Genes involved in cyclododecanone degradation pathway

Abstract

A 10 kb gene cluster has been isolated from Rhodococcus ruber SC1 comprising genes encoding enzymes useful for the synthesis of dodecanoic diacid from cyclododecanone and other cyclic intermediates. The six specific open reading frames have been identified that are associated with dodecanoic diacid biosynthesis. In addition to the expected substrates the enzymes of the instant invention have moderate specificity for C11-C15 compounds.

Description

FIELD OF THE INVENTION

[0002] The present invention relates to the field of molecular biology and microbiology. More particularly, the invention relates to bioproduction of dodecanoic diacid from cyclododecannone by microbiological means. The cyclododecanone degradation is mediated by a set of enzymes resident on a 10 kb gene cluster, isolated from Rhodococcus ruber SC1. The invention also relates to the bioproduction of lactones, hydroxy acids and diacids from cyclic compounds.

BACKGROUND OF THE INVENTION

[0003] Dodecanedioic acid (DDDA) and other diacids of different chain length are used in nylon manufacturing for production of different variants of nylon fibers. Nylon 6, 12 is a polymer condensed from monomers of hexamethylenediamine (HMD) and DDDA (C12 diacid), which has some different properties from Nylon 6,6 condensed from HMD and adipic acid (C6 diacid). The toughness of the Nylon 6,12 polymer allows it to be used in applications such as toothbrush bristles. Mixed diacids of different chain length (C11, C12 and C13) can also be used as soft segments in Lycra® or as corrosion inhibitors in automotive coatings.

[0004] Traditional ways of diacids synthesis are based on chemical and physical methods which involve harsh conditions such as very high temperatures and pressures. The chemical method to produce 1,12-dodecanoic diacid (DDDA) employs initial air oxidation of cyclododecane to yield a mixture of cyclododecanone (ketone) and cyclododecanol (alcohol), which is then oxidized to produce DDDA. Biocatalytic processes may provide an economically and environmentally more compatible approach towards nylon production. The biochemical route is performed under mild conditions such as ambient temperatures and atmospheric pressures.

[0005] Isolation of strains in the cyclododecane degradation pathway has been reported. (J. D. Schumacher and R. M. Fakoussa, Oxidation and cleavage of alicyclic structures using bacterial biocatalysts, DGMK Tagungsber. (1997), 9704 (Proceedings ICCS '97, Volume 3), 1583-1586. Schumacher et al., have isolated and examined the growth characteristics of Rhodococcus ruber CD1-411 on cyclododecane as sole carbon source (Schumacher et al, supra). The authors, employing biotransformation experiments and using cyclododecane as substrate and several enzyme inhibitors, proposed that Rhodococcus ruber CD1-41 metabolizes the alicyclic compound, cyclododecane, in a way similar to the degradation of cyclohexane. It is suggested that cyclododecane is first hydroxylated to cyclododecanol which is then dehydrogenated to cyclododecanone (J. D. Schumacher, et al, Appl. Microbiol. Biotechnol, 1999, 52:85-90). It is postulated that this alicylic ketone is then subject to a Baeyer-Villiger oxidation yielding the lactone oxacyclotridecan-2-one (lauryl lactone), which is hydrolyzed to 12-hydroxydodecanoic acid (12-hydroxy lauric acid). Only 12-hydroxydodecanoic acid was detected by this method, under these conditions

[0006] In related experiments, using an inhibitor of lactone hydrolysis, tetraethylpyrophosphate, Schumacher et al were able to detect lactone oxacyclotridecan-2-one (J. D. Schumacher, et al, Appl. Microbiol. Biotechnol, 1999, 52:85-90). The 12-hydroxy lauric acid was further converted to DDDA via 12-oxo lauric acid intermediate by a two-step sequential oxidation. The above proposed pathway suggests metabolic steps for the degradation of cyclododecane based on Baeyer-Villiger oxidation process and appearance of the major metabolites in Rhodococcus ruber CD4.

[0007] Cyclododecanone monooxygenase has been purified. This enzyme is responsible for the oxidation of cycloketone to the corresponding lactone. In spite of these findings there are no reports which describe other enzymes necessary in the cyclododecane degradation pathway. Additionally, the literature is silent with respect to genes encoding this cyclododecanone monooxygenase and isolation of the gene cluster responsible for the whole metabolic pathway.

[0008] The problem to be solved therefore is to provide a facile, environmentally responsible method for the production of dodecanoic diacid and other useful intermediates. Applicants have solved the stated problem by identifying, isolating and cloning a 10 kb nucleic acid fragment from Rhodococcus ruber SC1 which mediates the conversion of cyclododecanone and other cyclic compounds to dodecanoic diacid. Recombinant Escherichia coli hosts with the DNA containing the 10 kb gene cluster conveys on the host the ability to convert cyclododecanone to dodecanoic diacid.

SUMMARY OF THE INVENTION

[0009] The present invention provides an isolated nucleic acid fragment encoding a dodecanoic diacid synthesizing enzyme selected from the group consisting of: (a) an isolated nucleic acid fragment encoding all or a substantial portion of the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12; (b) an isolated nucleic acid fragment that is substantially similar to an isolated nucleic acid fragment encoding all or a substantial portion of the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12; (c) an isolated nucleic acid molecule that hybridizes with (a) under the following hybridization conditions: 6×SSC (1 M NaCl), 50% formamide, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.; and (d) an isolated nucleic acid fragment that is complementary to (a), (b) or (c).

[0010] Additionally the invention provides an isolated nucleic acid fragment having about 80% to about 90% identity to the nucleic acid fragment selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:1, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37.

[0011] The invention further provides polypeptides encoded by the nucleic acid sequences of the present invention. Additionally the invention provides chimeric genes comprising the instant nucleic acid sequences operably linked to suitable regulatory elements and transformed host cells comprising the chimeric genes.

[0012] In an alternate embodiment the invention provides a method of obtaining a nucleic acid fragment encoding all or a substantial portion of a dodecanoic diacid synthesizing enzyme comprising: (a) probing a genomic library with the nucleic acid fragment of the present invention; (b) identifying a DNA clone that hybridizes with the nucleic acid fragment of the present invention under the following conditions; 6×SSC (1 M NaCl), 50% formamide, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.; and (c) optionally sequencing the genomic fragment that comprises the clone identified in step (b), wherein the sequenced genomic fragment encodes all or substantially all of an amino acid sequence encoding a dodecanoic diacid synthesizing enzyme. Similarly the invention provides a method of obtaining a nucleic acid fragment encoding all or a substantial portion a dodecanoic diacid synthesizing enzyme comprising: (a) synthesizing at least one oligonucleotide primer corresponding to a portion of the sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37; and amplifying an insert present in a cloning vector using the oligonucleotide primer of step (a); wherein the amplified insert encodes a portion of an amino acid sequence encoding a dodecanoic diacid synthesizing enzyme.

[0013] The invention further provides a method for the production of dodecanedioic acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of cyclododecanone whereby dodecanedioic acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12 under the control of suitable regulatory sequences.

[0014] Similarly the invention provides a method for the production of lauryl lactone comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of cyclododecanone whereby lauryl lactone is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2, under the control of suitable regulatory sequences.

[0015] Additionally the invention provides a method for the production of 12-hydroxy lauric acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of lauryl lactone whereby 12-hydroxy lauric acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:4, under the control of suitable regulatory sequences.

[0016] In another embodiment the invention provides a method for the production of 12-oxo lauric acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount 12-hydroxy lauric acid whereby 12-oxo lauric acid acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:10, under the control of suitable regulatory sequences.

[0017] In an alternate embodiment the invention provides a method for the production of dodecanedioic acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount 12-oxo lauric acid whereby dodecanedioic acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:12, under the control of suitable regulatory sequences.

[0018] The invention further provides an isolated nucleic acid fragment encoding a dodecanedioic acid synthesizing enzyme selected from the group consisting of: (a) an isolated nucleic acid molecule as set forth in SEQ ID NO:13; (b) an isolated nucleic acid molecule that hybridizes with (a) under the following hybridization conditions: 6×SSC (1 M NaCl), 50% formamide, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.; and (c) an isolated nucleic acid molecule that is completely complementary to (a) or (b).

[0019] Additionally the invention provides a Rhodococcus ruber comprising endogenous genes encoding the proteins as set forth by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12, said Rhodococcus ruber SC1 having the ability to convert cyclododecanone to dodecanedioic acid under suitable growth conditions.

[0020] In another embodiment the invention provides a method for the production of hydroxy acids comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of a cyclic ketone selected from the group consisting of C6, C10, C11, C12, C13, and C15 cyclic ketones whereby the corresponding hydroxy acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2, and SEQ ID NO:4 under the control of suitable regulatory sequences.

BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE DESCRIPTIONS

[0021] FIG. 1 is a diagram showing the pathway for the conversion of cyclododecane to dodecanoic diacid.

[0022] FIG. 2 is a diagram showing the organization of ORF's 1-6 on the 10 kb gene cluster.

[0023] FIG. 3 is a diagram showing the amount of 12-hydroxy lauric acid and dodecanoic diacid produced from the recombinant E. coli cosmid clones.

[0024] The invention can be more fully understood from the following detailed description and the accompanying sequence descriptions which form a part of this application.

[0025] Applicant(s) have provided 39 sequences in conformity with 37 C.F.R. 1.821-1.825 (“Requirements for Patent Applications Containing Nucleotide Sequences and/or Amino Acid Sequence Disclosures—the Sequence Rules”) and consistent with World Intellectual Property Organization (WIPO) Standard ST.25 (1998) and the sequence listing requirements of the EPO and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the Administrative Instructions). The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. §1.822.

[0026] SEQ ID NO:1 is the nucleotide sequence of ORF 1 encoding a cyclododecanone monooxygenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0027] SEQ ID NO:2 is the deduced amino acid sequence of ORF 1 encoding a cyclododecanone monooxygenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0028] SEQ ID NO:3 is the nucleotide sequence of ORF 2 encoding a lauryl lactone esterase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0029] SEQ ID NO:4 is the deduced amino acid sequence of ORF 2 encoding a lauryl lactone esterase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0030] SEQ ID NO:5 is the nucleotide sequence of ORF 3 encoding a putative protein with unknown function isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0031] SEQ ID NO:6 is the deduced amino acid sequence of ORF 3 encoding a putative protein with unknown function isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0032] SEQ ID NO:7 is the nucleotide sequence of ORF 4 encoding a protein with unknown function isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0033] SEQ ID NO:8 is the deduced amino acid sequence of ORF 4 encoding a conserved hypothetical protein with unknown function isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0034] SEQ ID NO:9 is the nucleotide sequence of ORF 5 encoding a 12-hydroxy lauric acid dehydrogenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0035] SEQ ID NO:10 is the deduced amino acid sequence of ORF 5 encoding a 12-hydroxy lauric acid dehydrogenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococcus ruber SC1.

[0036] SEQ ID NO:11 is the nucleotide sequence of ORF 6 encoding a 12-oxo lauric acid dehydrogenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0037] SEQ ID NO:12 is the deduced amino acid sequence of ORF 6 encoding a 12-oxo lauric acid dehydrogenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC1.

[0038] SEQ ID NO:13 is the nucleotide sequence of the 10 kb gene cluster isolated from a Rhodococccus ruber SC1, encoding all the enzymes relevant to the biocoversion of cyclododecanone to dodecanoic diacid.

[0039] SEQ ID NO:14 is the N-terminal amino acid sequence of cycolododecanone monooxygenase from Rhodococccus ruber SC1.

[0040] SEQ ID NO:15 is the internal peptide amino acid sequence of cycolododecanone monooxygenase from Rhodococccus ruber SC1.

[0041] SEQ ID NO:16 is the nucleotide sequence of a JCR14 primer used to sequence 16s rDNA for typing the isolated bacterium.

[0042] SEQ ID NO:17 is the nucleotide sequence of a JCR15 primer used to sequence 16s rDNA for typing the isolated bacterium.

