Patent Application
20240218333
The text of the computer readable sequence listing filed herewith, titled “CCF_41219_202_SequenceListing.xml”, created on Mar. 21, 2024, having a file size of 6,546 bytes, is hereby incorporated by reference in its entirety.
Provided herein are compositions, systems, kits, and methods for generating hPSC derived quiescent hepatic stellate cells (HSCs) and employing them in a liver model. In certain embodiments, methods and compositions are provided for maintaining the quiescent HSCs in a quiescent state for a time period.
Nonalcoholic fatty liver disease (NAFLD), the most common form of chronic liver disease, encompasses a spectrum from steatosis to hepatocellular carcinoma (HCC) [1]. Disease progression is variable given the complex interplay between behavioral and genetic risk factors [1-3]. As such, the association of many single nucleotide polymorphisms (SNPs) with NAFLD arise in combination with metabolic insults. Strong hits include variants related to metabolic function like: lipid remodelling factor patatin-like phospholipase-domain containing protein 3 (PNPLA3) (rs738409 C>G) [4] and lipid droplet protein hydroxysteroid 17-beta dehydrogenase 13 (HSD17B13) (rs72613567 T>A) [5]. However, establishing mechanistic links between genetic variants and NAFLD requires human-relevant systems that recapitulate disease progression, are amenable to genetic manipulation and can respond to metabolic insults [6, 7].
The nonsynonymous rs738409 C>G SNP in PNPLA3 is strongly associated across the spectrum of NAFLD and accounts for the largest fraction of genetic predisposition to disease [4, 8]. PNPLA3 serves two roles in lipid metabolism as a triacylglycerol lipase in hepatocytes and a retinyl esterase in hepatic stellate cells (HSCs) [1, 9]. The isoleucine-to-methionine substitution at residue 148 (I148M) with rs738409 reduces enzymatic activity [10], suggesting that decreased lipid metabolism may promote NAFLD. However, Pnpla3-knockout mice do not develop hepatic steatosis whereas expressing the I148M mutant decreases hepatocyte triglyceride hydrolysis and increases de novo lipogenesis [11]. These conflicting results could be due to the partial identity or differential expression patterns of human and mouse PNPLA3 [11]. Thus, a human-relevant system is essential to understand how rs738409 contributes to NAFLD.
Provided herein are compositions, systems, kits, and methods for generating hPSC derived quiescent hepatic stellate cells (HSCs) and employing them in a liver model. In certain embodiments, methods and compositions are provided for maintaining the quiescent HSCs in a quiescent state for a time period.
In some embodiments, provided herein are methods of maintaining quiescence in quiescent hepatic stellate cells (HSCs) comprising: culturing quiescent HSCs in culture media for a time period such that the quiescent HSCs remain quiescent for the time period, wherein the time period is at least one day, and wherein the culture media comprises at least one of the following: fibroblast growth factor 1 (FGF1), fibroblast growth factor 2 (FGF2), and retinol.
In particular embodiments, the culture media comprises all three of FGF1, FGF2, and retinol. In other embodiments, the culture media further comprises epidermal growth factor (EGF) and/or lipids, wherein the EGF is optionally present in the culture media at a concentration of 5-120 ng/ml or 25-35 ng/ml, and optionally, wherein the lipids comprise a mixture of at least three of the following: arachidonic acid, linoleic acid, linolenic acid, myristic acid, oleic acid, palmitic acid stearic acid, cholesterol, Tween-80, tocopherol acetate and Pluronic F-68 (and optionally when said lipids make up about 0.5-4% of the culture media). In further embodiments, the time period is at least 2 days, or at least 7 days, or at least 14 days or at least 28 days, or at least 2 months. In further embodiments, the culture media comprises the FGF1, and wherein the FGF1 is present in the culture media at a concentration of about 1-80 ng/ml or 3-25 ng/ml. In other embodiments, the culture media comprises the FGF2 and wherein the FGF2 is present in the culture media at a concentration of about 2-40 ng/ml or 7-13 ng/ml. In additional embodiments, the culture media comprises the retinol and wherein the retinol is present in the culture media at a concentration of about 1-20 uM or about 3-7 uM.
In some embodiments, provided herein are composition, kits, and system comprising: a) quiescent hepatic stellate cells (HSCs) (e.g., derived from hPSCs, as described herein), and b) culture medium comprising at least one of the following: fibroblast growth factor 1 (FGF1), fibroblast growth factor 2 (FGF2), and retinol. In further embodiments, the culture media comprises all three of FGF1, FGF2, and retinol. In other embodiments, the culture media further comprises epidermal growth factor (EGF) and/or lipids, wherein the EGF is optionally present in the culture media at a concentration of 5-120 ng/ml or 25-35 ng/ml, and optionally, wherein the lipids comprise a mixture of at least three of the following: arachidonic acid, linoleic acid, linolenic acid, myristic acid, oleic acid, palmitic acid stearic acid, cholesterol, Tween-80, tocopherol acetate and Pluronic F-68 (and optionally when said lipids make up about 0.5-4% of the culture media). In further embodiments, the culture media comprises the FGF1, and wherein the FGF1 is present in the culture media at a concentration of about 1-80 ng/ml or 3-25 ng/ml. In particular embodiments, the culture media comprises the FGF2 and wherein the FGF2 is present in the culture media at a concentration of about 2-40 ng/ml or 7-13 ng/ml. In some embodiments, the culture media comprises the retinol and wherein the retinol is present in the culture media at a concentration of about 1-20 uM or about 3-7 uM.
In particular embodiments, provide herein are methods comprising: a) adding a single-cell suspension of human pluripotent stem cells (hPSCs) to a cell culture container containing a first cell-culture media, wherein the first cell-culture media optionally contains a p160ROCK inhibitor, wherein the p160ROCK inhibitor optionally comprises Y-27632; b) incubating at least a portion of the hPSCs such that at least about 10% confluence of the hPSCs is achieved; c) treating at least a portion of the hPSCs with: i) a second cell-culture media comprising at least one of the following: biotin, vitamin B12, and PABA, wherein the second cell-culture media optionally comprising RPMI 1640, ii) a first media supplement comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 reagents from Table 1, and optionally wherein the first media supplement comprises B-27 media supplement without insulin, iii) optionally a second media supplement comprising L-alanyl-L-glutamine dipeptide, and wherein optionally the second media supplement comprises GlutaMax, iv) optionally a third media supplement comprising non-essential amino acids; v) optionally an inhibitor of the GSK-3 enzyme, wherein the inhibitor optionally comprises CHIR99021; d) treating at least a portion of the hPSCs with either: i) the second cell-culture media, the first media supplement, and BMP4, and/or ii) Mesoderm Induction Medium; and e) incubating at least a portion of the hPSCs such that mesoderm cells are generated.
