detecting a cancerous colon cell comprising contacting a sample obtained from a test colon cell with a probe for detection of a gene product of a gene differentially expressed in colon cancer, wherein the gene corresponds to a polynucleotide having a sequence selected from the group consisting of SEQ ID NOS: 1-20, and where contacting is for a time sufficient for binding of the probe to the gene product; and comparing a level of binding of the probe to the sample with a level of probe binding to a control sample obtained from a control colon cell, wherein the control colon cell is of known cancerous state. An increased level of binding of the probe in the test colon cell sample relative to the level of binding in a control sample is indicative of the cancerous state of the test colon cell. In specific embodiments, the probe is a polynucleotide probe and the gene product is nucleic acid. In other specific embodiments, the gene product is a polypeptide. In further embodiments, the gene product or the probe is immobilized on an array.
In another aspect, the invention provides a method for assessing the cancerous phenotype (e.g., metastasis, aberrant cellular proliferation, and the like) of a colon cell comprising detecting expression of a gene product in a test colon cell sample, wherein the gene comprises a sequence selected from the group consisting of SEQ ID NOS: 1-20; and comparing a level of expression of the gene product in the test colon cell sample with a level of expression of the gene in a control cell sample. Comparison of the level of expression of the gene in the test cell sample relative to the level of expression in the control cell sample is indicative of the cancerous phenotype of the test cell sample. In specific embodiments, detection of expression of the gene is by detecting a level of an RNA transcript in the test cell sample. In other specific embodiments detection of expression of the gene is by detecting a level of a polypeptide in a test sample.
In another aspect, the invention provides a method for suppressing or inhibiting a cancerous phenotype of a cancerous cell, the method comprising introducing into a mammalian cell an antisense polynucleotide for inhibition of expression of a gene comprising a sequence selected from the group consisting of SEQ ID NOS: 1-20. Inhibition of expression of the gene inhibits development of a cancerous phenotype in the cell. In specific embodiments, the cancerous phenotype is metastasis, aberrant cellular proliferation relative to a normal cell, or loss of contact inhibition of cell growth.
In another aspect, the invention provides a method for assessing the tumor burden of a subject, the method comprising detecting a level of a differentially expressed gene product in a test sample from a subject suspected of or having a tumor, the differentially expressed gene product comprising a sequence selected from the group consisting of SEQ ID NOS: 1-20. Detection of the level of the gene product in the test sample is indicative of the tumor burden in the subject.
In another aspect, the invention provides a method for identifying a gene product as a target for a cancer therapeutic, the method comprising contacting a cancerous cell expressing a candidate gene product with an anti-cancer agent, wherein the candidate gene product corresponds to a sequence selected from the group consisting of SEQ ID NOS: 1-20; and analyzing the effect of the anti-cancer agent upon a biological activity of the candidate gene product and upon a cancerous phenotype of the cancerous cell. Modulation of the biological activity of the candidate gene product and modulation of the cancerous phenotype of the cancerous cell indicates the candidate gene product is a target for a cancer therapeutic. In specific embodiments, the cancerous cell is a cancerous colon cell. In other specific embodiments, the inhibitor is an antisense oligonucleotide. In further embodiments, the cancerous phenotype is aberrant cellular proliferation relative to a normal cell, or colony formation due to loss of contact inhibition of cell growth.
In another aspect, the invention provides a method for identifying agents that decrease biological activity of a gene product differentially expressed in a cancerous cell, the method comprising contacting a candidate agent with a differentially expressed gene product, the differentially expressed gene product corresponding to a sequence selected from the group consisting of SEQ ID NOS: 1-20; and detecting a decrease in a biological activity of the gene product relative to a level of biological activity of the gene product in the absence of the candidate agent. In specific embodiments, the detecting is by detection of a decrease in expression of the differentially expressed gene product. In other specific embodiments, the gene product is mRNA or cDNA prepared from the mRNA gene product. In further embodiments, the gene product is a polypeptide.
In all embodiments of the invention, analysis of expression of a gene product of a selected gene can be accomplished by analysis of gene transcription (e.g., by generating cDNA clones from mRNAs isolated from a cell suspected of being cancerous and comparing the number of cDNA clones corresponding to the gene in the sample relative to a number of clones present in a non-cancer cell of the same tissue type), detection of an encoded gene product (e.g., assessing a level of polypeptide encoded by a selected gene present in the test cell suspected of being cancerous relative to a level of the polypeptide in a non-cancer cell of the same tissue type), detection of a biological activity of a gene product encoded by a selected gene, and the like.
In all embodiments of the invention, comparison of gene product expression of a selected gene in a tumor cell can involve, for example, comparison to an “internal” control cell (e.g., a non-cancer cell of the same tissue type obtained from the same patient from whom the sample suspected of having a tumor cell was obtained), comparison to a control cell analyzed in parallel in the assay (e.g., a non-cancer cell, normally of the same tissue type as the test cell or a cancerous cell, normally of the same tissue type as the test cell), or comparison to a level of gene product expression known to be associated with a normal cell or a cancerous cell, normally of the same tissue type (e.g., a level of gene product expression is compared to a known level or range of levels of gene product expression for a normal cell or a cancerous cell, which can be provided in the form of, for example, a standard).
The sequences disclosed in this patent application were disclosed in several earlier patent applications. The relationship between the SEQ ID NOS in those earlier applications and the SEQ ID NOS disclosed herein is as follows. SEQ ID NOS: 1-321 of parent case 15805CON (Ser. No. 10/616,900, filed Jul. 9, 2003) correspond to SEQ ID NOS: 1-321 of the present application. SEQ ID NOS: 1-20 of parent case 16335 (Ser. No. 10/081,519, filed Feb. 21, 2002) correspond to SEQ ID NOS: 322-341 of the present application. SEQ ID NOS: 1-2164 of parent case 18095 (Ser. No. 10/310,673, filed Dec. 4, 2002) correspond to SEQ ID NOS: 342-2505 of the present application. SEQ ID NOS: 1-516 of parent case 17767 (Ser. No. 10/501,187, filed Jul. 8, 2004) correspond to SEQ ID NOS: 2506-3021 of the present application. SEQ ID NOS: 1-1303 of parent case 16336 (Ser. No. 10/081,124, filed Feb. 21, 2002) correspond to SEQ ID NOS: 3022-4324 of the present application. SEQ ID NOS: 1-9672 of parent case 18376 (US04/15421, filed May 13, 2004) correspond to SEQ ID NOS: 4325-13996 of the present application.
The disclosures of all prior U.S. applications to which the present application claims priority, which includes those U.S. applications referenced in the table above as well as their respective priority applications, are each incorporated herein by referenced in their entireties for all purposes, including the disclosures found in the Sequence Listings, tables, figures and Examples.
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
Candidate polynucleotides that may represent genes differentially expressed in cancer were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. In order to obtain the latter polynucleotides, mRNA was isolated from several selected cell lines and patient tissues, and used to construct cDNA libraries. The cells and tissues that served as sources for these cDNA libraries are summarized in Table 1 below.
The human colon cancer cell line Km12L4-A (Morikawa, et al., Cancer Research (1988) 48:6863) is derived from the KM12C cell line. The KM12C cell line (Morikawa et al. Cancer Res. (1988) 48:1943-1948), which is poorly metastatic (low metastatic) was established in culture from a Dukes' stage B2 surgical specimen (Morikawa et al. Cancer Res. (1988) 48:6863). The KML4-A is a highly metastatic subline derived from KM12C (Yeatman et al. Nucl. Acids. Res. (1995) 23:4007; Bao-Ling et al. Proc. Annu. Meet. Am. Assoc. Cancer. Res. (1995) 21:3269). The KM12C and KM12C-derived cell lines (e.g., KM12L4, KM12L4-A, etc.) are well-recognized in the art as a model cell line for the study of colon cancer (see, e.g., Moriakawa et al., supra; Radinsky et al. Clin. Cancer Res. (1995) 1:19; Yeatman et al., (1995) supra; Yeatman et al. Clin. Exp. Metastasis (1996) 14:246).
The MDA-MB-231 cell line (Brinkley et al. Cancer Res. (1980) 40:3118-3129) was originally isolated from pleural effusions (Cailleau, J. Natl. Cancer. Inst. (1974) 53:661), is of high metastatic potential, and forms poorly differentiated adenocarcinoma grade II in nude mice consistent with breast carcinoma. The MCF7 cell line was derived from a pleural effusion of a breast adenocarcinoma and is non-metastatic. The MV-522 cell line is derived from a human lung carcinoma and is of high metastatic potential. The UCP-3 cell line is a low metastatic human lung carcinoma cell line; the MV-522 is a high metastatic variant of UCP-3. These cell lines are well-recognized in the art as models for the study of human breast and lung cancer (see, e.g., Chandrasekaran et al., Cancer Res. (1979) 39:870 (MDA-MB-231 and MCF-7); Gastpar et al., J Med Chem (1998) 41:4965 (MDA-MB-231 and MCF-7); Ranson et al., Br J Cancer (1998) 77:1586 (MDA-MB-231 and MCF-7); Kuang et al., Nucleic Acids Res (1998) 26:1116 (MDA-MB-231 and MCF-7); Varki et al., Int J Cancer (1987) 40:46 (UCP-3); Varki et al., Tumour Biol. (1990) 11:327; (MV-522 and UCP-3); Varki et al., Anticancer Res. (1990) 10:637; (MV-522); Kelner et al., Anticancer Res (1995) 15:867 (MV-522); and Zhang et al., Anticancer Drugs (1997) 8:696 (MV522)).
The samples of libraries 15-20 are derived from two different patients (UC#2, and UC#3). The bFGF-treated HMVEC were prepared by incubation with bFGF at 10 ng/ml for 2 hrs; the VEGF-treated HMVEC were prepared by incubation with 20 ng/ml VEGF for 2 hrs. Following incubation with the respective growth factor, the cells were washed and lysis buffer added for RNA preparation. The GRRpz and WOca cell lines were provided by Dr. Donna M. Peehl, Department of Medicine, Stanford University School of Medicine. GRRpz was derived from normal prostate epithelium. The WOca cell line is a Gleason Grade 4 cell line.
Characterization of Sequences in the Libraries
The sequences of the isolated polynucleotides were first masked to eliminate low complexity sequences using the XBLAST masking program (Claverie “Effective Large-Scale Sequence Similarity Searches,” In: Computer Methods for Macromolecular Sequence Analysis, Doolittle, ed., Meth. Enzymol. 266:212-227 Academic Press, NY, N.Y. (1996); see particularly Claverie, in “Automated DNA Sequencing and Analysis Techniques” Adams et al., eds., Chap. 36, p. 267 Academic Press, San Diego, 1994 and Claverie et al. Comput. Chem. (1993) 17:191). Generally, masking does not influence the final search results, except to eliminate sequences of relative little interest due to their low complexity, and to eliminate multiple “hits” based on similarity to repetitive regions common to multiple sequences, e.g., Alu repeats. Masking resulted in the elimination of several sequences. The remaining sequences were then used in a BLASTN vs. GenBank search. Gene assignment for the query sequences was determined based on best hit from the GenBank database; expectancy values are provided with the hit.
Summary of Polynucleotides Described Herein
Table 2 provides a summary of polynucleotides isolated as described above and identified as corresponding to a differentially expressed gene (see Example 2 below), as well as those polynucleotides obtained from publicly available sources. Specifically, Table 2 provides: 1) the SEQ ID NO assigned to each sequence for use in the present specification; 2) the Candidate Identification Number (“CID”) to which the sequence is assigned and which number is based on the selection of the candidate for further evaluation in the differential expression in cancerous cells relative to normal cells; 3) the Sequence Name assigned to each sequence; and 4) the name assigned to the sample or clone from which the sequence was isolated. The sequences corresponding to SEQ ID NOS are provided in the Sequence Listing. Because at least some of the provided polynucleotides represent partial mRNA transcripts, two or more polynucleotides may represent different regions of the same mRNA transcript and the same gene and/or may be contained within the same clone. Thus, if two or more SEQ ID NOS are identified as belonging to the same clone, then either sequence can be used to obtain the full-length mRNA or gene. It should be noted that not all cDNA libraries described above are represented on an array in the examples described below.
Summary of Blast Search Results
Table 3 provides the results of BLASTN searches of the Genbank database using the sequences of the polynucleotides as described above. Table 3 includes 1) the SEQ ID NO; 2) the “CID” or Candidate Identification Number to which the sequence is assigned; 3) the GenBank accession number of the Blast hit; 4) a description of the gene encoded by the Blast hit (“HitDesc”) having the closest sequence homology to the sequence on the array (and in some instances contains a sequence identical to the sequence on the array); 5) the Blast score (“Score”), which value is obtained by adding the similarities and differences of an alignment between the sequence and a database sequence, wherein a “match” is a positive value and a “mismatch” or “non-match” is a negative value; 6) the “Length” of the sequence, which represents the number of nucleotides in the database “hit”; 7) the Expect value (E) which describes the number of hits or matches “expected” if the database was random sequence, i.e. the E value describes the random background noise that exists for matches between sequences; and 8) the “Identities” ratio which is a ratio of number of bases in the query sequence that exactly match the number of bases in the database sequence when aligned.
musculus frizzled homolog 10
sapiens S100 calcium-binding protein A4
sapiens EphB3 (EPHB3) mRNA
Homo sapiens, Similar to
sapiens dyskeratosis congenita 1,
sapiens AXL receptor tyrosine kinase
sapiens CDC28 protein kinase 2 (CKS2),
sapiens Arg/Abl-interacting protein
Homo sapiens, type I transmembrane
sapiens cadherin 3, type 1, P-cadherin
Homo sapiens, nucleolar phosphoprotein
sapiens 26S proteasome-associated pad1
Homo sapiens, centrin, EF-hand protein,
sapiens kallikrein 6 (neurosin, zyme)
sapiens arachidonate 5-lipoxygenase
sapiens forkhead box M1 (FOXM1),
Homo sapiens cDNA FLJ20133 fis,
Homo sapiens, splicing factor 3b,
Homo sapiens, Similar to translocase of
sapiens bone morphogenetic protein 4
sapiens Friedreich ataxia (FRDA),
sapiens hypothetical gene supported by
Mus musculus adult male testis cDNA,
Homo sapiens, matrix metalloproteinase
sapiens pyrroline-5-carboxylate
Homo sapiens, Similar to insulin induced
sapiens minichromosome maintenance
sapiens pituitary tumor-transforming 1
Homo sapiens, cathepsin H, clone
Homo sapiens, pyridoxal (pyridoxine,
Homo sapiens cDNA FLJ20829 fis,
Homo sapiens, Similar to differential
Homo sapiens, integrin beta 3 binding
H. sapiens mRNA for receptor tyrosine
sapiens transketolase (Wernicke-
sapiens KIAA0173 gene product
sapiens fucosyltransferase 1 (galactoside
Homo sapiens pterin carbinolamine
Homo sapiens, D123 gene product, clone
Homo sapiens, annexin A3, clone
Homo sapiens mRNA; cDNA
Homo sapiens cDNA: FLJ21119 fis,
Homo sapiens, mutS (E. coli) homolog
H. sapiens mRNA for ch-TOG protein
Homo sapiens, clone MGC: 3823,
Homo sapiens cDNA: FLJ21409 fis,
Homo sapiens genomic DNA,
Homo sapiens clone 25107 mRNA
sapiens immunoglobulin superfamily
Homo sapiens GS1999full mRNA,
Homo sapiens cDNA FLJ10653 fis,
Homo sapiens mRNA for KIAA0939
sapiens thymidine kinase 1, soluble
sapiens transforming growth factor, beta-
sapiens calcyclin binding protein
Homo sapiens, replication factor C
Homo sapiens, non-metastatic cells 1,
sapiens dipeptidase 1 (renal) (DPEP1),
Homo sapiens Axin2 mRNA for
Homo sapiens, KIAA0101 gene product,
sapiens chromosome 1 open reading
sapiens transcription factor NRF (NRF),
Homo sapiens mRNA; cDNA
sapiens antizyme inhibitor (LOC51582),
Homo sapiens, ClpP (caseinolytic
sapiens KIAA0175 gene product
Homo sapiens, cyclin-dependent kinase
sapiens catenin (cadherin-associated
Homo sapiens, lactate dehydrogenase B,
Homo sapiens tetraspan NET-4 mRNA,
Homo sapiens, Similar to phosphoserine
sapiens adenosine kinase (ADK), mRNA
Homo sapiens, interferon induced
sapiens KIAA0170 gene product
sapiens RAE1 (RNA export 1, S. pombe)
sapiens integrin, alpha 2 (CD49B, alpha
Homo sapiens cDNA FLJ13977 fis,
sapiens v-myb avian myeloblastosis viral
sapiens TH1 drosophila homolog
sapiens cadherin, EGF LAG seven-pass
Homo sapiens dpy-30-like protein
Homo sapiens, hypothetical protein,
sapiens kallikrein 11 (KLK11), mRNA
sapiens 7-dehydrocholesterol reductase
Homo sapiens translation initiation factor
Homo sapiens, Similar to EphB4, clone
Homo sapiens, clone MGC: 1892,
sapiens activity-dependent
sapiens catechol-O-methyltransferase
Homo sapiens, proteasome (prosome,
Homo sapiens cDNA: FLJ20965 fis,
Homo sapiens, sigma receptor (SR31747
Homo sapiens, non-POU-domain-
sapiens hypothetical protein FLJ10850
sapiens hypothetical protein FLJ10540
sapiens AXL receptor tyrosine kinase
musculus RIKEN cDNA 2600005P05
Homo sapiens cDNA FLJ13092 fis,
Homo sapiens U50HG genes for U50′
musculus zona pellucida glycoprotein 2
Homo sapiens full length insert
sapiens protein tyrosine phosphatase,
sapiens tumor protein D52-like 1
Homo sapiens, proteasome (prosome,
sapiens KIAA0175 gene product
sapiens valyl-tRNA synthetase 2
sapiens nudix (nucleoside diphosphate
sapiens FOXJ2 forkhead factor
Homo sapiens mRNA; cDNA
Homo sapiens, clone MGC: 3017,
Homo sapiens stearoyl-CoA desaturase
Homo sapiens stearoyl-CoA desaturase
Homo sapiens apoptosis-associated
Homo sapiens apoptosis-associated
Homo sapiens macrophage inhibitory
Homo sapiens cDNA FLJ12864 fis,
Homo sapiens alpha-catenin-like protein
Homo sapiens, clone MGC: 1892,
sapiens KIAA0712 gene product
sapiens catenin (cadherin-associated
Homo sapiens, clone IMAGE: 2823731,
Homo sapiens, Similar to EphB4, clone
D. rerio mRNA for tyrosine kinase ligand
sapiens retinoblastoma-binding protein 8
sapiens sulfotransferase family,
sapiens cadherin, EGF LAG seven-pass
sapiens cadherin, EGF LAG seven-pass
sapiens kallikrein 11 (KLK11), mRNA
sapiens DEAD-box protein abstrakt
Homo sapiens over-expressed breast
sapiens hypothetical protein
sapiens secretory leukocyte protease
Homo sapiens PNAS-143 mRNA,
sapiens pituitary tumor-transforming 1
sapiens solute carrier family 26, member
sapiens ubiquitin carrier protein E2-C
sapiens SET translocation (myeloid
Homo sapiens cDNA FLJ14241 fis,
Homo sapiens, S100 calcium-binding
Homo sapiens, clone HQ0310
sapiens kallikrein 10 (KLK10), mRNA
sapiens nascent-polypeptide-associated
Homo sapiens keratin 23 (KRT23)
sapiens amphiregulin (schwannoma-
sapiens gamma-glutamyl hydrolase
sapiens plastin 3 (T isoform) (PLS3),
Homo sapiens (cell line HepG2, HeLa)
sapiens chromosome 20 open reading
sapiens glutathione peroxidase 1
sapiens glutathione peroxidase 1
Homo sapiens, CGI-138 protein, clone
Homo sapiens, MAD2 (mitotic arrest
sapiens similar to hypothetical protein
sapiens S-adenosylhomocysteine
Homo sapiens GTP binding protein
Homo sapiens, Similar to hypothetical
sapiens hypothetical protein (HSPC152),
sapiens S100 calcium-binding protein P
sapiens S100 calcium-binding protein P
Homo sapiens (subclone 4_b10 from
Homo sapiens, kallikrein 10, clone
sapiens ribosomal protein L10a
Homo sapiens dpy-30-like protein
Homo sapiens, non-metastatic cells 2,
sapiens eukaryotic translation initiation
Homo sapiens, proteasome (prosome,
Homo sapiens cDNA FLJ14241 fis,
Homo sapiens cDNA FLJ14241 fis,
sapiens Apg12 (autophagy 12, S.
cerevisiae)-like (APG12L), mRNA
Homo sapiens, clone IMAGE: 3450586,
sapiens glyoxalase I (GLO1), mRNA
Homo sapiens spliced UHG RNA
Homo sapiens, macrophage migration
Homo sapiens, ribosomal protein S3A,
Homo sapiens, carcinoembryonic
Homo sapiens mRNA; cDNA
sapiens putative nucleotide binding
Homo sapiens mRNA; cDNA
sapiens hypothetical protein MGC3077
sapiens interferon induced
sapiens KIAA0101 gene product
Homo sapiens C1orf19 mRNA, partial
Homo sapiens EWS protein/E1A
Homo sapiens, clone MGC: 10493,
Homo sapiens mRNA; cDNA
sapiens galactokinase 1 (GALK1),
Homo sapiens macrophage inhibitory
Pongo pygmaeus RH50 glycoprotein
sapiens tissue inhibitor of
Schistocerca gregaria semaphorin 2a
Homo sapiens, polo (Drosophia)-like
sapiens solute carrier family 9
sapiens serum-inducible kinase (SNK),
Homo sapiens, Similar to sterile-alpha
Mus musculus adult male testis cDNA,
M. musculus Srp20 gene
Homo sapiens, serine/threonine kinase
sapiens mitogen-activated protein kinase
sapiens PDZ-binding kinase; T-cell
sapiens PDZ-binding kinase; T-cell
Homo sapiens, v-raf murine sarcoma
sapiens v-akt murine thymoma viral
sapiens retinoblastoma-binding protein 7
Macaca fascicularis brain cDNA
Danio rerio mRNA for GABAA
sapiens budding uninhibited by
sapiens acid phosphatase 1, soluble
Homo sapiens cDNA: FLJ22513 fis,
Homo sapiens, clone MGC: 10779,
sapiens glutathione S-transferase pi
Homo sapiens, Similar to
Homo sapiens, Similar to proteasome
Helianthus tuberosus lectin 1 mRNA,
sapiens myristoylated alanine-rich
Homo sapiens, Similar to proteasome
Homo sapiens, non-metastatic cells 2,
sapiens membrane-associated tyrosine-
Drosophila melanogaster clone 2G2
Xenopus laevis (clone: XTCAD-1)
sapiens KIAA0100 gene product
Danio rerio mRNA for GABAA
sapiens protein kinase domains
sapiens phosphoglycerate kinase 1
sapiens glutamine PRPP
sapiens mitogen-activated protein kinase
sapiens similar to serine protease,
Homo sapiens, eukaryotic translation
sapiens serine/threonine kinase 11
sapiens SFRS protein kinase 2 (SRPK2),
sapiens HSKM-B protein (HSKM-B),
sapiens similar to ribosomal protein S6
Homo sapiens, serine/threonine kinase
sapiens cyclin-dependent kinase 5
sapiens serum/glucocorticoid regulated
sapiens mitogen-activated protein kinase
Homo sapiens, non-POU-domain-
sapiens EphB3 (EPHB3) mRNA
sapiens activin A receptor, type I
Homo sapiens, TTK protein kinase,
sapiens EphB3 (EPHB3) mRNA
sapiens protein tyrosine kinase 2 beta
Macaca fascicularis brain cDNA,
Homo sapiens, Similar to protein kinase
sapiens serine/threonine-protein kinase
sapiens v-ros avian UR2 sarcoma virus
Homo sapiens, clone MGC: 10779,
sapiens TYRO3 protein tyrosine kinase
P. falciparum gene for Ca2+ - ATPase
mRNA isolated from samples of cancerous and normal colon tissue obtained from patients were analyzed to identify genes differentially expressed in cancerous and normal cells. Normal and cancerous cells collected from cryopreserved patient tissues were isolated using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al. (1998) Trends Genet. 14:272-6; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:998-1001).
