Genetically engineered transmissible hypovirulence

BACKGROUND OF THE INVENTION
Fungi remain a medically, industrially and agriculturally important group of organisms. Opportunistic pathogens such as Candida albicans and Aspergillus fumigatus can cause serious infections in humans. Recent increases in the incidence of infection of immunocomprised individuals by fungal pathogens has stimulated efforts to develop more effective antifungal therapeutic agents. There is a long history of the use of fungi in the food industry and for the production of biologicals, organic acids and pharmaceutical intermediates. The ability to genetically alter yeast and filamentous fungi by DNA-mediated transformation has considerably increased their industrial potential. Despite impressive progress in the development of chemical fungicides for agricultural application, yield losses due to plant pathogenic fungi remains a significant problem worldwide. The wide spread use of chemical fungicides is also complicated by the persistent development of acquired resistance and by a negative environmental impact.
Few plant disease epidemics have received as much attention or generated as much consternation as the chestnut blight epidemic that occurred in North America and Europe early this century as a result of the unintentional introduction of the Asian fungus, Cryphonectria (Endothia) parasitica. Contributing factors include the magnitude of the disease, e.g., an estimated 3.5 billion trees were destroyed in the North American eastern hardwood forest by 1950; the aesthetic, ecological and economic value of the host; and the total inability to devise effect control measures (Anagnostakis, 1982; Roane et al., 1986; Griffin 1986; MacDonald and Fulbright 1991). Consequently reports in the 1960's and 1970's of natural and artificial biological control of chestnut blight due to the phenomenon of "transmissible hypovirulence" generated considerable interest (Grente, 1965; Grente and Berthelay-Sauret, 1978; Van Alfen et al., 1975). Natural variants of C. parasitica that exhibited reduced levels of virulence (hypovirulent) were first discovered in Italy and were later identified in different geographic locations in Europe and North America (Grente and Berthelay-Sauret, 1978; Anagnostakis, 1982; MacDonald and Fulbright, 1991). While virulent C. parasitica strains penetrate and destroy bark and cambium layers causing wilting and death, hypoviolent strains usually produce superficial cankers that eventually heal as a result of host defense mechanisms. The basis for disease control lies with the ability of the hypovirulence phenotype to be transmitted to virulent strains resulting in conversion of the recipient to hypovirulence (Grente, 1965; Grente and Berthelay-Sauret, 1978; Van Alfen et al., 1975). Studies with auxotrophic mutant strains indicated that the genetic element responsible for the hypovirulence phenotype corresponded to a cytoplasmic determinant that was transferred by hyphal anastomosis (fusion of hyphae) (Van Alfen et al., 1975). Day et al. (1977) subsequently reported that hypovirulent C. parasitica strains contained double-stranded (ds) RNA species that were generally absent in virulent C. parasitica strains. Moreover, these ds RNAs were observed to be transmitted coincidentally with the hypovirulence phenotype during anastomosis.
Recent characterizations of structural and functional properties of hypovirulence-associated dsRNAs have provided evidence for a viral origin even though these RNAs appear not to have be encapsidated within a discrete virus particle. For example, the large dsRNA, L-dsRNA, present in hypovirulent C. parasitica strain EP713 was shown to encode two large polyproteins that undergo autoproteolytic processing during translation (Choi et al., 1991a; 1991b; Shapira et al., 1991a; Shapira and Nuss, 1991). Recent computer-assisted analysis of the predicted amino acid sequences of these polyproteins revealed five distinct domains with significant sequence similarity to previously described conserved domains within protein products encoded by members of the potyvirus group of positive-strand RNA plant viruses (Koonin et al., 1991). Phylogenic trees, derived from the alignment of one specific domain, that of the putative RNA-dependent RNA polymerase, with the sequences of all known viral RNA polymerases strongly suggested that L-dsRNA and potyvirus genomes share a common ancestry. Based on the similarity of the L-dsRNA genetic organization and expression strategy to those of several viral genomes and the apparent evolutionary relationship to the potyviruses, the term hypovirulence-associated virus (HAV) will be used to denote this class of genetic element (Shapira et al., 1991).
Direct analysis of the L-dsRNA present in hypovirulent C. parasitica strain EP713 has shown that one strand contains a 3'-poly (A) tail that is base paired to a stretch of poly (U) present at the 5'-terminus of the complementary strand (Hiremath et al., 1986). Sequence analysis of multiple cDNA clones that spanned the entire length of L-dsRNA revealed that the molecule consists of 12,712 bp, excluding the poly(A):poly(U) homopolymer domain, and that only the poly (A) strand contains coding domains of significant size (Shapira et al., 1991). The long open reading frame, designated ORF A, is preceded by a 495 nucleotide (nt) noncoding leader sequence and extends 1,869 nt. The junction between ORF A and ORF B, is contiguous with ORF A and extends 9,498 nt. The junction between ORF A and ORF B consists of the pentanucleotide 5'UAAUG-3' in which the UAA portion serves as a termination codon for ORF A (Choi et al., 1991a) and the AUG portion is the 5'-proximal initiation codon of ORF B (Shapira et al., 1991). An 851 nt 3' noncoding domain follows ORF B, terminating with the 3'-poly (A) tail.
ORF A encodes two polypeptides, p29 and p40, that are released from a polyprotein, p69, by an autocatalytic event mediated by p29 (Choi et al., 1991a). Cleavage occurs between Gly -248 and Gly-249 during translation and is dependent upon the essential residue Cys-162 and His-215 (Choi et al., 1991b). Expression of ORF B also involves an autoproteolytic event in which a 48 kDa polypeptide, designated p48, is released from the N-terminal portion of the encoded polyprotein (Shapira et al., 1991). Cleavage of p48 occurs between Gly-418 and Ala0419 and is dependent upon essential residues Cys-341 and His-388 (Shapira and Nuss, 1991). Both p29 and p48 resemble papain-like proteases. Putative RNA-dependent RNA polymerase and RNA helicase motifs have been located in the C-terminal half of ORF B (Shapira et al., 1991; Koonin et al., 1991).
Efforts to determine the precise genetic information responsible for transmissible hypovirulence have been hampered by the inability of HAV RNAs to initiate an infection by an extracellular route. This is a common property of mycoviruses and unencapsidated viral-like RNAs (Buck, 1986; Wickner 1989; El-Sherbeini and Bostian, 1987). We were recently able to partially overcome this limitation by introducing HAV coding domains into virus-free virulent C. parasitica strains by DNA-mediated transformation (Choi and Nuss, EMBO J. 1992). Significantly, transformation with a cDNA copy of the first L-dsRNA open reading frame, ORF A, conferred a number of traits similar to those exhibited by the- L-dsRNA-containing hypovirulent strain (EP713). These traits included reduced pigmentation, reduced laccase accumulation and suppressed conidiation, characteristics that frequently, but not universally, accompany hypovirulence-associated traits- (listed in Hillman et, al. 1990). However, virulence was not reduced in the ORF A transformants. These results established a direct cause and effect relationship between the viral ds RNA present in a hypovirulent c. parasitica strain and specific traits associated with that strain. The fact that these hypovirulence associated traits were conferred in viral-free transformants demonstrated that they are not the result of some general, reaction, of the fungus to the physical presence of replication viral RNA but are caused by a specific coding domain. The observation that reduced virulence was uncoupled from associated traits such as suppressed sporulation in the ORF A transformants suggests that different viral encoded proteins may be responsible for specific traits expressed by individual hypovirulent strains.
SUMMARY OF THE INVENTION
This invention is a hypovirulent fungus which can transmit the hyprovirulence phenotype and avoid vegetative incompatibility. Hypovirulence associated virus is also known as hypovirulence associated genetic element.

A BRIEF DESCRIPTION OF THE FIGURES
FIG. 1. Complete nucleotide sequence of L-dsRNA present in strain EP713. The sense strand sequence of the cloned cDNA copy of L-dsRNA is shown with number beginning with the 5'-terminal nucleotide. The deduced ORF A (first open reading frame) amino acid sequence is shown below the corresponding nucleotide sequence and extends from the initiation codon at nucleotide position 496-498 to the TAA termination codon, indicated by ###, at nucleotide positions 2362-2364. The ORF B (second open reading frame) amino acid sequence is shown above the corresponding nucleotide sequence and extends from the ATG codon at nucleotide positions 2364-2366 to the TAA codon at nucleotide positions 11859-11861. The GenBank accession number is M57938.
FIGS. 2A and 2B. Description of transformation vectors pAXHY2 and pAXHY5 and Southern analysis of C.parasitica transformants. PanelA. Plasmid pAXHY2 contains the first coding domain of the HAV L-dsRNA, ORFA, flanked by the C.parasitica glyceraldehyde-3-phosphate dehydrogenase gene promoter (Pgpd) and terminator (Tgpd). It was shown that ORFA encodes a polyprotein that is autocatalytically processed into two polypeptides, designated p29 and p40 (Choi et al., 1991a). The gpd-1 promoter region extended 1,696 nt upstream of map position 376 of the published gpd-1 sequence, while the terminator extended from map position 1571 through position 2172 (Choi and Nuss, 1990). This plasmid also contains the E.coli hygromycinB phosphotransferase gene (hygB) proceeded by the Aspergillus nidulans trpC promoter (ptrpC) (Cullen et al., 1987), all in a pUC19 background. Plasmid pAXHY5 is the same as pAXHY2 except that the ORFA coding domain is in the antisense orientation. The location of PstI sites within and flanking the ORFA coding region are also indicated. The arrows located under the ORFA region in each plasmid indicate the sizes of ORFA containing fragments that are expected to be liberated by PstI digestion. PanelB. Shown is the Southern analysis of PstI-digested genomic DNA prepared from four (+)ORFA transformants (A1, A5, A6, A10), two (-)ORFA transformants (a2 and a11), untransformed strain EP155 and hypovirulent strain EP713, all probed with the ORFA coding sequence. The positions of marker fragments are indicated at the left.
