TREA

Genes for diagnosing colorectal cancer

Follow

Information

  • Patent Application
  • 20050191634
  • Publication Number
    20050191634
  • Date Filed
    February 26, 2004
    20 years ago
  • Date Published
    September 01, 2005
    18 years ago
Information
Abstract
This invention relates to provide the genes for diagnosing colorectal cancer, the gene sequences searching comprise the steps of: (1) deriving epithelium cells from normal intestines, polypus of intestines and colorectal cancer tissue; (2) collecting genes with highly differential gene expression by Suppression Subtractive Hybridization (SSH), and building library; (3) deriving colonies with relatively high signal intensities from cancer tissue; (4) collecting more clinically cancer tissues by Northern Hybridization, real-time Polymerase Chain Reaction (PCR) combined with analysis of bioinformation to affirm variation between differential gene expression; and (5) selecting the most suitable genes from said library, and using the gene sequence as reagent provides the effects of early diagnosis, specificity, highly sensitivity and safety.
Description
FIELD OF THE INVENTION

This invention relates to genes for diagnosing colorectal cancer, particularly provided a method of clinical diagnosis for colorectal cancer which enables the effects of early diagnosis, specificity, highly sensitivity and safety.


BACKGROUND OF THE INVENTION

Colorectal cancer is one of the most common malignant tumors of the world, it is the second most frequent cause of malignant tumor related mortality in developed countries. In developed countries, mortality rate caused by colorectal cancer seems have a descending tendency progressively in previous 20 years, the main causes for early diagnosis is provided and the improvement of methods of therapy and medicines. But in Taiwan the reason of changing in diet habit is occidental habit input and the rapid changing in environment, the rate of suffering for colorectal cancer is rising constantly, furthermore, also showing an age-descending tendency.


According to top ten related cancer of Taiwanese of 2002, colorectal cancer (CRC) is the third leading cause of cancer-related death for male and female, which is announced by The Department of Health (DOH), highest level of the executive branch, Taiwan. About 6681 new cases of colorectal cancer diagnosed per year such as statistical data by DOH of 1999, for 3649 patients dead in the colorectal cancer per year such as statistical data by DOH of 2002 In Taiwan. The average age of colorectal cancer patient is lower than other countries. In other words, twenty-year-old or thirty-year-old people suffer from the colorectal cancer in Taiwan. Therefore, we can't ignore the possibility of the colorectal cancer caused by young person.


Although methods of diagnosis and surgical operation treatment are improved for colorectal cancer patients, if make a comparison between early diagnosis with later period diagnosis by surgical operation respectively, the treatment is able to probably overcome the colorectal cancer in early diagnosis, but is not able to absolutely overcome the colorectal cancer in the later period diagnosis. The far metastasis are main problem of the treatment for the colorectal cancer, therefore, if a method with highly sensitivity, highly specificity and easily diagnosis which is able to detect early and potentially curable CRC, We believe that is a novel target for CRC diagnosis and therapy.


The present invention is to provide functional genetic method, for diagnostic genes of colorectal cancer consist of 71 types of genes, that can be applied for early diagnosing possibility of recurrence and metastasis for colorectal patients. Simultaneously, tracing 100 colorectal cancer cases, found that 92% genes variation in colorectal tissue. In the process of tracing for 100 colorectal cancer cases simultaneously, mutation of genes is found in 92% colorectal cancer tissues. In the tracing process, although CEA of 16 patients still in normal value range, that detect early tumor cells in blood by using genes variation testing.


In WO0055351, ROSEN CRAIG A et. al., “Human Colon Cancer Associated Gene Sequences And Polypeptides”, disclose colon cancer related polynucleotides and the polypeptides encoded by the polynucleotides herein collectively known as “colon cancer antigens”, screening methods for identifying agonists and antagonists of colon cancer antigens of the invention, But, the present invention is to provide SSH and cDNA microarray technology to identify candidate marker genes which are overexpressed continuously from colorectal proliferous polypus to colorectal oncogene, detecting overexpressed genes are selected from up regulation genes which related intently in colorectal cancer oncogene, and down regulation genes which related in colorectal cancer oncogene. The total 71 genes are used to diagnosing early colorectal cancer.


SUMMARY OF THE INVENTION

Therefore, the main purpose according to this present invention is to provide the methods of clinical diagnosis for colorectal cancer for early diagnosis, specificity, highly sensitivity and safety.


For the purpose stated above, the gene sequences comprise the steps of: (1) deriving epithelium cells from normal intestines, polypus of intestines and colorectal cancer tissue; (2) collecting genes with highly differential gene expression by Suppression Subtractive Hybridization (SSH), and building library; (3) deriving colonies with relatively high signal intensities from cancer tissue; (4) collecting more clinically cancer tissues by Northern Hybridization, real-time Polymerase Chain Reaction (PCR) combined with analysis of bioinformation to affirm variation between differential gene expression; and (5) selecting the most suitable genes from said library. Moreover, the reagent uses the gene sequence as method of clinical diagnosis for colorectal cancer to the early diagnosis.




BRIEF DESCRIPTION OF THE DRAWINGS

The present invention will be better understood from the following detailed description of preferred embodiments of the invention, taken in conjunction with the accompanying drawings, in which.


Table 1 is a table showing the result of clinical examination of colorectal cancer biochip;



FIG. 1 is a view showing the procedure of deriving genes according to the present invention;



FIG. 2
a and FIG. 2b are views showing the primary screening according to the present invention;



FIG. 3
a and FIG. 3b are views showing affirmation to genes using Northern Blotting method according to the present invention;



FIGS. 4
a and 4b are views showing quantity expression of cancer tissue according to the present invention; and



FIG. 5 is a diagram showing second preferred embodiments according to the present invention.




DESCRIPTION OF THE PREFERRED EMBODIMENTS

The following descriptions of the preferred embodiments are provided to understand the methods and the procedures of the present invention. Please refer to FIG. 1, showing the procedure of searching genes according to the present invention. Said procedure comprise the steps of: (1) deriving epithelium cells from normal intestines, polypus of intestines and colorectal cancer tissue; (2) collecting genes with highly differential gene expression by Suppression Subtractive Hybridization (SSH), and building library; (3) deriving colonies with relatively high signal intensities from cancer tissue; (4) collecting more clinically cancer tissues by Northern Hybridization, real-time Polymerase Chain Reaction (PCR) combined with analysis of bioinformation to affirm variation between differential gene expression; and (5) selecting the most suitable genes from said library. Moreover, by using the gene sequence as a reagent, this enables clinical diagnosis for colorectal cancer to the effects of early diagnosis, specificity, highly sensitivity and safety.