Tables 4A and 4B provide information about each patient from which the samples were isolated, including: the “Patient ID” and “Path ReportID”, which are numbers assigned to the patient and the pathology reports for identification purposes; the “Group” to which the patients have been assigned; the anatomical location of the tumor (“Anatom Loc”); the “Primary Tumor Size”; the “Primary Tumor Grade”; the identification of the histopathological grade (“Histopath Grade”); a description of local sites to which the tumor had invaded (“Local Invasion”); the presence of lymph node metastases (“Lymph Node Met”); the incidence of lymph node metastases (provided as a number of lymph nodes positive for metastasis over the number of lymph nodes examined) (“Incidence Lymphnode Met”); the “Regional Lymphnode Grade”; the identification or detection of metastases to sites distant to the tumor and their location (“Distant Met & Loc”); a description of the distant metastases (“Descrip Distant Met”); the grade of distant metastasis (“Dist Met Grade”); and general comments about the patient or the tumor (“Comments”). Adenoma was not described in any of the patients; adenoma dysplasia (described as hyperplasia by the pathologist) was described in Patient ID No. 695. Extranodal extensions were described in two patients, Patient ID Nos. 784 and 791. Lymphovascular invasion was described in seven patients, Patient ID Nos. 128, 278, 517, 534, 784, 786, and 791. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.
Identification of Differentially Expressed Genes
cDNA probes were prepared from total RNA isolated from the patient cells described above. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.
Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.
Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red), and vice versa.
Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots, for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array.
Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. PCR products of from about 0.5 kb to 2.0 kb amplified from these sources were spotted onto the array using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about four duplicate measurements for each clone, two of one color and two of the other, for each sample.
Table 5 describes the physical location of the differentially expressed polynucleotides on the arrays. Table 5 includes: 1) a Spot ID, which is a unique identifier for each spot containing target sequence of interest on all arrays used; 2) a “Chip Num” which refers to a particular array representing a specific set of genes; 3) the “Sample Name or Clone Name” from which the sequence was obtained; and 4) the coordinates of the sequence on the particular array (“Coordinates”). Table 6 provides information about the sequences on the arrays, specifically: 1) Candidate Identification Number; 2) Sample name or clone name; 3) function of the gene corresponding to the sequence (as determined by homology to genes of known function by BLAST search of GenBank); 4) the class of the gene (as determined by homology to genes of known function by BLAST search of GenBank); 5) the pathway in which the gene is implicated; 6) gene assignment; which refers to the gene to which the sequence has the greatest homology or identity; 7) the “Gene Symbol”; 8) chromosome number on which the gene is located (“Chrom Num”); 9) the map position on the chromosome.
Homo sapiens S100
sapiens]
sapiens]
sapiens]
sapiens]
sapiens]
S. pombe) homolog
sapiens]
sapiens]
sapiens]
S. cerevisiae)-like
sapiens]
sapiens]
The differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.
The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.
The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.
A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the tumor and normal sample. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).
Table 7 (incorporated by reference to a compact disk) provides the results for gene products differentially expressed in the colon tumor samples relative to normal tissue samples. Table 7 includes: 1) the SEQ ID NO; 2) the CID or candidate identification number; 3) the spot identification number (“SpotID”); 4) the percentage of patients tested in which expression levels of the gene was at least 2-fold greater in cancerous tissue than in matched normal tissue (“>=2×”); 5) the percentage of patients tested in which expression levels of the gene was at least 2.5-fold greater in cancerous tissue than in matched normal tissue (“>=2.5×”); 6) the percentage of patients tested in which expression levels of the gene was at least 5-fold greater in cancerous tissue than in matched normal cells (“>=5×”); 7) the percentage of patients tested in which expression levels of the gene was less than or equal to ½ of the expression level in matched normal cells (“<=half×”); and 8) the number of patients tested for each sequence. Table 7 also includes the results from each patient, identified by the patient ID number (e.g., “15Ratio”). This data represents the ratio of differential expression for the samples tested from that particular patient's tissues (e.g., “15Ratio” is the ratio from the tissue samples of patient ID no. 15). The ratios of differential expression is expressed as a normalized hybridization signal associated with the tumor probe divided by the normalized hybridization signal with the normal probe. Thus, a ratio greater than 1 indicates that the gene product is increased in expression in cancerous cells relative to normal cells, while a ratio of less than 1 indicates the opposite.
These data provide evidence that the genes represented by the polynucleotides having the indicated sequences are differentially expressed in colon cancer.
The expression of the differentially expressed genes represented by the polynucleotides in the cancerous cells was analyzed using antisense knockout technology to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting a metastatic phenotype.
A number of different oligonucleotides complementary to the mRNA generated by the differentially expressed genes identified herein were designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of the genes. Sets of antisense oligomers specific to each candidate target were designed using the sequences of the polynucleotides corresponding to a differentially expressed gene and the software program HYB simulator Version 4 (available for Windows 95/Windows NT or for Power Macintosh, RNAture, Inc. 1003 Health Sciences Road, West, Irvine, Calif. 92612 USA). Factors considered when designing antisense oligonucleotides include: 1) the secondary structure of oligonucleotides; 2) the secondary structure of the target gene; 3) the specificity with no or minimum cross-hybridization to other expressed genes; 4) stability; 5) length and 6) terminal GC content. The antisense oligonucleotide is designed to so that it will hybridize to its target sequence under conditions of high stringency at physiological temperatures (e.g., an optimal temperature for the cells in culture to provide for hybridization in the cell, e.g., about 37° C.), but with minimal formation of homodimers.
Using the sets of oligomers and the HYB simulator program, three to ten antisense oligonucleotides and their reverse controls were designed and synthesized for each candidate mRNA transcript, which transcript was obtained from the gene corresponding to the target polynucleotide sequence of interest. Once synthesized and quantitated, the oligomers were screened for efficiency of a transcript knock-out in a panel of cancer cell lines. The efficiency of the knock-out was determined by analyzing mRNA levels using lightcycler quantification. The oligomers that resulted in the highest level of transcript knock-out, wherein the level was at least about 50%, preferably about 80-90%, up to 95% or more up to undetectable message, were selected for use in a cell-based proliferation assay, an anchorage independent growth assay, and an apoptosis assay.
The ability of each designed antisense oligonucleotide to inhibit gene expression was tested through transfection into SW620 colon colorectal carcinoma cells. For each transfection mixture, a carrier molecule, preferably a lipitoid or cholesteroid, was prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide was then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide was further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, lipitoid or cholesteroid, typically in the amount of about 1.5-2 nmol lipitoid/μg antisense oligonucleotide, was diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide was immediately added to the diluted lipitoid and mixed by pipetting up and down. Oligonucleotide was added to the cells to a final concentration of 30 nM.
The level of target mRNA that corresponds to a target gene of interest in the transfected cells was quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA were normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) was placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water was added to a total volume of 12.5 μl. To each tube was added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents were mixed by pipetting up and down, and the reaction mixture was incubated at 42° C. for 1 hour. The contents of each tube were centrifuged prior to amplification.
An amplification mixture was prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT was added, and amplification was carried out according to standard protocols.
The results of the antisense assays are provided in Table 8. The results are expressed as the percent decrease in expression of the corresponding gene product relative to non-transfected cells, vehicle-only transfected (mock-transfected) cells, or cells transfected with reverse control oligonucleotides. Table 8 includes: 1) the SEQ ID NO; 2) the CID; 3) the “Gene Assignment” which refers to the gene to which the sequence has the greatest homology or identity; 4) the “Gene Symbol”; 5) GenBank gene name; and 6) the percent decrease in expression of the gene relative to control cells (“mRNA KO”).
Homo sapiens S100 calcium-binding protein
The effect of gene expression on the inhibition of cell proliferation was assessed in metastatic breast cancer cell lines (MDA-MB-231 (“231”)), SW620 colon colorectal carcinoma cells, or SKOV3 cells (a human ovarian carcinoma cell line).
Cells were plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide was diluted to 21.1M in OptiMEM™ and added to OptiMEM™ into which the delivery vehicle, lipitoid 116-6 in the case of SW620 cells or 1:1 lipitoid 1:cholesteroid 1 in the case of MDA-MB-231 cells, had been diluted. The oligo/delivery vehicle mixture was then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments was 300 nM, and the final ratio of oligo to delivery vehicle for all experiments was 1.5 nmol lipitoid/μg oligonucleotide.
Antisense oligonucleotides were prepared as described above (see Example 3). Cells were transfected overnight at 37° C. and the transfection mixture was replaced with fresh medium the next morning. Transfection was carried out as described above in Example 3.
The results of the antisense experiments are shown in Table 9 (column labeled “Proliferation”). Those antisense oligonucleotides that resulted in decreased proliferation in SW620 colorectal carcinoma cells are indicated by “Inhib in” and “weak effect in”, with the cell type following. Those antisense oligonucleotides that resulted in inhibition of proliferation of SW620 cells indicates that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibited proliferation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that resulted in inhibition of proliferation of MDA-MB-231 cells indicates that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells.
The effect of gene expression upon colony formation of SW620 cells, SKOV3 cells, and MD-MBA-231 cells was tested in a soft agar assay. Soft agar assays were conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer was formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells were counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots were placed with media in 96-well plates (to check counting with WST1), or diluted further for the soft agar assay. 2000 cells were plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidified, 2 ml of media was dribbled on top and antisense or reverse control oligo (produced as described in Example 3) was added without delivery vehicles. Fresh media and oligos were added every 3-4 days. Colonies formed in 10 days to 3 weeks. Fields of colonies were counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.
Table 9 provides the results of these assays (“Softagar”). Those antisense oligonucleotides that resulted in inhibition of colony formation are indicated by “inhibits”, “weak effect”, or “weak inhibition” followed by the cell type. Those antisense oligonucleotides that resulted in inhibition of colony formation of SW620 cells indicates that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibited colony formation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that resulted in inhibition of colony formation of MDA-MB-231 cells indicates that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells.
In order to assess the effect of depletion of a target message upon cell death, SW620 cells, or other cells derived from a cancer of interest, are transfected for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol is followed but cells are left in the presence of 2 μM drug. Each day, cytotoxicity was monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH is measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) is included; loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).
The gene products of sequences of a gene differentially expressed in cancerous cells can be further analyzed to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting or inhibiting development of a metastatic phenotype. For example, the function of gene products corresponding to genes identified herein can be assessed by blocking function of the gene products in the cell. For example, where the gene product is secreted or associated with a cell surface membrane, blocking antibodies can be generated and added to cells to examine the effect upon the cell phenotype in the context of, for example, the transformation of the cell to a cancerous, particularly a metastatic, phenotype.
Where the gene product of the differentially expressed genes identified herein exhibits sequence homology to a protein of known function (e.g., to a specific kinase or protease) and/or to a protein family of known function (e.g., contains a domain or other consensus sequence present in a protease family or in a kinase family), then the role of the gene product in tumorigenesis, as well as the activity of the gene product, can be examined using small molecules that inhibit or enhance function of the corresponding protein or protein family.
Additional functional assays include, but are not necessarily limited to, those that analyze the effect of expression of the corresponding gene upon cell cycle and cell migration. Methods for performing such assays are well known in the art.
The sequences of the polynucleotides provided in the present invention can be used to extend the sequence information of the gene to which the polynucleotides correspond (e.g., a gene, or mRNA encoded by the gene, having a sequence of the polynucleotide described herein). This expanded sequence information can in turn be used to further characterize the corresponding gene, which in turn provides additional information about the nature of the gene product (e.g., the normal function of the gene product). The additional information can serve to provide additional evidence of the gene product's use as a therapeutic target, and provide further guidance as to the types of agents that can modulate its activity.
In one example, a contig was assembled using the sequence of the polynucleotide having SEQ ID NO:2 (sequence name 019.G3.sp6—128473), which is present in clone M00006883D:H12. A “contig” is a contiguous sequence of nucleotides that is assembled from nucleic acid sequences having overlapping (e.g., shared or substantially similar) sequence information. The sequences of publicly-available ESTs (Expressed Sequence Tags) and the sequences of various clones from several cDNA libraries synthesized at Chiron were used in the contig assembly. None of the sequences from these latter clones from the cDNA libraries had significant hits against known genes with function when searched using BLASTN against GenBank as described above.
The contig was assembled using the software program Sequencher, version 4.05, according to the manufacturer's instructions. The final contig was assembled from 11 sequences, provided in the Sequence Listing as SEQ ID NOS:2 and 310-320. The sequence names and SEQ ID NOS of the sequences are provided in the overview alignment produced by Sequencher (see
The clone containing the sequence of 035JN032.H09 (SEQ ID NO:319) is of particular interest. This clone was originally obtained from a normalized cDNA library prepared from a prostate cancer tissue sample that was obtained from a patient with Gleason grade 3+3. The clone having the 035JN032.H09 sequence corresponds to a gene that has increased expression in (e.g., is upregulated) in colon cancer as detected by microarray analysis using the protocol and materials described above. The data is provided in Table 10 below.
“%>2×” and “%>5×” indicate the percentage of patients in which the corresponding gene was expressed at two-fold and five-fold greater levels in cancerous cells relative to normal cells, respectively.
This observation thus further validates the expression profile of the clone having the sequence of 035JN032.H09, as it indicates that the gene represented by this sequence and clone is differentially expressed in at least two different cancer types.
The sequence information obtained in the contig assembly described above was used to obtain a consensus sequence derived from the contig using the Sequencher program. The consensus sequence is provided as SEQ ID NO:320 in the Sequence Listing.
In preliminary experiments, the consensus sequence was used as a query sequence in a BLASTN search of the DGTI DoubleTwist Gene Index (DoubleTwist, Inc., Oakland, Calif.), which contains all the EST and non-redundant sequence in public databases. This preliminary search indicated that the consensus sequence has homology to a predicted gene homologue to human atrophin-1 (HSS0190516.1 dtgic|HSC010416.3 Similar to: DRPL_HUMAN gi|17660|sp|P54259|DRPL_HUMAN ATROPHIN-1 (DENTATORUBRAL-PALLIDOLUYSIAN ATROPHY PROTEIN) [Homo sapiens (Human), provided as SEQ ID NO:322), with a Score=1538 bits (776), Expect=0.0, and Identities=779/780 (99%).
While the preliminary results regarding the homology to atrophin-1 are not yet confirmed, this example, through contig assembly and the use of homology searching software programs, shows that the sequence information provided herein can be readily extended to confirm, or confirm a predicted, gene having the sequence of the polynucleotides described in the present invention. Further the information obtained can be used to identify the function of the gene product of the gene corresponding to the polynucleotides described herein. While not necessary to the practice of the invention, identification of the function of the corresponding gene, can provide guidance in the design of therapeutics that target the gene to modulate its activity and modulate the cancerous phenotype (e.g., inhibit metastasis, proliferation, and the like).
The biological materials used in the experiments that led to the present invention are described below.
Source of Patient Tissue Samples
Normal and cancerous tissues were collected from patients using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al. (1998) Trends Genet. 14:272-6; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:9981001). Table 11 provides information about each patient from which colon tissue samples were isolated, including: the Patient ID (“PT ID”) and Path ReportID (“Path ID”), which are numbers assigned to the patient and the pathology reports for identification purposes; the group (“Grp”) to which the patients have been assigned; the anatomical location of the tumor (“Anatom Loc”); the primary tumor size (“Size”); the primary tumor grade (“Grade”); the identification of the histopathological grade (“Histo Grade”); a description of local sites to which the tumor had invaded (“Local Invasion”); the presence of lymph node metastases (“Lymph Met”); the incidence of lymph node metastases (provided as a number of lymph nodes positive for metastasis over the number of lymph nodes examined) (“Lymph Met Incid”); the regional lymphnode grade (“Reg Lymph Grade”); the identification or detection of metastases to sites distant to the tumor and their location (“Dist Met & Loc”); the grade of distant metastasis (“Dist Met Grade”); and general comments about the patient or the tumor (“Comments”). Histophatology of all primary tumors indicated the tumor was adenocarcinoma except for Patient ID Nos. 130 (for which no information was provided), 392 (in which greater than 50% of the cells were mucinous carcinoma), and 784 (adenosquamous carcinoma). Extranodal extensions were described in three patients, Patient ID Nos. 784 and 791. Lymphovascular invasion was described in Patient ID Nos. 128, 228, 278, 517, 784, 786, 791, and 890. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.
Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. Table 12 provides information about the polynucleotides on the arrays including: (1) the “SEQ ID NO” assigned to each sequence for use in the present specification; (2) the spot identification number (“Spot ID”), an internal reference that serves as a unique identifier for the spot on the array; (3) the “Clone ID” assigned to the clone from which the sequence was isolated; (4) the number of the Group (“Grp”) to which the gene is assigned (see Example 11 below); and (5) the gene represented by the SEQ ID NO (“Gene”).
Homo sapiens IGF-II
Homo sapiens, TTK
Homo sapiens mRNA for
Homo sapiens cDNA:
Homo sapiens cDNA:
Homo sapiens, Similar to
Homo sapiens, clone
Homo sapiens, centrin,
Homo sapiens NPD008
Homo sapiens mRNA for
Homo sapiens fibroblast
Homo sapiens BBS2
H. sapiens mRNA for
Homo sapiens mitogen-
Homo sapiens, Similar to
Homo sapiens, Similar to
The sequences corresponding to the SEQ ID NOS are provided in the Sequence Listing.
Characterization of Sequences
The sequences of the isolated polynucleotides were first masked to eliminate low complexity sequences using the RepeatMasker masking program, publicly available through a web site supported by the University of Washington (See also Smit, A. F. A. and Green, P., unpublished results). Generally, masking does not influence the final search results, except to eliminate sequences of relatively little interest due to their low complexity, and to eliminate multiple “hits” based on similarity to repetitive regions common to multiple sequences, e.g., Alu repeats. Masking resulted in the elimination of several sequences.
The remaining sequences of the isolated polynucleotides were used in a homology search of the GenBank database using the TeraBLAST program (TimeLogic, Crystal Bay, Nev.), a DNA and protein sequence homology searching algorithm. TeraBLAST is a version of the publicly available BLAST search algorithm developed by the National Center for Biotechnology, modified to operate at an accelerated speed with increased sensitivity on a specialized computer hardware platform. The program was run with the default parameters recommended by TimeLogic to provide the best sensitivity and speed for searching DNA and protein sequences. Gene assignment for the query sequences was determined based on best hit form the GenBank database; expectancy values are provided with the hit.
Summary of TeraBLAST Search Results
Table 12 also provides information about the gene corresponding to each polynucleotide. Table 12 includes: (1) the “SEQ ID NO” of the sequence; (2) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GBHit”); (3) a description of the GenBank sequence (“GBDesc”); (4) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GBScore”). The published information for each GenBank and EST description, as well as the corresponding sequence identified by the provided accession number, are incorporated herein by reference.
cDNA probes were prepared from total RNA isolated from the patient cells described above. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.
Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.
Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red), and vice versa.
Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots, for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array.
Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues as described above and in Table 12. PCR products of from about 0.5 kb to 2.0 kb amplified from these sources were spotted onto the array using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about four duplicate measurements for each clone, two of one color and two of the other, for each sample.
The differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.
The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.
The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.
A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the tumor and normal sample. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).
Tables 13A-D summarize the results of the differential expression analysis. Table 13A-D provides: (1) the spot identification number (“Spot ID”), an internal reference that serves as a unique identifier for the spot on the array; (2) the number of the Group (“Grp”) to which the gene is assigned (see Example 11 below); and (3) the ratio of expression of the gene in each of the patient samples, identified by the patient ID number (e.g., 15). This data represents the ratio of differential expression for the samples tested from that particular patient's tissues (e.g., “RATIO15” is the ratio from the tissue samples of Patient ID no. 15). The ratios of differential expression are expressed as a normalized hybridization signal associated with the tumor probe divided by the normalized hybridization signal with the normal probe. Thus, a ratio greater than 1 indicates that the gene product is increased in expression in cancerous cells relative to normal cells, while a ratio of less than 1 indicates the opposite.
These data provide evidence that the genes represented by the polynucleotides having the indicated sequences are differentially expressed in colon cancer as compared to normal non-cancerous colon tissue.
Groups of genes with differential expression data correlating with specific genes of interest can be identified using statistical analysis such as the Student t-test and Spearman rank correlation (Stanton Glantz (1997) Primer of Bio-Statistics, McGraw Hill, pp 65-107, 256-262). Using these statistical tests, patients having tumors that exhibit similar differential expression patterns can be assigned to Groups. At least two Groups were identified, and are described below.
Group 1
Genes that Exhibit Differential Expression in Colon Cancer in a Pattern that Correlates with IGF2
Using both the Student-t test and the Spearman rank correlation test, the differential expression data of IGF2 correlated with that of 14 distinct genes: TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1 (see Tables 13A-D). The differential expression data for these genes is presented in graphical form in
Group 2
Genes that Exhibit Differential Expression in Colon Cancer in a Pattern that Correlates Interferon Induced Transmembrane (IFITM) Protein Family
Using the Spearman rank correlation test, the differential expression data of the IFITM family (1-8U; 1-8D; 9-27) correlated with that of 2 other genes: ITAK and BIRC3/H-IAP1 (see Tables 13A-D). The differential expression data for these genes is presented in graphical form in
The expression of the differentially expressed genes represented by the polynucleotides in the cancerous cells can be analyzed using antisense knockout technology to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting a metastatic phenotype.
A number of different oligonucleotides complementary to the mRNA generated by the differentially expressed genes identified herein can be designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of the genes. Sets of antisense oligomers specific to each candidate target are designed using the sequences of the polynucleotides corresponding to a differentially expressed gene and the software program HYBsimulator Version 4 (available for Windows 95/Windows NT or for Power Macintosh, RNAture, Inc. 1003 Health Sciences Road, West, Irvine, Calif. 92612 USA). Factors that are considered when designing antisense oligonucleotides include: 1) the secondary structure of oligonucleotides; 2) the secondary structure of the target gene; 3) the specificity with no or minimum cross-hybridization to other expressed genes; 4) stability; 5) length and 6) terminal GC content. The antisense oligonucleotide is designed so that it will hybridize to its target sequence under conditions of high stringency at physiological temperatures (e.g., an optimal temperature for the cells in culture to provide for hybridization in the cell, e.g., about 37° C.), but with minimal formation of homodimers.
Using the sets of oligomers and the HYB simulator program, three to ten antisense oligonucleotides and their reverse controls are designed and synthesized for each candidate mRNA transcript, which transcript is obtained from the gene corresponding to the target polynucleotide sequence of interest. Once synthesized and quantitated, the oligomers are screened for efficiency of a transcript knock-out in a panel of cancer cell lines. The efficiency of the knock-out is determined by analyzing mRNA levels using lightcycler quantification. The oligomers that resulted in the highest level of transcript knock-out, wherein the level was at least about 50%, preferably about 80-90%, up to 95% or more up to undetectable message, are selected for use in a cell-based proliferation assay, an anchorage independent growth assay, and an apoptosis assay.