FIG. 3. Effect of ORFA transformation on pigmentation and colony morphology. Transformation of EP155 spheroplasts was performed essentially as described (Churchill et al., 1990), followed by selection on hygromycinB-containing medium (40-mg/ml). Transformants used in this study were further selected on a higher level of hygromycinB (200 mg/ml). Transformants containing either vector pAXHY2 �(+)ORFA transformants, A1,A5,A6 or A10! or vector pAXHY5 �(-)ORFA transformants, a2 and a11! were grown in parallel with untransformed EP155 and the isogenic hypovirulent strain EP713 for five days on potato dextrose agar (Difco) on the laboratory bench: light<2,000lx, temperature 22-24 degrees C. as described (Hifman et al., 1990).
FIG. 4. Effect of ORFA transformation on accumulation of laccase activity. Strains EP155, EP713 and the (+)ORFA and (-)-ORFA transformants were grown for five days in the dark at 22-24 degrees C. on cellophane covering the surface of agar plates containing Bavendamm's medium (Bavendamm, 1928).
FIG. 5. Slot blot analysis of ORF A specific transcripts present in strain EP713 and in ORF A (+) transformants. As indicated in Materials and Methods, each well was loaded with approximately 15 micrograms or denatured ssRNA. The same set of samples were probed first with a DNA fragment that spanned the entire ORF A region (shown at left) and, following stripping of the first probe, with a DNA fragment that corresponded to the coding domain of C. parasitica endothiapepsin gene (epn-1) to provide an indication of the relative amount of cellular mRNA applied to each well. The fungal strains from which the FNA samples were prepared are indicated at the left. Hybridization signals were quantified with the aid of an LKB ULtrascan laser densitometer. THe relative amounts of ORF A specific transcripts present in the fungal strains and transformants were 0%, 100%, 8%, 4%, less than 1%, and less than 1% for EP155, EP713, A1, A5, A6, and A10 respectively.
FIG. 6. Construction of full-length cDNA clone of L-ds RNA (hypovirulence associated virus or genetic element). See Example 2 for details.
FIG. 7. Plasmid pXH9.

Table 1. Effect of ORFA transformation on conidiation. Colonies were grown on potato-dextrose agar plates as described in FIG. 2 for 10 days. Conidia were liberated with a glass rod after flooding plates with 10 ml of 0.15% Tween 80. The number of conidia was quantified by direct counting with the aid of a hemacytometer. Results are presented as average number of conidia per ml of the original 10 ml suspension. Strain designations are in FIG. 2. N.D=not determined.
______________________________________STRAIN CONIDIA/ML______________________________________EP155 1.6 .times. 10.sup.7EP713 <1.0 .times. 10.sup.4a2 1.4 .times. 10.sup.7a11 1.7 .times. 10.sup.7A1 N.D.A5 6.2 .times. 10.sup.5A6 9.5 .times. 10.sup.5A10 3.7 .times. 10.sup.5______________________________________
DETAILED DESCRIPTION OF THE INVENTION
This invention comprises a fungus or fungal spore or parts of either comprising cells of a pathogenic fungus or fungal spore, the nuclear genome of said cells having integrated therein cDNA sequence which is sufficiently homologous to an RNA sequence of a hypovirulence associated genetic element to confer a hypovirulent phenotype which is transmissible. An example is a element or a fungus or fungal spore having a hypovirulent phenotype and the ability to transmit such phenotype by sexual reproduction as a result of a modification to its nuclear genome which modification consists of the integration of a DNA sequence completely or closely homologous to an RNA sequence of a hypovirulence associated virus into said genome resulting in sexually transmissible hypovirulence. Parts of the fungus include mycelia and hyphae.
The fungus or fungal spore may be a plant or an animal pathogen. Examples of plant pathogens are Cryphonectria parasitica, Ophiostoma ulmi, Gaeumannomyces graminis, Helminthosporium victoriae, Ustilago maydis, Phytophthora infestans, or Rhizoctonia solani. These pathogens are are described in Nuss and Koltin, Ann. Rev. Phytopanthol. 1990, 28:37-58, and possess dsRNAs (i.e. genetic elements).
A preferred RNA sequence is the RNA sequence of a hypovirulence associated genetic element of C. parasitica. An example is strain EP 713. Such RNA is isolated as described in Hillman et al., 1990, however any conventional means is acceptable.
The invention in particular includes a fungus or fungal spore or parts of either comprising cells of a pathogenic fungus or fungal spore, the nuclear genome of said cells having integrated therein a cDNA sequence which is sufficiently homologous to the second open reading frame of the RNA sequence of a hypovirulence associated genetic element of C. parasitica to confer a hypovirulent phenotype which is transmissible without repressing sporulation capacity. Strain EP 713 is an example.
The integrated DNA may have the sequence shown in FIG. 1. cDNA is produced by conventional means. (see Maniatis. et. al). Specifically, obtaining cDNA from RNA is described in Shapiro et al (1991). Any conventional means is contemplated.
Also, part of this invention are three cDNA polynucleotides sequences. Sequences are provided in FIG. 1. The whole EP 713 genetic element is the sequence of FIG. 1. The first open reading frame (ORF A) is from about nucleotide 496-98 to about 2362-64 of FIG. 1, and the second (ORF B) from about 2364-to about 11859-61 of FIG. 1.
A vector suitable for expression in fungi which contains any one of these three polynucleotide sequences is part of this invention.
Suitable vectors may contain a fungal promoter and a fungal terminator, and optionally a marker suitable for expression in fungi. Conventional vectors may be used. Methods for producing vectors using recombinant DNA technology are well known in the art.
In particular, a vector may contain the C. parasitica glyceraldehyde-3-phosphate dehydrogenase gene promoter and terminator. Specific vectors are pAXHY2, pAXHY5 and pXY9, described in Example 1 and 2.
Also included in this invention is an isolated polypeptide having the amino acid sequence of FIG. 1, an isolated polypeptide having the amino acid sequence from about amino acid 1 to about amino acid 622 of FIG. 1 (ORF A) and an isolated polypeptide having the amino acid sequence from about amino acid 1 to about amino acid 3165 of FIG. 1 (OFR B). Antibodies to these polypeptides are included. Antibodies and polypeptides can be produced and isolated by conventional methods. Polypeptides can be isolated by known means from fungi, or produced by known methods recombinantly using the DNA sequence of FIG. 1. For specific examples of antibody production, see Rae, et. al. 1989.
This invention also includes a method for producing a fungus or fungal spore or parts of either comprising cells of a pathogenic fungus or fungal spore having a hypovirulent phenotype which is transmissible which comprises integrating a cDNA sequence sufficiently homologous to an RNA sequence of a hypovirulence associated genetic element into the genome of said fungus or fungal spore or parts so as to confer sexually or vegetatively transmissible hypovirulence on the fungus or fungal spore.
Another aspect of the invention is a method for producing a protein in a fungus which comprises inserting into a fungus a vector comprising a DNA sequence homologous to the second open reading frame of the RNA sequence of a hypovirulence associated gentic element of C. parasitica strain EP713 and a DNA sequence encoding the protein; and culturing the fungus to cause multiple copies of the vector to generate and express, thereby causing production of the protein. This is an example of a high copy number cytoplasmic expression vector.
A method for treating fungal diseases which comprises administering to an organism infected with a virulent fungus a composition containing a fungus or fungal spore or parts of either comprising cells of the virulent fungus or fungal spore, the nuclear genome of said cells having integrated therein a cDNA sequence which is sufficiently homologous to an RNA sequence of a hypovirulence associated genetic element to confer a transmissible hypovirulent phenotype and a suitable carrier, said fungus or fungal spore or parts being present in amounts sufficient to retard the growth of virulent fungus by converting the preponderance of infecting fungi to a hypovirulent phenotype is part of this invention. The organism may be a plant.
In particular, a method for treating chestnut blight which comprises administering to plants infected with C. parasitica a composition containing a fungus or fungal spore or parts of either comprising cells of C. parasita, the nuclear genome of said cells having integrated therein a cDNA sequence which is sufficiently homologous to the RNA sequence of a hypovirulence associated genetic element of C. parasitica to confer a transmissible hypovirulent phenotype and a suitable carrier, said fungus or fungal spore or parts being present in amounts sufficient, to retard the growth of convert the preponderance of infecting fungi to a hypovirulent phenotype is included. The composition may be delivered as a spray, and may contain a paste made up of the mycelia or hyphae of the fungus. (See Anagnostakis 1984 and Grente and Berthelay-Sauret 1978).