The genes for diagnosing colorectal cancer, the specific oligonucleotides sequence are selected from the group consisting of:

NoHs IDACC NoDiscriptionDefinitionOligo sequence1Hs.107213BC027178FNBP3Homo sapiens,CATCATAGGAA(SEQUENCEForminformin bindingACGTTCCCGCTLISTING 72)bindingprotein 3, cloneCTCGATCGGGGprotein 3MGC: 16979TCAGATTCAGATIMAGE: 4343048,GATGATGmRNA,(SEQUENCEcomplete cdsLISTING 1)2Hs.123107NM_002257KLK1Homo sapiensGCCTTCTGTCG(SEQUENCEKallikrein 1,kallikrein 1,CCGTCAGAGTGLISTING 73)renal/pancreas/renal/pancreas/CTGTCTTATGTGsalivarysalivary (KLK1),AAGTGGATCGAmRNA.GGACA(SEQUENCELISTING 2)3Hs.1369NM_000574DAF DecayHomo sapiensGGGCAGTCAAT(SEQUENCEacceleratingdecayGGTCAGATATTLISTING 74)factor foracceleratingGAAGAGTTCTGcomplementfactor forCAATCGTAGCT(CD55,complementGCGAGGTGCromer blood(CD55, Cromer(SEQUENCEgroupblood groupLISTING 3)system)system) (DAF),mRNA4Hs.151254NM_005046KLK7Homo sapiensTGGAACCACCT(SEQUENCEKallikrein 7kallikrein 7GTACTGTCTCCLISTING 75)(chymotryptic,(chymotryptic,GGCTGGGGCACstratumstratumTACCACGAcorneum)corneum)(SEQUENCE(KLK7),LISTING 4)transcript variant1, mRNA.5Hs.1526NM_001681ATP2A2Homo sapiensCATCGGCATCT(SEQUENCEATPase,ATPase, Ca++TCGGGCAGGATLISTING 76)Ca++transporting,GAGGACGTGACtransporting,cardiac muscle,GTCAAAAGCTTTcardiacslow twitch 2CACAGmuscle, slow(ATP2A2),(SEQUENCEtwitch 2mRNALISTING 5)6Hs.184270NM_006135CAPZA1Homo sapiensTGACCACTTAC(SEQUENCECappingcapping proteinGGAAAGAAGCALISTING 77)protein actin)(actin filament)AGTGACCCCCAfilament)muscle Z-line,GCCAGAAGAAGmuscle Z-alpha 1CAGATGline, alpha 1(CAPZA1),(SEQUENCEmRNA.LISTING 6)7Hs.2043NM_001151SLC25A4Homo sapiensAGATCTTCAAGT(SEQUENCESolute carriersolute carrierCTGATGGCCTGLISTING 78)family 25family 25AGGGGGCTCTA(mitochondrial(mitochondrialCCAGGGTTTCAcarriercarrier; adenineACGTCadeninenucleotide(SEQUENCEnucleotidetranslocator),LISTING 7)translocator),member 4member 4(SLC25A4),nuclear geneencodingmitochondrialprotein, mRNA.8Hs.267871NM_005177ATP6V0A1Homo sapiensGGACAGAAAGG(SEQUENCEATPase, H+ATPase, H+AATTCAGTGTTTLISTING 79)transporting,transporting,CCTGGTAGTGGlysosomal V0lysosomal V0TTGCACTACTGTsubunit asubunit aGTGTACCTTGGisoform 1isoform 1(SEQUENCE(ATP6V0A1),LISTING 8)mRNA.9Hs.4935D79998KIAA0176Human mRNAGGAAAGGATAC(SEQUENCEKIAA0176for KIAA0176GGGACAATGAGLISTING 80)proteingene, partial cdsAACAGAACTTCACAAGGCCCCGTGAAGC(SEQUENCELISTING 9)10Hs.5509NM_006495EVI2BHomo sapiensGCCCCTGCCAC(SEQUENCEEcotropicecotropic viralCAGTAGATTTTALISTING 81)viralintegration siteTGAAAAACCAAintegration2B (EVI2B),GAAGATTCCAAsite 2BmRNA.CCTTGAGATCCAGTGTC(SEQUENCELISTING 10)11Hs.5662NM_006098GNB2L1Homo sapiensATGACTGAGCA(SEQUENCEGuanineguanineGATGACCCTTCLISTING 82)nucleotidenucleotideGTGGCACCCTCbindingbinding proteinAAGGGCCACAAprotein (G(G protein), betaCprotein), betapolypeptide 2- (SEQUENCEpolypeptidelike 1 (GNB2L1),LISTING 11)2-like 1mRNA.12Hs.75990NM_005143HPHomo sapiensAGGCTGTTGGA(SEQUENCEHaptoglobinhaptoglobinGATAAACTTCCTLISTING 83)(HP), mRNA.GAATGTGAAGCAGATGACGGCTGCCCG(SEQUENCELISTING 12)13Hs.83384NM_006272S100B S100Homo sapiensCCGAACTCAAG(SEQUENCEcalciumS100 calciumGAGCTCATCAALISTING 84)bindingbinding protein,CAATGAGCTTTCprotein, betabeta (neural)CCATTTCTTAGA(neural)(S100B), mRNAGGAAATCAAAGAGCAGGAG(SEQUENCELISTING 13)14Hs.10029NM_001814CTSCHomo sapiensCACCGGAAAGA(SEQUENCECathepsin Ccathepsin CAGGTGGGAACTLISTING 85)(CTSC), mRNAGCCTCTGAGAATGTGTATGTCAACACAGC(SEQUENCELISTING 14)15Hs. 103982NM_005409SCYB11Homo sapiensGGGCATGGCTA(SEQUENCESmallsmall inducibleTAGCCTTGGCTLISTING 86)induciblecytokineGTGATATTGTGTcytokinesubfamily BGCTACAGTTGTTsubfamily B(Cys-X-Cys),CAAGGC(Cys-X-Cys),member 11(SEQUENCEmember 11(SCYB11),LISTING 15)mRNA.16Hs.12314AL049397HomoHomo sapiensCAACACCACAG(SEQUENCEsapiensmRNA; cDNAACAGCTGCAGGLISTING 87)mRNA; cDNADKFZp586C1019ACTCGATATCCADKFZp586C1019(from cloneTGGCTTCTTTCC(fromDKFZp586C1019)ATCACclone(SEQUENCEDKFZp586C1019)LISTING 16)17Hs.150557NM_001206BTEB1 BasicHomo sapiensTTCCACCCCAG(SEQUENCEtranscriptionbasicCATGATCAAGCLISTING 88)elementtranscriptionGATCGAAAAAGbindingelement bindingGCGCTGGCCAAprotein 1protein 1CGCTTT(BTEB1),(SEQUENCEmRNA.LISTING 17)18Hs.169266NM_000909NPY1RHomo sapiensCCGGTCTCGGG(SEQUENCENeuropeptideneuropeptide YATGATGATTATGLISTING 89)Y receptor Y1receptor Y1AAACAATAGCC(NPY1R),ATGTCCACGATmRNA.GCACACAG(SEQUENCELISTING 18)19Hs.1827NM_002507NGFR NerveHomo sapiensCAAGCGGGAGG(SEQUENCEgrowth factornerve growthAGGTGGAGAAGLISTING 90)receptorfactor receptorCTTCTCAACGG(TNFR(TNFRCTCTGCGsuperfamily,superfamily,(SEQUENCEmember 16)member 16)LISTING 19)(NGFR), mRNA.20Hs.1869NM_002633PGM1Homo sapiensGCCAACGGGAT(SEQUENCEPhosphoglucomu-phosphoglucomu-CGGTCGCTTGGLISTING 91)tase 1tase 1 (PGM1),TTATCGGACAGmRNA.AATGGAATCCTCTCCA(SEQUENCELISTING 20)21Hs.194148NM_005433YES1 V-yes-Homo sapiensCAAGTGTGAGC(SEQUENCE1 Yamaguchiv-yes-1CATTATGGAGCLISTING 92)sarcoma viralYamaguchiAGAACCCACTAoncogenesarcoma viralCAGTGTCACCAhomolog 1oncogeneTGTCCGhomolog(SEQUENCE1(YES1), mRNALISTING 21)22Hs.2352X74210ADCY2H. sapiensTCGTCTGCTTTG(SEQUENCEAdenylatemRNA forCTGGACAGCTTLISTING 93)cyclase 2adenylyl cyclaseCTGCAATGCAG(brain)CAAAAAAGCCTCTCCC(SEQUENCELiSTING 22)23Hs.246885NM_017958FLJ20783Homo sapiensCCAAGATTCTA(SEQUENCEHypotheticalhypotheticalGGACAAACACALISTING 94)proteinproteinGCGTATGTGGGFLJ20783FLJ20783CTCTGCAGTCA(FLJ20783),TGACCGmRNA.