The ability of each designed antisense oligonucleotide to inhibit gene expression is tested through transfection into SW620 colon carcinoma cells. For each transfection mixture, a carrier molecule (such as a lipid, lipid derivative, lipid-like molecule, cholesterol, cholesterol derivative, or cholesterol-like molecule) is prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide is then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide is further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, the carrier molecule, typically in the amount of about 1.5-2 nmol carrier/μg antisense oligonucleotide, is diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide is immediately added to the diluted carrier and mixed by pipetting up and down. Oligonucleotide is added to the cells to a final concentration of 30 nM.
The level of target mRNA that corresponds to a target gene of interest in the transfected cells is quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA are normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) is placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water is added to a total volume of 12.5 μl To each tube is added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents are mixed by pipetting up and down, and the reaction mixture is incubated at 42° C. for 1 hour. The contents of each tube are centrifuged prior to amplification.
An amplification mixture is prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT is added, and amplification is carried out according to standard protocols. The results are expressed as the percent decrease in expression of the corresponding gene product relative to non-transfected cells, vehicle-only transfected (mock-transfected) cells, or cells transfected with reverse control oligonucleotides.
The effect of gene expression on the inhibition of cell proliferation can be assessed in metastatic breast cancer cell lines (MDA-MB-231 (“231”)); SW620 colon colorectal carcinoma cells; SKOV3 cells (a human ovarian carcinoma cell line); or LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells.
Cells are plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide is diluted to 2 μM in OptiMEM™. The oligonucleotide-OptiMEM™ can then be added to a delivery vehicle, which delivery vehicle can be selected so as to be optimized for the particular cell type to be used in the assay. The oligo/delivery vehicle mixture is then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments can be about 300 nM.
Antisense oligonucleotides are prepared as described above (see Example 12). Cells are transfected overnight at 37° C. and the transfection mixture is replaced with fresh medium the next morning. Transfection is carried out as described above in Example 12.
Those antisense oligonucleotides that result in inhibition of proliferation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit proliferation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of proliferation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit proliferation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.
The effect of gene expression on the inhibition of cell migration can be assessed in SW620 colon cancer cells using static endothelial cell binding assays, non-static endothelial cell binding assays, and transmigration assays.
For the static endothelial cell binding assay, antisense oligonucleotides are prepared as described above (see Example 12). Two days prior to use, colon cancer cells (CaP) are plated and transfected with antisense oligonucleotide as described above (see Examples 4 and 5). On the day before use, the medium is replaced with fresh medium, and on the day of use, the medium is replaced with fresh medium containing 2 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in DMEM/1% BSA/10 mM HEPES pH 7.0. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.
Endothelial cells (EC) are plated onto 96-well plates at 40-50% confluence 3 days prior to use. On the day of use, EC are washed 1× with PBS and 50λ DMDM/1% BSA/10 mM HEPES pH 7 is added to each well. To each well is then added 50K (50) CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. The plates are incubated for an additional 30 min and washed 5× with PBS containing Ca++ and Mg++. After the final wash, 100 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).
For the non-static endothelial cell binding assay, CaP are prepared as described above. EC are plated onto 24-well plates at 30-40% confluence 3 days prior to use. On the day of use, a subset of EC are treated with cytokine for 6 hours then washed 2× with PBS. To each well is then added 150-200K CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. Plates are placed on a rotating shaker (70 RPM) for 30 min and then washed 3× with PBS containing Ca++ and Mg++. After the final wash, 500 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).
For the transmigration assay, CaP are prepared as described above with the following changes. On the day of use, CaP medium is replaced with fresh medium containing 5 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in EGM-2-MV medium. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.
EC are plated onto FluorBlok transwells (BD Biosciences) at 30-40% confluence 5-7 days before use. Medium is replaced with fresh medium 3 days before use and on the day of use. To each transwell is then added 50K labeled CaP. 30 min prior to the first fluorescence reading, 10 μg of FITC-dextran (10K MW) is added to the EC plated filter. Fluorescence is then read at multiple time points on a fluorescent plate reader (Ab492/Em 516 nm).
Those antisense oligonucleotides that result in inhibition of binding of SW620 colon cancer cells to endothelial cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that result in inhibition of endothelial cell transmigration by SW620 colon cancer cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous colon cells.
The effect of gene expression upon colony formation of SW620 cells, SKOV3 cells, MD-MBA-231 cells, LNCaP cells, PC3 cells, 22Rv1 cells, MDA-PCA-2b cells, and DU145 cells can be tested in a soft agar assay. Soft agar assays are conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer is formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells are counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for the soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo (produced as described in Example 12) is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies form in 10 days to 3 weeks. Fields of colonies are counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.
Those antisense oligonucleotides that result in inhibition of colony formation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit colony formation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of colony formation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit colony formation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.
In order to assess the effect of depletion of a target message upon cell death, SW620 cells, or other cells derived from a cancer of interest, can be transfected for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol is followed but cells are left in the presence of 2 μM drug. Each day, cytotoxicity is monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH is measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) is included; loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).
The gene products of sequences of a gene differentially expressed in cancerous cells can be further analyzed to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting or inhibiting development of a metastatic phenotype. For example, the function of gene products corresponding to genes identified herein can be assessed by blocking function of the gene products in the cell. For example, where the gene product is secreted or associated with a cell surface membrane, blocking antibodies can be generated and added to cells to examine the effect upon the cell phenotype in the context of, for example, the transformation of the cell to a cancerous, particularly a metastatic, phenotype. In order to generate antibodies, a clone corresponding to a selected gene product is selected, and a sequence that represents a partial or complete coding sequence is obtained. The resulting clone is expressed, the polypeptide produced isolated, and antibodies generated. The antibodies are then combined with cells and the effect upon tumorigenesis assessed.
Where the gene product of the differentially expressed genes identified herein exhibits sequence homology to a protein of known function (e.g., to a specific kinase or protease) and/or to a protein family of known function (e.g., contains a domain or other consensus sequence present in a protease family or in a kinase family), then the role of the gene product in tumorigenesis, as well as the activity of the gene product, can be examined using small molecules that inhibit or enhance function of the corresponding protein or protein family.
Additional functional assays include, but are not necessarily limited to, those that analyze the effect of expression of the corresponding gene upon cell cycle and cell migration. Methods for performing such assays are well known in the art.
The sequences of the polynucleotides provided in the present invention can be used to extend the sequence information of the gene to which the polynucleotides correspond (e.g., a gene, or mRNA encoded by the gene, having a sequence of the polynucleotide described herein). This expanded sequence information can in turn be used to further characterize the corresponding gene, which in turn provides additional information about the nature of the gene product (e.g., the normal function of the gene product). The additional information can serve to provide additional evidence of the gene product's use as a therapeutic target, and provide further guidance as to the types of agents that can modulate its activity.
In one example, a contig is assembled using a sequence of a polynucleotide of the present invention, which is present in a clone. A “contig” is a contiguous sequence of nucleotides that is assembled from nucleic acid sequences having overlapping (e.g., shared or substantially similar) sequence information. The sequences of publicly-available ESTs (Expressed Sequence Tags) and the sequences of various clones from several cDNA libraries synthesized at Chiron can be used in the contig assembly.
The contig is assembled using the software program Sequencher, version 4.05, according to the manufacturer's instructions and an overview alignment of the contiged sequences is produced. The sequence information obtained in the contig assembly can then be used to obtain a consensus sequence derived from the contig using the Sequencher program. The consensus sequence is used as a query sequence in a TeraBLASTN search of the DGTI DoubleTwist Gene Index (DoubleTwist, Inc., Oakland, Calif.), which contains all the EST and non-redundant sequence in public databases.
Through contig assembly and the use of homology searching software programs, the sequence information provided herein can be readily extended to confirm, or confirm a predicted, gene having the sequence of the polynucleotides described in the present invention. Further the information obtained can be used to identify the function of the gene product of the gene corresponding to the polynucleotides described herein. While not necessary to the practice of the invention, identification of the function of the corresponding gene, can provide guidance in the design of therapeutics that target the gene to modulate its activity and modulate the cancerous phenotype (e.g., inhibit metastasis, proliferation, and the like).
The biological materials used in the experiments that led to the present invention are described below.
Source of Patient Tissue Samples
Normal and cancerous tissues were collected from patients using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al. (1998) Trends Genet. 14:272-6; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:9981001). Table 14 below provides information about each patient from which the prostate tissue samples were isolated, including: 1) the “Patient ID”, which is a number assigned to the patient for identification purposes; 2) the “Tissue Type”; and 3) the “Gleason Grade” of the tumor. Histopathology of all primary tumors indicated the tumor was adenocarcinoma.
Source of Polynucleotides on Arrays
Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. Table 15 provides information about the polynucleotides on the arrays including: 1) the “SEQ ID NO” assigned to each sequence for use in the present specification; 2) the spot identification number (“Spot ID”), an internal reference that serves as a unique identifier for the spot on the array; 3) the “Sequence Name” assigned to each sequence; and 4) the “Sample Name or Clone Name” assigned to the sample or clone from which the sequence was isolated. The sequences corresponding to the SEQ ID NOS are provided in the Sequence Listing.
Characterization of Sequences
The sequences of the isolated polynucleotides were first masked to eliminate low complexity sequences using the RepeatMasker masking program, publicly available through a web site supported by the University of Washington (See also Smit, A. F. A. and Green, P., unpublished results). Generally, masking does not influence the final search results, except to eliminate sequences of relative little interest due to their low complexity, and to eliminate multiple “hits” based on similarity to repetitive regions common to multiple sequences, e.g., Alu repeats. Masking resulted in the elimination of several sequences.
The remaining sequences of the isolated polynucleotides were used in a homology search of the GenBank database using the TeraBLAST program (TimeLogic, Crystal Bay, Nev.), a DNA and protein sequence homology searching algorithm. TeraBLAST is a version of the publicly available BLAST search algorithm developed by the National Center for Biotechnology, modified to operate at an accelerated speed with increased sensitivity on a specialized computer hardware platform. The program was run with the default parameters recommended by TimeLogic to provide the best sensitivity and speed for searching DNA and protein sequences. Gene assignment for the query sequences was determined based on best hit form the GenBank database; expectancy values are provided with the hit.
Tables 16 and 17 provide information about the gene corresponding to each polynucleotide. Tables 16 and 17 include: 1) the spot identification number (“Spot ID”); 2) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GenBankHit”); 3) a description of the GenBank sequence (“GenBankDesc”); and 4) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GenBankScore”). The published information for each GenBank and EST description, as well as the corresponding sequence identified by the provided accession number, are incorporated herein by reference.
cDNA probes were prepared from total RNA isolated from the patient cells described above. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.
Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.
Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red), and vice versa.
Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots, for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array.
Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues as described above and in Table 15. PCR products of from about 0.5 kb to 2.0 kb amplified from these sources were spotted onto the array using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about four duplicate measurements for each clone, two of one color and two of the other, for each sample.
The differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.
The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.
The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.
A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the tumor and normal sample. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).
Table 16 provides the results for gene products expressed by at least 2-fold or greater in the prostate tumor samples relative to normal tissue samples in at least 20% of the patients tested. Table 16 includes: 1) the spot identification number (“Spot ID”); 2) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GenBankHit”); 3) a description of the GenBank sequence (“GenBankDesc”); 4) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GenBankScore”); 5) the number of patients analyzed; 6) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 2-fold greater in cancerous tissue than in matched normal tissue (“>=2×”); 7) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 5-fold greater in cancerous tissue than in matched normal tissue (“>=5×”); and 8) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was less than or equal to ½ of the expression level in matched normal cells (“<=halfx”).
Table 17 provides the results for gene products in which expression levels of the gene in prostate tumor cells was less than or equal to ½ of the expression level in normal tissue samples in at least 20% of the patients tested. Table 17 includes: 1) the spot identification number (“Spot ID”); 2) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GenBankHit”); 3) a description of the GenBank sequence (“GenBankDesc”); 4) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GenBankScore”); 5) the number of patients analyzed; 6) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 2-fold greater in cancerous tissue than in matched normal tissue (“>=2×”); 7) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 5-fold greater in cancerous tissue than in matched normal tissue (“>=5×”); and 8) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was less than or equal to ½ of the expression level in matched normal cells (“<=half×”).
Tables 16 and 17 also include the results from each patient, identified by the patient ID number (e.g., 93). This data represents the ratio of differential expression for the samples tested from that particular patient's tissues (e.g., “93” is the ratio from the tissue samples of patient ID no. 93). The ratios of differential expression are expressed as a normalized hybridization signal associated with the tumor probe divided by the normalized hybridization signal with the normal probe. Thus, a ratio greater than 1 indicates that the gene product is increased in expression in cancerous cells relative to normal cells, while a ratio of less than 1 indicates the opposite.
These data provide evidence that the genes represented by the polynucleotides having the indicated sequences are differentially expressed in prostate cancer as compared to normal non-cancerous prostate tissue.
The expression of the differentially expressed genes represented by the polynucleotides in the cancerous cells can be analyzed using antisense knockout technology to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting a metastatic phenotype.
A number of different oligonucleotides complementary to the mRNA generated by the differentially expressed genes identified herein can be designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of the genes. Sets of antisense oligomers specific to each candidate target are designed using the sequences of the polynucleotides corresponding to a differentially expressed gene and the software program HYB simulator Version 4 (available for Windows 95/Windows NT or for Power Macintosh, RNAture, Inc. 1003 Health Sciences Road, West, Irvine, Calif. 92612 USA). Factors that are considered when designing antisense oligonucleotides include: 1) the secondary structure of oligonucleotides; 2) the secondary structure of the target gene; 3) the specificity with no or minimum cross-hybridization to other expressed genes; 4) stability; 5) length and 6) terminal GC content. The antisense oligonucleotide is designed so that it will hybridize to its target sequence under conditions of high stringency at physiological temperatures (e.g., an optimal temperature for the cells in culture to provide for hybridization in the cell, e.g., about 37° C.), but with minimal formation of homodimers.
Using the sets of oligomers and the HYB simulator program, three to ten antisense oligonucleotides and their reverse controls are designed and synthesized for each candidate mRNA transcript, which transcript is obtained from the gene corresponding to the target polynucleotide sequence of interest. Once synthesized and quantitated, the oligomers are screened for efficiency of a transcript knock-out in a panel of cancer cell lines. The efficiency of the knock-out is determined by analyzing mRNA levels using lightcycler quantification. The oligomers that resulted in the highest level of transcript knock-out, wherein the level was at least about 50%, preferably about 80-90%, up to 95% or more up to undetectable message, are selected for use in a cell-based proliferation assay, an anchorage independent growth assay, and an apoptosis assay.
The ability of each designed antisense oligonucleotide to inhibit gene expression is tested through transfection into LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate carcinoma cells. For each transfection mixture, a carrier molecule (such as a lipid, lipid derivative, lipid-like molecule, cholesterol, cholesterol derivative, or cholesterol-like molecule) is prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide is then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide is further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, the carrier molecule, typically in the amount of about 1.5-2 nmol carrier/μg antisense oligonucleotide, is diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide is immediately added to the diluted carrier and mixed by pipetting up and down. Oligonucleotide is added to the cells to a final concentration of 30 nM.
The level of target mRNA that corresponds to a target gene of interest in the transfected cells is quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA are normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) is placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water is added to a total volume of 12.5 μl. To each tube is added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents are mixed by pipetting up and down, and the reaction mixture is incubated at 42° C. for 1 hour. The contents of each tube are centrifuged prior to amplification.
An amplification mixture is prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT is added, and amplification is carried out according to standard protocols. The results are expressed as the percent decrease in expression of the corresponding gene product relative to non-transfected cells, vehicle-only transfected (mock-transfected) cells, or cells transfected with reverse control oligonucleotides.
The effect of gene expression on the inhibition of cell proliferation can be assessed in metastatic breast cancer cell lines (MDA-MB-231 (“231”)); SW620 colon colorectal carcinoma cells; SKOV3 cells (a human ovarian carcinoma cell line); or LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells.
Cells are plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide is diluted to 2 μM in OptiMEM™. The oligonucleotide-OptiMEM™ can then be added to a delivery vehicle, which delivery vehicle can be selected so as to be optimized for the particular cell type to be used in the assay. The oligo/delivery vehicle mixture is then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments can be about 300 nM.
Antisense oligonucleotides are prepared as described above (see Example 21). Cells are transfected overnight at 37° C. and the transfection mixture is replaced with fresh medium the next morning. Transfection is carried out as described above in Example 21.
Those antisense oligonucleotides that result in inhibition of proliferation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit proliferation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of proliferation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit proliferation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.
The effect of gene expression on the inhibition of cell migration can be assessed in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells using static endothelial cell binding assays, non-static endothelial cell binding assays, and transmigration assays.
For the static endothelial cell binding assay, antisense oligonucleotides are prepared as described above (see Example 21). Two days prior to use, prostate cancer cells (CaP) are plated and transfected with antisense oligonucleotide as described above (see Examples 21 and 22). On the day before use, the medium is replaced with fresh medium, and on the day of use, the medium is replaced with fresh medium containing 2 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in DMEM/1% BSA/10 mM HEPES pH 7.0. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.
Endothelial cells (EC) are plated onto 96-well plates at 40-50% confluence 3 days prior to use. On the day of use, EC are washed 1× with PBS and 50λ DMDM/1% BSA/10 mM HEPES pH 7 is added to each well. To each well is then added 50K (50λ) CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. The plates are incubated for an additional 30 min and washed 5× with PBS containing Ca++ and Mg++. After the final wash, 100 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).
For the non-static endothelial cell binding assay, CaP are prepared as described above. EC are plated onto 24-well plates at 30-40% confluence 3 days prior to use. On the day of use, a subset of EC are treated with cytokine for 6 hours then washed 2× with PBS. To each well is then added 150-200K CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. Plates are placed on a rotating shaker (70 RPM) for 30 min and then washed 3× with PBS containing Ca++ and Mg++. After the final wash, 500 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).
For the transmigration assay, CaP are prepared as described above with the following changes. On the day of use, CaP medium is replaced with fresh medium containing 5 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in EGM-2-MV medium. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.
EC are plated onto FluorBlok transwells (BD Biosciences) at 30-40% confluence 5-7 days before use. Medium is replaced with fresh medium 3 days before use and on the day of use. To each transwell is then added 50K labeled CaP. 30 min prior to the first fluorescence reading, 1014 of FITC-dextran (10K MW) is added to the EC plated filter. Fluorescence is then read at multiple time points on a fluorescent plate reader (Ab492/Em 516 nm).
Those antisense oligonucleotides that result in inhibition of binding of LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells to endothelial cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous prostate cells. Those antisense oligonucleotides that result in inhibition of endothelial cell transmigration by LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous prostate cells.
The effect of gene expression upon colony formation of SW620 cells, SKOV3 cells, MD-MBA-231 cells, LNCaP cells, PC3 cells, 22Rv1 cells, MDA-PCA-2b cells, and DU145 cells can be tested in a soft agar assay. Soft agar assays are conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer is formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells are counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for the soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo (produced as described above) is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies form in 10 days to 3 weeks. Fields of colonies are counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.
Those antisense oligonucleotides that result in inhibition of colony formation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit colony formation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of colony formation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit colony formation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.
In order to assess the effect of depletion of a target message upon cell death, LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells, or other cells derived from a cancer of interest, can be transfected for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol is followed but cells are left in the presence of 2 μM drug. Each day, cytotoxicity is monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH is measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) is included; loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).
The gene products of sequences of a gene differentially expressed in cancerous cells can be further analyzed to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting or inhibiting development of a metastatic phenotype. For example, the function of gene products corresponding to genes identified herein can be assessed by blocking function of the gene products in the cell. For example, where the gene product is secreted or associated with a cell surface membrane, blocking antibodies can be generated and added to cells to examine the effect upon the cell phenotype in the context of, for example, the transformation of the cell to a cancerous, particularly a metastatic, phenotype. In order to generate antibodies, a clone corresponding to a selected gene product is selected, and a sequence that represents a partial or complete coding sequence is obtained. The resulting clone is expressed, the polypeptide produced isolated, and antibodies generated. The antibodies are then combined with cells and the effect upon tumorigenesis assessed.
Where the gene product of the differentially expressed genes identified herein exhibits sequence homology to a protein of known function (e.g., to a specific kinase or protease) and/or to a protein family of known function (e.g., contains a domain or other consensus sequence present in a protease family or in a kinase family), then the role of the gene product in tumorigenesis, as well as the activity of the gene product, can be examined using small molecules that inhibit or enhance function of the corresponding protein or protein family.
Additional functional assays include, but are not necessarily limited to, those that analyze the effect of expression of the corresponding gene upon cell cycle and cell migration. Methods for performing such assays are well known in the art.
The sequences of the polynucleotides provided in the present invention can be used to extend the sequence information of the gene to which the polynucleotides correspond (e.g., a gene, or mRNA encoded by the gene, having a sequence of the polynucleotide described herein). This expanded sequence information can in turn be used to further characterize the corresponding gene, which in turn provides additional information about the nature of the gene product (e.g., the normal function of the gene product). The additional information can serve to provide additional evidence of the gene product's use as a therapeutic target, and provide further guidance as to the types of agents that can modulate its activity.
In one example, a contig is assembled using a sequence of a polynucleotide of the present invention, which is present in a clone. A “contig” is a contiguous sequence of nucleotides that is assembled from nucleic acid sequences having overlapping (e.g., shared or substantially similar) sequence information. The sequences of publicly-available ESTs (Expressed Sequence Tags) and the sequences of various clones from several cDNA libraries synthesized at Chiron can be used in the contig assembly.
The contig is assembled using the software program Sequencher, version 4.05, according to the manufacturer's instructions and an overview alignment of the contiged sequences is produced. The sequence information obtained in the contig assembly can then be used to obtain a consensus sequence derived from the contig using the Sequencher program. The consensus sequence is used as a query sequence in a TeraBLASTN search of the DGTI DoubleTwist Gene Index (DoubleTwist, Inc., Oakland, Calif.), which contains all the EST and non-redundant sequence in public databases.
Through contig assembly and the use of homology searching software programs, the sequence information provided herein can be readily extended to confirm, or confirm a predicted, gene having the sequence of the polynucleotides described in the present invention. Further the information obtained can be used to identify the function of the gene product of the gene corresponding to the polynucleotides described herein. While not necessary to the practice of the invention, identification of the function of the corresponding gene, can provide guidance in the design of therapeutics that target the gene to modulate its activity and modulate the cancerous phenotype (e.g., inhibit metastasis, proliferation, and the like).
Laser Capture Microdissection (LCM) was used to dissect cancerous cells, as well as peritumoral normal cells from patients with prostate cancer (various grades), colon cancer, breast cancer and stomach cancer. Total RNA was prepared from these samples by standard methods. cDNA probes were made from this RNA and fluorescently labeled. The labeled cDNAs were used to probe a microarray chip containing sequences of multiple genes. As shown in Table 16, Spot ED 25837, which corresponds to chondroitin 4-O sulfotransferase 2 (C4S-2) and SEQ ID 847 (see Table 15), revealed a differential expression between normal and cancerous cells. The data displayed in
Trending analysis revealed that several genes trend in patient expression with C4S-2 (
Quantitative PCR of a number of normal tissues and tumor cell lines, particularly colorectal and prostate carcinoma cell lines was used to analyze expression of C4S2. Quantitative real-time PCR was performed by first isolating RNA from cells using a Roche RNA Isolation kit according to manufacturer's directions. One microgram of RNA was used to synthesize a first-strand cDNA using MMLV reverse transcriptase (Ambion) using the manufacturers buffer and recommended concentrations of oligo dT, nucleotides, and Rnasin.