[0043] SEQ ID NO:18 is the nucleotide sequence of a CDDK4 primer which was derived from the N terminal sequence of cyclododecanone monooxygenase enzyme and was used for cloning of this enzyme from Rhodococcus ruber SC1.

[0044] SEQ ID NO:19 is the nucleotide sequence of a CDDK10 primer which was derived from the internal sequence of cyclododecanone monooxygenase enzyme and was used for cloning of this enzyme from Rhodococcus ruber SC1.

[0045] SEQ ID NO:20 is the nucleotide sequence of a C12 MO TOP primer which was used to screen the cosmid library.

[0046] SEQ ID NO:21 is the nucleotide sequence of a C12 MO BOTTOM primer which was used to screen the cosmid library.

[0047] SEQ ID NO:22 is the nucleotide sequence of a KK1 primer used to construct a subclone pDCQ5 containing only cyclododecanone monooxygenase gene and lauric acid esterase gene.

[0048] SEQ ID NO:23 is the nucleotide sequence of a KK2 primer used to construct a subclone pDCQ5 containing only cyclododecanone monooxygenase gene and lauric acid esterase gene.

[0049] SEQ ID NO:24 is the nucleotide sequence of a KK3 primer used to construct a subclone pDCQ6 containing only cyclododecanone monooxygenase gene and lauric acid esterase gene.

[0050] SEQ ID NO:25 is the nucleotide sequence of a KK4 primer used to construct a subclone pDCQ6 containing only cyclododecanone monooxygenase gene and lauric acid esterase gene.

[0051] SEQ ID NOs:26-28 are nucleic acid sequences which will hybridize under stringent conditions to the nucleic acid sequence for ORF 1 (SEQ ID NO:1) encoding a cyclododecanone monooxygenase enzyme.

[0052] SEQ ID NOs:29-31 are nucleic acid sequences which will hybridize under stringent conditions to the nucleic acid sequence for ORF 2 (SEQ ID NO:3) encoding a lauryl lactone esterase enzyme.

[0053] SEQ ID NOs:32-34 are nucleic acid sequences which will hybridize under stringent conditions to the nucleic acid sequence for ORF 5 (SEQ ID NO:9) encoding a 12-hydroxy lauric acid dehydrogenase enzyme.

[0054] SEQ ID NOs:35-37 are nucleic acid sequences which will hybridize under stringent conditions to the nucleic acid sequence for ORF 6 (SEQ ID NO:11) encoding a 12-oxo lauric acid dehydrogenase enzyme.

[0055] SEQ ID NOs:38-39 are primers used to amplify the cddA gene.

DETAILED DESCRIPTION OF THE INVENTION

[0056] The present invention provides new sequences encoding key enzymes in the synthesis of dodecanoic diacid from cyclododecanone. The genes and their expression products are useful for the creation of recombinant organisms that have the ability to produce dodecanoic diacid while growing on cyclododecanone, and for the identification of new species of bacteria having the ability to produce dodecanoic diacid. Dodecanedioic acid (DDDA) and other diacids have utility as monomers in the manufacture of various polymers such as Nylon. Other intermediates such as lactones have utilities as automotive coatings or flavors and fragrances. Full length sequences for 6 ORF's have been obtained and identified by comparison to public databases containing nucleotide and protein sequences using the BLAST algorithms well known to those skilled in the art. The relevant ORF's all reside on a 10 kb nucleic acid fragment and together represent a gene cluster that encodes proteins that are sufficient to mediate the transformation of cyclododecanone to dodecanoic diacid (FIGS. 1 and 2). The genes involved in cyclododecanone oxidation have been isolated from Rhodococcus ruber SC1. Conversion of cyclododecanone to dodecanoic diacid has been demonstrated in recombinant host cells containing the 10 kb nucleic acid fragment. Moreover, it has been discovered that the enzymes involved in cyclododecanone degradation pathway have specificity for large cyclic ketones. For example, hydroxy acids of C6, C10 C11, C12, C13, and C15 were produced from their corresponding cyclic ketones. The hydroxy acids of the present invention have use as monomers in the synthesis of polymers such as polyester.

[0057] In this disclosure, a number of terms and abbreviations are used. The following definitions are provided.

[0058] “Open reading frame” is abbreviated ORF.

[0059] “Polymerase chain reaction” is abbreviated PCR.

[0060] “High performance liquid chromatography” is abbreviated HPLC.

[0061] “Mass spectrometry” is abbreviated MS.

[0062] “High performance liquid chromatography coupled with mass spectrometry” is abbreviated LC/MS.

[0063] “Baeyer-Villiger oxidation” refers to a reaction of oxidizing carbonyl compounds by peroxy compounds which involves formal insertion of an oxygen atom into one of the carbon-carbon bonds at the carbonyl group. This insertion is accomplished by a sequence of steps involving addition of the carbonyl group and migration to oxygen.

[0064] “Cyclododecanone monooxygenase” refers to the enzyme required in the oxidation of cycloketone to the corresponding lactone. This enzyme is encoded by ORF 1 (designated as cddA) and is resident on the 10 kb Rhodococcus ruber SC1 gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.

[0065] “Lauryl lactone esterase” or “lauryl lactone hydrolase” refers to an enzyme that is involved in the conversion of lauryl lactone to 12-hydroxy lauric acid. This enzyme is encoded by ORF 2 (designated as cddB) and is resident on the 10 kb Rhodococcus ruber SC1 gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.

[0066] “12-hydroxy lauric acid dehydrogenase” refers to an alcohol dehydrogenase enzyme that catalyzes oxidation of 12-hydroxy lauric acid to 12-oxo lauric acid. This enzyme is encoded by ORF 5 (designated as cddC) and is resident on the 10 kb Rhodococcus ruber SC1 gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.

[0067] “12-oxo lauric acid dehydrogenase” refers to an aldehyde dehydrogenase which catalyzes conversion of 12-oxo lauric acid to dodecanoic diacid. This enzyme is encoded by ORF 6 (designated as cddD) and is resident on the 10 kb Rhodococcus ruber SC1 gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.

[0068] The term “cddX” and “cddY” refers to two unknown proteins encoded by ORF 3 and ORF 4, respectively, both of which are resident on the 10 kb Rhodococcus ruber SC1 gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.

[0069] The term “gene cluster” will mean genes organized in a single expression unit or physically associated with each other.

[0070] The term “10 kb nucleic acid fragment” refers to the 10 kb gene cluster comprising ORFs 1-6 sufficient for the conversion of cyclododecanone to dodecanoic diacid.

[0071] The term “dodecanoic diacid” and “dodecanedioic acid” will be used interchangeably and abbreviated as DDDA.

[0072] The term “dodecanoic diacid synthesizing enzyme” means the gene product of any of ORF 1, ORF 2, ORF 5 and ORF 6 encoding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10 and SEQ ID NO:12, respectively.

[0073] The term “knockout construct” means a DNA sequence which has been altered via any known means, for example, insertion, deletion, point mutation or rearrangement, so as to eliminate the function of one or more of the naturally occurring gene products.

[0074] The term “knockout mutants” refer to cells, microorganisms in which one or more of the naturally occurring genes have been replaced through genetic engineering with a knockout construct.

[0075] As used herein, an “isolated nucleic acid fragment” is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.

[0076] As used herein, “substantially similar” refers to nucleic acid fragments wherein changes in one or more nucleotide bases results in substitution of one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequence. “Substantially similar” also refers to nucleic acid fragments wherein changes in one or more nucleotide bases does not affect the ability of the nucleic acid fragment to mediate alteration of gene expression by antisense or co-suppression technology. “Substantially similar” also refers to modifications of the nucleic acid fragments of the instant invention such as deletion or insertion of one or more nucleotide bases that do not substantially affect the functional properties of the resulting transcript. It is therefore understood that the invention encompasses more than the specific exemplary sequences.

[0077] For example, it is well known in the art that alterations in a gene which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded protein are common. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue (such as glycine) or a more hydrophobic residue (such as valine, leucine, or isoleucine). Similarly, changes which result in substitution of one negatively charged residue for another (such as aspartic acid for glutamic acid) or one positively charged residue for another (such as lysine for arginine) can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the protein molecule would also not be expected to alter the activity of the protein. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products. Moreover, the skilled artisan recognizes that substantially similar sequences encompassed by this invention are also defined by their ability to hybridize, under stringent conditions, (0.1×SSC, 0.1% SDS, 65° C. and washed with 2×SSC, 0.1% SDS followed by 0.1×SSC, 0.1% SDS), with the sequences exemplified herein. Preferred substantially similar nucleic acid fragments of the instant invention are those nucleic acid fragments whose DNA sequences are at least 80% identical to the DNA sequence of the nucleic acid fragments reported herein. More preferred nucleic acid fragments are at least 90% identical to the DNA sequence of the nucleic acid fragments reported herein. Most preferred are nucleic acid fragments that are at least 95% identical to the DNA sequence of the nucleic acid fragments reported herein.

[0078] A nucleic acid molecule is “hybridizable” to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table 11.1 therein (entirely incorporated herein by reference). The conditions of temperature and ionic strength determine the “stringency” of the hybridization.

[0079] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 6×SSC (1 M NaCl), 30 to 35% formamide, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 6×SSC (1 M NaCl), 40 to 45% formamide, 1% SDS at 37° C., and a wash in 0.5× to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 6×SSC (1 M NaCl), 50% formamide, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.

[0080] Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. The melting temperature (Tm) of a probe—target hybrid can be calculated to provide a starting point for the determination of correct stringency conditions. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem., 138:267-284 (1984): Tm=81.5° C.+16.6 ( log M)+0.41 (%G+C)−0.61 (% form)−500/L; where M is the molarity of monovalent cations, %G+C is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ≧90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4° C. lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20° C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution) it is preferred to increase the SSC. concentration so that a higher temperature can be used. Thus, for example, sequences that will hybridize to the nucleic acid sequence of ORF 1 (SEQ ID NO:1) under stringent conditions will include but are not limited to those sequences set forth in SEQ ID NOs:26-28. Those sequences that will hybridize to the nucleic acid sequence of ORF 2 (SEQ ID NO:3) under stringent conditions will include but are not limited to those sequences set forth in SEQ ID NOs:29-31. Those sequences that will hybridize to the nucleic acid sequence of ORF 5 (SEQ ID NO:9) under stringent conditions will include but are not limited to those sequences set forth in SEQ ID NOs:32-34. Similarly, those sequences that will hybridize to the nucleic acid sequence of ORF 6 (SEQ ID NO:1) under stringent conditions will include but are not limited to those sequences set forth in SEQ ID NOs:35-37. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, Part I, Chapter 2 “Overview of principles of hybridization and the strategy of nucleic acid probe assays”, Elsevier, N.Y. (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995).

[0081] A “substantial portion” of an amino acid or nucleotide sequence comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Basic Local Alignment Search Tool; Altschul, S. F., et al., (1993) J. Mol. Biol. 215:403-410; see also www.ncbi.nlm.nih.gov/BLAST/). In general, a sequence of ten or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene. Moreover, with respect to nucleotide sequences, gene specific oligonucleotide probes comprising 20-30 contiguous nucleotides may be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12-15 bases may be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a “substantial portion” of a nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence. The instant specification teaches partial or complete amino acid and nucleotide sequences encoding one or more particular fungal proteins. The skilled artisan, having the benefit of the sequences as reported herein, may now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art. Accordingly, the instant invention comprises the complete sequences as reported in the accompanying Sequence Listing, as well as substantial portions of those sequences as defined above.

[0082] The term “complementary” is used to describe the relationship between nucleotide bases that are capable to hybridizing to one another. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the instant invention also includes isolated nucleic acid fragments that are complementary to the complete sequences as reported in the accompanying Sequence Listing as well as those substantially similar nucleic acid sequences.

[0083] The term “percent identity”, as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, “identity” also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. “Identity” and “similarity” can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences was performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.