(SEQUENCELISTING 23)24Hs.29665NM_014944CLSTN1Homo sapiensCACGAGCCCTT(SEQUENCECalsyntenin 1calsyntenin 1CTCTGTGACTGLISTING 95)(CLSTN1),AGGATTACCCGmRNA.CTCCATCCATCCAAGAT(SEQUENCELISTING 24)25Hs.3235NM_002272KRT4 KeratinHomo sapiensTTCAGCTGTGG(SEQUENCE4keratin 4CTCGGCCATTGLISTING 96)(KRT4), mRNATAGGCGGTGGCAAGAGAGGT(SEQUENCELISTING 25)26Hs.55209AF327354HomoHomo sapiensTAAAGTGGGCT(SEQUENCEsapiens DMRDMR proteinCATTGTCATCCCLISTING 97)proteinmRNA,CAAGCCAGGCCmRNA,complete cdsAGTTCTCCAGGcomplete cdsTGGAA(SEQUENCELISTING 26)27Hs.585NM_000384APOBHomo sapiensGCCCAAGGCCA(SEQUENCEApolipoproteinapolipoprotein BCAGGGGTCCTTLISTING 98)B (including(including Ag(x)TATGATTATGTCAg(x)antigen)AACAAGTACCAantigen)(APOB), mRNACTGGG(SEQUENCELISTING 27)28Hs.62187AF022913PIGKHomo sapiensTCTTGTCCTTCG(SEQUENCEPhosphati-GPIGCAGCGTGGCCLISTING 99)dylinositoltransamidaseGCTAGTCATATCglyan, classmRNA,GAGGATCAAGCKcomplete cdsAGAA(SEQUENCELISTING 28)29Hs.63290NM_012260HPCL2 2-Homo sapienCATGAACTGCT(SEQUENCEhydroxyphy-2-GGCCCTTGCTTLISTING 100)tanoyl-CoAhydroxyphy-GTGATTGGTGGlyasetanoyl-CoA lyaseTTCCTCTGAAAG(HPCL2), mRNAAAACCAAG(SEQUENCELISTING 29)30Hs.699NM_000942PPIBHomo sapiensAGCCGGGATAA(SEQUENCEPeptidylprolylpeptidylprolylACCCCTGAAGGLISTING 101)isomerase Bisomerase BATGTGATCATC(cyclophilin(cyclophilin B)GCAGACTGCGGB)(PPIB), mRNACAAGAT(SEQUENCELISTING 30)31Hs.74111NM_007367RALY RNAHomo sapiensAGCGAGGAAGA(SEQUENCEbindingRNA bindingGCTGGAACACALISTING 102)proteinproteinGCCAGGACACA(autoantigen-(autoantigenic,GACGCGGATGAic, hnRNP-hnRNP-Tassociatedassociated with(SEQUENCEwith lethallethal yellow)LISTING 31)yellow)(RALY)transcript variant2, mRNA32Hs.75103NM_003406YWHAZHomo sapiensCGGAAGGTGCT(SEQUENCETyrosine 3-tyrosine 3-GAGAAAAAACALISTING 103)monooxygen-monooxygenase/GCAGATGGCTCase/tryptophan/tryptophan 5-GAGAATACAGA5-monooxygenaseGAGAAAATTGAmonooxygen-activationGACGGase activationprotein, zeta(SEQUENCEprotein, zetapolypeptideLISTING 32)polypeptide(YWHAZ),mRNA33Hs.75117NM_004515ILF2Homo sapiensTGACTTCTATTT(SEQUENCEInterleukininterleukinGTGTGAAATGGLISTING 104)enhancerenhancerCCTTTCCCCGGbinding factorbinding factor 2,GTCAAGCCAGC2, 45 kD45 kD (ILF2),ACCTGmRNA(SEQUENCELISTING 33)34Hs.75236NM_021952ELAVL4Homo sapiensGCACCATGGAG(SEQUENCEELAVELAVCCTCAGGTGTCLISTING 105)(embryonic(embryonicAAATGGTCCGAlethal,lethal, abnormalCATCCAATACAAabnormalvision,GCAATGvision,Drosophila)-like(SEQUENCEDrosophila)-4 (Hu antigen D)LISTING 34)like 4 (Hu(ELAVL4),antigen D)mRNA35Hs.75258NM_004893H2AFY H2AHomo sapiensCACCGAAGCCA(SEQUENCEhistoneH2A histoneGGAAGCCCCGTLISTING 106)family,family, memberTTGTAAGCGTGmember YY (H2AFY),TGTTGTGGTGCtranscript variantTTTATT2, mRNA(SEQUENCELISTING 35)36Hs.75498NM_004591SCYA20Homo sapiensGCTACTCCACC(SEQUENCESmallsmall inducibleTCTGCGGCGAALISTING 107)induciblecytokineTCAGAAGCAGCcytokinesubfamily AAAGCAACTTTGAsubfamily A(Cys—Cys),CTGCT(Cys—Cys),member 20(SEQUENCEmember 20(SCYA20),LISTING 36)mRNA37Hs.76913NM_002790PSMA5Homo sapiensGTTTCTTACCCG(SEQUENCEProteasomeproteasomeGTCTGAGTACGLISTING 108)(prosome,(prosome,ACAGGGGCGTGmacropain)macropain)AATACTTTTTCTsubunit,subunit, alphaCCCGalpha type, 5type, 5(SEQUENCE(PSMA5),LISTING 37)mRNA38Hs.79889NM_012329MMDHomo sapiensGCTATGAACAT(SEQUENCEMonocyte tomonocyte toGCTGCTAACTGLISTING 109)macrophagemacrophageTTACACACACGdifferentiation-differentiation-CATTCCTCATTGassociatedassociatedTTCCGGCC(MMD), mRNA(SEQUENCELiSTING 38)39Hs.82173NM_005655TIEG TGFBHomo sapiensTTTGTGGTACC(SEQUENCEinducibleTGFB inducibleCCAGCCCGTTGLISTING 110)early growthearly growthTGCAGAGTTCAresponseresponseAAGCCTCCGGT(TIEG) MrnaG(SEQUENCELISTING 39)40Hs.84072NM_004616TM4SF3Homo sapiensGCAATGACTCT(SEQUENCETransmembranetransmembraneCAAGCAATTTTTLISTING 111)44 superfamilyGGTTCTGAAGAsuperfamilymember 3TGTAGGCTCTAmember 3(TM4SF3),GCTCCTACGTTmRNAGCTGTG(SEQUENCELISTING 40)41Hs.85146NM_005239ETS2 V-etsHomo sapiensCTCATGACTCC(SEQUENCEerythroblastosisv-etsGCCAACTGTGALISTING 112)virus E26erythroblastosisATTGCCTTTGTToncogenevirus E26AACCCCGTGCAhomolog 2oncogeneGCAAG(avian)homolog 2(SEQUENCE(avian) (ETS2),LISTING 41)mRNA42Hs.85844NM_002529NTRK1Homo sapiensTTCATGGACAA(SEQUENCENeurotrophicneurotrophicCCCTTTCGAGTTLISTING 113)tyrosinetyrosine kinase,CAACCCCGAGGkinase,receptor, type 1ACCCCATCCCTreceptor, type(NTRK1), mRNAGTCT1(SEQUENCELISTING 42)43Hs.88219NM_003454ZNF200 ZincHomo sapiensCCCAGTCAGAA(SEQUENCEfinger proteinzinc fingerAGTCAAGGAGALISTING 114) 200protein 200CCTTGGTTATTA(ZNF200),TGAAAGATGTGmRNAAGCTCAAGCCTTCAGAACAG(SEQUENCELISTING 43)44Hs.9914NM_006350FSTHomo sapiensCCCTGACAGTA(SEQUENCEFollistatinfollistatin (FST),AGTCGGATGAGLISTING 