Also included is a composition which comprises a fungus or fungal spore or parts of either comprising cells of the virulent fungus or fungal spore, the nuclear genome of said cells having integrated therein a cDNA sequence which is sufficiently homologous to an RNA sequence of a hypovirulence associated genetic element to confer a transmissible hypovirulent phenotype, and a suitable carrier.
For example, the composition may be in the form of a liquid, or powder. The RNA sequence may be that of a hypovirulence associated virus or genetic element of C. parasitica strain EP713.
For example, the composition may include a cDNA sequence which is completely or closely homologous to the second open reading frame of the RNA sequence of a hypovirulence associated virus of C. parasitica strain EP713.
Various formulations of the compositions are possible and are produced by conventional methods. Agronomically acceptable adjuvants and carriers are employable to disperse the fungi, spores, or active portions thereof. Precise formulations and dosages may be selected to best facilitate the spread of hypovirulence for a given application.
The composition may be aqueous, a dust or powder, a wettable powder, an emulsion, a granular form a paste or any known type of formulation depending on how it is to be applied. As examples of means of application, a paste, in particular paste made up of fungal mycelia or hyphae with appropriate carriers and components as described below, could be applied directly to plants. Powders can be dispersed by air, and aqueous solutions sprayed. Another application method is to bore holes around the periphery of a canker of an infected plant, and insert into the holes mycelial paste as described above.
The fungus or spore cell concentration should be at a level which provides for establishment of the fungus or spore cells on the treated plants and for their ability to multiply and transmit their hypovirulent phenotype to infecting virulent fungi.
Compositions may include additives such as surfactants, nutrients, buffers, biological or chemical pesticides, and pentrating agents, in particular in the case of aqueous compositions. Included in particular in dry compositions are inert powders, stablizing agents, salts, anticaking agents, nutrients, buffers, film-forming material.
Aqueous compositions may be aerosels, foliage sprays, mists, and other known compositions.
A method for treating chestnut blight which comprises administering to plants infected with C. parasitica a composition containing a fungus or fungal spore or parts of either comprising cells of C. parasitica, the nuclear genome of said cells having integrated therein a cDNA sequence which is sufficiently homologous to the RNA sequence of the second open reading frame of the RNA sequence of a hypovirulence associated genetic element of C. parasitica to confer a hypovirulent phenotype which is transmissible without repressing sporulation capacity and a suitable carrier, said fungus or fungal spore or parts being present in amounts sufficient to retard the growth of infecting fungi by converting the preponderance of infecting fungi to a hypovirulent phenotype without affecting sporulation is also part of this invention.
EXAMPLE 1
The potential phenotypic contribution of the first open reading frame present in L-dsRNA, ORFA, was tested by transforming virulent C.parasitica strain EP155, which is isogenic to the L-dsRNA-containing hypovirulent strain EP713, with vector pAXHY2. This vector contains the ORFA coding domain fused upstream to the C.parasitica glyceraldehyde-3-phosphate dehydrogenase (gpd-1) promoter and fused downstream to the gpd-1 terminator (FIG. 2A). pAXHY2 also contains the Escherichia coli hygromycinB phosphotransferase gene as a selectable marker flanked by the trpC promoter and terminator domains from Aspergillus nidulans (Cullen et al., 1987). Plasmid pAXHY5, which contained ORFA in the reverse orientation, served as a control vector. Selected transformants were subjected to Southern hybridization analysis to confirm integration of the appropriate transformation vector. Two different sets of ORFA-containing fragments are liberated from each vector by PstI digestion, fragments of 2.7 kb and 1.1 kb from pAXHY2 and two 1.9 kb fragments from pAXHY5 (illustrated in FIG. 2A). As shown in FIG. 2B, fragments of the expected size were observed when a blot containing PstI-digested genomic DNA of four independent pAXHY2 transformants �designated, (+)ORFA transformants A1, A5, A6 and A10! and two independent pAXHY5 transformants �designated (-)ORFA transformants a2 and a11! was probed with the ORFA sequence. Based on the relative intensity of the hybridized bands, it appeared that each of the four (+)ORFA transformants contained the same approximate number of copies of integrated pAXHY2 DNA, while the copy numbers for the two (-)ORFA transformants were several fold higher. No homology to ORFA sequences was observed for genomic DNA prepared from either strain EP155 or EP713.
The isogenic virulent and hypovirulent strains EP155 and EP713 exhibit clearly observable phenotypic differences that provide convenient markers for transformation studies aimed at examining the consequence of introducing HAV genetic information. When grown under standard laboratory conditions, strain EP155 is orange in color, conidiates abundantly and produces consistent levels of phenol oxidase activity of the laccase type. In contrast, strain EP713 appears white, is severely suppressed in conidiation and produces significantly reduced levels of laccase (Hillman et al., 1990).
As indicated in FIG. 3, transformation with the (-)ORFA vector pAXHY5 resulted in no alteration in colony morphology or reduction in pigmentation (compare transformants a2 and a11 with EP155). This result indicates that the introduction of vector sequences, including the hygromycinB phosphotransferase gene, does not significantly alter fungal phenotype. Remarkably, the four independent (+)ORFA transformants, A1, A5, A6 and A10, all resembled strain EP713. Pigment production was severely reduced throughout the culture period in which the colonies were actively expanding. However, unlike the situation with strain EP713, mature (+)ORFA transformant colonies did develop a very low level of pigmentation. It is noteworthy that no alterations in pigmentation were previously observed among any hygromycin resistant isolates generated from numerous unrelated transformation experiments. In contrast, all (+) ORFA transformants, including the four presented here, showed reduced pigment production.
There have been several reports that hypovirulent C.parasitica strains are deficient in phenol oxidase activity of the laccase type (Hillman et al., 1990; Rigling et al., 1989) and that the difference in relative laccase levels can readily, be detected by a color reaction on Bavendamm's medium (Rigling et al., 1989). As indicated in FIG. 4, strain EP155 when grown on this medium produces a dark brown color, while strain EP713 exhibits a very weak color reaction. Similar to the results observed for pigmentation, transformants a2 and a11 resembled EP-155 in terms of color reaction while laccase accumulation was reduced in all four (+)ORFA transformants. However, there was some apparent variation in the level of laccase reduction. Transformant A6 exhibited a slightly darker color reaction than did transformant A10, and laccase activity appeared to be reduced less in all four (+)ORFA transformants than in strain EP713.
Suppressed conidiation is another common hypovirulence-associated characteristic. The level of suppression in the case of strain EP713 is consistent and nearly complete under standard laboratory conditions (Hillman et al., 1990, Table 1). As indicated in Table1, the (-)ORFA transformants produced conidia at a level comparable to that of the untransformed EP155 control. In contrast, (+)ORFA transformants produced conidia at a level between 16 and 40 fold less than the level produced by the EP155 control. However, the level of suppression, while significant, was much less than that of the EP713 control (Table 1) .
The observation that (+)ORFA transformants exhibited a number of hypovirulence-associated traits prompted us to examine whether virulence was also reduced in these transformants. Dormant chestnut stems were inoculated (Jaynes and Elliston, 1980) and the relative virulence, as a function of the mean canker radial growth, was analyzed (SAS system for personal computer release 6.04 from SAS Institute Inc., Cary, N.C.). There was no significant difference between the canker sizes for (+)ORFA (A6 and A10) and (-) ORFA (a2 and a11) transformants and all four transformants produced cankers at least 5 times larger than the EP713 cankers (data not shown). Based on this assay, there was no evidence that the (+)ORFA transformants were reduced in virulence.
The uncoupling of hypovirulence from associated traits is highly significant and shows that hypovirulent strains could be engineered to exhibit specific traits. It is possible to delete portions of the HAV sequence that are, for example responsible for reduced levels of sporulation while modifying other portions of the molecule to enhance hypovirulence. Introduction of these engineered molecules into virulent fungal strains by various; means can result in the generation of hypovirulent strains which disseminate through abundant sporulation. A specific L-dsRNA coding domain, in the absence of replicating HAV RNA, is sufficient to confer certain traits that are exhibited by the corresponding untransformed hypovirulent strain. This result established a direct cause and effect relationship between the viral dsRNA present in a hypovirulent C.parasitica strain and specific traits associated with that strain. Additionally, it clearly demonstrates that these phenotypic traits are not the result of some general reaction of the fungus to the physical presence of replicating viral RNA but are caused by specific viral coding domains.
Materials and Methods
Fungal strains and growth conditions. C.parasitica strains EP155 (virulent, dsRNA-free) and EP713 (isogenic to EP155, hypovirulent, contains L-dsRNA) were maintained as described previously (Hillman et al., 1990). Transformed strains were grown on potato dextrose agar (Difco) on the laboratory bench: light <2000lx, temperature 22-24 degrees C. as described by Hillman et al., (1990). To test for laccase activity, colonies were grown in the dark at 22-24 degrees C. on cellophane covering the surface of agar plates containing Bavendamm's medium (Bavendamm, 1928).