[0084] Suitable nucleic acid fragments (isolated polynucleotides of the present invention) encode polypeptides that are at least about 70% identical, preferably at least about 80% identical to the amino acid sequences reported herein. Preferred nucleic acid fragments encode amino acid sequences that are about 85% identical to the amino acid sequences reported herein. More preferred nucleic acid fragments encode amino acid sequences that are at least about 90% identical to the amino acid sequences reported herein. Most preferred are nucleic acid fragments that encode amino acid sequences that are at least about 95% identical to the amino acid sequences reported herein. Suitable nucleic acid fragments not only have the above homologies but typically encode a polypeptide having at least 50 amino acids, preferably at least 100 amino acids, more preferably at least 150 amino acids, still more preferably at least 200 amino acids, and most preferably at least 250 amino acids.

[0085] The term “sequence analysis software” refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. “Sequence analysis software” may be commercially available or independently developed. Typical sequence analysis software will include but is not limited to the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.), BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol. 215:403-410 (1990), and DNASTAR (DNASTAR, Inc. 1228 S. Park St. Madison, Wis. 53715 USA), and the FASTA program incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Publisher: Plenum, New York, N.Y.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the “default values” of the program referenced, unless otherwise specified. As used herein “default values” will mean any set of values or parameters which originally load with the software when first initialized.

[0086] “Codon degeneracy” refers to divergence in the genetic code permitting variation of the nucleotide sequence without effecting the amino acid sequence of an encoded polypeptide. Accordingly, the instant invention relates to any nucleic acid fragment that encodes all or a substantial portion of the amino acid sequence encoding the bacterial dodecanoic diacid synthesizing enzymes as set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12.

[0087] The skilled artisan is well aware of the “codon-bias” exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.

[0088] “Synthetic genes” can be assembled from oligonucleotide building blocks that are chemically synthesized using procedures known to those skilled in the art. These building blocks are ligated and annealed to form gene segments which are then enzymatically assembled to construct the entire gene. “Chemically synthesized”, as related to a sequence of DNA, means that the component nucleotides were assembled in vitro. Manual chemical synthesis of DNA may be accomplished using well established procedures, or automated chemical synthesis can be performed using one of a number of commercially available machines. Accordingly, the genes can be tailored for optimal gene expression based on optimization of nucleotide sequence to reflect the codon bias of the host cell. The skilled artisan appreciates the likelihood of successful gene expression if codon usage is biased towards those codons favored by the host. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available.

[0089] “Gene” refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the coding sequence. “Native gene” refers to a gene as found in nature with its own regulatory sequences. “Chimeric gene” refers any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. “Endogenous gene” refers to a native gene in its natural location in the genome of an organism. A “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A “transgene” is a gene that has been introduced into the genome by a transformation procedure.

[0090] “Coding sequence” refers to a DNA sequence that codes for a specific amino acid sequence. “Suitable regulatory sequences” refer to nucleotide sequences located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

[0091] “Promoter” refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3′ to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.

[0092] The “3′ non-coding sequences” refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3′ end of the mRNA precursor.

[0093] “RNA transcript” refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from posttranscriptional processing of the primary transcript and is referred to as the mature RNA. “Messenger RNA (mRNA)” refers to the RNA that is without introns and that can be translated into protein by the cell. “cDNA” refers to a double-stranded DNA that is complementary to and derived from mRNA. “Sense” RNA refers to RNA transcript that includes the mRNA and so can be translated into protein by the cell. “Antisense RNA” refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA that blocks the expression of a target gene (U.S. Pat. No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5′ non-coding sequence, 3′ non-coding sequence, introns, or the coding sequence. “Functional RNA” refers to antisense RNA, ribozyme RNA, or other RNA that is not translated yet has an effect on cellular processes.

[0094] The term “operably linked” refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.

[0095] The term “expression”, as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.

[0096] “Mature” protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or propeptides present in the primary translation product have been removed. “Precursor” protein refers to the primary product of translation of mRNA; i.e., with pre- and propeptides still present. Pre- and propeptides may be but are not limited to intracellular localization signals.

[0097] “Transformation” refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” or “recombinant” or “transformed” organisms.

[0098] The terms “plasmid”, “vector” and “cassette” refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3′ untranslated sequence into a cell. “Transformation cassette” refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitate transformation of a particular host cell. “Expression cassette” refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.

[0099] Standard recombinant DNA and molecular cloning techniques used here are well known in the art as described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) (hereinafter “Maniatis”); and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Cold Press Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987).

[0100] The invention provides new sequences encoding key enzymes in the synthesis of dodecanoic diacid from cyclododecanone. These seqeunces comprising six open reading frames residing on a 10 kb gene cluster isolated from Rhodococcus ruber SC1. ORF's 1, 2, 5 and 6 all encode identifiable enzymes known to be useful in the synthesis of DDDA. The present genes were identified both on the basis of expression data as well as comparison of the nucleic acid and deduced amino acid sequences to public databases using algorithms well known in the art. Sequence comparisons revealed that the most similar known sequences range from a distant as about 30% identical at the amino acid level (ORF 1, cyclohexanone monooxygenase) to about 50% identical (ORF 2, 12-oxo lauric acid dehydrogenase).

[0101] Accordingly preferred polypeptides of the instant invention are those active proteins which are at least 80% identical to the amino acid sequence of reported herein. More preferred amino acid fragments are at least 90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein. Similarly, preferred nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences of reported herein. More preferred nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.

[0102] The nucleic acid fragments of the instant invention may be used to isolate cDNAs and genes encoding homologous enzymes from the same or other bacterial species. Isolation of homologous genes using sequence-dependent protocols is well known in the art. Examples of sequence-dependent protocols include, but are not limited to, methods of nucleic acid hybridization, and methods of DNA and RNA amplification as exemplified by various uses of nucleic acid amplification technologies (e.g., polymerase chain reaction, ligase chain reaction).

[0103] For example, genes encoding similar enzymes to those of the instant dodecanoic diacid pathway, either as cDNAs or genomic DNAs, could be isolated directly by using all or a portion of the instant nucleic acid fragments as DNA hybridization probes to screen libraries from any desired bacteria using methodology well known to those skilled in the art. Specific oligonucleotide probes based upon the instant nucleic acid sequences can be designed and synthesized by methods known in the art (Maniatis). Moreover, the entire sequences can be used directly to synthesize DNA probes by methods known to the skilled artisan such as random primers DNA labeling, nick translation, or end-labeling techniques, or RNA probes using available in vitro transcription systems. In addition, specific primers can be designed and used to amplify a part of or full-length of the instant sequences. The resulting amplification products can be labeled directly during amplification reactions or labeled after amplification reactions, and used as probes to isolate full length cDNA or genomic fragments under conditions of appropriate stringency.

[0104] Where PCR is employed, two short segments of the instant ORF's 1-6 may be used in polymerase chain reaction protocols to amplify longer nucleic acid fragments encoding homologous genes from DNA or RNA. The polymerase chain reaction may also be performed on a library of cloned nucleic acid fragments wherein the sequence of one primer is derived from the instant nucleic acid fragments, and the sequence of the other primer takes advantage of the presence of the polyadenylic acid tracts to the 3′ end of the mRNA precursor encoding bacterial genes. Alternatively, the second primer sequence may be based upon sequences derived from the cloning vector. For example, the skilled artisan can follow the RACE protocol (Frohman et al., PNAS USA 85:8998 (1988)) to generate cDNAs by using PCR to amplify copies of the region between a single point in the transcript and the 3′ or 5′ end. Primers oriented in the 3′ and 5′ directions can be designed from the instant sequences. Using commercially available 3′ RACE or 5′ RACE systems (BRL), specific 3′ or 5′ cDNA fragments can be isolated (Ohara et al., PNAS USA 86:5673 (1989); Loh et al., Science 243:217 (1989)).

[0105] Typically, in PCR-type amplification techniques, the primers have different sequences and are not complementary to each other. Depending on the desired test conditions, the sequences of the primers should be designed to provide for both efficient and faithful replication of the target nucleic acid. Methods of PCR primer design are common and well known in the art. (Thein and Wallace, “The use of oligonucleotide as specific hybridization probes in the Diagnosis of Genetic Disorders”, in Human Genetic Diseases: A Practical Approach, K. E. Davis Ed., (1986) pp. 33-50 IRL Press, Herndon, Va.); Rychlik, W. (1993) In White, B. A. (ed.), Methods in Molecular Biology, Vol. 15, pages 31-39, PCR Protocols: Current Methods and Applications. Humania Press, Inc., Totowa, N.J.)

[0106] Alternatively the instant sequences may be employed as hybridization reagents for the identification of homologs. The basic components of a nucleic acid hybridization test include a probe, a sample suspected of containing the gene or gene fragment of interest, and a specific hybridization method. Probes of the present invention are typically single stranded nucleic acid sequences which are complementary to the nucleic acid sequences to be detected. Probes are “hybridizable” to the nucleic acid sequence to be detected. The probe length can vary from 5 bases to tens of thousands of bases, and will depend upon the specific test to be done. Only part of the probe molecule need be complementary to the nucleic acid sequence to be detected. In addition, the complementarily between the probe and the target sequence need not be perfect. Hybridization does occur between imperfectly complementary molecules with the result that a certain fraction of the bases in the hybridized region are not paired with the proper complementary base.

[0107] Hybridization methods are well defined. Typically the probe and sample must be mixed under conditions which will permit nucleic acid hybridization. This involves contacting the probe and sample in the presence of an inorganic or organic salt under the proper concentration and temperature conditions. The probe and sample nucleic acids must be in contact for a long enough time that any possible hybridization between the probe and sample nucleic acid may occur. The concentration of probe or target in the mixture will determine the time necessary for hybridization to occur. The higher the probe or target concentration the shorter the hybridization incubation time needed. Optionally a chaotropic agent may be added. The chaotropic agent stabilizes nucleic acids by inhibiting nuclease activity. Furthermore, the chaotropic agent allows sensitive and stringent hybridization of short oligonucleotide probes at room temperature [Van Ness and Chen (1991) Nucl. Acids Res. 19:5143-5151]. Suitable chaotropic agents include guanidinium chloride, guanidinium thiocyanate, sodium thiocyanate, lithium tetrachloroacetate, sodium perchlorate, rubidium tetrachloroacetate, potassium iodide, and cesium trifluoroacetate, among others. Typically, the chaotropic agent will be present at a final concentration of about 3M. If desired, one can add formamide to the hybridization mixture, typically 30-50% (v/v).

[0108] Various hybridization solutions can be employed. Typically, these comprise from about 20 to 60% volume, preferably 30%, of a polar organic solvent. A common hybridization solution employs about 30-50% v/v formamide, about 0.15 to 1M sodium chloride, about 0.05 to 0.1M buffers, such as sodium citrate, Tris-HCl, PIPES or HEPES (pH range about 6-9), about 0.05 to 0.2% detergent, such as sodium dodecylsulfate, or between 0.5-20 mM EDTA, FICOLL (Pharmacia Inc.) (about 300-500 kilodaltons), polyvinylpyrrolidone (about 250-500 kilodaltons), and serum albumin. Also included in the typical hybridization solution will be unlabeled carrier nucleic acids from about 0.1 to 5 mg/mL, fragmented nucleic DNA, e.g., calf thymus or salmon sperm DNA, or yeast RNA, and optionally from about 0.5 to 2% wt./vol. glycine. Other additives may also be included, such as volume exclusion agents which include a variety of polar water-soluble or swellable agents, such as polyethylene glycol, anionic polymers such as polyacrylate or polymethylacrylate, and anionic saccharidic polymers, such as dextran sulfate.

[0109] Nucleic acid hybridization is adaptable to a variety of assay formats. One of the most suitable is the sandwich assay format. The sandwich assay is particularly adaptable to hybridization under non-denaturing conditions. A primary component of a sandwich-type assay is a solid support. The solid support has adsorbed to it or covalently coupled to it immobilized nucleic acid probe that is unlabeled and complementary to one portion of the sequence.