115)transcript variantCCTGTCTGTGCFST317, mRNACAGTGACAATGCCACTT(SEQUENCELISTING 44)45Hs.169319NM_003419ZNF345 ZincHomo sapiensCAGGGATCTCA(SEQUENCEfinger proteinzinc fingerGGAAGGACATTLISTING 116)345protein 345TCAGTGAAATG(ZNF345),ATATTTACTCCTmRNAGAAGACATGCCCACTTTCAG(SEQUENCELISTING 45)46Hs.72805NM_030921DC42Homo sapiensGGCATGGCAGC(SEQUENCEHypotheticalhypotheticalAAATGCCAACATLISTING 117)protein DC42protein DC42TTTGTGGAATAG(DC42), mRNACAGCAAATCTACAAGAGACCCTGG(SEQUENCELISTING 46)47HS.108301NM_003297NR2C1Homo sapiensGACACCTACAG(SEQUENCENuclearnuclear receptorGTTATCCAGACTLlSTING 118)receptorsubfamily 2,ACTACTCAGATTsubfamily 2,group C,GCCAGCTTTAAgroup C,member 1GACTGATGAATmember 1(NR2C1), mRNAGCTACCATC(SEQUENCELISTING 47)48Hs.177926NM_030941LOC81691Homo sapiensCCCAGTGACGA(SEQUENCEExonucteaseexonucleaseCCAAACTCAAALISTING 119)NEF-spNEF-spGATGTACAGAG(LOC81691),GCAGTTAAAAGmRNACACTGCTTCCTC(SEQUENCELISTING 48)49Hs.194746NM_018896CACNA1GHomo sapiensACGTCAGAGAT(SEQUENCECalciumcalciumTGTGTCTGAACLISTING 120)channel,channel,CGTCCTGCTCTvoltage-voltage-CTAGCTCTGACdependent,dependent,GGATGAalpha 1Galpha 1G(SEQUENCEsubunitsubunitLISTING 49)(CACNA1G),mRNA50Hs.209061NM_003831SUDD SudDHomo sapiensTCACGGCCTGG(SEQUENCEsuppressor ofsudDAGTTCTTGTTCCLISTING 121)bimD6suppressor ofGGGACTGCAGGhomolog (A.bimD6 homologAATGTCTCGCAnidulans)(A. nidulans)GTT(SUDD), mRNA(SEQUENCELISTING 50)51Hs.25087NM_006070TFG TRK-Homo sapiensTAATCCTTATGC(SEQUENCEfused geneTRK-fused geneGCGTAACCGTCLISTING 122)(TFG), mRNACTCCCTTTGGTCAGGGCTATACCCAAC(SEQUENCELISTING 51)52Hs.3017NM_003284TNP1Homo sapiensGATCAAAGCCA(SEQUENCETransitiontransition proteinGAGAGGAGCCTLISTING 123)protein 11 (duringATGGAATGTGG(duringhistone toATCAAATGCCAhistone toprotamineGTTGTGACGprotaminereplacement)(SEQUENCEreplacement)(TNP1), mRNALISTING 52)53Hs.283664NM_032466ASPHHomo sapiensGAACCACAACA(SEQUENCEAspartateaspartate beta-AGAGGATGATGLISTING 124)beta-hydroxylaseAGTTTCTTATGGhydroxylase(ASPH),CGACTGATGTAtranscript variantGATGATAGATTT3, mRNAGAGACCCTGG(SEQUENCELISTING 53)54Hs.283664NM_032467ASPHHomo sapiensCTCAGGGAGAT(SEQUENCEAspartateaspartate beta-GGATTTGCTCGLISTING 125)beta-hydroxylaseTTGTTTTCTTCChydroxylase(ASPH),CTCCTTCCCCTTtranscript variantCCTG4, mRNA(SEQUENCELISTING 54)55Hs.171992NM_002843PTPRJHomo sapiensCCGTGGATGTG(SEQUENCEProteinprotein tyrosineTATGGGATTGTLISTING 126)tyrosinephosphatase,GTATGACCTTCphosphatase,receptor type, JGAATGCATAGGreceptor type,(PTPRJ), mRNACCTTTAATGGTGJC(SEQUENCELISTING 55)56Hs.155172NM_003664AP3B1adaptor-relatedGCCCAGCTTAT(SEQUENCEprotein complexCATAAACACTGALISTING 127)3, beta 1 subunitGAAAACTGTGATTGGCTCTGTTCTGCTGCGGG(SEQUENCELISTING 56)57Hs.183418M37712CDC2L2cell dividionCGAGAAAATGA(SEQUENCEcycle2-like2AAACCACCTCTTLISTING 128)GGTTGTTCCAGAGTCACGGTTCGACCGAG(SEQUENCELISTING 57)58Hs.244473NM_031900AGXT2alanine-TCCGGGATTGT(SEQUENCEglyoxylateTACTGTCAGTGTLISTING 129)aminotransferaseTGGCCATTGCC2ACCCAAAGGTGAATGC(SEQUENCELISTING 58)59Hs.12835NM_004842AKAP7A kinaseGAGCCCGATGA(SEQUENCE(PRKA) anchorCGCTGAACTAGLISTING 130)protein 7TAAGGCTCAGTAAGAGGCTGGTGGAGAA(SEQUENCELISTING 59)60Hs.1650NM_000111SLC26A3solute carrierTCAGCCCCCTA(SEQUENCEfamily 26,TTACACCTGACLISTING 131)member 3GTGGAGACTTTCCAAAACACCGTAGGAG(SEQUENCELISTING 60)61Hs.29981NM_000112SLC26A2solute carrierCAGCAGGGATC(SEQUENCEfamily 26CACACACTGAALISTING 132)(sulfateAGAAGTTCGCAtransporter),GAGATTATGAAmember 2GCCATTGGAATCC(SEQUENCELISTING 61)62Hs.2246NM_001308CPN1carboxypeptidaseTCAAGTAAGCC(SEQUENCEN, polypeptideCTGTGAGGAGALISTING 133)1, 50 kDGCTCCCAGCAGAAGGCACGGAGT(SEQUENCELISTING 62)63Hs.267871NM_005177ATP6V0A1ATPase, H+AAATGCTTGATT(SEQUENCEtransporting,GCAGAGGTCTGLISTING 134)lysosomal V0GTGCCCTGTCAsubunit aCCGACCTTGACisoform 1TCCAT(SEQUENCELISTING 63)64Hs.75445NM_004684SPARCL1SPARC-like 1CTGCGAGCATC(SEQUENCE(mast9, hevin)TCTGGTGCCCALISTING 135)TGGAACACTGCATAACCCGTTTCTTTGA(SEQUENCELISTING 64)65Hs.39957NM_016445PLEK2pleckstrin 2TGGCGTTCCCA(SEQUENCE(mouse)CTGGGGTTAAALISTING 136)homologGGGAATGTCCAGGGAAACCTCTTCAAAG(SEQUENCELISTING 65)66Hs.65029NM_002048GAS1growth arrest-CGACTACTACG(SEQUENCEspecific 1ATGAGGACTACLISTING 137)GATGACGAGCAGCGCACCGG(SEQUENCELISTING 66)67Hs.239926NM_006745SC4MOLsterol-C4-methylGCTGGTTCTCG(SEQUENCEoxidase-likeGCATCATGATTTLISTING 138)CCACCACATGAACTTCATTGGAAACTATGCTTCAAC(SEQUENCELISTING 67)68Hs.59271NM_006758U2AF1U2(RNU2) smallTCTGTGACAAC(SEQUENCEnuclear RNACTGGGAGACCALISTING 139)auxillary factor 1CCTGGTGGGGAACGTGTACGTCAAGTTT(SEQUENCELISTING 68)69Hs.8867NM_001554CYR61cysteine-rich,CAAAACGCAGC(SEQUENCEangiogenicCCTGCGACCACLISTING 140)inducer, 61ACCAAGGGGCTGGAATGCAACTT(SEQUENCELISTING 69)70Hs.50123NM_003452ZNF189zinc fingerCAACAGCGCAG(SEQUENCEprotein 189TCTTGTCAACCALISTING 141)TCAGATGATCCATGCAGAGGTGAAAACCC(SEQUENCELISTING 70)71Hs.82071NM_006079CITED2Cbp/p300-CACCAGATGAA(SEQUENCEinteractingCGGGACAAACCLISTING 142)transactivator,AGCACTTCCGAwith Glu/Asp-GATTGCAACCCrich carboxy-CAAGCAterminal domain,(SEQUENCE2LISTING 71)