Transformations. Transformation vector pAXHY2 contained the entire first open reading frame, ORFA, of L-dsRNA flanked by the C.parasitica glyceraldehyde-3-phosphate dehydrogenase gene (gpd-1) promoter and terminator and the E.coli hygromycinB phosphotransferase gene proceeded by the Aspergillus nidulans trpC promoter (Cullen et al., 1987) all in a pUC19 background (see FIG. 2A). The gpd-1 promoter region extended 1,696 nt upstream of map position 376 of the published gpd-1 sequence, while the terminator extended from map position 1571 through position 2172 (Choi and Nuss, 1990). Transformation of EP155 spheroplasts was performed essentially as described by Churchill et al. (1990), followed by selection on hygromycinB- containing medium (40 mg/ml).
EXAMPLE 2
The manipulations used to construct a full-length cDNA clone of L-dsRNA are indicated in FIG. 6. Several large intermediate clones were first generated from the set of partial cDNA clones initially used to derive the L-dsRNA nucleotide sequence and genetic map. Additionally, modifications were introduced into the terminal regions of the L-dsRNA, sequence with the aid of the polymerase chain reaction (PCR)(Saiki et, al., 1988). These, included the addition of XbaI and SspI sites at the end corresponding to the 5'terminus of the coding strand as subsequent cloning aids. A sequence corresponding to the bacteriophage T7 polymerase promoter was also fused to the L-dsRNA sequence. Modifications introduced into the other terminus included a 22 residue long stretch of poly (A): poly (U) to stimulate the natural heteropolymer domain followed by SpeI and HindIII sites. A four factor ligation-transformation was then performed to generate a plasmid, pLDST, that contained the full-length L-dsRNA clone in a pUC19 background. The unique SspI and SpeI sites introduced at the termini of the L-dsRNA sequence by PCR facilitate subsequent subcloning of the intact L-dsRNA cDNA compliment into suitable C. parasitica transformation vectors. For the purposes of this study, the SspI/SpeI fragment was subcloned into transformation vector pCPXHY1 to yield plasmid pXH9 (FIG. 7). This construct contains the entire L-dsRNA sequence with the PCR-modified termini fused upstream to the C. parasitica glyceraldehyde-3-phosphate dehydrogenase (gpd-1) promoter and fused downstream to the gpd-1 terminator. pXH9 also contains the Escherichia coli hygromycin B phosphotransferase gene as a selectable marker flanked by the Aspergillus nidulans trpC promoter and terminator domains (Cullen et al., 1987), all in a pUC19 genetic background.
L-dsRNA cDNA is Infectious
Hypovirulent C. parasitica strains often exhibit traits in addition to reduced virulence that distinguish them from virulent strains. These so-called hypovirulence-associated traits vary among individual hypovirulent strains but commonly include suppressed sporulation, reduced pigmentation and reduced accumulation of specific enzymatic activities or metabolytes. Therefore, differences are exhibited between the L-dsRNA-containing hypovirulent strain EP713 and its virus-free isogenic virulent strain EP155 in transformation studies. Under standard laboratory conditions, strain EP155 produces orange pigments, conidiates abundantly, and produces easily measurable levels of phenol oxidase activity of the laccase type. In contrast, strain EP713 is white in appearance, is suppressed in conidiation and produces significantly reduced levels of laccase (Hillman et al., 1990). Using a transformation vector similar to pXH9, we observed that introduction of the L-dsRNA ORF a coding domain into strain EP155 conferred most of the hypovirulence-associated traits characteristic of strain EP 713 but failed to confer hypovirulence (Choi and Nuss, 1992).
The observation that ORF-A alone could confer hypovirulence-associated traits suggest that these same traits could be used to initially score pXH9 transformants. In fact, most of the hygromycin resistant pXH9 transformants did exhibit EP713-like traits as exemplified by transformants CN2, CN3, CN6 and CN7. These transformants failed to produce orange pigments or to produce any asexual spores under standard laboratory conditions and appeared to be slightly retarded in the rate of growth in comparison to both strain EP 155 and EP713. The EP713-like pXH9 transformants also gave a very weak color reaction when grown on Bavendams medium indicating a deficiency in laccase accumulation as has been reported for strain EP713 (Hillman et al., 1990) and other natural hypovirulent strains (Rigling et al., 1989). It is noteworthy that the hypovirulence-associated traits exhibited by these pXH9 transformants were significantly more severe than was observed for the ORF A transformants. For example, sporulation was reduced between 16 and 40 fold in the ORF A transformants but was completely suppressed in the pXH9 transformants. Hygromycin resistant colonies that exhibited. EP155-like traits were also observed among the pXH9 transformants at a rate of approximately 10%, as exemplified by transformants CN4 and CN5.
Since transformants that contained an integrated form of ORF A exhibited hypovirulence-associated traits in the absence of viral replication, the ability of pXH9 to confer similar traits might also be the result of exclusive expression from integrated copies of the L-dsRNA cDNA. Alternatively, since pXH9 contains the entire L-dsRNA sequence, including the putative RNA-dependent RNA polymerase and RNA helicase coding domains, the possibility existed that the L-dsRNA sequence could be resurrected from the cDNA copy as a cytoplasmically replicating dsRNA form as has been reported previously for cDNA copies of Poliovirus and bacteriophage Q.beta. genomes (Taniguchi et al., 1978; Racaniello and Baltimore, 1981). The four EP713-like pXH9 transformants was found to harbor a dsRNA species that comigrated with L-dsRNA extracted from strain EP713. In contrast, the two EP155-like pXH9 transformants lacked any detectable dsRNA species. Strain EP713 contains other dsRNA species in addition to L-dsRNA that have been shown to represent internally deleted forms of L-dsRNA (Shapira et al., 1991b). One particularly abundant family of defective dsRNA, the M-dsRNAs (8 to 10 kbp) has been consistently found in every dsRNA fraction prepared from strain EP713 and has been observed to invariably co-segregate with the the L-dsRNA species in a single conidial isolates. The absence of the M-dsRNA species in the pXH9 transformants is consistent with the finding that the L-dsRNA species was recently resurrected from an integrated copy of L-dsRNA cDNA.
Transmissibility of Conferred Traits
A hallmark of transmissible hypovirulence is the ability of the hypovirulence phenotype to be transmitted to vegetatively compatible virulent strains by hyphal anastomosis coincident with the transfer of hypovirulence-associated viral RNAs (Van Alfen et al., 1975). Consequently, a functional test of the biological activity of the putative resurrected L-dsRNA species would be to examine whether the traits exhibited by the pXH9 transformants could be cytoplasmically transmitted via hyphal anastomosis. Anastomosis-mediated conversion of a virulent strain to the hypovirulence phenotype can be monitored visually in the laboratory by the paired inoculation on an agar plate of a normally orange virulent strain and a vegetable compatible white hypovirulent strain. Inoculation points are positioned so that the two colonies intersect within the first two days of culture. The converted virulent hyphae appear as a wedge of white mycelium that initiates at the interface between the colonies and extends along the periphery of the virulent colony. In fact, this pattern was observed when virulent strain EP155 was paired with pXH9 transformant CN2 indicating that the resurrected L-dsRNA is transmissible via anastomosis.
To confirm the apparent conversion of virulent strain EP155 by the resurrected L-dsRNA, mycelial samples from various portions of the paired colonies were characterized with respect to hygromycin B resistance, colony morphology and presence of L-dsRNA. As expected, samples taken from the CN2 colony carried the hygromycin B phosphotransferase marker, produced white colonies and contained L-dsRNA. In contrast, samples taken from the orange portion of the EP155 colony failed to grow in the presence of hygromycin B, produced orange colonies and lacked any dsRNAs. Significantly, samples taken from the converted periphery of the EP155 colony also failed to grow in the presence of hygromycin B, but produced white colonies and were found to contain dsRNAs. Interestingly, the dsRNA fraction extracted from the latter samples contained species in addition to L-dsRNA that were not found in the original CN2 transformant. Although these new dsRNAs were similar in size to the M-dsRNA species present in strain EP713, they were shown not to co-migrate with the M-dsRNAs when subjected to further electrophoresis.
The relationship between anastomosis and the generation of internally deleted defective forms of L-dsRNA is currently unclear due to the limited sample size analyzed to date. However, given the impact that defective RNAs have on symptom expression in other viral systems (Roux et al., 1991), this subject warrants further investigation.
The Infectious L-dsRNA cDNA Clone Confers the Complete Hypovirulence Phenotype
Dormant chestnut stems were inoculated (Jaynes & Elliston 1980) and relative virulence as a function of mean canker radial growth was analyzed. Converted strains which contained the resurrected ds L-RNA (or genetic element) and integrated cDNA copy or that contained the resurrected as RNA but lacked the integrated cDNA copy had the same reduced virulence (hypovirulence) as the corresponding natural hypovirulence strain.
Transformation of an isogenic, virus-free, virulent C. parasitica strain with the full-length L-dsRNA cDNA clone resulted in transformants that expressed the complete hypovirulence phenotype and that contained a resurrected cytoplasmically replicating form of L-dsRNA that was transmissible via hyphal anastomosis.
The availability of an infectious cDNA clone of an HAV dsRNA makes it possible to employ site-directed and specific deletional mutagenesis to generate a collection of defined L-dsRNA mutants that contain defects in any desired portion of the molecule. L-dsRNA modulates the expression of specific fungal genes by selectively altering regulatory pathways (Choi et al., 1992); Rigling and Van Alfen 1991). A collection of mutant L-dsRNA cDNA clones would also facilitate efforts to define the role of specific viral gene products in modulating virulence and fungal gene expression.