[0110] Availability of the instant nucleotide and deduced amino acid sequences facilitates immunological screening cDNA expression libraries. Synthetic peptides representing portions of the instant amino acid sequences may be synthesized. These peptides can be used to immunize animals to produce polyclonal or monoclonal antibodies with specificity for peptides or proteins comprising the amino acid sequences. These antibodies can be then be used to screen cDNA expression libraries to isolate full-length cDNA clones of interest (Lerner, R. A. Adv. Immunol. 36:1 (1984); Maniatis).

[0111] The enzymes and gene products of the instant 10 kb nucleic acid fragment may be produced in heterologous host cells, particularly in the cells of microbial hosts, and can be used to prepare antibodies to the resulting proteins by methods well known to those skilled in the art. The antibodies are useful for detecting the proteins in situ in cells or in vitro in cell extracts. Preferred heterologous host cells for production of the instant enzymes are microbial hosts. Specific suitable hosts include but are not limited Aspergillus, Saccharomyces, Pichia, Candida, Hansenula, Salmonella, Bacillus, Acinetobacter, Rhodococcus, Streptomyces, Escherichia, Corynebacterium, and Pseudomonas. Microbial expression systems and expression vectors containing regulatory sequences that direct high level expression of foreign proteins are well known to those skilled in the art. Any of these could be used to construct chimeric genes for production of the any of the gene products of the 10 kb fragment. These chimeric genes could then be introduced into appropriate microorganisms via transformation to provide high level expression of the enzymes.

[0112] Additionally, chimeric genes will be effective in altering the properties of the host bacteria. It is expected, for example, that introduction of chimeric genes encoding one or more of the ORF's 1-6 under the control of the appropriate promoters, into a host cell comprising at least one copy of these genes will demonstrate the ability to convert cyclododecanone to lauryl lactone; lauryl lactone to 12-hydroxy lauric acid; and 12-hydroxy lauric acid to 12-oxo lauric acid and 12-oxo lauric acid to DDDA respectively. Additionally expression of ORF's 1-6, either separately or together may facilitate the mediation of cyclododecanone to dodecanoic diacid, or any of the intermediate steps depending on the presence or absence of these proteins in the host. Applicants have discovered that the instant dodecanoic diacid synthesizing enzymes have a broad substrate specificity and are able to act on cyclic ketones and esters ranging from C6 to C18 where a range of C6 to C15 is preferred. Accordingly it is contemplated that microbial hosts transformed with genes encoding the instant enzymes will demonstrate the ability to convert C6-C18 cyclic ketones and preferably C6, C10-C13 and C15 cyclic ketones and esters to their corresponding hydroxy acids. For example cyclohexanone (C6), cyclodecanone (C10), cycloundecanone (C11), cyclododecanone (C12), cyclotridecanone (C13) and cyclopentadecanone (C15) may each be converted to their corresponding hydroxy acids in the presence of the instant dodecanoic diacid synthesizing enzymes. Additionally it will be appreciated by the skilled person that, given the broad substrate range of the present enzymes it is contemplated that these proteins will convert cyclic ketones to macrolactones of C10 or greater.

[0113] Vectors or cassettes useful for the transformation of suitable host cells are well known in the art. Typically the vector or cassette contains sequences directing transcription and translation of the relevant gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5′ of the gene which harbors transcriptional initiation controls and a region 3′ of the DNA fragment which controls transcriptional termination. It is most preferred when both control regions are derived from genes homologous to the transformed host cell, although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host.

[0114] Initiation control regions or promoters, which are useful to drive expression of the instant ORF's in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genes is suitable for the present invention including but not limited to CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for expression in Saccharomyces); AOX1 (useful for expression in Pichia); and lac, trp, 1PL, 1PR, T7, tac, and trc (useful for expression in Escherichia coli).

[0115] Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary however; it is most preferred if included.

[0116] Optionally it may be desired to produce the instant gene product as a secretion product of the transformed host. Secretion of desired proteins into the growth media has the advantages of simplified and less costly purification procedures. It is well known in the art that secretion signal sequences are often useful in facilitating the active transport of expressible proteins across cell membranes. The creation of a transformed host capable of secretion may be accomplished by the incorporation of a DNA sequence that codes for a secretion signal which is functional in the host production host. Methods for choosing appropriate signal sequences are well known in the art (see for example EP 546049;WO 9324631). The secretion signal DNA may be between the expression-controlling DNA and the instant gene or gene fragment, and in reading frame with the latter. Where commercial production of dodecanoic diacid or any of the intermediates in the synthesis of dodecanoic diacid from cyclododencane using organisms transformed with the instant genes is desired, a variety of fermentation methodologies may be applied. For example, large scale production may be produced by both Batch or continuous fermentation.

[0117] Classical batch fermentation is a closed system where the composition of the media is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the media is inoculated with the desired organism or organisms and fermentation is permitted to occur adding nothing to the system. Typically, however, “batch” fermentation is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems the metabolite and biomass compositions of the system change constantly up to the time the fermentation is stopped. Within batch cultures cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase generally are responsible for the bulk of production of end product or intermediate.

[0118] A variation on the standard batch system is the Fed-Batch system. Fed-Batch fermentation processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the fermentation progresses. Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2. Batch and Fed-Batch fermentations are common and well known in the art and examples may be found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, M. A., or Deshpande, Mukund V., Appl. Biochem. Biotechnol., 36, 227, (1992), herein incorporated by reference.

[0119] Commercial production of dodecanoic diacid and related synthesis intermediates may also be accomplished with continuous fermentation. Continuous fermentation is an open system where a defined fermentation media is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.

[0120] Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate. In other systems a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to media being drawn off must be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.

[0121] It is contemplated that the present nucleotides may be used to produce gene products having enhanced or altered activity. Various methods are known for mutating a native gene sequence to produce a gene product with altered or enhanced activity including but not limited to error prone PCR (Melnikov et al., Nucleic Acids Research, (Feb. 15, 1999) Vol. 27, No. 4, pp. 1056-1062); site directed mutagenesis (Coombs et al., Proteins (1998), 259-311, 1 plate. Editor(s): Angeletti, Ruth Hogue. Publisher: Academic, San Diego, Calif.) and “gene shuffling” (U.S. Pat. No. 5,605,793; U.S. Pat. No. 5,811,238; U.S. Pat. No. 5,830,721; and U.S. Pat. No. 5,837,458, incorporated herein by reference).

[0122] The method of gene shuffling is particularly attractive due to its facile implementation, and high rate of mutagenesis and ease of screening. The process of gene shuffling involves the restriction of a gene of interest into fragments of specific size in the presence of additional populations of DNA regions of both similarity to or difference to the gene of interest. This pool of fragments was then denatured and then reannealed to create a mutate gene. The mutated gene is then screened for altered activity.

[0123] The instant bacterial sequences of the present invention may be mutated and screened for altered or enhanced activity by this method. The sequences should be double stranded and can be of various lengths ranging form 50 bp to 10 kb. The sequences may be randomly digested into fragments ranging from about 10 bp to 1000 bp, using restriction endonucleases well known in the art (Maniatis supra). In addition to the instant bacteria sequences populations of fragments that are hybridizable to all or portions of the bacterial sequence may added. Similarly, a population of fragments which are not hybridizable to the instant sequence may also be added. Typically these additional fragment populations are added in about 10 to 20 fold excess by weight as compared to the total nucleic acid. Generally if this process is followed the number of different specific nucleic acid fragments in the mixture will be about 100 to about 1000. The mixed population of random nucleic acid fragments are denatured to form single-stranded nucleic acid fragments and then reannealed. Only those single-stranded nucleic acid fragments having regions of homology with other single-stranded nucleic acid fragments will reanneal. The random nucleic acid fragments may be denatured by heating. One skilled in the art could determine the conditions necessary to completely denature the double stranded nucleic acid. Preferably the temperature is from 80° C. to 100° C. Nucleic acid fragments may be reannealed by cooling. Preferably the temperature is from 20° C. to 75° C. Renaturation can be accelerated by the addition of polyethylene glycol (“PEG”) or salt. The salt concentration is preferably from 0 mM to 200 mM. The annealed nucleic acid fragments are next incubated in the presence of a nucleic acid polymerase and dNTP's (i.e. dATP, dCTP, dGTP and dTTP). The nucleic acid polymerase may be the Klenow fragment, the Taq polymerase or any other DNA polymerase known in the art. The polymerase may be added to the random nucleic acid fragments prior to annealing, simultaneously with annealing or after annealing. The cycle of denaturation, renaturation and incubation in the presence of polymerase is repeated for a desired number of times. Preferably the cycle is repeated from 2 to 50 times, more preferably the sequence is repeated from 10 to 40 times. The resulting nucleic acid is a larger double-stranded polynucleotide of from about 50 bp to about 100 kb and may be screened for expression and altered activity by standard cloning and expression protocol. (Manatis supra).

DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0124] The present invention relates to the isolation of genes encoding enzymes useful for the conversion of cyclododecanone to dodecanoic diacid. The relevant genes were isolated from a Rhodococcus ruber SC1 which was cultured from an industrial waste stream. Colonies that had the ability to grow on cyclododecanone as a sole carbon source were selected for further study.

[0125] To facilitate the isolation of the present gene cluster the clyclododecanone monooxygenase was isolated and purified from the Rhodococcus ruber SC1 strain on the basis of a substrate-dependent NADPH oxidation assay. Following purification the N-terminal sequence of the protein was determined by standard peptide sequencing methods.

[0126] Using the N-terminal sequence of the monooxygenase, the gene was recovered from the isolated Rhodococcus ruber SC1 genome in a cosmid. Sequencing of the cosmid revealed the gene sequence of the monooxygenase and the other associated ORF's encoding the remaining dodecanoic diacid synthesizing enzymes (ORF's 2-6). All the relevant ORF's resided on a 10 kb portion of the cosmid and the entire 10 kb region was sequenced.

[0127] Transformation studies revealed that 12-hydroxy lauric acid and dodecanoic diacid were synthesize in the presence of cyclododecanone by organisms transformed with the cosmid. Additionally it was demonstrated that lauryl lactone was accumulated in a recombinant organism comprising a plasmid subclone where the downstream gene (ORF 2, encoding the lauryl lactone esterase) was disrupted.

[0128] Further studies of enzyme kinetics indicated that the dodecanoic diacid synthesizing enzymes, acting in concert, had substrate specificities beyond their natural substrates. When cosmid transformants were grown in the presence of cyclic ketones ranging from C6-C15, good conversion to the corresponding hydroxy acids was seen.

EXAMPLES

[0129] The present invention is further defined in the following Examples presenting the details of the procedures that were followed in its development and validation. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

General Methods

[0130] Standard recombinant DNA and molecular cloning techniques used in the Examples are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, (1989) (Maniatis) and by T. J. Silhavy, M. L. Bennan, and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1984) and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, pub. by Greene Publishing Assoc. and Wiley-Interscience (1987).

[0131] Materials and methods suitable for the maintenance and growth of bacterial cultures are well known in the art. Techniques suitable for use in the following examples may be found as set out in Manual of Methods for General Bacteriology (Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, eds), American Society for Microbiology, Washington, D.C. (1994)) or by Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland, Mass. (1989). All reagents, restriction enzymes and materials used for the growth and maintenance of bacterial cells were obtained from Aldrich Chemicals (Milwaukee, Wis.), DIFCO Laboratories (Detroit, Mich.), GIBCO/BRL (Gaithersburg, Md.), or Sigma Chemical Company (St. Louis, Mo.) unless otherwise specified.

[0132] Manipulations of genetic sequences were accomplished using the BLAST family of programs which can be used for database similarity searches. The family includes BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995). Software for performing BLAST analyses is publicly available, e.g., through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) and other sources (BLAST Manual, Altschul et al., Natl. Cent. Biotechnol. Inf., Natl. Library Med. (NCBI NLM) NIH, Bethesda, Md. 20894; Altschul et al., J. Mol. Biol. 215:403-410 (1990)). Unless otherwise stated all sequence analysis algorithms employed default values.

[0133] The meaning of abbreviations is as follows: “h” means hour(s), “min” means minute(s), “sec” means second(s), “d” means day(s), “mL” means milliliters, “L” means liters.

