Genes, polypeptides, and compositions for cold tolerance in plants

Abstract

Described are proteins having molecular weights of 85 and 160 kDa, which proteins are responsive to cold acclimation or drought stress in plants. The cDNA for the 85 and 160 kDa proteins, designated CAP85 and CAP160, are disclosed. Transgenic cells, including microorganisms and plants, can be produced which express the CAP85 and CAP160 proteins and thereby advantageously enhance the cold or water stress tolerance in the transgenic organism. Freeze and desiccation damage can also be prevented by applying a cold acclimation protein to the organism needing such protection.

Description

BACKGROUND OF THE INVENTION

Plants must possess and maintain adaptive mechanisms to ensure survival during periods of adverse environmental conditions. Two common stresses that temperate species are most likely to encounter are freezing and drought, both of which may cause cellular dehydration. Plants with the ability to become more freezing tolerant upon exposure to low nonfreezing temperatures in the range of 0.degree.-10.degree. C. contain genes that encode products which are directly or indirectly responsible for the greater resistance. Low temperature exposure and/or a change in day length may be necessary for these genes to become activated and produce gene product(s) in amounts that are physiologically significant in response to a natural environment. Once activated, proper expression of the genes confers on plant cells and tissues added resistance to the stresses and mechanical strains caused by the withdrawal of cellular water during ice formation. As long as expression of these genes continues at proper levels, and their respective products are localized at the proper cellular sites, the cells will remain tolerant to extracellular freezing at a level that is characteristic for that particular species. Once expression of the genes is reduced or halted in tolerant plants, resistance to the stresses and strains of extracellular freezing will decline. Since this increased freezing tolerance results from the process termed cold acclimation, genes responsible for the greater freezing tolerance that are induced or activated by low temperature are given the name "cold acclimation genes."

Cold acclimation constitutes an inducible response on the part of temperate plants to developing unfavorable temperature conditions. Conversely, most plants that have evolved in and are native to tropical regions of the world lack the ability to tolerate even the slightest freezing. More importantly, they lack the inducible mechanism of cold acclimation and cannot alter their freezing tolerance upon exposure to low nonfreezing temperatures. The dichotomies between temperate and tropical species in tolerance to freezing and ability to cold acclimate are the result of evolutionary pressures and natural selection as plants colonized colder regions of the world. Nevertheless, it is the activation and expression of certain genes in temperate species that is not only necessary, but is also diagnostic of greater freezing tolerance.

Specific polypeptides are induced and/or synthesized at higher rates only when certain plants and certain tissues are becoming more cryotolerant (Guy, C. L., D. Haskell �1987! Plant Physiol. 84:872-878; Guy et al. �1988! Cryobiology 25:264-271; Gilmour et al. �1988! Plant Physiol. 87:745-750). Similarly, these same proteins cease to be synthesized at high rates during the loss of cryotolerance at noninductive temperatures. Thus, the synthesis of these proteins shows induction and repression kinetics that exactly mimic the induction and loss of freezing tolerance (Guy and Haskell �1987!, supra).

Since increases in freezing tolerance are tightly linked to the syntheses of these proteins, the ability of a given plant or tissue to show increases in freezing tolerance ultimately depends on the presence and proper expression of the genes that encode the above proteins inducible by low nonfreezing temperature exposure.

A major component of freezing tolerance appears to involve tolerance to dehydration (Yelenosky, G., C. L. Guy �1989! Plant Physiol 89:444-451). Therefore, responses evoked by water stress may also be involved in freezing tolerance mechanisms. Many studies have demonstrated that a mild drought stress can increase freezing tolerance (Chen, P., P. H. Li, C. J. Weiser �1975! Hort. Sci. 10:372-374; Cloutier, Y., C. J. Andrews �1984! Plant Physiol. 76:595-598; Cloutier, Y., D. Siminovitch �1982! Plant Physiol. 69:256-258; Guy, C., D. Haskell, L. Neven, P. Klein, C. Smelser �1992! Planta 188:265-270; Siminovitch, D., Y. Cloutier �1982! Plant Physiol. 69:250-255) and that application of abscisic acid (ABA) at nonacclimating temperatures can also increase freezing tolerance (Chen, H. H., P. Gavinlertvatana, P. H. Li �1979! Bot. Gaz. 140:142-147; Chen, H. H., L. V. Gusta �1983! Plant Physiol. 73:71-75; Lang, V., P. Heino, E. T. Palva �1989! Theor. Appl. Genetics 77:729-734; Mohapatra, S. S., L. Wolfraim, R. J. Poole, R. S. Dhindsa �1988! Plant Physiol. 89:375-380).

A number of genes responsive to heat stress, water stress, and ABA treatments have now been characterized (U.S. Pat. Nos. 5,071,962; 4,797,359; Baker, J., C. Steele, L. Dure III �1988! Plant Mol. Biol. 11:277-291; Harada, J. J., A. J. DeLisle, C. S. Baden, M. L. Crouch �1989! Plant Mol. Biol. 12:395-401; Hong, B., S. J. Uknes, T. D. Ho �1988! Plant Mol. Biol. 11:495-506; Hughes, D. W., G. A Galau �1991! Plant Cell 3:605-618; Mundy, J., K Yamaguchi-Shinozaka, N. H. Chua �1990! Proc. Natl. Acad. Sci. USA 87:1406-1410; Raynal, M., D. Depigny, R. Cooke, M. Delseny �1989! Plant Physiol. 91:829-836; Vilardell, J., A Goday, M. A. Freire, M. Torrent, M. C. Martinez, J. M. Torne, M. Pages �1990! Plant Mol. Biol. 14:423-432). For simplicity of nomenclature, the group of water stress proteins is referred to as WSPs. These proteins were originally identified as LEAs, RABs, and dehydrins. LEAs (late embryogenesis abundant proteins) are, as their name implies, expressed at high levels during the latter stages of seed development and programmed seed dry-down (Dure, L. III, M. Crouch, J. Harada, T. D. Ho, J. Mundy, R. Quatrano, T. Thomas, Z. R. Sung �1989! Plant Mol. Biol. 12:475-486). Dehydrins and RABs (responsive to ABA) are similar to LEAs in several ways: hydrophilicity (>55% hydrophilic residues), responsiveness to ABA treatments, boiling solubility, a general absence of cysteine and tryptophan residues, and the presence of repeating motifs. Most of these proteins range in size from 10 kDa to 40 kDa.

In contrast to the water stress proteins, very little is known about proteins and genes which participate in plant freezing tolerance (Cattivelli, L., D. Bartels �1990! Plant Physiol. 93:1504-1510; Gilmour, S. J., N. N. Artus, M. F. Thomashow �1992! Plant Mol. Biol. 18:13-21; Guy, C. L. �1990!Annu. Rev. Plant Physiol Plant Mol. Biol. 41:187-223; Hajela, R. K, D. P. Horvath, S. J. Gilmour, M. F. Thomashow �1990! Plant Physiol. 93:1246-1252; Kurkela, S., M. Franck �1990! Plant Mol. Biol. 15:137-144). Recent findings indicate that WSP-like proteins may also participate in plant freezing tolerance (Gilmour, S. J., M. F. Thomashow �1991! Plant Mol. Biol. 17:1233-1244; Gilmour et al.�1992!, supra; Nordin, K., P. Heino, E. T. Palva �1991! Plant Mol. Biol. 16:1061-1071), but the nature of their role in this process remains uncertain.

SUMMARY OF THE INVENTION

The subject invention concerns nucleotide sequences that encode either inducible or upregulated (increased synthesis and accumulation) proteins during exposure to low temperature or under drought stress. Specifically described herein are cDNA sequences encoding the proteins designated CAP85 and CAP160. The subject nucleotide sequences or genes comprising those sequences can be utilized to create transgenic plants having the advantageous characteristics of cold tolerance or drought resistance. These DNA sequences can also be used as probes in assays for crop and plant tolerance levels during seasons of risk to freezing temperature or drought conditions.

Also disclosed are proteins that are encoded by the disclosed genes. These proteins can be employed in novel methods for preventing freeze damage or desiccation damage to a cell, including plant cells and eukaryotic and prokaryotic organisms. Monoclonal antibodies that specifically recognize the disclosed proteins are also described. Further, the subject invention concerns transgenic plants which have been transformed with the subject genes in order to express the described proteins, thereby enhancing the freezing tolerance or drought resistance of the transformed host.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Peptide sequences of CAP85(SEQ IN NO:2). CAP85 was cleaved by CNBr and the peptides were resolved by SDS-PAGE. Three major peptides of 66, 50, and 55 kDa were sequenced using gas-phase amino acid sequencing.

FIG. 2 shows the sequence of CAP85 PCR clone pcr733(SEQ ID NOS: 1 and 2). The positions of the synthetic oligonucleotides which were used to amplify the pcr733 fragment from cDNA are shown in boxes.

FIGS. 3A and 3B show the sequence of the 1.8 kb cDNA clone of CAP85 (SEQ ID NOS: 1 and 2). The sequence of pcr733 is identical to the 5' region, 110-850 bp of the cDNA clone. The arrow above the first methionine of the cDNA indicates a translation start site consensus sequence. Repeating motifs are noted as follows: boxed, lysine rich 22-mer; single underline, 16-mer; double underline, 8-mer.

FIG. 4 lists the 11 repeats of the 22 amino acid lysine-rich motif (SEQ ID NO:2). The residue notations are: p, polar; +, positively charged; -, negatively charged; n, nonpolar; g, glycine. Charged residues are boxed in the consensus sequence.

FIG. 5 shows the enhancement of survival rate following a freeze/thaw stress of Escherichia coli XL1-Blue cells expressing a fusion protein for spinach CAP160. Squares, wild-type cells containing a pBluescript plasmid without an insert; closed circles, cells containing pBluescript expressing CAP160 fusion protein; diamonds, cells containing a pBluescript without an insert or expressing the CAP160 fusion protein, cooled to -4.degree. C. or -10.degree. C., then warmed to 4.degree. C. without freezing. Percent survival was based on unfrozen control cells that were kept at 4.degree. C.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO. 1 is the nucleotide sequence for CAP85

SEQ ID NO. 2 is the deduced amino acid sequence of CAP85.

SEQ ID NO. 3 is the nucleotide sequence for CAP160.

SEQ ID NO. 4 is the deduced amino acid sequence of CAP160.