First, primers were designed. The primers were blasted against known genes and sequences to confirm the specificity of the primers to the target. The sequences of the primers are, for set 1: Forward: ATCTCCGCCTTCCGCAGCAA (SEQ ID NO: 14067) and reverse: TCGTTGAAGGGCGCCAGCTT (SEQ ID NO: 14068), and set 2: forward: CATCTACTGCTACGTG (SEQ ID NO: 14069) and reverse: ACTTCTTGAGCTTGACC (SEQ ID NO: 14070). These primers were used in a test qPCR using the primers against normal RTd tissue, as well as a mock RT to pick up levels of possible genomic contamination.
Quantitative PCR of a panel of normal tissue, total cancer tissue, LCM tissue, and cancer cell lines were used to determine the expression levels of C4S2. qPCR was performed by first isolating the RNA from the above mentioned tissue/cells using a Qiagen RNeasy mini prep kit. In the case of the LCM tissue, RNA was amplified via PCR to increase concentration after initial RNA isolation. 0.5 micrograms of RNA was used to generate a first strand cDNA using Stratagene MuLV Reverse Transcriptase, using recommended concentrations of buffer, enzyme, and Rnasin. Concentrations and volumes of dNTP, and oligo dT, or random hexamers were lower than recommended to reduce the level of background primer dimerization in the qPCR.
The cDNA is then used for qPCR to determine the levels of expression of C4S2 using the GeneAmp 7000 by ABI as recommended by the manufacturer. Primers for housekeeping were also run in order to normalized the values, and eliminate possible variations in cDNA template concentrations, pipetting error, etc. Three housekeepers were run depending on the type of tissue, beta-actin for cell lines, GusB for LCM tissue, HPRT for whole tissue.
A subset of patient RNA used to probe the microarray chip was analyzed by semi-quantitative RT-PCR to confirm the microarray results. Pools of 7 or 8 patient RNA samples were analyzed using primers that specifically recognize C4S-2. The data is expressed as mRNA expression level relative to a housekeeping gene (GUSB). Consistent with the microarray data, the data, displayed in
Using the RT-PCR methods described above, C4S-2 specific primers were used to assess the expression of C4S-2 mRNA obtained from normal tissues (from commercial sources), as well as RNA expression whole tumor tissue (pools of 7 or 8 patients). This tissue contains cell types other than epithelium. The data is expressed as mRNA expression level relative to a housekeeping gene (HPRT). The data, shown in
Using the RT-PCR methods described above, C4S-2 specific primers were used to assess the expression of C4S-2 mRNA obtained from various prostate cell lines. The data is expressed as mRNA expression level relative to a housekeeping gene (actin). The data, displayed in
Additional functional information on C4S-2 was generated using antisense knockout technology. A number of different oligonucleotides complementary to C4S-2 mRNA were designed (
The level of target mRNA (C4S-2) in the transfected cells was quantitated in the cancer cell lines using the methods described above. Values for the target mRNA were normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) was placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water was added to a total volume of 12.5 μl. To each tube was added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents were mixed by pipetting up and down, and the reaction mixture was incubated at 42° C. for 1 hour. The contents of each tube were centrifuged prior to amplification.
An amplification mixture was prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT was added, and amplification was carried out according to standard protocols.
In separate experiments, inhibitory RNA molecules are used to inhibit C4S-2 mRNA expression in cells.
PC3 cells were plated at 5000 cells/well in 96-well plate and grown overnight. Reverse control or antisense oligonucleotide was diluted to 2 μM in OptiMEM™ and mixed with 30 μM Lipitoid1, a delivery vehicle, also diluted in OptiMEM™. This mixture of oligonucleotide and lipitoid in OptiMEM™ was then mixed with serum containing medium and then overlayed onto the cells overnight. The next day the transfection mix was removed and replaced with fresh media. Final concentration of oligonucleotide for these experiments was 300 nM and the ratio of oligonucleotide to Lipitoid 1 was 1.5 nmol lipoid per oligonucleotide. Cell proliferation was quantified using CyQUANT® Cell Proliferation Assay Kit (Molecular Probes #C-7026).
MDAPca2b cells were plated to 50% confluency and similarly transfected with 300 nM reverse control or antisense oligonucleotide with 30 μM Lipitoid1 overnight. After transfection, the cells were detached with trypsin, washed twice with medium, counted and plated at 5000 cells/well in 96-well plates. Cell proliferation was quantified using CellTiter-Glo™ Luminescent Cell Viability Assay (Promega #G7573).
Using these methods, anti-sense oligonucleotides described in
Anti-sense oligonucleotides described in
The effect of C4S-2 expression upon colony formation was tested in a soft agar assay. Soft agar assays were conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer was formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells were counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies are formed in 10 days to 3 weeks. Fields of colonies were counted by eye.
PC3 cells were transfected as described above. Transfected cells were then assessed for their ability to grow in soft-agar to determine the effect of inhibiting C4S-2 on anchorage-independent growth. PC3 cells were plated at either 400, 600 or 1000 (“1 k”) cells per well. Multiple transfection conditions were used (L1 or L1/C1). As shown in
MDA Pca 2b cells were transfected as described above and also assessed for their ability to grow in soft-agar to determine the effect of inhibiting C4S-2 on anchorage-independent growth. MDA Pca 2b cells were plated at either 400, 600 or 1000 cells per well. As shown in
Spheroids were assayed as follows: briefly, 96-well plates were coated with poly(2-hydroxyethyl methacrylate or poly-HEMA at 12 ug/ml in 95% ethanol. Poly-HEMA was slowly evaporated at room temperature until plates were dry. Prior to adding cells plates were rinsed twice with 1×PBS. Approximately 10 000 cells/well were then added and transfected with either anti-sense or reverse control oligonucleotide, directly in suspension with similar conditions as described elsewhere. The cells were allowed to grow in suspension for 5 days. The effects of inhibiting C4S-2 mRNA expression were assessed both visually and using the LDH assay to assess degree of cytotoxicity.
Lactate dehydrogenase (LDH) activity is measured, using the Cytotoxicity Detection Kit (Roche Catalog number: 1 644 793) by collecting culture supernatant and adding 100 ul ALPHA MEM medium w/o FBS in V-bottom 96 well plate, transferring all the culture supernatant (100 ul) to the V-bottom plate, mixing, spinning the plate at 2000 rpm for 10 mins, and removing 100 μl for an LDH assay. Alternatively, culture supernatant was removed, and 200 ul ALPHA MEM medium w/o FBS and containing 2% Triton-X 100 was added to the plate, incubated for 1 minute to all for lysis, spun at 2000 rpm for 10 min and 100 μl removed for LDH detection.
LDH was measured using a 1:45 mixture of catalyst, diaphoreses/NAD+ mixture, lyophilizate resuspended H2O and dye solution containing sodium lactate, respectively. 100 ul of this mix is added to each well, and the sample incubated at room temperature for 20 mins. Plates can be reat in a microtiter plate reader with 490 nm filter.
rLDH/tLDH ratio is calculated as follows: the total amount of LDH (tLDH) is calculated by adding released LDH (rLDH, from culture supernatant) to the intracellular LDH (iLDH, from cell lysate): tLDH=rLDH+iLDH. In order to compare the amount of cytotoxicity between AS and RC treated samples, the ratio between rLDH and tLDH is used.
MDA Pca 2b were plated under non-adherent conditions and transfected in suspension with either anti-sense or reverse control oligonucleotides. The cells were allowed to grow in suspension for 5 days. The effects of inhibiting C4S-2 mRNA expression were assessed both visually (
Cells were transfected, and the activity of LDH was measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals, as described above. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). MRC9 cells were transfected with multiple pairs of C4S-2 anti-sense and reverse control oligonucleotides and allowed to grow for 3 days. The C4S-2 anti-sense oligonucleotides did not induce cytoxicity (above reverse control) in this “normal” (i.e. non-cancerous) fibroblast cell line (
184B5 cells were also transfected with multiple pairs of C4S-2 anti-sense and reverse control oligonucleotides and allowed to grow for 3 days. The C4S-2 anti-sense oligonucleotides did not induce cytoxicity (above reverse control) in this “normal” (i.e. non-cancerous) breast epithelial cell line (
MRC9 and 184B5 cells were transfected with multiple pairs of C4S-2 anti-sense and reverse control oligonucleotides and allowed to grow for 4 days. The C4S-2 anti-sense oligonucleotides did not inhibit proliferation (above reverse control) in these non-cancerous cell lines (
Screening assays are performed according to Burkart & Wong Anal Biochem 274:131-137 (1999), with modifications.
Using primers flanking the open reading frame, C4S-2 is cloned into a shuttle vector, from which it can be shuttled into multiple expression vectors. Protein expression is assessed using a polyclonal antibody. Activity is assessed using standard assays, i.e. those designed to assay sulfate transfer to chondroitin, chondroitin sulfate or dermatan sulfate. βAST-IV is also cloned and expressed as described in the above report Burkart et al, supra.
C4S-2-modulatory agents are counter-screened to ensure specificity. Included in the counterscreen are C4S-1, C4S-3 and HNK1ST (closest relatives to C4S-2 with approximately 30-42% homology). Additionally, representatives from other classes of sulfotransferases (heparin sulfotransferase, estrogen sulfotransferase, phenol sulfotransferase, tyrosine sulfotransferase) with low homology are also screened. Additionally, representatives from classes of kinases will be used in the counter-screen.
C4S-2 will transfer a sulfonyl group from PAPS to chondroitin sulfate, thus generating PAP. βAST-IV will regenerate PAPS, using p-nitrophenyl sulfate as the sulfate donor. One of the resulting products from the latter reaction—p-nitrophenol can be monitored colorimetrically.
Inhibitors are assessed for their ability to inhibit C4S-2, as determined by an inhibition of p-nitrophenol generation. Control screens include regeneration of PAPS from PAP by βAST-IV, in the absence of C4S-2, to ensure that inhibitors of βAST-IV are not selected. Compounds that inhibit C4S-2 activity are counterscreened against relevant enzymes listed above.
Inhibitors passing the above screens are tested in cell-based functional assays (Proliferation, LDH, spheroid and soft-agar assays). The tested cell lines include PC3, MDA Pca 2b, DU145, Colo320, KM12C, A431, MDA435, MDA469, etc. Additionally, cell lines stably transfected to over-express C4S-2 are assessed compared to parental and control transfected lines.
Inhibitors that show efficacy in the cell line functional assays are tested in xenograft mouse models. A subset of the lines, including PC3, DU145 and MDA435, etc. is in these animal models.
The cells used for detecting differential expression of breast cancer related genes were those previously described for the HMT-3522 tumor reversion model, disclosed in U.S. Pat. Nos. 5,846,536 and 6,123,941, herein incorporated by reference. The model utilizes both non-tumorigenic (HMT-3522 S1) and tumorigenic (HMT-3522 T4-2) cells derived by serial passaging from a single reduction mammoplasty. In two dimensional (2D) monolayers on plastic, both S1 and T4-2 cells display similar morphology. But in three dimensional (3D) matrigel cultures, Si form phenotypically normal mammary tissue structures while T4-2 cells fail to organize into these structures and instead disseminate into the matrix. This assay was designated as a tumor reversion model, in that the T4-2 cells can be induced to form S1-like structures in 3D by treatment with beta-1 integrin or EGFR blocking antibodies, or by treating with a chemical inhibitor of the EGFR signaling pathway (tyrophostin AG 1478). These treated T4-2 cells, called T4R cells, are non-tumorigenic.
Growth of Cells 2D and 3D for Microarray Experiments: HMT3522 S1 and T4-2 cells were grown 2D and 3D and T4-2 cells reverted with anti-EGFR, anti-beta 1 integrin, or tyrophostin AG 1478 as previously described (Weaver et al J. Cell Biol. 137:231-45, 1997; and Wang et al PNAS 95:14821-14826, 1998). Anti-EGFR (mAb 225) was purchased from Oncogene and introduced into the matrigel at the time of gelation at a concentration of 4 ug/ml purified mouse IgG1. Anti-beta 1 integrin (mAb AIIB2) was a gift from C. Damsky at the University of California at San Francisco and was also introduced into the matrigel at the time of gelation at a concentration of 100 ug/ml ascites protein (which corresponds to 4-10 ug/ml purified rat IgG1). Tyrophostin AG 1478 was purchased from Calbiochem and used at a concentration of 100 nM.
Isolation of RNA for Microarray Experiments: RNA was prepared from: S1 passage 60 2D cultures; T4-2 passage 41 2D cultures; S1 passage 59 3D cultures; and T4-2 and T4-2 revertant (with anti-EGFR, anti-beta 1 integrin, and tyrophostin) passage 35 3D cultures.
All RNA for microarray experiments was isolated using the commercially available RNeasy Mini Kit from Qiagen. Isolation of total RNA from cells grown 2D was performed as instructed in the kit handbook. Briefly, media was aspirated from the cells and kit Buffer RLT was added directly to the flask. The cell lysate was collected with a rubber cell scraper, and the lysate passed 5 times through a 20-G needle fitted to a syringe. One volume of 70% ethanol was added to the homogenized lysate and mixed well by pipetting. Up to 700 ul of sample was applied to an RNeasy mini spin column sitting in a 2-ml collection tube and centrifuged for 15 seconds at >8000×g. 700 ul Buffer RW1 was added to the column and centrifuged for 15 seconds at >8000×g to wash. The column was transferred to a new collection tube. 500 ul Buffer RPE was added to the column and centrifuged for 15 seconds at >8000×g to wash. Another 500 ul Buffer RPE was added to the column for additional washing, and the column centrifuged for 2 minutes at maximum speed to dry. The column was transferred to a new collection tube and RNA eluted from the column with 30 ul RNase-free water by centrifuging for 1 minute at >8000×g.
Isolation of total RNA from cells grown 3D was performed as described above, except cells were isolated from matrigel prior to RNA isolation. The cells were isolated as colonies from matrigel using ice-cold PBS/EDTA (0.01 M sodium phosphate pH 7.2 containing 138 mM sodium chloride and 5 mM EDTA). See Weaver et al, J Cell Biol 137:231-245, 1997; and Wang et al. PNAS 95:14821-14826, 1998.
The relative expression levels of a selected sequence (which in turn is representative of a single transcript) were examined in the tumorigenic versus non-tumorigenic cell lines described above, following culturing of the cells (S1, T4-2 and T4R) in either two-dimensional (2D) monolayers or three-dimensional (3D) matrigel cultures as described above. Differential expression for a selected sequence was assessed by hybridizing mRNA from S1 and T4-2 2D cultures, and S1, T4-2 and T4R 3D cultures to microarray chips as described below, as follows: Exp1=T4-2 2D/S1 2D; Exp2=T4-2 3D/S1 3D; Exp3=Si 3D/S1 2D; Exp4=T4-2 3D/T4-2 2D; Exp5=T4-2 3D/T4R (anti-EGFR) 3D; Exp6=T4-2 3D/T4R (anti-beta1 integrin) 3D; and Exp7=T4-2 3D/T4R (tyrophostin AG 1478) 3D.
Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array. Spotting was accomplished using PCR amplified products from 0.5 kb to 2.0 kb and spotted using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides.
The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about 4 duplicate measurements for each clone, two of one color and two of the other, for each sample.
Identification Of Differentially Expressed Genes: “Differentially expressed” in the context of the present example meant that there was a difference in expression of a particular gene between tumorigenic vs. non-tumorigenic cells, or cells grown in three-dimensional culture vs. cells grown in two-dimensional culture. To identify differentially expressed genes, total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.
Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from tumorigenic RNA sample were compared to fluorescently labeled cDNAs prepared from non-tumorigenic cell RNA sample. For example, the cDNA probes from the non-tumorigenic cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumorigenic cells were labeled with Cy5 fluorescent dye (red).
The differential expression assay was performed by mixing equal amounts of probes from tumorigenic cells and non-tumorigenic cells, and/or cells grown in 3D vs. those grown in 2D. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS). After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.
The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to non-tumorigenic or tumorigenic cells grown two-dimensionally or three-dimensionally. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.
The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescence intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.
A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumorigenic and non-tumorigenic cells or cells grown two-dimensionally versus three-dimensionally. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the two samples compared. For example, if the tumorigenic sample has detectable expression and the non-tumorigenic does not, the ratio is truncated at 1000 since the value for expression in the non-tumorigenic sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the non-tumorigenic sample has detectable expression and the tumorigenic does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).
In general, a polynucleotide is said to represent a significantly differentially expressed gene between two samples when there is detectable levels of expression in at least one sample and the ratio value is greater than at least about 1.2 fold, at least about 1.5 fold, or at least about 2 fold, where the ratio value is calculated using the method described above.
A differential expression ratio of 1 indicates that the expression level of the gene in tumorigenic cells was not statistically different from expression of that gene in the specific non-tumorigenic cells compared. A differential expression ratio significantly greater than 1 in tumorigenic breast cells relative to non-tumorigenic breast cells indicates that the gene is increased in expression in tumorigenic cells relative to non-tumorigenic cells, suggesting that the gene plays a role in the development of the tumorigenic phenotype, and may be involved in promoting metastasis of the cell. Detection of gene products from such genes can provide an indicator that the cell is cancerous, and may provide a therapeutic and/or diagnostic target. Likewise, a differential expression ratio significantly less than 1 in tumorigenic breast cells relative to non-tumorigenic breast cells indicates that, for example, the gene is involved in suppression of the tumorigenic phenotype. Increasing activity of the gene product encoded by such a gene, or replacing such activity, can provide the basis for chemotherapy. Such gene can also serve as markers of cancerous cells, e.g., the absence or decreased presence of the gene product in a breast cell relative to a non-tumorigenic breast cell indicates that the cell is cancerous.
Using the above methodology, three hundred and sixty-seven (367) genes or products thereof were identified from 20,000 chip clones analyzed as being overexpressed 2-fold or more in one or more of these experiments, with a p-value of 0.001 or less. These identified genes or products thereof are listed in Table 18, according to the Spot ID of the spotted polynucleotide, the Sample ID, the corresponding GenBank Accession Number (No.), the GenBank description (if available) for the corresponding Genbank Accession Number, and the GenBank score (p-value; the probability that the association between the SEQ ID NO. and the gene or product thereof occurred by chance). The polynucleotide and polypeptide sequences, as provided by any disclosed Genbank entries are herein incorporated by reference to the corresponding Genbank accession number. The differential hybridization results from the seven differential expression microarray experiments listed above are provided in Table 19, where sequences have a measurement corresponding to its ratio of expression in the 7 experiments, e.g. spot ID 10594 is 2.2-fold overexpressed in 3D T4-2 cells as compared to 3D Si cells. SEQ ID NOS:1-3004, representing the sequences corresponding to the spot Ids listed in Tables 18 and 19 are provided in the sequence listing. Table 20 is a lookup table showing the relationship between the spot Ids (i.e. the nucleic acids spotted on the microarray) and the sequences provided in the sequence listing.
Homo sapiens thyroid autoantigen
Homo sapiens lipocalin 2
Macaca fascicularis brain cDNA,
Homo sapiens mRNA full length
Homo sapiens mRNA for
Homo sapiens filamin B, beta
Homo sapiens filamin (FLNB)
Homo sapiens ERO1L (ERO1L)
Homo sapiens mRNA for
H. sapiens CL 100 mRNA for
Homo sapiens hypothetical protein
Homo sapiens cDNA FLJ10107 fis,
Homo sapiens hypothetical gene
Homo sapiens phosphoinositide-3-
Homo sapiens mRNA; cDNA
Homo sapiens, MRJ gene for a
Homo sapiens DKFZP586A0522
Homo sapiens DKFZP586A0522
H. sapiens mitochondrial genome
H. sapiens 5T4 gene for 5T4
Homo sapiens hypothetical protein
Homo sapiens retinol
Homo sapiens stearoyl-CoA
Homo sapiens retinal short-chain
Homo sapiens ten integrin EGF-
Homo sapiens monoamine oxidase
Homo sapiens Apo-2 ligand
Homo sapiens S100 calcium-
Homo sapiens S100 calcium-
Homo sapiens, Pirin, clone
Homo sapiens cDNA FLJ11293 fis,
Homo sapiens brain-derived
Homo sapiens similar to
Homo sapiens clone 24833
Homo sapiens mRNA for
Homo sapiens breast cancer-
Homo sapiens, clone
Homo sapiens full length insert
H. sapiens mRNA for colon
Homo sapiens superoxide
Homo sapiens full length insert
Homo sapiens full length insert
Homo sapiens, inhibitor of DNA
Homo sapiens mRNA for
Homo sapiens clone 23764 mRNA
Homo sapiens, insulin-like growth
Homo sapiens MAIL mRNA,
Homo sapiens, Ras-related GTP-
Homo sapiens phosphodiesterase
Homo sapiens interleukin 13
Homo sapiens interleukin-1
Homo sapiens spermine synthase
Homo sapiens nuclear receptor
Homo sapiens Kreisler (mouse)
Homo sapiens Rab acceptor 1
Homo sapiens N-ethylmaleimide-
Homo sapiens complement
H. sapiens nuk_34 mRNA for
Homo sapiens aldolase C,
4E−62
Homo sapiens aldolase C,
Homo sapiens CDP-diacylglycerol--
Homo sapiens type I
Homo sapiens hydroxyacyl
Homo sapiens collagen type XVII
Homo sapiens ribonuclease,
Homo sapiens checkpoint
Homo sapiens BRCA1-associated
Homo sapiens zinc finger protein
H. sapiens lysosomal acid
Homo sapiens mRNA for serin
Homo sapiens MAX-interacting
Homo sapiens procollagen-proline,
Homo sapiens receptor-associated
Homo sapiens mRNA for BNIP3L,
Homo sapiens angiopoietin 1
Homo sapiens hypoxia-inducible
H. sapiens mRNA for endothelial
Homo sapiens glycoprotein
Homo sapiens N-
Homo sapiens, cyclin C, clone
Homo sapiens 5T4 oncofetal
Homo sapiens colony stimulating
Homo sapiens colony stimulating
Homo sapiens colony stimulating
H. sapiens CL 100 mRNA for
H. sapiens CL 100 mRNA for
Homo sapiens gamma-
Homo sapiens solute carrier family
Homo sapiens, clone MGC: 9281
Homo sapiens mannosidase, beta
Homo sapiens RAP1, GTP-GDP
Homo sapiens cyclin G associated
Homo sapiens insulin-like growth
Homo sapiens cDNA FLJ10718 fis,
H. sapiens mRNA for elongation
Homo sapiens inhibitor of DNA
Homo sapiens similar to receptor
Homo sapiens Lysosomal-
Homo sapiens, inhibitor of DNA
Homo sapiens mRNA; cDNA
Homo sapiens carbonyl reductase
Homo sapiens, succinate
Homo sapiens katanin p80 (WD40-
Homo sapiens, exostoses
Homo sapiens, clone MGC: 5184
Homo sapiens, claudin 4, clone
Homo sapiens, HIRA-interacting
H. sapiens mRNA for TIM17
Homo sapiens mitochondrial DNA,
Homo sapiens mitochondrial DNA,
Homo sapiens mitochondrial DNA,
Homo sapiens mitochondrial DNA,
Homo sapiens mitochondrial DNA,
Homo sapiens mitochondrial DNA,
Homo sapiens mitochondrial DNA,
Homo sapiens myosin light chain
Homo sapiens hypothetical protein
Homo sapiens partial IL4RA gene
Homo sapiens HSPC292 mRNA,
Homo sapiens HSPC292 mRNA,
Homo sapiens duodenal
H. sapiens mRNA for chloride
H. sapiens gene for
Homo sapiens FWP001 and
H. sapiens mRNA for MAT8 protein
Homo sapiens serum amyloid A
Mus musculus 18 days embryo
Homo sapiens laminin 5 beta 3
Homo sapiens laminin, beta 3
Homo sapiens laminin, beta 3
Homo sapiens nuclear factor of
Homo sapiens, clone
Homo sapiens, clone MGC: 17355
Homo sapiens cDNA FLJ10808 fis,
Homo sapiens amphiregulin
Homo sapiens mRNA for mother
Homo sapiens dual specificity
Homo sapiens, v-fos FBJ murine
Homo sapiens, v-fos FBJ murine
Homo sapiens, v-fos FBJ murine
Homo sapiens, Similar to SH3-
Homo sapiens HSPC317 mRNA,
Homo sapiens procollagen-lysine,
H. sapiens mRNA for p cadherin
Homo sapiens E1B 19K/Bcl-2-
Homo sapiens E1B 19K/Bcl-2-
Homo sapiens, erythrocyte
Homo sapiens gap junction protein,
Homo sapiens, Similar to N-myc
Homo sapiens mRNA for cytosolic
Homo sapiens histone H2A.2
Homo sapiens glycogen synthase
Homo sapiens glycogen synthase
Homo sapiens v-jun avian sarcoma
Homo sapiens ribosomal protein
Homo sapiens RAB9-like protein
Homo sapiens, proteasome
Homo sapiens creatine transporter
Homo sapiens desmoplakin I
Homo sapiens clone YAN1
Homo sapiens interferon-gamma
Homo sapiens superoxide
C. aethiops mRNA for heat shock
H. sapiens CL 100 mRNA for
H. sapiens CL 100 mRNA for
Homo sapiens guanosine
Homo sapiens,
Homo sapiens,
Homo sapiens myristoylated
Homo sapiens type-2 phosphatidic
Homo sapiens, prothymosin beta 4,
Homo sapiens aldo-keto reductase
Homo sapiens ribosomal protein,
Homo sapiens cDNA: FLJ22862
Homo sapiens, Similar to N-myc
Homo sapiens, Similar to N-myc
Homo sapiens cDNA: FLJ22657
Homo sapiens hypothetical protein
Homo sapiens FWP001 and
Homo sapiens cDNA: FLJ22253
Homo sapiens cDNA: FLJ22050
Homo sapiens cDNA: FLJ22050
Homo sapiens hypothetical protein
Homo sapiens cDNA: FLJ21851
Homo sapiens cDNA FLJ13155 fis,
Homo sapiens cDNA FLJ12906 fis,
Homo sapiens hypothetical gene
Mus musculus adult retina cDNA,
Homo sapiens, clone MGC: 17352
Homo sapiens GS1999full mRNA,
Homo sapiens, clone
Mus musculus 0 day neonate skin
Homo sapiens cDNA FLJ10943 fis,
Homo sapiens mRNA for EGLN1
Homo sapiens hypothetical gene
Homo sapiens methylmalonyl-CoA
Bos taurus lae mRNA for lipoate-
Homo sapiens cDNA FLJ14415 fis,
Homo sapiens similar to Ras-
sapiens) (LOC92951), mRNA
H. sapiens mRNA for MAT8 protein
A gene or product thereof called cyclin G associated kinase, or GAK, was identified as being overexpressed in 3D T4-2 cultures relative to both 3D Si cultures (ratio: 7.9296) and 2D T4-2 cultures (ratio: 34.6682) (Sample ID RG: 1056692:10012:C11, Spot ID 19990). GAK corresponds to Genbank Accession number XM—003450.