The introduction of an artificial cDNA intermediate into the replication cycle of an HAV dsRNA could potentially have a very significant impact on current efforts to restore the American chestnut as a valuable forest species. Although transmissible hypovirulence has been shown to effectively control chestnut blight in Europe, attempts to apply this biological control strategy to North American forest ecosystems have met with limited success primarily due to problems associated with poor dissemination of the introduced hypovirulent strain (see Anagnostakis, 1982; MacDonald and Fulbright, 1991). It is generally accepted that the vegetative incompatibility system that governs the ability of different C. parasitica strains to undergo anastamosis can have a considerable influence on the spread of the hypovirulence phenotype. Since the HAV dsRNA responsible for the phenotype is transmitted only by anastomosis, an introduced hypovirulent strain can convert only those virulent strains in the population that are of the same or closely related vegetative compatibility (VC) group. If the number of different VC groups is low, as appears to be the case in Europe (Anagnostakis et al., 1986), a significant portion of the virulent strain can convert only those virulent strains in the population can be converted to hypovirulence by the introduction of hypovirulent stain s representing several different VC groups, i.e., few barriers to vegetative spread of the HAV dsRNA will exist in such a population. In contrast, if the VC structure of the virulent C. parasitica population is complex, as is the case in the eastern deciduous forest in North America (Anagnostakis et al., 1986), considerable barriers exist to vegetative dissemination. In this context, by introducing a single genetically engineered hypovirulent strain that contains integrated cDNA copies of L-dsRNA, we can obviate the barriers to vegetative dissemination imposed by the vegetative incompatibility system. Since sexual incompatibility in C. parasitica is homogenic at a single mating type locus (Anagnostakis 1984), barriers to the spread of the integrated L-dsRNA cDNA copy through the population by sexual crossing would be limited. Thus, the integrated L-dsRNA genetic information could be transmitted to a vegetatively incompatible strain by mating. Nuclear inheritance of the integrated L-dsRNA cDNA is followed by resurrection of the cytoplasmic L-dsRNA form in the progeny and subsequent vegetative dissemination through all VC groups represented in the progeny population.
The existing L-dsRNA cDNA clone can be subjected to genetic manipulations to produce hypovirulent fungal strains that are more effective biocontrol agents. Transformation of a virulent C. parasitica strain with a cDNA copy of ORF A resulted in suppressed sporulation (Choi and Nuss 1992). By appropriately mutating ORF A within the context of the infectious L-dsRNA cDNA clone, a hypovirulent strain can be engineered to exhibit an increased asexual sporulation capacity, thus resulting in an increased rate of dissemination of the hypovirulence phenotype. Additionally, every asexual spore would contain L-dsRNA genetic information either in a cDNA and dsRNA forms. This would contrast with the normal situation for strain EP713 where L-dsRNA is transmitted in approximately 40% of the conidia.
Since the surviving root systems of blight infested American chestnut trees continues to produce sprouts throughout its natural range (Anagnostakis, 1982), the release of improved genetically engineered hypovirulent C. parasitica strains could significantly contribute to the restoration of this once important forest species. Specific means of treatment will take into account potential alterations in host range, ecological fitness, meiotic stability of the integrated L-dsRNA genetic information and mitotic stability of the resurrected L-dsRNA.
Finally, the availability of a full-length cDNA clone of the HAV L-dsRNA provides an opportunity to expand this form of biological control to other pathogenic fungi.
EXAMPLE 3
Materials and Methods Fungal strains and growth conditions
C.parasitica strains EP155 (virulent, dsRNA-free, ATCC #38755) and EP713 (isogenic to EP155, hypovirulent, contains dsRNA, ATCC #52571) were maintained as described previously (Hillman et al., 1990). Inoculum for induction experiments was prepared by growing cultures in potato-dextrose broth (PDB, Difco) at 25 degrees C., in the dark, without shaking. Once the cultures reached stationary phase, mycelial clumps were disrupted by grinding with a Polytron (Kinematica) and the cultures were diluted with one volume of PDB and stored at 4 degrees C. Cultures used to examine the induction of laccase mRNA accumulation were initiated by inoculating 50 ml of PDB in 250 ml Delong flasks with 1/20th volume of inoculum. Growth conditions were as described for the inoculum except that the growing hyphae were dispersed by gently pipetting twice a day. After 40 h to 48 h, a zero time sample was removed and cycloheximide was added to a final concentration of 3-mM from a 3 mM stock solution prepared in ethanol. An equivalent volume of ethanol was added to uninduced cultures. The flasks were swirled gently and incubated as described above.
Identification and characterization of the gene encoding laccase
The probe used to screen the C.parasitica genomic library was generated by polymerase chain reaction (PCR) amplification of a 720 bp fragment corresponding to the 240 C-terminal amino acid coding domain of N.crassa laccase (Germann et al., 1988). Template DNA was prepared from N.crassa (FGSC #2489) obtained from the Fungal Genetics Stock Center, Kansas City, Kans. PCR (Saiki et al., 1988) was performed with reagents from the GeneAmp kit (Perkin-Elmer-Cetus) for 30 cycles with the following parameters: denaturation for 1.5 min at 94 degrees C., annealing for 2 min at 62 degrees C., extension for 3 min at 72 degrees C. The PCR product was treated with T4 DNA polymerase (Sambrook et al., 1989), cloned into the SmaI site of pUC19 and subjected to sequence analysis before use. All sequence analyses were performed by the dideoxy termination method (Sanger et al., 1977) using Sequenase reagents (US Biochemical Co.). Library screening, subcloning and other routine procedures were performed according to standard protocols (Sambrook et al., 1989).
For primer extension analysis, a 17 nucleotide oligodeoxynucleotide, complementary to the laccase gene sequence at map positions 125 to 141, was 5'-end-labelled with �.sup.32 P! ATP by T4 polynucleotide kinase (Sambrook et al., 1989). One pmol of the labelled primer was hybridized with 0.9 mg of poly(A).sup.+ RNA in 10 ml of a solution containing 0.2M NaCl and 5 mM PIPES, pH6.4. The mixture was heated at 65 degrees C. for 3 min and transferred to 50 degrees C. for 2h. The reaction mixture was added to 90 ml of a solution containing 50 mM Tris-HCl, pH8.3, 10 mM DTT, 6 mM MgCl.sub.2, 0.5 mM each deoxynucleotide triphosphate and 25 mg/ml Actinomycin D. cDNA synthesis was initiated by the addition of 10U of avian myeloblastosis reverse transcriptase (Promega). Following incubation at 42 degrees C. for 1 h, the reaction mixture was precipitated with ethanol. The pellet was suspended in standard sequencing sample buffer, heat denatured and analyzed on an 8% polyacrylamide/7M urea sequencing gel.
The precise intron/exon junctions were located by sequence analysis of PCR-amplified laccase cDNA generated from an EP155 cDNA library or poly(A).sup.+ mRNA. cDNA was synthesized as described by Xu et al. (1987) without prior treatment with methylmercuric hydroxide. Appropriate sets of primers (sequences available upon request) were employed to amplify laccase cDNA sequences under the following conditions: denaturation at 94 degrees C. for 1.0 min, annealing at 50.infin.C for 30 sec and extension at 72 degrees C. for 30-sec for a total of 30 cycles. The PCR products were subcloned into pUC19 for sequence analysis.
Nucleic acid preparation and analysis
Total nucleic acids were prepared from C.parasitica cultures by the method of Borges et al., (1990) with minor modifications. Liquid grown mycelium (1-2 gm) was harvested, blotted dry and powderized in liquid nitrogen with a mortar and pestle. The mycelial powder was transferred to a 50 ml polypropylene Corning centrifuge tube containing 15 ml of cold buffer (4 mM spermidine, 10-mM EDTA, 0.1M NaCl, 0.5% SDS, 10 mM freshly added b-mercaptoethanol and 40 mM Tris HCl, pH8.0), and shaken vigorously. The mixture was extracted twice with phenol/chloroform/isoamyl alcohol (25/24/1) and once with chloroform. The aqueous phase was amended with 0.1 vol of 3M sodium acetate (pH5.5) and nucleic acids were precipitated by incubating on ice for 10 min after addition of 2vol of cold ethanol. The precipitate was collected by centrifugation at 10,000 rpm in a Beckman JS-13 rotor for 10 min, rinsed with 75% ethanol and dissolved in TE buffer (10 mM Tris-HCl, pH7.5, 1 mM EDTA). These preparations were used for Southern hybridization experiments after digestion with appropriate restriction endonucleases.
