The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jun. 14, 2021, is named 070050_6507_SL.txt and is 47,040 bytes in size. The Sequence Listing does not extend beyond the scope of the specification and thus does not contain new matter.
The disclosed subject matter relates to intracellular fluorescent tags, specifically for flow cytometry and fluorescence microscopy.
Networks of dynamically interacting cells and species govern many biological processes with relevance to human health and ecology. Understanding these cellular networks, such as the microbiome and the immune system, can enable the elucidation and prediction of complex behaviors like microbial drug metabolism, pathogen engraftment, inflammatory disease and cancer. One component to understanding these network processes is tracking the identities and phenotypes of cells over time. While certain cell barcoding methods, such as those based on sequencing or exogenous labeling, can capture system-wide snapshots of cell populations, these techniques are not necessarily easily adapted for measuring time-resolved rates of change in cell phenotype or population composition.
These cell barcoding tools should be highly scalable, resolvable, self-renewing, and conveniently analyzed in a non-destructive manner using widely accessible instruments. Certain fluorescent proteins (FPs) can be components for building cellular barcodes because they meet several of these criteria. First, they are genetically encoded and therefore do not dilute over multiple cell generations. Second, they emit fluorescence signals that can be easily measured directly form the sample with microscopy and flow cytometry. Finally, a wide variety of FPs are available with different colors and biophysical properties. However, despite their exceptional qualities, FPs can have broad fluorescence spectra that limit the number of variants that can be resolved simultaneously. This can restrict FP-based barcoding to experiments containing only a small number (3 to 5) of cell types. While elegant combinatorial approaches can address this challenge, certain methods exhaust most available fluorescence channels because of their dependence on three or more FP colors. This can limit their use alongside other fluorescent reporters and places an upper bound on their scalability. Moreover, certain methods, such as those based on Brainbow, can face scaling challenges since discrimination between similar hues becomes increasingly difficult with increasing barcode number, requiring the use of additional spatial information to fully identify specific cells. Finally, to generate more than three colors, these methods can rely on stochastic genetic integration of multiple expression units, which makes barcode generation unpredictable and unassignable a priori. The above limitations can place restrictions on how and where FP markers can be used for multiplexed cellular tracking.
As efforts progress in studying, modeling, and even building multicellular networks, a next generation of multiplex cell barcoding tools is needed for time-resolved cellular identification, lineage tracing and phenotypic reporting from intact biological systems.
The present disclosure provides a nucleic acid construct for labeling one or more cells, e.g., within a population of cells. In certain embodiments, the nucleic acid construct includes a first nucleic acid segment encoding a first fluorescent protein, a second nucleic acid segment encoding a second fluorescent protein, a third nucleic acid segment including a slippery site, e.g., positioned upstream of the second nucleic acid segment encoding the second fluorescent protein, and a fourth nucleic acid segment including a frameshift stimulatory sequence, e.g., positioned upstream of the second nucleic acid segment encoding the second fluorescent protein. In certain embodiments, the nucleic acid construct includes a fifth nucleic acid segment encoding a stop codon, e.g., positioned upstream of the second nucleic acid segment encoding the second fluorescent protein. In certain embodiments, the fifth nucleic acid segment, e.g., the stop codon, is in frame with the second nucleic acid segment encoding the second fluorescent protein.
In certain embodiments, a nucleic acid construct of the present disclosure can include one or more nucleic acid segments encoding a third fluorescent protein, a fourth fluorescent protein, a fifth fluorescent protein, a sixth fluorescent protein, a seventh fluorescent protein, an eighth fluorescent protein, a ninth fluorescent protein and/or a tenth fluorescent protein. In certain embodiments, the nucleic acid construct can include one or more nucleic acid segments encoding a second slippery site, a third slippery site, a fourth slippery site, a fifth slippery site, a sixth slippery site, a seventh slippery site, an eighth slippery site and/or a ninth slippery site. In certain embodiments, the nucleic acid construct can include one or more nucleic acid segments encoding a second stop codon, a third stop codon, a fourth stop codon, a fifth stop codon, a sixth stop codon, a seventh stop codon, an eighth stop codon and/or a ninth stop codon. In certain embodiments, the nucleic acid construct can include a second frameshift stimulatory sequence, a third frameshift stimulatory sequence, a fourth frameshift stimulatory sequence, a fifth frameshift stimulatory sequence, a sixth frameshift stimulatory sequence, a seventh frameshift stimulatory sequence, an eighth frameshift stimulatory sequence and/or a ninth frameshift stimulatory sequence. For example, but not by way of limitation, a nucleic acid construct of the present disclosure can further include a sixth nucleic acid segment encoding a third fluorescent protein, a seventh nucleic acid segment encoding a second slippery site, an eighth nucleic acid segment encoding a second frameshift stimulatory sequence and a ninth nucleic acid segment encoding a second stop codon.
In certain embodiments, the first fluorescent protein, the second fluorescent protein and/or the third fluorescent protein can be a fluorescent protein selected from the group consisting of a green fluorescent protein (GFP), a red fluorescent protein (RFP), a blue fluorescent protein (BFP), a cyan fluorescent protein (CFP), a yellow fluorescent protein (YFP), an orange fluorescent protein (OFP), a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein, a timer fluorescent protein and mutants or variants thereof. In certain embodiments, the first fluorescent protein, the second fluorescent protein and/or third fluorescent protein are different fluorescent proteins, e.g., the first fluorescent protein, the second fluorescent protein and/or third fluorescent protein are dependently selected from a GFP, an RFP, a BFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein, a timer fluorescent protein and mutants or variants thereof. In certain embodiments, first fluorescent protein, second fluorescent protein and/or third fluorescent protein are dependently selected from GFP, sfGFP, deGFP, eGFP, Venus, mVenus, YFP, Cerulean, Citrine, CFP, eYFP, eCFP, RFP, mRFP, mCherry, mmCherry, mTurquoise2, mKO2, BFP, mTagBFP2 and mutants or variants thereof. In certain embodiments, the first fluorescent protein is a GFP, e.g., eGFP, and the second fluorescent protein is an RFP, e.g., mCherry. In certain embodiments, the first fluorescent protein is a GFP, e.g., eGFP, the second fluorescent protein is an RFP, e.g., mCherry, and the third fluorescent protein is a BFP, e.g., mTagBFP2.
The present disclosure further provides genetically-engineered cells that include one or more or two or more nucleic acid constructs disclosed herein. In certain embodiments, the cell is a prokaryotic cell or a eukaryotic cell. In certain embodiments, the cell is selected from the group consisting of a mammalian cell, a plant cell and a fungal cell. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the cell is a plant cell. In certain embodiments, the cell is a fungal cell. In certain embodiments, the fungal cell is a species of the phylum Ascomycota, e.g., Saccharomyces cerevisiae, Saccharomyces castellii, Vanderwaltozyma polyspora, Torulaspora delbrueckii, Saccharomyces kluyveri, Kluyveromyces lactis, Zygosaccharomyces rouxii, Zygosaccharomyces bailii, Candida glabrata, Ashbya gossypii, Scheffersomyces stipites, Komagataella (Pichia) pastoris, Candida (Pichia) guilliermondii, Candida parapsilosis, Candida auris, Yarrowia hpolytica, Candida (Clavispora) lusitaniae, Candida albicans, Candida tropicalis, Candida tenuis, Lodderomyces elongisporous, Geotrichum candidum, Baudoinia compniacensis, Schizosaccharomyces octosporus, Tuber melanosporum, Aspergillus oryzae, Schizosaccharomyces pombe, Aspergillus (Neosartorya) fischeri, Pseudogymnoascus destructans, Schizosaccharomyces japonicus, Paracoccidioides brasiliensis, Mycosphaerella graminicola, Penicillium chrysogenum, Aspergillus nidulans, Phaeosphaeria nodorum, Hypocrea jecorina, Botrytis cinereal, Beauvaria bassiana, Neurospora crassa, Sporothrix scheckii, Magnaporthe oryzea, Dactylellina haptotyla, Fusarium graminearum, Capronia coronate and combinations thereof. In certain embodiments, the cell is Saccharomyces cerevisiae. In certain embodiments, the first fluorescent protein and the second fluorescent protein are expressed in the genetically-engineered cell at a ratio of about 1:1,000 to about 1,000:1, e.g., about 1:100 to about 100:1. In certain embodiments, the first fluorescent protein and the third fluorescent protein are expressed in the genetically-engineered cell at a ratio of about 1:1,000 to about 1,000:1, e.g., about 1:100 to about 100:1. In certain embodiments, the second fluorescent protein and the third fluorescent protein are expressed in the genetically-engineered cell at a ratio of about 1:1,000 to about 1,000:1, e.g., about 1:100 to about 100:1.
The present disclosure further provides a cell population that includes one or more genetically-engineered cells described herein. The present disclosure further provides kits that include one or more nucleic acid constructs or genetically-engineered cells described herein.
The present disclosure further provides methods for labeling a cell that includes introducing one or more nucleic acid constructs described herein into the cell. In certain embodiments, the method can include expressing two or more fluorescent proteins from the one or more nucleic acid constructs. In certain embodiments, the method can further include determining the ratio of fluorescent between the two or more fluorescent proteins expressed in the cell.
The present disclosure provides for nucleic acid constructs encoding two or more proteins, e.g., fluorescent proteins, that when introduced into a cell, e.g., yeast cell, results in the genetically-engineered cell expressing a ratio of the two proteins, e.g., fluorescent proteins.