From the above table, the HS ID of the 71 genes comprises:


Hs. 107213 Hs. 123107 Hs. 1369 Hs. 151254 Hs. 1526Hs. 184270 Hs. 2043 Hs. 267871 Hs. 4935 Hs. 5509 Hs. 5662 Hs. 75990 Hs. 83384 Hs. 10029 Hs. 103982 Hs. 12314 Hs. 150557 Hs. 169266 Hs. 1827 Hs. 1869 Hs. 194148 Hs. 2352 Hs. 246885 Hs. 29665 Hs. 3235 Hs. 55209 Hs. 585 Hs. 62187Hs. 63290 Hs. 699 Hs. 74111 Hs. 75103 Hs. 75117 Hs. 75236 Hs. 75258 Hs. 75498 Hs. 76913 Hs. 79889 Hs. 82173 Hs. 84072 Hs. 85146 Hs. 85844 Hs. 88219 Hs. 9914 Hs. 169319 Hs. 72805 Hs. 108301 Hs. 177926 Hs. 194746 Hs. 209061 Hs. 25087 Hs. 3017 Hs. 283664 Hs. 283664 Hs. 171992 Hs. 155172 Hs. 183418 Hs. 244473 Hs. 12835 Hs. 1650 Hs. 29981 Hs. 2246 Hs. 267871 Hs. 75445 Hs. 39957 Hs. 65029 Hs. 239926 Hs. 59271 Hs. 8867 Hs. 50123 Hs. 82071 etc.


We obtain said specific oligonucleotides sequences by using analysis of OMP (Oligonucleotide Modeling Platform, DNA Software, Inc., Ann Arbor, Mich.) DNA software, Said gene sequences can act as a reagent, a biochip and a medicine for detecting colorectal cancer shown in table 1.


According to the present invention, FIG. 2a and FIG. 2b are views showing the primary screening. FIG. 3a and FIG. 3b are views showing affirmation to genes using Northern Blotting method. FIGS. 4a and 4b are views showing quantity expression of cancer tissue we search over progressive distinctive new genes among the carcinoma process of colorectal cancer by using SSH method to build up CRA libraries and CRC libraries which make the comparison between adenoma, adenocarcinoma and normal tissue, that obtain over 5000 clones in per library; then randomly select about 3000 clones of cDNA from per library to dot on nylon membrane as pre-screen by using Colony Hybridization shown in FIG. 2a and FIG. 2b. The high expression colonies in colorectal cancer and adenoma are selected by the Colony Hybridization and then the nucleic acid of cDNA after purification spot on glass chip by using microarray testing.


