Patent Application
20160326546
Engineered biological circuits provide insight into the underlying biology of living cells and offer potential solutions to a range of medical and industrial challenges. A prerequisite for efficient engineering of such sophisticated circuits is the availability of a library of regulatory devices that can be connected in various contexts to create new and predictable behaviors. In synthetic biology, a regulatory device is typically a set of biochemical regulatory interactions that implements a basic information-processing relationship between inputs and outputs.
Provided herein, in some embodiments, are modular transcriptional modulation (e.g., repression) architectures and methods for regulating expression of guide RNAs in cells, such as human cells. These architectures and methods are based, in part, on Clustered Regularly Interspaced Palindromic Repeats (CRISPR) systems. The CRISPR regulatory devices of the present disclosure can be layered (e.g., in human cells) to create functional cascaded circuits, providing a valuable toolbox for bioengineering and other biotechnological applications.
For the transcriptional devices as provided herein, the input is typically expression of a gene product that regulates production of output from a corresponding promoter. For example, repressor devices and activator devices can be used to build computational circuits.
To date, an impediment to engineering larger and more complex circuits in any living organism is the lack of an efficient framework for generating a sufficient number of ‘composable’ regulatory devices (having matching input and output types and expression levels) that can interconnect to form functional circuits.
Recent efforts toward developing a transcriptional framework for a large library of composable devices include the creation of synthetic transcriptional modifiers by fusing effector domains to zinc-finger proteins or transcription activator-like effector proteins, albeit with limitations such as extensive DNA assembly protocols or slow temporal responses, because of the epigenetic modifications caused by the effector domains at target promoters. The Cas9 protein from the Streptococcus pyogenes CRISPR-Cas immune system has recently been adapted for both RNA-guided genome editing and gene regulation in a variety of organisms. This mechanism is attractive for engineering a large library of devices in mammalian cells because Cas9 can be targeted to virtually any DNA sequence by means of a small guide RNA (gRNA) and thus can be easily programmed for the generation of a diverse device library. In addition, catalytically inactive Cas9 protein (referred to as ‘dCas9’ or ‘Cas9m’), not fused to any effector domains, represses both synthetic and endogenous genes through steric blocking of transcription initiation and elongation. Therefore, the CRISPR system was used, as described herein, to generate synthetic gene regulatory devices and circuits. Specifically, expression of gRNAs was regulated in human cells using both RNA polymerase type II (RNA Pol II) and RNA polymerase type III (RNA Pol III) promoters, and it was demonstrated that CRISPR repressor devices can be layered to create functional circuits with high on/off ratios.
Two CRISPR families of promoters regulated by Cas9m-mediated steric blocking of transcription are provided: CRISPR-responsive RNA Pol II promoters (CRP;
Thus, in some embodiments, provided herein are engineered nucleic acids comprising a CRISPR-responsive promoter (CRP) comprising a transcription start site flanked by a first gRNA target site and a second gRNA target site.
Also provided herein, in some embodiments, are engineered nucleic acids comprising a RNA Pol II promoter flanked by a first gRNA target site and a second gRNA target site, wherein the RNA Pol II promoter is operably linked to a nucleic acid encoding a product.
Further provided herein, in some embodiments, are engineered nucleic acids comprising a RNA Pol III promoter comprising a sense strand, an antisense strand and a TATA sequence flanked by a first gRNA target site and a second gRNA target site is provided.
In some embodiments, the present disclosure provides cells comprising any of one or a combination of engineered nucleic acids described above is disclosed.
In some embodiments, the disclosure provides libraries comprising pairs of engineered nucleic acids, wherein each pair comprises (a) an engineered nucleic acid comprising a CRISPR-responsive promoter comprising a transcription start site flanked by a first gRNA target site and a second gRNA target site, and (b) an engineered nucleic acid comprising a nucleic acid encoding a gRNA, wherein the gRNA binds to the first and second gRNA target sites of the engineered nucleic acid of (a).
In some embodiments, a cell comprises (a) an engineered nucleic acid comprising a response element located upstream from a CRISPR-responsive promoter comprising a transcription start site flanked by a first gRNA target site and a second gRNA target site, wherein the promoter is operably linked to a detectable molecule, (b) an engineered nucleic acid comprising a CRISPR-responsive promoter comprising a transcription start site flanked by a third gRNA target site and a fourth gRNA target site, wherein the promoter is operably linked to a nucleic acid encoding a gRNA that binds to the first and second gRNA target sites of the engineered nucleic acid of (a), and (c) an engineered nucleic acid comprising a promoter operably linked to a nucleic acid encoding a gRNA that binds to the third and fourth gRNA target sites of the engineered nucleic acid of (b).
The following drawings form part of and are included to further demonstrate certain aspects o, the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. The data illustrated in the drawings in no way limit the scope of the disclosure.
Provided herein, in some embodiments, are regulatory devices that comprise a set of biochemical regulatory interactions between input and output that implement the repression of transcription of a nucleic acid sequence encoding a product. Such regulatory devices can be used for numerous applications and are particularly useful in human cells. For example, such repressor devices can be used to control the transcription of a therapeutic compound, or a detectable molecule, or to coordinate step-wise programming or reprogramming of cells for differentiation. In some embodiments, the disclosed regulatory devices are used to deliver programs to cancerous cells that result in cell death based on the sensing intracellular molecules that correlate with diseased state or cancer. In some embodiments, the disclosed regulatory devices are used to control the expression of an antiviral gene based on the sensing of viral proteins or cellular proteins, the expression of which is dampened by viral infection. Other applications are encompassed by the present disclosure.
Transcriptional repression devices, as provided herein, typically include an engineered nucleic acid that comprises a CRISPR-responsive promoter (CRP), which includes comprising a transcription start site flanked by a first gRNA target site and a second gRNA target site.
A CRISPR-responsive promoters (CRP) is a promoter regulated (e.g., repressed or activated) by Cas9. In some embodiments, the Cas9 is catalytically inactive Cas9m. Without being bound by theory, catalytically-inactive Cas9m represses transcription through a steric blocking mechanism (see, e.g.,
CRISPR-responsive promoters of the present disclosure are typically eukaryotic promotors, which are particularly useful in human cells. To date, synthetic gene regulatory devices and circuits for regulated expression in human cells has been limited. The present disclosure provides a ‘toolbox’ to facilitate a wide range of applications in human cells, for example.
Thus, in some embodiments, a CRISPR-responsive promoter comprises a RNA Pol II promoter or an RNA Pol II promoter.