In further embodiments, the methods further comprise: f) treating at least a portion of the mesoderm cells with: the second cell-culture media, the first media, BMP4, FGF1, insulin, transferrin, and selenite, and optionally ascorbic acid and/or dexamethasone; and g) culturing at least a portion of the mesoderm cells such that mesodermal progenitor cells are generated. In other embodiments, the methods further comprise: h) treating at least a portion of the mesodermal progenitor cells with: the second cell-culture media, the first media, insulin, transferrin, selenite, lipids, and FGF2, and optionally ascorbic acid, dexamethasone, and/or EGF, and i) culturing at least a portion of the mesodermal progenitor cells such that quiescent hepatic stellate cells (HSCs) are generated.
In particular embodiments, the lipids are selected from one or more of the following: arachidonic acid, linoleic acid, linolenic acid, myristic acid, oleic acid, palmitic acid, stearic acid, cholesterol, Tween-80, tocopherol acetate, Pluronic F-68 solubilized in cell culture water.
In some embodiments, provide herein are methods comprising: a) adding hPSC-derived hepatocytes (HEPs), hPSC-derived macrophages (Macs) and hPSC-derived hepatic stellate cells (HSCs) to a transwell container containing a first cell-culture media, wherein the Macs are added such that they are in a first compartment of the transwell container, and the HEPs and HSCs are added such that they are in a second compartment, wherein the first and second compartments are configured to allow secreted factors to diffuse between the first and second compartments; b) incubating the transwell container such that cell clusters are generated, wherein in each cell cluster comprises a plurality of HSCs surrounded by a larger plurality of HEPs, c) adding a second cell culture media to the first and second compartments of the transwell container, wherein the second culture media comprises basal maintenance media (BMM), and wherein optionally the BMM comprises Dulbecco's Modified Eagle Medium supplemented with knockout serum replacement (KOSR), B-27 supplement, heparin, transferrin, EGF, retinol, and dexamethasone; d) incubating the transwell container; e) supplementing the BMM with high levels of insulin, glucose, and free fatty acids which are optionally oleic acid and palmitic acid, to mimic lipotoxic liver conditions, optionally wherein the lipotoxic conditions are similar to plasma levels in NAFLD patients. In other embodiments, the methods further comprise: f) adding a candidate agent to the second transwell container, and incubating the transwell container. In additional embodiments, the methods further comprise: g) isolating the HSCs, the HEPs, and/or the Macs, and running as assay with such isolated cells to determine the impact of the candidate agent on such isolated cells.
In some embodiments, the lipids are selected from: at least one, two, three, or all of the following: non-animal derived fatty acids (e.g., 2 ug/ml, or 1-5 ug/ml, arachidonic and 10 ug/ml, or 5-20 ug/ml, each linoleic, linolenic, myristic, oleic, palmitic and stearic), about 0.22, or 0.1-0.8, mg/ml cholesterol, such as from New Zealand sheep's wool, about 2.2 mg/ml, or 1.0-5.0 mg/ml, Tween-80, about 70 ug/ml, or 30-100 ug/ml, tocopherol acetate and about 100 mg/ml, or 50-150 mg/ml, Pluronic F-68 solubilized in cell culture water). In certain embodiments, the lipids are selected from one or more of the following: non-animal derived fatty acids: arachidonic, linoleic, linolenic, myristic, oleic, palmitic and stearic acid, cholesterol, Tween-80, tocopherol acetate, Pluronic F-68 solubilized in cell culture water.
Provided herein are compositions, systems, kits, and methods for generating hPSC derived quiescent hepatic stellate cells (HSCs) and employing them in a liver model. In certain embodiments, methods and compositions are provided for maintaining the quiescent HSCs in a quiescent state for a time period.
A number of genetic polymorphisms have been associated with susceptibility to or protection against nonalcoholic fatty liver disease (NAFLD), but the underlying mechanisms remain unknown. Here, we focused on the rs738409 C>G single nucleotide polymorphism (SNP), which produces the I148M variant of patatin-like phospholipase domain-containing protein 3 (PNPLA3) and is strongly associated with NAFLD.
To enable mechanistic dissection, we developed a human pluripotent stem cells (hPSC)-derived multicellular liver culture by incorporating hPSC-derived hepatocytes, hepatic stellate cells, and macrophages. We first adopted this liver culture to model NAFLD by utilizing a lipotoxic milieu reflecting the circulating levels of disease risk factors in patients. We then created an isogenic pair of liver cultures differing only at rs738049 and compared NAFLD phenotypes development.
Our hPSC-derived liver culture recapitulated many key characteristics of NAFLD development and progression including lipid accumulation and oxidative stress, inflammatory response, and stellate cell activation. Under the lipotoxic conditions, the I148M variant caused the enhanced development of NAFLD phenotypes. These differences were associated with elevated IL6/STAT3 activity in liver cultures, consistent with transcriptomic data of liver biopsies from patients carrying the rs738409 SNP. Dampening IL6/STAT3 activity alleviated the I148M-mediated susceptibility to NAFLD, while boosting it in wild-type liver cultures enhanced NAFLD development. Finally, we attributed this elevated IL6/STAT3 activity in liver cultures carrying the rs738409 SNP to increased NF-kB activity. Our study thus reveals a potential causal link between elevated IL6/STAT3 activity and 148M-mediated susceptibility to NAFLD.
In certain embodiments, the media employed herein comprises at least 5 . . . 10 . . . 15 . . . or all 20 of the reagents below in Table 1.
PNPLA3 I148M genetic variant increases the risk of NAFLD development and progression. To explore the underlying mechanism, we developed a hPSC-derived liver culture to study NAFLD by utilizing disease risk factors derived from patients. In liver cultures containing the variant, we observed that I148M variant increased the risk of NAFLD by elevating IL6/STAT3 signaling, which agreed with analysis of patient liver biopsies. Our findings demonstrate a potential causal link between elevated IL6/STAT3 activity and I148M variant-mediated risk of NALFD. Further, our liver culture is a useful platform for exploring genetic variants in NAFLD development.