C.parasitica RNA was prepared for Northern analysis by a method originally developed for N. crassa (Yarden and Yanofsky, 1991) following several modifications. Mycelia was harvested from liquid culture by gentle vacuum filtration through Miracloth (Calbiochem) and excess liquid was removed by blotting. The drained mycelial pads were inserted into 1.5 ml screw top microcentrifuge tubes containing 0.5 gm of a 0.5 mM Zirconium beads, 350 ml of water saturated phenol, and 500 ml of extraction buffer �150 mM sodium acetate, pH5.0, 100 mM LiCl, 4% SDS, 10 mM EDTA and 20 mM b-mercaptoethanol (adapted from Lucas et al., 1977)!. The tubes were immediately shaken for 1 min in a Mini Bead Beater (Biospec Products) set at high speed, allowed to cool and shaken a second time for 2 min at low speed. 350 ml of chloroform-isoamyl alcohol was added and the samples were shaken an additional two min at low speed. Following centrifugation to separate the phases, the phenol phase was re-extracted with 250 ml of extraction buffer. The aqueous phases were then combined and extracted with phenol-chloroform until no interface was present; the final aqueous phase was then extracted once with chloroform. RNA was precipitated by adding 1/3 vol of 8M LiCl and incubated overnight at 4 degrees C. The precipitate was recovered by centrifugation, washed with 80% ethanol, thoroughly drained, resuspended in 2 mM EDTA and stored at -70 degrees C. RNA concentrations were determined photometrically. Samples containing 15 mg of RNA were denatured, subjected to electrophoresis through a formaldehyde-1.5% agarose gel and transferred to a nylon membrane (Gene Screen Plus DuPont). Blots were hybridized with probes specific for C.parasitica laccase, actin, b-tubulin and glyceraldehyde 3-phosphate dehydrogenase (gpd-1) transcripts in four independent, sequential hybridization reactions under stringent conditions as specified by the membrane manufacturer.
Nucleotide sequence accession number
Nucleotide sequence data reported in this paper have been submitted to the GenBank data base and were assigned accession number M73257.
Identification and characterization of the C.parasitica laccase gene
Screening of a C.parasitica genomic DNA library with a 720 bp PCR amplicon corresponding to the 240 amino acid carboxyl-terminal coding domain of the N.crassa laccase gene resulted in the identification of 12 prospective positive clones. Of these, four clones (lambda LAC1, lambda LAC12, lambda LAC14, lambda LAC15) were further characterized and shown, by restriction- and Southern-hybridization analysis, to contain independent overlapping inserts. An overview of the C.parasitica laccase gene organization, as revealed by sequence analysis of a series of contiguous subclones extending in both directions from the region that was hybridized to the N.crassa specific probe, is presented in FIG. 1.
Two transcription start sites for the C.parasitica laccase gene were identified by primer extension experiments. A canonical TATA box was identified 42 nt upstream of the first transcription start site and the sequence between the two elements was found to be pyrimidine rich (31 of 42 residues). This is similar to the organization of the N.crassa laccase gene in which a TATA box motif was found 42 nt upstream of the transcription start site and the intervening sequence contained 29 pyrimidine residues. In contrast to the N.crassa laccase gene, the C.parasitica laccase gene contained a CCAAT motif 64 nt upstream of the first transcription start. The first ATG codon located downstream of the identified transcriptiontart sites (map positions 86-88) also constituted the initiation codon of the predicted laccase coding region based on amino acid sequence similarities with the predicted N.crassa laccase amino acid sequence (Germann et al., 1988). The nucleotide sequence context of this ATG codon, ATCAATATGC, is similar to the consensus sequence, A.sub.G TCA.sup.A CATGG, derived for favorable translation initiation of N.crassa genes (Roberts et al., 1988).
The predicted C.parasitica laccase coding domain consisted of 592 codons, including the termination codon at map positions 2864-2866, and contained a total of 12 introns. By contrast, the N.crassa laccase gene was reported to contain a single intron (Germann et al., 1988) that upon inspection was found to correspond to the second intron found in the C.parasitica laccase gene. The presence and extact boundaries of the predicted introns were confirmed by sequence analysis of PCR-amplified laccase cDNA generated from a C.parasitica strain EP155 cDNA library or poly(A).sup.+ mRNA. Intron sizes ranged from 55 to 214 nucleotides, comparable to that reported for other fungal genes (Germann et al., 1988; Roberts et al., 1988). A survey of 17 introns compiled from three C.parasitica genes; the genes for laccase (lac-1, this study), glyceraldehyde 3-phosphate dehydrogenase (gpd-1) (Choi and Nuss, 1990) and endothiapepsin (epn-1, G.H.C., R. Shapira, and D.L.N.), revealed the conserved sequences GT.sup.A G.sup.A GGT and .sup.G TAG for the 5' and 3' splice sites, respectively. Additionally, an internal consensus sequence CT.sup.G AAC, which may be involved in lariat formation (Langford et al., 1984), was identified 6-24 nucleotides upstream of the 3' splice sites. These consensus sequences are in agreement with those found for other fungal introns (Roberts et al., 1988).
The C.parasitica laccase polyadenylation site was mapped to position 3226 also by sequence analysis of PCR amplified laccase cDNA. In this case, the 3' primer contained nineteen 3'-terminal T-residues and the 5' primer was complementary to map positions 1986-2002. There was no evidence of a typical polyadenylation signal, AATAAA (Proudfoot and Brownlee, 1976), in the region upstream of the polyadenylation site, a situation common to many fungal genes. However, two pyrimidine-rich regions were observed at map positions 2949-3008 and 3018-3066. Similar thymidine- and cytosine-rich regions were also found in the 3' noncoding region of the N.crassa laccase gene (Germann et al, 1988).
Comparison of the predicted amino acid sequences for the N. crassa and C.parasitica laccases revealed a 73% similarity with a 57% level of identity. Regions of high similarity include four domains considered to contain copper-binding ligands that are conserved among a number of multicopper oxidases (Messerschmidt and Huber, 1990). These regions are highly conserved in all four fungal laccases for which sequence information is available and share considerable sequence similarity with multicopper oxidases from plant and animal sources. The high level of conservation for these regions among the fungal laccases contrasts with the overall level of amino acid similarity, e.g., comparison of the C.parasitica laccase and the A.nidulans laccasel amino acid sequences (Aramayo and Timberlake, 1990) revealed values of 51% similarity and only 28% identity.
Comparison of the predicted N.crassa laccase amino acid sequence with that of the purified mature form of the protein revealed evidence for both N-terminal and C-terminal processing (Germann et al., 1988). Although the N.crassa laccase sequence contains a putative signal peptide sequence, additional processing events appear to result in the removal of a total of 49 N-terminal residues from the precursor protein (Germann et al., 1988). Moreover, there is evidence for the processing of 13 residues from the C-terminus of the precursor. Interestingly, the predicted C.parasitica laccase sequence is 28 residues shorter than that predicted for the N.crassa laccase, and gaps in the alignment of the two sequences fall within these terminal domains. While the N-terminal portion of the C.parasitica sequence contains the hallmarks of a signal peptide (von Heijne, 1986), i.e., a positively charged residue at position6 followed by a hydrophobic core region as revealed by hydropathy analysis (data not shown) and several potential dipeptide cleavage sites, it also contains two large alignment gaps, comprising 15 residues, within the region corresponding to the 49 residues that are processed from the N-terminal portion of the N.crassa laccase sequence. Additionally, the C.parasitica laccase sequence lacks a sequence corresponding to the 13 residue oligopeptide that is processed from the C-terminus of N.crassa laccase. These dissimilarities suggest that different pathways may be involved in the post-translational processing of these related enzymes. A comparison of the processing pathways for the laccases from these two ascomycetes may provide insights into general mechanisms involved in post-translational modification and secretion of fungal proteins.
Laccase gene expression
Southern blot analysis was performed on genomic DNA of the isogenic virulent/hypovirulent strains EP155/EP713. Identical patterns consisting of anticipated 3.3 kbp and 1.3 kbp bands, corresponding to the 5' and 3' portions of the laccase gene, were observed for both strains. Combined, the two fragments span the laccase gene from 1976 nucleotides upstream of the first transcription start site through intron 12 (map positions -1976 through 2669). This result indicates the absence of closely related genes in the C.parasitica genome and confirms that both strains EP155 and EP713 contain the same structural gene. Additional Southern analysis indicated that there was no apparent structural rearrangement of the laccase gene due to the presence of the HAV-dsRNA and that the laccase gene is likely present as a single copy gene in each strain.
The level of accumulation appeared to be influenced by a variety of conditions including the culture medium, the age of the culture and exposure to light, while laccase mRNA accumulation was generally found to be substantially lower in strain EP713 than in EP155.
As shown in FIG. 6, addition of 3 mM cycloheximide to cultures of the virulent C.parasitica strain EP155 resulted in a time-dependent increase in the accumulation of a .about.2.3 kb RNA species corresponding to laccase mRNA. An increase in band intensity was evident by 6 h after cycloheximide addition and was found to reach a level of approximately 15-20 fold by 24 h. Although some variability was observed in the uninduced level of laccase mRNA and, consequently, the final magnitude of induction, the addition of 3 mM cycloheximide consistently resulted in a significant increase in laccase mRNA accumulation.
To test whether the induction of laccase mRNA accumulation was selective, or whether the results reflected a general increase in mRNA accumulation, blots were re-hybridized with probes specific for other C.parasitica mRNAs. These included probes for mRNAs that encode two structural proteins, b-tubulin and actin, and an mRNA encoding the highly expressed protein, glyceraldehyde 3-phosphate dehydrogenase. The levels of b-tubulin and actin mRNAs (1.9 kb and 1.8 kb, respectively) were found to change little during the 24 h incubation period with the small variation observed most likely being related to differences in sample loading. The level of gpd-1 mRNA (1.5 kb) also remained relatively stable over the incubation period, exhibiting a slight increase in accumulation by the 24 h time point.