A promoter, generally, is a region of nucleic acid that initiates transcription of a nucleic acid encoding a product. A promoter may be located upstream (e.g., 0 bp to −100 bp, −30 bp, −75 bp, or −90 bp) from the transcriptional start site of a nucleic acid encoding a product, or a transcription start site may be located within a promoter. A promoter may have a length of 100-1000 nucleotide base pairs, or 50-2000 nucleotide base pairs. In some embodiments, promoters have a length of at least 2 kilobases (e.g., 2-5 kb, 2-4 kb, or 2-3 kb).
In some embodiments, a promoter is an RNA pol II promoter. RNA pol II promoters comprise a DNA sequence that is sufficient to direct accurate initiation of transcription of the nucleic acid encoding a product that is located downstream of the promoter by RNA polymerase II machinery, or a minimal essential promoter. In some embodiments, a RNA pol II promoter is a mini-CMV promoter. Other RNA pol II promoters (e.g., CMV promoter) are encompassed by the present disclosure.
Thus, in some aspects, the disclosure provides an engineered nucleic acid comprising a RNA Pol II promoter flanked by a first gRNA target site and second gRNA target site, wherein the RNA Pol II promoter is operably linked to a nucleic acid encoding a product. In some embodiments, the RNA Pol II promoter is a mini-CMV promoter. In some embodiments, an engineered nucleic acid comprising a RNA Pol II promoter flanked by a first gRNA target site and second gRNA target site comprises a response element located upstream from the first gRNA target site. In some embodiments, the response element is at least one UAS site (e.g., 1×UAS, 2×UAS, 4×UAS, 5×UAS).
In some embodiments, a promoter is an RNA pol Ill promoter. In some embodiments, the RNA pol III promoter is a RNA pol III U6 (or U6) promoter. RNA Pol II promoters, such as U6, in some embodiments, are useful for the expression of small RNAs, including small interfering RNA, short hairpin RNA, and guide RNA, for CRISPR editing systems. Other RNA pol III promoters (e.g., H1) are encompassed by the present disclosure.
In some aspects, the disclosure provides an engineered nucleic acid comprising a RNA Pol III promoter comprising a sense strand, an antisense strand and a TSS flanked by a first gRNA target site and a second gRNA target site. In some embodiments, the TSS is TATA sequence. In some embodiments, the RNA Pol III promoter is a U6 promoter. In some embodiments, an engineered nucleic acid comprising a RNA Pol III promoter comprising a sense strand, an antisense strand and a TSS flanked by a first gRNA target site and a second gRNA target site further comprises a response element located upstream from the first gRNA target site. In some embodiments, the first gRNA target site and the TSS are separated by at least 20 nucleotide base pairs (e.g., 20, 25, 30, or 50 bp), at least 40 nucleotide base pairs (e.g., 40, 45, 50, or 100 bp), at least 60 nucleotide base pairs (e.g., 60, 80, 100, or 150 bp), at least 80 nucleotide base pairs (e.g., 80, 90, 100, 150, or 200 bp), at least 100 nucleotide base pairs (e.g., 100, 120, 150, or 200 bp), or at least 200 (e.g., 200, 250, 300, or 500 bp) nucleotide base pairs.
Any of a number of promoters suitable for use in a cell (e.g., a human cell) may be used in the transcriptional repressor devices of the present disclosure. A promoter may be, for example, a constitutive promote or an inducible promoter. In some embodiments, a promoter is a tissue-specific promoter or a developmental stage-specific promoter. Promoters, as used herein, may be naturally occurring or synthetic. In some embodiments, promoters are bidirectional, wherein the 5′ ends of two nucleic acids that each encode a product on opposite strands flank the promoter.
For example, constitutive promoters having different strengths can be used. A nucleic acid described herein may include one or more constitutive promoters, such as viral promoters or mammalian promoters (obtained from mammalian genes) that are generally active in promoting transcription. Non-limiting examples of constitutive viral promoters include the Herpes Simplex virus (HSV), thymidine kinase (TK), Rous Sarcoma Virus (RSV), Simian Virus 40 (SV40), Mouse Mammary Tumor Virus (MMTV), Ad E1A and cytomegalovirus (CMV) promoters. Non-limiting examples of constitutive mammalian promoters include housekeeping gene promoters such β-actin promoter (e.g., chicken 3-actin promoter) and human elongation factor-1α (EF-1α) promoter.
Inducible promoters may also be used. Non-limiting examples of suitable inducible promoters include those from genes such as cytochrome P450 genes, heat shock protein genes, metallothionein genes, and hormone-inducible genes, such as the estrogen gene promoter. Another example of an inducible promoter is the tetVP16 promoter that is responsive to tetracycline.
Tissue-specific promoters and/or regulatory elements may also be used. Non-limiting examples of such promoters that may be used include hematopoietic stem cell-specific promoters.
Synthetic promoters may also be used. A synthetic promoter may comprise, for example, regions of known promoters, regulatory elements, transcription factor binding sites, enhancer elements and/or repressor elements.
It is to be understood, that any of a number of known promoters (e.g., CMV, mini-CMV, EFiα, sv40, PGK1, Ubc, human beta actin, chicken beta actin, CAG, TRE, UAS, AcS, polyhedron, CaMKIIα, GAL1, GAL10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1, or U6) can be flanked by a first guide RNA (gRNA) target site and a second gRNA target site to create a CRP.
A CRP, in some embodiments, comprises a transcription start site (TSS) flanked by a first guide RNA (gRNA) target site and a second gRNA target site. In some embodiments, an entire promoter that includes a TSS is flanked by a first guide RNA (gRNA) target site and a second gRNA target site, while in other embodiments, only a portion of a promoter is flanked by a first gRNA target site and a second gRNA target site. For example, only the TSS (e.g., a TATA box/sequence) located within a promoter (or located upstream from a promoter) may be flanked by a first gRNA target site and a second gRNA target site.
In some embodiments a nucleic acid comprising a CRISPR-responsive promoter comprising a transcriptional start site flanked by a first and second gRNA target sites further comprises a response element located upstream from the first gRNA target site. A response element is a sequence of nucleotides to which a protein (e.g., transcription factor or transcription initiation complex) binds, resulting in transcriptional regulation (e.g., initiation or activation of transcription). For example, transcription activator proteins often bind to response elements upstream of a promoter to activate transcription. In some embodiments, promoters, together with other control elements, control the level of transcription of a nucleic acid encoding a product. Promoters, in some embodiments, include multiple response elements that may be identical to each other (e.g., have identical sequences) or different from each other.
In some embodiments, nucleic acids disclosed herein comprise a transcription start site. A transcription start site is the location where transcription starts at the 5′-end of a nucleic acid encoding a product. In some embodiments, the transcription start site is located within a promoter. In some embodiments, the first gRNA target site and the TSS are separated by at least 20 nucleotide base pairs (e.g., 20, 25, 30, or 50 bp), at least 40 nucleotide base pairs (e.g., 40, 45, 50, or 100 bp), at least 60 nucleotide base pairs (e.g., 60, 80, 100, or 150 bp), at least 80 nucleotide base pairs (e.g., 80, 90, 100, 150, or 200 bp), at least 100 nucleotide base pairs (e.g., 100, 120, 150, or 200 bp), or at least 200 (e.g., 200, 250, 300, or 500 bp) nucleotide base pairs.