Additional functional information on GAK was generated using antisense knockout technology. A number of different oligonucleotides complementary to GAK mRNA were designed (AS) with corresponding controls (RC): GGAATCACCGCTTTGCCATCTTCAA (SEQ ID NO:3005; CHIR159-1AS, gak:P1868AS), AACTTCTACCGTTTCGCCACTAAGG (SEQ ID NO:3006; CHIR159-1RC, gak:P1868RC); GACCGTGTACTGCGTGTCGTGCG (SEQ ID NO:3007; CHIR159-7AS, gak:P0839AS) and GCGTGCTGTGCGTCATGTGCCAG (SEQ ID NO: 3008; CHIR159-7RC, gak:P0839RC), and tested for their ability to suppress expression of GAK in human malignant colorectal carcinoma SW620 cells, human breast cancer MDA231 cells, and human breast cancer T4-2 cells. For each transfection mixture, a carrier molecule, preferably a lipitoid or cholesteroid, was prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide was then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide was further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, lipitoid or cholesteroid, typically in the amount of about 1.5-2 nmol lipitoid/μg antisense oligonucleotide, was diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide was immediately added to the diluted lipitoid and mixed by pipetting up and down. Oligonucleotide was added to the cells to a final concentration of 300 nM.
The level of target mRNA (GAK) in the transfected cells was quantitated in the cancer cell lines using the methods using primers CHIR159—2896 (GCCGTCTTCAGGCAACAACTCCCA; SEQ ID NO: 3009; forward) and CHIR159—3089 (TGCTGGACGAGGCTGTCATCTTGC; SEQ ID NO: 3010; reverse). RNA was extracted as above according to manufacturer's directions.
Quantitative PCR (qPCR) was performed by first isolating the RNA from the above mentioned tissue/cells using a Qiagen RNeasy mini prep kit. A total of 0.5 micrograms of RNA was used to generate a first strand cDNA using Stratagene MuLV Reverse Transcriptase, using recommended concentrations of buffer, enzyme, and Rnasin. Concentrations and volumes of dNTP, and oligo dT, or random hexamers were lower than recommended to reduce the level of background primer dimerization in the qPCR.
The cDNA is then used for qPCR to determine the levels of expression of GAK using the GeneAmp 7000 by ABI as recommended by the manufacturer. Primers for actin were also used in order to normalized the values, and eliminate possible variations in cDNA template concentrations, pipetting error, etc.
For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) was placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water was added to a total volume of 12.5 μl. To each tube was added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents were mixed by pipetting up and down, and the reaction mixture was incubated at 42° C. for 1 hour. The contents of each tube were centrifuged prior to amplification.
An amplification mixture was prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT was added, and amplification was carried out according to standard protocols.
Table 21 shows that the antisense oligonucleotides described above reduced expression of GAK mRNA as compared to controls in all three cell lines. GAK mRNA reduction ranged from about 50% to about 90%, as compared to cells transfected with reverse (i.e. sense) control oligonucleotides.
Reduction of GAK protein by antisense polynucleotides in SW620, MDA231 and T4-2 was confirmed using an antibody that specifically recognizes GAK.
The effect of GAK gene expression upon anchorage-independent cell growth of SW620 and MBA-231 cells was measured by colony formation in soft agar. Soft agar assays were performed by first coating a non-tissue culture treated plate with PolyHEMA to prevent cells from attaching to the plate. Non-transfected cells were harvested using 0.05% trypsin and washing twice in media. The cells are counted using a hemacytometer and resuspended to 104 per ml in media. 50 μl aliquots are placed in poly-HEMA coated 96-well plates and transfected. For each transfection mixture, a carrier molecule, preferably a lipitoid or cholesteroid, was prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide was then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide was further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, lipitoid or cholesteroid, typically in the amount of about 1.5-2 nmol antisense oligonucleotide, was diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide was immediately added to the diluted lipitoid and mixed by pipetting up and down. Oligonucleotide was added to the cells to a final concentration of 300 nM. Following transfection (˜30 minutes), 3% GTG agarose is added to the cells for a final concentration of 0.35% agarose. After the cell layer agar solidifies, 100 μl of media is dribbled on top of each well. Colonies form in 7 days. For a read-out of growth, 20 μl of Alamar Blue is added to each well and the plate is shaken for 15 minutes. Fluorecence readings (530 nm excitation 590 nm emission) are taken after incubation for 6-24 hours.
The data presented in Table 22 shows that the application of GAK antisense oligonucleotides to SW620 and MDA 231 cells results in inhibition of colony formation and shows that GAK plays a role in production anchorage-independent cell growth. Table 22 shows the average fluorescence reading for several experiments. The standard deviation (St. Dev) of the fluorescence reading and coefficient of variation (% CV) is also shown.
Several previously uncharacterized genes were identified as being induced in these experiments. One such gene was represented by two spots, Spot ID Nos 22793 and 26883 (gene assignment DKFZp566I133). This gene was expressed at a ratio of about 2.2 in two 2-dimensional (2D) T4-2 vs. 2D S1 experiments, and also at a ratio of about 2 when 3-dimensional (3D) T4-2 cells were compared to the various tumor reversion cultures. However, the ratio of expression increased to an average of 3.2 when 3-dimensional (3D) T4-2 cultures were compared to 2D S1 cultures. In contrast, there was essentially no difference in expression levels when 3D Si cultures were compared to 2D Si cultures, suggesting that expression of this gene is specifically elevated in the tumorigenic cell line T4-2, and even further elevated when the tumorigenic cell line is grown in three dimensional cultures (see Table 23).
These array data were confirmed by qPCR using the methods described above and the gene specific PCR primers CHIR180—1207ACAGGGAGAAAACTGGTTGTCCTGG (SEQ ID NO:3011; Forward) and CHIR180—1403 AAGGCAGAACCCATCCACTCCAA (SEQ ID NO:3012; Reverse). Independent cultures were used for these experiments, and data was normalized to B-catenin. These data are shown in Table 24
DKFZ corresponds to Genbank Accession numbers NP—112200, AAH09758, and NM—030938. Orthologs of DKFZ are identified in species other than Homo sapiens include NM—138839 from Rattus norvegicus.
Analysis of the sequence of DKFZ using a transmembrane helix prediction algorithm (Sonhammer, et al, A hidden Markov model for predicting transmembrane helices in protein sequences, In Proc. of Sixth Int. Conf. on Intelligent Systems for Molecular Biology, p. 175-82, Ed. J. Glasgow, T. Littlejohn, F. Major, R. Lathrop, D. Sankoff, and C. Sensen, Menlo Park, Calif.: AAAI Press, 1998) indicates that the DKFZ protein has six transmembrane regions (
Additional functional information on DKFZ was generated using antisense knockout technology. A number of different oligonucleotides complementary to DKFZ mRNA were designed (AS) with corresponding controls (RC): GCTGCTGGATTCGTTTGGCATAACT (SEQ ID NO: 3013; CHIR180-7AS, DKFZp566I1:P1301AS), TCAATACGGTTTGCTTAGGTCGTCG (SEQ ID NO: 3014; CHIR180-7RC, DKFZp566I1:P1301RC), TCTCCTCTGAGTTCAACCGCTGCT (SEQ ID NO: 3015; CHIR180-8AS, DKFZp566I1:P1320AS) and TCGTCGCCAACTTGAGTCTCCTCT (SEQ ID NO: 3016; CHIR180-8RC, DKFZp566I1:P1320AS), and tested for their ability to suppress expression of DKFZ in human malignant colorectal carcinoma SW620 cells, human breast cancer MDA231 cells, and human breast cancer T4-2 cells, as described above.
Table 25 shows that the antisense (AS) oligonucleotides described above reduced expression of DKFZ mRNA as compared to controls in all three cell lines. DKFZ mRNA reduction ranged from about 95% to about 99%, as compared to cells transfected with reverse (i.e. sense) control (RC) oligonucleotides.
The effect of gene expression on the inhibition of cell proliferation was assessed in metastatic breast cancer cell line MDA-231 and breast cancer cell line T4-2.
Cells were plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide was diluted to 2 μM in OptiMEM™ and added to OptiMEM™ into which a delivery vehicle, preferably a lipitoid or cholesteroid, had been diluted. The oligo/delivery vehicle mixture was then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments was 300 nM, and the final ratio of oligo to delivery vehicle for all experiments was 1.5 nmol lipitoid/μg oligonucleotide.
Antisense oligonucleotides were prepared. Cells were transfected for 4 hours or overnight at 37° C. and the transfection mixture was replaced with fresh medium. Plates are incubated for 4 days, with a plate harvested for each day0-day4. To determine differences in cell number, a CyQuant Cell Proliferation Assay kit (Molecular Probes) was used per manufacturer's instructions. Fluorecence readings (480 nm excitation 520 nm emission) are taken after incubation for 5 minutes.
The results of these assays are shown in Tables 26 and 27. The data show that DKFZ antisense polynucleotides significantly reduce cell proliferation as compared to controls, and, as such, DKFZ plays a role in production or maintenance of the cancerous phenotype in cancerous breast cells.
The effect of DKFZ gene expression upon anchorage-independent cell growth of MDA435 and MCF7 human breast cancer cells was measured by colony formation in soft agar. Soft agar assays were conducted by the method described for GAK, above.
The data presented in Table 28 shows that the application of DKFZ antisense oligonucleotides to MDA435 and MCF7 cells results in inhibition of colony formation and shows that DKFZ plays a role in anchorage-independent cell growth of cancer cells. Table 28 shows the average fluorescence reading for several experiments. The standard deviation (St. Dev) of the fluorescence reading and coefficient of variation (% CV) and probability (P-value) is also shown.
The effect of DKFZ gene expression upon invasiveness of MDA231 human breast cancer cells was measured by a matrigel assay. A 3-dimensional reconstituted basement membrane culture of cells was generated as described previously (Peterson et al., (1992) Proc. Natl. Acad. Sci. USA 89:9064-9068) using a commercially prepared reconstituted basement membrane (Matrigel; Collaborative Research, Waltham, Mass.) and examined using methods well known in the art.
Table 29 (quantitated using Alamar Blue similar to the soft agar assay) and
The following peptides were used for polyclonal antibody production: peptide 809: gvhqqyvqriek (SEQ ID NO:2885), corresponding to amino acids 97-108 of the DKFZ protein and peptide 810: sgaepddeeyqef (SEQ ID NO: 2886), corresponding to amino acids 215-227 of the DKFZ protein.
Antibodies specific for DKFZ are used in FACS and immunolocalization analysis to show that DKFZ is associated with membrane, and up-regulated in cancer tissues of biopsies from cancer patients.
Further, antibodies specific for DKFZ are used to modulate DKFZ activity in cancerous breast, and is further used, alone or conjugated to a toxic moiety, as a treatment for breast cancer.
The biological materials used in the experiments that led to the present invention are described below.
Source of Patient Tissue Samples
Normal and cancerous tissues were collected from patients using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al. (1998) Trends Genet. 14:2726; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:9981001). Table 30 provides information about each patient from which colon tissue samples were isolated, including: the Patient ID (“PT ID”) and Path ReportID (“Path ID”), which are numbers assigned to the patient and the pathology reports for identification purposes; the group (“Grp”) to which the patients have been assigned; the anatomical location of the tumor (“Anatom Loc”); the primary tumor size (“Size”); the primary tumor grade (“Grade”); the identification of the histopathological grade (“Histo Grade”); a description of local sites to which the tumor had invaded (“Local Invasion”); the presence of lymph node metastases (“Lymph Met”); the incidence of lymph node metastases (provided as a number of lymph nodes positive for metastasis over the number of lymph nodes examined) (“Lymph Met Incid”); the regional lymphnode grade (“Reg Lymph Grade”); the identification or detection of metastases to sites distant to the tumor and their location (“Dist Met & Loc”); the grade of distant metastasis (“Dist Met Grade”); and general comments about the patient or the tumor (“Comments”). Histopathology of all primary tumors indicated the tumor was adenocarcinoma except for Patient ID Nos. 130 (for which no information was provided), 392 (in which greater than 50% of the cells were mucinous carcinoma), and 784 (adenosquamous carcinoma). Extranodal extensions were described in three patients, Patient ID Nos. 784, 789, and 791. Lymphovascular invasion was described in Patient ID Nos. 128, 228, 278, 517, 534, 784, 786, 789, 791, 890, and 892. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.
Source of Polynucleotides on Arrays
Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. Table 31 provides information about the polynucleotides on the arrays including: (1) the “SEQ ID NO” assigned to each sequence for use in the present specification; (2) the spot identification number (“Spot ID”), an internal reference that serves as a unique identifier for the spot on the array; (3) the “Clone ID” assigned to the clone from which the sequence was isolated; and (4) the “MAClone ID” assigned to the clone from which the sequence was isolated. The sequences corresponding to the SEQ ID NOS are provided in the Sequence Listing.
Characterization of Sequences
The sequences of the isolated polynucleotides were first masked to eliminate low complexity sequences using the RepeatMasker masking program, publicly available through a web site supported by the University of Washington (See also Smit, A. F. A. and Green, P., unpublished results). Generally, masking does not influence the final search results, except to eliminate sequences of relatively little interest due to their low complexity, and to eliminate multiple “hits” based on similarity to repetitive regions common to multiple sequences, e.g., Alu repeats. Masking resulted in the elimination of several sequences.
The remaining sequences of the isolated polynucleotides were used in a homology search of the GenBank database using the TeraBLAST program (TimeLogic, Crystal Bay, Nev.), a DNA and protein sequence homology searching algorithm. TeraBLAST is a version of the publicly available BLAST search algorithm developed by the National Center for Biotechnology, modified to operate at an accelerated speed with increased sensitivity on a specialized computer hardware platform. The program was run with the default parameters recommended by TimeLogic to provide the best sensitivity and speed for searching DNA and protein sequences. Gene assignment for the query sequences was determined based on best hit form the GenBank database; expectancy values are provided with the hit.
Summary of TeraBLAST Search Results
Table 32 provides information about the gene corresponding to each polynucleotide. Table 32 includes: (1) the “SEQ ID NO” of the sequence; (2) the “Clone ID” assigned to the clone from which the sequence was isolated; (3) the “MAClone ID” assigned to the clone from which the sequence was isolated; (4) the percentage of masking of the sequence (“Mask Prcnt”) (5) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GBHit”); (6) a description of the GenBank sequence (“GBDescription”); and (7) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GBScore”). The published information for each GenBank and EST description, as well as the corresponding sequence identified by the provided accession number, are incorporated herein by reference.