SEQ ED NO. 5 is degenerate synthetic oligonucleotide primer 55-A5', constructed from the peptide sequence of the CNBr peptides.

SEQ ID NO. 6 is degenerate synthetic oligonucleotide primer 50-B3', constructed from the peptide sequence of the CNBr peptides.

DETAILED DESCRIPTION OF THE INVENTION

The subject invention concerns materials and methods for protecting cells against damage that can result from low temperatures or desiccation. Specifically, the invention described herein provides proteins that are useful in procedures for making cells more resistant to cold or drought. Genes encoding these proteins are also provided.

As disclosed herein, the proteins of the subject invention can be purified by preparative electrophoretic methods, and polyclonal and monoclonal antibodies made to the purified proteins. The proteins may also be produced by recombinant means. Specifically described herein are the CAP85 and CAP160 proteins and the genes encoding these proteins.

CAP85. CAP85 is a basic protein with an apparent molecular weight of about 85 kDa in 10% acrylamide gels and exhibiting a pI of about 6.3 in isoelectric focusing gels. The protein is present in spinach leaf tissue and hypocotyl. The MIRNA for CAP85 does not appear to encode a signal sequence or a precursor protein for transport into organelles. The gene(s) are encoded in the nucleus, and the protein is synthesized on cytoplasmic ribosomes. The DNA sequence for CAP85 was determined and is shown herein as SEQ ID NO. 1. The corresponding amino acid sequence is shown in SEQ ID NO. 2. Several partial amino acid sequences derived from cyanogen bromide cleavage fragments have also been determined. Western blot analyses indicate an 85 kDa molecular weight protein is present in non-acclimated leaf tissue at low levels, but is accumulated when plants are grown at 5.degree. C. Like the CAP160 protein, we have found that this protein is also accumulated in leaf tissue subjected to desiccation.

CAP85 is regulated in response to low temperature and is also responsive to slight changes in water balance. CAP85 accumulates during exposure to low temperature or water stress. In the experiments described herein, the soil was well-watered and the plants did not show any loss of turgor or decrease in water potential. Therefore, the accumulation of CAP85 during cold acclimation does not appear to be due to water stress, but represents a true low temperature response.

CAP160 . CAP160 is an acidic protein with an apparent molecular weight of about 155 to about 160 kDa in 10% SDS acrylamide gels and also exhibits a pI of about 4.5 to 4.7 in isoelectric focusing gels. This protein is present in spinach leaf and hypocotyl tissue and can be resolved into as many as five physically similar isoforms varying only slightly in pI and molecular weight. This protein is phosphorylated. The protein is not accumulated in the nucleus, chloroplast, or mitochondria of the cell. It is encoded by a nuclear gene(s) and is synthesized on cytoplasmic ribosomes. The mRNA does not encode a precursor translation product exhibiting a leader sequence for transport into organelles. The DNA sequence for the gene encoding the CAP160 protein is shown as SEQ ID NO. 3. The amino acid sequence of the protein is shown as SEQ ID NO. 4. Partial amino acid sequences have been derived from cyanogen bromide cleavage fragments of the protein. This protein, or similar homologues, may be present in a number of plant species including Citru, Poncirus, Petunia, and Arabidopsis. Western blot experiments, using mouse hybridoma cell culture supernatants, demonstrate that this protein is present in nonacclimated spinach leaf and hypocotyl tissue, and is accumulated during exposure to 5.degree. C. This protein is also accumulated in droughted or desiccated leaf and hypocotyl tissue.

The amino acid compositions for each of the described proteins was determined and compared in Table 1. Proteins from cold acclimated hypocotyl tissue were separated by two-dimensional gel electrophoresis and electroblotted onto PVDF. Individual proteins were excised, hydrolyzed, and the liberated amino acids were determined by HPLC.

TABLE 1______________________________________Amino acid composition of high molecular masscold acclimation proteins from spinach hypocotyl tissue Composition (mol %)Amino acid 160 kDa 85 kDa______________________________________Asparagine/aspartic 12.4 16.2Threonine 9.8 3.8Serine 10.6 4.9Glutamine/glutamic 15.3 16.4Proline 5.2 5.0Glycine 14.8 8.5Alanine 7.0 5.8Methionine 1.4 0.4Isoleucine 3.6 2.9Leucine 4.3 5.8Histidine 4.6 9.3Lysine 7.2 12.9Valine 1.8 3.0Tyrosine 0.5 3.8Phenylalanine 0 0.6Arginine 1.3 0.7______________________________________

The cDNA transcript can be obtained from the plasmids in essentially pure form by standard art methods. The essentially pure cDNA thus obtained can be used for subcloning into a different transformation vector.

Introduction of a single or multiple genes into plants and appropriate expression can lead to an increase in cold tolerance or drought resistance in the transformed plant. The described transformations center around introduction of the genes using engineered Ti plasmid vectors in Agrobacterium tumefaciens. Model libraries containing but a single cold acclimation gene, and all possible combinations of several cold acclimation genes can be used to transform freezing sensitive plants. Expression of the genes can be controlled by a number of promoters ranging from the 35S promoter of cauliflower mosaic virus to a number of inducible promoters where the expression of the introduced genes can be controlled by the external application of an environmental condition or chemical. Alternatively, the natural upstream promoter regions of the cold acclimation genes can be used to control expression of the cold acclimation genes in transgenic plants upon exposure to low temperatures. However, it may be necessary to introduce the genes for the transacting factors that recognize the cold acclimation consensus elements of the cold acclimation gene promoters, provided that freezing sensitive plants, in general, lack genes responsive to low temperature.

The creation of transformed plants can utilize any one of several strategies well known in the art for introduction of foreign genes into cold sensitive plants, including electroporation and facilitated DNA uptake (protoplast and liposome fusion) (Fromm et al.�1986! Nature 319:791), the biolistic gun, and with Agrobacterium (Horsch et al.�1985! Science 227:1229-1231). At the present time, transformation with Agrobacterium is the most versatile method available. Inoculations of plant tissues to be transformed by Ti plasmid transfer can be made with Agrobacterium tumefaciens strains carrying cointegrates of disarmed Ti plasmid constructs encoding genes for antibiotic resistance and a spinach cold acclimation gene. The bacterial strains and transformation vectors have been described and are well known in the art.

The proteins described herein can be used to protect a cell from freeze damage or desiccation damage brought on by the formation of intracellular or extracellular ice. For example, the protein can be added, with an appropriate carrier, directly to the plant by applying it to the surface or injected into the plant or can be placed in the growth medium of the plant. Appropriate carriers, preservatives, and adjuvants are well known in the art and can be readily adapted for each particular protein or plant.

As is well known in the art, the amino acid sequence of a protein is determined by the nucleotide sequence of the DNA Because of the redundancy of the genetic code, i.e., more than one coding nucleotide triplet (codon) can be used for most of the amino acids used to make proteins, different nucleotide sequences can code for a particular amino acid. Thus, the genetic code can be depicted as follows:

Phenylalanine (Phe) TTK Histidine (His) CAK Leucine (Leu) X TY Glutamine (Gln) CAJ Isoleucine (Ile) ATM Asparagine (Asn) AAK Methionine (Met) ATG Lysine (Lys) AAJ Valine (Val) GTL Aspartic acid (Asp) GAK Serine (Ser) QRS Glutamic acid (Glu) GAJ Proline (Pro) CCL Cysteine (Cys) TGK Threonine (Thr) ACL Tryptophan (Trp) TGG Alanine (Ala) GCL Arginine (Arg) WGZ Tyrosine (Tyr) TAK Glycine (Gly) GGL Termination signal TAJ Termination signal TGA Key: Each 3-letter deoxynucleotide triplet corresponds to a trinucleotide of MRNA, having a 5'-end on the left and a 3'-end on the right. All DNA sequences given herein are those of the strand whose sequence corresponds to the mRNA sequence, with thymnine substituted for uracil. The letters stand for the purine or pyrimidine bases forming the deoxynucleotide sequence.

A=adenine

G=guanine

C=cytosine

T=thymine

X=T or C if Y is A or G

X=C if Y is C or T

Y=A, G, C or T if X is C

Y=A or G if X is T

W=C or A if Z is A or G

W=C if Z is C or T

Z=A, G, C or T if W is C

Z=A or G if W is A

QR=TC if S is A, G, C or T; alternatively

QR=AG if S is T or C

J=A or G

K=T or C

L=A, T, C or G

M=A, C or T

The above shows that the amino acid sequences of CAP85 or CAP160 can be prepared by nucleotide sequences other than those disclosed. Functionally equivalent nucleotide sequences encoding the novel amino acid sequences of these proteins and fragments can be prepared by known synthetic procedures. Accordingly, the subject invention includes such functionally equivalent nucleotide sequences.

The one-letter symbol for the amino acids used above is well known in the art. For convenience, the relationship of the three-letter abbreviation and the one-letter symbol for amino acids is as follows:

______________________________________Ala A Leu LArg R Lys KAsn N Met MAsp D Phe FCys C Pro PGln Q Ser SGlu E Thr TGly G Trp WHis H Tyr YIle I Val V______________________________________

Thus, the scope of the subject invention includes not only the specific nucleotide sequences depicted herein, but also all equivalent nucleotide sequences coding for molecules with substantially the same biological activity. The term "equivalent" is being used in its ordinary patent usage here as denoting a nucleotide sequence which performs substantially as the nucleotide sequence identified herein to produce molecules with substantially the same biological activity in essentially the same kind of hosts. Within this definition are subfragments which have freezing tolerance and drought resistance biological activity.

It is well within the skill of those in the genetic engineering art to use the nucleotide sequences encoding the described environmental stress resistance activity of the subject invention to produce the disclosed proteins via microbial processes. Fusing the sequences into an expression vector and transforming or transfecting into appropriate hosts are standard procedures used in producing other well-known proteins, e.g., insulin, interferons, human growth hormone, and the like. Similar procedures, or obvious modifications thereof, can be employed to prepare proteins by microbial means or plant or mammalian tissue culture technology in accord with the subject invention.

Further, the scope of the subject invention is intended to cover not only the specific amino acid sequences disclosed, but also similar sequences of proteins or protein fragments having comparable biological activity.