In some embodiments, the transcription start site is a TATA sequence (consensus sequence TATAAA), which is recognized by the general transcription factor TATA-binding protein (TBP). Many transcription start sites are known in the art and can be found in a database of transcription start sites (Suzuki, Y., et al., DBTSS, DataBase of Transcriptional Start Sites: progress report 2004, Nucleic Acids Res., 1; 32: D78-81, 2004), and are herein incorporate by reference in its entirety.
Guide RNA (gRNA) Target Site and gRNAs
A gRNA is a synthetic RNA composed of a scaffold sequence, which is necessary for Cas9- or Cas9m-binding, and a user-defined targeting sequence, which defines the complementing gRNA target site that flanks a nucleic acid encoding a product. In some embodiments, a gRNA is operably linked to a constitutive promoter. In some embodiments, a gRNA is operably linked to a CRP. For example, SEQ ID NO: 22 provides a sequence of a nucleic acid comprising a gRNA operably linked to an RNA Pol II promoter.
In some embodiments, a gRNA has length of 10-50 nucleotides. For example, a gRNA may have length of 10-20, 10-30, 10-40, 15-20, 15-20, 15-40, 15-50, 20-30, 20-40 or 20-50 nucleotides. In some embodiments, a gRNA has a length of 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. In some embodiments, a gRNA has a length of 20 nucleotides.
A guide RNA (gRNA) target site is a nucleotide sequence to which a gRNA binds. A gRNA comprises a nucleotide sequence that is complementary to (partially or wholly complementary to) a gRNA target site. A gRNA target site also comprises a Protospacer Adjacent Motif (PAM) located immediately downstream from the target site. Examples of PAM sequence are known (see, e.g., Shah S A et al. RNA Biology 10 (5): 891-899, 2013). In some embodiments, the sequence of PAM is dependent upon the species of Cas9 used in the architecture. In some embodiments, a PAM sequence is selected from the group consisting of: CGG, GGG, AGG, and TGG. Non-limiting examples of gRNA and gRNA target sequences are represented by SEQ ID NOs: 20-21, and SEQ ID NOs: 29-33. SEQ ID NOs: 24-28 represent non-limiting examples of gRNA target sequences containing a PAM sequence.
In some embodiments, the first gRNA target site is located in the sense strand upstream of the transcription start site and the second gRNA target site is located in the antisense strand downstream of the transcription start site in the engineered nucleic acid. An example sequence of a sense-antisense configuration of a CR-U6 is provided in SEQ ID NO: 3 and 12. An example amino acid sequence of a sense-antisense configuration of a CR-U6 is provided by SEQ ID NO: 13.
In some embodiments, the first gRNA target site is located in the antisense strand upstream of the transcription start site and the second gRNA target site is located in the sense strand downstream of the transcription start site in the engineered nucleic acid. An example sequence of an antisense-sense configuration of a CR-U6 is provided in SEQ ID NO: 4 and 14. An example amino acid sequence of an antisense-sense configuration of a CR-U6 is provided by SEQ ID NO: 15.
In some embodiments, the first gRNA target site is located in the sense strand upstream of the transcription start site and the second gRNA target site is located in the sense strand downstream of the transcription start site in the engineered nucleic acid. An example sequence of a sense-sense configuration of a CR-U6 is provided in SEQ ID NO: 5 and 16. An example amino acid sequence of a sense-sense configuration of a CR-U6 is provided by SEQ ID NO: 17.
In some embodiments, the first gRNA target site is located in the antisense strand upstream of the transcription start site and the second gRNA target site is located in the antisense strand downstream of the transcription start site in the engineered nucleic acid. Examples of U6-gRNA sequences are provided by SEQ ID NO: 1 and SEQ ID NO: 2. Example CRP promoter sequences are provided by SEQ ID NO: 8 and SEQ ID NO: 9.
CRPs regulate transcription of nucleic acid encoding a product based on the presence or absence of gRNA. In some embodiments, gRNA is constitutively expressed. In some embodiments, gRNA is constitutively expressed from a standard U6 promoter. In some embodiments, gRNA expression is controlled by another CRP.
A response element is a sequence of nucleotides within a promoter region of a nucleic acid to which specific transcription factors bind to regulate (e.g., activate) transcription of the nucleic acid encoding a product.
In some embodiments, a nucleic acid encoding a product is controlled by UAS to which GAL4VP16 binds. In some embodiments, a tetracycline response element, to which tetracycline binds, controls the transcription of a nucleic acid encoding a product. Many response elements are known in the art and can be included in the disclosed nucleic acids or circuits (e.g., HRE (Gao S., et al., Toxicol Sci. 2013, 132(2): 379-389); p 53 (Wang B. et al., Cell Cycle. 2010, 9(5):870-9; IARC TP53 database, World Health Organization); C/EBP (Osada S., et al, J. Biol. Chem. 1996, 271: 3891-3896; Van der Sanden M., et al., J. Biol. Chem. 2004, 279:52007-52015), and CRE (koyanaqi S. et al., J. Biol. Chem. 2011, 286: 32416-23)).
It is to be understood that any number of repeats (e.g., 2-20, 2-15, 2-10, 2-5) of a response element sequence may be used to control the transcription of a nucleic acid encoding a product. For example, 2×, 3×, 4×, 5×, 6×, 7×, or 14× of a response element sequence can be designed to control transcription of a nucleic acid encoding a product. In some embodiments, the response element is located upstream from the first gRNA target site flanking a promoter or transcription start site. In some embodiments, the response element is located downstream from the first gRNA target site that flanks a promoter.