Here, we developed a multicellular liver culture system that utilizes human pluripotent stem cell (hPSC)-derived hepatocytes, HSCs, and macrophages, three cell types involved in NAFLD. Under conditions reflecting NAFLD-associated metabolic dysfunction [6, 7], this system recapitulates disease phenotypes. After generating an isogenic hPSC pair expressing rs738409, we found a pivotal role for the signal transducer and activator of transcription 3 (STAT3) and interleukin 6 (IL6) pathway in PNPLA3-mediated NAFLD susceptibility.
Generation of a hPSC-Derived Multicellular Liver Culture
To establish an in vitro human-relevant hepatic system that recapitulates liver complexity, we co-cultured hPSC-derived hepatocytes, HSCs, and liver-resident macrophages (Kupffer cells). However, few methods robustly produce quiescent HSCs [12], whose activation into a proliferative fibrogenic state is critical in NAFLD progression [1].
Thus, we developed a differentiation protocol for quiescent hPSC-derived HSCs (hPSC-HSCs) using fibroblast growth factor 1 (FGF1) and FGF2, epidermal growth factor (EGF), retinol and lipids, which are important for HSC quiescence (
Another hallmark of quiescent HSCs is their ability to respond to inflammatory and pro-fibrotic stimuli like lipopolysaccharide (LPS) and transforming growth factor beta 1 (TGFβ1). hPSC-HSCs expressed LPS receptors (CD14/TLR4/LY96) and induced cytokine upon stimulation (
We also compared hPSC-derived macrophages (hPSC-macrophages) and hepatocytes (hPSC-hepatocytes) to primary human Kupffer cells and hepatocytes (PHHs). hPSC-macrophages expressed characteristic Kupffer cell markers (
The majority of hPSC-hepatocytes expressed hepatocyte-specific markers albumin (ALB) and α1-antitrypsin (A1AT) (
To establish a liver culture system, we co-cultured hPSC-hepatocytes, HSCs and macrophages at an 8:1:1 ratio, proportions reflective of healthy livers [14]. We used a transwell to separate macrophages from co-cultured hepatocytes and HSCs while permitting diffusion of secreted factors (
Liver function depends on intercellular communication mediated by soluble factors and cell-cell contact. We first determined how cell type-defining properties were affected by co-culture. In hepatocytes, albumin secretion increased in the liver culture and HEP/HSC co-culture (
Next, we examined how this homeostatic state was altered by LPS, which is implicated in chronic liver diseases [16]. After one week of LPS exposure, HSCs lost cytoplasmic lipid droplets and expressed elevated activation markers (
To model NAFLD, we applied a lipotoxic milieu composed of glucose (25 mM), insulin (7 nM), palmitic acid (45 μM), and oleic acid (68 μM). The levels of these risk factors mimic circulating concentrations in NAFLD patients [6, 7]. For comparison, “healthy” conditions contained normal physiological levels of insulin (700 pM) and glucose (6 mM) (
First, we assessed hepatocyte lipid accumulation. Limited amounts were seen in purified hepatocytes from healthy cultures, but lipids accumulated ˜3-fold under lipotoxic conditions (
Since NAFLD is often accompanied by insulin resistance, we next evaluated hepatocyte glucose homeostasis. Under lipotoxic conditions, we found a 2-fold increase in glucose secretion and gluconeogenesis-associated enzyme expression like phosphoenolpyruvate carboxykinase 1 (PCK1) and fructose-1,6-bisphosphatase 1 (FBP1) (
We then evaluated whether HSCs and macrophages affected hepatocyte phenotypes. Similar lipid accumulation was observed between liver culture and hepatocyte monoculture with lipotoxic exposure (
Next, we evaluated how NAFLD risk factors affected HSC activation. Under lipotoxic conditions, quiescent HSCs differentiated into activated myofibroblasts that highly expressed COL1A1 and α-SMA (
We then assessed hepatocyte death in liver cultures given its importance in NAFLD progression [1]. Under lipotoxic conditions, culture supernatants showed elevated caspase-generated cytokeratin 18 (CK18) fragments (
Beyond biochemical changes, we also monitored cellular morphology. Hepatocytes formed lipid droplets that gradually led to cytoplasmic vacuolation (
Finally, we compared how liver cultures from hPSCs and primary cells responded to lipotoxic conditions (
Generation of an Isogenic Pair of Co-Cultures Harboring Either PNPLA3WT or PNPLA3I148M
To analyze genetic variants, we generated an isogenic pair of hPSCs harboring wildtype or I148M PNPLA3. We introduced the rs738409 C>G point mutation into hPSCWT cells to make a homozygous hPSCI148M line (
We first evaluated cell-intrinsic changes associated with the I148M variant. hPSCWT and hPSCI148M-derived hepatocytes showed comparable albumin secretion (
We then compared PNPLA3WT and PNPLA3I148M liver cultures under healthy conditions. In both cases, cellular morphology and patterning remained stable for at least 3 weeks. In our liver cultures, PNPLA3 was detected in HSCs and hepatocytes, but not macrophages (
To study the I148M variant in NAFLD development, we compared the response of PNPLA3WT or PNPLA3I148M liver cultures after two-weeks in lipotoxic conditions. We quantified hepatocyte lipid accumulation and observed a 1.5-fold greater increase in oil-red staining and intracellular TAG levels in PNPLA3I148M hepatocytes compared to PNPLA3WT (
Next, we examined hepatocyte glucose regulation. Under healthy conditions, glucose secretion was comparable between both liver cultures until day 12, after which an increase was evident in PNPLA3I148M liver cultures (
Focusing on HSCs, we found that HSCs in both liver cultures developed fibroblast-like morphologies. However, expression of activation markers was higher in HSCs purified from PNPLA3I148M liver cultures while retinol content and quiescence marker PPARG were lower (
Given the inflammatory nature of NAFLD, we found that inflammatory cytokine levels were higher in both the supernatants and separately purified cells from PNPLA3I148M than PNPLA3WT liver cultures (
Our in vitro results indicate that the PNPLA3 I148M variant causally enhances NAFLD susceptibility as suggested by genome-wide association studies [4]. Since lipotoxic conditions induce strong inflammation in PNPLA3I148M liver cultures, a defining feature of NAFLD progression [11], we hypothesized that secreted factors in the culture supernatant likely drives the enhancement of NAFLD phenotypes. To identify potential soluble effectors, we used a human cytokine array to analyze supernatants from day 6 of lipotoxic exposure since hepatocyte and HSC differences appeared after ˜1 week (
The three most differentially expressed cytokines and chemokines were CCL5, IL6 and IL1β, which have all been implicated in NAFLD pathogenesis [11]. Interestingly, IL6 is significantly increased in the liver of NAFLD patients and associated with severity [21]. IL6 binds to the IL6R/gp130 receptor, which signals via the JAK1/JAK2/STAT3 pathway, to promote STAT3 phosphorylation and target gene transcription. Compared to PNPLA3WT liver cultures, all three purified cell types from the PNPLA3I148M cultures showed elevated STAT3 phosphorylation (
These in vitro results led us to hypothesize that increased IL6/STAT3 signaling could also be found in patients harboring the rs738409 C>G SNP. By genotyping transcriptomic data of NAFLD and healthy liver biopsies [9, 24], we classified patients as wild-type, I148M homozygous or I148M heterozygous (
Beyond metabolism, GO terms related to inflammatory response were also highly enriched, consistent with the inflammatory signature of PNPLA3I148M liver cultures (
Expression of IL6 signaling components also showed relatively higher levels in this patient subset (
Together, these analyses comparing our in vitro liver cultures with primary liver biopsies suggest a strong association of elevated IL6/STAT3 activity with the PNPLA3 I148M variant.