Homo sapiens mRNA for aflatoxin B1-
sapiens creatine kinase, mitochondrial 1
Homo sapiens, adaptor-related protein
Homo sapiens cDNA: FLJ22874 fis, clone
Homo sapiens, inositol 1,3,4-triphosphate
Homo sapiens cDNA FLJ31102 fis, clone
Homo sapiens, lysophospholipase-like,
Homo sapiens, Similar to cut (Drosophila)-
Homo sapiens F1-ATPase epsilon-subunit
Homo sapiens cDNA FLJ20133 fis, clone
Homo sapiens mRNA; cDNA
Homo sapiens, clone MGC: 15585
Homo sapiens, clone IMAGE: 4296901,
Homo sapiens, retinoid X receptor, alpha,
Homo sapiens cDNA: FLJ21896 fis, clone
Homo sapiens, Similar to CAAX box 1,
Homo sapiens mRNA for Fas-associated
Homo sapiens, cytochrome c oxidase
Homo sapiens mRNA for chromosome 11
Homo sapiens mRNA for zetal-COP,
Homo sapiens, proliferating cell nuclear
Homo sapiens, Similar to G8 protein, clone
Homo sapiens cDNA FLJ20474 fis, clone
Homo sapiens, protein (peptidyl-prolyl
sapiens ribosomal protein S10 (RPS10),
Homo sapiens mRNA; cDNA
Homo sapiens ribosomal protein L26
H. sapiens plk-1 mRNA
Homo sapiens, Similar to ADP-
Homo sapiens Alu co-repressor 1 (ACR1)
Homo sapiens cDNA FLJ10773 fis, clone
Homo sapiens, BCL2-antagonist of cell
Homo sapiens cDNA FLJ30124 fis, clone
Homo sapiens, clone MGC: 14608
Homo sapiens mRNA; cDNA
Homo sapiens haplotype X mitochondrion,
sapiens podocalyxin-like protein mRNA,
sapiens dual specificity phosphatase 1
Homo sapiens mRNA; cDNA
Homo sapiens apoptosis-associated nuclear
Homo sapiens RAD17 pseudogene,
Homo sapiens mRNA for KIAA0956
Homo sapiens transmembrane protein
Homo sapiens cDNA FLJ31250 fis, clone
sapiens antigen NY-CO
Homo sapiens CDA09 mRNA, complete
Mus musculus adult male testis cDNA,
Homo sapiens mRNA; cDNA
Homo sapiens mRNA; cDNA
Homo sapiens, structure specific
Mus musculus adult male small intestine
sapiens microfibrillar-associated protein 2
Homo sapiens LRP16 (LRP16) mRNA,
Homo sapiens, clone MGC: 12603
Homo sapiens cDNA FLJ10623 fis, clone
sapiens chromosome-ass
Homo sapiens, programmed cell death 2,
Homo sapiens mitochondrial DNA
Homo sapiens cDNA FLJ13175 fis, clone
Homo sapiens, Similar to cytochrome b-
H. sapiens RNA for nm23-H2 gene
sapiens macrophage migration inhibitory
Homo sapiens cDNA: FLJ22881 fis, clone
sapiens bystin-like (BYSL), mRNA
Homo sapiens (cell line HepG2, HeLa)
sapiens brain-expressed HHCPA78
Homo sapiens, clone IMAGE: 3505920,
Homo sapiens, Similar to nucleolin, clone
Homo sapiens mitochondrial inner
Homo sapiens, ribosomal protein S4, X-
Homo sapiens, heterogeneous nuclear
sapiens heterogeneous nuclear
Homo sapiens cDNA FLJ14949 fis, clone
sapiens sodium-depend
Homo sapiens, clone IMAGE: 3837222,
sapiens TATA-binding protein-binding
Homo sapiens cDNA FLJ30321 fis, clone
Homo sapiens, G1 to S phase transition 1,
Homo sapiens, menage a trois 1 (CAK
sapiens actinin, alpha 1 (ACTN1), mRNA
sapiens mitochondrial DNA, complete
Homo sapiens mRNA; cDNA
Homo sapiens cDNA FLJ10869 fis, clone
Homo sapiens cDNA FLJ13289 fis, clone
sapiens ribosomal protein L34 (RPL34),
Homo sapiens, clone IMAGE: 4041545,
Homo sapiens cDNA FLJ25116 fis, clone
sapiens ribosomal protein S11 (RPS11),
Homo sapiens map 3p22; 9.65 cR from
H. sapiens mRNA translocon-associated
Homo sapiens, clone MGC: 15545
H. sapiens pS2 protein gene
Homo sapiens cDNA: FLJ22459 fis, clone
Homo sapiens CSGEF (SGEF) mRNA,
Homo sapiens, DKFZP586A0522 protein,
Homo sapiens CSGEF (SGEF) mRNA,
Homo sapiens, kallikrein 3, (prostate
Homo sapiens stannin mRNA, complete
H. sapiens mRNA for adenosine
Homo sapiens cDNA FLJ14276 fis, clone
sapiens biliverdin-IX alpha reductase
Homo sapiens, calcium-regulated heat-
Homo sapiens mRNA; cDNA
Homo sapiens mRNA; cDNA
Homo sapiens HAH-P (HAH-P) mRNA,
sapiens mRNA for TGF-betaIIR alpha,
Homo sapiens, Similar to RIKEN cDNA
Homo sapiens cDNA: FLJ23241 fis, clone
Homo sapiens cDNA FLJ31439 fis, clone
sapiens glutathione S-transferase pi
H. sapiens mRNA for S100 calcium-
Homo sapiens, ribonucleotide reductase
Homo sapiens, ribosomal protein, large,
Homo sapiens, clone MGC: 2616
Homo sapiens, RNA binding motif protein,
Homo sapiens, TGFB-induced factor 2
Homo sapiens, replication factor C
Homo sapiens, Similar to golgi
Homo sapiens mRNA for KIAA0911
Homo sapiens mesenchymal stem cell
Homo sapiens ribosomal protein L18a
Homo sapiens cDNA FLJ31625 fis, clone
sapiens SAC2 (suppressor of actin
Homo sapiens cDNA FLJ14775 fis, clone
Homo sapiens, heterogeneous nuclear
Homo sapiens, clone MGC: 861
Homo sapiens cDNA FLJ31899 fis, clone
Homo sapiens clone HQ0569
Homo sapiens ubiquitously expressed
Homo sapiens, clone MGC: 29782
Homo sapiens cDNA FLJ14723 fis, clone
Homo sapiens, clone IMAGE: 3683864,
Homo sapiens, clone MGC: 12798
Homo sapiens HSPC028 mRNA, complete
Homo sapiens cDNA FLJ30113 fis, clone
Homo sapiens cDNA FLJ20077 fis, clone
Homo sapiens mRNA; cDNA
Homo sapiens, protein kinase, interferon-
Homo sapiens cDNA: FLJ22873 fis, clone
Homo sapiens CGI-11 protein mRNA,
Homo sapiens, actinin, alpha 1, clone
Homo sapiens, farnesyl-diphosphate
Homo sapiens cDNA FLJ20602 fis, clone
H. sapiens mRNA for phenylalkylamine
sapiens ribosomal protein L32 (RPL32),
Homo sapiens pituitary tumor transforming
Homo sapiens microsomal glutathione s-
Homo sapiens, Similar to RIKEN cDNA
Homo sapiens, retinal short-chain
sapiens SFRS protein kinase 1 (SRPK1),
Homo sapiens cDNA FLJ12867 fis, clone
sapiens 17 beta-hydro
Homo sapiens DC5 (DC5) mRNA,
Homo sapiens, eukaryotic translation
Homo sapiens core histone macroH2A2.2
Homo sapiens, clone MGC: 15290
Homo sapiens, Similar to poly (A)
Homo sapiens NAG22 protein mRNA,
Homo sapiens, clone MGC: 3993
Cercopithecus aethiops DnaJ-like protein
Homo sapiens, clone MGC: 19606
Homo sapiens mRNA for KIAA0695
Homo sapiens, clone IMAGE: 3831740,
Homo sapiens P8 protein mRNA, complete
Homo sapiens, clone IMAGE: 3867552,
H. sapiens mRNA for Lon protease-like
sapiens enolase 1, (alpha) (ENO1), mRNA
sapiens heterogeneous nuclear
sapiens mRNA for A+U-rich element RNA
Homo sapiens, clone MGC: 1004
Homo sapiens putative SH3 domain-
Homo sapiens cDNA: FLJ21487 fis, clone
Homo sapiens, hypothetical protein, clone
Homo sapiens, clone MGC: 20633
Homo sapiens, clone IMAGE: 4332982,
sapiens ribosomal protein S21 (RPS21),
Homo sapiens, aldehyde dehydrogenase 4
Homo sapiens cDNA: FLJ21841 fis, clone
Homo sapiens NUF2 mRNA for
Homo sapiens collagen type XVII
Homo sapiens small zinc finger-like
Homo sapiens mRNA; cDNA
Homo sapiens cDNA FLJ13813 fis, clone
Gorilla gorilla beta-2-microglobulin
Homo sapiens, ubiquinol-cytochrome c
Homo sapiens stearoyl-CoA desaturase
Homo sapiens, homolog of yeast long
Homo sapiens membrane associated
Homo sapiens, Similar to transmembrane 4
Homo sapiens colon Kruppel-like factor
sapiens ribosomal protein S18 (RPS18),
Homo sapiens, clone IMAGE: 3891886,
Homo sapiens, Similar to stromal antigen
sapiens myosin light chain 1 slow a
Homo sapiens, clone MGC: 10643
Homo sapiens FK506 binding protein
Homo sapiens mRNA; cDNA
H. sapiens mRNA for S100E calcium
Homo sapiens mRNA for KIAA1143
Homo sapiens, U5 snRNP-specific protein,
Homo sapiens, Similar to aspartyl-tRNA
Homo sapiens brain-specific STE20-like
Homo sapiens adenocarcinoma antigen
Homo sapiens, clone IMAGE: 3503646,
Homo sapiens cDNA FLJ25434 fis, clone
Homo sapiens, eukaryotic translation
Homo sapiens, clone MGC: 2068
Homo sapiens, clone IMAGE: 3451980,
sapiens DNA for cyclophilin 40, complete
Homo sapiens clone 23969 mRNA
sapiens TRAF4 associated factor 1 mRNA,
Homo sapiens, Similar to RIKEN cDNA
Homo sapiens RPL32 gene for ribosomal
Homo sapiens, natural killer cell transcript
Homo sapiens, clone MGC: 1567
Homo sapiens SUI1 isolog mRNA,
Homo sapiens, hypothetical protein
Homo sapiens, MRJ gene for a member of
Homo sapiens sorting nexin 3 (SNX3)
Homo sapiens CGI-114 protein mRNA,
Homo sapiens, ribosomal protein S14,
Homo sapiens, chromobox homolog 1
Homo sapiens mRNA for KIAA1181
Homo sapiens, clone IMAGE: 3869909,
Homo sapiens, clone IMAGE: 4121355,
Homo sapiens, glucose phosphate
Homo sapiens, hypothetical protein, clone
Homo sapiens, clone MGC: 19606
Homo sapiens mRNA; cDNA
sapiens heat shock 70 kD protein 1B
Homo sapiens, clone MGC: 15728
Homo sapiens, Similar to aspartyl-tRNA
Homo sapiens class I alcohol
Homo sapiens, clone MGC: 8967
sapiens potassium channel, subfamily K,
sapiens ribosomal protein L10 (RPL10),
Homo sapiens hUNC18b alternatively-
Homo sapiens, ribonuclease, RNase A
Homo sapiens, Similar to selenium binding
Homo sapiens, clone MGC: 17066
Homo sapiens, eukaryotic translation
sapiens pancreatitis-associated protein
sapiens heparan N-deacetylase/N-
sapiens necdin homolog (mouse) (NDN),
Homo sapiens, clone MGC: 9344
Homo sapiens, clone IMAGE: 2959721,
Homo sapiens, clone IMAGE: 3960207,
Homo sapiens gene for interleukin 3
Homo sapiens mRNA for KIAA0563
sapiens ribosomal protein S8 (RPS8),
sapiens IL-17 receptor mRNA, complete
Homo sapiens, clone MGC: 1111
Homo sapiens, TATA box binding protein
Homo sapiens cDNA FLJ32232 fis, clone
H. sapiens mRNA for diubiquitin
sapiens mRNA for serin protease with
Homo sapiens protein-tyrosine kinase
Homo sapiens mRNA for KIAA0293 gene,
Homo sapiens, ribosomal protein L13,
H. sapiens mRNA for sphingomyelinase
Homo sapiens, small nuclear
Homo sapiens tumor suppressing STF
Homo sapiens, isocitrate dehydrogenase 2
sapiens mitotic feedback control protein
Homo sapiens, Similar to metallothionein 3
Homo sapiens PKY protein kinase mRNA,
Homo sapiens clone 24747 mRNA
Homo sapiens, guanosine monophosphate
Homo sapiens envoplakin (EVPL) gene,
Homo sapiens chaperonin containing t-
sapiens mRNA for RBP-MS/type 1,
Homo sapiens, phosphatidic acid
Homo sapiens, Similar to glutaminyl-
Homo sapiens, tissue specific
Homo sapiens cDNA: FLJ22996 fis, clone
Homo sapiens, Similar to solute carrier
H. sapiens mRNA for lung amiloride
Homo sapiens, Similar to calpastatin, clone
H. sapiens rel proto-oncogene mRNA
Homo sapiens, Similar to amyloid beta
Homo sapiens nephrin mRNA, complete
Homo sapiens mRNA for CDEP, complete
Homo sapiens mRNA for
Homo sapiens, clone MGC: 23226
Homo sapiens mawbp mRNA for MAWD
Homo sapiens, fucosidase, alpha-L-1,
Homo sapiens cDNA FLJ25284 fis, clone
Homo sapiens YAC clone 377A1 unknown
Homo sapiens cDNA FLJ32915 fis, clone
sapiens H105e3 (H105e3) mRNA,
Homo sapiens, clone IMAGE: 3617364,
sapiens myosin light chain kinase (MLCK)
sapiens monoamine oxidase A (MAOA),
Homo sapiens mRNA from chromosome
sapiens hepatocyte growth factor-like
Homo sapiens, small nuclear RNA
Homo sapiens mRNA for nucleolar protein
sapiens brain-expressed HHCPA78
Homo sapiens mRNA; cDNA
sapiens mRNA for B-FABP, complete cds
Homo sapiens mRNA; cDNA
sapiens alcohol dehydrogenase 1C (class
Homo sapiens UDP-glucose
H. sapiens encoding CLA-1 mRNA
Homo sapiens SNC73 protein (SNC73)
Homo sapiens, clone MGC: 3855
Homo sapiens, clone IMAGE: 3897044,
Homo sapiens, clone MGC: 3101
Homo sapiens, peptidylprolyl isomerase B
Homo sapiens, Similar to protease inhibitor
Homo sapiens mRNA for KIAA1206
Homo sapiens, polymerase (RNA) II
sapiens ribosomal protein S20 (RPS20),
Homo sapiens multiple endocrine
Homo sapiens, proteasome (prosome,
Homo sapiens, eukaryotic translation
Homo sapiens mRNA full length insert
Homo sapiens, hypothetical protein
Homo sapiens, Similar to interleukin 10
Homo sapiens, clone IMAGE: 3617778,
Homo sapiens, ribosomal protein L4, clone
Homo sapiens, solute carrier family 1
Homo sapiens, ribophorin II, clone
Homo sapiens, phosphatidic acid
Homo sapiens NADH:ubiquinone
Homo sapiens cDNA FLJ20699 fis, clone
Homo sapiens translation initiation factor
Homo sapiens, phosphatidylserine synthase
Homo sapiens, eukaryotic translation
sapiens matrix metalloproteinase 2
Homo sapiens, Similar to aldehyde
sapiens neuronal apoptosis inhibitory
H. sapiens mRNA for oct-binding factor
Homo sapiens mRNA for B120, complete
Homo sapiens, Similar to plastin 3 (T
Homo sapiens ubiquitous TPR motif, Y
Homo sapiens, ectodermal-neural cortex
Homo sapiens, ribosomal protein L7a,
Homo sapiens, ribosomal protein L13a,
Homo sapiens, proteasome (prosome,
Homo sapiens, clone MGC: 9485
Homo sapiens cDNA FLJ31712 fis, clone
H. sapiens mRNA for kinesin (heavy chain)
Homo sapiens mRNA for protein tyrosine
Homo sapiens, Similar to acidic 82 kDa
Homo sapiens, phosphoenolpyruvate
H. sapiens mRNA for Icln protein
Homo sapiens, cysteine-rich protein 1
sapiens CDC16 cell division cycle 16
Homo sapiens gastrointestinal peptide
Homo sapiens alpha-(1,3/1,4)-
H. sapiens HMG-2 mRNA
Homo sapiens, Similar to villin-like, clone
Homo sapiens breakpoint cluster region
H. sapiens mRNA for arginine
Homo sapiens, general transcription factor
Homo sapiens cDNA FLJ10824 fis, clone
Homo sapiens, guanine nucleotide binding
sapiens differentiation-dependent A4
sapiens eukaryotic translation initiation
sapiens hemoglobin, beta (HBB), mRNA
sapiens Finkel-Biskis-Reilly murine
Homo sapiens, Similar to acyl-Coenzyme
Homo sapiens, immature colon carcinoma
Homo sapiens, clone IMAGE: 3937549,
H. sapiens mRNA for trypsinogen IV b-
sapiens ribosomal protein, large, P0
Homo sapiens, proteasome (prosome,
Homo sapiens, clone MGC: 21520
Homo sapiens, replication protein A3
Homo sapiens, matrilin 2, clone
Homo sapiens, Similar to interferon
Homo sapiens YAC clone 136A2 unknown
Homo sapiens carboxypeptidase M
H. sapiens RNA for snRNP protein B
Homo sapiens, Similar to for protein
sapiens mRNA for zinc finger protein
sapiens FXYD domain-containing ion
Homo sapiens, Similar to keratin 7, clone
Homo sapiens TGF-beta type secreted
Homo sapiens AD-014 protein mRNA,
Homo sapiens genomic sequence
H. sapiens mRNA for translin associated
Homo sapiens, cyclophilin, clone
Homo sapiens, Similar to synaptophysin-
Homo sapiens mRNA full length insert
H. sapiens mRNA for IL-13 receptor
Homo sapiens mRNA for neurotrypsin
Homo sapiens putative sterol reductase
Homo sapiens, lectin, galactoside-binding,
Homo sapiens, signal sequence receptor,
H. sapiens mRNA for interleukin-1B
Homo sapiens pigment epithelium-derived
sapiens basic leucine zipper transcription
sapiens hnRNP Q2 mRNA, complete cds
H. sapiens ERC-55 mRNA
H. sapiens mRNA for RanBP1
Homo sapiens, Similar to ubiquitin-
Homo sapiens, lysophospholipase-like,
Homo sapiens, hypothetical protein, clone
Homo sapiens, small nuclear
Homo sapiens serine protease (OMI)
Homo sapiens, dolichyl-
H. sapiens MT-11 mRNA
H. sapiens mRNA homologous to S. cerevisiae
H. sapiens nek3 mRNA for protein kinase
Homo sapiens, clone MGC: 22754
sapiens ret proto-oncogene (multiple
sapiens ribosomal protein L17 (RPL17),
Homo sapiens FGFR-4 gene
Homo sapiens, clone IMAGE: 3455871,
Homo sapiens, TTK protein kinase, clone
Homo sapiens translocon-associated
Homo sapiens DC44 mRNA, complete cds
Homo sapiens MTG8-like protein
H. sapiens mRNA for prepro-alpha2(I)
Homo sapiens PRO0066 mRNA, complete
sapiens serine/threonine kinase 22C
sapiens hepatoma transmembrane kinase
Homo sapiens cDNA FLJ11350 fis, clone
Homo sapiens cDNA FLJ12941 fis, clone
Homo sapiens C8ORF4 protein (C8ORF4)
Homo sapiens cDNA FLJ12820 fis, clone
Homo sapiens mRNA for sialin
Homo sapiens, clone IMAGE: 3141444,
Homo sapiens casein kinase I epsilon
Homo sapiens mRNA; cDNA
Homo sapiens, clone IMAGE: 4645230,
Homo sapiens mRNA; cDNA
Homo sapiens SAR1 (SAR1) mRNA,
Homo sapiens (clone lamda-hPEC-3)
Homo sapiens mRNA for GalNAc alpha-2,
Homo sapiens cDNA FLJ31387 fis, clone
Homo sapiens, clone IMAGE: 3354010,
H. sapiens 44 kDa protein kinase related to
Homo sapiens urokinase-type plasminogen
Homo sapiens, protein kinase, interferon-
Homo sapiens, clone MGC: 3255
Homo sapiens cDNA FLJ25120 fis, clone
Homo sapiens, ribosomal protein L6, clone
Homo sapiens, dual specificity
Homo sapiens, nucleolar autoantigen
Homo sapiens, Similar to cyclin B1,
Homo sapiens mRNA for KIAA1846
Homo sapiens XAG-2 homolog long
Homo sapiens PRO1038 mRNA, complete
Homo sapiens cDNA FLJ31149 fis, clone
Homo sapiens, Similar to creatine kinase,
Homo sapiens, CDC-like kinase 3, clone
Homo sapiens mRNA for multidrug
Homo sapiens N-acetylneuraminic acid
H. sapiens mRNA for peroxisome
Homo sapiens, Similar to heat shock
Homo sapiens, clone IMAGE: 4040789,
Arabidopsis thaliana putative transcription
Homo sapiens CGI-81 protein mRNA,
Homo sapiens, clone IMAGE: 3506553,
Homo sapiens, Similar to high-mobility
H. sapiens 40 kDa protein kinase related to
Homo sapiens, cell division cycle 25B,
Homo sapiens, Similar to acyl-Coenzyme
Homo sapiens cDNA FLJ31080 fis, clone
scrofa calcium/calmodu
sapiens ribosomal protein L11 (RPL11),
Homo sapiens, clone IMAGE: 3162218,
H. sapiens mRNA for receptor protein
sapiens serine kinase SRPK2 mRNA,
Homo sapiens, eukaryotic translation
Homo sapiens histone H2A.F/Z variant
Homo sapiens, clone MGC: 15133
Homo sapiens cDNA: FLJ21025 fis, clone
Homo sapiens, clone IMAGE: 4861487,
Homo sapiens serine/threonine kinase
Homo sapiens HSC54 mRNA for heat
musculus putative E1-E2 ATPase mRNA,
Homo sapiens cDNA FLJ11883 fis, clone
Homo sapiens cDNA FLJ31238 fis, clone
sapiens mRNA for MNB protein kinase,
Homo sapiens nemo-like kinase mRNA,
Homo sapiens, clone MGC: 11034
Homo sapiens cDNA FLJ31002 fis, clone
Homo sapiens mRNA; cDNA
Homo sapiens cDNA FLJ30113 fis, clone
Homo sapiens C1orf19 mRNA, partial cds
Homo sapiens cDNA FLJ20050 fis, clone
Homo sapiens, Similar to CAP-binding
Homo sapiens mRNA; cDNA
Homo sapiens cDNA FLJ25006 fis, clone
Homo sapiens placenta-specific ATP-
Homo sapiens receptor protein-tyrosine
Homo sapiens fibroblast growth factor
Homo sapiens, interleukin 1, alpha, clone
Homo sapiens, pyruvate kinase, muscle,
Homo sapiens, clone IMAGE: 3140866,
Homo sapiens, clone IMAGE: 3609337,
Homo sapiens sgk gene
Homo sapiens, clone IMAGE: 3537447,
Homo sapiens cDNA FLJ32516 fis, clone
sapiens ankyrin repea
Homo sapiens cDNA FLJ20186 fis, clone
Homo sapiens c-syn protooncogene
Homo sapiens mRNA for SRp25 nuclear
Homo sapiens aurora-related kinase 2
H. sapiens mRNA PSSALRE for
Homo sapiens mRNA full length insert
Homo sapiens mRNA for KIAA0803
sapiens phosphoprotein associated with
Homo sapiens cDNA FLJ13450 fis, clone
sapiens mRNA for KIAA
sapiens mRNA for Eph-family protein,
sapiens mRNA for Eph-family protein,
sapiens glutamine PRPP amidotransferase
Homo sapiens cDNA FLJ20243 fis, clone
Homo sapiens genomic sequence
Homo sapiens, acid phosphatase 1, soluble,
Homo sapiens, Similar to retinoblastoma-
Homo sapiens, insulin-like growth factor
Homo sapiens cytoplasmic phosphotyrosyl
Homo sapiens cDNA FLJ30831 fis, clone
Homo sapiens, clone MGC: 17244
Homo sapiens cDNA FLJ31265 fis, clone
Gallus gallus syndesmo
Homo sapiens HSNFRK (HSNFRK)
Homo sapiens clone FLB9440 PRO2550
Homo sapiens full length insert cDNA
Homo sapiens small GTP-binding protein
Homo sapiens cDNA: FLJ22876 fis, clone
Homo sapiens WS beta
Homo sapiens cDNA: FLJ21884 fis, clone
Homo sapiens cDNA FLJ20764 fis, clone
Homo sapiens mRNA; cDNA
Homo sapiens ethanolamine kinase (EKI1)
Homo sapiens 11 beta-hydroxysteroid
sapiens ribosomal protein L36 (RPL36),
Homo sapiens, Similar to interferon
Homo sapiens, Similar to interferon
Homo sapiens, clone IMAGE: 3954272,
Homo sapiens, ribosomal protein L10a,
Homo sapiens, Similar to synaptophysin-
Homo sapiens cDNA: FLJ22518 fis, clone
Homo sapiens HSPC235
sapiens signal sequence receptor, beta
Homo sapiens PRO2853 mRNA, complete
Homo sapiens alpha gene sequence
Homo sapiens nickel-specific induction
Homo sapiens, clone IMAGE: 3883264,
Homo sapiens, tubulin-specific chaperone
H. sapiens pS2 protein gene
sapiens ribosomal protein S6 (RPS6),
Homo sapiens, PDZ and LIM domain 1
Homo sapiens, cold shock domain protein
Homo sapiens, Similar to serine (or
Homo sapiens, Similar to nucleophosmin
Homo sapiens, catechol-O-
sapiens porimin mRNA, complete cds
sapiens ribosomal protein S11 (RPS11),
sapiens hydroxysteroid (17-beta)
Homo sapiens mRNA for URIM protein
Homo sapiens, clone IMAGE: 3348134,
H. sapiens gene for Ig kappa light chain
Homo sapiens, peptidylprolyl isomerase A
sapiens cadherin 17, LI cadherin (liver-
sapiens colon mucosa-associated (DRA)
Homo sapiens, clone MGC: 12335
sapiens regenerating gene type IV mRNA,
Homo sapiens, clone MGC: 1138
Homo sapiens mRNA for immunoglobulin
Homo sapiens gastrointestinal secretory
sapiens mitochondrial ribosomal protein
Homo sapiens, ubiquitin-conjugating
sapiens putative splice factor transformer2-
Homo sapiens, Similar to RIKEN cDNA
Homo sapiens mRNA for oxidative-stress
Homo sapiens cDNA FLJ11993 fis, clone
sapiens leucine amino
Homo sapiens cDNA: FLJ22779 fis, clone
Homo sapiens NIMA-related kinase 6
sapiens ribosomal protein L31 (RPL31),
Homo sapiens RPL6 gene for ribosomal
sapiens ribosomal protein S8 (RPS8),
sapiens apolipoprotein B mRNA editing
sapiens fibronectin 1 (FN1), transcript
Homo sapiens, myo-inositol 1-phosphate
H. sapiens mitochondrial genome
Homo sapiens, lactate dehydrogenase B,
Homo sapiens, guanine nucleotide binding
Homo sapiens cDNA: FLJ22996 fis, clone
H. sapiens mRNA for carcinoembryonic
Homo sapiens, clone MGC: 14690
H. sapiens Ig lambda light chain variable
Homo sapiens partial mRNA, clone c1-
sapiens heterogeneous nuclear
Homo sapiens, CGI-89 protein, clone
Homo sapiens cDNA: FLJ21087 fis, clone
Homo sapiens malate dehydrogenase
Homo sapiens carcinoembryonic antigen
Homo sapiens clone FLB9737
Homo sapiens cDNA: FLJ22905 fis, clone
sapiens Humanin (HN1) mRNA, complete
Homo sapiens, ribosomal protein, large P2,
H. sapiens mRNA for Pr22 protein
sapiens ribosomal protein S12 (RPS12),
Homo sapiens mitochondrion, complete
sapiens ribosomal protein S15a (RPS15A),
sapiens Humanin (HN1) mRNA, complete
Homo sapiens, N-acetylneuraminic acid
sapiens ribosomal protein L5 (RPL5),
Homo sapiens, eukaryotic translation
Homo sapiens cDNA FLJ13300 fis, clone
Homo sapiens, clone IMAGE: 3462987,
sapiens ribosomal protein S23 (RPS23),
Homo sapiens, lactate dehydrogenase B,
sapiens laminin receptor 1 (67 kD,
sapiens ribosomal protein S8 (RPS8),
Homo sapiens HSPC297 mRNA, partial
Homo sapiens, Similar to ribosomal
sapiens ribosomal protein L18 (RPL18),
Homo sapiens, ribosomal protein L3, clone
sapiens nuclear antigen H731-like protein
Homo sapiens, clone MGC: 15290
Homo sapiens cDNA: FLJ21425 fis, clone
sapiens mRNA for IgG Fc binding protein,
sapiens mRNA for IgG Fc binding protein,
Homo sapiens, proliferating cell nuclear
Homo sapiens, Similar to signal
Homo sapiens, clone MGC: 1138
Homo sapiens, clone IMAGE: 4025624,
Homo sapiens PRO1489 mRNA, complete
Homo sapiens, ribosomal protein L44,
Homo sapiens cDNA: FLJ22875 fis, clone
Homo sapiens normal mucosa of
Homo sapiens mRNA for vacuolar
Homo sapiens hepatocellular carcinoma
Homo sapiens, thymosin, beta 4, X
Homo sapiens, RNA polymerase I 16 kDa
H. sapiens genomic DNA of ribosomal
Homo sapiens clone FLC0165 mRNA
Homo sapiens calcium-dependent chloride
sapiens fucosidase, alpha-L-1, tissue
Homo sapiens, nuclear transport factor 2
Homo sapiens, nuclear transport factor 2
Homo sapiens cDNA FLJ20063 fis, clone
Homo sapiens cDNA FLJ20106 fis, clone
sapiens ribosomal protein L27 (RPL27),
H. sapiens Wilms tumor gene 1, exon 4
Homo sapiens cDNA FLJ14531 fis, clone
Homo sapiens, menage a trois 1 (CAK
Homo sapiens, ribosomal protein S10,
Homo sapiens, small acidic protein, clone
Homo sapiens, Similar to RNA helicase-
Homo sapiens, basic transcription factor 3,
Homo sapiens, Similar to carbonic
Homo sapiens, clone IMAGE: 3343539,