In some embodiments, a product encoded by a nucleic acid is a detectable molecule. A detectable molecule is a molecule that can be visualized (e.g., using a naked eye or under a microscope). In some embodiments, the detectable molecule is a fluorescent molecule, a bioluminescent molecule, or a molecule that provides color (e.g., β-galactosidase, β-lactamasses, β-glucuronidase and spheriodenone). In some embodiments, the detectable molecule is a fluorescent protein or functional peptide or functional polypeptide thereof. The fluorescent protein may be a blue fluorescent protein, cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein or red fluorescent protein. The blue fluorescent protein may be azurite, EBFP, EBFP2, mTagBFP or Y66H. The cyan fluorescent protein may be ECFP, AmCyan1, Cerulean, CyPet, mECFP, Midori-ishi Cyan, mTFP1 or TagCFP. The Green fluorescent protein may be AcGFP, Azami Green, EGFP, Emarald, GFP or a mutated form of GFP (e.g., GFP-S65T, mWasabi, Stemmer, Superfolder GFP, TagGFP, TurboGFP or ZsGreen). The yellow fluorescent protein may be EYFP, mBanana, mCitrine, PhiYFp, TagYFP, Topaz, Venus, YPet or ZsYellow1. Orange fluorescent protein may be DsRed, RFP, DsRed2, DsRed-Express, Ds-Red-monomer, Tomato, tdTomato, Kusabira Orange, mKO2, mOrange, mOrange2, mTangerine, TagRFP or TagRFP-T. Red fluorescent protein may be AQ142, AsRed2, dKeima-Tandem, HcRed1, tHcRed, Jred, mApple, mCherry, mPlum, mRasberry, mRFP1, mRuby or mStrawberry. In some embodiments, the fluorescent protein is mKate.
In some embodiments, the detectable molecule is EYFP. In some embodiments, the detectable molecules is mKate.
Bioluminescent molecules are bioluminescent proteins or functional polypeptides or functional peptides thereon. Examples of non-limiting bioluminescent proteins are firefly luciferase, click-beetle luciferase, and Renilla luciferase.
In some embodiments, a product encoded by a nucleic acid is a therapeutic protein, mRNA, miRNA or polypeptide. In some embodiments, the therapeutic protein, mRNA, miRNA or polypeptide is an antibody, a peptibody, a growth factor, a clotting factor, a hormone, a membrane protein, a cytokine, a chemokine, an activating or inhibitory peptide acting on a cell surface receptors or an ion channel, a thrombolytic, an enzyme, a bone morphogenetic protein, a nucleases or another protein used for gene editing, an Fc-fusion protein, or an anticoagulant.
In some embodiments, a product encoded by a nucleic acid is a differentiation-inducing factor (e.g., DIF-1, DIF-2, or DIF-3). In some embodiments, a product encoded by a nucleic acid is a transcription factor that induces cell reprogramming of cells (e.g., induced pluripotent stem cells or embryonic progenitor cells). For example, transcription factors OCT4 and SOX2 maintain pluripotency of induced pluripotent stem cells. Another non-limiting example of a differentiation inducing factor is MUC5ac, which induces the programing of tracheal epithelial cells to mucous secreting goblet cells.
In some embodiments, a product encoded by a nucleic acid is a gRNA for the control of transcription of another nucleic acid encoding a product.
In some embodiments, a product is a detectable molecule and is used as a transfection marker.
In some embodiments, the nucleic acid is located on (or within) a vector (e.g., a plasmid, a bacteriophage, a cosmid, or a viral vector). In some embodiments, plasmids are cloning plasmids. In some embodiments, plasmids are expression plasmids. A non-limiting example of a plasmid is pCR2.1-TOPO TA vector. In some embodiments, the engineered nucleic acid comprised by the vector is integrated into the genome of the cell, organ, organoid, or organism to which it is introduced. In some embodiments, the vector is episomal.
In some embodiments, an engineered nucleic acid is a nucleic acid that has been designed and made using known in vitro techniques in the art. In some embodiments, an engineered nucleic acid, also referred to as a circuit herein, is a nucleic acid that is not isolated from the genome of an organism. In some embodiments, the engineered nucleic acid is introduced to a cell, plurality of cells, an organ or an organism to perform diverse functions (e.g., differentiation of cells, as sensors within cells, program a cell to act as a sensor, and delivery of selective cell-based therapies). In some embodiments, the engineered nucleic acid comprises one or more nucleic acid encoding a product and control elements. Non-limiting examples of control elements include promoters, activators, repressor elements, insulators, silencers, response elements, introns, enhancers, transcriptional start sites, termination signals, linkers and poly(A) tails. Any combination of such control elements is contemplated herein (e.g., a promoter and an enhancer).
CRISPR-based devices of the present disclosure are particularly useful, for example, for scaling to large, sophisticated circuits, as the nucleic acid required for each additional device is small. This means that complex circuits can be encoded when there are size limits on the nucleic acid (e.g., DNA) to be delivered, and that any given circuit topology can be encoded in a much smaller amount of DNA. Regulation by RNA interference integrates well with CRISPR-based devices, providing a useful means of sensing and effecting cell state. Additional scaling of the CRISPR technology and the creation of more complex logic also benefits from using multiple orthogonal Cas9 proteins. Give the simplicity of creating additional gRNAs and corresponding promoters, and the high performance of the devices presented here, it is possible to rapidly generate and characterize a large library of effective regulatory devices. Taken together, the scalability and ability to rapidly design the devices as provided herein allows CRISPR based circuits to facilitate a wide range of applications in human cells.
Biological circuits that comprise a nucleic acid encoding a product and at least one control elements (e.g., promoters, activators, repressor elements, insulators, silencers, response elements, introns, enhancers, transcriptional start sites, termination signals or poly(A) tails) enable the manipulation of cells for different purposes. For example, a biological circuit can be used to achieve the simple task of delivering a molecule to a cell that changes its differentiation state, inhibits or enhances a signaling pathway, or changes its growth rate.
However, for performing more sophisticated tasks, such as delivering a molecule based on the result of a sensing of the same or another molecule (e.g., an intracellular molecule or an extracellular molecule that alleviates disease), layering of biological circuits useful. Layered circuitry refers to the ability to compose complex multi-level control or regulatory operations with biological circuits. The difficulty is assembling components that do not interfere with each other. Provided herein are architectures/constructs and methods for layering circuits comprising components that interact with each other. Such interactions can be used to perform sophisticated tasks (e.g., step-wise differentiation of cell, or engineering sophisticated control over cell function in cell-based therapies). A sophisticated task is one that involves both an input and an output, rather than only an output. Disclosed herein, in some embodiments, are layered circuits for complex multi-level control or regulatory operations by interconnecting CRISPR-based devices.
Accordingly, in some aspects, the disclosure provides a cell (e.g., a human cell) comprising multiple circuits that interact with each other (layered circuits).
In some aspects, the disclosure provides a cell (e.g., a human cell) comprising an engineered nucleic acid comprising a CRISPR-responsive promoter (e.g., RNA Pol II such as mini-CMV or RNA Pol III such as U6) comprising a transcription start site flanked by a first gRNA target site and a second gRNA target site, wherein the CRISPR-responsive promoter is operably linked to a nucleic acid encoding a product. In some embodiments, a cell further comprises an engineered nucleic acid comprising a promoter operably linked to a nucleic acid encoding a gRNA that binds to the first and second gRNA target sites of the engineered nucleic acid, thus providing layering of the circuit.