For purposes of clarity of disclosure and not by way of limitation, the detailed description is divided into the following subsections:
I. Definitions;
II. Nucleic Acid Constructs;
III. Cells;
IV. Methods of Use;
V. Kits.
The terms used in this specification generally have their ordinary meanings in the art, within the context of this disclosure and in the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the compositions and methods of the present disclosure and how to make and use them.
As used herein, the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification can mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”
The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms or words that do not preclude additional acts or structures. The present disclosure also contemplates other embodiments “comprising,” “consisting of” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.
The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.
The term “expression” or “expresses,” as used herein, refer to transcription and translation occurring within a cell, e.g., yeast cell. The level of expression of a gene and/or nucleic acid in a cell can be determined on the basis of either the amount of corresponding mRNA that is present in the cell or the amount of the protein, e.g., fluorescent protein, encoded by the gene and/or nucleic acid that is produced by the cell. For example, mRNA transcribed from a gene and/or nucleic acid is desirably quantitated by northern hybridization. Sambrook et al., Molecular Cloning: A Laboratory Manual, pp. 7.3-7.57 (Cold Spring Harbor Laboratory Press, 1989). Protein encoded by a gene and/or nucleic acid can be quantitated either by assaying for the biological activity of the protein or by employing assays that are independent of such activity, such as western blotting or radioimmunoassay using antibodies that are capable of reacting with the protein. Sambrook et al., Molecular Cloning: A Laboratory Manual, pp. 18.1-18.88 (Cold Spring Harbor Laboratory Press, 1989).
As used herein, “polypeptide” refers generally to peptides and proteins having about three or more amino acids. The polypeptides can be endogenous to the cell, or preferably, can be exogenous, meaning that they are heterologous, i.e., foreign, to the cell being utilized, such as a synthetic peptide and/or protein, e.g., a fluorescent protein. In certain embodiments, synthetic peptides are used, more preferably those which are directly secreted into the medium.
The term “protein” is meant to refer to a sequence of amino acids for which the chain length is sufficient to produce the higher levels of tertiary and/or quaternary structure. This is to distinguish from “peptides” that typically do not have such structure. Typically, the protein herein will have a molecular weight of at least about 15-100 kD, e.g., closer to about 15 kD. In certain embodiments, a protein can include at least about 50, about 60, about 70, about 80, about 90, about 100, about 200, about 300, about 400 or about 500 amino acids. Examples of proteins encompassed within the definition herein include all proteins, and, in general proteins that contain one or more disulfide bonds, including multi-chain polypeptides including one or more inter- and/or intrachain disulfide bonds. In certain embodiments, proteins can include other post-translation modifications including, but not limited to, glycosylation and lipidation. See, e.g., Prabakaran et al., WIREs Syst Biol Med (2012), which is incorporated herein by reference in its entirety.
As used herein the term “amino acid,” “amino acid monomer” or “amino acid residue” refers to organic compounds composed of amine and carboxylic acid functional groups, along with a side-chain specific to each amino acid. In particular, alpha- or α-amino acid refers to organic compounds in which the amine (—NH2) is separated from the carboxylic acid (—COOH) by a methylene group (—CH2), and a side-chain specific to each amino acid connected to this methylene group (—CH2) which is alpha to the carboxylic acid (—COOH). Different amino acids have different side chains and have distinctive characteristics, such as charge, polarity, aromaticity, reduction potential, hydrophobicity, and pKa. Amino acids can be covalently linked to form a polymer through peptide bonds by reactions between the carboxylic acid group of the first amino acid and the amine group of the second amino acid. Amino acid in the sense of the disclosure refers to any of the twenty plus naturally occurring amino acids, non-natural amino acids, and includes both D and L optical isomers.
The terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid construct” or “polynucleotide,” used interchange herein, include any compound and/or substance that includes a polymer of nucleotides. Each nucleotide is composed of a base, specifically a purine- or pyrimidine base (i.e., cytosine (C), guanine (G), adenine (A), thymine (T) or uracil (U)), a sugar (i.e., deoxyribose or ribose), and a phosphate group. Often, the nucleic acid molecule is described by the sequence of bases, whereby said bases represent the primary structure (linear structure) of a nucleic acid molecule. The sequence of bases is typically represented from 5′ to 3′. Herein, the term nucleic acid molecule encompasses deoxyribonucleic acid (DNA) including, e.g., complementary DNA (cDNA) and genomic DNA, ribonucleic acid (RNA), in particular messenger RNA (mRNA), synthetic forms of DNA or RNA, and mixed polymers including two or more of these molecules. The nucleic acid molecule can be linear or circular. In addition, the term nucleic acid molecule includes both, sense and antisense strands, as well as single stranded and double stranded forms. Moreover, the herein described nucleic acid molecule can contain naturally occurring or non-naturally occurring nucleotides. Examples of non-naturally occurring nucleotides include modified nucleotide bases with derivatized sugars or phosphate backbone linkages or chemically modified residues. Nucleic acid molecules also encompass DNA and RNA molecules which are suitable as a vector for direct expression of fluorescent proteins of the disclosure in vitro and/or in vivo, e.g., in a yeast cell. Such DNA (e.g., cDNA) or RNA (e.g., mRNA) vectors, can be unmodified or modified. For example, mRNA can be chemically modified to enhance the stability of the RNA vector and/or expression of the encoded molecule.
As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
As used herein, the term “recombinant cell” refers to cells which have some genetic modification from the original parent cells from which they are derived. Such cells can also be referred to as “genetically-engineered cells.” Such genetic modification can be the result of an introduction of a heterologous nucleic acid for expression of a fluorescent protein, e.g., two or more fluorescent proteins.
As used herein, the term “recombinant protein” refers generally to peptides and proteins. Such recombinant proteins are “heterologous,” i.e., foreign to the cell being utilized, such as a heterologous secretory peptide produced by a yeast cell.
As used herein, “sequence identity” or “identity” in the context of two polynucleotide or polypeptide sequences makes reference to the nucleotide bases or amino acid residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity or similarity is used in reference to proteins, it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted with a functionally equivalent residue of the amino acid residues with similar physiochemical properties and therefore do not change the functional properties of the molecule.
As used herein, “percentage of sequence identity” means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can include additions or deletions (gaps) as compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
As understood by those skilled in the art, determination of percent identity between any two sequences can be accomplished using certain well-known mathematical algorithms. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller, the local homology algorithm of Smith et al.; the homology alignment algorithm of Needleman and Wunsch; the search-for-similarity-method of Pearson and Lipman; the algorithm of Karlin and Altschul, modified as in Karlin and Altschul. Computer implementations of suitable mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL, ALIGN, GAP, BESTFIT, BLAST, FASTA, among others identifiable by skilled persons.
As used herein, “reference sequence” is a defined sequence used as a basis for sequence comparison. A reference sequence can be a subset or the entirety of a specified sequence; for example, as a segment of a full-length protein or protein fragment. A reference sequence can be, for example, a sequence identifiable in a database such as GenBank and UniProt and others identifiable to those skilled in the art.
The term “operative connection” or “operatively linked,” as used herein, with regard to regulatory sequences of a gene indicate an arrangement of elements in a combination enabling production of an appropriate effect. With respect to genes and regulatory sequences, an operative connection indicates a configuration of the genes with respect to the regulatory sequence allowing the regulatory sequences to directly or indirectly increase or decrease transcription or translation of the genes. In particular, in certain embodiments, regulatory sequences directly increasing transcription of the operatively linked gene, include promoters typically located on a same strand and upstream on a DNA sequence (towards the 5′ region of the sense strand), adjacent to the transcription start site of the genes whose transcription they initiate. In certain embodiments, regulatory sequences directly increasing transcription of the operatively linked gene or gene cluster include enhancers that can be located more distally from the transcription start site compared to promoters, and either upstream or downstream from the regulated genes, as understood by those skilled in the art. Enhancers are typically short (50-1500 bp) regions of DNA that can be bound by transcriptional activators to increase transcription of a particular gene. Typically, enhancers can be located up to 1 Mbp away from the gene, upstream or downstream from the start site.
As would be understood by those skilled in the art, the term “codon optimization,” as used herein, refers to the introduction of synonymous mutations into codons of a protein-coding gene in order to improve protein expression in expression systems of a particular organism, such as a cell of a species of the phylum Ascomycota, in accordance with the codon usage bias of that organism. The term “codon usage bias” refers to differences in the frequency of occurrence of synonymous codons in coding DNA. The genetic codes of different organisms are often biased towards using one of the several codons that encode a same amino acid over others—thus using the one codon with, a greater frequency than expected by chance. Optimized codons in microorganisms, such as Saccharomyces cerevisiae, reflect the composition of their respective genomic tRNA pool. The use of optimized codons can help to achieve faster translation rates and high accuracy.
In the field of bioinformatics and computational biology, many statistical methods have been discussed and used to analyze codon usage bias. Methods such as the ‘frequency of optimal codons’ (Fop), the Relative Codon Adaptation (RCA) or the ‘Codon Adaptation Index’ (CAI) are used to predict gene expression levels, while methods such as the ‘effective number of codons’ (Nc) and Shannon entropy from information theory are used to measure codon usage evenness. Multivariate statistical methods, such as correspondence analysis and principal component analysis, are widely used to analyze variations in codon usage among genes. There are many computer programs to implement the statistical analyses enumerated above, including CodonW, GCUA, INCA, and others identifiable by those skilled in the art. Several software packages are available online for codon optimization of gene sequences, including those offered by companies such as GenScript, EnCor Biotechnology, Integrated DNA Technologies, ThermoFisher Scientific, among others known those skilled in the art.