We therefore sought to test directly whether elevated IL6/STAT3 activity enhances susceptibility to NAFLD phenotypes. To downregulate IL6, we transduced shRNA against IL6 or control (termed sh-IL6 and sh-Ctrl) after forming liver cultures to minimize effects on differentiation. IL6 levels in PNPLA3I148M liver cultures under lipotoxic conditions were reduced to similar levels as PNPLA3WT liver cultures (
IL6 signaling mainly occurs through two distinct pathways: (i) classical-signaling through membrane-bound IL6R leading to gp130 homodimerization, and (ii) trans-signaling through metalloproteinase-cleaved soluble IL6R (sIL6R) producing the IL6/sIL6R complex that signals through gp130 [26-28]. Thus, we sought to distinguish between these possibilities given the importance of IL6 signaling. Levels of sIL6R and soluble gp130 (sgp130) were increased under lipotoxic conditions and reached slightly higher levels in PNPLA3I148M cultures (
As a complementary approach, we determined if IL6 was sufficient to enhance NAFLD susceptibility in lipotoxic conditions by supplementing IL6 in PNPLA3WT cultures to a level similar to that of PNPLA3I148M cultures. We began after 5 days of lipotoxic exposure when disease phenotypes begin to manifest (
Finally, we sought to understand the basis of differential IL6 expression in PNPLA3WT and PNPLA3I148M liver cultures. IL6 is primarily induced under inflammatory conditions by activated stromal and immune cells [27]. By comparing the purified cells from PNPLA3WT and PNPLA3I148M cultures, the elevated IL6 expression comes primarily from macrophages (
Current in vitro models of NAFLD are insufficient for dissecting how genetic variants produce disease phenotypes. Immortalized cells show metabolic and immune alterations whereas primary cells are limited by availability and donor-to-donor variability. In particular, combining primary cells of unmatched backgrounds complicates variant-to-function inference [18, 29]. While hPSCs-derived liver organoids are an attractive renewable platform, they lack mesenchymal components involved in NAFLD [11]. Thus, there is a clear unmet need for new disease models.
Addressing these limitations, we established a multicellular liver culture. Notably, we developed differentiation conditions that generated quiescent HSCs in contrast to the activated phenotypes of HSC lines and pHSCs. The multicellularity is important for studying proteins expressed in multiple cell-types like PNPLA3 [22]. Finally, we developed a protocol to purify individual cell types to deconvolute their separate or joint contributions to disease. To model NAFLD, we applied a lipotoxic milieu reflecting disease-associated metabolic dysfunction and showed clear recapitulation of features like abnormal lipid accumulation, insulin resistance and inflammation. The amount of steatosis and ECM deposition suggest that we are modeling early NAFLD, consistent with a recent primary cell model [18]. This model is therefore positioned to understand how disease-associated SNPs influence the NAFLD development. By comparing an isogenic liver cultures, we found that PNPLA3I148M liver cultures developed stronger NAFLD phenotypes with accelerated kinetics, consistent with increased disease susceptibility.
In PNPLA3I148M liver cultures, we observed enhanced IL6/STAT3 signaling that was consistent with transcriptomics from patient liver biopsies. IL6 is a pleiotropic cytokine involved in tissue homeostasis, regeneration and metabolism [20, 27]. Hepatocyte-specific ablation exaggerates diet-induced inflammation [30], yet IL6 hyperactivation is implicated in inflammatory disease pathogenesis [26-28]. IL6 signals via distinct pathways: classic-signaling mediates protective and regenerative effects whereas trans-signaling is often pro-inflammatory. In our liver cultures, globally blocking IL6 signaling not only reduced NALFD development, but also nearly normalized the differences between PNPLA3WT and PNPLA3I148M Selective inhibition of trans-signaling produced similar results. Thus, blocking IL6 trans-signaling may be a therapeutic candidate for rs738409-homozygous NAFLD patients and a clinical trial of sgp130-Fc (Olamkicept) in inflammatory bowel disease indicates that this strategy is anti-inflammatory and well-tolerated [31]. Since IL6 trans-signaling and the I148M variant have been respectively associated with HCC development and risk [11, 32], our liver platform is a promising pre-clinical tool for variant-to-function studies for liver diseases beyond NAFLD.
Macrophages are major source of IL6 in our liver cultures, yet PNPLA3 expression is low or undetectable. Thus, inflammation driven by the I148M variant is likely downstream soluble factors from hepatocytes and/or HSCs. Several possible identities for these factors merit future investigation: (i) Metabolic lipid products from the enzymatic activity of PNPLA3 in hepatocytes and HSCs could promote metabolic stress. (ii) Hepatocyte-derived biomolecules whose secretion is modulated by TAG accumulation. Oxidized low-density lipoprotein cholesterol, for instance, is increased in NAFLD patients and associated with IL6 production [33]. Alternatively, damaged hepatocytes could release damage-associated molecular patterns (DAMPs) that drive immune activation [1]. (iii) Macrophage-derived products like lipoprotein-associated phospholipase A2 (Lp-PLA2) known to be elevated in NAFLD could produce IL6 feedback activation in myeloid cells [35]. Such possibilities highlight the importance of multicellularity in disease models to understand intercellular communication.
In summary, we have developed an hPSC-derived model of NAFLD suitable for mechanistic dissection of genetic variants. As proof-of-concept, we show that the strong association between the rs738409 C>G SNP in PNPLA3 and NAFLD susceptibility is caused by elevated IL6/STAT3 activity that accelerates disease development. Our liver culture is therefore a useful platform to conduct causal variant-to-function studies in NAFLD.