In some embodiments, a cell comprises a nucleic acid encoding a gRNA that is flanked by cognate intronic splice sites. In some embodiments, a cell comprises a nucleic acid encoding a gRNA that is flanked by cognate intronic splice sites and is located within a nucleic acid encoding a product. In some embodiments, the product is a detectable molecule. In some embodiments, the detectable molecule is used to monitor transfection. In some embodiments, the detectable molecule is mKate. Example sequences of nucleic acids comprising intronic gRNA flanked by mKate are provide by SEQ ID NO: 6 and SEQ ID NO: 7. SEQ ID NO: 23 provides an example amino acid sequence of gRNA intron of mKate fluorescent protein coding gene. Example sequences of nucleic acids comprising intronic gRNA flanked by RFP are provide by SEQ ID NO: 10 and SEQ ID NO: 11.
In some embodiments, a cell comprising an engineered nucleic acid comprising a CRP comprising a TSS flanked by a first gRNA target site and a second gRNA target site comprises a response element upstream of a promoter operably linked to a nucleic acid encoding a product. In some embodiments, the product is a gRNA. In some embodiments, the response element is a tetracycline response element.
In some embodiments, the disclosed cell further comprises a nucleic acid that encodes an activator of transcription (e.g., GAL4VP16).
In some embodiments, the cell disclosed herein comprises cas9. In some embodiments, cas9 is encoded from an engineered nucleic acid. In some embodiments, the cas9 is catalytically inactive case9 (cas9m). In some embodiments, transcription of nucleic acid encoding cas9m is controlled by a constitutive promoter, inducible promoter, or a tissue-specific promoter. In some embodiments, a cell comprises a nucleic acid encoding cas9m regulated by a constitutive promoter, tissue-specific promoter, or inducible promoter, and also another nucleic acid encoding cas9m that is regulated by a CRISPR-responsive promoter.
In some embodiments, a cell comprises at least two (e.g., 2, 3, 4, 5, or 10) nucleic acids disclosed herein. For example, a cell may comprise a first engineered nucleic acid comprising a promoter operably linked to a nucleic acid encoding a gRNA, and a second engineered nucleic acid comprising a CRISPR-responsive promoter comprising a TSS flanked by a first and second gRNA target sites, and that is operably linked to a nucleic acid encoding a product. In some embodiments, the gRNA of the first nucleic acid binds to the gRNA target sites of the second nucleic acid. In some embodiments for example, a cell comprises a first engineered nucleic acid comprising a promoter operably linked to a nucleic acid encoding a gRNA; a second engineered nucleic acid comprising a CRISPR-responsive promoter comprising a TSS that is flanked by first and second gRNA target sites, and that is operably linked to a nucleic acid encoding a first product; and a third engineered nucleic acid comprising a CRISPR-responsive promoter comprising a TSS that is flanked by a third and fourth gRNA target sites, and that is operably linked to a nucleic acid encoding a second product. In some embodiments, the gRNA of the first nucleic acid binds to the gRNA target sites of the second, third, or second and third nucleic acids. In some embodiments, the first product is a gRNA that binds to the gRNA target sides of the third nucleic acid. In some embodiments, the promoter of the first nucleic acid that encodes the gRNA is a CRISPR-responsive promoter and the second product is another gRNA that binds to the gRNA target sites of the first nucleic acid to provide a feedback mechanism. In some embodiments, the gRNA encoded by the first and second nucleic acid is the same. In some embodiments, the gRNA encoded by the first and third gRNA is the same. In some embodiments, the gRNA encoded by the first, second and third nucleic acids is the same. In some embodiments, the gRNA of any of the first, second or third nucleic acid is flanked by cognate intronic splice sites.
It is to be understood that a cell comprising more than three layered (or interacting) nucleic acids that comprise one or more of the following components are contemplated to interacted in any configuration (a) a promoter operably linked to a nucleic acid encoding a gRNA, (b) a CRISPR-responsive promoter that comprises a TSS that is flanked by gRNA target sites and that is operably linked to a nucleic acid that encodes a product, (c) a promoter operably linked to a nucleic acid encoding Cas9m, and (d) a promoter operably linked to nucleic acid encoding a detectable molecule, that may be used as a transfection control. In some embodiments, a component of one nucleic acid interacts with another component on the same nucleic acid. In some embodiments, a component of one nucleic acid interacts with a component of another nucleic acid. In some embodiments, a component of one nucleic acid interacts with more than one component on the same or a different nucleic acid. It is to be understood that any of the gRNA can be flanked by cognate intronic splice sites of a product. The product may be an activator or transcription.
In some embodiments, a cell comprises a nucleic acid that encodes multiple gRNAs, or multiple nucleic acids each encoding one or more gRNAs (e.g., 2, 3, 4, 5, 6, or 10 or more). Any number of gRNA and gRNA target sites pairs are contemplated to be comprised by a cell. In some embodiments, actions of the different gRNA and gRNA target sites pairs are sequential. For example, a first gRNA and gRNA sites pair may control the transcription of a nucleic acid encoding a second gRNA, which then acts on its paired gRNA target sites to control the transcription of a nucleic acid encoding a third gRNA, or another product. In some embodiments, actions of the different gRNA and gRNA target sites pairs are parallel or unrelated. For example, a first gRNA and gRNA sites pair may control the transcription of a nucleic acid encoding a first product, and a second pair of gRNA and gRNA target sites control the transcription of a nucleic acid encoding a second product.
In some embodiments, a cell comprises a nucleic acid encoding a gRNA regulated by a constitutive promoter, tissue-specific promoter, or inducible promoter, and also another nucleic acid encoding the same gRNA that is regulated by a CRISPR-responsive promoter.
In some embodiments, a cell comprises an engineered nucleic acid comprising a response element upstream of the promoter operably linked to a nuclide acid encoding a product. In some embodiments, the product is a gRNA. The response element comprised in a nucleic acid comprised by the disclosed cell can be any of the response elements described above. In some embodiments, a cell disclosed herein comprises a tetracycline response element.
Thus in some embodiments, disclosed herein is a cell, comprising (a) an engineered nucleic acid comprising a response element located upstream from a CRISPR-responsive promoter comprising a transcription start site flanked by a first gRNA target site and a second gRNA target site, wherein the promoter is operably linked to a detectable molecule; (b) an engineered nucleic acid comprising a CRISPR-responsive promoter comprising a transcription start site flanked by a third gRNA target site and a fourth gRNA target site, wherein the promoter is operably linked to a nucleic acid encoding a gRNA that binds to the first and second gRNA sites of the engineered nucleic acid of (a); and (c) an engineered nucleic acid encoding a gRNA that binds to the third and fourth gRNA target sites of the engineered nucleic acid of (b).