The terms “detect” or “detection,” as used herein, indicates the determination of the existence and/or presence of a target, e.g., fluorescent protein, in a limited portion of space, including but not limited to a sample, a reaction mixture, a molecular complex and a substrate. The “detect” or “detection” as used herein can include determination of a property, e.g., chemical and/or biological property, of the target, including but not limited to ability to interact, and in particular bind, other compounds, ability to activate another compound and additional properties identifiable by a skilled person upon reading of the present disclosure. The detection can be quantitative or qualitative. A detection is “quantitative” when it refers, relates to, or involves the measurement of quantity or amount of the target or signal (also referred as quantitation), which includes but is not limited to any analysis designed to determine the amounts or proportions of the target or signal. A detection is “qualitative” when it refers, relates to, or involves identification of a quality or kind of the target or signal in terms of relative abundance to another target or signal, which is not quantified.
As used herein, the term “a population of cells” or “a cell population” refers to a group of at least two cells. In certain non-limiting examples, a cell population can include at least about 10, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000 cells, at least about 5,000 cells or at least about 10,000 cells or at least about 100,000 cells or at least about 1,000,000 cells. The population can be a pure population including one cell type. Alternatively, the population can include more than one cell type, for example a mixed cell population.
As used herein, the term “in vitro” refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vitro environments exemplified, but are not limited to, test tubes and cell cultures.
As used herein, the term “derived from” or “established from” or “differentiated from” when made in reference to any cell disclosed herein refers to a cell that was obtained from (e.g., isolated, purified, etc.) a parent cell in a cell line, tissue (such as a dissociated embryo, or fluids using any manipulation, such as, without limitation, single cell isolation, cultured in vitro, treatment and/or mutagenesis using for example proteins, chemicals, radiation, infection with virus, transfection with DNA sequences, such as with a morphogen, etc., selection (such as by serial culture) of any cell that is contained in cultured parent cells. A derived cell can be selected from a mixed population by virtue of response to a growth factor, cytokine, selected progression of cytokine treatments, adhesiveness, lack of adhesiveness, sorting procedure and the like.
The present disclosure relates to a nucleic acid construct, e.g., DNA construct, that can be introduced into one or more cells to express a fluorescent protein. In certain embodiments, the nucleic acid construct encodes for at least two different fluorescent proteins. For example, but not by way of limitation, the nucleic acid construct encodes for at least three different fluorescent proteins, at least four different fluorescent proteins, at least five different fluorescent proteins, at least six different fluorescent proteins, at least seven different fluorescent proteins, at least eight different fluorescent proteins, at least nine different fluorescent proteins or at least ten different fluorescent proteins. In certain embodiments, a nucleic acid construct of the present disclosure encodes about two or more fluorescent proteins, e.g., about two or more, about three or more, about four or more, about five or more, about six or more, about seven or more, about eight or more, about nine or more or about ten or more fluorescent proteins.
In certain embodiments, a nucleic acid construct of the present disclosure encodes from about two to about ten different fluorescent proteins. For example, but not by way of limitation, a nucleic acid construct of the present disclosure encodes from about two to about nine different fluorescent proteins, about two to about eight different fluorescent proteins, about two to about seven different fluorescent proteins, about two to about six different fluorescent proteins, about two to about five different fluorescent proteins, about two to about four different fluorescent proteins or about two to about three different fluorescent proteins.
In certain embodiments, a nucleic acid construct encodes for two different fluorescent proteins, e.g., the nucleic acid construct includes a first nucleic acid segment encoding a first fluorescent protein and a second nucleic acid segment encoding a second fluorescent protein. In certain embodiments, a nucleic acid construct encodes for three different fluorescent proteins, e.g., the nucleic acid construct further includes a third nucleic acid segment encoding a third fluorescent protein. In certain embodiments, a nucleic acid construct encodes for four different fluorescent proteins, e.g., the nucleic acid construct further includes a fourth nucleic acid segment encoding a fourth fluorescent protein. In certain embodiments, a nucleic acid construct encodes for five different fluorescent proteins, e.g., the nucleic acid construct further includes a fifth nucleic acid segment encoding a fifth fluorescent protein. In certain embodiments, a nucleic acid construct encodes for six different fluorescent proteins, e.g., the nucleic acid construct further includes a sixth nucleic acid segment encoding a sixth fluorescent protein. In certain embodiments, a nucleic acid construct encodes for seven different fluorescent proteins, e.g., the nucleic acid construct further includes a seventh nucleic acid segment encoding a seventh fluorescent protein. In certain embodiments, a nucleic acid construct encodes for eight different fluorescent proteins, e.g., the nucleic acid construct further includes an eighth nucleic acid segment encoding an eighth fluorescent protein. In certain embodiments, a nucleic acid construct encodes for nine different fluorescent proteins, e.g., the nucleic acid construct further includes a ninth nucleic acid segment encoding a ninth fluorescent protein. In certain embodiments, a nucleic acid construct encodes for ten different fluorescent proteins, e.g., the nucleic acid construct further includes a tenth nucleic acid segment encoding a tenth fluorescent protein.
In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein and a second fluorescent protein. In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein, a second fluorescent protein and a third fluorescent protein. In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein, a second fluorescent protein, a third fluorescent protein and a fourth fluorescent protein. In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein, a second fluorescent protein, a third fluorescent protein, a fourth fluorescent protein and a fifth fluorescent protein. In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein, a second fluorescent protein, a third fluorescent protein, a fourth fluorescent protein, a fifth fluorescent protein and a sixth fluorescent protein. In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein, a second fluorescent protein, a third fluorescent protein, a fourth fluorescent protein, a fifth fluorescent protein, a sixth fluorescent protein and a seventh fluorescent protein. In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein, a second fluorescent protein, a third fluorescent protein, a fourth fluorescent protein, a fifth fluorescent protein, a sixth fluorescent protein, a seventh fluorescent protein and an eighth fluorescent protein. In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein, a second fluorescent protein, a third fluorescent protein, a fourth fluorescent protein, a fifth fluorescent protein, a sixth fluorescent protein, a seventh fluorescent protein, an eighth fluorescent protein and a ninth fluorescent protein. In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein, a second fluorescent protein, a third fluorescent protein, a fourth fluorescent protein, a fifth fluorescent protein, a sixth fluorescent protein, a seventh fluorescent protein, an eighth fluorescent protein, a ninth fluorescent protein and a tenth fluorescent protein.
Any fluorescent protein can be encoded by a nucleic acid construct of the present disclosure. In certain embodiments, a fluorescent protein encoded by a nucleic acid construct of the present disclosure can be a green fluorescent protein (GFP), a red fluorescent protein (RFP), a blue fluorescent protein (BFP), a cyan fluorescent protein (CFP), a yellow fluorescent protein (YFP), an orange fluorescent protein (OFP), a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein, a timer fluorescent protein and mutants or variants thereof. For example, but not by way of limitation, a GFP can be detected with an excitation range of about 485, e.g., 488, and an emission range of about 515, e.g., 525, an RFP can be detected with an excitation range of about 580, e.g., 594, and an emission range of about 610, e.g., 620, and a BFP can be detected with an excitation range of about 400, e.g., 405, and an emission range of about 425, e.g., 450. Additional not limiting examples of fluorescent proteins include sfGFP, deGFP, eGFP, Venus, mVenus, YFP, Cerulean, Citrine, CFP, eYFP, eCFP, mRFP, mCherry, mmCherry, mTurquoise2, mKO2, mTagBFP2 and mutants or variants thereof. Further non-limiting examples of fluorescent proteins are disclosed in WO 2007/142582, which are incorporated by reference herein in their entireties.
In certain embodiments, the fluorescent proteins encoded by the nucleic acid construct are the same. In certain embodiments, each of the fluorescent proteins encoded by the nucleic acid construct are different. For example, but not by way of limitation, each of the fluorescent proteins encoded by a nucleic acid construct of the present disclosure are dependently selected from the group consisting of a green fluorescent protein (GFP), a red fluorescent protein (RFP), a blue fluorescent protein (BFP), a cyan fluorescent protein (CFP), a yellow fluorescent protein (YFP), an orange fluorescent protein (OFP), a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein, a timer fluorescent protein and mutants or variants thereof. In certain embodiments, one of the fluorescent proteins can be a GFP and the other fluorescent protein can be an RFP, a BFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be an RFP and the other fluorescent protein can be a GFP, a BFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be an BFP and the other fluorescent protein can be a GFP, an RFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be an CFP and the other fluorescent protein can be a GFP, an RFP, a BFP, a YFP, an OFP, a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be an YFP and the other fluorescent protein can be a GFP, an RFP, a BFP, a CFP, an OFP, a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be an OFP and the other fluorescent protein can be a GFP, an RFP, a BFP, a YFP, an CFP, a far-red fluorescent protein, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be a far-red fluorescent protein and the other fluorescent protein can be a GFP, an RFP, a BFP, a CFP, a YFP, an OFP, a near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be a near-infrared fluorescent protein and the other fluorescent protein can be a GFP, an RFP, a BFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be a long stokes shift fluorescent protein and the other fluorescent protein can be a GFP, an RFP, a BFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, near-infrared fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be a photo-activatable fluorescent protein and the other fluorescent protein can be a GFP, an RFP, a BFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photoconvertible fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be a photoconvertible fluorescent protein and the other fluorescent protein can be a GFP, an RFP, a BFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoswitchable fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be a photoswitchable fluorescent protein and the other fluorescent protein can be a GFP, an RFP, a BFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein or a timer fluorescent protein. In certain embodiments, one of the fluorescent proteins can be a timer fluorescent protein and the other fluorescent protein can be a GFP, an RFP, a BFP, a CFP, a YFP, an OFP, a far-red fluorescent protein, near-infrared fluorescent protein, a long stokes shift fluorescent protein, a photo-activatable fluorescent protein, a photoconvertible fluorescent protein or a photoswitchable fluorescent protein.