MATERIALS AND METHODS

Plant material. Spinach seedlings (Spinacia oleracea L. cv Bloomsdale) were grown from seed in a controlled environment as previously described (Guy and Haskell �1987!, supra). Cold acclimation, deacclimation, and water stress treatments were conducted as previously described (Id.).

Protein extraction. Protein was extracted from etiolated spinach (Spinacia oleracea L. cv Bloomsdale) hypocotyl-cotyledon tissue grown at 5.degree. C. for 4 weeks. Frozen tissue was ground in a dry-ice-cooled mortar. Forty grams of tissue was homogenized in a Polytron with 100 ml of 80% v/v distilled phenol buffered with 120 mM Tris-HCl (pH 6.8), 50 mM EDTA, 100 mM KCl, 2% v/v Triton X-100, 5% v/v glycerol, and 2% v/v 2-mercaptoethanol was added to an additional 100 ml of the preceding buffer. The extract was centrifuged at 15,000 g for 5 minutes. The aqueous phase was removed and the phenol phase extracted with 50 ml buffer 3 additional times. The final phenol phase was filtered through glass wool to remove cellular debris. Protein was precipitated from the phenol solution with 5 volumes of -20.degree. C. acetone containing 1% v/v 2-mercaptoethanol for 2 hours at -20.degree. C. and pelleted at 15,000 g for 5 minutes to remove insoluble material. The supernatant was stored at -20.degree. C. All protein content determinations were by the dye-binding method.

Protein purification. Total protein extracts were fractionated by preparative, free solution isoelectric focusing (Rotofor.TM., BioRad). Rotofor solution with 2% v/v ampholytes (0.8% pH 5-7, 0.8% pH 4-6, and 0.4% pH 3-10) (BioRad) was prefocused for 1 hour at 12 W constant power with 10.degree. C. coolant. The protein sample was dissolved in Rotofor solution with 2% ampholytes (usually 3.5 to 4.0 ml containing from 31 to 187 mg of protein). The protein/ampholyte solution was loaded into the compartment having a pH near the midpoint of the gradient (to substantially eliminate protein precipitation during focusing). Proteins were focused for 5 hours at 12 W constant power with 10.degree. C. coolant. After sample collection, 25 .mu.l of each fraction was loaded directly onto, and separated in, 10% SDS-polyacrylamide gels. Separated proteins were stained with Coomassie blue. The free solution isoelectric focusing purification closely approximated analytical two-dimensional separations for spinach cold acclimation proteins, which facilitated identification of fractions containing CAP85. Total protein content was assayed and the percentage of CAP85 present in the fraction was determined by densitometry of the SDS-polyacrylamide gel separation, which yielded an estimate of the micrograms of CAP85 present. Protein from fractions containing CAP85 were precipitated with 5 volumes of -20.degree. C. acetone with 1% 2-mercaptoethanol for 2 hours at -20.degree. C. followed by centrifugation at 11,000 g. The co-precipitating urea was removed by washing with 10 ml of methanol. After centrifugation, the methanol-urea supernatant was discarded and the protein pellet dried under vacuum.

Monoclonal antibody production. Protein pellets from fractions of free solution isoelectric focusing containing CAP85 were resuspended in phosphate buffered saline. Balb/c mice were injected with approximately 100 .mu.g of CAP85 (500 .mu.g total protein) with RIBI MPL+TDM adjuvant. The four boosts of antigen in adjuvant were made with equal or greater amounts of antigen. Serums were titered and cell fusion supernatants were screened by Western blot of SDS-PAGE fractionated spinach proteins using a miniblotter (Immunetics). Immune complexes were detected using alkaline phosphatase conjugated to goat anti-mouse IgG. The color development substrate was NBT/BCIP.

Polyclonal antibody production. A 3 ml solution containing approximately 2400 .mu.g total protein and about 500 .mu.g of CAP85 was fractionated on a SDS-polyacrylamide gel (7.5%, 0.75 mm thick, 16 cm wide). After briefly staining with Coomassie blue and destaining, the CAP85 band was excised, rinsed in water 2 minutes, and homogenized with PBS in a Ten Broeck tissue grinder. The homogenized gel was transferred with water to a glass tube and lyophilized to reduce the volume of liquid. A Balb/c mouse was injected initially with 70 .mu.g of CAP85 in RIBI MPL+TDM adjuvant. This was followed by three boosts of 70, 70, and 100 .mu.g of CAP85 in adjuvant. The final working titer was 1:10,000.

Protein cleavage, sequencing, and homology. Initial attempts to sequence CAP85 revealed that the amino terminus was blocked. Amino acid composition suggested that the methionine content was low. Therefore, CAP85 was cleaved at methionine residues with CNBr to obtain internal peptides which could be sequenced. Protein pellets from enriched CAP85 fractions resulting from free solution isoelectric focusing were redissolved in SDS sample buffer. The protein was loaded onto a 7.5% SDS-polyacrylamide slab gel (0.75 mm thick and 16 cm wide) that had been pre-run with 0.1 mM Na thioglycolate in the cathode buffer until the front was at least 1 cm into the running gel. The proteins were transferred by semi-dry electroblotter to PVDF membrane. Without allowing the blot to dry, the CAP85 band was excised and cut into pieces to fit into a 1.5 ml microfuge tube. In the fume hood, 1 ml of 70% formic acid (diluted with distilled water from 90% formic acid) was added to the tube followed by 100 .mu.l of 5M CNBr in acetonitrile. The closed tube was sealed from parafilm, wrapped in foil, and placed on a rocker table. A nitrogen atmosphere was not necessary for CNBr cleavage in the small tube. The reaction was allowed to proceed for 14 hours, then the tube was opened in the hood to vent gases. Formic acid was removed by lyophilization. The solution was transferred to a 15 ml Corex tube and diluted with 3 ml of distilled water, frozen at -80.degree. C. and lyophilized overnight. When dry, another 1 ml of distilled water was added to dissolve the residue, then lyophilized again to dryness. The peptide fragments were dissolved in SDS sample buffer. After protein determination, the fragments were fractionated on 10 and 15% SDS-polyacrylamide gels that had been pre-run as before with 0.1 mM Na thioglycolate in the cathode buffer. The protein fragments, along with molecular weight standards, were transferred to PVDF using a semi-dry electroblotter. The membrane was washed twice with distilled water to remove glycine and stained with 0.2 amido black in distilled water and then destained by repeated washing with distilled, deionized water (ddH.sub.2 O). When dry, the membranes were stored at -20.degree. C. until the fragments were sequenced. Protein sequencing was performed on an Applied Biosystems gas phase sequenator.

Boiling stability. Proteins were homogenized from 1.0 g of 2 day cold acclimated spinach leaf tissue in 2.0 ml of 50 mM MOPS, pH 7.5, 10 mM MgCl.sub.2, 1 mM EDTA buffer in a glass tissue grinder held on ice. The homogenate was centrifuged at 15,000 g in a microfuge for 10 minutes. An aliquot of the supernatant was subjected to 100.degree. C. heat treatment for 2 or 10 minutes. The boiled sample was centrifuged at 15,000 g for 5 minutes to remove insoluble proteins. Equal volumes, 15 .mu.l, of total extract and boiled samples were electrophoresed on a 8.0% SDS-PAGE. Proteins were then electroblotted onto PVDF membrane and probed with the appropriate antibodies or stained with Coomassie blue.

Cell fractionations and protein extractions. Plants were cold acclimated at least 7 days prior to fractionations. All isolation steps were performed on ice or at 4.degree. C. Final fractionation extracts were boiled for 2 minutes, centrifuged for 10 minutes at 15,000 g, transferred to new tubes, and stored at -20.degree. C. Protein content was determined by dye-binding method.

Chloroplasts. Chloroplasts were isolated using a modification of the protocol of Cline (Cline, K. �1975! "Purification of inner and outer chloroplast envelope membranes," In Modem Methods of Plant Analysis New Series Volume 1: Cell Components, H. F. Linskens, J. F. Jackson, eds., Springer-Verlag, Berlin-Heidelberg). Plants were kept in the dark for at least 24 hours before isolating chloroplasts to reduce the size of starch grains that interfere with recovery of intact chloroplasts. Spinach leaf tissue, 5 g, was homogenized in 20 ml 1.times.HSB (homogenization solution with BSA, modified to 0.5M sorbitol to isotonically stabilize cold acclimated chloroplasts) with a Polytron using three 5-7 second bursts at setting 12. The homogenate was filtered through a cotton plugged syringe and divided between two 15-ml Corex tubes that were centrifuged for 2 minutes at 2,500 g in Beckman JA 13.1 rotor. The pellets were resuspended in 0.5 ml of 1.times.HS and layered on Percoll gradients that were formed by mixing 5 ml of Percoll and 5 ml of 2.times.HSB in plastic tubes centrifuged at 43,000 g for 30 minutes in a JA 20 rotor. Chloroplast suspensions were layered on the preformed gradients and centrifuged for 30 minutes at 1,000 g in a JA 13.1 rotor. The band of intact chloroplasts from the gradient was pooled and diluted with 2 volumes of 1.times.HS (homogenization solution). Chloroplasts were recovered by centrifugation in a JA 13.1 rotor at 2,000 g for 7 minutes. The chloroplast pellet was resuspended in 320 .mu.l HS, to which was added 80 .mu.l of proteinase K (Boehringer Mannheim) (1 mg/ml HS). After 30 minutes on ice, the proteinase K was inactivated by bringing the solution to 2 mM PMSF. The suspension was centrifuged at 1,500 g for 6 minutes in a JA 13.1 rotor and the resultant chloroplast pellet was washed with buffer. Protein from the chloroplast pellet was extracted following the addition of 30 .mu.l of 8 mM PMSF and 90 .mu.l of 1.times.SDS buffer.

Nuclei. Nuclei were isolated in Honda medium (HM). Nuclei were further purified using a modification of the Percoll step gradient. See Luthe, D. S., R. S. Quatrano (1980) Plant Physiol. 65:305-308. Two aliquots of 7 to 8 g of tissue were placed in a glass Petri dish on ice. HM (with 1 mM DTT substituted for the 2% 2-mercaptoethanol) was added in a ration of 3 to 1 (v/w). The tissue was chopped with a razor blade for 10 minutes. The chopped material was filtered through a coarse screen followed by a fine screen (mesh size not known). Twice, the tissue residue was returned to the Petri dish, washed with 10 ml of HM, and refiltered. The filtrate was centrifuged at 1,000 g for 5 minutes in Beckman JA 13.1 swinging bucket rotor in 30 ml Corex tubes. The pellet was resuspended in 5 ml HM in 15 ml Corex tubes and the centrifugation step repeated. The resulting pellet was resuspended in 2 ml of HM.