For example, a U6 promoter can be operably linked to a nucleic acid that encodes a first gRNA, which in turn binds to target sites flanking a nucleic acid encoding a second gRNA, which in turn binds to the target sites flanking a nucleic acid encoding a product (e.g., EYFP, a transcription activator such as Ga14VP16, or a therapeutic protein).
In some embodiments, the cell comprising (a), (b) and (c) further comprises (d) an engineered nucleic acid comprising a promoter operably linked to a nucleic acid encoding catalytically inactive Cas9 (Cas9m). In some embodiments, the cell comprising (a), (b) and (c), (a), (b), (c), and (d) comprises an engineered nucleic acid encoding a protein that binds to the response element of the engineered nucleic acid of (a). In some embodiments, the promoter of (a) is a RNA Pol II promoter (e.g., mini-CMV promoter). In some embodiments, the promoter of (a) is a RNA Pol III promoter (e.g., U6 promoter). In some embodiments, the detectable molecule is a fluorescent protein In some embodiments, the response element comprised in a cell is at least one UAS sequence. IN some embodiments, the protein that binds to the response element is Ga14 (e.g., Ga14VP16). In some embodiments, the cell is a human cell.
In some embodiments, a cell comprises (a) a nucleic acid comprising a constitutive promoter operably linked to a transcription activator (e.g., Ga14VP16) that activates the transcription of (b) a nucleic acid encoding a product (e.g., EYFP), which is operably linked to a promoter comprising a TSS that is flanked by gRNA target sites corresponding to (c) a gRNA that is operably linked to a promoter comprising a response element (e.g., TRE). Such a cell may further comprise a nucleic acid encoding cas9m and/or a nucleic acid encoding a detectable molecule (e.g., mKate). The interactions of such a circuitry is exemplified in
In some embodiments, a cell comprises a nucleic acid comprising an inducible response element (e.g., TRE) as one component of layered circuitry such that the response element allows for reversibility of repression of transcription of nucleic acid encoding a product. For example, doxycycline (Dox) treatment can result in an “ON” mode of the promoter, whereas no Dox results in an “OFF” mode.
A cell may be one of many cells cultured under certain conditions, or part of an organ that is harvested, part of an organoid, or an organism. In some embodiments, a cell disclosed herein is a eukaryotic cell (derived from a eukaryotic organism). In some embodiments, a eukaryotic cell is derived from ectoderm, endoderm, or mesoderm.
In some embodiments, a eukaryotic cell is a human cell. In some embodiments, a eukaryotic cell is a mouse cell, rat cell, cat cell, dog cell, hamster cell, or a cell from a non-human primate.
In some embodiments, a eukaryotic cell derived from ectoderm is derived from surface ectoderm, neural crest or neural tube. In some embodiments, cells of the surface ectoderm are derived from skin (e.g., trichocyte, or keratinocyte) or anterior pituitary (e.g., gonadotrope, corticotrope, thyrotrope, somatotrope, or lactothroph). In some embodiments, cells of the neural crest are derived from peripheral nervous system (e.g., neuro or glial cell), neuroendocrine system (e.g., chromaffin cell, parafollicular cell or glomus cell), skin (melanocyte or Merkel cell), teeth (e.g., odontoblast or cementoblast), or eyes (corneal epithelial cell or photoreceptor cell). In some embodiments, cells of the neural tube are derived from central nervous system (e.g., neuron or astrocyte), ependymal (e.g., ependymocyte), or pineal gland (e.g., pinealocyte).
In some embodiments, a eukaryotic cell derived from endoderm is derived from foregut, pharyngeal pouch (e.g., cells of thyroid gland or paraphyroid gland) or cloaca (e.g., urothelial cell). In some embodiments, cells of the foregut are derived from respiratory system (e.g., pheumocyte, goblet cell or club cell), digestive system, or islets of Langerhans (e.g., alpha cell, beta cell, delta cell or F cell). In some embodiments cells derived from the digestive system are derived from stomach (e.g., G cell, delta cell, enterochromaffin-like cell, gastric chief cell, parietal cell or foveolar cell), intestine (e.g., S cell, delta cell or cholecystokinin cell, goblet cell, paneth cell or tuft cell), liver (e.g., hetaotcyte, hepatic stellate cell or kupffer cell), gall bladder (e.g., cholecystocyte), or exocrine pancreas (e.g., centroacinar cell or pancreatic stellate cell.
In some embodiments, a eukaryotic cell derived from mesoderm is derived from paraxial mesoderm, intermediate mesoderm (e.g., a renal cell or cell of the reproductive system) or lateral plate. In some embodiments, a cell of the paraxial mesoderm a mesenchymal stem cell, such as an osteochondroprogenitor cell (e.g., an osteocyte derived from an osteoblast, a chondrocyte derived from a condroblast), a myofibroblast (e.g., an adipocyte derived from a lipoblast, a myocyte derived from myoblast, tendon cell or cardiac muscle cell) or interstitial cell of Cajal. In some embodiments, a cell of intermediate mesoderm is a renal cell or a cell of reproductive system (e.g., sertoli cell, Leydig cell, granulosa cell, Peg cell or germ cell). A cell of the lateral plate may be a hematopoietic stem cell, or a cell of the circulatory system (e.g., endothelial progenitor cell, endothelial colony forming cell, endotehlial stem cell, angioblast, pericyte or mural cell).
In some embodiments, a cell disclosed herein is a stem cell (e.g., an induced pluripotent stem cell). In some embodiments, a disclosed herein is immortalized (e.g. HEK293, A549, HeLa, Jurkat, 3T3, or Vero cell).
Also provided herein are libraries of composable devices. In some embodiments, provided herein are pairs of engineered nucleic acids, wherein each pair comprises: (a) an engineered nucleic acid comprising a CRISPR-responsive promoter comprising a transcription start site flanked by a first gRNA target site and second gRNA target site, and (b) an engineered nucleic acid comprising a nucleic acid encoding a gRNA, wherein the gRNA binds to the first and second gRNA target sites of the engineered nucleic acid of (a).
In some embodiments, the target sequence of (a) has a length of 15-50 nucleotides (e.g., 20 nucleotides). In some embodiments, the target sequence of (a) has a length of 18-22 nucleotides, or 15-25 nucleotides.
In some embodiments, the gRNA of (b) in the library is operably linked to a promoter. In some embodiments, the promoter to which the gRNA of (b) in the library is operably linked is a constitutive promoter. In some embodiments, the promoter to which the gRNA of (b) in the library is operably linked is a CRP, as provided herein. The promoter to which the gRNA of (b) in the library may be operably linked to any of the promoters described herein.
In some embodiments, the nucleic acid encoding the gRNA of (b) is flanked by cognate intronic splice sites and may be located within a nucleic acid encoding a nucleic acid encoding a product. In some embodiments, the product is a detectable molecule (e.g., a fluorescent protein).