In certain embodiments, each of the fluorescent proteins encoded by a nucleic acid construct of the present disclosure are dependently selected from the group consisting of sfGFP, deGFP, eGFP, Venus, mVenus, YFP, Cerulean, Citrine, CFP, eYFP, eCFP, mRFP, mCherry, mmCherry, mTurquoise2, mKO2, mTagBFP2 and mutants or variants thereof. For example, and not by way of limitation, the first fluorescent protein can be a GFP, e.g., eGFP and the second fluorescent protein can be a RFP, e.g., mCherry. See, for example,
In certain embodiments, the nucleic acid sequence of the fluorescent protein encoded by a nucleic construct of the present disclosure includes a sequence disclosed in Tables 6 and 7. In certain embodiments, the nucleic acid sequence of the fluorescent protein encoded by a nucleic construct of the present disclosure includes a sequence that is at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% homologous to a sequence disclosed in Tables 6 and/or 7. In certain embodiments, the DNA sequence of the fluorescent protein eGFP is provided in Table 6. In certain embodiments, the DNA sequence of the fluorescent protein mCherry is provided in Table 6. In certain embodiments, the DNA sequence of the fluorescent protein mTagBFP2 is provided in Table 6. In certain embodiments, the DNA sequence of the fluorescent protein mTurquoise is provided in Table 7. In certain embodiments, the DNA sequence of the fluorescent protein mVenus is provided in Table 7. In certain embodiments, the DNA sequence of the fluorescent protein mKO2 is provided in Table 7.
In certain embodiments, a nucleic acid of the present disclosure can include one or more stop codons, e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more or nine or more. In certain embodiments, a stop codon is located between the nucleic acid segments that encode the fluorescent proteins. See, for example,
In certain embodiments, a nucleic acid of the present disclosure can include one or more slippery sites, e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more or nine or more. In certain embodiments, a slippery site, or slippery sequence, is positioned upstream of the stop codon. In certain embodiments, a slippery site, or slippery sequence, is positioned between the nucleic acid segments encoding the fluorescent proteins, e.g., between the nucleic acid segment encoding the first fluorescent protein and the nucleic acid segment encoding the second fluorescent protein. A slippery site, when translated into mRNA (and also called a slippery site as mRNA) is a sequence where the compliment tRNA can sometimes shift at least one base pair after pairing with its anticodon, resulting in a change in the reading frame for subsequent translation. In certain embodiments, the slippery site is positioned upstream of the frameshift stimulatory sequence. In certain embodiments, the slippery sequence can include from about 5 to about 20 nucleotides, e.g., from about 5 to about 15 or from about 5 to about 10 nucleotides. In certain embodiments, the slippery sequence can include about 7 nucleotides. In certain embodiments, a slippery site can include the nucleic acid sequence disclosed in
In certain embodiments, a nucleic acid of the present disclosure can include one or more frameshift stimulatory sequences, e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more or nine or more. For example, but not by way of limitation, a frameshift stimulatory sequence can be positioned to increase the probability of a frameshift at the slippery site. Different frameshift stimulatory sequences produce different probabilities of frameshifting (see, e.g.,
In certain embodiments, a nucleic acid construct of the present disclosure includes a frameshift stimulatory sequence including a nucleic acid sequence disclosed in Table 1 and/or
In certain embodiments, a nucleic acid construct of the present disclosure can include a first nucleic acid sequence encoding a first fluorescent protein, a slippery site, a stop codon, a frameshift stimulatory sequence and a second nucleic acid encoding a second fluorescent protein. In certain embodiments, a nucleic acid construct of the present disclosure can include a first nucleic acid sequence encoding a first fluorescent protein, a first slippery site, a first stop codon, a first frameshift stimulatory sequence, a second nucleic acid encoding a second fluorescent protein, a second slippery site, a second stop codon, a second frameshift stimulatory sequence and a third nucleic acid encoding a third fluorescent protein. Additional non-limiting examples of nucleic acid constructs, including the arrangement of the various nucleic acid segments with the nucleic acid construct, are provided in Table 2. In certain embodiments, a nucleic acid construct of the present disclosure includes a nucleotide sequence disclosed in Table 1. In certain embodiments, a nucleic acid construct of the present disclosure includes a nucleotide sequence that is at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% homologous to a sequence disclosed in Table 1.
In certain embodiments, a nucleic acid construct of the present disclosure can include one or more linkers, e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more or nine or more.
The present disclosure further provides vectors and other nucleic acid molecules including the nucleic acid constructs disclosed herein. Suitable vectors include, but are not limited to, viral and non-viral vectors, plasmids, cosmids, phages, plasmids, and used for cloning, amplifying, expressing, transferring etc. of the nucleic acid sequence of the present disclosure in the appropriate target cell, e.g., yeast cell. In certain embodiments, to prepare the constructs, the partial or full-length nucleic acid construct is inserted into a vector typically by means of DNA ligase attachment to a cleaved restriction enzyme site in the vector. Alternatively, the desired nucleotide sequence can be inserted by homologous recombination in vivo, typically by attaching regions of homology to the vector on the flanks of the desired nucleotide sequence. Regions of homology are added by ligation of oligonucleotides, or by polymerase chain reaction using primers including both the region of homology and a portion of the desired nucleotide sequence, for example.
The present disclosure further provides expression cassettes or systems that can be used for the expression of the subject fluorescent proteins or for replication of the subject nucleic acid molecules. The expression cassette can exist as an extrachromosomal element or can be integrated into the genome of the cell as a result of introduction of the expression cassette into the cell. In the expression vector, a subject nucleic acid is operably linked to a regulatory sequence that can include promoters, enhancers, terminators, operators, repressors and inducers. For example, but not by way of limitation, the promoter can be for use in the cell transformed with the expression cassette, e.g., a yeast cell. Methods for preparing expression cassettes or systems capable of expressing the desired product are known for a person skilled in the art.
The present disclosure also relates to a nucleic acid construct library, consisting of multiple constructs as described above. In certain embodiments, each construct of the library can have nucleic acid segments, e.g., DNA segments, encoding a different frameshift stimulatory sequences or different combinations of frameshift stimulatory sequences, such that each construct causes cells transformed with the construct to express different ratios of fluorescent proteins. In certain embodiments, different constructs can also cause transformed cells to express different absolute amounts of the fluorescent proteins. Different nucleic acid constructs can cause the expression of different fluorescent proteins, or the same fluorescent proteins.
In certain embodiments, the nucleic acid construct library can include from about 2 to about 10,000 nucleic acid constructs. For example, by not by way of limitation, the nucleic acid construct library can include about 2 or more, about 5 or more about 10 or more, about 20 or more, about 30 or more, about 40 or more, about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 1,000 or more, about 5,000 or more about 10,000 or more nucleic acid constructs.
Cells for use in the present disclosure can be prokaryotic or eukaryotic cells. For example, but not by way of limitation, one or more nucleic acid constructs of the present disclosure can be introduced into a cell, e.g., a prokaryotic or eukaryotic cell, to generate a genetically-engineered cell.
In certain embodiments, a nucleic acid construct of the present disclosure can be introduced into a metazoan cell, a plant cell or a fungal cell. In certain embodiments, the cell can be a metazoan cell, e.g., mammalian cell. In certain embodiments, the cell can be a mammalian cell, e.g., a genetically engineered mammalian cell, e.g., a human cell or derived from a human cell. In certain embodiments, the cell can be a plant cell, e.g., a genetically engineered plant cell. In certain embodiments, the cell can be a fungal cell, e.g., a genetically engineered fungal cell.