[0134] Bacterial Strains and Plasmids:

[0135] Rhodococcus ruber SC1 was isolated from enrichment of activated sludge obtained from an industrial wastewater treatment facility. Escherichia coli XL1-BlueMR and SuperCos 1 cosmid vector were purchased as part of the SuperCos 1 Cosmid Vector Kit from Stratagene (La Jolla, Calif.). pBluescript SK(+) vector was also purchased from Stratagene. Shot-gun cloning vector pUC18 treated with SmaI/BAP was purchased from GIBCO/BRL.

[0136] Growth Conditions:

[0137] Bacterial cells were usually grown in Luria-Bertani medium containing 1% of bacto-tryptone, 0.5% of bacto-yeast extract and 1% of NaCl unless otherwise indicated below.

[0138] Synthetic S12 medium was used to establish enrichment. S12 medium contains the following: 10 mM ammonium sulfate, 50 mM potassium phosphate buffer (pH 7.0), 2 mM MgCl2, 0.7 mM CaCl2, 50 μM MnCl2, 1 μM FeCl3, 1 μM ZnCl3, 1.72 μM CuSO4, 2.53 μM CoCl2, 2.42 μM Na2MoO2, and 0.0001% FeSO4. The carbon sources were added directly to the S12 medium and the bacteria were grown in sealed culture flasks.

[0139] S12 agar was used to test isolates that utilize compounds as the sole source of carbon and energy. S12 agar was prepared by adding 1.5% Noble agar (DIFCO) to S12 medium. Bacteria growing on S12 agar were supplied with volatile compounds such as cyclododecanone by sprinkling solids of the volatile compound on the interior of the petri dish lid or 5 μl of other volatile liquid as vapor. The petri dish was sealed with parafilm and incubated with the lid on the bottom.

[0140] The standard M9 minimal medium was used to assay for dodecanoic diacid and/or intermediates production from recombinant E. coli clones. The M9 medium consisted of 42.3 mM Na2HPO4, 22.1 mM KH2PO4, 8.6 mM NaCl, 18.7 mM NH4Cl, 2 mM MgSO4, 0.1 mM CaCl2. 0.4% of glucose was used as the carbon source. 250 mg/l of cyclododecanone was added as the substrate for bioconversion.

[0141] Construction of Rhodococcusr Cosmid Library:

[0142] Rhodococcus ruber SC1 was grown in 25 mL LB medium till mid-log phase at 37° C. with aeration. Bacterial cells were centrifuged at 6,000 rpm for 10 min in a Sorvall RC5C centrifuge at 4° C. Supernatant was decanted and cell pellet was frozen at −80° C. Chromosomal DNA was prepared as outlined below with special care taken to avoid shearing of DNA. The cell pellet was gently resuspended in 5 mL of 50 mM Tris-10 mM EDTA (pH 8) and lysozyme was added to a final concentration of 2 mg/mL. The suspension was incubated at 37° C. overnight. Sodium dodecyl sulfate was then added to a final concentration of 1% and proteinase K was added at 100 μg/mL final concentration. The suspension was incubated at 55° C. for 5 h. The suspension became clear and the clear lysate was extracted with equal volume of phenol:chloroform:isoamyl alcohol (25:24:1). After centrifuging at 17,000 g for 20 min, the aqueous phase was carefully removed and transfered to a new tube. Two volumes of ethanol were added and the DNA was gently spooled with a sealed glass pasteur pipet. The DNA was dipped into a tube containing 70% ethanol. After air drying, the DNA was resuspended in 400 μl of TE (10 mMTris-1 mM EDTA, pH 8) with RNaseA (100 μg/mL) and store at 4° C. The concentration and purity of DNA was determined spectrophotometrically by OD260/OD280. A diluted aliquot of DNA was run on a 0.5% agarose gel to determine the intact nature of DNA.

[0143] Chromosomal DNA was partially digested with Sau3AI (GIBRO/BRL, Gaithersburg, Md.) as outlined by the instruction manual for the SuperCos 1 Cosmid Vector Kit. DNA (10 μg) was digested with 0.5 unit of Sau3AI at room temperature in 100 μl of reaction volume. Aliquotes of 20 μl were withdrawn at various time points of the digestion: e.g., 0, 3, 6, 9, 12 min. DNA loading buffer was added and samples were analyzed on a 0.5% agarose gel to determine the extent of digestion. A decrease in size of chromosomal DNA corresponded to an increase in the length of time for Sau3AI digestion. The larger scale preparative reaction was performed using 50 μg of DNA digested with 1 unit of Sau3AI for 3 min. at room temperature. The digestion was terminated by addition of EDTA to 8 mM final concentration. The DNA was extracted once with phenol:chloroform:isoamyl alcohol and once with chloroform. The aqueous phase was adjusted to 0.3 M NaOAc and ethanol precipitated. The partially digested DNA was dephosphorylated with calf intestinal alkaline phosphatase (Gibco/BRL) and ligated to SuperCos 1 vector, which had been treated according to the instructions in the SuperCos 1 Cosmid Vector Kit. The ligated DNA was packaged into lambda phage using Gigapack III XL packaging extract recommended by Stratagene. Manufacturer's instructions were followed. The packaged Rhodococcus genomic DNA library contained a phage titer of 1×105 colony forming units per μg of DNA as determined by transfecting E. coli XL1-Blue MR (Stratagene). Cosmid DNA was isolated from twelve randomly chosen E. coli transformants and found to contain large insert of DNA (30-40 kb).

[0144] Construction of Shot-Gun Sequencing Library:

[0145] Cosmid DNA with large DNA insert was sheared in a nebulizer (Inhalation Plastics Inc., Chicago, Ill.) at 20 psi for 45 sec and the 1-3 kb portion was gel purified. Purified DNA was treated with T4 DNA polymerase and T4 polynucleotide kinase following manufacturer's (GIBCO/BRL) instructions. Polished inserts were ligated to pUC18 vector using Ready-To-Go pUC18SmaI/BAP+Ligase (GIBCO/BRL). The ligated DNA was transformed into E. coli DH5α cells (Gibco/BRL) and plated on LB with ampicillin and X-gal. Majority of the transformants was white and those containing inserts were sequenced with the universal and reverse primers of pUC18 by standard sequencing methods.

[0146] Southern Hybridization:

[0147] Southern hybridization was used to map the junction of the insert DNA in cosmids. Cosmid DNA was digested with single restriction enzyme such as BglII, NcoI or XhoI. The digests were separated on a 0.9% agarose gel and transfered to positively charged Nylon membrane (Boehringer Mannheim, Indianapolis, Ind.) by alkaline downward capillary blotting. Probes for cyclododecanone monooxygenase gene and the alcohol dehydrogenase gene were prepared with PCR DIG labeling kit (Boehringer Mannheim) using digoxigenin-labeled dNTP. Hybridization was carried out overnight at 37° C. in Easy Hyb Solution (Boehringer Mannheim). The blot was washed once with 2×SSC+0.1% SDS and once with 0.1×SSC+0.1% SDS and developed with DIG-luminescent detection kit (Boehringer Mannheim).

[0148] Isolation and Identification of Dodecanoic Diacids or Intermediates:

[0149] Transformed XL1-Blue MR cells were grown in M9 medium with 0.4% glucose as sole carbon source. Substrate for conversion was added at early log phase (OD=0.2) and cells were allowed to grow at 30° C. for 20 additional hours. Cells were then frozen and thawed once, centrifiged, and supernatant was filtered through 0.2 μm filters. Filtrate was prepared for GC/MS analysis as described below.

[0150] Filtrate was first acidified to pH 2 using concentrated HCl. The acidified sample was extracted twice with methylene chloride or ethyl acetate. The extracts were combined and dried by adding anhydrous magnesium sulfate. Magnesium sulfate was then removed by filteration using Whatman 3MM filter paper and the remaining solvent in the filtrate was evaporated under a gentle stream of nitrogen. The dried residues were resuspended in 0.5 mL of methylene chloride as underivatized samples or derivatized with 0.5 mL of BSTFA [bis (trimethylsilyl) trifluoroacetamide] silylation reagent (SUPELCO, Bellefonte, Pa.). The GC/MS analysis was performed using a Hewlett Packard 5989B MS Engine GC/MS instrument. Samples were injected onto a 30 meter MDN-5S capillary column (SUPELCO, 0.5 μm film thickness) for separation. GC/MS analysis was conducted using electron impact ionization (70 eV).

Example 1

Isolation and Identification of a Bacterium That Grows With Cyclododecanone as Sole Source of Carbon and Energy

[0151] Bacterial strains that could grow on cyclododecanone as the sole source of carbon and energy were isolated. Analysis of 16s rRNA gene sequences indicated that the collection of isolates belong to the the bacterial genus Rhodococcus.

[0152] Bacterial strains that grew on cyclododecanone were isolated from an enrichment culture. The enrichment culture was established by inoculating 1 mL of activated sludge into 20 mL of S12 medium in a 125 mL screw-cap Erlenmeyer flask. The activated sludge was obtained from a wastewater treatment facility. The enrichment culture was supplemented with flakes of cyclododecanone, added directly to the culture medium and was incubated at 35° C. with reciprocal shaking. The enrichment culture was maintained by adding cyclododecanone flakes every 4-6 days. The culture was diluted every 5-11 days by replacing 18 mL of the culture with the same volume of S 12 medium. After 24 days of incubation, 100 μl of the enrichment culture was spread onto S12 plates with cyclododecanone as the carbon source. Bacteria that grew on the S12/cyclododecanone plates were purified by streaking onto R2A agar media (DIFCO Laboratory, Detroit, Mich.). A single colony, designated as SC1, was isolated and it was able to grow on S12 liquid with cyclododecanone as the sole carbon and energy source.

[0153] Strain SC1 was typed using 16s rRNA gene sequence analysis as follows. SC1 was grown on R2A agar. Several colonies from the plate were suspended in 200 μl of TE+ RNase and 0.1 mg/mL of lysozyme, and incubated 37° C. for 4 hrs. To this mixture Proteinase K and SDS were added to final concentration of 50 μg/mL of and 0.5%, respectively. The mixture was extracted with phenol/chloroform and precipitated with sodium acetate and ethanol. The 16s rRNA gene sequences in the suspension were amplified by PCR by using a commercial kit according to the manufacturer's instructions (Perkin Elmer, Norfolk, Conn.) with JCR14 primer ACGGGCGGTGTGTAC (SEQ ID NO:16) and JCR15 primer GCCAGCAGCCGCGGTA (SEQ ID NO:17). PCR was performed in a Perkin Elmer GeneAmp 9600. The samples were incubated for 5 min at 94° C. and then cycled 35 times at 94° C. for 30 sec, 55° C. for 1 min and 72° C. for 1 min. The amplified 16s rRNA genes were purified using a QIAquick PCR Purification Kit according to the manufacturer's instructions (Qiagen, Valencia, Calif.) and sequenced on an automated ABI sequencer. The 16s rRNA gene sequence of strain SC1 was used as the query sequence for a BLASTN search (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”, Nucleic Acids Res. 25:3389-3402. The isolate has close homology to Rhodococcus ruber, and designated as R. ruber strain SC1.

[0154] Rhodococcus ruber SC1 isolated from cyclododecanone (C12 cyclic ketone) enrichment culture was also tested for growth on cyclic ketones of different carbon numbers as sole carbon and energy source (Table 3). It grows well on cyclopentadecanone (C15 cyclic ketone), cyclotridecanone (C13 cyclic ketone), cyclododecanone (C12 cyclic ketone) and cycloundecanone (C11 cyclic ketone). It grows moderately well on cyclodecanone (C10 cyclic ketone). It does not grow on cyclooctanone (C8 cyclic ketone), cycloheptanone (C7 cyclic ketone) and cyclohexanone (C6 cyclic ketone).