SNP: single nucleotide polymorphisms; NAFLD: non-alcoholic fatty liver disease; hPSC: human pluripotent stem cells; HCC: hepatocellular carcinoma; HSC: hepatic stellate cells; FGF: fibroblast growth factor; EGF: epidermal growth factor; MES: mesoderm; TAG: triacylglycerol; LPS: lipopolysaccharide; GO: gene oncology; ECM: extracellular matrix; LDL: low-density lipoprotein cholesterol; ER: endoplasmic reticulum; ACC1: acetyl-CoA carboxylase alpha; FASN: fatty acid synthase; SCD: stearoyl-CoA desaturase; CHI3L1: chitinase-3-like protein 1; CXCL10: C—X—C motif chemokine ligand 10; ASGR1: Asialoglycoprotein Receptor 1; TNF: tumor necrosis factor; DEG: differentially expressed genes
Primary human hepatocytes, Kupffer cells, hepatic stellate cells were maintained in Lonza cell growth media according to the manufacturer's instructions.
Human pluripotent stem cells (hPSCs) including ESCs (HUES8) and iPSCs (iPSC-W3) were cultured on growth factor-reduced matrigel according to the manufacturer's recommendations in feeder-independent mTeSR1-based medium (regular or mTeSR1 Plus). Cultures were replenished with fresh medium every day. Cells were passaged every 4-6 days as clumps using ReLeSR. For all the experiments in this study, hES/iPSCs were used between passage 30 and 40. For experiments reported in
Differentiation of hPSC-Derived Quiescent Hepatic Stellate Cells (HSC)
For HSC differentiation, cell culture plates were coated twice with matrigel to increase the thickness of the protein membrane. Human PSCs were first dissociated into single-cell suspension and seeded onto a matrigel-coated plate in mTeSR1 medium supplemented with Rock inhibitor (Y-27632, final concentration 10 μM) to reach approximately 20% confluence on the following day. Mesoendoderm differentiation was initiated by treating hPSCs with RPMI/B-27 (RPMI/1640, 2% B-27 (minus insulin), 0.5% GlutaMax and 0.5% non-essential amino acid) supplemented with 10 μM CHIR99021 for one day. Cells were then treated with RPMI/B-27 supplemented with 20 ng/ml BMP4 for three more days to promote mesoderm generation. Alternatively, mesoderm cells were derived by treated cells with Mesoderm Induction medium. To induce differentiation of mesodermal progenitors, cells were grown in the RPMI/B-27 supplemented with 50 ug/ml of ascorbic acid, 0.5% ITS (insulin transferrin selenium), 0.5 μM dexamethasone, 5 ng/ml BMP4 and 20 ng/ml FGF1 for three days. Quiescent HSCs were finally induced by culturing cells in RPMI/B-27 supplemented with 50 ug/ml of ascorbic acid, 0.5% ITS, 0.5 μM dexamethasone, 1% synthetic lipids, 30 ng/ml EGF, 10 ng/ml FGF2, and 5 μM retinol for six days. A diagram of a simple differentiation protocol is included in
Differentiation of hPSC-Derived Hepatocyte (HEP)
Differentiation of HEP was performed as described previously [36]. Briefly, hPSCs were first differentiated into definitive endoderm cells by using the STEMdiff Definitive Endoderm Kit following the manufacturer's instructions. Then, endoderm cells were dissociated into single-cell suspensions using Accutase and plated onto Matrigel-coated plates with Rock inhibitor in RPMI/B-27 supplemented with 20 ng/ml BMP4 and 10 ng/ml FGF2. Medium was replaced daily for five days. Cells were then exposed to RPMI/B-27 containing 20 ng/ml HGF for five days. Cells were further matured in Lonza hepatocyte culture medium containing ascorbic acid, BSA-FAF, hydrocortisone, transferrin, insulin, GA-1000, and 20 ng/ml OSM for an additional one to two weeks. HEP cultures were replenished with fresh medium every two days.
Differentiation of hPSC-Derived Macrophages (Macs)
hPSCs were first differentiated into hematopoietic stem cells using the Spin-EB method. Briefly, 3000 hPSC cells were seeded into U-bottom 96-well non-tissue culture plates in 50 μL of SFM (IMDM/Ham's F12 (1:1), 5 mg/ml BSA, 1× insulin-transferrin-selenium, 1× synthetic lipids, 50 μg/ml of ascorbic acid and 2 mM GlutaMax) supplemented with 10 ng/ml BMP4, 10 ng/ml FGF2, and 10 μM Y-27632 for two days. SFM supplemented with 10 ng/ml BMP4, 10 ng/ml FGF2, and 20 ng/ml VEGF was added to cultures (50 μl/well) every three days. On day 8, half of the culture medium was removed and fresh SFM medium containing 10 ng/ml FGF2, 10 ng/ml VEGF, and 50 ng/ml SCF were added every three days until day 14 when cells were collected for purification of HSCs using the EasySep human CD34 positive selection kit (Stemcell Technologies) according to the manufacturer's instructions.
Purified hematopoietic stem cells were expanded in the expansion medium (StemSpan SFEM II supplemented with 10% CD34+ expansion supplement) for three days. Macrophage differentiation was initiated by culturing hematopoietic stem cells in induction medium (IMDM, 3% AB serum, 2% human plasma, 10 ng/ml insulin, 3U/ml heparin and 200 μg/ml transferrin) supplemented with 50 ng/ml SCF, 1 ng/ml IL-3, 50 ng/ml Flt3 and 100 ng/ml M-CSF for 7-11 days. Medium was replenished every three days and cultures were further expanded to keep the cell density around 1.0-1.5 million/ml.
hPSC-derived HEPs, HSCs, and Mac were differentiated separately. HEPs from day 15 and HSCs from day 12 (or day 11 if using Mesoderm Induction medium) of differentiation were incubated with Accutase supplemented with 10 μM Y-27632 and detached into single-cell suspension. HEPs and HSCs were mixed at a ratio of 8:1 and re-plated onto matrigel coated 12-well cell culture plate, at a density of 0.4×106 cells/well, in the medium (50% of the final stage medium for HEPs and 50% of the final stage medium for HSCs) supplemented with 10 μM Y-27632. The following day, Macs from day 9 of differentiation were added in a 1:1 ratio with HSCs to the top compartment of a transwell system and the transwell insert was placed onto the well containing HEPs/HSCs. Culture medium was changed to basal maintenance medium (BMM) that consisted of glucose-free DMEM supplemented with 2% knockout serum replacement (KOSR), 2% B-27, 3U/ml heparin, 200 μg/ml Transferrin, 30 ng/ml EGF, 5 μM retinol, and 0.5 μM dexamethasone. The 12-well plate containing co-cultures was placed on an orbital shaker platform at a speed of 30 rpm/min. Co-culture was replenished with fresh medium every two days or as indicated in the figure legend. To mimic healthy condition, BMM was supplemented with normal physiological levels of insulin (0.7 nM) and glucose (6.0 mM). To mimic lipotoxic condition, high levels of insulin (7.0 nM), glucose (25.0 mM) and free fatty acid (oleic acid, 68 μM and palmitic acid, 45 μM) to mimic plasma concentrations of these factors in NAFLD patients. In these experiments, half of the culture medium was replenished every two days.