In certain embodiments, the cell can be a genetically engineered fungal cell, e.g., a cell of Alternaria brasicicola, Arthrobotrys oligospora, Ashbya aceri, Ashbya gossypii, Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigate, Aspergillus kawachii, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Aspergillus ruber, Aspergillus terreus, Baudoinia compniacensis, Beauveria bassiana, Botryosphaeria parva, Botrytis cinereal, Candida albicans, Candida dubliniensis, Candida glabrata, Candida guilliermondii, Candida lusitaniae, Candida parapsilosis, Candida tenuis, Candida tropicalis, Capronia coronate, Capronia epimyces, Chaetomium globosum, Chaetomium thermophilum, Chryphonectria parasitica, Claviceps purpurea, Coccidioides immitis, Colletotrichum gloeosporioides, Coniosporium apollinis, Dactylellina haptotyla, Debaryomyces hansenii, Endocarpon pusillum, Eremothecium cymbalariae, Fusarium oxysporum, Fusarium pseudograminearum, Gaeumannomyces graminis, Geotrichum candidum, Gibberella fujikuroi, Gibberella moniliformis, Gibberella zeae, Glarea lozoyensis, Grosmannia clavigera, Kazachstania Africana, Kazachstania naganishii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces waltii, Komagataella pastoris, Kuraishia capsulate, Lachancea kluyveri, Lachancea thermotolerans, Lodderomyces elongisporus, Magnaporthe oryzae, Magnaporthe poae, Marssonina brunnea, Metarhizium acridum, Metarhizium anisopliae, Mycosphaerella graminicola, Mycosphaerella pini, Nectria haematococca, Neosartorya fischeri, Neurospora crassa, Neurospora tetrasperma, Ogataea parapolymorpha, Ophiostoma piceae, Paracoccidioides lutzii, Penicillium chrysogenum, Penicillium digitatum, Penicillium oxalicum, Penicillium roqueforti, Phaeosphaeria nodorum, Pichia sorbitophila, Podospora anserine, Pseudogymnoascus destructans, Pyrenophora teres f teres, Pyrenophora tritici-repentis, Saccharomyces bayanus, Saccharomyces castellii, Saccharomyces cerevisiae, Saccharomyces dairenensis, Saccharomyces mikatae, Saccharomyces paradoxis, Scheffersomyces stipites, Schizosaccharomyces japonicus, Schizosaccharomyces octosporus, Schizosaccharomyces pombe, Sclerotinia borealis, Sclerotinia sclerotiorum, Sordaria macrospora, Sporothrix schenckii, Tetrapisispora blattae, Tetrapisispora phaffii, Thielavia heterothallica, Togninia minima, Torulaspora delbrueckii, Trichoderma atroviridis, Trichoderma jecorina, Trichoderma vixens, Tuber melanosporum, Vanderwaltozyma polyspora 1, Vanderwaltozyma polyspora 2, Verticillium alfalfae, Verticillium dahliae, Wickerhamomyces ciferrii, Yarrowia hpolytica, Zygosaccharomyces bailii, Zygosaccharomyces rouxii and combinations thereof.
In certain embodiments, the cell can be a fungal cell, e.g., a genetically engineered fungal cell, of the phylum Ascomycota. In certain embodiments, the cell, e.g., a genetically engineered cell, can be a species selected from Saccharomyces cerevisiae, Saccharomyces castellii, Saccharomyces var boulardii, Vanderwaltozyma polyspora, Torulaspora delbrueckii, Saccharomyces kluyveri, Kluyveromyces lactis, Zygosaccharomyces rouxii, Zygosaccharomyces bailii, Candida glabrata, Ashbya gossypii, Scheffersomyces stipites, Komagataella (Pichia) pastoris, Candida (Pichia) guilliermondii, Candida parapsilosis, Candida auris, Yarrowia hpolytica, Candida (Clavispora) lusitaniae, Candida albicans, Candida tropicalis, Candida tenuis, Lodderomyces elongisporous, Geotrichum candidum, Baudoinia compniacensis, Schizosaccharomyces octosporus, Tuber melanosporum, Aspergillus oryzae, Schizosaccharomyces pombe, Aspergillus (Neosartorya) fischeri, Pseudogymnoascus destructans, Schizosaccharomyces japonicus, Paracoccidioides brasiliensis, Mycosphaerella graminicola, Penicillium chrysogenum, Aspergillus nidulans, Phaeosphaeria nodorum, Hypocrea jecorina, Botrytis cinereal, Beauvaria bassiana, Neurospora crassa, Sporothrix scheckii, Magnaporthe oryzea, Dactylellina haptotyla, Fusarium graminearum, and Capronia coronata. In certain embodiments, the one or more cell of the present disclosure is a yeast cell, e.g., Saccharomyces cerevisiae.
In certain embodiments, the present disclosure provides for genetically engineered cells including one or more nucleic acid constructs disclosed herein. For example, but not by way of limitation, a genetically engineered cell of the present disclosure can include two or more, three or more, four or more or five or more nucleic acid constructs. In certain embodiments, a genetically engineered cell of the present disclosure includes one nucleic acid construct. In certain embodiments, a genetically engineered cell of the present disclosure includes two nucleic acid constructs. In certain embodiments, a genetically engineered cell of the present disclosure includes three nucleic acid constructs. In certain embodiments, a genetically engineered cell of the present disclosure includes four nucleic acid constructs. In certain embodiments, a genetically engineered cell of the present disclosure includes five nucleic acid constructs. In certain embodiments, the two or more nucleic acid constructs can be different. Alternatively, the two or more nucleic acid constructs can be the same.
The cells to be used in the present disclosure can be genetically engineered using recombinant techniques known to those of ordinary skill in the art. Production and manipulation of the nucleic acid constructs described herein are within the skill in the art and can be carried out according to recombinant techniques described, for example, in Sambrook et al. 1989. Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Innis et al. (eds). 1995. PCR Strategies, Academic Press, Inc., San Diego. For example, but not by way of limitation, a cell, e.g., a yeast cell, can be genetically engineered to include one or more nucleic acid constructs of the present disclosure.
One or more endogenous genes of the genetically modified cells can be knocked out by a genetic engineering system. Various genetic engineering systems known in the art can be used. Non-limiting examples of such systems include the Clustered regularly-interspaced short palindromic repeats (CRISPR)/Cas system, the zinc-finger nuclease (ZFN) system, the transcription activator-like effector nuclease (TALEN) system, use of yeast endogenous homologous recombination and the use of interfering RNAs.
In certain embodiments, nucleic acid constructs of the present disclosure can be introduced into the yeast cell either as a construct or a plasmid. In certain embodiments, a nucleic acid can include one or more regulatory regions such as promoters, transcription factor binding sites, operators, activator binding sites, repressor binding sites, enhancers, protein-protein binding domains, RNA binding domains, DNA binding domains, and other control elements known to a person skilled in the art. For example, but not by way of limitation, a nucleic acid construct of the present disclosure can be introduced into the yeast cell either as a construct or a plasmid in which it is operably linked to a promoter active in the yeast cell or such that it is inserted into the yeast cell genome at a location where it is operably linked to a suitable promoter.
Non-limiting examples of suitable yeast promoters for inclusion in the nucleic acid constructs of the present disclosure include, but are not limited to, constitutive promoters pTef1, pPgk1, pCyc1, pAdh1, pKex1, pTdh3, pTpi1, pPyk1 and pHxt7 and inducible promoters pGal1, pCup1, pMet15, pFig1 and pFus1, GAP, P GCW14 and variants thereof. In certain embodiments, a variant of Tef1 is scTef1. In certain embodiments, the sequence of the promoter can include a nucleic acid sequence disclosed in Table 6. For example, but not by way of limitation, a nucleic acid construct of the present disclosure can include a constitutively active promoter, e.g., pTdh3, located upstream of the nucleic acid segment encoding the first fluorescent protein (see, e.g., Table 2). In certain embodiments, a nucleic acid construct can include an inducible promoter, e.g., pFus1 or pFig1, located upstream of the nucleic acid encoding the first fluorescent protein. In certain embodiments, a nucleic acid construct can include a constitutively active promoter, e.g., pAdh1, located 5′ to the nucleic acid encoding the first fluorescent protein.
In certain embodiments, nucleic acid constructs of the present disclosure can be inserted into the genome of the cell, e.g., yeast cell. In certain embodiments, one or more nucleic acid constructs can be inserted into the genome of the cell, e.g., yeast cell. In certain embodiments, two or more nucleic acid constructs can be inserted into the genome of the cell, e.g., yeast cell. In certain embodiments, three or more nucleic acid constructs can be inserted into the genome of the cell, e.g., yeast cell. In certain embodiments, four or more nucleic acid constructs can be inserted into the genome of the cell, e.g., yeast cell. In certain embodiments, five or more nucleic acid constructs can be inserted into the genome of the cell, e.g., yeast cell. For example, but not by way of limitation, one or more nucleic acid constructs of the present disclosure, e.g., can be inserted into the Ste2, Ste3 and/or HO locus of the cell. In certain embodiments, one or more nucleic acid constructs of the present disclosure can be inserted into the LEU2 locus of the cell. In certain embodiments, the one or more nucleic acids can be inserted into one or more loci that minimally affects the cell, e.g., in an intergenic locus or a gene that is not essential and/or does not affect growth, proliferation and cell signaling.
In certain embodiments, expression of a nucleic acid construct of the present disclosure in a cell results in the differential expression of the two or more fluorescent proteins. For example, but not by way of limitation, expression of a nucleic acid construct of the present disclosure encoding two different fluorescent proteins in a cell can result in the differential expression of the two or more fluorescent proteins. In certain embodiments, the genetically-engineered cell can express the first fluorescent protein and the second fluorescent protein in a ratio. For example, but not by way of limitation, the first fluorescent protein is expressed at a ratio of about 1,000:1 to about 1:1,000, e.g., from about 900:1 to about 1:900, from about 800:1 to about 1:800, from about 700:1 to about 1:700, from about 600:1 to about 1:600, from about 500:1 to about 1:500, from about 400:1 to about 1:400, from about 300:1 to about 1:300, from about 200:1 to about 1:200, from about 100:1 to about 1:100, from about 90:1 to about 1:90, from about 80:1 to about 1:80, from about 70:1 to about 1:70, from about 60:1 to about 1:60, from about 50:1 to about 1:50, from about 40:1 to about 1:40, from about 30:1 to about 1:30, from about 20:1 to about 1:20, from about 10:1 to about 1:10, from about 10:1 to about 1:100, from about 10:1 to about 1:50, from about 50:1 to about 1:100 or from about 100:1 to about 1:500 of the second fluorescent protein (see, e.g.,
The present disclosure also provides a cell library. In certain embodiments, a cell library of the present disclosure includes a population of cells transformed with a number of different constructs as described above. In certain embodiments, the population of cells in a cell library will express a variety of different ratios of fluorescent proteins.