Example 2

Purification and Characterization of Cyclododecanone Monooxygenase Enzyme From Rhodococcus Ruber SC1

[0155] Purification of Cyclododecanone Monooxygenase:

[0156] One liter of LB in a 2.8 L Fernbach flask was inoculated with Rhodococcus ruber SC (100 mL LB culture grown overnight) and allowed to grow at 37° C. with shaking for about 24 h. Cells were collected by centrifugation (11000×g, 20 min) in sterile bottles, washed twice with S12+10 mg/L yeast extract medium (S12+YE, 200 mL), and added to S12+YE (1 L), supplemented with about 8-10 mg of solid cyclododecanone, and allowed to grow at 37° C. overnight. A second portion of cyclododecanone was added in the morning, and the culture was allowed to grow for 6-8 h longer. The cells were then collected by centrifugation. A typical culture provided 5-7 g of cell paste.

[0157] The above cell paste was suspended in 40 mL of 50 mM Na-HEPES buffer (N-2-hydroxyethyl piperazine-N′-2-ethanesulfonic acid, pH 7.5). About two mg of lysozyme was added, and the suspension was kept at 0° C. for 0.5 to 2 h. 0.2 mL of PMSF stock solution (phenylmethylsulfonyl fluoride, 0.1 M in ethanol) was added and the suspension was passed seven times through a French press at 16000 psi. PMSF was added again as before, and the extract was centrifuged (9000×g, 20 min). The supernatant was set aside as the crude cell extract. The pellet was suspended in 20 mL of HB buffer (50 mM Na-HEPES, pH 7.5,+10 mM 2-mercaptoethanol), and centrifuged as before. The crude cell extracts were combined, diluted with HB to 250 mL, and applied to Pharmacia Q-Sepharose fast flow column (column volume: 100 mL in HB, run at 4° C.). The column was washed with HB (100 mL) and eluted with a linear NaCl gradient (0 to 0.7 M NaCl in HB, 500 mL each with 2.4 mL/min flow rate). Activity of fractions were determined by NADPH oxidation assay. Active fractions were pooled (typically ˜40 mL) and diluted with HB (total volume ˜200 mL), and applied to an Amicon Matrex Red A agarose column (column volume:5 mL in HB, run at 4° C., Beverly, Mass.). The red agarose affinity column is designed for enzymes requiring NADPH as cofactor [Branchaud and Walsh, J. Am. Chem. Soc. 107,2153-2161 (1985)]. The column was washed with 15 mL of HB, and monoxygenase was eluted with 25 mL of NADPH (0.1 mM). Further purification was obtained by gel filtration with TSK-3000SW column (TosoHaas, Montgomeryville, Pa.) using HB buffer at 0.5 mL/min flow rate or by Reverse Phase-HPLC using Vydac CA column (4.6×250 mm, The Separation Group, Hesperia, Calif.) using water+0.1% TFA (A) and acetonitrile+0.1% TFA (B) gradient at flow rate of 1 mL/min. The gradient was set as follows: 0 min, 25% B; 5 min, 25%B; 14 min, 43%B; 54 min, 51%B; 54.1 min, 90%B; 59 min, 90%B. A typical load was ˜0.5 mg protein.). Protein eluted from the affinity column was typically >90% pure when examined by SDS-PAGE, and the yield was on the order of ˜0.02 mg per g of cell paste. The size of the protein was estimated to be 65-70 kD.

[0158] Activity of cyclododecanone monooxygenase in the fractions was assayed by substrate-dependent NADPH oxidation. Typically, the background rate of NADPH oxidation (340 nm, 6.22 mM) in a mixture of 0.2 mL of enzyme+buffer (0.1 M glycine-NaOH, pH 8.8) without substrate was recorded using a spectrophotometer. One microliter of cyclododecanone (10 mM in n-propanol stock) was added, mixed with a loop of teflon-coated wire, and the A340 trace was examined for cyclododecanone-stimulated NADPH oxidation.

[0159] The cyclododecanone monooxygenase enzyme was usually assayed by cyclododecanone-dependent NADPH oxidation as described previously. The product of the reaction, which is the lauryl lactone converted from cyclododecanone by the purified enzyme was also confirmed by GC/MS, as follows. Enzyme purified from the red agarose column was depleted of NADPH by repeated concentration and dilution cycles, using HB buffer and a Centricon-30 (Amicon). Cyclododecanone (800 nmol, 146 μg) in n-propanol was taken close to dryness in a 1 mL cuvette, diluted with 0.94 mL HB buffer, and supplemented with NADPH (36 μl of 11 mM stock). Twenty microliter of enzyme was added (5.8 mg/mL stock, determined using the Bio-Rad protein assay). After 20 min, the A340 had decreased to about ¼ of its initial value. Additional NADPH (18 μl of 11 mM stock) was added at 20 min and at 1 h. At 90 min, the pH was adjusted to ˜3 using the color of added bromophenol blue as a guide, and octadecane (146 μg) was added as an internal standard for GC/MS analysis. The sample was extracted with one mL of hexane (3×), dried with MgSO4, and analyzed by GC/MS. HP5890 Gas Chromatographer was connected to a HP5971 mass-selective detector. DB-1 capillary column was used with 3 min hold at 75° C., increase to 220° C. at 10° C./min, increase to 300° C. at 20° C./min and 3.5 min hold at 300° C. Peaks were identified by comparison of their retention times and mass spectra with those of authentic standards. The sample contained lauryl lactone, cyclododecanone, and octadecane at ˜1:0.08:1 area ratio, respectively. A parallel sample without enzyme contained cyclododecanone and octadecane only, at 0.75:1 area ratio.

[0160] Partial Amino Acid Sequencing of Cyclododecanone Monooxygenase Protein:

[0161] Protein from the red agarose column was separated on SDS-PAGE and electroblotted to PVDF membrane. The prominent 65 kD protein band was excised from the membrane and used for N-terminal amino acid sequencing by Edman degradation. N-terminal sequence of TTSIDREALRRKYAEERDKR (SEQ ID:14) was obtained. For internal sequence, protein was further purified by Reverse Phase-HPLC and 1 mg of protein was recovered from the HPLC purification. The recovered protein was dried, dissolved in 100 μl 70% formic acid containing 3 mg CNBr, and digested overnight. SDS gel loading buffer (50 μl) was added, plus enough 0.1 M Tris-Cl, pH 8, to bring the pH above 6. The volume was then reduced in a Centricon-10 concentrator (Amicon), and used for SDS-PAGE and electroblotting for N-terminal sequencing of one of the most prominent CNBr fragment bands. The internal amino acid sequence of the ERIRARVDEIG (SEQ ID:15) was obtained and used to design degenerate primer for PCR amplification of portion of the cyclododecanone monooxygenase gene.

Example 3

Cloning of Cyclododecanone Monooxygenase Gene From Rhodococcus Ruber SC1

[0162] Reverse genetics strategy was employed for the cloning of cyclododecanone monooxygenase gene. Partial amino acid sequences were obtained from the purified enzyme as described above. The N-terminal amino acid sequence: TTSIDREALRRKYAEERDKR (SEQ ID NO:14) and the internal peptide sequence: ERIRARVDEIG (SEQ ID NO:15) were used to design degenerate PCR primers. Primer CDDK4: AARTAYGCNGARGARCGNGAYAA, where R=A or G, Y=C or T, N=A or C or G or T (SEQ ID NO:18) was derived from the N terminal sequence and primer CDDK10: CCDATYTCRRCNACNCKNGC, where D=A or G or T, Y=C or T, R=A or G, N=A or C or G or T (SEQ ID NO:19) was derived from the internal sequence. PCR was carried out as follows: one cycle of 94° C. for 5 min, 35 cycles of 94° C. for 1 min, 30° C. for 1 min and 72° C. for 30 sec followed by 1 cycle of 72° C. for 5 min. The PCR products obtained ranged from about 300 bp to 800 bp. The mixture of PCR products was cloned into the pCR2.1-TOPO cloning vector following manufacturer's instruction (Invitrogen, Carlsbad, Calif.). About 20 clones were sequenced using the standard M13 forward (−20) primer and the M13 reverse primer from the vector. One of the clones containing a insert of 556 bp had significant homology to cyclohexanone monooxygenase from Acinetobacter sp. NCIB9871 [Chen et al., J. Bacteriol. 170 (2), 781-789 (1988)] and steroid monooxygenase from Rhodococcus rhodochrous (Morii et al, AB010439). The deduced amino acid sequence of both ends of the insert DNA matched with the partial amino acid sequences (SEQ ID NO:14 and SEQ ID NO:15) previously determined from sequencing of the purified protein. The amino terminal methionine residue is cleaved thus, not found in the mature protein.

Example 4

Identification and Characterization of Cosmid Clones Containing Cyclododecanone Monooxygenase Gene From SC1 Library

[0163] The cosmid library of Rhodococcus SC1 was screened using specific primers designed based on the sequence of the amplified N terminal DNA fragment of cyclododecanone monooxygenase gene from degenerate PCR. Two primers, C12 MO TOP: ATGCAGAGGAGCGGGACAAG (SEQ ID NO:20) and C12 MO BOTTOM: ACTTCGGTGTGGAACAGCGC (SEQ ID NO:21) amplified the 430 bp of N terminal fragment of cyclododecanone monooxygenase gene. The cosmid library was screened by PCR using C12 MO TOP and C12 MO BOTTOM primers. Six positive clones (D12D, E9F, O8E, O11G, S8C and T3C) were identified from two independent screens of total of 2000 clones. They all contain inserts of 35-40 kb spanning the cyclododecanone monooxygenase gene. Shot gun libraries of some of the cosmids were constructed and inserts were sequenced with pUC18 universal and reverse primers. Sequences of 400 clones were assembled using Sequencher 3.0 program and a contig of 10480 bp (SEQ ID NO:13) containing the cyclododecanone monooxygenase gene was formed.

[0164] Six ORFs (designated cddA, cddB, cddX, cddY, cddC and cddD) were identified from the 10480 bp contig (FIG. 2). BLAST (Basic Local Alignment Search Tool; Altschul, S. F., et al., (1993) J. Mol. Biol. 215:403-410; see also www.ncbi.nlm.nih.gov/BLAST/) searches were conducted for similarity to sequences contained in the BLAST “nr” database (comprising all non-redundant GenBank CDS translations, sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, SWISS-PROT protein sequence database, EMBL, and DDBJ databases). The sequences obtained were analyzed for similarity to all publicly available DNA sequences contained in the “nr” database using the BLASTN algorithm provided by the National Center for Biotechnology Information (NCBI). The DNA sequences were translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the “nr” database using the BLASTX algorithm (Gish, W. and States, D. J. (1993) Nature Genetics 3:266-272) provided by the NCBI.

[0165] The sequence comparisons based on BLASTX analysis against the “nr” database are given below in Table lusing Xnr BLAST algorithm.

TABLE 1
Gene		SEQ ID	SEQ ID	%	%
Name	Similarity Identified	base	Peptide	Identitya	Similarityb	E-valuec
cddA	pir||A28550	1	2	30	46	3e−58
	cyclohexanone monooxygenase
	[Acinetobacter sp.]
cddB	emb|CAA78842| (Z15137)	3	4	41	54	4e−78
	esterase A [Streptomyxes chrysomallus]
cddX	Not hits found	5	6
cddY	emb|CAA18084.1| (AL022121)	7	8	49	61	e−169
	hypothetical protein Rv3762c
	[Mycobacterium tuberculosis]
cddC	emb|CAB02404| (Z80226) adhB	9	10	49	64	e−105
	alcohol dehydrogenase [Mycobacterium
	tuberculosis]
cddD	emb|CAB46804.1| (AL096811) putative	11	12	50	63	e−127
	aldehyde dehydrogenase [Streptomyces
	coelicolor]
a% Identity is defined as percentage of amino acids that are identical between the two proteins.
b% Similarity is defined as percentage of amino acids that are identical or conversed between the two proteins.
cExpect value. The Expect value estimates the statistical significance of the match, specifying the number of matches, with a given score, that is expected in a search of a database of this size absolutely by chance.