Separation of HEPs from HSCs
Isolation of HEPs from co-cultures was performed as described previously with modifications [37]. Briefly, hPSC-derived co-cultures of HEPs and HSCs were washed once with Versene and incubated in Versene at 37° ° C. for 20-25 minutes to loosen the cell-to-cell contacts. Cells were washed with pre-warmed DMEM/F12 and then incubated with pre-warmed collagenase mixture (2.0 mg/ml collagenase, 1.0 mg/ml dispase, 100UI/ml DNase, 0.2% DMSO in HBM) at 37ºC for 35-40 minutes. During incubation, cells were gently pipetted to break up clumps and aid dissociation. Cells were then collected by adding Versene and centrifuged at 400 g for 5 minutes at room temperature. After resuspension in Versene, cells were further incubated at 37° C. for 45 minutes. Towards the end of Versene incubation, the majority of cells should be dissociated to single cells. If necessary, the single-cell suspension was further filtered using a 100 μm cell strainer to remove large cell clumps. To separate HEPs from HSCs, single cells were first blocked in 1% BSA and incubated on ice for 1.0 hr. Cells were then stained with mouse anti-ASGR1 antibody, incubated with anti-mouse IgG microbeads, and separated by a magnetic separator at 4° C. HEPs were collected from the fraction bound to the magnetic wall; HSCs were collected from the flow-through faction after another round of hepatocyte purification. Purified HEPs and HSCs were collected for downstream analysis including various metabolic assays, western blot, RNA extraction, and flow cytometry.
For replating-induced activation, hPSC-derived HSCs at day 13 of differentiation were detached by incubation with Accutase and re-plated onto cell culture-treated plastic surface in the basic medium (RPMI/B-27, 0.5% ITS, 1% synthetic lipids, and 0.5% GlutaMax). For TGFβ1, FBS-, PDGF- and LPS-induced activation, hPSC-derived HSCs were incubated with the abovementioned basic medium in the presence of 5 ng/ml TGFβ1, 10% FBS, 30 ng/ml PDGF, or 500 ng/ml LPS, and analyzed for expression of activation marker genes by RT-qPCR at 24 hrs or by western blot at the indicated time points post-treatment.
To quantify the secretion of activation markers in the supernatant, activated HSCs were first washed with DMEM/F-12 three times before being incubated with medium (RPMI/1640 and 0.5% GlutaMax) for 3 hrs. The supernatants were analyzed by western blot using an anti-COL1A1 antibody. To monitor fibronectin (FN) secretion, the supernatant from multicellular cultures was collected and subject to analysis by western blot using an anti-FN antibody. To quantify the expression of intracellular activation markers, purified HSCs were directed lysed in 2× western blot lysis buffer and subject to analysis using specific antibodies.
Intracellular triacylglycerol levels were analyzed for hPSC-derived HEPs purified from different conditions using commercial kits (Promega) per the manufacturer's instructions.
For measurement of basal levels of total glucose secretion by HEPs, the transwell insert with Macs was removed, HEPs and HSCs co-cultures were washed gently but thoroughly using glucose-free DMEM and incubated at 37° ° C. for 6 hrs in glucose-free DMEM. Supernatants were then collected and concentrated by nitrogen gas flow after which glucose levels were measured using a Glucose Detection Kit (Sigma) according to the manufacturer's instructions. For insulin-stimulated glucose secretion, HEPs and HSC co-cultures were washed as above, incubated with glucose-free DMEM supplemented with high glucose (25.0 mM) for 1 hr, and then incubated at 37° C. for 6 hrs in glucose-free DMEM in the presence or absence of insulin (200.0 nM). Supernatants were collected and glucose levels were measured as above.
CYP P450 enzymatic activities were analyzed for hPSC-derived HEPs at day 20 using commercial kits (Promega) per the manufacturer's instructions. Primary human hepatocytes from two different donors were included as a positive control.
Purified hPSC-derived HEPs and PHHs were washed with D-PBS twice and seeded into 96-well plate (3×104/well). The intracellular ATP was measured using the CellTiter-Glo luminescent cell viability assay kit (Promega) according to the manufacturer's instructions.
Phagocytosis of green E. coli by hPSC-derived Macs was performed using a phagocytosis assay kit (BioVision) according to the manufacturer's instructions. Cytochalasin D was used as a phagocytosis inhibitor. Phagocytosis of green E. coli was analyzed using a fluorescent microscope.
We first generated hPSCs with doxycycline-inducible expression of Cas9 (HUES8-iCas9) using TALEN-mediated gene targeting into the AAVS1 locus. Then the iCas9 cells were genotyped by using PCR primers: sense: 5′-GACCTGCTGCATGGGAATTCTGGGG-3′ (SEQ ID NO:1) and anti-sense: 5′-CCAGCCAGTTTACCTTACA-3′ (SEQ ID NO:2) to amply a 722 bp fragment followed by sanger sequencing. The introduction of rs738409 C>G mutation was achieved as follow: Briefly, a single guide RNA (sgRNA) (sequence: TGCTTCATGCCTTTCTACAG (SEQ ID NO:3)) was cloned into pLenti-CRISPR-V2 vector and used as PCR template to amply a 120 bp fragment including the T7 promoter sequence, CRISPR recognition sequence, and a constant chimeric sgRNA sequence, using primers (sense: 5′-TAATACGACTCACTATAGGGACTGTAGAAAGG-3′ (SEQ ID NO:4) and antisense: 5′-AAAAGCACCGACTCGGTGCC-3′ (SEQ ID NO:5)). Purified PCR product was then used for in vitro transcription to generate sgRNA. For homology-directed repair, a single-stranded DNA (ssDNA) template (sequence: 5′-GAGCACACTTCAGAGGCCCCC AGGACTCAGCGCTAGCAGAGAAAGCCGACTTACCACGCCTCTGAAGGAAGGAGG GATAAGGCCACTGTAGAAAGGGATGAAGCACGAACATACCAAGGCCTGTGAAA GCAAAGGAGAGAGAAGTTATAGGCGAGAGCACCCTTTTAATTTTCCTGATCCTTC ATAAGCTTTC-3; (SEQ ID NO:6)) containing the mutated sequence flanked by 90nt of homology on each side was synthesized. Before ssDNA/sgRNA co-transfection, iCas9-hPSCs were pretreated with doxycycline (2 μg/ml) for 24 hrs. Cells were transfected with ssDNA/sgRNA (ratio 5:1) twice using RNAiMAX reagent (Invitrogen) in the presence of doxycycline (2 μg/ml). The first transfection was done while cells were being seeded. Two days after the second transfection, cells were detached into single-cell suspension and used for single-cell cloning. Clones were then picked, expanded, and analyzed by PCR using the two genotyping primers. Correct clones were further characterized for their growth rate, pluripotent marker expression, and trilineage differentiation capacity.