In certain embodiments, the present disclosure provides a population of cells that includes one or more cells that contain one or more nucleic acid constructs disclosed herein. In certain embodiments, the cell population includes one cell type. In certain embodiments, the cell population includes one or more cell types, e.g., two or more cell types, three or more cell types, four or more cell types, five or more cell types or six or more cell types. In certain embodiment, each cell type includes a different nucleic acid construct. For example, but not by way of limitation, the present disclosure provides a cell population that include one cell type or cell that include a first nucleic acid construct. In certain embodiments, the cell population further includes a second cell type or cell that includes a second nucleic acid construct. In certain embodiments, the first nucleic acid construct and the second nucleic acid construct are different, e.g., include different frameshift modulatory sequences.
In certain embodiments, one or more genetically engineered cells of the present disclosure can be culture in a media that has a reduction in the amount and/or level of compounds, chemicals, nutrients and/or components that are photosensitive.
The present disclosure further provides methods for using the nucleic acid constructs and/or the cells including the disclosed nucleic acid constructs. For example, but not by way of limitation, nucleic acid constructs of the present disclosure can be used to label cells, e.g., to distinguish between two or more cells within a population of cells. In certain embodiments, the cell population includes bacterial cells. In certain embodiments, the cell population includes fungal, e.g., yeast, cells. In certain embodiments, the cell population includes mammalian cells.
In certain embodiments, the present disclosure provides methods for labeling cells. In certain embodiments, the method can include introducing one or more nucleic acid constructs disclosed herein into the cell. In certain embodiments, the method can further include analyzing the ratio of fluorescent between the fluorescent proteins encoded by the nucleic acid construct.
In certain embodiments, the present disclosure further provides methods for distinguishing between two or more cells within a population of cells. For example, but not by way of limitation, a method of the present disclosure includes introducing one or more disclosed nucleic constructs that encode two or more fluorescent proteins into a cell to generate a genetically engineered cell. In certain embodiments, the method can further include determining the expression level of the two or more fluorescent proteins into the cell, e.g., the expression level of the first fluorescent protein and the second fluorescent protein. In certain embodiments, the method can further include comparing the expression levels of the two or more fluorescent proteins into the cell, e.g., the expression level of the first fluorescent protein and the second fluorescent protein, to determine the ratio of the expression level of the first fluorescent protein and the second fluorescent protein. In certain embodiments, the method can further include identifying the cells with a particular ratio of the first fluorescent protein expression level to the expression level of the second fluorescent protein. In certain embodiments, the method can further include determining the expression level of a third, fourth, fifth, sixth, seventh, eighth, night or tenth fluorescent protein and comparing it to the expression level of a different fluorescent protein expressed in the cell. In certain embodiments, the genetically engineered cell expresses the first fluorescent protein and the second fluorescent protein in a ratio that allows it to be distinguished from other cells within the cell population, e.g., cells that express the first fluorescent protein and the second fluorescent protein in a different ratio. The ratio at which the two different fluorescent proteins will be expressed depends on the nucleic acid construct that is present within the cell and such cells can be identified based on this ratio.
In certain embodiments, the present disclosure further provides methods for labeling cell free extracts.
In certain embodiments, the expression level of the fluorescent proteins can be detected by any technique known in the art. In certain embodiments, the expression level can be determined by flow cytometry. In certain embodiments, the expression level can be determined by fluorescence microscopy.
In certain embodiments, the nucleic acid constructs can be used to track cells with a mixed cell population, e.g., a cell population of different cell types. For example, but not by way of limitation, the nucleic acid constructs can be used to characterize a population of cells over time. In certain embodiments, one type of cell within the mixed cell population can include one nucleic acid construct and a different type of cell within the mixed population of cells can include a different nucleic acid construct. In certain embodiments, the mixed population of cells can be monitored over time and identified by the expression of the nucleic acid constructs, e.g., by analyzing the ratio of the fluorescent proteins expressed within the various cells within the mixed population.
In certain embodiments, the method for distinguishing between two or more cells within a population of cells can be performed by a computer that has at least a processor and at least a memory the processor can access. In certain embodiments, the method includes collecting the fluorescence data of the first fluorescent protein, which is a function of the number of cells and the intensity of that fluorescence. In certain embodiments, the method can further include collecting the fluorescence data of the second fluorescent protein, which is a function of the number of cells and the intensity of that fluorescence. In certain embodiments, the method can include collecting the sum fluorescence data, which is a function of the number of cells and the sum of the first and second proteins' fluorescence. In certain embodiments, the method can include collecting the ratio fluorescence data, which is a function of the number of cells and the ratio of the first protein's fluorescence to the second protein's fluorescence. In certain embodiments, the method includes creating a set of graph bisections that will be used to bisect each of the graphs. The set of graph bisections identifies the location of the bisection, where the location can be identified as a local minimum. In certain embodiments, the set of graph bisections can identify more than one bisection location in a graph. In certain embodiments, the set of graph bisections can be specific to a set of constructs. In certain embodiments, the bisection divides the graph into two equal halves. Alternatively, the bisection divides the graph into two unequal halves. A person having ordinary skill in the art will realize that one half, in this context, means one of the two portions of the graph created when the graph is divided by the bisection. In certain embodiments, the method also includes bisecting a graph of the first protein fluorescence on one axis and the number of cells on the second axis according to the set of graph bisections, where half of the bisected data is temporarily discarded, while the other half is retained. In certain embodiments, the method also includes bisecting a graph of the second protein fluorescence on one axis and the number of cells on the second axis to the set of graph bisections, where half of the bisected data is temporarily discarded, while the other half is retained. In certain embodiments, the method includes bisecting a graph of the sum of the first protein fluorescence and the second protein fluorescence on one axis and the number of cells on the second axis to the set of graph bisections, where half of the bisected data is temporarily discarded, while the other half is retained. In certain embodiments, the method also includes bisecting a graph of the ratio of the first protein's fluorescence to the second protein's fluorescence on one axis and the number of cells on the second axis to the set of graph bisections, where half of the bisected data is temporarily discarded, while the other half is retained. The graphs are bisected as described above until all bisections in the set of bisections are performed. This results in only a single peak in each graph, representing a population of cells with the same first fluorescent protein expression and the same second fluorescent protein expression. A computer can be used to execute some of these steps, or all of these steps.
The present disclosure further provides kits for generating the genetically engineered cells described herein. For example, a kit of the present disclosure includes one or more nucleic acid constructs described herein, e.g., to generate a genetically engineered cell.
In certain embodiments, a kit of the present disclosure includes a container including one or more nucleic acid constructs. In certain embodiments, the nucleic acid construct includes a first nucleic acid segment encoding a first fluorescent protein, a slippery site, a stop codon, a frameshift stimulatory sequence and a second nucleic acid segment encoding a second fluorescent protein. Non-limiting examples of nucleic acid constructs is provided in Table 2. In certain embodiments, the kit can further include a second container containing one or more cells that can be transformed with the nucleic acid constructs provided in the first container.
In certain embodiments, a kit of the present disclosure can include a container including at least one or more genetically-engineered cells described herein. In certain embodiments, the one or more genetically-engineered cells include one or more nucleic acid constructs. In certain embodiments, a nucleic acid construct of the present disclosure encodes a first fluorescent protein and a second fluorescent protein.
The presently disclosed subject matter will be better understood by reference to the following Examples, which are provided as exemplary of the presently disclosed subject matter, and not by way of limitation.
Recognizing the limitations of the prior art, a genetically encoded fluorescent cell barcoding technology that preserves all of the advantages of fluorescent proteins (FPs) while also delivering a large set of robust, unique and well-defined tags was established. Moreover, this was achieved by using a minimal number of fluorescence channels. To this end one embodiment developed was a palette of ratiometric fluorescent barcodes, referred to as FRAME-tags (Frameshift-controlled RAtiometric Multi-fluorescent protein Expression tags). FRAME-tags are distinguished based on absolute FP expression ratios directly encoded in their mRNAs as seen in
The FRAME-tag is a scalable palette of genetically encoded barcodes that achieves 20+ resolvable cell markers using two or more FPs. FRAME-tags can be a nucleic acid, e.g., DNA, construct and encode single-mRNA constructs that leverage custom ribosomal frameshifting RNA modules (frameshift modules, or frameshift motifs) to precisely control FP synthesis ratios leading to narrow fluorescence distributions that are robust to biological noise. This allows FP ratios to be used as the barcode signal for cell tracking. FRAME-tags can be used to accurately identify cells in high throughput using both flow cytometry and fluorescence microscopy.
The present disclosure uses a co-translational mechanism that can precisely regulate FP synthesis ratios from a single mRNA. In particular, a −1 programmed ribosomal frameshifting (—1 PRF) was identified as a mechanism to encode FP stoichiometry since it uses self-contained RNA elements, is active in a wide variety of organisms, and can be tuned by the choice of frameshift stimulatory RNA signals (also called a frameshift stimulator or stimulatory motif). Previously, a large collection of −1 PRF signals that possess frameshifting efficiencies spanning two orders of magnitude in yeast (0.2% to 30%) was reported. In this example, discrete frameshift modules (fs) were designed that incorporate these −1 PRF frameshift stimulatory signals for modular assembly of a FRAME-tag palette (
Frameshift module architecture and predicted frameshift stimulatory signals are shown in
Frameshift Vs) modules are designed to control the stoichiometry of upstream and downstream open reading frames (FP-1 and FP-2) via −1 PRF (
While FRAME-tags use fs modules to control the expression ratio of two fluorescent proteins, the same construct architecture shown in
FRAME-tags can be used to track mixed cell populations over time, allowing for characterization of population-wide rates of change in phenotype and composition. Recently, DNA recording systems have been developed to track cell lineage and expression intensity. The limit on time-resolution for FRAME-tag data is dictated only by the rate of fluorescence capture, and acquired data is relevant at both the population and single cell scale. Furthermore, time-resolved data is obtained directly from samples without any further manipulations or reagents, whereas sequencing-based methods require multiple labor- and reagent-intensive steps that delay data recovery. Because of this fast acquisition time, FRAME-tags enable rapid experimental iteration and open the door to continuous monitoring using automated flow cytometry and microscopy.