Laccase activity has been shown to be associated with pigment production in several fungi. For example, laccase is probably involved in the production of a brown pigment during fruiting body formation in the basidiomycete Schizophyllum commune (Leonard, 1971). A role for laccase in the production of the green pigment associated with spores of the ascomycete Aspergillus nidulans has been confirmed by genetic means (Clutterbuck, 1972). In this regard, hypovirulent C.parasitica strain EP713 exhibits both reduced pigmentation and reduced laccase activity. Within the context of host-pathogen interaction, laccase could potentially contribute to pathogen-mediated degradation of lignified zones (Lewis and Yamamoto, 1990) generated by the host as a physical defense mechanism. It is well established that hypovirulent C.parasitica strains are deficient in their ability to form the deep necrotic cankers associated with infection by virulent strains (Hebard et al., 1984, and reviewed by Griffin, 1986).
References
1. S. L. Anagnostakis, Science 215, 466 (1982).
2. M. K. Roane, G. J. Griffin and J. R. Elkins, in Chestnut Blight, Other Endothia Diseases and the Genus Endothia, (APS Press., St. Paul, Minn., 1987) p. 53.
3. G. J. Griffin, Hort. Rev. 8, 291 (1986).
4. W. L. MacDonald and D. W. Fulbright, Plant Disease, 75, 656 (1991).
5. J. Grente, C. R. Acad. Agt Fr., 51, 1033 (1965).
6. J. Grente and S. Berthelay-Sauret, Proceedings of the American Chestnut Symposium, W. L. MacDonald, F. C. Cech, J. Luchok, C. Smith, Eds. (West Virginia University Press, Morgantown, 1978), pg. 75.
7. N. K. Van Alfen, R. A. Jaynes, S. L. Anagnostakis, P. R. Day, Science 189, 890 (1975).
8. P. R. Day, J. R. Dodds, J. E. Elliston, R. A. Jaynes, S. L. Anagnostakis, Phytopathology, 67, 1393 (1977).
9. G. H. Choi, R. Shapira, D. L. Nuss, Proc. Natl. Acad. Sci. USA 88, 1167 (1991).
10. G. H. Choi, D. M. Pawlyk, D. L. Nuss, Virology 83, 747 (1991).
11. R. Shapira, G. H. Choi, D. L. Nuss, EMBO J. 10, 731 (1991).
12. R. Shapira and D. L. Nuss, J. Biol. Chem. 266, 19419 (1991).
13. E. V. Koonin, G. H. Choi, D. L. Nuss, R. Shapira, J. C. Carrington, Proc. Natl. Acad. Sci. USA 88, 10647 (1991).
14. K. W. Buck, in Fungal Virology, K. W. Buck, Ed. (CRC Press, Boca Raton, Fla., 1986), pp. 1-84.
15. R. B. Wickner, FASEB J. 3, 2257 (1989).
16. M. El-Sherbeini, D. J. Tipper, D. J. Mitchell, K. A. Bostian, Mol. Cell. Biol. 4, 2818 (1984).
17. B. I. Hillman, R. Shapira, D. L. Nuss, Phytopathology 80, 453 (1 990).
18. M. Taniguchi, C. Palmieri, C. Weissman, Nature (London) 274, 223 (1978).
19. V. R. Racaniello and D. Baltimore, Science 214, 916 (1981).
20. R. K. Saiki, et al., Science 239, 487 (1988).
21. D. Rigling, U. Heiniger, H. R. Hohl, Phytopathology 79, 219 (1989).
22. L. Roux, A. E. Simon, J. J. Holland, Adv. Vir. Res. 40, 181 (1991).
23. D. Rigling, N. K. Van Alfen, J. Bact. 173, 8000 (1991).
24. C. E. Carpenter et al., Mol. Plant-Microbe Inter. 4, 55 (1992).
25. G. H. Choi, T. G. Larson, D. L. Nuss, Mol. Plant-Microbe Inter. (in press).
26. S. L. Anagnostakis, B. Hau and J. Kranz, Plant Disease 70, 536 (1986).
27. Anagnostakis, S. L. (1982) Science 215, 466-471.
28. Anagnostakis, S. L. (1987) Mycologica 79, 23-37.
29. Anagnostakis, S. L. (1984) In Jennings, D. H. and Rayner, A. D. M. (eds). The Ecology and Physiology of the Fungal Mycelium, Cambridge University Press, Cambridge, pp.353-366.
30. Anagnostakis, S. L. (1990) Forest Science 36, 113-124.
31. Anagnostakis, S. L. and Day, P. R. (1979) Phytopathology 69, 1226-1229.
32. Bavendamm, W. (1928) Z. Pflanzenkrank. Pflanzenkschutz 38, 257-276.
33. Choi, G. H. and Nuss, D. L. (1990) Nucleic Acids Res. 18, 5566.
34. Choi, G. H., Shapira, R. and Nuss, D. L. (1991a) Proc. Natl. Acad. Sci. USA 88, 1167-1171.
35. Choi, G. H., Pawlyk, D. M. and Nuss, D. L. (1991b) Virology 183, 747-752.
36. Churchill, A. C. L., Ciuffetti, L. M., Hansen, D. R., Van Etten, H. D. and Van Alfen, N. K. (1991) Curr. Genet. 17, 25-31.
37. Cullen, D., Leong, S. A, Wilson, L. J. and Henner, D. J. (1987) Gene 57, 21-26.
38. Day, P. R., Dodds, J. A., Elliston, J. E., Jaynes, R. A. and Anagnostakis, S. L. (1977) Phytopathology 67, 1393-1396.
39. Elliston, J. E. (1978) In MacDonald, W. L., Cech, F. C., Luchok, J. and Smith, H. C. (eds) Proceedings of the American Chestnut Symposium, West Virginia University Press, Morgantown, pp.95-100.
40. Elliston, J. E. (1985) Phytopathology 74, 151-158.
41. Grente, J. and Berthelay-Sauret, S. (1978) In MacDonald, W. B., Cech, F. C., Luchok, J. and Smith, H. C. (eds), Proceedings of American Chestnut Symposiuym, West Virginia University Press, Morgantown, pp.30-34.
42. Hillman, B. I., Rae, B., Tartaglia, J. and Nuss, D. L. (1989) In Molecular Biology of Plant Pathogen Interactions, Proc. UCLA Symposium 101, 59-70.
43. Hillman, B. I., Shapira, R. and Nuss, D. L. (1990) Phytopathology 80, 950-956.
44. Jaynes, R. A. and Elliston, J. F. (1980) Phytopathology 70, 453-456.
45. Koonin, E. V., Choi, G. H., Nuss, D. L., Shapira, R. and Carrington, J. C. (1991) Proc. Natl. Acad. Sci. USA (in press).