[0166] BLAST results indicated that the sequence with the greatest homology to cddA encoding the monooxygenase was 30% identical and 46% similar to the gene published by Chen et al., J. Bacteriol. 170 (2), 781-789 (1988). The sequence with the greatest homology to cddB encoding the esterase was 41% identical and 54% similar to the gene published by Berger et al., J. Bacteriol. 180 (23), 6396-6399 (1998). The sequence with the greatest homology to cddC encoding the alcohol dehydrogenase was 49% identical and 64% similar to the gene adhB identified from the complete genome sequence of Mycobacterium tuberculosis published by Cole et al., Nature. 393 (6685), 537-544 (1998). The sequence with the greatest homology to cddD encoding the aldehyde dehydrogenase was 50% identical and 63% similar to the gene identified from the Streptomyces coelicolor sequencing project at Sanger Centre.

Example 5

Production of 12-Hydroxyl Lauric Acid and 1,12 Dodecanoic Diacid By E. Coli Cosmid Clones

[0167] Six E. coli cosmid clones containing the 10 kb fragment including cyclododecanone monooxygenase gene were grown in M9 minimal medium supplemented with 0.4% glucose as the carbon source. Cells were grown at 30° C. with shaking to OD600 of 0.2 and cyclododecanone dissolved in ethanol was added to each culture to a concentration of 250 mg/L. Cells were further incubated at 30° C. for 20 h. Control culture consisted of the host strain transformed with the SuperCos vector only was grown under the same conditions. Samples were frozen at −80° C. and thawed at 37° C. Cells were pelleted and supernatants were passed through 0.22 μm disc filters. The filtered supernatants were acidified to pH 2 and extracted with methylene chloride. The methylene chloride residues after evaporation were derivatized by BSTFA (bis(trimethylsilyl) trifluoro acetamide) before injected onto the GC column.

[0168] All six cosmid clones produced a large peak with retention time around 24.8 min. Mass spectrometry analysis showed that the molecular weight of the compound in the peak was 360, corresponding to trimethylsilylated (TMS) 12-hydroxy lauric acid. In the vector control sample, this product peak was not detected. Furthermore, the cyclododecanone substrate peak at retention time around 19.7 min (molecular weight of 182) was detected in the vector control sample, but disappeared from the cosmid samples. Therefore, cyclododecanone was converted by the cosmid clones to 12-hydroxy lauric acid. In addition, a small peak at retention time around 25.6 min was also detected in some of the cosmid samples. Mass spectrometry analysis revealed the molecular weight of the peak compound to be 374, corresponding to the trimethylsilylated (TMS) 1,12-dodecanoic diacid (DDDA).

[0169] Quantitation experiment was performed by GC analysis with three representatives of the cosmid clones S8C, D12D O8E and the vector control using a DB-5 column (30 m×0.32 mm i.d. with a 1 μm coating, J &W Scientific). The temperature was programmed to begin at 50° C. for 5 min, ramp to 310° C. at 10° C./min and hold at 310° C. for 5 min. The injector was at 125° C. and the flame ionization detector was at 320° C. The retention time of the peaks was compared to that of the 12-hydroxy lauric acid or DDDA authentic standard. The quantitation result based on the peak area calculation was summarized in Table 2. Conversion percentage of cyclododecanone (CDDK) to 12-hydroxy lauric acid was high (56%), which suggested that the cyclododecanone monooxygenase cddA and the lauryl lactone hydrolase cddB were actively expressed in E. coli. The percentage for CDDK to DDDA conversion was only 1.7%, however, it was over 40 times higher than the background level in D12D and O8E (Table 2). One likely explanation was that the alcohol dehydrogenase and the aldehyde dehydrogenase encoded by cddC and cddD on S8C responsible for further convertion of 12-hydroxy lauric acid to DDDA were poorly expressed in E. coli.

TABLE 2
Production Of 12-Hydroxy Lauric Acid And DDDA From
Cyclododecanone By E. Coli Cosmids
		12-hydroxy lauric acid	DDDA (% of
	Cosmid clones	(% of conversion)	conversion)
	Vector control	0	0
	S8C	4900 μg (56.1%)	160 μg (1.7%)
	D12D	2140 μg (24.1%)	39 μg (0.04%)
	O8E	360 μg (4.1%)	2 μg (0.021%)

Example 6

Production of 12-Hydroxy Lauric Acid by E. Coli Subclone Containing Only cddA and cddB Genes

[0170] Since cosmids contain insert DNA about 35 kb, question arises as what subset of the genes on the cosmids contributed to converting cyclododecanone to 12-hydroxy lauric acid. Southern hybridization and PCR analysis suggested that most cosmids such as S8C contain the full 10 kb gene cluster and substantial upstream and downstream region. However, some cosmids contained only part of the 10 kb gene cluster. Cosmid D12D contains about 30 kb of upstream region plus only cddA and cddB gene from the cluster. The 3′ end of the insert lay within the alcohol dehydrogenase sequence (cddC gene). Sequencing of the junction of D12D cosmid DNA using standard T7 primer on the vector mapped the end to be at 7346 bp, which contains only 51 bp of the N terminal region of the alcohol dehydrogenase gene (cddC). On the other hand, cosmid O8E contains intact cdd genes and about additional 25 kb downstream region, but very limited upstream region. Sequencing of the O8E 5′ insert junction indicated that 515 bp upstream of cddA was present on O8E. The fact that lower amount of 12-hydroxy lauric acid was detected in O8E (Table 2) compared to S8C suggested that the limited upstream region of cddA and B on O8E might have affected the expression of cddA and B resulting in lower conversion to 12-hydroxy lauric acid. Taken together, the overlapping region of the D12D and O8E insert encodes only cddA and cddB genes. Both D12D and O8E produced 12-hydroxy lauric acid from cyclododecanone, which indicated that the only common genes cddA and cddB on the two clones were required for the conversion (FIG. 3).

[0171] To confirm that only cddA and cddB genes are required for conversion of cyclododecanone to 12-hydroxy lauric acid, these two genes with about 1 kb upstream region were subcloned onto pBluescript SK(+) vector. Primer KK1: CCCCAAGCTTGAACCCAGCCCCTGCAAGAT (SEQ ID NO:22) and primer KK2: GGACTAGTTCAGTTCGAGCATCAGCCGCGG (SEQ ID NO:23) was used to amplify a 4243 bp fragment containing the cddA and cddB genes plus 1072 bp upstream and 101 bp downstream region. PCR product was digested with HindIII and SpeI and cloned into HindIII and SpeI sites of pBluescript SK(+) to construct pDCQ5. In pDCQ5, the cddAB genes was in the opposite orientation as the lacZ gene on the vector. A similar construct pDCQ6 was made using primer KK3: GGACTAGTGAACCCAGCCCCTGCAAGAT (SEQ ID NO:24) and primer KK4: CCCCAAGCTTGTAGGAGAGTGCACCCTGGA (SEQ ID NO:25), which placed cddA and B genes in the same orientation as the lacZ gene. The fact that cosmid S8C produced 12-hydroxy lauric acid in E. coli suggested that either the promoter for cddA and cddB genes functions in E. coli or there is a fortuitous E. coli promoter present upstream of the cddA and B genes that drives the expression of the cddAB genes. The 1 kb upstream region on pDCQ5 or pDCQ6 presumably contains the promoter needed to express cddA and B genes in E. coli.

[0172] pDCQ5 and pDCQ6 were transformed into E. coli XL1 BlueMR cells for bioconversion analysis. Two clones of each construct were chosen to grow in M9+glucose medium with cyclododecanone as substrate. Presence of 12-hydroxy lauric acid was assayed by GC/MS as described previously. 12-Hydroxy lauric acid was detected in both clones of pDCQ6, but not in either of the two clones of pDCQ5. DDDA was not detected in any clones of pDCQ5 or pDCQ6. Therefore, introducing only cddAB genes in the orientation as such on pDCQ6 conferred E. coli the ability to convert cyclododecanone to 12-hydroxy lauric acid. cddA gene encodes the cyclododecanone monooxygenase that converts cyclododecanone to lauryl lactone. cddB gene encodes lauryl lactone esterase that hydrolyzes the lauryl lactone to 12-hydroxy lauric acid.

Example 7

Production of Lauryl Lactone by Hydrolase Deletion Mutant

[0173] Conversion of cyclododecanone to lauryl lactone by cyclododecanone monooxygenase was demonstrated in vitro using purified enzyme as illustrated in Example 2. To demonstrate lauryl lactone could be produced and accumulated as an intermediate in vivo, E. coli strains containing only cyclododecanone monooxygenase gene cddA by deleting the downstream hydrolase gene cddB were constructed. The cddB hydrolase gene was deleted from pDCQ5 by isolating and self-ligating the 5.9 kb Klenow filled BglII-XbaI fragment containing the vector and cddA gene away from the 1.3 kb fragment containing cddB gene. The cddB esterase gene was deleted from pDCQ6 by isolating and self-ligating the 5.9 kb Klenow filled BglII-HindIII fragment containing the vector and cddA gene away from the 1.3 kb fragment containing cddB gene. The resulting constructs pDCQ7 and pDCQ8 were verified by restriction digests and retransformed into XL1BlueMR cells (Stratagene) for intermediates analysis by HPLC and GC/MS.

[0174] Two isolates of each construct pDCQ7 or pDCQ8 were grown in the presence of cyclododecanone as described previously. 100 uL of unconcentrated supernatants were taken for HPLC analysis. The pellets were extracted with 10 mL of acetonitrile and 100 uL of the pellet extracts were also analyzed by HPLC. The HPLC system used was a Hewlett-Packard 1100 series with a Photodiode array detector. Wavelength of 220 nm was used for detection. A Zorbax reverse phase C18 column (4.6 mm×25.0 cm) was purchased from Agilent Technologies (Palo Alto, Calif.). The column temperature was 30.0° C. and the flow rate was 1.0 mL/min. The isocratic mobile phase was 75% acetonitrile and 25% water. The retention time of the experimental samples were compared to that of the lauryl lactone authentic standard (Aldrich). Lauryl lactone was detected in the pellet extracts for both pDCQ8 clones, but not in any pDCQ7 clones, consistent with the expression interference observed in pDCQ5 (Example 6), from which pDCQ7 was derived. No lauryl lactone was detected in any supernatant.

[0175] Both supernatants and pellets were also analyzed by GC/MS as described previously. Supernatants were extracted with methylene chloride or ethyl acetate. The supernatant extracts and the acetonitrile pellet extracts were dried and concentrated in 1 mL of methylene chloride. One μl of underivatized sample was split injected and analyzed by GC/MS. Results confirmed those from the HPLC analysis. No lauryl lactone was detected in any of the concentrated supernatants, presumably due to hydrophobicity of the compound. Lauryl lactone and cyclododecanone were detected in pellet extracts of pDCQ8, which the putative native promoter was in the same orientation as the plac promoter on the vector. No lauryl lactone was detected in pellet extracts of pDCQ7, which the putative native promoter was in the opposite orientation as the plac promoter on the vector. Therefore, cyclododecanone monooxygenase was confirmed in vivo to convert cyclododecanone to lauryl lactone, and lauryl lactone was accumulated when the lauryl lactone hydrolase was genetically knocked out.

Example 8

Production Of Different Chain Length Hydroxy Acids by Recombinant E. Coli Clones

[0176] Example 8 explores whether the cyclic substrates could be expanded to cyclic ketones of different chain length and whether corresponding hydroxy acids could be produced. S8C was grown as described above except that different cyclic ketones were added. Cyclohexanone (C6), cycloheptanone (C7), cyclooctanone (C8), cyclodecanone (C10), cycloundecanone (C11), cyclododecanone (C12), cyclotridecanone (C13) and cyclopentadecanone (C15) were added as substrates at 250 mg/L concentration. Identification of the corresponding hydroxy acids produced was performed by GC/MS analysis as described above. Large amount of corresponding hydroxy acids were detected from S8C grown in the presence of C11, C12 and C13 cyclic ketones. Medium level of 15-hydroxy acid was detected from C15 cyclic ketone grown cells. Small amount of hydroxy acids was detected from cells grown on C6 and C10 cyclic ketones. No hydroxy acid was detected when cells were grown on C7 or C8 cyclic ketones. The substrate range of the monooxygenase and esterase on the S8C appeared to favor long chain cyclic ketones (C>10). This correlated well with the growth substrate range (C10-C15) of the Rhodococcus ruber SC1. The ability of Rhodococcus ruber SC1 to grow on cyclic ketones of C11-C15 was likely due to the relatively broad substrate specificity of the single set of monooxygenase and esterase encoded on S8C clone (Table 3). It is possible that mixture of the large cyclic ketones may be used as substrates in a biotransformation to produce a mixture of long chain hydroxy acids or diacids for certain applications.