In some embodiments, gRNA and CRP pairs of the library show a repression efficiency from 2-fold to 30-fold (e.g., 2-fold, 4-fold, 15-fold, 26-fold), 1.1-fold to 50-fold (e.g., 1.5-fold, 30-fold, 45-fold, 50-fold), relative to control. In some embodiments, gRNA and CRP pairs of the library show a repression efficiency of at least 30-fold, at least 50-fold, at least a 100-fold, or at least a 1000-fold relative to a control. Repression efficiency herein refers to the ratio of transcription of a nucleic acid encoding a product when transcription is not being repressed (or a control) to the transcription of the nucleic acid encoding a product when repressor devices are used. A control, in some embodiments, is a transcription level of a nucleic acid encoding a product to which a pair of nucleic acids from the library is applied, when either one, or both, of nucleic acids (a) or (b) is absent or rendered non-functional. For example, a control may be a transcription level of a nucleic acid encoding a product observed when gRNA is absent. In some embodiments, a control is a transcription level of a nucleic acid encoding a product when Cas9 (or Cas9m) is absent is a cell. In some embodiments, a control is a transcription level of a nucleic acid encoding a product when the PAM is absent, or the gRNA target sequence is mismatched or scrambled or absent so that the gRNA cannot bind to the gRNA target sites.
In some embodiments, a gRNA target sequence belonging to the library is selected from the following sequences: SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33.
In some embodiments, a gRNA target sequence at a hybrid promoter is followed immediately by PAM nucleotide sequence selected from the following sequences: SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 (Table 1).
The following Examples provide data showing that a Cas9 system can be layered to generate circuitry of interconnected transcriptional repression devices. Architectures/constructs for generating a large library of transcriptional devices for such purposes is also provided. The results below demonstrate that CRISPR gRNA can be regulated by RNA Pol II promoters in human cells, which enables incorporation of many Pol II regulatory elements not currently available for Pol III based promoters.
The ability of a CRP to regulate expression of enhanced yellow fluorescent protein (EYFP) based on the presence or absence of gRNA constitutively expressed from a standard U6 promoter was tested. Flow cytometry analysis 48 hours after transfection of regulatory circuitry into human embryonic kidney (HEK) 293 cells showed approximately 100-fold repression for two different gRNA and CRP pairs (gRNA-a and gRNA-b;
The potential to create layered circuitry based on CRISPR devices was investigated. CR-U6 architecture to both express and be regulated by gRNA was designed to create composable devices. To this end, one Cas9m or gRNA target site was inserted upstream and another was inserted downstream of the U6 promoter TATA box. Three versions of the CRa-U6 promoter differing in the directionality of gRNA-a target sites flanking the TATA box were created (
Strategies were developed for expressing gRNA from RNA Pol II promoters, specifically the well-studied mini-CMV promoter, so that CRP devices can be likewise composed. This allows CRISPR devices to be regulated and tuned by commonly used modulators (e.g., Ga14VP16 or rtTA316), and to participate in the same framework as other protein-based regulators, sensors, actuators, and reporters. First, a gRNA sequence was inserted directly downstream of a Tetracycline Response Element (TRE) promoter (
Reversibility of the circuit was then tested. An increase in EYFP expression was found following removal of doxycycline (
Guide RNA (gRNA) was encoded as an intron with flanking splicing sequences using a strategy similar to that employed for intronic microRNAs (
The intronic gRNA (igRNA) devices were assayed further. Two stop codons were inserted within the intron sequence, which allowed verification of proper splicing of intron by observing mKate fluorescence (
To examine whether proper processing of spliced intron is required for the function of Cas9m/igRNA complex, the eukaryotic intron branch point sequence was replaced with a sequence from HSV latency-associated transcript, which interferes with proper de-branching of a spliced intron. This modification results in diminished igRNA/Cas9m mediated repression efficiency (
To demonstrate the extensibility of CRISPR regulatory devices, a small library of igRNA and CRP pairs that differ only in the nucleotide sequence of the designated target sites in the CRPs and corresponding intronic gRNA sequences was designed. The nucleotide sequence composition of the target site for each library member is given in Table 1. The library sequences were rationally designed by modification of the gRNA-a target sequence based on current knowledge of CRISPR targeting specificity. Specifically, at least one or more mismatch within the first five nucleotides immediately upstream of PAM that has been shown to be essential for CRISPR specificity was inserted and a number of additional mismatches from nucleotides 5-20 upstream of this sequence were added, with the goal of creating orthogonality within the library. Characterization of this library show a range of repression efficiencies from 2- to 30-fold (
It was next tested whether igRNA from a CRP can regulate another CRP, forming a layered CRISPR cascade with connected RNA Pol-II promoters (
Specifically, the CRa-U6 device in
A similar configuration of U6/CRP/CRP promoters, but exchanging gRNA-a and gRNA-b, resulted in a moderately functional cascade (
Circuits comprising only RNA Pol II promoters did not yield substantial regulation in this particular experiment (
A catalytically inactive mutant Cas9 not fused to any effector domain was used in the studies described herein, otherwise referred to as Cas9m. The absence of an effector domain should reduce deleterious effects in potential off-target binding sites. In addition, the level of transfected Cas9m is kept as low as possible, transfecting 2×105 HEK293 cells with only 70 ng of Cas9m, which has been suggested to decrease off-target effects. Although the efficacy of these strategies is still unclear, they may contribute to the low toxicity observed in the studies described herein. Flow cytometry analysis of cell viability using 7-Aminoactinomycin-D (7-AAD) dye in the igRNA-a device revealed comparable viability across different conditions (
The promoter sequences in the devices reported herein are adapted from a previously reported study evaluating TALEs binding to their cognate target sites and modified to allow CRISPR recognition and targeting. Nucleotide BLAST of these sequences finds no exact matches in the human genome. CRISPR specificity and off-target effects remain active areas of research. The specificity of Cas9 is sequence- and locus-dependent and appears to be governed by the quantity, position and identity of mismatching bases. While prior reports have suggested that 8-12 nucleotides proximal of PAM is essential for specificity, another recent report demonstrates that specificity is defined by exact matching of the PAM-proximal 5 bp to the guide sequence. Studies as the one described herein, and the generation and characterization of larger libraries of engineered regulatory devices will be useful to further improve the understanding of CRISPR specificity.