The HM suspensions were layered on discontinuous gradients of Percoll containing the following steps: 2 ml 40%, 2 ml 60%, and 4 ml 80% (v/v) Percoll made with gradient buffer (0.25M sucrose, 25 mM Tris-HCl, pH 7.4, 10 mM MgCl.sub.2). The gradients were centrifuged at 3,948 g in a JA 13.1 swinging bucket rotor for 30 minutes. The interfaces of the 40% and 60% Percoll steps were collected and transferred to 15 ml Corex tubes and mixed with 5 ml HM. The suspensions were centrifuged for 5 minutes at 5,685 g in a JA 13.1 rotor. The supernatants were aspirated off and each pellet was resuspended in 50 .mu.l gradient buffer and transferred to microfuge tubes. The Corex tubes were rinsed with 25 .mu.l more of buffer and the rinses added to the microfuge tubes. The Corex tubes were rinsed with 25 .mu.l more of buffer and the rinses added to the microfuge tubes. The presence of nuclei was confirmed by light microscopy. Protein was extracted from the nuclei by adding 50 .mu.l of 2.times.SDS buffer, which formed a viscous solution, and vortexed. Protein extracts from several gradient purifications were pooled.

Mitochondria. Spinach was grown in the dark to produce etiolated hypocotyls. Four aliquots of 5 g of hypocotyl tissue were chopped for 10 minutes with razor blades in glass Petri dishes on ice containing 15 ml each of chopping medium (CM) (0.3M mannitol, 1 mM EDTA, 30 mM MOPS-KOH (pH 7.2), and 0.02% defatted BSA (w/v). The solutions of chopped tissue were individually filtered through a coarse screen followed by a fine screen into 50 ml plastic tubes. The tissue residue was returned to the Petri dish, washed with 10 ml CM, filtered into the plastic tubes, and the process repeated with 5 ml CM. The filtered suspensions were centrifuged at 3,000 g for 5 minutes in a Beckman JA rotor. The pellets were resuspended with 1.0 ml CM and layered on discontinuous Percoll gradients in 15 ml Corex tubes containing the following steps: 4 ml 13.5%, 4 ml 21%, and 2 ml 45% (v/v) Percoll made with gradient buffers of Jackson et al. (Jackson, C., J. E. Dench, D. O. Hall, A. L. Moore �1979! Plant Physiol. 64:150-153). The gradients were centrifuged for 30 minutes at 7,500 g in a JA 20 rotor. Fractions from the interface of the 21% and 45% steps from each of the two gradients were mixed with 20 ml of chopping medium minus BSA (CM-BSA) in 30 ml Corex tubes and centrifuged at 11,000 g for 15 minutes. After aspiration of most of the supernatant, loose pellets were transferred to microfuge tubes and spun in JA 18.1 at 11,000 g for 15 minutes. Supernatant was removed with a Pasteur pipet. Eighty microliters of CM-BSA and 20 .mu.l of proteinase K (1 mg/ml CM-BSA) were added to the pellet. After 30 minutes on ice, the suspension was brought to 2 mM PMSF, mixed, and centrifuged in a JA 18.1 rotor at 11,000 g for 15 minutes. The supernatant was removed and the pellet was washed with 150 .mu.l CM-BSA followed by centrifugation as above. The supernatant was removed. To the pellet, 60 .mu.l of 8 mM PMSF in CM-BSA and 90 .mu.l 1.times.SDS buffer were added with mixing by vortex mixer.

Endoplasmic reticulum. Three grams of leaf tissue were ground with a mortar and pestle with 2 vol (w/v) of grinding buffer (10 mM Tris-HCl, pH 8.5 at 25.degree. C., 7.2% sucrose (w/v), 10 mM KCl, 5 mM MgCl.sub.2). The solution was centrifuged at 10,000 g for 5 minutes in a JA rotor. The supernatant was layered on a discontinuous sucrose gradient of modified grinding buffer: 0.8 ml 0.5M, 0.8 ml 1.0M, 0.8 ml 1.5 M, 0.4 ml 2.0M sucrose. The gradients were centrifuged at 80,000 g in a SW 50.1 rotor for 30 minutes. The recovered endoplasmic reticulum fraction from the interface of the 1.0 M and 1.5 M sucrose layers was mixed with 10 ml of grinding buffer minus sucrose (GB-S) and centrifuged in a JA 20 rotor for 1 hours at 37,000 g. The pellet was resuspended in 900 .mu.l of GB-S and 100 .mu.l of 1.5 mg/ml GB-S stock proteinase K After 30 minutes on ice, the suspension was brought to 2 mM PMSF and centrifuged in a JA 18.1 rotor for 1 hour at 37,000 g. The pellet was mixed in 100 .mu.l of 1.times.SDS buffer.

Soluble protein. After the ultracentrifugation step in the endoplasmic reticulum isolation procedure, the sample layer at the top was recovered and deemed the soluble protein fraction. One volume of this fraction was mixed with one volume of 2.times.SDS sample buffer.

Leaf and hypocotyl protein. Protein was extracted separately from cold acclimated leaf and hypocotyl tissue in SDS buffer and processed as above. Since CAP85 has no known enzymatic activity and can only be detected by antibody reactivity, marker proteins for selected cell fractions were assayed by protein blotting. The chloroplast marker was a polyclonal antibody reactive against the large subunit of RuBisCo purchased from Sigma. For ER, a polyclonal antibody specific for the tobacco ER luminal protein, BiP, was used. The mitochondrial marker was a polyclonal antibody reactive against the .alpha.-subunit of the F.sub.1 -ATPase of yeast, and the nuclear marker was an antibody reactive against high mobility group proteins.

Equal amounts of protein (3 .mu.g/lane) were fractionated on SDS-PAGE gels and marker proteins detected by antibody binding and color visualization as described previously.

Nucleic acid purification. RNA was extracted from spinach tissues using the phenol/LiCl procedure. Poly (A.sup.+) RNA was purified using oligo dT-cellulose and used in RNA blots and cDNA synthesis. DNA was extracted from spinach leaf tissue following methods known in the art.

RNA and DNA blotting. RNA blots were performed using total or poly (A.sup.+) RNA DNA blots were performed using 20 .mu.g of spinach total DNA digested with 10.times.excess restriction endonuclease. The digested DNA was electrophoresed in 0.8% agarose gels in TBE. The gels were then pressure blotted to Hybond-N nylon membrane (Amersham) and fixed with UV light (Stratalinker 1800, Stratagene). Both RNA and DNA blots were prehybridized in 50% formamide, 5.times.SSPE, 5.times.Denhardts, 0.2% SDS, 10 .mu.g/ml salmon sperm DNA at 42.degree. C. for at least 4 hours. DNA used in both blotting procedures was labeled using random primers as previously described (52). Blots (11.5.times.12.5 cm) were hybridized with 2.times.10.sup.7 cpm, of labeled probe (approximately 5.times.10.sup.5 cpm/ng), overnight at 42.degree. C., then washed twice in 2.times.SSC, 0.2% SDS for 15 minutes at room temperature, followed by 2 washes in 0.5.times.SSC, 0.2% SDS for 30 minutes at 68.degree. C., and 2 washes in 0.1.times.SSC, 0.2% SDS for 15 to 30 minutes at 68.degree. C. Blots were wrapped wet in plastic, and placed into cassettes and exposed XAR5 X-ray film with one intensifying screen at -80.degree. C.

Library construction and screening. A PCR fragment specific for CAP85 was generated from cDNA synthesized from 2 day cold acclimated spinach leaf tissue poly (A.sup.+) RNA. Synthetic oligonucleotides matching 50 (50-B3') and 55 (55-A5') kDa CNBr peptide sequences were used to amplify cDNA. Approximately 1/10 of a cDNA synthesis reaction from an initial 2 .mu.g poly (A+) RNA was used in the amplification reaction. The amplification of cDNA with the synthetic oligonucleotides was performed following a cycling regime of an initial denaturation of 3 minutes at 94.degree. C., followed by 40 cycles of 1 minute 94.degree. C., 1 minute 50.degree. C., 3 minutes 72.degree. C., and finishing with a final 10 minute extension at 72.degree. C. From PCR, a 650 bp fragment was purified and blunt end cloned into EcoRV-digested Bluescript (Stratagene). cDNA synthesis for library construction, using RNA from 2 day cold acclimated leaf tissue, was performed with the Uni-Zap unidirectional lambda phage cloning kit (Stratagene). The library was screened using the PCR generated clone for CAP85. DNA sequencing was accomplished by the Taq DyeDeoxy.TM. Terminator Cycle Sequencing Kit (Applied Biosystems, Inc.) on an automated sequencer (Applied Biosystems, Inc.).

Sequence analysis and homology searches. Analysis of DNA sequences was initially carried out using DNASTAR (DNASTAR, Inc.). Searches of gene data bases (GENEBANK, EMBL, NBRF) and protein data bases (PIR and Swissprot) were carried out using GCG (Genetics Computer Group), which allows comparisons of DNA and peptide sequences.

Following are examples which illustrate procedures, including the best mode, for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

EXAMPLE 1--CAP85 Protein and Gene Characterization

The influence of acclimation and deacclimation on CAP85 content in leaves was determined by protein blot analyses. Protein levels were elevated throughout the cold acclimation period and decreased following a return to 25.degree. C. There were significant levels of CAP85 one day after a return to 25.degree. C. After 7 days of deacclimation, the levels of CAP85 were near that of the non-acclimated control. CAP85 was resolved into a doublet of 85 kDa and a lower band of .noteq.80-84 kDa. This doublet was observed with both polyclonal and monoclonal antibodies. When protease inhibitors for the four major classes of proteases were included in the extraction buffer, the doublet pattern was not altered, nor was the intensity of the lower band reduced.

The protein used in antibody production and sequencing was composed of the doublet. Initial attempts to sequence the amino terminus from 2-D gel electroblots indicated a blocked amino terminus blockage. Amino acid composition analyses showed the presence of 0.4 mole % methionine (see Table 1), which made feasible the cleavage of CAP85 with cyanogen bromide. From this procedure, we obtained three major peptides of 66, 55, and 50 kDa, which yielded the sequences shown in FIG. 1. Peptide sequence analysis indicated homology of the 50 kDa peptide to Group 2 LEAs.