The expression profiles of the cDNA chips were derived from a set of cDNA probes including adenoma, adenocarcinoma and the corresponding normal tissue from the same patient. Genes exhibiting at least three-fold greater intensities in the adenocarcinoma or adenoma than in corresponding normal tissue samples were considered significant. The significant up-regulated genes were then further confirmed by Northern blot (FIG. 3a and FIG. 3b) and subsequently sequenced. Northern analysis of each set of cDNA genes on the chip revealed that 36 genes were detected as up-regulated in adenoma compared to normal, and 54 genes were detected as up-regulated in carcinoma as compared to the normal control. A set of 23 genes with serial increase of genes expression from adenoma to carcinoma was identified.


Further, comparison is made by using EMBL/GenBank libraries of NCBI/BLAST program, there are 3 unknown functional genes among 23 identified genes including ectopic viral integration site 2B (Genbank accession no.NM-006495) Homo sapiens chromosome 21q22.1 anonymous mRNA sequence (Genebank accession no.AF003738) and Homo sapiens DMR protein mRNA (Genbank accession no.AF327354), and another 20 functional genes. Among these 20 functional genes, 6 genes are CRC-related (such as TM4SF3), 14 genes are CRC-unrelated (such as ATP2A2). Moreover, we obtain cDNAs of three patients who suffer from adenoma and adenocarcinama simultaneously and four colorectal cancer patients to affirm variation of 23 identified genes, result shown that were at least 3-fold higher in mRNA expression level in the adenocarcinoma tissues compared with normal samples, and the level gradually increased from colorectal adenomas to adenocarcinomas shown in FIG. 4a and FIG. 4b.


Now, methods of clinical diagnosis for detecting colorectal cancer are fecal occult blood test, image test, tumor label and colonoscopy. In each of these methods, we can generalize purpose of the present invention according to disadvantage of these methods.


1. Early Diagnosis


If patient undergo colorectal cancer before tumor cells spread out, five-year survival rate can be achieved over 90%. A certain number of tumor cells are needed for traditional detection by using tumor label method. In the case of image test, normally, correctly affirmation can be made easier when tumor become large. It is high invasion and price to make low acceptance for the patient in the colonoscopy that can not suitable for early diagnosis. Because of the process of circulating of tumor cells, different expression certainly happen among the genes. In the process of proliferation of early tumor cells, the dying cells cause molecule of ribonucleic acid to release into blood circulation. And, early diagnosis can be offered by the detection of using the constructed oligonucleotide biochip which is discharged from small number of tumor cells in the peripheral blood.


2. Specificity and Sensitivity


Fecal occult blood test has shortcomings for high false positives and false negatives to low specificity and sensitivity of the method, therefore the method is merely a first screening tool and the tumor label method is also not high specificity and sensitivity. But, we use these genes to detect peripheral blood of 100 CRC patients, peripheral blood of 50 healthy people and 40 other cancer-related patients as controls shown in FIG. 1, these genes can detect 88 colorectal cancer patients for remarkable sensitivity of 88% ( 88/100) and specificity of 90% ( 90/100) in the clinical analysis.


3. Safety


The colonoscopy has high invasion and price to make low acceptance for patient in the mass screening tool of early diagnosis. Because sample collection is convenience and low invasion, Peripheral blood test of patient is a diagnosis method of genes, that is suitable to mass screening clinical application.


Please refer to FIG. 5, showing another preferred embodiment according to the present invention. We choose genes of colorectal cancer and vector that express simultaneously in eukaryotic and prokaryotic to form recombination genes, and then form eukaryotic transformant cell by using and further form prokaryotic transfectant cell, and then obtain secreted protein by using extract of genes having said recombination genes, and obtain antibody from said secreted protein immune animals for making of protein testing reagent, colorectal vaccine and colorectal protein medicine for colorectal cancer.


The present invention may be embodied in other specific forms without departing from the spirit of the essential attributes thereof; therefore, the illustrated embodiment should be considered in all respects as illustrative and not restrictive, reference being made to the appended claims rather than to the foregoing description to indicate the scope of the invention.

TABLE 1Assessment of clinical testing result forcolorectal cancer biochipNo.AgeSexdiagnosisStageresult143FColon cancerC1P235FColon cancerB2P368MColon adenomaP456FColon cancerC2P532FColon cancerB1N665MColon cancerB2P746MColon cancerC1P867MColon cancerC1P958FColon cancerC1P1045MColon cancerB2P1162FColon adenomaP1264FColon cancerC2P1358FColon cancerAN1476MColon cancerC1P1538MColon cancerB2P1667MColon cancerC1P1786FColon adenomaP1847FColon cancerC2P1956MColon cancerB1P2067FColon cancerB2P2143FColon adenomaP2265MColon cancerAP2343FColon cancerC2P2454MColon cancerB1P2534FColon cancerB2P2676FColon adenomaP2766MColon cancerB2P2878FColon cancerB1P2957MColon cancerB2P3074MColon adenomaP3165FColon cancerB1P3264FColon cancerB2P3362MColon cancerB1P3446MColon cancerB2P3554FColon cancerB1P3658FColon cancerB1P3764FColon adenomaP3856MColon cancerB1P3967MColon cancerB2P4048FColon cancerB1P4155MColon cancerB1P4264FColon adenomaP4358FColon cancerC1P4465MColon cancerC1P4566MColon cancerC2P4643MColon cancerC1P4726FColon cancerC2P4854MColon cancerC1P4959FColon cancerC2P5071FColon adenomaN5137MColon cancerC1P5247FColon cancerC1P5362MColon cancerC2P5447MColon adenomaP5555FColon cancerB2P5648MColon cancerB1P5766FColon cancerB2P5864MColon cancerB1N5930MColon cancerB1P6056FColon cancerB2P6146MColon cancerB1P6267FColon cancerB2P6335MColon cancerB1P6445FColon cancerB1P6586FColon cancerB2P6654MColon cancerB1P6757MColon cancerC1P6876FColon cancerC2P6946MColon cancerC1P7068MColon cancerB2P7145FColon cancerB1P7287MColon cancerB1P7353MColon cancerC1P7458FColon cancerAP7554MColon cancerB1P7667FColon cancerC2P7756FColon cancerAN7835MColon adenomaP7979FColon cancerB2P8082MColon cancerC2P8176MColon cancerC2P8254FColon cancerC1P8342MColon cancerB1P8468MColon cancerB1P8527MColon cancerB2P8667FColon cancerB2P8746MColon adenomaN8876FColon cancerB1P8944MFColon cancerB1P9056FColon cancerB2P9165MColon cancerC2P9257FColon cancerC1P9367MColon cancerB1P9478FColon adenomaP9556FColon cancerC1P9656MColon cancerC1P9745FColon cancerB1P9863FColon cancerB2P9962MColon cancerC2P10054FColon cancerC1P