Extrapolating from the FRAME-tags (FTs) that were constructed and tested empirically, the expected number of resolvable FT variants in three-color space can be predicted (
As shown in
While the raw cytometry data generated by flow cytometry or microscopy using FRAME-tagged cells (FTs) can be analyzed manually using available software, this process is tedious for samples that include many FT populations and, as with any manually analyzed cytometry data, it is subjective. Therefore, to simplify analysis of FTs and to remove user bias, a method implemented was designed as a front end for the existing suite of automated flow cytometry processing functions collected under the R package openCyto. Thus, this package runs on a computer and identifies different FT populations based on their particular FRAME-tag. The computer has both a processor and memory that is accessible to the processor. The method can be loaded into memory. The processor and memory can be in communication with the flow cytometer or the fluorescence microscope. The communication can be wireless or wired.
The existing openCyto pipeline enables automated gating of cytometry data based on a user-defined input file (the “Gating Template”) that defines a gating hierarchy and the corresponding automatic gating functions to use at each level of the hierarchy. The instant method builds on this pipeline in three ways: (1) it dynamically generates the correct “Gating Template” based on a much simpler input file that need only list the FTs present in the sample; (2) it automatically pre-processes the raw data to generate two derived parameters used in gating (RFP/GFP ratio and RFP+GFP total fluorescence); and (3) it includes an automatic gating function that simplifies valley-specific bisection of 1-dimensional histograms with multiple sharp peaks and valleys characteristic of the FT populations.
This method (
This method also enables robust and efficient assignment of FT indices to each event even for high throughput and real-time experiments that can generate hundreds of individual data files. This method can leverage the consistent cluster structure of FTs. This cluster structure can be completely predetermined based on the known FTs in the sample and therefore efficiently traversed computationally. However, this method can still be applied to a cluster structure de novo.
FRAME-tags efficiently minimize the number of fluorescent channels that are required for barcode identification, thus allowing other orthogonal fluorescent reporters to be used alongside FRAME-tags. These reporters can be analyzed in multiplex through FRAME-tag-indexed deconvolution of the reporters' bulk fluorescent signals. Using a promoter driven orthogonal FP, expression from 20 yeast promoters across 21 experimental conditions in multiplex were profiled using FRAME-tags as promoter identifiers. Beyond promoter activity, FRAME-tags could also be used to multiplex other fluorescent reporters such as those used for detection of calcium levels, phosphorylation state and receptor signaling. FRAME-tags do not suffer signal dilution over time. Therefore, in conjunction with other fluorescent reporters, FRAME-tags can be applicable to various multiplexed phenotypic screens including microbial expression profiling, cell state reporters, and drug screening.
As developed here, FRAME-tags can be useful for wide range of applications since they are modular, scalable, and can be conveniently characterized with widely accessible instruments. This current FRAME-tag palette can be immediately used in yeast for basic biology and biotechnology. In addition, it can be possible to develop FRAME-tags for bacteria and mammalian cells, as −1 PRF naturally occurs in these cell types as well. It can also be possible to develop FRAME-tags for any other eukaryotic or prokaryotic cell, including fungal or plant cells. As basic biology tools, FRAME-tags can find use for investigating microbiome dynamics and pathogen engraftment, or for lineage tracing in developing organisms and tumors. Furthermore, as synthetic biology tools, FRAME-tags could be used in multicellular community engineering, distributed metabolic engineering, and biosensor arrays. With the aid of emerging genome-engineering technologies, automated cytometry, and time-lapse imaging, FRAME-tags and variants can find extensive use in the broader scientific community for high throughput, real-time, multicellular tracking.
Finally, FRAME-tags can be used to generate phenotypic cell libraries, for example cell libraries for new strains (
The scalability limit of FP-based cell markers was overcome by harnessing ribosomal frameshifting to precisely encode non-overlapping FP expression ratios. With this approach, a total of 20 genetically encoded FRAME-tags were constructed using just two FPs and demonstrated the potential to scale to 100 tags with just three FPs. Importantly, this approach achieves scalability purely based on fluorescence signals. Three-FP FRAME-tags can be scaled further to potentially 1,000 tags using combinations of five currently available resolvable FP variants (5 choose 3 FP combinations×100 FRAME-tag designs). Furthermore, integrating FRAME-tags with spatial information, such as subcellular localization, could scale the palette exponentially.
To demonstrate their applicability, FRAME-tags were used to simultaneously track different sub-populations of cells in real-time and to perform multiplexed expression profiling in synthetic yeast communities. The scalability of the palette to potentially 100 FRAME-tags was established by simply including a third FP. This technology overcomes the FP multiplexing limit imposed by spectral overlap and enables straightforward tracking of complex cellular systems using widely available fluorescence techniques.
A diverse yeast community was also tracked in real time by exploiting rapid fluorescence data acquisition, which allowed the visualization of dynamic growth trajectories for all sub-populations simultaneously.
Polymerases, restriction enzymes and Gibson assembly mix were obtained from New England Biolabs (NEB) (Ipswich, Mass., USA). Media components were obtained from BD Bioscience (Franklin Lakes, N.J., USA) and Sigma Aldrich (St. Luis, Mo., USA). Oligonucleotides and synthetic DNA constructs were purchased from Integrated DNA Technologies (IDT) (Coralville, Iowa, USA). Plasmids were cloned and amplified in E. coli strain TG1 (Lucigen, Madison, Wis., USA) or C3040 (NEB). Human urine (Catalog No: IR100007P) was purchased from Innovative Research (Novi, Mich., USA). All other commercial chemical reagents were obtained from Sigma Aldrich. Bulk optical density and fluorescence measurements were made using an Infinite M200 plate reader (Tecan).
Overlap between mCherry fluorescence distributions (normalized to side scatter) for frameshift (fs) modules depicted in
Frameshift Stimulatory Signal Structure Prediction.
Plasmid Cloning and Genomic Integration in Yeast.
All yeast strains were derived from parental strains Fy251 [American Type Culture Collection (ATCC) 96098] or the two-hybrid strain MaV203 (Invitrogen) (Vidal, M. et al., Proc. Natl. Acad. Sci. 93, 10321-10326 (1996)). Yeast transformations were carried out using the lithium acetate method (Gietz, R. D. & Schiestl, R. H., Nat. Protoc. 2, 31-34 (2007)). All plasmids are derivatives of the pRS series of shuttle plasmids, cloned using standard molecular biology protocols, yeast gap repair and Gibson assembly. Endogenous yeast promoters were obtained by PCR from genomic DNA of strain Fy251. Genomic integration in yeast was done by homologous recombination of linearized DNA constructs with homology arms and a selectable marker. See Table 3 for a list of all strains used in this work. See Table 4 for a list of plasmids used in this work. See Table 5 for a list of primers used to clone endogenous promoters. See Table 6 for a list of DNA parts used to construct all FRAME-tags. FRAME-tag integration plasmids will be made available for distribution on Addgene.
FRAME-Tag DNA Constructs and Strains.