PCR cloning and cDNA library screening. The NH.sub.2 terminus of CAP85 is blocked. The peptide sequence of the CNBr peptides were used to construct degenerate synthetic oligonucleotides (55-A5'=ATG AAG AAG AA(T or C) AA(C or T) AAG GG(C or T) GAG �SEQ ID NO. 5!; and 50-B3'=TA(A or G) TC(A or G) TTC TTC TT(A or G) TCC TC(A or G) TG �SEQ ID NO. 6!) primers for the PCR amplification of cDNA derived from RNA extracted from 2 day cold acclimated leaf tissue. From this procedure, a 650 bp fragment (pcr733) was amplified, cloned, and labeled for use in RNA blot analyses. This fragment hybridized to a 2-0 to 2.2 kb RNA which was upregulated during cold acclimation. The deduced amino acid sequence of this fragment showed high homology to the amino acid sequences of the 55 kDa CAP85 CNBr cleavage peptide, matching perfectly 35 of 37 identified residues (FIG. 2). A screening of 100,000 plaques with the PCR fragment yielded 60 positives, of which the two largest clones were about 1.8 kb. Both clones hybridized to a strongly upregulated message during cold acclimation. There was a large increase in the level of message after one day of exposure to 5.degree. C. and the high levels of message were maintained over a 7-day exposure to 5.degree. C. Upon return to 25.degree. C., the message levels returned to that of non-acclimated plants and remained low throughout the deacclimation period. Sequencing demonstrated that the two clones were identical, except the smaller clone was missing approximately 200 bp from the 5' end (FIGS. 3A-3B ). Over 178 bp of the 3' end were non-coding sequences. Sequence analysis indicated that the cDNA clones were identical to the PCR clone. At this stage, additional matches between the deduced protein sequence of the cDNAs and the peptide sequences became evident. The 55 kDa peptide matches the cDNA predicted sequence beginning at bp 109. A peptide fragment of this size can be deduced from the cDNA. One of the 66 kDa peptide sequences was identical to that of the 50 kDa peptide. Both were perfect matches to sequences in the cDNA beginning at bp 814. The second 66 kDa peptide sequence most closely matched a sequence near the carboxyl-terminus of the cDNA beginning at bp 1474. However, it clearly cannot be the source of the 66 kDa peptide.

A consensus translation start sequence is observed at the first ATG. The predicted size of the protein encoded by the cDNA clone is 61.5 kDa. This is roughly 72% of the estimated size of CAP85 as determined by SDS-PAGE. However, the SDS-PAGE size estimates for many WSPs is usually greater than that predicted by DNA sequences. The predicted protein from the cDNA clone gives a calculated pI of 6.2, close to the estimated pI of 6.3 of in vivo produced CAP85 as determined from 2-D gels, and the amino acid composition predicted by the clone is a close approximation to that determined from protein compositional analyses. The deduced protein is rich in charged residues (K 15%, D 12%, E 10%, and H 11%), but did not contain either cysteine or tryptophan.

Inspection of the cDNA sequence revealed similarity to the WSP gene family, or more specifically, to Group 2 LEAs. The gene showed a typical Group 2-like 11-residue lysine-rich repeat contained within a larger 22-amino acid sequence that was repeated 11 times within the clone (FIGS. 3A, 3B and 4). The repeats begin at around 300 bp into the 2.0 kb clone and continue to near the stop codon at bp 1640. The repeats are not contiguous but are separated irregularly by spans of 9 to 28 amino acids. Database searches indicated the highest homology to Rab17, which is a Group 2 LEA. Two other imperfect repeating motifs were also found in the primary structure of the deduced protein. Both were interspersed between the lysine repeats. The longer repeat was present 4 times, while the shorter repeat was present 3 times (FIGS. 3A and 3B). CAP85 differs from the Group 2 LEAs in that there is no serine cluster.

Blot of genomic DNA digests. Genomic Southern blots probed with either the PCR clone, pcr733, or the cDNA clone provided insight into the organization of the gene. Both probes produced the same pattern. The hybridization pattern appeared simple, which indicated that CAP85 is present as a single gene or a small gene family.

Increased message and protein levels of CAP85 during cold and water stress. When spinach was subjected to a water stress, there was a dramatic increase in the message levels. The levels of message remained elevated throughout the desiccation stress period. Once the plant was returned to a normal hydrated state, the message levels decreased to non-stressed levels within one day. Spinach also showed an increased abundance of CAP85 protein in response to a water stress. In contrast, the protein levels remained high even after return to a normal hydration state. The protein turn-over rate appeared to be slower than that of the message, as elevated protein levels were evident 24 hours following the return to non-stress conditions. Also, while changes in the protein levels were apparent, the changes in the message abundance were far more pronounced.

The distribution of CAP85 protein and message. The distribution of the protein and the message in spinach seedlings was determined. Protein and RNA were extracted from various tissues from 2 day cold acclimated plants. Immunodetectable protein was found in the leaf, cotyledon, hypocotyl, and root. CAP85 protein was also detected in seeds and pollen. Similarly, the CAP85 message was present in leaf, petiole, and root tissues during cold acclimation. Cell fractionation studies with leaf and hypocotyl tissue showed that CAP85 was present in the cytosol, and possibly in the endoplasmic reticulum and chloroplast.

Boiling solubility of CAP85. Proteins were extracted from 2 day cold acclimated leaf tissues and subjected to 2 and 10 minute boiling treatments. Protein blot analyses confirmed that CAP85 is not rendered insoluble by boiling.

EXAMPLE b 2--Amplification of CAP85 cDNA

Amplification of the cDNA to obtain a CAP85 probe selected for a gene with an orientation which placed the 55-A5' sequence before that of the 50-B3' sequence. In screening the cDNA library with pcr733, we selected for the gene with the 55-A5'.fwdarw.50-B3' arrangement. Both pcr733 and the EDNA clone hybridize, under high stringency, to the gene containing the 55-A5'.fwdarw.>50-B3' orientation, and not the B.fwdarw.A orientation. Even if the two genes encode closely related proteins, the bias of the PCR and cDNA clones would select for only one member of the CAP85 doublet. The match of the cDNA clone to the 55 kDa peptide sequence from CAP85 establishes the linkage of this gene to a protein that is associated with the cold acclimation process. In addition, the amino acid composition of the predicted protein and that of CAP85 are similar, as are the observed and the estimated isoelectric points. Finally, the influences of low temperature and water stress on the abundance of the transcript are consistent with the accumulation of CAP85 in response to these conditions.

EXAMPLE 3--Secondary and Tertiary Structure of CAP 85

For secondary and tertiary structure of the protein, an .alpha.-helical structure in the 22-mer lysine repeating motif of CAP85 is suggested. In plotting a 3.6 amino acids/turn .alpha.-helix, beginning with the first member of the motif, we observe four distinct faces. The first face is primarily composed of acidic residues (D.sub.12, E.sub.5, D.sub.16), while the second face is composed of basic residues (K.sub.6, K.sub.13, K.sub.17). The third face is mostly non-polar residues with adjacent (E.sub.3, K.sub.7) acidic and basic residues, which can form a salt bridge. Additional salt bridge combinations can act to stabilize the .alpha.-helical structure. The final face is a mixture of acid, basic, non-polar, and polar residues. The repeating motif, from residue 1 to 18, forms four complete cycles ending at residue P.sub.19. Proline is associated with loop structures. The glycine immediately following P.sub.19 further favors that this part of the peptide is a turn or loop region. The 11 repeating motifs in the .alpha.-helical conformation can join in helix-helix associations either along the non-polar regions or in anti-parallel arrangements along the acidic and basic faces. These associations along the non-polar regions permit the charged residues to be free to form interactions with charged cellular components. Such helices can interact with phospholipid head groups of the membrane. In such associations, the formation of ionic interactions between the charged phospholipid head groups and CAP85 can function to stabilize the membrane both during water loss due to dehydration and also exposure to low temperature by acting as a reinforcing lattice network. A coating of CAP85 on the inner face of the plasma membrane can provide a matrix able to stabilize membrane structure during extreme loss of cellular water and volume. These highly hydrophilic proteins participate in adaptive mechanisms in plants during cold and water stress conditions.

EXAMPLE 4--Cloning of CAP160

Antibody screening was used to isolate cDNAs for CAP160. Sixty clones were selected from initial screenings of the same cDNA library used to isolate CAP85. Several of these clones were used for a RNA blot screening to verify that the cDNA corresponded to a gene that was upregulated during cold acclimation. The clones with the largest inserts were further characterized by protein blot analysis of the fusion protein in E. coli lysates. Two clones expressed a fusion protein that appeared to be slightly larger than authentic CAP160 obtained from spinach leaf tissue. These clones, along with another lacking 200 bp from the NH.sub.2 -terminus, were used for sequencing. From sequence analysis, the cDNAs for CAP160 appear to contain full coding sequence for the protein. We were also able to match the deduced amino acid sequence with protein sequence information obtained from sequencing CNBr cleavage products of purified CAP160, firmly establishing the identify of the cDNAs.

Like CAP85, CAP160 has repeating motifs. However, the pattern and sequence of the repeating elements are very different from those of CAP85. The repeats are fewer and larger in CAP160. No significant sequence similarity at the amino acid level appears between CAP160 and CAP85. Only in the carboxyl-termini of both proteins is there significant homology over a short 10-residue region that happens to encompass a lysine repeat of CAP85. Evidence that the cDNAs encode CAP160 include the antibody reactivity, low temperature upregulation, the size of product at roughly 160 kDa by SDS-PAGE, and the cDNA sequence closely matches the amino acid sequence determined from CNBr cleavage fragments of purified CAP160.

We have screened the genomic library for CAP160 clones. Five clones have been isolated and confirmed by PCR with three different sets of CAP160 primers. The clones range from 4 to perhaps greater than 6 kb.