Trilineage Differentiation of hPSCs
Trilineage differentiation was done on the isogenic pair of hPSC using STEMdiff™ Trilineage Differentiation kit (Stemcell Technologies) per the manufacturer's instructions.
Approximately 100 ng of total RNA was used as input. Libraries were prepared according to Illumina's instructions for the TruSeq Stranded mRNA LT Sample Prep Kit (Catalog IDs: RS-122-2101, RS-122-2102) and sequenced on an Illumina NextSeq 500 with a read length of 75 nucleotides (single end configuration).
Libraries were sequenced to generate approximately 20 to 30 million reads per sample. FastQC (v.0.11.8) was used to assess the quality of reads. Trimmomatic (v0.39) was used to trim the reads, and quality was assessed again with FastQC. Gene and transcript expression levels (TPM and estimated counts) were quantified by pseudo-alignment using Salmon (v0.13.1) using the annotation from Ensembl v95 as the reference transcriptome. The R statistical framework (v3.5.1) was used for all downstream analyses. The tximport package (v1.8.0) was used to import and summarize these estimates. For PCA analysis, the DESeq2 package (v1.20.0) was used to normalize and variance stabilize the estimated read counts by regularized log transformation prior to plotting using the ggplot2 package (v3.0.0). For heatmap analyses, data was plotted using the ggplot2 package (v3.1.1).
Raw sequences for patient liver biopsy RNA-seq data were downloaded from GEO database (GSE126848 and GSE135251). The sequences were reprocessed through the nf-core/rnaseq pipeline [38]. The pipeline involved quality control of the reads with FastQC, adapter trimming using Trim Galore! (https://github.com/FelixKrueger/TrimGalore), read alignment with STAR [39]. Alignment was performed using the GRCh38 build native to nf-core and annotation was performed using Gencode Human Release 33 (GRCH38.p13). The quantification of the reads was done with FeatureCounts. The reads were normalized using variance-stabilizing transform (vst) in DESeq2 package in R for visualization purposes in log-scale [40]. Differential expression of genes was calculated by DESeq2.
The comparisons were done either by disease conditions or by SNP conditions (GSE135251 dataset only), correcting for sequencing batches with a covariate where applicable. To retrieve the SNP status of the PNPLA3 locus (chromosome 22, rs738409), the variant was called from the aligned sequences detailed above, using SAMtools mpileup and bcftools [41, 42]. The called variant was categorized as homozygous, heterozygous, and wild-type and stored as a metadata for downstream analyses.
Differentially expressed genes were determined by the cutoffs of BH-adjusted p-value <0.05 and absolute log 2 fold-change greater than 1. Among these differentially expressed genes, the top 100 variable genes were used to perform gene ontology (GO) analysis using enrichR [43]. Any signature with p-value <0.05 was taken as significant. A list of significantly enriched pathways is reported in Table 2.
Cells were fixed in 4% para-formaldehyde in phosphate-buffered saline (PBS) at room temperature for 10 min and blocked with PBTG (PBS containing 10% normal goat serum, 1% bovine serum albumin (BSA), 0.1% Triton-X100) at room temperature for 2 to 3 hr. Cells were incubated with primary antibodies at 4° C. overnight or 2 hr at room temperature. Isotype mouse or rabbit IgGs were used as negative controls. After four washes with PBS, Alexa-350, 488, or 594 conjugated secondary antibodies were added and incubated in the dark at room temperature for 1 hr, followed by four washes with PBS. Staining of hPSC-derived Macs was similarly performed, except cells were forced to attach to slides via cytospining. For lipid droplets staining in hPSC-derived HEPs, cells grown on coverslips were fixed with 10% formalin for 30 min and washed with 60% isopropanol for 10 min at room temperature. Cells were then stained with 0.18% freshly made oil-red in PBS for 5 min at room temperature and washed thoroughly with double-distilled water four times. Nuclei were stained with DAPI for 1 min at room temperature. Oil red quantification was performed as total red staining intensity normalized to nuclei counts using ImageJ software. Representative images from at least three independent experiments are shown in figures.
Expression of surface markers on hPSC-derived Macs was assessed by flow cytometry. Specifically, Macs were first purified from hPSC-derived macrophage cultures using anti-CD163 antibody-conjugated magnetic beads. Purified cells were then stained with fluorescent dye-conjugated anti-CD14, anti-CD11b, anti-CD68, and anti-CD163 antibodies at 4° C. in dark. Dead cells were excluded during flow cytometry analysis and gating was determined by using isotype controls.
To quantify retinol content, HSCs in single-cell suspension were analyzed for auto-fluorescence after UV light excitation using FACS-LSRII (BD Bioscience) and mean fluorescent intensity was calculated. For gating under UV light, mesoderm (MES) cells were used as a negative control. Stained cells were analyzed with FACS-LSRII (BD Bioscience).