Controls











NO
Age
Sex
Diagnosis
result














1
76
F
Breast cancer
N


2
35
F
Breast cancer
N


3
74
F
Breast cancer
P


4
57
F
Gastric cancer
N


5
87
F
Breast cancer
N


6
55
M
Gastic cancer
N


7
35
M
NPC
N


8
78
F
Breast cancer
N


9
65
M
NPC
N


10
55
F
Breast cancer
N


11
54
M
NPC
N


12
67
F
normal
N


13
86
M
Gastic cancer
P


14
53
F
NPC
N


15
58
F
normal
N


16
78
F
Breast cancer
N


17
45
M
normal
N


18
78
F
normal
N


19
87
F
normal
N


20
45
M
normal
N









Claims
  • 1. Genes for diagnosing colorectal cancer, the gene sequences searching comprising the steps of: (1) deriving epithelium cells from normal intestines, polypus of intestines and colorectal cancer tissue; (2) collecting genes with highly differential gene expression by Suppression Subtractive Hybridization (SSH), and building library; (3) deriving colonies with relatively high signal intensities from cancer tissue; (4) collecting more clinically cancer tissues by Northern Hybridization, real-time Polymerase Chain Reaction (PCR) combined with analysis of bioinformation to affirm variation between differential gene expression; and (5) selecting the most suitable genes from said library.
  • 2. Genes for diagnosing colorectal cancer, the gene sequences are selected from the group consisting of: (1) A gene sequence as set forth in HS ID: Hs. 107213 and Acc No.: BC027178; (2) A gene sequence as set forth in HS ID: Hs. 123107 and Acc No.: NM—002257; (3) A gene sequence as set forth in HS ID: Hs. 1369 and Acc No.: NM—000574; (4) A gene sequence as set forth in HS ID: Hs. 151254 and Acc No.: NM—005046; (5) A gene sequence as set forth in HS ID: Hs. 1526 and Acc No.: NM—001681; (6) A gene sequence as set forth in HS ID: Hs. 184270 and Acc No.: NM—006135; (7) A gene sequence as set forth in HS ID: Hs. 2043 and Acc No.: NM—001151; (8) A gene sequence as set forth in HS ID: Hs. 267871 and Acc No.: NM—005177; (9) A gene sequence as set forth in HS ID: Hs. 4935 and Acc No.: D79998; (10) A gene sequence as set forth in HS ID: Hs. 5509 and Acc No.: NM—006495; (11) A gene sequence as set forth in HS ID: Hs. 5662 and Acc No.: NM—006098; (12) A gene sequence as set forth in HS ID: Hs. 75990 and Acc No.: NM—005143; (13) A gene sequence as set forth in HS ID: Hs. 83384 and Acc No.: NM—006272; (14) A gene sequence as set forth in HS ID: Hs. 10029 and Acc No.: NM—001814; (15) A gene sequence as set forth in HS ID: Hs. 103982 and Acc No.: NM—005409; (16) A gene sequence as set forth in HS ID: Hs. 12314 and Acc No.: AL049397; (17) A gene sequence as set forth in HS ID: Hs. 150557 and Acc No.: NM—001206; (18) A gene sequence as set forth in HS ID: Hs. 169266 and Acc No.: NM—000909; (19) A gene sequence as set forth in HS ID: Hs. 1827 and Acc No.: NM—002507; (20) A gene sequence as set forth in HS ID: Hs. 1869 and Acc No.: NM—002633; (21) A gene sequence as set forth in HS ID: Hs. 194148 and Acc No.: NM—005433; (22) A gene sequence as set forth in HS ID: Hs. 2352 and Acc No.: X74210; (23) A gene sequence as set forth in HS ID: Hs. 246885 and Acc No.: NM—017958; (24) A gene sequence as set forth in HS ID: Hs. 29665 and Acc No.: NM—014944; (25) A gene sequence as set forth in HS ID: Hs. 3235 and Acc No.: NM—002272; (26) A gene sequence as set forth in HS ID: Hs. 55209 and Acc No.: AF327354; (27) A gene sequence as set forth in HS ID: Hs. 585 and Acc No.: NM—000384; (28) A gene sequence as set forth in HS ID: Hs. 62187 and Acc No.: AF022913; (29) A gene sequence as set forth in HS ID: Hs. 63290 and Acc No.: NM—012260; (30) A gene sequence as set forth in HS ID: Hs. 699 and Acc No.: NM—000942; (31) A gene sequence as set forth in HS ID: Hs. 74111 and Acc No.: NM—007367; (32) A gene sequence as set forth in HS ID: Hs. 75103 and Acc No.: NM—003406; (33) A gene sequence as set forth in HS ID: Hs. 75117 and Acc No.: NM—004515; (34) A gene sequence as set forth in HS ID: Hs. 75236 and Acc No.: NM—021952; (35) A gene sequence as set forth in HS ID: Hs. 75258 and Acc No.: NM—004893,; (36) A gene sequence as set forth in HS ID: Hs. 75498 and Acc No.: NM—004591; (37) A gene sequence as set forth in HS ID: Hs. 76913 and Acc No.: NM—002790; (38) A gene sequence as set forth in HS ID: Hs. 79889 and Acc No.: NM—012329; (39) A gene sequence as set forth in HS ID: Hs. 82173 and Acc No.: NM—005655; (40) A gene sequence as set forth in HS ID: Hs. 84072 and Acc No.: NM—004616; (41) A gene sequence as set forth in HS ID: Hs. 85146 and Acc No.: NM—005239; (42) A gene sequence as set forth in HS ID: Hs. 85844 and Acc No.: NM—002529; (43) A gene sequence as set forth in HS ID: Hs. 88219 and Acc No.: NM—003454; (44) A gene sequence as set forth in HS ID: Hs. 88219 and Acc No.: NM—006350; (45) A gene sequence as set forth in HS ID: Hs. 169319 and Acc No.: NM—003419; (46) A gene sequence as set forth in HS ID: Hs. 72805 and Acc No.: NM—030921; (47) A gene sequence as set forth in HS ID: Hs. 108301 and Acc No.: NM—003297; (48) A gene sequence as set forth in HS ID: Hs. 177926 and Acc No.: NM—030941; (49) A gene sequence as set forth in HS ID: Hs. 194746 and Acc No.: NM—018896; (50) A gene sequence as set forth in HS ID: Hs. 209061 and Acc No.: NM—003831; (51) A gene sequence as set forth in HS ID: Hs. 25087 and Acc No.: NM—006070; (52) A gene sequence as set forth in HS ID: Hs. 3017 and Acc No.: NM—003284; (53) A gene sequence as set forth in HS ID: Hs. 283664 and Acc No.: NM—032466; (54) A gene sequence as set forth in HS ID: Hs. 283664 and Acc No.: NM—032467; (55) A gene sequence as set forth in HS ID: Hs. 171992 and Acc No.: NM—002843; (56) A gene sequence as set forth in HS ID: Hs. 155172 and Acc No.: NM—003664; (57) A gene sequence as set forth in HS ID: Hs. 183418 and Acc No.: M37712; (58) A gene sequence as set forth in HS ID: Hs. 244473 and Acc No.: NM13 031900; (59) A gene sequence as set forth in HS ID: Hs. 12835 and Acc No.: NM—004842; (60) A gene sequence as set forth in HS ID: Hs. 1650 and Acc No.: NM—000111; (61) A gene sequence as set forth in HS ID: Hs. 29981 and Acc No.: NM—000112; (62) A gene sequence as set forth in HS ID: Hs. 2246 and Acc No.: NM—001308; (63) A gene sequence as set forth in HS ID: Hs. 267871 and Acc No.: NM—005177; (64) A gene sequence as set forth in HS ID: Hs. 75445 and Acc No.: NM—004684; (65) A gene sequence as set forth in HS ID: Hs. 39957 and Acc No.: NM—016445; (66) A gene sequence as set forth in HS ID: Hs. 65029 and Acc No.: NM—002048; (67) A gene sequence as set forth in HS ID: Hs. 239926 and Acc No.: NM—006745; (68) A gene sequence as set forth in HS ID: Hs. 59271 and Acc No.: NM—006758; (69) A gene sequence as set forth in HS ID: Hs. 8867 and Acc No.: NM—001554; (70) A gene sequence as set forth in HS ID: Hs. 50123 and Acc No.: NM—003452; and (71) A gene sequence as set forth in HS ID: Hs. 82071 and Acc No.: NM—006079.
  • 3. The genes for diagnosing colorectal cancer according to claim 2, wherein said gene sequences are to a testing reagent for detecting colorectal cancer.
  • 4. The genes for diagnosing colorectal cancer according to claim 2, wherein said gene sequences are to a testing biochip for detecting colorectal cancer.