EXAMPLE 5--Insertion of Cold or Drought Tolerance Genes Into Plants

One aspect of the subject invention is the transformation of plants with genes encoding a cold acclimation protein as disclosed herein. The transformed plants are resistant to damage by extreme cold temperatures, freezing, or drought. The transformed plants can be monocots or dicots and, in a preferred embodiment, would be citrus. When transforming monocots, it may be most advantageous to transform embryogenic cells or tissue using DNA bound to high-velocity microprojectiles as a means of delivering it to the embryogenic cells. See for example, Fromm, M. E., F. Morrish, C. Armstrong, R. Williams, J. Thomas, T. M. Klein �1990! "Inheritance of expression of chimeric genes in the progeny of transgenic maize plants," Bio/Technology 8:833-839.

Genes encoding cold acclimation proteins, as disclosed herein, can be inserted into plant cells using a variety of techniques which are well known in the art. For example, a large number of cloning vectors comprising a replication system in E. coli and a marker that permits selection of the transformed cells are available for preparation for the insertion of foreign genes into higher plants. The vectors comprise, for example, pBR322, pUC series, M13mp series, pACYC184, and the like. Accordingly, the sequence encoding a cold acclimation protein can be inserted into the vector at a suitable restriction site. The resulting plasmid is used for transformation into E. coli. The E. coli cells are cultivated in a suitable nutrient medium, then harvested and lysed. The plasmid is recovered. Sequence analysis, restriction analysis, electrophoresis, and other biochemical-molecular biological methods are generally carried out as methods of analysis. After each manipulation, the DNA sequence used can be cleaved and joined to the next DNA sequence. Each plasmid sequence can be cloned in the same or other plasmids. Depending on the method of inserting desired genes into the plant, other DNA sequences may be necessary. If, for example, the Ti or Ri plasmid is used for the transformation of the plant cell, then at least the right border, but often the right and the left border of the Ti or Ri plasmid T-DNA, has to be joined as the flanking region of the genes to be inserted.

The use of T-DNA for the transformation of plant cells has been intensively researched and sufficiently described in EP 120 516; Hoekema (1985) In: The Binary Plant Vector System, Offset-durkkerij Kanters B. V., Alblasserdam, Chapter 5; Fraley et al., Crit. Rev. Plant Sci. 4:1-46; and An et al. (1985) EMBO J. 4:277-287.

Once the inserted DNA has been integrated in the genome, it is relatively stable there and, as a rule, does not come out again. It normally contains a selection marker that confers on the transformed plant cells resistance to a biocide or an antibiotic, such as kanamycin, G 418, bleomycin, hygromycin, or chloramphenicol, inter alia. The individually employed marker should accordingly permit the selection of transformed cells rather than cells that do not contain the inserted DNA A large number of techniques are available for inserting DNA into a plant host cell. Those techniques include transformation with T-DNA using Agrobactenium lumefaciens or Agrobactetium rhizogenes as transformation agent, fusion, injection, electroporation, or the use of high-velocity microprojectiles, as well as other possible methods. If agrobacteria are used for the transformation, the DNA to be inserted has to be cloned into special plasmids, namely either into an intermediate vector or into a binary vector. The intermediate vectors can be integrated into the Ti or Ri plasmid by homologous recombination owing to sequences that are homologous to sequences in the T-DNA. The Ti or Ri plasmid also comprises the vir region necessary for the transfer of the T-DNA. Intermediate vectors cannot replicate themselves in agrobacteria. The intermediate vector can be transferred into Agrobacterium tumefaciens by means of a helper plasmid (conjugation). Binary vectors can replicate themselves both in E. coli and in agrobacteria. They comprise a selection marker gene and a linker or polylinker which are framed by the right and left T-DNA border regions. They can be transformed directly into agrobacteria (Holsters et al.�1978! Mol. Gen. Genet. 163:181-187). The agrobacterium used as host cell is to comprise a plasmid carrying a vir region. The vir region is necessary for the transfer of the T-DNA into the plant cell. Additional T-DNA may be contained. The bacterium so transformed is used for the transformation of plant cells. Plant explants can advantageously be cultivated with Agrobactetium tumefaciens or Agrobacterium rhizogenes for the transfer of the DNA into the plant cell. Alternatively, DNA may be introduced into plant cell suspensions, embryogenic cells, or other embryogenic tissue by one of the methods noted above. Whole plants can then be regenerated from the treated plant material (for example, pieces of leaf, segments of stalk, roots, but also protoplasts or suspension-cultivated cells) in a suitable medium, which may contain antibiotics or biocides for selection. The plants so obtained can then be tested for the presence of the inserted DNA. No special demands except for a selectable or screenable marker are made of the plasmids in the case of injection and electroporation. It is possible to use ordinary plasmids, such as, for example, pUC derivatives.

The transformed cells grow inside the plants in the usual manner. They can form germ cells and transmit the transformed trait(s) to progeny plants. Such plants can be grown in the normal manner and crossed with plants that have the same transformed hereditary factors or other hereditary factors. The resulting hybrid individuals have the corresponding phenotypic properties.

A variety of plants have been genetically transformed according to the above-described methods. These plants include alfalfa, apple, asparagus, broccoli, cabbage, carrot, cauliflower, celery, corn, cotton, cranberry, cucumber, eggplant, flax, grape, horseradish, kiwi fruit, lettuce, muskmelon, oilseed rape, papaya, pea, pepper, plum, poplar, potato, raspberry, rice, rye, soybean, spruce, strawberry, sugarbeet, sugarcane, sunflower, sweet potato, tobacco, tomato, walnut, and wheat (Gasser, C. S., R. T. Fraley �1992! Scientific American June:62-69). Other transgenic plants of interest which can be produced are plants included in the family Solanaceae, as well as citrus.

EXAMPLE 6--Enhancement of Cold Tolerance in Microorganisms

The inability of Escherichia coli to survive a freeze/thaw cycle is well known. We demonstrated that CAP160 can be expressed in a microorganism and, advantageously, alter its cryotolerance. Escherichia coli were transformed with a gene expressing a CAP160 DNA .beta.-galactosidase fusion protein according to methods well known in the art. The survival rate of the transformed E. coli cells following a freeze/thaw cycle was compared against cells containing pBluescript plasmid without an insert (wild-type).

XL1-Blue cells containing a pBluescript plasmid with the CAP160 DNA, or without an insert, were grown to midlog phase in an LB/AMP medium at 37.degree. C. Fusion protein expression was induced by addition of IPTG to the culture medium (1 or 10 mM final concentration). The cultures were allowed to incubate for an additional 30 minutes at 37.degree. C. following the addition of IPTG. Aliquots of cells in culture tubes were then equilibrated to -5.degree. C. in a controlled temperature bath and seeded with a chip of sterile ice to initiate freezing of the culture medium. Freezing of the 2 ml culture medium equilibrated to -5.degree. C. was rapid with the transition from liquid to solid phase occurring within a minute. After one hour at -5.degree. C., frozen cells were either maintained at -5.degree. C., or transferred to -20.degree. C. After one hour at -20.degree. C., aliquots of the cells were transferred to -80.degree. C. The rate of cooling from -5.degree. C. to -20.degree. C. and -80.degree. C. was not determined. After 16 hours, the cultures were thawed at 4.degree. C., and survival was determined by dilution series plate counts following overnight growth on LB/AMP agar plates at 37.degree. C. Unfrozen cells kept at 4.degree. C. served as the control. The data, as shown in Table 2, below, are expressed as the percent survival relative to the unfrozen control. The values are the mean.+-.SE of nine separate experiments.

TABLE 2______________________________________Survival of recombinant Escherichia colifollowing a freeze/thaw stress Temperature (.degree.C.) -5 -20 -80______________________________________pBluescript only-IPTG 11 .+-. 4 4 .+-. 2 1 .+-. 1+IPTG 10 .+-. 2 3 .+-. 1 1 .+-. 1pBluescript w/CAP160-IPTG 27 .+-. 8 5 .+-. 2 1 .+-. 1+IPTG 31 .+-. 9 6 .+-. 1 2 .+-. 1______________________________________

After freezing at -5.degree. C., the survival rate for the cells expressing CAP160 was roughly three-fold higher than the wild-type cells containing pBluescript plasmid only. Induction with IPTG only slightly altered the survival rate in the CAP160 producing cells and had no effect on the others. At temperatures below -5.degree. C., survival of 30 CAP160 cells was slightly higher than that of the cells containing pBluescript only.

To determine the equilibrium freezing LT.sub.50 (killing temperature for 50% of the cells), cultures induced with IPTG were cooled at 2.degree. C. per hour to -20.degree. C. following the initiation of freezing with a sterile ice chip at -2.degree. C. Survival of frozen cells was determined after exposure to -2, -4, -6, -8, -10, -15, or -20.degree. C. and thawing overnight at 4.degree. C. Cells containing the pBluescript plasmid without an insert lost viability rapidly between -2.degree. and -4.degree. C. (FIG. 5) and yielded an estimated LT.sub.50 of -3.degree. C. The cells expressing the CAP160 fusion protein showed substantially greater survival following freezing. The estimated LT.sub.50 of these cells was about -6.degree. C., and between -6.degree. C. and -20.degree. C., their survival rate was between four and seven fold higher than wild-type cells. Clearly, expressing the CAP160 fusion protein enhanced the ability of XL1-Blue cells to survive a freeze/thaw stress.

Freezing is much more deleterious to E. coli than chilling and/or supercooling. That CAP160 was protecting against freeze/thaw stress and not against chilling stress was indicated by the near 100% survival rate of cells supercooled to -10.degree. C. and warmed without freezing (FIG. 5).

Other transgenic microorganisms can be produced by methods that are well known and which can be conducted by a person of ordinary skill in the art. These other organisms include other bacteria as well as eukaryotic microorganisms such as yeast.

Homology searches indicate that CAP160, in its entirety, is a novel protein whose biological function cannot be identified by shared homology with known proteins, including antifreeze and ice nucleation proteins that function to alter freezing of water. Thus, CAP160 represents a new class of intracellular low temperature stress proteins with a function linked to enhanced freezing tolerance mechanisms in microorganisms.

EXAMPLE 7--Construction of Chimeric Genes

Any number of structural chimeric cold acclimation genes can be constructed using readily available promoters and polyadenylation signals. One example is to use the cauliflower mosaic virus 35S promoter, which is a strong constitutive promoter, to drive transcription of the cold acclimation gene, and a nopaline synthase polyadenylation signal to ensure the RNA is properly processed and translated into a functional protein (Shah et al. �1986! Science 233:478-481). Transformed kanamycin resistant cells can be regenerated into plants and tested for enhanced freezing tolerance. Plants showing enhanced cold tolerance can be analyzed to show that the introduced cold acclimation genes are responsible for the change in hardiness. Promoters for inducible genes can also be used in chimeric cold acclimation gene constructs. Natural promoters for these genes also can be used. This allows the cold acclimation genes to be activated when needed to enhance freezing tolerance at specific times. Other inducible promoters can also be used.