HEK293FT cells were obtained from Invitrogen and maintained in DMEM (CellGro) supplemented with 10% FBS (PAA Laboratories), 1% L-glutamine-streptomycin-penicillin mix (CellGro) and 1% nonesential amino acids (NEAA; HyClone) at 37° C. and 5% CO2. rtTA3 stable cell lines (HEK293-rtTA3) were created by lentiviral transduction of HEK293 cells with rtTA3 coding sequence under a constitutive promoter and antibiotic selection with hygromycin for 2 weeks. All experiments were done in HEK293-rtTA3 cell lines. Transfections were performed using Attractene reagent (QIAGEN). Cells were seeded the day before at 2×105 cells per well in a 24-well plate. Dosages of plasmids used for the transfections were identified after optimization experiments for each component of the devices and circuits (data not shown). For transfections involving the repression devices, 500 ng of input gRNA plasmid was mixed with a cocktail of other plasmids (ratio of 1x:4x:14x:4x for Ga14VP16-2A-rtTa3 plasmid, EYFP (output) expression plasmid, Cas9m-BFP expression plasmid and mKate expression plasmid, respectively, where x=5 ng) in 70 μl of DMEM (without supplements). For transfection of the cascade circuits of two U6-based devices, 500 ng of the stage 1 gRNA-encoding plasmid was mixed with a cocktail of other plasmids (ratio of 2x:x:14x:10x:5x for Ga14VP16-2A-rtta3 plasmid, EYFP (output) expression plasmid, Cas9m-BFP expression plasmid, stage 2 gRNA plasmid and mKate expression plasmid, respectively, where x=5 ng). For transfections of the cascade circuits of other devices the concentration of the stage 2 gRNA encoding plasmid was twice the value of stage 2 gRNA in U6-only cascades. In control experiments, we replaced the DNA plasmid under study with an equivalent amount of empty DNA plasmid to maintain the total amount of transfected DNA constant among the groups. 1.5 ml of Attractene was added to DNA mixtures, and the tube was gently mixed and kept at room temperature for 20 min to form the DNA-liposome complex. Fresh medium was added to the cells directly before transfection (500 ml of DMEM with supplements). The DNA-Attractene solution was then added drop-wise to the wells. Induction of the circuit was performed at this time as well by addition of doxycycline. In experiments involving the cascade, the ratio of stage 1 gRNA encoding plasmid to the stage 2 gRNA encoding plasmid was 5:1, except for U6-only cascades in which the ratio was 10:1.
Plasmids.
Plasmids used for this project were constructed using the Gateway system (Invitrogen). A plasmid encoding catalytically mutant Cas9 fused to BFP was obtained from Addgene (plasmid 46910). The expression vectors were made by Gateway cloning. The U6-driven gRNA expression cassettes were ordered as gblocks from IDT and cloned into a pCR2.1-TOPO TA vector by Topo TA cloning. The library of CRPs were ordered as gene fragments from IDT and assembled into an appropriate promoter entry vector. igRNA library elements were also ordered as gblocks from IDT and assembled into the mKate entry vector by appropriate restriction digest. Sequences are exemplified below.
Flow Cytometry.
Flow cytometry data were collected 48 h after transfection. ells were trypsinized and centrifuged at 453 g for 5 min t 4° C. The supernatant was then removed, and the cells were resuspended in Hank's Balanced Salt Solution without calcium or magnesium supplemented with 2.5% FBS. BD LSRII was used to obtain low cytometry measurements with the following settings: EBFP, easured with a 405 nm laser and a 450/50 filter; EYFP, measured with a 488 nm laser and a 530/30 filter; mKate, measured with a 61 nm laser and a 695/40 filter. At least 100,000 events were gathered from each sample, ensuring that any 1/10 decade interval with more than 5% of the mean density of events would contain at least 00 expected events.
Statistical Analysis.
Flow cytometry data were converted from arbitrary units to compensated molecules of equivalent fluorescein (MEFL) using the tool-chain to accelerate synthetic biological engineering (TASBE) characterization method (MIT CSAIL Tech. Report 2012-008 (2012). An affine compensation matrix is computed from single positive and blank controls. FITC measurements are calibrated to MEFL using SpheroTech RCP-30-5-A beads, and mappings from other channels to equivalent FITC are computed from cotransfection of DNA encoding constitutively expressed constitutive EBFP, EYFP and mKate (plus iRFP, for four-color experiments) each controlled by the Hef1a promoter on its own otherwise identical plasmid. Nontransfected controls were included in each experiment. MEFL data are segmented by constitutive fluorescent protein expression into logarithmic bins at 10 bins per decade, and geometric mean and variance are computed for those data points in each bin. Based on the observed constitutive fluorescence distributions (
Data shown in the figures are geometric mean and s.d. of means for cells expressing the transfection marker mKate based on the MEFL threshold set. High outliers were removed by excluding all bins without at least 100 data points. Both population and per-bin geometric statistics were computed over this filtered set of data. Sample sizes were predetermined for each experiment based on initial pilot experiments. We also ensured that we gathered at least 100,000 flow cytometry events per technical replicate. During analysis of flow cytometry data, samples were excluded by the following predetermined criteria: if they contained less than 10% of the number of events or less than 10% of the fraction of successful transfections of the mode for the batch in which they were collected.
GAACATGTGTTTAAGAGCTATGCTGGAAACAGCAGAAATAGCAAGTTTAA
TGTGTTTAAGAGCTATGCTGGAAACAGCAGAAATAGCAAGTTTAAATAAG
GAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA
AAGTGGCACCGAGTCGGTGCTACTAACTCTCGAGTCTTCTTTTTTTTTTT
CACAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTG
TGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAA
CTTGAAAAAGTGGCACCGAGTCGGTGCTACTAACTCGAGTCTTCTTTTTT
TTTTTCACAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGG
AGTGGTCCTATAGAACCGATCCTCCCATGTTTTAGAGCTAGAAATAGCAA
GTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG
GTGCTACTAACTCTCGAGTCTTCTTTTTTTTTTTCACAGGACGCAGGCTT
AGTGGTCCTACCTCATCAGGAACATGTGTTTTAGAGCTAGAAATAGCAAG
TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGG
TGCTACTAACTCTCGAGTCTTCTTTTTTTTTTTCACAGGACGCAGGCTTC
)
)
)
)
)
All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The term “or” is generally employed in its sense including “and/or” unless the content clearly dictates otherwise.
It should be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended (including but not limited to). Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should also be understood that all open-ended transitional phrases may be substituted with closed or semi-closed transitional phrases. Thus, the term “comprising” may be substituted with “consisting of” or “consisting essentially of.”
All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
This application claims the benefit under 35 U.S.C. §119(e) from U.S. provisional application No. 62/156,555, filed May 4, 2015, which is incorporated by reference herein in its entirety.
This invention was made with Government support under Grant Nos. P50 GM098792 and R01 CA155320 awarded by the National Institutes of Health and under Grant No. W911NF-11-2-0054 awarded by the Army Research Office. The Government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62156555 | May 2015 | US |