The yEGFP DNA sequence and mCherry DNA sequence were amplified from a previously constructed plasmid (Anzalone, A. V. et al., Nat. Methods 13, 453-458 (2016)). mTagBFP2 (Subach, O. M. et al., PLoS ONE 6, e28674 (2011)), mKO2 (Sakaue-Sawano, A. et al., Cell 132, 487-498 (2008)), mTurquoise2 (Goedhart, J. et al., Nat. Commun. 3, ncomms1738 (2012)), and mVenus (Nagai, T. et al., Nat. Biotechnol. 20, 87-90 (2002)), were obtained as synthetic DNA fragments that were codon optimized for S. cerevisiae with the IDT codon optimization tool (Integrated DNA Technologies) and the JCat Codon Adaptation tool (see Table 7) (Grote, A. et al., Nucleic Acids Res. 33, W526-W531 (2005)). A parent dual FP integration construct was derived from the pNH600 series of vectors (Zalatan, J. G. et al., Science 337, 1218-1222 (2012)), which harbor integration constructs containing a multiple cloning site, an ADH1 terminator from Candida albicans, selectable auxotrophic markers from Candida glabrata, and flanking 500 bp homology regions to the target locus (pNH605: LEU2). Full integration constructs were cloned into a pRS416 backbone to allow comparison of plasmid-borne and genome-integrated constructs from the same vector. −1 PRF sequences were amplified as a DNA library from the previously reported in vitro selection products and cloned into the parent dual FP integration vector by gap repair in the yeast strain Fy251 (Anzalone, A. V. et al., Nat. Methods 13, 453-458 (2016)). Individual clones were isolated by selection on -Ura and the ratios of yEGFP and mCherry fluorescence were assayed in 96-well plates using an Infinite M200 plate reader (Tecan). Plasmid variants representing a range of fluorescence ratios were sequenced, then linearized and integrated into the LEU2 locus of a fresh Fy251 strain. Transformants were selected on SC (glucose, -Leu) plates, and proper integration was confirmed by sequencing of locus-specific PCR amplified DNA. The expanded palette of dual-FP FRAME-tags was generated by individually constructing combinations of the 5 chosen frameshift modules at early and late positions, with two fluorescent proteins (Table 2). Vectors were linearized and integrated independently into Fy251, the resulting strains were pre-cultured as above and characterized by flow cytometry. Third fluorescent proteins were screened for compatibility by cloning into a galactose inducible construct (pRS416-Gal1). Sequence verified plasmids were transformed into green-red FRAME-tagged yeast strains and grown in SC (2% glucose, -Ura) or SC (2% galactose, 2% raffinose, -Ura) media. The contribution of the third fluorescent protein on both GFP and mCherry signals was evaluated by pre-culturing the strains as above and characterizing the fluorescence by flow cytometry (
Selected fs modules were inserted between yEGFP and mCherry, then chromosomally integrated into yeast; mCherry fluorescence was evaluated by flow cytometry and normalized by side scatter; values above distributions indicate frameshift efficiency determined by comparison of mCherry/yEGFP ratios with the 100% yEGFP-mCherry fusion (see
To begin constructing the FRAME-tag palette, several fs modules were screened in a yeast dual-FP reporter (
A set of five modules were identified with highly resolved mCherry (a fluorescent protein) fluorescence distributions, which displayed less than 1% overlap between adjacent populations (
A two-FP FRAME-tag construct was designed wherein each FP is paired with a single upstream fs module (
The consistency of these fs modules allowed the generation of a palette of 20 unique FRAME-tags in yeast that were well resolved by flow cytometry and microscopy using only two FPs, though more can be used (
It was also found that this initial FRAME-tag series could be expanded to a third color dimension by the introduction of one additional FP variant. After screening several FPs, it was determined that the blue mTagBFP2 (Subach, O. M. et al., PLoS ONE 6, e28674 (2011)) is compatible with yEGFP and mCherry fluorescence channels (
To establish scalability, three additional two-FP FRAME-tags were generated containing mTagBFP2, and a FRAME-tag construct that expresses all three FPs regulated was designated by upstream fs modules. The latter design was validated by the construction of two additional FRAME-tags (
Based on these results demonstrating consistently narrow distributions of both two-color and three-color FRAME-tag populations, it is estimated that up to 100 unique FRAME-tags can fit within this three-color FP space (as discussed above).
CAACAACGCGTTAAACCCACTAGAAGGCGGTT
To streamline data analysis for FRAME-tag applications, a method based on the R package openCyto that exploits the characteristically narrow FRAME-tag population distributions (
The statistical analysis of the method revealed gate positive predictive values (PPV) ranging from 0.99 to >0.9999 (mean gate PPV of 0.9987) at a cell detection sensitivity level of 90% (
Extrapolation of these data predicts that a large majority of FRAME-tagged strains could be detected with a PPV of greater than 0.9 for dilutions down to as low as 1 in >103 while maintaining a cell detection rate of 50% (
Characterization of the FY251-based FRAME-tag strains including the multiplex transcriptional profiling was performed on a LSR II (Becton Dickinson) using the following laser/filter sets: 488/525 for yEGFP; 594/620 for mCherry; 405/450 for mTagBFP2. For standard analysis, FRAME-tagged strains were individually pre-cultured overnight in 96-well plates in standard synthetic dropout media (2% glucose) at 30° C. and 800 RPM, then inoculated at an OD600 of 0.1 into fresh medium as individual strains or mixtures and grown for a further 10 hours. Cells were harvested by centrifugation, kept as pellets on ice, and analyzed within two hours. High throughput characterization of the MaV203-based FRAME-tag strains, including construction and real-time tracking of the yeast community, was performed on an LSR Fortessa (Becton Dickinson) using the following laser/filter sets: 488/530 for yEGFP; 561/610 for mCherry. Individual strains or mixtures of strains were cultured as described in flat-bottom 96-well plates and directly analyzed on the flow cytometer using a High Throughput Sampler (HTS, Becton Dickinson) in standard mode. All fluorescence signals were normalized by side scatter as a proxy for cell size and reported as arbitrary normalized fluorescence units scaled by 100,000 (Zuleta, I. A. et al., Nat. Methods 11, 443-448 (2014)). Automated gating and data analysis was carried out using the method based on the R package openCyto (see the method described above).
FRAME-tagged strains were grown as described above. The mixtures of FRAME-tag strains were imaged on standard microscope slides with coverslips using a Ti-E microscope with Perfect Focus System (Nikon), a CFI Plan Apochromat Lambda 20X objective and a Zyla sCMOS camera (Andor). Excitation/emission (nm) sets used were: 470/525 for yEGFP; 555/620 for mCherry. For each experiment, 10-15 fields were automatically collected representing 8,000 to 12,000 cells. Bright field and fluorescence images were sectioned with FIJI using a custom script to extract average fluorescence values of individual cells (Schindelin, J. et al., Nat. Methods 9, 676 (2012)). The resulting data was input into the automated FRAME-tag gating and analysis software in R (see above) to index each cell with its respective FRAME-tag identity. These indices were used in FIJI to colorize the original bright filed images using the ROI Color Coder (Ferreira, T. et al., Zenodo (2015). doi:10.5281/zenodo.28838).
Fluorescence microscopy can be used to characterize FRAME-tags. Using two-color microscopy, samples of 104 cells were imaged and fluorescence intensity values determined for each cell by image segmentation (
This is shown with 8 FRAME-tags in
A complex yeast library was constructed using the streamlined method that gives FRAME-tag indexed phenotypes with a minimal number of transformations (
This yeast community was designed based on the MaV203 background strain, whose growth phenotype in the presence of varying concentrations of 5-FOA, histidine and 3-AT can be tuned based on Gal4 induction strength (
After establishing the fluorescent barcode palette and efficient analytical tools, FRAME-tags were applied for long-term, continuous tracking of cell populations composed of multiple distinct cell types. First, a streamlined workflow was formulated for introducing FRAME-tags into new host yeast strains (
The composition of this synthetic community was tracked in various conditions using flow cytometry-based FRAME-tag identification (
where Xs is the mapped integer value for Ss and Ps is the measured population fraction of strains. PDI takes values between −4 and 4. The results of 216 growth conditions plotted as a heatmap of PDI are shown in
An assessment was made if FRAME-tags would be useful for tracking subpopulation dynamics over time. To test this, an abrupt transition of the community between different culture conditions was made, and changes in strain abundance measured. This provided a detailed readout of subpopulation growth trajectories in real-time (
Native yeast promoters were cloned upstream of an mTagBFP2 expression construct within a pRS416 plasmid backbone (see Table 5 and Table 8). Sequence confirmed reporter plasmids were then transformed into separate FRAME-tagged Fy251 strains. Strains were individually pre-cultured overnight in 96-well plates in standard synthetic dropout media (2% glucose) at 30° C. and 800 RPM. Culture density was measured using the OD600, and strains were combined to yield a mixed culture containing an equal proportion of all reporter-FRAME-tag strains. The reporter strain mixture was inoculated in fresh medium to an Moo of 0.1, grown for 10 hours until reaching an OD600 of 2.7, and then inoculated into 96-well plates containing the appropriate media condition (see
where MFIprom.j.treat.k is the MFI of the jth promoter in the kth treatment. The expression fold-change for each sample was calculated as follows:
log2(MFI fold change)=log2(nMFIprom.j.treat.k)−log2(nMFIprom.j.control)
where nMFIprom.j.control is the normalized MFI of the jth promoter in the control treatment of standard synthetic dropout medium (2% glucose) at 30° C.
Another feature of FRAME-tags is their compatibility with additional fluorescent reporters. Therefore, strain identification coupled with fluorescent phenotypic reporting within a mixed cell population was explored. To demonstrate this multiplexed reporting capability, a reporter system based on the orthogonal mTagBFP2 was combined with the palette of green-red FRAME-tags. 20 yeast promoters were selected, including 18 environmentally sensitive genes and two housekeeping genes, and cloned these upstream of mTagBFP2 (see strains in Table 3). Each reporter construct was then transformed into one of the 20 green-red FRAME-tagged strains (
Transcriptional responses were analyzed from each cell type in multiplex by deconvolution of the sample's bulk blue fluorescence signal using FRAME-tag identities (
This analysis yielded histograms corresponding to the activation profile of individual promoters as well as information on cell type abundance (
This confirmed many known yeast transcriptional responses (
tctagaaa
ctagaaa
Live-Cell Visualization of Protein Phosphorylation. Chem. Biol. 21, 186-197 (2014).
Although the present disclosure and its advantages have been described in detail, it should be understood that various changes, substitutions and alternations can be made herein without departing from the spirit and scope of the disclosure as defined by the following claims.
This application is a continuation of International Patent Application No. PCT/US2019/066634, filed Dec. 16, 2019, which claims priority to U.S. Provisional Application No. 62/779,993, filed on Dec. 14, 2018, the contents of each of which are hereby incorporated by reference in their entireties, and to each which priority is claimed.
This invention was made with government support under AI110794 and CA174357 awarded by the National Institutes of Health and 1144155 awarded by the National Science Foundation. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62779993 | Dec 2018 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2019/066634 | Dec 2019 | US |
| Child | 17347285 | US |