In order to explore the prospect that CAP160 and CAP85 form a complex that requires both proteins for optimum function, plants expressing both spinach proteins can be produced. Two ways to achieve this are to transform transgenic plants already expressing one of the spinach proteins with a construct from the second gene and to make constructs that contain both cDNA sequences that can be co-expressed in transformed plants or, as above, transferred sequentially. In the former case, a second selective media can be employed using the bar gene (Vasil et al. �1992! Bio/Technology 10:667-674).

It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 6(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1813 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:CACGAGCTAATTTGTTGTAATCAAGCAATAACAATGGCTGATGAAAGGAACACTTATGGG60GGACCCGCACCATCTATGGAGACCACTGATCGTGGTATGTTTGATTTCATGAAGAAGAAC120AACAAGGGAGAGGATCACAAGCCATCCGAGGCCGATGTGATTGCCTCCGGCGGTATCGGA180AAGTTGCCCGTCTCCGAACCTGCTCATTATGACCATGATGACAAGGAACATGTTGGACTC240CTTGAGAAAAAACATATTGGACTTGTTGAGCAATTCCATCGTTCTGATCACGCTTCCGAC300GAAAGACATCATGATGAAGAGCAAAACAAAGGTGGTGTCTTCGGAAAAATCAAGGAGAAG360CTCCCCGGTCAGCATGATTCGGATACTACCACACATACACAACAATTATACCCTGCTTCT420GATCATAACTACAACACCCACCATGTCCACCAAGACGATGAAAAGAAGGACAACATCCTT480GACAAAATCAAGGATAAGCTTCCCGGGAAACATGAAGATAAGAAGCAAGACTATCACCAG540CACCAAGAGGAGGAAAAGAAGGGAGGAGCCCTTGACAAAATCAAGGACAAGCTGCCCGGT600CAGGGTAATGCTGGACACACGCAGCAATTATACCCTGCCCCTGATCATAACTACAACACA660CACCATGTCCACCAAGACGAGGAAAACAAGGATAGTGTCTTAGACAAAATCAAGGATAAG720CTGCCCGGACAACATGAAGATAAGAAGAATGACTATCACCACCACCAAGAGGAGGAAAAG780AAGGATAGTGTCCTAGACAAAATCAAGGATAAGATGTCCGGGCAGCATGAAGATAAGAAG840AATGACTATCACCACCACCAAGAGGAGGAAAAGAAGGGAGGAGTCCTTGACAAAATCAAG900GACAAGTTGCCTGGTCAACATGATGCAGACACTGCCAGACACACGCAGCAACTATACCCT960GCTGCTGATCATAACTACAACACACACCATGTCCACCAAGATGAGGAAAACAAGGATAGC1020GTCCTTGACAAAATCAAGGACAAACTACCCGGACAACATGATGATAAGGCTGCATACTCG1080CAACATGACCACCACAAGCACCACCAAGAGGAGGAAAACAAGGGTGGAGTCCTCGACAAA1140ATCAAGGACAAACTGCCTGGTGTCTACATGGTGGTCAAACATGATGGTGATATTGTCGAA1200CACACGCAACAATTATACCCTGCTCCTGATCATAACTACAACACTCACTATGTCCATGAA1260GACGAGAAAAAGAAGGATAGTGTCCTAGACAAAATCAAGGACAAGTTACCCGGACAACAT1320GAGGAAAAGGCAGCAGCATACTCTGAGCCATCATATGATTCACACCCTACACCTGCAAAG1380CATCATGATTATTTCCCCCAAGAGGAGGAAAAGAAAGGTGGTGTCATGGACAAAATTAAG1440GACAAGCTTTCCGGCCAACATAAAGATAAGGCCGACGAGCATGAGTTGGTTGCTCCGTTG1500GTGACAGTCGAACCACATTCTGAGGGTGATAAGGAAAAGAAGGGGTTCTTGGAGAAGATT1560AAGGACAAAATCCCCGGCCTCCACTCCAAGAATGATGCTGAAGAGAAGAAGACCCATGAG1620GAGAAAAAAGAGGGATACTAAACTTAACTAATAAATATCTACGTATATTATGTTCAATAA1680GATCGAATTAGTTGCTTTTTTTAGGTTGATGTGTTTTTCTTGATCAATGCTTTGTGTAAT1740TTGAGTCCAAACTGTGGGGTTTTGATGTCAGTGTTTTTTTCATGACGATGAATATGCAAT1800TATGTGTGTATGG1813(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 535 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAlaAspGluArgAsnThrTyrGlyGlyProAlaProSerMetGlu151015ThrThrAspArgGlyMetPheAspPheMetLysLysAsnAsnLysGly202530GluAspHisLysProSerGluAlaAspValIleAlaSerGlyGlyIle354045GlyLysLeuProValSerGluProAlaHisTyrAspHisAspAspLys505560GluHisValGlyLeuLeuGluLysLysHisIleGlyLeuValGluGln65707580PheHisArgSerAspHisAlaSerAspGluArgHisHisAspGluGlu859095GlnAsnLysGlyGlyValPheGlyLysIleLysGluLysLeuProGly100105110GlnHisAspSerAspThrThrThrHisThrGlnGlnLeuTyrProAla115120125SerAspHisAsnTyrAsnThrHisHisValHisGlnAspAspGluLys130135140LysAspAsnIleLeuAspLysIleLysAspLysLeuProGlyLysHis145150155160GluAspLysLysGlnAspTyrHisGlnHisGlnGluGluGluLysLys165170175GlyGlyAlaLeuAspLysIleLysAspLysLeuProGlyGlnGlyAsn180185190AlaGlyHisThrGlnGlnLeuTyrProAlaProAspHisAsnTyrAsn195200205ThrHisHisValHisGlnAspGluGluAsnLysAspSerValLeuAsp210215220LysIleLysAspLysLeuProGlyGlnHisGluAspLysLysAsnAsp225230235240TyrHisHisHisGlnGluGluGluLysLysAspSerValLeuAspLys245250255IleLysAspLysMetSerGlyGlnHisGluAspLysLysAsnAspTyr260265270HisHisHisGlnGluGluGluLysLysGlyGlyValLeuAspLysIle275280285LysAspLysLeuProGlyGlnHisAspAlaAspThrAlaArgHisThr290295300GlnGlnLeuTyrProAlaAlaAspHisAsnTyrAsnThrHisHisVal305310315320HisGlnAspGluGluAsnLysAspSerValLeuAspLysIleLysAsp325330335LysLeuProGlyGlnHisAspAspLysAlaAlaTyrSerGlnHisAsp340345350HisHisLysHisHisGlnGluGluGluAsnLysGlyGlyValLeuAsp355360365LysIleLysAspLysLeuProGlyValTyrMetValValLysHisAsp370375380GlyAspIleValGluHisThrGlnGlnLeuTyrProAlaProAspHis385390395400AsnTyrAsnThrHisTyrValHisGluAspGluLysLysLysAspSer405410415ValLeuAspLysIleLysAspLysLeuProGlyGlnHisGluGluLys420425430AlaAlaAlaTyrSerGluProSerTyrAspSerHisProThrProAla435440445LysHisHisAspTyrPheProGlnGluGluGluLysLysGlyGlyVal450455460MetAspLysIleLysAspLysLeuSerGlyGlnHisLysAspLysAla465470475480AspGluHisGluLeuValAlaProLeuValThrValGluProHisSer485490495GluGlyAspLysGluLysLysGlyPheLeuGluLysIleLysAspLys500505510IleProGlyLeuHisSerLysAsnAspAlaGluGluLysLysThrHis515520525GluGluLysLysGluGlyTyr530535(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2720 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GCACAAGGTTATAACCTCCTATTTATTTCCAATTCAATTTGTATCTCATTTTATATAAAT60AGTATTTTCAATTAAAAAAACCAAGAATTCAAAATGGAACACCCTAGCGGTCACACGCGT120CACACTACTCATGTAGAAGATGATCTTCAAGATGCTTCCATACAAACTGGTCATAATGAA180GATGAGAAGCCTGAGAAGAAAACAATGATGATGAAAGTAAAGGCGAAAGCAAGGAAGATT240AGAGACAGTATTAAGAATGTTGGACATAGTCATGATCATGATCATGATCACGATGAGAAT300GACGACGATGATGACGAGGAGGAGGAAGTTGAGATGGATATGGACTCTGAAATCCAAGGC360ACTCATACTGCTCAAACCGGCACACCAGGGGAGGAAGTTACAAGGCAGAAGCTGCATGAA420CCAAAACTGGTAGAAAGAACAATAGGTGAAGATATCCAAGTTCGGAACAGACTAGGTGAT480TATCAGACATTTGATCCTACTTCTGAAACATTCACTCCTGGACATGATCAGACCTTAGGT540TGGTCGAGGACTGATACCGGAAAGCCAAAAGAGTACGGTGGAAGTCATAGTACTGAAGCT600TCTGATAAAGAGATGAATGCAGCAGCTCCTGTAAATCTTGGAGGTGTTGTTGTTGGTTGT660GACCATCAGGTCCCGAAAGATGTAGGGGAAGATAGTCATTCTGCTAATTATCAGTCTGAA720GTCATTGAACCAACAGTTACTGGATTCGAATTCCCGGTTGCTCAAAGTCATTCACCAGCA780AATAAGCCACAGGGCGATTTTCAGACCTTTAATCCTAGGACTGATACTGAAAGGCTAAAC840AAGTCAGTGGAAATGTTCAATGAATCGAATAATGCACCAATATCAGCCCATTCAGGACAT900GAATCACATGAAAGAACTGCAATGGAAGGGGTGGTTGATGCCCCGGGAAACAAGACAGAA960GGCGATTATCAGACCTTTGATCCTAAGTCTACAAGCTATGTTCCCGGACAAGAAGAGACC1020TTGGGTTGGTCTAGAACTGACACCGGAGGGCTAAACAAGTCCGAGGAACTTTCCAATCTA1080TCGAACAACACATCAACTGAAACTCATTCAGGTGATGAAGAAACAAGGATTATTCAAATC1140CTGAATCAGATGGATTTAATGAACGTTAACGAAGAATCGCAGCAGAAACCAACAGCACCA1200GATGATTCTCACCTGAACAAAACAGAACATCATAATCCACCAGATGAGAAAATCTCAACT1260GAAAGCCACCATGATCAGTTCTTTGCAAAGCCAGACACATCTGAGACGGGCCCAGTTGTT1320CAAGCTACTACTACTCCAGCCACTGATGGTAATAGCTACACCGGAATGATATCAAATGCG1380GCTGCAATGGTGGCTGATAAGGCAATGCTAGCCACTAGTGCTGTTACATCAAAGCTAGGG1440TATGGTGGGCCATCCACCGGGCCTACTAGTCCTGATCAGCAGCACTCAACAACTGATGTA1500ACTTCAGAAATGCACGACAACAACCCGTCAGATAAGCCCGTGGGTACTACTTATGGGGAG1560AGAATGTCGAGTGCCACAGCTGTTGTTACTGATAAAGCTATACAAGCCAAGGATGTTGTA1620GCCACTAAGCTAGGCTATGGTGGCAATCCTGATCAGCAGCACTCCACTGATGTGACTTCA1680GAAATGCATGATAACCCGTCAGAGCAGCCCGTGGGTACTACCTACGGGGAGAAAATATCG1740AGTGCCACGACTGTTGTTACTGATAAGGCTATACAAGCCAAGGATGTTGTAGCCGCTAAG1800CTGGGCTATGGCGGGCCGTCCACCGGGCCATCCACTGGGCCTATTACCGGACCATCCAAG1860GGGCCTATTACCGGGCCATCCACCGGGCCTATTACATGGGGGGATAAGGGAGTGGCAGTG1920AAGGAGTATTTGGTAGAGAAACTGAAGCCCGGTGAAGATGACAAGGCGTTGTCCGAGGTT1980ATAACTGAAGCCTTGCCTTCGCCCTTACACAAACCGAAGGAGGAGGGTGTGACTATAATA2040GGGAGAGTTGCAGAGCCTAAAGAGGTGGTGCAAATGATTGATCATATTGAGGAGAAGAAT2100GATGATGGTATAGTGATGGGTGAAGATGACAAGGCAGTGTTCGAGGCTGTAGTTGGGAAG2160GTAGGGGGAGGGGACGAGGTTGCGGAAAGGCTTGGTTGGGGGGAGGAGAAGAAGGAGGAT2220GGTAGTGATAATGGTGGTGCAGGGGTGGTTAGTCCAGGGAAGGGTGTAATGGAAAGGATT2280AAAGATGCTGCTAGTGGGTGGTTTCAGAGTAGTGATGACTTTCCGTCTCAGGATACCGGT2340ACCCGTACCCGTCATATCACACAAGGAACGGAAAGTTTTCCCATTTCTAGCATGGAAAGT2400GAGCAGAAAAGAATCGGTGGTGCAGCGTCTCTTTAGTAATTTGAGCTTAGATATGTGTTC2460CGGGTCTGGAAGTGGAACTGGGGGATGATCTGGAAGTACCTTGCCCTGTCAAGTAGAGCA2520AACGTTAGCCCCACTTTACGACCCAGTACAATATGTTGTATTCCCGGATTTTTTTTATTT2580GTGATGTGTAAACAATAGCAGTTTGCTTCAGGAGTAATGCTGCTAGCTTGCTAGGAATGT2640ACTTCAAATTAACAACTGTTGTAATTTTGTAAATAAAGAACTGGACACTTTCCAGAGTTT2700GTGAAAAAAAAAAAAAAAAA2720(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 802 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:ThrArgAlaAsnSerLeuAlaThrGluAspPheArgMetCysCysAla151015ProArgPheSerGluGlnMetGluHisProSerGlyHisThrArgHis202530ThrThrHisValGluAspAspLeuGlnAspAlaSerIleGlnThrGly354045HisAsnGluAspGluLysProGluLysLysThrMetMetMetLysVal505560LysAlaLysAlaArgLysIleArgAspSerIleLysAsnValGlyHis65707580SerHisAspHisAspHisAspHisAspGluAsnAspAspAspAspAsp859095GluGluGluGluValGluMetAspMetAspSerGluIleGlnGlyThr100105110HisThrAlaGlnThrGlyThrProGlyGluGluValThrArgGlnLys115120125LeuHisGluProLysLeuValGluArgThrIleGlyGluAspIleGln130135140ValArgAsnArgLeuGlyAspTyrGlnThrPheAspProThrSerGlu145150155160ThrPheThrProGlyHisAspGlnThrLeuGlyTrpSerArgThrAsp165170175ThrGlyLysProLysGluTyrGlyGlySerHisSerThrGluAlaSer180185190AspLysGluMetAsnAlaAlaAlaProValAsnLeuGlyGlyValVal195200205ValGlyCysAspHisGlnValProLysAspValGlyGluAspSerHis210215220SerAlaAsnTyrGlnSerGluValIleGluProThrValThrGlyPhe225230235240GluPheProValAlaGlnSerHisSerProAlaAsnLysProGlnGly245250255AspPheGlnThrPheAsnProArgThrAspThrGluArgLeuAsnLys260265270SerValGluMetPheAsnGluSerAsnAsnAlaProIleSerAlaHis275280285SerGlyHisGluSerHisGluArgThrAlaMetGluGlyValValAsp290295300AlaProGlyAsnLysThrGluGlyAspTyrGlnThrPheAspProLys305310315320SerThrSerTyrValProGlyGlnGluGluThrLeuGlyTrpSerArg325330335ThrAspThrGlyGlyLeuAsnLysSerGluGluLeuSerAsnLeuSer340345350AsnAsnThrSerThrGluThrHisSerGlyAspGluGluThrArgIle355360365IleGlnIleLeuAsnGlnMetAspLeuMetAsnValAsnGluGluSer370375380GlnGlnLysProThrAlaProAspAspSerHisLeuAsnLysThrGlu385390395400HisHisAsnProProAspGluLysIleSerThrGluSerHisHisAsp405410415GlnPhePheAlaLysProAspThrSerGluThrGlyProValValGln420425430AlaThrThrThrProAlaThrAspGlyAsnSerTyrThrGlyMetIle435440445SerAsnAlaAlaAlaMetValAlaAspLysAlaMetLeuAlaThrSer450455460AlaValThrSerLysLeuGlyTyrGlyGlyProSerThrGlyProThr465470475480SerProAspGlnGlnHisSerThrThrAspValThrSerGluMetHis485490495AspAsnAsnProSerAspLysProValGlyThrThrTyrGlyGluArg500505510MetSerSerAlaThrAlaValValThrAspLysAlaIleGlnAlaLys515520525AspValValAlaThrLysLeuGlyTyrGlyGlyAsnProAspGlnGln530535540HisSerThrAspValThrSerGluMetHisAspAsnProSerGluGln545550555560ProValGlyThrThrTyrGlyGluLysIleSerSerAlaThrThrVal565570575ValThrAspLysAlaIleGlnAlaLysAspValValAlaAlaLysLeu580585590GlyTyrGlyGlyProSerThrGlyProSerThrGlyProIleThrGly595600605ProSerLysGlyProIleThrGlyProSerThrGlyProIleThrTrp610615620GlyAspLysGlyValAlaValLysGluTyrLeuValGluLysLeuLys625630635640ProGlyGluAspAspLysAlaLeuSerGluValIleThrGluAlaLeu645650655ProSerProLeuHisLysProLysGluGluGlyValThrIleIleGly660665670ArgValAlaGluProLysGluValValGlnMetIleAspHisIleGlu675680685GluLysAsnAspAspGlyIleValMetGlyGluAspAspLysAlaVal690695700PheGluAlaValValGlyLysValGlyGlyGlyAspGluValAlaGlu705710715720ArgLeuGlyTrpGlyGluGluLysLysGluAspGlySerAspAsnGly725730735GlyAlaGlyValValSerProGlyLysGlyValMetGluArgIleLys740745750AspAlaAlaSerGlyTrpPheGlnSerSerAspAspPheProSerGln755760765AspThrGlyThrArgThrArgHisIleThrGlnGlyThrGluSerPhe770775780ProIleSerSerMetGluSerGluGlnLysArgIleGlyGlyAlaGly785790795800SerLeu(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:ATGAAGAAGAAYAAYAAGGGYGAG24(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:TARTCRTTCTTCTTRTCCTCRTG23__________________________________________________________________________