Total RNA was isolated from cell lysates using the RNAeasy Mini Kit (Qiagen) followed by reverse transcription using Superscript III First-Strand Synthesis System or RevertAid First Strand cDNA Synthesis (ThermoFisher). Gene expression was quantified using the LightCycler SYBR Green I Master Mix (Roche Life Science) on a LightCycler 480 Instrument (Roche Life Science) or QuantStudio3 Instrument (Applied Biosystems) with gene-specific primers. PCR conditions were as follows: initial denaturation step at 50° C. for 2 min and 95° C. for 10 min, then 45 cycles of 95° C. for 15 sec, 56° C. for 15 sec, and 72° C. for 20 sec; followed by a melting step of 95° C. for 10s, 65° C. for 10s and a 0.07° C./s decrease from 95° C.; and finally, a cooling step of 50° C. for 5s. PCR product specificity was confirmed by a melting-curve analysis. Fold changes in mRNA expression were determined using the ΔΔCt method relative to the values in control samples as indicated in figure legends, after normalization to housekeeping genes (RPS11 or GAPDH). Results are presented as means±standard deviation (SD), unless stated otherwise. Comparisons between groups/cells were made using the two-tailed t-test with Welch's corrections to calculate exact p-values, unless stated otherwise. Statistical analysis was performed in Graph Pad PRISM 8.4.
Cells were directly lysed in 2×SDS lysis buffer and cell lysates were separated by 7.5%, 10%, or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, in MES or MOPS buffer, followed by transfer onto polyvinylidene fluoride membrane (EMD Millipore), as previously described. To detect phosphorylated AKT and phosphorylated FOXO1 in HEPs, cells were washed with glucose-free DMEM, and incubated at 37° C. for 2 hrs in glucose-free DMEM supplemented with glucose (6.0 mM), then either left untreated or treated with 10.0 nM insulin for 10 minutes at 37° C. followed by being lysed in 2×SDS sample buffer (2 mL Tris-HCl (pH 6.8), 50% glycerol, 10% SDS, 0.5% bromophenol blue, and freshly added 10% β-mercaptoethanol). Representative blots from at least three independent experiments are shown in figures.
For comparison between different groups or treatments, β-actin (ACTB) or RPS11 were used as housekeeping gene controls.
The Sendai virus-Cantell stock was propagated by inoculation into the allantoic cavity of 10-day-old embryonated chicken eggs. Following incubation at 37° ° C. for 48 h, allantoic fluid was harvested and titered by hemagglutination of chicken red blood cells. The influenza A/PR/8/34-ΔNS1 virus (kindly provided by Adolfo Garcia-Sastre) was grown in MDCK cells constitutively expressing the influenza virus NS1 protein (MDCK-NS1). Cells were infected at a multiplicity of infection (MOI) of 0.01 and the supernatant was harvested 5 days post-infection when the cytopathic effect was detected. The stock titer was determined by titrating the virus on MDCK-NS1 cells followed by immunostaining for viral NP. Both viral stocks were aliquoted and stored at −80° C.
hPSC-derived and primary macrophages and HSCs were stimulated with either Sendai or influenza particles for 12 hrs and analyzed for transcript levels of various cytokine genes by RT-qPCR.
To measure the secreted levels of human cytokines TGFβ1, IL6, and IL1β in the liver cultures under different experiment settings, supernatants were collected at indicated time points and cytokines levels were quantified by ELISA kits (R&D Systems), according to the manufacturers' instructions.
hPSC-derived and primary HSCs were cultured in RPMI/B-27 (RPMI/1640, 2% B-27 (minus insulin), 0.5% GlutaMax and 0.5% non-essential amino acid) on plastic surface. Once the cells reached confluence, the monolayer was scraped with a 200-pipet tip to create a scratch. Following removal of debris, cells were cultured in fresh medium supplemented with PDGF-BB (25 ng/ml), FBS (10%), or Y-27532 (20 μM) for 48 hrs. Using phase contrast microscopy, images were taken at 0 hr (after debris removal) and 48 hrs after scratching. Closure distances were calculated as percentage with respect to time=0 distance.
IL6 Neutralization Assay and sgp130Fc Treatment
For IL6 neutralization and sgp130-Fc treatment in the multicellular liver cultures, IL6 neutralizing antibody and sgp130Fc protein were added directly to culture supernatant to a final concentration of 100 ng/ml (IL6 neutralization) or 10-100 ng/ml (spg130Fc) and replenished whenever a new culture medium was added.
Soluble IL6R (sIL6R) and Soluble Gp130 (Sgp130) Measurement
The supernatants were collected at indicated experiment settings in liver culture, and sIL6R and sgp130 levels were quantified by ELISA kits (Invitrogen), according to the manufacturers' instructions.
PAS staining was done on hPSC-derived HEPs at day 20 using a commercial kit (Sigma-Aldrich) per the manufacturer's instructions. ICG was first dissolved in DMSO and then further by culture medium to a final concentration of 1 mg/ml. HEPs were incubated with ICG for 30 min at 37° C. Then the uptake of ICG by HEPs was observed using a microscope following washing cells with culture medium twice. Cells were then maintained in a 37° C. incubator for another 12 hrs for the second check of ICG.
NF-κB reporter assay
The fragment containing five copies of NF-κB binding sites (GGGGACTTTCCGC) with firefly luciferase was amplified from psiCHECK2-NF-κB (from Q. Deng at Purdue University) by PCR and cloned into pLenti-CRISPR v2 vector to construct pLenti-NF-κB-FLuc. Macrophages derived from hPSCWT and hPSCI148M were transduced with pLenti-NF-κB-FLuc before being incorporated into liver cultures. Macrophages were then collected for luciferase reporter assay at two weeks post lipotoxic condition exposure.
To measure hepatocyte cell death under lipotoxic condition, the supernatants and cells were collected at indicated experiment conditions, then lactate dehydrogenase (LDH) activity and caspase-generate CK18 fragments were quantified by LDH cytotoxicity assay kit (Invitrogen) and M30 CytoDeath CK18 kit (Diapharma), according to the manufacturers' instructions.
The sample sizes were determined by power analysis based on pilot data collected in our laboratory or published studies (PMC3320597, PMC5811326, PMC7125181). The exact value of n, and what n represents (e.g., number of cell clones or experimental replicate) can be found in figure legends. The data were analyzed using GraphPad Prism 8.4.3. software. The unpaired Student's t test (two-tailed) was used for comparisons between two groups.
Comparisons between three or more independent groups were performed using one-way analysis of variance (ANOVA) with Tukey's multiple comparison's test, unless stated otherwise. The data are presented as the mean±Standard deviation (SD) in graphs. All p-values were shown and values of p<0.05 were considered statistically significant.
All publications and patents mentioned in the specification and/or listed below are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope described herein.
The present application claims priority to U.S. Provisional application Ser. No. 63/385,873, filed Dec. 2, 2022, which is herein incorporated by reference in its entirety.
| Number | Date | Country | |
|---|---|---|---|
| 63385873 | Dec 2022 | US |