TABLE 3
Cyclic Ketones Specificity
Cyclic
Ketone	Growth of	Corresponding Hydroxy Acid
Substrate	RhodococcusruberSC1	Produced by E. coli Cosmids
C6	−	+/−
C7	−	−
C8	−	−
C10	+	+/−
C11	+	++
C12	+	++
C13	+	++
C15	+	+

Example 9

Functional Expression of cddA Gene in E. coli

[0177] The initial purification of cyclododecanone monooxygenase from the native host of Rhodococcus ruber SC1 yielded only small amount of protein. It was decided to express the cddA gene from a strong E. coli promoter to increase protein yields.

[0178] Two primers, cddA-N: ATGACGACGAGCATCGACCG (SEQ ID NO:38) and cddA-C: TCAGCGGAAGGTGAGGCCGTCG (SEQ ID NO:39) were designed to amplify the 1812 bp full length of cddA gene from ATG start codon to TGA stop codon. The amplified cddA gene was cloned into pTrcHis2 TOPO TA cloning vector (Invitrogen, Carlsbad, Calif.) and transformed into TOP10 competent cells (Invitrogen). The ampicillin resistant transformants were first screened for the presence of the insert. They were also digested with EcoRI to check the insert orientation. Three clones designated pDCQ9, two of them (#2 and #5) in the forward orientation and the other one (#3) in the reverse orientation, were chosen for further protein expression analysis.

[0179] The cells were diluted from fresh overnight culture and growing in LB with ampicillin at 37° C. for about 3 hours. Each culture was divided into two tubes, one induced with 1 mM IPTG and one not induced. They were further incubated for 2 hours at 37° C. Cells from 1 mL of each sample were pelleted and resuspended in SDS sample buffer (BIO-RAD, Hercules, Calif.). The samples were boiled for 5 min and spun at 14,000 g for 10 min. The supernatants were loaded onto 8-16% gradient Tris-Glycine polyacrylamide gel (FMC BioProducts, Rockland, Me.). Overexpression of a protein at the expected molecular weight 65 kD was achieved with clone #2 and #5 under IPTG induction. The protein was also expressed at higher than basal levels in these two clones without IPTG induction, which is likely due to the leaky expression of the trc promoter under uninduced condition. On the other hand, no expression of this protein was observed with clone #3, which cddA gene was cloned in the wrong orientation relative to the trc promoter, under both induced and uninduced conditions.

[0180] For protein purification, 1-liter cultures of Top10/pDCQ9 clone #2 were grown in 2.81 Fembach flasks, in LB+100 μg/mL ampicillin, at 37° C. Enzyme production was induced by addition of 1 mM IPTG when the absorbance of the culture at 600 nm reached ˜0.75, and growth was continued for four hours. Cells were collected by centrifugation, and stored at −76° C. until needed. The purification was carried out at 4° C. Cells (˜5 g wet weight) were suspended in HB buffer (50 mM Na-HEPES, pH 7.5, containing 10 mM 2-mercaptoethanol), to a volume of 40 mL. Phenylmethanesulfonyl fluoride (PMSF, 200 μl of 0.1 M in ethanol stock) was added, and the cells were passed through a French press at 16,000 psi. A second portion of PMSF was added, and cell debris was removed by centrifugation. The extract was applied to a 25 mL column of Q-Sepharose fast flow (Pharmacia) in HB, and the column was washed with 40 mL HB. The column was eluted with a gradient (250 mL total volume) from 0 to 0.7 M NaCl in HB. Active fractions, which were bright yellow in color, were pooled and diluted to 200 mL in HB. The pool was applied to a 60 mL column of Amicon Matrex Red A agarose, and followed with 60 mL of HB. Approximately 30 mg of homogeneous enzyme was eluted from the column with 200 mL 100 μM NADPH in HB. The yield of purified enzyme from the recombinant E. coli strain (6 mg of enzyme/g of cell paste) was much higher than the 20 μg of enzyme/g of cells yield from the native Rhodococcus strain. Activity of the enzyme purified from E. coli was also demonstrated using the cyclododecanone-dependent NADPH oxidation assay as described previously.

Claims

1. An isolated nucleic acid fragment encoding a dodecanoic diacid synthesizing enzyme selected from the group consisting of: (a) an isolated nucleic acid fragment encoding all or a substantial portion of the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12; (b) an isolated nucleic acid fragment that is substantially similar to an isolated nucleic acid fragment encoding all or a substantial portion of the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12; (c) an isolated nucleic acid molecule that hybridizes with (a) under the following hybridization conditions: 6×SSC (1 M NaCl), 50% formamide, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.; and (d) an isolated nucleic acid fragment that is complementary to (a), (b) or (c).

2. An isolated nucleic acid molecule comprising a first nucleotide sequence encoding an enzymatically active cyclododecanone monooxygenase of at least 603 amino acids that has at least 30% identity based on the Smith-Waterman method of alignment when compared to a polypeptide having the sequence as set forth in SEQ ID NO:2 or a second nucleotide sequence comprising the complement of the first nucleotide sequence.

3. An isolated nucleic acid molecule comprising a first nucleotide sequence encoding an enzymatically active lauryl lactone esterase of at least 386 amino acids that has at least 41% identity based on the Smith-Waterman method of alignment when compared to a polypeptide having the sequence as set forth in SEQ ID NO:4 or a second nucleotide sequence comprising the complement of the first nucleotide sequence.

4. An isolated nucleic acid molecule comprising a first nucleotide sequence encoding an enzymatically active 12-hydroxylauric acid dehydrogenase of at least 374 amino acids that has at least 49% identity based on the Smith-Waterman method of alignment when compared to a polypeptide having the sequence as set forth in SEQ ID NO:10 or a second nucleotide sequence comprising the complement of the first nucleotide sequence.

5. An isolated nucleic acid molecule comprising a first nucleotide sequence encoding an enzymatically active 12-oxo lauric acid dehydrogenase of at least 474 amino acids that has at least 50% identity based on the Smith-Waterman method of alignment when compared to a polypeptide having the sequence as set forth in SEQ ID NO:12 or a second nucleotide sequence comprising the complement of the first nucleotide sequence.

6. An isolated nucleic acid fragment having 80% identity to the nucleic acid fragment selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9,.SEQ ID NO:11, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37.

7. An isolated nucleic acid fragment having 90% identity to the nucleic acid fragment selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37.

8. The isolated nucleic acid fragment of claim 1 selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37.

9. A polypeptide encoded by the isolated nucleic acid fragment of claim 1.

10. The polypeptide of claim 9 selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12.

11. A chimeric gene comprising the isolated nucleic acid fragment of claim 1 operably linked to suitable regulatory sequences.

12. A transformed host cell comprising a host cell and the chimeric gene of claim 11.

13. The transformed host cell of claim 12 wherein the host cell is selected from the group consisting of bacteria, yeast and filamentous fungi.

14. The transformed host cell of claim 13 wherein the host cell is selected from the group consisting of Escherichia, Bacillus, Streptomyces, Pseudomonas, Salmonella, Acinetobacter, Rhodococcus, Aspergillus, Saccharomyces, Corynebacterium and Pichia.

15. A method of obtaining a nucleic acid fragment encoding all or a substantial portion of a dodecanoic diacid synthesizing enzyme comprising: (a) probing a genomic library with the nucleic acid fragment of claim 1;(b) identifying a DNA clone that hybridizes with the nucleic acid fragment of claim 1 under the following conditions; 6×SSC (1 M NaCl), 50% formamide, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.; and (c) optionally sequencing the genomic fragment that comprises the clone identified in step (b), wherein the sequenced genomic fragment encodes all or substantially all of an amino acid sequence encoding a dodecanoic diacid synthesizing enzyme.

16. A method of obtaining a nucleic acid fragment encoding all or a substantial portion a dodecanoic diacid synthesizing enzyme comprising: (a) synthesizing at least one oligonucleotide primer corresponding to a portion of the sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37; and (b) amplifying an insert present in a cloning vector using the oligonucleotide primer of step (a); wherein the amplified insert encodes a portion of an amino acid sequence encoding a dodecanoic diacid synthesizing enzyme.

17. The product of the method of claims 15 or 16.

18. A method for the production of dodecanedioic acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of cyclododecanone whereby dodecanedioic acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12 under the control of suitable regulatory sequences.

19. The method of claim 18 wherein said nucleic acid fragment is a 10 kb gene cluster as set forth in SEQ ID NO:13.

20. A method for the production of lauryl lactone comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of cyclododecanone whereby lauryl lactone is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2, under the control of suitable regulatory sequences.

21. A method for the production of 12-hydroxy lauric acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of lauryl lactone whereby 12-hydroxy lauric acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:4, under the control of suitable regulatory sequences.

22. A method for the production of 12-oxo lauric acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount 12-hydroxy lauric acid whereby 12-oxo lauric acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:10, under the control of suitable regulatory sequences.

23. A method for the production of dodecanedioic acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount 12-oxo lauric acid whereby dodecanedioic acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:12, under the control of suitable regulatory sequences.

24. A transformed host cell transformed with the nucleic acid fragment of claim 1.

25. An isolated nucleic acid fragment encoding a dodecanedioic acid synthesizing enzyme selected from the group consisting of: (a) an isolated nucleic acid molecule as set forth in SEQ ID NO:13; (b) an isolated nucleic acid molecule that hybridizes with (a) under the following hybridization conditions: 6×SSC (1 M NaCl), 50% formamide, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.; and (c) an isolated nucleic acid molecule that is completely complementary to (a) or (b).

26. A Rhodococcus ruber comprising endogenous genes encoding the proteins as set forth by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12, said Rhodococcus ruber having the ability to convert cyclododecanone to dodecanedioic acid under suitable growth conditions.

27. A method for the production of hydroxy acids comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of a cyclic ketone having from six to eighteen carbon atoms, whereby the corresponding hydroxy acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2, and SEQ ID NO:4 under the control of suitable regulatory sequences.

28. A method according to claim 27 wherein the cyclic ketone is selected from the group consisting of C6, C10, C11, C12, C13, and C15 cyclic ketones.

29. A method according to claim 28 wherein the cyclic ketone is selected from the group consisting of cyclohexanone, cyclodecanone, cycloundecanone, cyclododecanone, cyclotridecanone, and cyclopentadecanone.

30. A method according to claim 27 wherein the nucleic acid fragment comprises the nucleic acid sequences SEQ ID NO:1, and SEQ ID NO:3.

31. A method for the production of macrolactones having at least ten carbon atoms comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of a cyclic ketone having at least ten carbon atoms whereby the corresponding macrolactone is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2 under the control of suitable regulatory sequences.

32. A method for the production of dodecanedioic acid comprising: contacting the Rhodococcus ruber of claim 26 under suitable growth conditions with an effective amount of cyclododecanone whereby dodencanedioic acid is produced.

33. A mutated gene encoding a dodecanedioic acid synthesizing enzyme having an altered biological activity produced by a method comprising the steps of: (i) digesting a mixture of nucleotide sequences with restriction endonucleases wherein said mixture comprises: (a) a native sequence encoding a dodecanedioic acid synthesizing enzyme selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12; (b) a first population of nucleotide fragments which will hybridize to said native sequence; c) a second population of nucleotide fragments which will not hybridize to said native sequence; wherein a mixture of restriction fragments are produced; (ii) denaturing said mixture of restriction fragments; (iii) incubating the denatured said mixture of restriction fragments of step (ii) with a polymerase; (iv) repeating steps (ii) and (iii) wherein a mutated native sequence is produced encoding a dodecanedioic acid synthesizing enzyme having an altered biological activity.