Claims

1. An isolated DNA molecule comprising a nucleotide sequence encoding a protein which enhances cold tolerance of a plant cell, wherein said protein is CAP85 having an amino acid sequence as given in SEQ ID NO:2 or CAP160 having an amino acid sequence as given in SEQ ID NO:4.

2. The DNA molecule of claim 1, wherein the encoded protein is CAP85.

3. The DNA molecule of claim 2, wherein the nucleotide sequence encoding the CAP85 protein is as given in SEQ ID NO:1, from nucleotide 34 to nucleotide 1648.

4. The DNA molecule of claim 1, wherein the encoded protein is CAP160.

5. The DNA molecule of claim 4, wherein the nucleotide sequence encoding the CAP160 protein is as given in SEQ ID NO:3.

6. A process for enhancing cold tolerance of a cell, wherein said process comprises the step of transforming said cell with a DNA molecule comprising a coding sequence for a cold acclimation protein selected from the group consisting of CAP85 having an amino acid sequence as given in SEQ ID NO:2 and CAP160 having an amino acid sequence as given in SEQ ID NO:4, wherein expression of said coding sequence results in enhanced cold tolerance of said cell.

7. The process, according to claim 6, wherein said cell is a plant cell.

8. The process, according to claim 7, wherein said plant cell is a cell of a plant of the family Solanaceae.

9. The process, according to claim 7, wherein said plant cell is a citrus plant cell.

10. The process, according to claim 6, Wherein said cell is a bacterium.

11. The process, according to claim 6, wherein said cell is a yeast cell.

12. A transformed cell, wherein said cell is transformed according to the process of claim 6.

13. The transformed cell, according to claim 12, wherein said cell is a plant cell.

14. The transformed cell, according to claim 13, wherein said plant cell is a citrus plant cell.