Homo sapiens, clone MGC: 14460
sapiens ribosomal protein L10 (RPL10),
Homo sapiens cDNA: FLJ22997 fis, clone
sapiens ribosomal protein L38 (RPL38),
Homo sapiens cDNA FLJ25284 fis, clone
Homo sapiens DNAJ domain-containing
sapiens cyclin-dependent kinase 9 (CDC2-
Homo sapiens, clone MGC: 17534
Homo sapiens HSPC214 mRNA, complete
sapiens ribosomal protein, large, P0
Homo sapiens, tumor protein,
sapiens ribosomal protein S17 (RPS17),
Homo sapiens mitochondrion, complete
sapiens ribosomal protein S8 (RPS8),
Homo sapiens, clone IMAGE: 4549553,
Homo sapiens, LPS-induced TNF-alpha
Homo sapiens alpha gene sequence
sapiens mitochondrial DNA, complete
H. sapiens Ig lambda light chain variable
Homo sapiens cDNA: FLJ22517 fis, clone
Homo sapiens, Similar to eukaryotic
Homo sapiens mRNA full length insert
Homo sapiens, fucosidase, alpha-L-1,
Homo sapiens partial mRNA, clone c1-
Homo sapiens, Sjogren syndrome antigen
H. sapiens rearranged Humigla1L1 gene
Homo sapiens sin3 associated polypeptide
Homo sapiens mRNA for GalNAc alpha-2,
Homo sapiens, ribosomal protein, large,
Homo sapiens, tissue inhibitor of
sapiens ribosomal protein S24 (RPS24),
H. sapiens GPx-4 mRNA for phospholipid
Homo sapiens serine/threonine protein
Homo sapiens, Similar to sorcin, clone
sapiens laminin receptor 1 (67 kD,
sapiens ribosomal protein, large, P0
H. sapiens XG mRNA (clone R4(551))
H. sapiens mRNA for carcinoembryonic
Homo sapiens carcinoembryonic antigen
Homo sapiens, ribosomal protein S16,
H. sapiens Ig lambda light chain variable
sapiens CAG-isl 7 mRNA, complete cds
Homo sapiens mRNA for nebulette
sapiens peptidylprolyl isomerase A
Homo sapiens, multifunctional polypeptide
Homo sapiens, Similar to heat shock 90 kD
Homo sapiens, Similar to centrin, EF-hand
Homo sapiens mRNA for hluPGFS,
Homo sapiens clone TCBAP0781 mRNA
sapiens ribosomal protein L35 (RPL35),
Homo sapiens, ribosomal protein S11,
sapiens ribosomal protein S11 (RPS11),
Homo sapiens, eukaryotic translation
Homo sapiens mRNA for nucleolar RNA-
Homo sapiens gamma-interferon inducible
Homo sapiens, clone IMAGE: 4636237,
Homo sapiens, ribosomal protein L11,
Homo sapiens, PDZ and LIM domain 1
sapiens ribosomal protein L13a (RPL13A),
Homo sapiens, ribosomal protein L3, clone
Homo sapiens, Similar to enhancer of
H. sapiens gene for cytokeratin 20
sapiens 16S ribosomal RNA gene, partial
Homo sapiens, Similar to ribosomal
sapiens ribosomal protein L36 (RPL36),
Homo sapiens, heat shock 60 kD protein 1
H. sapiens mRNA for rat translocon-
Homo sapiens, nuclear factor of kappa
Homo sapiens heat shock factor binding
Homo sapiens, clone MGC: 8704
Homo sapiens, clone MGC: 15787
H. sapiens Ig lambda light chain variable
sapiens ribosomal protein L5 (RPL5),
Homo sapiens PAPS synthetase-2
Homo sapiens lymphocyte antigen HLA-
Homo sapiens guanine nucleotide binding
Homo sapiens mRNA for vacuolar
sapiens ribosomal protein S8 (RPS8),
Homo sapiens, Similar to protease inhibitor
Homo sapiens cDNA FLJ30111 fis, clone
sapiens Humanin (HN1) mRNA, complete
Homo sapiens, clone IMAGE: 3462987,
Homo sapiens, Similar to non-POU-
Homo sapiens, Similar to seven
Homo sapiens SID6-8061 mRNA for
Homo sapiens, ribosomal protein L19,
Homo sapiens, clone IMAGE: 3462987,
Macaca fascicularis brain cDNA
Homo sapiens mitogenic oxidase mRNA,
Homo sapiens, glutathione peroxidase 2
Homo sapiens cDNA FLJ32984 fis, clone
sapiens splice varian
sapiens heat shock 90 kD protein 1, alpha
sapiens ribosomal protein L5 (RPL5),
Homo sapiens, ribosomal protein L8, clone
Homo sapiens mRNA for TIGA1,
Homo sapiens cDNA: FLJ22513 fis, clone
Homo sapiens cDNA: FLJ23538 fis, clone
Homo sapiens cDNA: FLJ22875 fis, clone
Homo sapiens, lysophospholipase-like,
sapiens ribosomal protein L23 (RPL23),
Homo sapiens cDNA: FLJ22917 fis, clone
Homo sapiens cDNA FLJ32114 fis, clone
Homo sapiens, POP7 (processing of
Homo sapiens, cyclin-dependent kinase 4,
Homo sapiens, 60S ribosomal protein L30
Homo sapiens, clone IMAGE: 3462987,
sapiens ribosomal protein L9 (RPL9),
Homo sapiens cDNA FLJ31884 fis, clone
sapiens ribosomal protein L18 (RPL18),
Homo sapiens cDNA FLJ20133 fis, clone
Homo sapiens, clone IMAGE: 3945177,
Homo sapiens cDNA: FLJ23487 fis, clone
Homo sapiens, clone MGC: 1191
Homo sapiens mitochondrion, complete
Homo sapiens, Similar to transforming,
Homo sapiens, peptidylprolyl isomerase B
Homo sapiens, guanine nucleotide binding
Homo sapiens, ribosomal protein L44,
Homo sapiens, heterogeneous nuclear
Homo sapiens, ribosomal protein S4, X-
Homo sapiens genomic sequence
Homo sapiens mRNA for long-chain acyl-
Homo sapiens cDNA: FLJ22905 fis, clone
Homo sapiens, ribosomal protein S16,
Homo sapiens, Similar to metallothionein
Homo sapiens PTD008 mRNA, complete
Homo sapiens, ribosomal protein, large P2,
Homo sapiens GTP binding protein
Homo sapiens, Similar to RNA helicase-
Homo sapiens neuroendocrine secretory
Homo sapiens, clone MGC: 15764
Homo sapiens clone FLC0165 mRNA
Homo sapiens HGTD-P (HGTD-P)
Homo sapiens, lactate dehydrogenase A,
sapiens ribosomal protein S12 (RPS12),
H. sapiens CpG island DNA genomic Mse1
Homo sapiens, catechol-O-
sapiens ribosomal protein L12 (RPL12),
sapiens ribosomal protein L13a (RPL13A),
Homo sapiens (cell line HepG2, HeLa)
Homo sapiens mRNA for chromosome 11
Homo sapiens, male-enhanced antigen,
Homo sapiens HGTD-P (HGTD-P)
Homo sapiens, Similar to eukaryotic
H. sapiens CpG island DNA genomic Mse1
H. sapiens DNA for monoamine oxidase
sapiens ribosomal protein S21 (RPS21),
Homo sapiens short chain L-3-
Homo sapiens, clone MGC: 15572
Homo sapiens HGTD-P (HGTD-P)
Homo sapiens mitochondrion, complete
sapiens ribosomal protein S15 (RPS15),
Homo sapiens HSPC010 mRNA, complete
sapiens ribosomal protein, large, P0
Homo sapiens cDNA FLJ14986 fis, clone
sapiens RanBP7/import
Homo sapiens, ribosomal protein L17,
Homo sapiens histone H2A.F/Z variant
sapiens ribosomal protein S20 (RPS20)
Homo sapiens MoDP-2, MoDP-3 mRNA
Homo sapiens, protein kinase C, zeta,
Homo sapiens, tissue inhibitor of
Homo sapiens, tubulin-specific chaperone
Homo sapiens, proteasome (prosome,
Homo sapiens, ribosomal protein L6, clone
sapiens ribosomal protein L18a (RPL18A),
sapiens ribosomal protein L12 (RPL12),
sapiens ribosomal protein L27 (RPL27),
sapiens ribosomal protein L12 (RPL12),
Homo sapiens, eukaryotic translation
Homo sapiens 15.5 kD RNA binding
Homo sapiens, glutathione peroxidase 2
sapiens ribosomal protein S18 (RPS18),
Homo sapiens, Similar to ribosomal
sapiens MAL2 proteolipid (MAL2)
Homo sapiens Amplified in Breast Cancer
sapiens ribosomal protein S14 (RPS14),
H. sapiens RNA for nm23-H2 gene
sapiens ribosomal protein S6 (RPS6),
Homo sapiens, ribosomal protein S3A,
Homo sapiens cDNA: FLJ21806 fis, clone
Homo sapiens galectin-4 mRNA, complete
sapiens ribosomal protein L3 (RPL3),
Homo sapiens Hsp89-alpha-delta-N
sapiens CAG-isl 7 mRNA, complete cds
H. sapiens mRNA translocon-associated
Homo sapiens cDNA FLJ30458 fis, clone
Homo sapiens 3′phosphoadenosine 5′-
Homo sapiens, ferritin, heavy polypeptide
Homo sapiens mitochondrion, complete
Homo sapiens, ribosomal protein S27a,
Homo sapiens, HSPC023 protein, clone
Homo sapiens, nucleophosmin (nucleolar
sapiens ribosomal protein L39 (RPL39),
sapiens ribosomal protein L6 (RPL6),
Homo sapiens hepatocellular carcinoma
Homo sapiens alpha gene sequence
Homo sapiens retinol dehydrogenase
Homo sapiens cDNA: FLJ22996 fis, clone
Homo sapiens GTP binding protein
Homo sapiens mRNA for immunoglobulin
sapiens mitochondrial DNA, complete
sapiens cap-binding protein mRNA,
Homo sapiens ribosomal protein L30
Homo sapiens cDNA FLJ31091 fis, clone
sapiens ribosomal protein L23 (RPL23),
sapiens ribosomal protein L13a (RPL13A),
Homo sapiens chaperonin-containing TCP-
sapiens ribosomal protein L10 (RPL10),
Homo sapiens, ribosomal protein L37a,
Homo sapiens, peptidylprolyl isomerase B
Homo sapiens mRNA full length insert
sapiens colon mucosa-associated (DRA)
Homo sapiens cDNA FLJ20161 fis, clone
Homo sapiens CD24 signal
Homo sapiens, prothymosin, alpha (gene
Homo sapiens, Similar to metallothionein
Homo sapiens genomic sequence
Homo sapiens, eukaryotic translation
Homo sapiens, lactate dehydrogenase A,
sapiens ribosomal protein S18 (RPS18),
sapiens human gamma-glutamyl hydrolase
Homo sapiens, Similar to tetraspan 1, clone
Homo sapiens cDNA FLJ32558 fis, clone
Homo sapiens, hemoglobin, beta, clone
Homo sapiens, Similar to immunoglobulin
Homo sapiens, diaphorase
sapiens laminin receptor 1 (67 kD,
Homo sapiens cDNA FLJ20002 fis, clone
H. sapiens mRNA for carcinoembryonic
sapiens metallothionein 1G (MT1G),
Homo sapiens, clone MGC: 16362
sapiens ribosomal protein L34 (RPL34),
Homo sapiens inorganic pyrophosphatase 1
Homo sapiens CDA09 mRNA, complete
Homo sapiens mRNA; cDNA
H. sapiens mRNA for prepro-alpha2(I)
Homo sapiens cDNA FLJ20328 fis, clone
Homo sapiens testicular acid phosphatase
Homo sapiens alpha NAC mRNA,
Homo sapiens, clone IMAGE: 3343539,
Homo sapiens, ribosomal protein L10a,
Homo sapiens, Similar to KIAA0102 gene
Homo sapiens mRNA for KIAA0873
Homo sapiens, myo-inositol 1-phosphate
Homo sapiens, clone IMAGE: 3343539,
sapiens ribosomal protein L11 (RPL11),
sapiens ribosomal protein L35 (RPL35),
Homo sapiens clone TCBAP0781 mRNA
H. sapiens mitochondrial genome
Homo sapiens, clone MGC: 5522
Homo sapiens, Similar to seven
Homo sapiens, ribosomal protein S11,
sapiens ribosomal protein S12 (RPS12),
sapiens ribosomal protein L26 (RPL26),
Homo sapiens, Similar to ATPase, Na+/K+
Homo sapiens, clone MGC: 1138
Homo sapiens 3-alpha hydroxysteroid
Homo sapiens, clone IMAGE: 4074053,
Homo sapiens Hsp89-alpha-delta-N
Homo sapiens mRNA; cDNA
Homo sapiens cDNA: FLJ21250 fis, clone
Homo sapiens mRNA fo
sapiens heat shock 90 kD protein 1, alpha
Homo sapiens mRNA; cDNA
Homo sapiens, tissue inhibitor of
sapiens acid phosphatase 1, soluble
Homo sapiens, Similar to creatine kinase,
sapiens dual specificity phosphatase 1
Homo sapiens alpha gene sequence
sapiens ribosomal protein S12 (RPS12),
sapiens ribosomal protein L6 (RPL6),
Homo sapiens, clone IMAGE: 3343539,
Homo sapiens, activating transcription
Homo sapiens, insulin-like growth factor
Homo sapiens clone FLB0708 mRNA
Homo sapiens, clone IMAGE: 4856273,
sapiens ribosomal protein S23 (RPS23),
H. sapiens mRNA for signal recognition
Homo sapiens, clone MGC: 20390
Homo sapiens nasopharyngeal carcinoma
Homo sapiens HSPC024 mRNA, complete
sapiens caspase 7, apoptosis-related
Homo sapiens mRNA for galectin-3,
Homo sapiens, small inducible cytokine
Drosophila bendless ge
cDNA probes were prepared from total RNA isolated from the patient cells described above. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.
Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.
Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red), and vice versa.
Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots, for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array.
Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues as described above and in Table 31. PCR products of from about 0.5 kb to 2.0 kb amplified from these sources were spotted onto the array using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about four duplicate measurements for each clone, two of one color and two of the other, for each sample.
The differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.
The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.
The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.
A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the tumor and normal sample. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).
Table 33 provides the results for gene products that were expressed by at least 2-fold or greater in the colon tumor samples relative to normal tissue samples in at least 20% of the patients tested, or gene products in which expression levels of the gene in colon tumor cells was less than or equal to ½ of the expression level in normal tissue samples in at least 20% of the patients tested. Table 33 includes: (1) the “SEQ ID NO” of the sequence tested; (2) the spot identification number (“Spot ID”); (3) the “Clone ID” assigned to the clone from which the sequence was isolated; (4) the “MACIone ID” assigned to the clone from which the sequence was isolated; (5) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 2-fold greater in cancerous tissue than in matched normal tissue (“>=2×”); (6) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 5-fold greater in cancerous tissue than in matched normal tissue (“>=5×”); (7) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was less than or equal to ½ of the expression level in matched normal cells (“<=half×”); and (8) the number of patients analyzed (“Num Ratios”).
Table 33 also includes the results from each patient, identified by the patient ID number (e.g., 10). This data represents the ratio of differential expression for the samples tested from that particular patient's tissues (e.g., “10” is the ratio from the tissue samples of Patient ID no. 10). The ratios of differential expression are expressed as a normalized hybridization signal associated with the tumor probe divided by the normalized hybridization signal with the normal probe. Thus, a ratio greater than 1 indicates that the gene product is increased in expression in cancerous cells relative to normal cells, while a ratio of less than 1 indicates the opposite.
These data provide evidence that the genes represented by the polynucleotides having the indicated sequences are differentially expressed in colon cancer as compared to normal non-cancerous colon tissue.
The expression of the differentially expressed genes represented by the polynucleotides in the cancerous cells can be analyzed using antisense knockout technology to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting a metastatic phenotype.
A number of different oligonucleotides complementary to the mRNA generated by the differentially expressed genes identified herein can be designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of the genes. Sets of antisense oligomers specific to each candidate target are designed using the sequences of the polynucleotides corresponding to a differentially expressed gene and the software program HYB simulator Version 4 (available for Windows 95/Windows NT or for Power Macintosh, RNAture, Inc. 1003 Health Sciences Road, West, Irvine, Calif. 92612 USA). Factors that are considered when designing antisense oligonucleotides include: 1) the secondary structure of oligonucleotides; 2) the secondary structure of the target gene; 3) the specificity with no or minimum cross-hybridization to other expressed genes; 4) stability; 5) length and 6) terminal GC content. The antisense oligonucleotide is designed so that it will hybridize to its target sequence under conditions of high stringency at physiological temperatures (e.g., an optimal temperature for the cells in culture to provide for hybridization in the cell, e.g., about 37° C.), but with minimal formation of homodimers.
Using the sets of oligomers and the HYB simulator program, three to ten antisense oligonucleotides and their reverse controls are designed and synthesized for each candidate mRNA transcript, which transcript is obtained from the gene corresponding to the target polynucleotide sequence of interest. Once synthesized and quantitated, the oligomers are screened for efficiency of a transcript knock-out in a panel of cancer cell lines. The efficiency of the knock-out is determined by analyzing mRNA levels using lightcycler quantification. The oligomers that resulted in the highest level of transcript knock-out, wherein the level was at least about 50%, preferably about 80-90%, up to 95% or more up to undetectable message, are selected for use in a cell-based proliferation assay, an anchorage independent growth assay, and an apoptosis assay.
The ability of each designed antisense oligonucleotide to inhibit gene expression is tested through transfection into SW620 colon carcinoma cells. For each transfection mixture, a carrier molecule (such as a lipid, lipid derivative, lipid-like molecule, cholesterol, cholesterol derivative, or cholesterol-like molecule) is prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide is then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide is further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, the carrier molecule, typically in the amount of about 1.5-2 nmol carrier/μg antisense oligonucleotide, is diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide is immediately added to the diluted carrier and mixed by pipetting up and down. Oligonucleotide is added to the cells to a final concentration of 30 nM.
The level of target mRNA that corresponds to a target gene of interest in the transfected cells is quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA are normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) is placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water is added to a total volume of 12.5 μl. To each tube is added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents are mixed by pipetting up and down, and the reaction mixture is incubated at 42° C. for 1 hour. The contents of each tube are centrifuged prior to amplification.
An amplification mixture is prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT is added, and amplification is carried out according to standard protocols. The results are expressed as the percent decrease in expression of the corresponding gene product relative to non-transfected cells, vehicle-only transfected (mock-transfected) cells, or cells transfected with reverse control oligonucleotides.
The effect of gene expression on the inhibition of cell proliferation can be assessed in metastatic breast cancer cell lines (MDA-MB-231 (“231”)); SW620 colon colorectal carcinoma cells; SKOV3 cells (a human ovarian carcinoma cell line); or LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells.
Cells are plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide is diluted to 2 μM in OptiMEM™. The oligonucleotide-OptiMEM™ can then be added to a delivery vehicle, which delivery vehicle can be selected so as to be optimized for the particular cell type to be used in the assay. The oligo/delivery vehicle mixture is then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments can be about 300 nM.
Antisense oligonucleotides are prepared as described above (see Example 51). Cells are transfected overnight at 37° C. and the transfection mixture is replaced with fresh medium the next morning. Transfection is carried out as described above in Example 51.
Those antisense oligonucleotides that result in inhibition of proliferation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit proliferation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of proliferation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit proliferation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.
The effect of gene expression on the inhibition of cell migration can be assessed in SW620 colon cancer cells using static endothelial cell binding assays, non-static endothelial cell binding assays, and transmigration assays.
For the static endothelial cell binding assay, antisense oligonucleotides are prepared as described above (see Example 51). Two days prior to use, colon cancer cells (CaP) are plated and transfected with antisense oligonucleotide as described above (see Examples 51 and 52). On the day before use, the medium is replaced with fresh medium, and on the day of use, the medium is replaced with fresh medium containing 2 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in DMEM/1% BSA/10 mM HEPES pH 7.0. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.
Endothelial cells (EC) are plated onto 96-well plates at 40-50% confluence 3 days prior to use. On the day of use, EC are washed 1× with PBS and 50λ DMDM/1% BSA/10 mM HEPES pH 7 is added to each well. To each well is then added 50K (50λ) CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. The plates are incubated for an additional 30 min and washed 5× with PBS containing Ca++ and Mg++. After the final wash, 100 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).
For the non-static endothelial cell binding assay, CaP are prepared as described above. EC are plated onto 24-well plates at 30-40% confluence 3 days prior to use. On the day of use, a subset of EC are treated with cytokine for 6 hours then washed 2× with PBS. To each well is then added 150-200K CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. Plates are placed on a rotating shaker (70 RPM) for 30 min and then washed 3× with PBS containing Ca++ and Mg++. After the final wash, 500 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).
For the transmigration assay, CaP are prepared as described above with the following changes. On the day of use, CaP medium is replaced with fresh medium containing 5 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in EGM-2-MV medium. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.
EC are plated onto FluorBlok transwells (BD Biosciences) at 30-40% confluence 5-7 days before use. Medium is replaced with fresh medium 3 days before use and on the day of use. To each transwell is then added 50K labeled CaP. 30 min prior to the first fluorescence reading, 10 μg of FITC-dextran (10K MW) is added to the EC plated filter. Fluorescence is then read at multiple time points on a fluorescent plate reader (Ab492/Em 516 nm).
Those antisense oligonucleotides that result in inhibition of binding of SW620 colon cancer cells to endothelial cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that result in inhibition of endothelial cell transmigration by SW620 colon cancer cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous colon cells.
The effect of gene expression upon colony formation of SW620 cells, SKOV3 cells, MD-MBA-231 cells, LNCaP cells, PC3 cells, 22Rv 1 cells, MDA-PCA-2b cells, and DU145 cells can be tested in a soft agar assay. Soft agar assays are conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer is formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells are counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for the soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo (produced as described in Example 51) is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies form in 10 days to 3 weeks. Fields of colonies are counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.
Those antisense oligonucleotides that result in inhibition of colony formation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit colony formation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of colony formation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit colony formation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.
In order to assess the effect of depletion of a target message upon cell death, SW620 cells, or other cells derived from a cancer of interest, can be transfected for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol is followed but cells are left in the presence of 2 drug. Each day, cytotoxicity is monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH is measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) is included; loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).