  • 5. The genes for diagnosing colorectal cancer according to claim 2, wherein said gene sequences are to a medicine for detecting colorectal cancer.
  • 6. The genes for diagnosing colorectal cancer according to claim 2, wherein said gene sequences are to a protein testing reagent for detecting colorectal cancer.
  • 7. The genes for diagnosing colorectal cancer according to claim 2, wherein said gene sequences are to a protein for curing medicine of colorectal cancer.
  • 8. The genes for diagnosing colorectal cancer according to claim 2, wherein said gene sequences are to a vaccine for detecting colorectal cancer.
  • 9. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 107213 and Acc No.: BC027178.
  • 10. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 123107 and Acc No.: NM—002257.
  • 11. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 1369 and Acc No.: NM—000574.
  • 12. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 151254 and Acc No.: NM—005046.
  • 13. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 1526 and Acc No.: NM—001681.
  • 14. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 184270 and Acc No.: NM—006135.
  • 15. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 2043 and Acc No.: NM—001151.
  • 16. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 267871 and Acc No.: NM—005177.
  • 17. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 4935 and Acc No.: D79998.
  • 18. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 5509 and Acc No.: NM—006495.
  • 19. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 5662 and Acc No.: NM—006098.
  • 20. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 75990 and Acc No.: NM—005143.
  • 21. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 83384 and Acc No.: NM—006272.
  • 22. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 10029 and Acc No.: NM—001814.
  • 23. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 103982 and Acc No.: NM—005409.
  • 24. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 12314 and Acc No.: AL049397.
  • 25. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs150557 and Acc No.: NM—001206.
  • 26. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 169266 and Acc No.: NM—000909.
  • 27. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 1827 and Acc No.: NM—002507.
  • 28. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 1869 and Acc No.: NM—002633.
  • 29. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 194148 and Acc No.: NM—005433.
  • 30. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 2352 and Acc No.: X74210.
  • 31. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 246885 and Acc No.: NM—017958.
  • 32. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 29665 and Acc No. NM—014944.
  • 33. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 3235 and Acc No.: NM—002272.
  • 34. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 55209 and Acc No.: AF327354.
  • 35. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 585 and Acc No.: NM—000384.
  • 36. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 62187 and Acc No.: AF022913.
  • 37. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 63290 and Acc No.: NM—012260.
  • 38. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 699 and Acc No.: NM—000942.
  • 39. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 74111 and Acc No.: NM—007367.
  • 40. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 75103 and Acc No.: NM—003406.
  • 41. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 75117 and Acc No.: NM—004515.
  • 42. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 75236 and Acc No.: NM—021952.
  • 43. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 75258 and Acc No.: NM—004893.
  • 44. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 75498 and Acc No.: NM—004591.
  • 45. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 76913 and Acc No.: NM—002790.
  • 46. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 79889 and Acc No.: NM—012329.
  • 47. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 82173 and Acc No.: NM—005655.
  • 48. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 84072 and Acc No.: NM—004616.
  • 49. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 85146 and Acc No.: NM—005239.
  • 50. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 85844 and Acc No.: NM—002529.
  • 51. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID Hs. 88219 and Acc No.: NM—003454.
  • 52. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 9914 and Acc No.: NM—006350.
  • 53. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 169319 and Acc No.: NM—003419.
  • 54. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 72805 and Acc No.: NM—030921.
  • 55. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 108301 and Acc No.: NM—003297.
  • 56. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 177926 and Acc No.: NM—030941.
  • 57. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 194746 and Acc No.: NM—018896.
  • 58. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 209061 and Acc No.: NM—003831.
  • 59. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 25087 and Acc No.: NM—006070.
  • 60. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 3017 and Acc No.: NM—003284.
  • 61. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID Hs. 283664: and Acc No.: NM—032466.
  • 62. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 283664 and Acc No.: NM—032467.
  • 63. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 171992 and Acc No: NM—002843.
  • 64. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 155172 and Acc No: NM—003664.
  • 65. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 183418 and Acc No: M37712.
  • 66. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 244473 and Acc No: NM—031900.
  • 67. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 12835 and Acc No: NM—004842.
  • 68. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 1650 and Acc No: NM—000111.
  • 69. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 29981 and Acc No.: NM—000112.
  • 70. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 2246 and Acc No.: NM—001308.
  • 71. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 267871 and Acc No.: NM—005177.
  • 72. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 75445 and Acc No.: NM—004684.
  • 73. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 39957 and Acc No.: NM—016445.
  • 74. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 65029 and Acc No.: NM—002048.
  • 75. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 239926 and Acc No.: NM—006745.
  • 76. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 59271 and Acc No.: NM—006758.
  • 77. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 8867 and Acc No.: NM—001554.
  • 78. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 50123 and Acc No.: NM—003452.
  • 79. Genes for diagnosing colorectal cancer, a gene sequence as set forth in HS ID: Hs. 82071 and Acc No.: NM—006079.