The gene products of sequences of a gene differentially expressed in cancerous cells can be further analyzed to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting or inhibiting development of a metastatic phenotype. For example, the function of gene products corresponding to genes identified herein can be assessed by blocking function of the gene products in the cell. For example, where the gene product is secreted or associated with a cell surface membrane, blocking antibodies can be generated and added to cells to examine the effect upon the cell phenotype in the context of, for example, the transformation of the cell to a cancerous, particularly a metastatic, phenotype. In order to generate antibodies, a clone corresponding to a selected gene product is selected, and a sequence that represents a partial or complete coding sequence is obtained. The resulting clone is expressed, the polypeptide produced isolated, and antibodies generated. The antibodies are then combined with cells and the effect upon tumorigenesis assessed.
Where the gene product of the differentially expressed genes identified herein exhibits sequence homology to a protein of known function (e.g., to a specific kinase or protease) and/or to a protein family of known function (e.g., contains a domain or other consensus sequence present in a protease family or in a kinase family), then the role of the gene product in tumorigenesis, as well as the activity of the gene product, can be examined using small molecules that inhibit or enhance function of the corresponding protein or protein family.
Additional functional assays include, but are not necessarily limited to, those that analyze the effect of expression of the corresponding gene upon cell cycle and cell migration. Methods for performing such assays are well known in the art.
The sequences of the polynucleotides provided in the present invention can be used to extend the sequence information of the gene to which the polynucleotides correspond (e.g., a gene, or mRNA encoded by the gene, having a sequence of the polynucleotide described herein). This expanded sequence information can in turn be used to further characterize the corresponding gene, which in turn provides additional information about the nature of the gene product (e.g., the normal function of the gene product). The additional information can serve to provide additional evidence of the gene product's use as a therapeutic target, and provide further guidance as to the types of agents that can modulate its activity.
In one example, a contig is assembled using a sequence of a polynucleotide of the present invention, which is present in a clone. A “contig” is a contiguous sequence of nucleotides that is assembled from nucleic acid sequences having overlapping (e.g., shared or substantially similar) sequence information. The sequences of publicly-available ESTs (Expressed Sequence Tags) and the sequences of various clones from several cDNA libraries synthesized at Chiron can be used in the contig assembly.
The contig is assembled using the software program Sequencher, version 4.05, according to the manufacturer's instructions and an overview alignment of the contiged sequences is produced. The sequence information obtained in the contig assembly can then be used to obtain a consensus sequence derived from the contig using the Sequencher program. The consensus sequence is used as a query sequence in a TeraBLASTN search of the DGTI DoubleTwist Gene Index (DoubleTwist, Inc., Oakland, Calif.), which contains all the EST and non-redundant sequence in public databases.
Through contig assembly and the use of homology searching software programs, the sequence information provided herein can be readily extended to confirm, or confirm a predicted, gene having the sequence of the polynucleotides described in the present invention. Further the information obtained can be used to identify the function of the gene product of the gene corresponding to the polynucleotides described herein. While not necessary to the practice of the invention, identification of the function of the corresponding gene, can provide guidance in the design of therapeutics that target the gene to modulate its activity and modulate the cancerous phenotype (e.g., inhibit metastasis, proliferation, and the like).
The biological materials used in the experiments that led to the present invention are described below.
Source of Patient Tissue Samples
Normal and cancerous tissues were collected from patients using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al. (1998) Trends Genet. 14:272-6; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:998-1001). Table 34 provides information about each patient from which colon tissue samples were isolated, including: the Patient ID (“PT ID”) and Path ReportID (“Path ID”), which are numbers assigned to the patient and the pathology reports for identification purposes; the group (“Grp”) to which the patients have been assigned; the anatomical location of the tumor (“Anatom Loc”); the primary tumor size (“Size”); the primary tumor grade (“Grade”); the identification of the histopathological grade (“Histo Grade”); a description of local sites to which the tumor had invaded (“Local Invasion”); the presence of lymph node metastases (“Lymph Met”); the incidence of lymph node metastases (provided as a number of lymph nodes positive for metastasis over the number of lymph nodes examined) (“Lymph Met Incid”); the regional lymphnode grade (“Reg Lymph Grade”); the identification or detection of metastases to sites distant to the tumor and their location (“Dist Met & Loc”); the grade of distant metastasis (“Dist Met Grade”); and general comments about the patient or the tumor (“Comments”). Histopathology of all primary tumors indicated the tumor was adenocarcinoma except for Patient ID Nos. 130 (for which no information was provided), 392 (in which greater than 50% of the cells were mucinous carcinoma), and 784 (adenosquamous carcinoma). Extranodal extensions were described in three patients, Patient ID Nos. 784, 789, and 791. Lymphovascular invasion was described in Patient ID Nos. 128, 228, 278, 517, 534, 784, 786, 789, 791, 890, and 892. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.
Two overlapping groups of patients described in Table 34 were studied. The first group contained 33 members whereas the second group contained 22 members. In the case of the first group of patients, gene product expression profiles of tissue samples from metastasized tumors were compared to gene product expression profiles of an “unmatched” sample, where the unmatched sample is a pool of samples of normal colon from the sample patients. For the second group of patients, gene product expression profiles of tissue samples from metastasized tumors were compared to gene product expression profiles of a “matched” sample, where the matched sample is matched to a single sample within a patient. As such, a metastasized colon tumor sample is “matched” with a normal colon sample or a primary colon tumor from the same patient. Metastases of colon cancers may appear in any tissue, including bone, breast, lung, liver, brain, kidney skin, intestine, appendix, etc. In many patients, the colon cancer had metastasized to liver.
Source of Polynucleotides on Arrays
Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. Table 35 provides information about the polynucleotides on the arrays including: (1) the “SEQ ID NO” assigned to each sequence for use in the present specification; (2) the spot identification number (“Spot ID”), an internal reference that serves as a unique identifier for the spot on the array; (3) the “Clone ID” assigned to the clone from which the sequence was isolated; and (4) the “MAClone ID” assigned to the clone from which the sequence was isolated. The sequences corresponding to the SEQ ID NOS are provided in the Sequence Listing.
Characterization of Sequences
The sequences of the isolated polynucleotides were first masked to eliminate low complexity sequences using the RepeatMasker masking program, publicly available through a web site supported by the University of Washington (See also Smit, A. F. A. and Green, P., unpublished results). Generally, masking does not influence the final search results, except to eliminate sequences of relatively little interest due to their low complexity, and to eliminate multiple “hits” based on similarity to repetitive regions common to multiple sequences, e.g., Alu repeats. Masking resulted in the elimination of several sequences.
The remaining sequences of the isolated polynucleotides were used in a homology search of the GenBank database using the TeraBLAST program (TimeLogic, Crystal Bay, Nev.), a DNA and protein sequence homology searching algorithm. TeraBLAST is a version of the publicly available BLAST search algorithm developed by the National Center for Biotechnology, modified to operate at an accelerated speed with increased sensitivity on a specialized computer hardware platform. The program was run with the default parameters recommended by TimeLogic to provide the best sensitivity and speed for searching DNA and protein sequences. Gene assignment for the query sequences was determined based on best hit from the GenBank database; expectancy values are provided with the hit.
Summary of TeraBLAST Search Results
Table 36 provides information about the gene corresponding to each polynucleotide. Table 36 includes: (1) the “SEQ ID NO” of the sequence; (2) the “Clone ID” assigned to the clone from which the sequence was isolated; (3) the “MAClone ID” assigned to the clone from which the sequence was isolated; (4) the library source of the clone (“PatientType”); (5) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GBHit”); (6) a description of the GenBank sequence (“GBDescription”); and (7) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GBScore”). The published information for each GenBank and EST description, as well as the corresponding sequence identified by the provided accession number, are incorporated herein by reference.
cDNA probes were prepared from total RNA isolated from the patient samples described above. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.
Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.
Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from a normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red), and vice versa.
Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots, for a total of about 9,216 spots on each array. The two areas are spotted identically which provides for at least two duplicates of each clone per array.
Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues as described above and in Table 35. PCR products of from about 0.5 kb to 2.0 kb amplified from these sources were spotted onto the array using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about four duplicate measurements for each clone, two of one color and two of the other, for each sample.
The differential expression assay was performed by mixing equal amounts of probes from matched or unmatched samples. The arrays were pre-incubated for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.
The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.
The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level of fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.
A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the matched or unmatched samples. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).
Table 37 provides the results for gene products that were over- or under-expressed as determined by comparison of matched or unmatched pairs of samples isolated from the two patient groups described above. The results show data from three separate experiments using the same set of gene products, each identified by SEQ ID NO. The three experiments are: 1) a comparison of the gene expression profile of metastasized colon tumor tissue compared to unmatched normal colon tissue (“unmatched metastasis/normal”); 2) a comparison of the gene expression profile of metastasized colon tumor tissue compared to normal colon tissue from the same patient (“matched metastasis/normal”); and 3) a comparison of the gene expression profile of metastasized colon tumor tissue compared to primary tumor tissue from the same patient (“matched metastasis/tumor”). If samples are matched, they are both samples from a single patient. If samples are unmatched, one sample is obtained from a patient, and compared to pooled samples from many patients.
The results in Table 37 show the sequences that are induced by at least 2-fold or greater in the metastasized colon tumor samples relative to normal or primary tumor tissue samples in at least 20% of the patients tested, or gene products in which expression levels of the gene in metastasized colon tumor cells was less than or equal to ½ of the expression level in normal or primary tissue samples in at least 20% of the patients tested. Table 37 Table 35 includes: (1) the “SEQ ID NO” of the sequence tested; (2) the “Clone ID” assigned to the clone from which the sequence was isolated; and (3) the “MAClone ID” assigned to the clone from which the sequence was isolated; (4) the percentage of patients tested in which expression levels (e.g., as message level) of a particular sequence was at least 2-fold greater in metastasized colon cancer tissue than in unmatched or matched colon tissue (“>=2×”); (5) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was less than or equal to ½ of the expression level in matched or unmatched colon tissue (“<=half×”); and (6) the number of patients analyzed in each experiment (“Ratios”).
These data provide evidence that the genes represented by the polynucleotides having the indicated sequences are differentially expressed in colon cancer, particularly metastasized colon cancer, as compared to colon cancer primary tumors or normal non-cancerous colon tissue.
The expression of the differentially expressed genes represented by the polynucleotides in the cancerous cells can be analyzed using antisense knockout technology to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting a metastatic phenotype.
A number of different oligonucleotides complementary to the mRNA generated by the differentially expressed genes identified herein can be designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of the genes. Sets of antisense oligomers specific to each candidate target are designed using the sequences of the polynucleotides corresponding to a differentially expressed gene and the software program HYB simulator Version 4 (available for Windows 95/Windows NT or for Power Macintosh, RNAture, Inc. 1003 Health Sciences Road, West, Irvine, Calif. 92612 USA). Factors that are considered when designing antisense oligonucleotides include: 1) the secondary structure of oligonucleotides; 2) the secondary structure of the target gene; 3) the specificity with no or minimum cross-hybridization to other expressed genes; 4) stability; 5) length and 6) terminal GC content. The antisense oligonucleotide is designed so that it will hybridize to its target sequence under conditions of high stringency at physiological temperatures (e.g., an optimal temperature for the cells in culture to provide for hybridization in the cell, e.g., about 37° C.), but with minimal formation of homodimers.
Using the sets of oligomers and the HYB simulator program, three to ten antisense oligonucleotides and their reverse controls are designed and synthesized for each candidate mRNA transcript, which transcript is obtained from the gene corresponding to the target polynucleotide sequence of interest. Once synthesized and quantitated, the oligomers are screened for efficiency of a transcript knock-out in a panel of cancer cell lines. The efficiency of the knock-out is determined by analyzing mRNA levels using lightcycler quantification. The oligomers that resulted in the highest level of transcript knock-out, wherein the level was at least about 50%, preferably about 80-90%, up to 95% or more up to undetectable message, are selected for use in a cell-based proliferation assay, an anchorage independent growth assay, and an apoptosis assay.
The ability of each designed antisense oligonucleotide to inhibit gene expression is tested through transfection into SW620 colon carcinoma cells. For each transfection mixture, a carrier molecule (such as a lipid, lipid derivative, lipid-like molecule, cholesterol, cholesterol derivative, or cholesterol-like molecule) is prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide is then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide is further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, the carrier molecule, typically in the amount of about 1.5-2 nmol carrier/μg antisense oligonucleotide, is diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide is immediately added to the diluted carrier and mixed by pipetting up and down. Oligonucleotide is added to the cells to a final concentration of 30 nM.
The level of target mRNA that corresponds to a target gene of interest in the transfected cells is quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA are normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) is placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water is added to a total volume of 12.5 μl. To each tube is added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents are mixed by pipetting up and down, and the reaction mixture is incubated at 42° C. for 1 hour. The contents of each tube are centrifuged prior to amplification.
An amplification mixture is prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT is added, and amplification is carried out according to standard protocols. The results are expressed as the percent decrease in expression of the corresponding gene product relative to non-transfected cells, vehicle-only transfected (mock-transfected) cells, or cells transfected with reverse control oligonucleotides.
The effect of gene expression on the inhibition of cell proliferation can be assessed in, for example, metastatic breast cancer cell lines (MDA-MB-231 (“231”)); SW620 colon colorectal carcinoma cells; SKOV3 cells (a human ovarian carcinoma cell line); or LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells.
Cells are plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide is diluted to 2 μM in OptiMEM™. The oligonucleotide-OptiMEM™ can then be added to a delivery vehicle, which delivery vehicle can be selected so as to be optimized for the particular cell type to be used in the assay. The oligo/delivery vehicle mixture is then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments can be about 300 nM.
Antisense oligonucleotides are prepared as described above (see Example 60). Cells are transfected overnight at 37° C. and the transfection mixture is replaced with fresh medium the next morning. Transfection is carried out as described above in Example 60.
Those antisense oligonucleotides inhibit proliferation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit proliferation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of proliferation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit proliferation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.
The effect of gene expression on the inhibition of cell migration can be assessed in SW620 colon cancer cells using static endothelial cell binding assays, non-static endothelial cell binding assays, and transmigration assays.
For the static endothelial cell binding assay, antisense oligonucleotides are prepared as described above (see Example 60). Two days prior to use, colon cancer cells (CaP) are plated and transfected with antisense oligonucleotide as described above (see Examples 60 and 61). On the day before use, the medium is replaced with fresh medium, and on the day of use, the medium is replaced with fresh medium containing 2 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in DMEM/1% BSA/10 mM HEPES pH 7.0. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.
Endothelial cells (EC) are plated onto 96-well plates at 40-50% confluence 3 days prior to use. On the day of use, EC are washed 1× with PBS and 50λ DMDM/1% BSA/10 mM HEPES pH 7 is added to each well. To each well is then added 50K (50) CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. The plates are incubated for an additional 30 min and washed 5× with PBS containing Ca++ and Mg++. After the final wash, 100 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).
For the non-static endothelial cell binding assay, CaP are prepared as described above. EC are plated onto 24-well plates at 30-40% confluence 3 days prior to use. On the day of use, a subset of EC are treated with cytokine for 6 hours then washed 2× with PBS. To each well is then added 150-200K CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. Plates are placed on a rotating shaker (70 RPM) for 30 min and then washed 3× with PBS containing Ca++ and Mg++. After the final wash, 500 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).
For the transmigration assay, CaP are prepared as described above with the following changes. On the day of use, CaP medium is replaced with fresh medium containing 5 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in EGM-2-MV medium. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.
EC are plated onto FluorBlok transwells (BD Biosciences) at 30-40% confluence 5-7 days before use. Medium is replaced with fresh medium 3 days before use and on the day of use. To each transwell is then added 50K labeled CaP. 30 min prior to the first fluorescence reading, 10 μg of FITC-dextran (10K MW) is added to the EC plated filter. Fluorescence is then read at multiple time points on a fluorescent plate reader (Ab492/Em 516 nm).
Those antisense oligonucleotides that result in inhibition of binding of SW620 colon cancer cells to endothelial cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that result in inhibition of endothelial cell transmigration by SW620 colon cancer cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous colon cells.
The effect of gene expression upon colony formation of SW620 cells, SKOV3 cells, MD-MBA-231 cells, LNCaP cells, PC3 cells, 22Rv1 cells, MDA-PCA-2b cells, and DU145 cells can be tested in a soft agar assay. Soft agar assays are conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer is formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells are counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for the soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo (produced as described in Example 60) is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies form in 10 days to 3 weeks. Fields of colonies are counted by eye. WST-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.
Those antisense oligonucleotides that result in inhibition of colony formation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit colony formation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of colony formation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit colony formation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.
In order to assess the effect of depletion of a target message upon cell death, SW620 cells, or other cells derived from a cancer of interest, can be transfected for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol is followed but cells are left in the presence of 2 μM drug. Each day, cytotoxicity is monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH is measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) is included; loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).
In order to assess the effect of depletion of a target message upon colon cancer metastasis and the growth of metastasized colon cancer cells in vivo, a mouse model is utilized. Mouse models for cancer metastasis are well known in the art (e.g. Hubbard et al Dis Colon Rectum. 2002 45:334-41; Rashidi et al Clin Cancer Res. 2000 6:2556-61; Rashidi et al Anticancer Res. 2000 20:715-22; Rho et al Anticancer Res. 1999 19:157-61; Hasegawa et al, Int J Cancer 1998 76:812-6; and Warren et al J Clin Invest. 1995 95:1789-97.
In one model, before, at the same time as, or sometime after the intravenous or intraperitoneal administration of cancer cells to a model mouse, antisense molecules of Example 60 or other inhibitory molecules are administered to the model mouse. Cancer progression, including establishment and growth of tumors derived from the administered cells and longevity of mice, are monitored.
The gene products of sequences of a gene differentially expressed in cancerous cells can be further analyzed to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting or inhibiting development of a metastatic phenotype. For example, the function of gene products corresponding to genes identified herein can be assessed by blocking function of the gene products in the cell. For example, where the gene product is secreted or associated with a cell surface membrane, blocking antibodies can be generated and added to cells to examine the effect upon the cell phenotype in the context of, for example, the transformation of the cell to a cancerous, particularly a metastatic, phenotype. In order to generate antibodies, a clone corresponding to a selected gene product is selected, and a sequence that represents a partial or complete coding sequence is obtained. The resulting clone is expressed, the polypeptide produced isolated, and antibodies generated. The antibodies are then combined with cells and the effect upon tumorigenesis assessed.
Where the gene product of the differentially expressed genes identified herein exhibits sequence homology to a protein of known function (e.g., to a specific kinase or protease) and/or to a protein family of known function (e.g., contains a domain or other consensus sequence present in a protease family or in a kinase family), then the role of the gene product in tumorigenesis, as well as the activity of the gene product, can be examined using small molecules that inhibit or enhance function of the corresponding protein or protein family.
Additional functional assays include, but are not necessarily limited to, those that analyze the effect of expression of the corresponding gene upon cell cycle and cell migration. Methods for performing such assays are well known in the art.
The sequences of the polynucleotides provided in the present invention can be used to extend the sequence information of the gene to which the polynucleotides correspond (e.g., a gene, or mRNA encoded by the gene, having a sequence of the polynucleotide described herein). This expanded sequence information can in turn be used to further characterize the corresponding gene, which in turn provides additional information about the nature of the gene product (e.g., the normal function of the gene product). The additional information can serve to provide additional evidence of the gene product's use as a therapeutic target, and provide further guidance as to the types of agents that can modulate its activity.
In one example, a contig is assembled using a sequence of a polynucleotide of the present invention, which is present in a clone. A “contig” is a contiguous sequence of nucleotides that is assembled from nucleic acid sequences having overlapping (e.g., shared or substantially similar) sequence information. The sequences of publicly-available ESTs (Expressed Sequence Tags) and the sequences of various clones from several cDNA libraries synthesized at Chiron can be used in the contig assembly.
The contig is assembled using the software program Sequencher, version 4.05, according to the manufacturer's instructions and an overview alignment of the contiged sequences is produced. The sequence information obtained in the contig assembly can then be used to obtain a consensus sequence derived from the contig using the Sequencher program. The consensus sequence is used as a query sequence in a TeraBLASTN search of the DGTI DoubleTwist Gene Index (DoubleTwist, Inc., Oakland, Calif.), which contains all the EST and non-redundant sequence in public databases.
Through contig assembly and the use of homology searching software programs, the sequence information provided herein can be readily extended to confirm, or confirm a predicted, gene having the sequence of the polynucleotides described in the present invention. Further the information obtained can be used to identify the function of the gene product of the gene corresponding to the polynucleotides described herein. While not necessary to the practice of the invention, identification of the function of the corresponding gene, can provide guidance in the design of therapeutics that target the gene to modulate its activity and modulate the cancerous phenotype (e.g., inhibit metastasis, proliferation, and the like).
While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.
This application is a divisional of U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 now U.S. Pat. No. 7,700,359, filed Sep. 22, 2004, which is continuation-in-part of and claims priority to U.S. application Ser. No. 10/616,900, filed on Jul. 9, 2003, which is a continuation of U.S. application Ser. No. 09/872,850, filed on Jun. 1, 2001, now abandoned, which claims the benefit of U.S. provisional application Ser. No. 60/208,871, filed on Jun. 2, 2000. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is a continuation-in-part of and claims priority to U.S. application Ser. No. 10/081,519, filed on Feb. 21, 2002, now abandoned, which claims the benefit of U.S. provisional application Ser. No. 60/270,959, filed on Feb. 21, 2001. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is also a continuation-in-part of and claims priority to U.S. application Ser. No. 10/310,673, filed on Dec. 4, 2002, now abandoned, which claims the benefit of U.S. provisional application Ser. No. 60/336,613, filed on Dec. 4, 2001. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is also a continuation-in-part of and claims priority to U.S. application Ser. No. 10/501,187, filed as a National stage of international application No. PCT/US2003/000657, filed on Jan. 8, 2003, which claims the benefit of U.S. provisional application Ser. No. 60/345,637, filed on Jan. 8, 2002. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is also a continuation-in-part of and claims priority to U.S. application Ser. No. 10/081,124, filed on Feb. 21, 2002, now abandoned, which claims the benefit of U.S. provisional application Ser. No. 60/270,855, filed on Feb. 21, 2001. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is also a continuation-in-part of and claims priority to application PCT/US2004/015421, filed on May 13, 2004, which claims the benefit of U.S. provisional application Ser. No. 60/475,872, filed on Jun. 3, 2003. The contents of each of the preceding applications is incorporated by reference in its entirety.
| Number | Date | Country | |
|---|---|---|---|
| 60208871 | Jun 2000 | US | |
| 60270959 | Feb 2001 | US | |
| 60336613 | Dec 2001 | US | |
| 60345637 | Jan 2002 | US | |
| 60270855 | Feb 2001 | US | |
| 60475872 | Jun 2003 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 12725341 | Mar 2010 | US |
| Child | 13491434 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10948737 | Sep 2004 | US |
| Child | 12725341 | US | |
| Parent | 09872850 | Jun 2001 | US |
| Child | 10616900 | US | |
| Parent | 10948737 | Sep 2004 | US |
| Child | 12725341 | US | |
| Parent | 10948737 | Sep 2004 | US |
| Child | 12725341 | US | |
| Parent | 10948737 | Sep 2004 | US |
| Child | 12725341 | US | |
| Parent | 10948737 | Sep 2004 | US |
| Child | 12725341 | US | |
| Parent | 10948737 | Sep 2004 | US |
| Child | 12725341 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10616900 | Jul 2003 | US |
| Child | 10948737 | US | |
| Parent | 10081519 | Feb 2002 | US |
| Child | 10948737 | US | |
| Parent | 10310673 | Dec 2002 | US |
| Child | 10948737 | US | |
| Parent | 10501187 | Jan 2006 | US |
| Child | 10948737 | US | |
| Parent | 10081124 | Feb 2002 | US |
| Child | 10948737 | US | |
| Parent | PCT/US04/15421 | May 2004 | US |
| Child | 10948737 | US |