46. Rigling, D., Heiniger, U. and Hohl, H. R. (1989) Phytopathology 79, 219-223.
47. Shapira, R. and Nuss, D. L. (1991) J. Biol. Chem. (in press).
48. Shapira, R., Choi, G. H. and Nuss, D. L. (1991) EMBO J. 10, 731-739.
49. Van Alfen, N. K., Jaynes, R. A., Anagnostakis, S. L., and Day, P. F. (1975) Science 189, 890-891.
50. Rae, et al. (1989) EMBO J. 8:657-663.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 3(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 12752 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Endothia parasitica (Cryphonectriaparasitica)(B) STRAIN: EP713(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GCCTATGGGTGGTCTACATAGGTGAGCATGCGTTGCTCGATATAGACCGCCATTATTGGT60AACACGCTTGAAGTGTTCTCATCCGGAGAAAGTGATTTGCTTTCTTCCATGAGGCTCCCT120GGAGGGATTGTCCAATAATGGTTGATAATTTTGGTTGCTGCACAACCGGGGCTTTGCCCG180GGGATTTCATCCCGTTCAAGGTGAGGCCCTTGTAGTAACCTCTCCCCGCTGCGTGAGCGA240ATACATAAGTTCACCCAGTACTGACAGTGTCAGCGCCGCACGTGCGTGAAACGTGTGACT300CGCAGACTGAAGCGACCTATGGTGAAAACGGATGTACCATCTAGCTGTGGAGTAGTGACC360CTAGAAGCTAATCCGATGGTTCCACCAGTCGTTGTTTGCCGGCAAACGCCACAAACGGTT420TCGTGCTTTGCGTGAAGAAGCACGGTCTCTTAAGAGTTCATTGGTACGGTTGACCCCGAA480CGAGGTCCGAACATAATGGCTCAATTAAGAAAACCCAGTCAGAGTCTGGTGCTCTCTGAA540AGTGTTGATCCTACTACAGTGGATCCTTTCGTCAGCGTGAGGACGGAAGAGGTGGTCCCT600GCGGGTTGCATAACCCTATGGGAGTACAGAGACTCATGTGGCGACGTGCCTGGCCCGTTG660TCGCATGGTGATCTCCGGCGTTTGCGCACCCCTGACGGGGTATGTAAGTGCCAGGTCCAC720TTTGAGTTGCCGACCGTGCTCAAGAGTGGTTCCACCGGAACGGTCCCGGAACACCCCGCG780GTGTTGGCTGCCTTCATTGGCAGGCCTCGCCGGTGTTCCTTGGAACAACGTACGAAGGAG840TTGGATTCCCGATTCCTTCAGTTGGTGCATGGTGGCCTCCCTGCGAGGCCATCATACATG900ATTGCGCGCCCGCCCAGGCCAGTTCGAGGCCTGTGCTCATCTCGGAACGGTTCCCTTGCT960CAGTTTGGGCAGGGCTACTGTTATCTCTCGGCCATTGTAGACAGCGCAAGATGGCGCGTC1020GCCCGTACCACCGGTTGGTGTGTACGTGTGGCAGACTATCTTAGGCTGCTACAATGGGTT1080GGTCGCCGGTCCTTTGGCTCCTTTCAGATTGAGAAAAGCGCCGTCGACCATGTTTATCAC1140GTGGTCGTCGACGCTGAGTATCAGTCTGAGCAGGATGGGGCCCTTTTCTACCAAGCCATT1200TTGGGTTTGGCCGAGAAGGATCCCCTTGCCCGGATTGGCGGCCGATTGAACCCGCTCGCT1260GCCGAGTTTGCGCCCGGCAGCGCCCTTAGGGTTGAACCTGTGACTCCACAGGTTACCCGC1320CGTAAAGGTTCGACTCGGATGACTGGTCGTGACCCAACCATTGTCTCCGTTGGCAAGGTT1380GGTATGGCCATCACCAGCATCCAGGATGCTCTTGTGGCTACGGAGTTGAGGAACGTCAAT1440TTCGGCCGTCGTGACACGGAAGCTGAGTGTCGTCGCCTTTGGGCGAGATACGAAGTGAAC1500GACTATTTCCGTCGTCACAAGGCCGAACTCCTCAAGTTCGATGCGCGCCTTCGGTCGCGC1560ATGGCCAAGAAACCTGCGTCGTCACGGGCCCGCCCGTCCGACGCAAAGATTCAGTGCATA1620GGGTGGCGTGATCGCCACCTGTTGCCACAACGCCTTGCTGGTCTCTCCAAACAAGGCCGT1680TCCCTCGTCTGGTCGCGGTTCGCGACCAGCAACATCAGACGCAAGACTCCGCCTTGTGTC1740GTCAACCCCAGTGCGGACCCCGTCGTCCATAACTGGAAGGATTCCGCTGCCCTGGCAGTG1800AAGAAAATCGCCGAAGCACGCCGGCGACAAGAAATTCGCGCTGCAGCCTACGCCGAGCGG1860GCCAAAGCTCGGGGGCAGACCAATGTCGTTGCTTCCATTTCGGAAGCAATTGAAACCACT1920CTACGGCGGAATAAAACCCGCTTTGCCTTGGATGGTCTTCATCTGGCGGCATCTGCCATT1980GTCACGACCCGGTTGAGGTCGTGGAACCAAGAGGAAATTCGTGCTGGTCGCGAATTTCGT2040AAATCAACCACTTCCTGGATATGGAGGCATGTGCCTTCATCAATCCAGGACGCCCTGAAC2100CTGACTTCGGTCAGGGACAAGCTCGACCCCGGCCGCGCGTTTGGTTACGTGCAGGCTGCG2160GTTGCGCAGGGCATGTCCGACTTCCGGAGGGCAAAGCGGGCATTGGCGATCGTCGCCAAG2220CCCGTAATCCGGAACATCCGTGACCCCTATGAGCACGGGTTTGTCAAGCGAGATGGTAAG2280CTTCGCCATTCTCGCGACGCATTTAATAAGAAGCTGCGTACAAAGGCCGTGGCCGCCACG2340AAGGTCCACAAAATAAAATTTTAATGTATAAGGAAGCCGAACGACCTATTGAAGTGTGGC2400GAACACAGGTCATGGACGGGCCAACATGGACTGCCCTTTCTGAGTCGTGCAGGGACAGGT2460TGTTCTTTGCATCCGGGGAAGGTGGTGAGCACATGACGCTCGATATCATCCAGCCTGATT2520CGTACACCAAGATACGCTTATTTCGCAGCGGTCGGTTCGAGGTGTCGGTTGACGGAAAGA2580GTTTTGGCCAGGGCGGCAACCGTTATAGATTCGTCTTTCGCTATGACTCTTTGCTGTCGA2640CACCTTTTGGATATCCTGCCGAGGACAAGGAAATAGCGCTTCAGGATTACAATCACAAGC2700AGTTGCTGGGTGAGATGTTCTTGAAGCTTCCTGACTCCTATGTTGACGGGAGACCGATCG2760CTGAGGCTTTCTTTCGTTACGTTGACGACCTGAAATGGGATGTCGGCGTGTTCCGTGACC2820GCAGGTCGCTAACGGAACTTCATTTACCAGCATCATCTGGTTTAACAACTGCACAAGTTT2880CGGTGGCCAAACTCGAATGGCCGCCACTACCTATCATCCAGGCCCAGCCGACAATACTAG2940CCGGTATCATTGACAACTTCAAGATTTGCTTCCCCGTAAACGGGAAATGGATCTATGGTC3000AAGGGTTGTCATGGACCAGATACGATGGCGATGCCTCCGTTCCAACCTCTCTATTGTCCA3060ACCGACAGCACGCGAGGTTCTGGAACGAGAAGGACATCCCCACCGGCCTGAAGCTTTCAA3120AGGAAGGCTTCATCAAGCTCTGGGCCCAGAAATCTCGCAAGTGGCAGGACCACATGGCGA3180GATCGATAGGATTAAGTCACGAGGCCGCTGTAGAGTTGGTTCGTGCAACAAGAGTGAACG3240AAGCAAAGCCCCATCTCGTCCCCATGGAAGAGGCGAAAGAGGCACCTAGGCAGCAGCTTG3300TTCCTAGGCGTTCAACTTTCGTCGATAACCATGAGGAGGAGGTTGAGATTGACACCCTTC3360GGGTGCCGGTCGAAGAGGGTCGATGTTTCGAGCTCTTGTTCAATAATCAAGTAACCCCTG3420CAATTTTCGACAAGAAGCCATTGCTTAAAGACGTCCTCGGCGTGTTCGAAGAGAATGTCT3480GCACGATGGACTCGCTCGAAATCAGTCACAGTGACCAATGCGTGCACATTGTCGCTGGTG3540AAACCTTCCGGAACTACGATGAAATCAAAGCCGTTCTCGAGGTCATTCTTGAGAACGAGC3600CTGACATCCTCGTTGGAGCTGAAGAAGGTTCAGTCGCTGATTATGTGAAAGCGGGCAAAC3660ACTTCTTGTTTGAAAACCACCAGTGGGTCAGAAATGGGCTCAAGCTAGCGAAGGGTCTAG3720CTGAACCTGGCCAAAGGGCCAAAGATAATACCAACCCTTCGACACCTAGGCCGATTGAAG3780ACGCTGACTACATTCATCCTTTTGACAACGGACAGCCCCTCCCGGGCAGGTCCGACCAAT3840GGGTCAGCGGCTTTGAAGTGACGAGGTTACGTCACCATGACGAAATGCCACACATTAGGA3900GTGTGAGGAACACGGGCATCCATGGGCTACCTGGGGATTTCTTGTCGAATTACCCTAGAC3960TGCCTACGCCTGTATTTCATCGCCTCCGCGATTTGTGGGATGATGTCATCGGCATACTGA4020TGAAGCTTGAATTCGGGGACAATTGTTCACCGGTGCTCAACGTGACTGCTAATGCAGACT4080GGGTTCGGTCAGAGACGACGATAAATTTTATCTCTGACCAACCCGGCAAGGCTCAGTCAC4140GTCCTCGCGAAGATGGGGGTTTTGACATCCTCGTTCCTTGCAGGGGCATCGCAACCCGAA4200GCATCAGGCTTCTGCCTCTATTCATCAGACTGCCAAACCGTTTCAGGGCCGTGGCTTTGT4260TAAACGGTAGGCAGTCTGATTATGACAATTATGGTTGGCCAGTGTTCAATCCGGTCATCC4320CATTGCCTCAGATGGACTCCTTCTACGTGGAGGCCGTCGCCGCTGGCAGATCAATGTACC4380CACCTGGTTTCCTCCTAGGTAGGTATGACGCACTAGAGTATCTAGTGCACACTGCGACGG4440TGTATGGCGCTGAGGAAGCCTTCTTGCTTCCGTTCACGCATCATGTGAGAGTGTATCCCC4500CTCCCCGTCCAGGGAGGGAGATTCCTTTCGGCTCGTGGTGCAAGAACTACAAGTTCGAAG4560CAGAAAGGTTTTGGTATGACGCGGACTGGAAACTGAGGGTCCACGAAACCAACCACGATT4620TTGACAGGTTAATCGAAATAACAAAAACCTGTCGCCGCAACCCCCCCGAAGAAAACTTGC4680AAGCAAAACTGGAGGACACCGCGCGCAAGGTGTGTAGTGTATGGCAATATAACATCATGA4740TCGCTTCATCTGTCGCGTTTCTAGTGCCATTATACTTCACACTCTATGTGCCGTACCTGC4800AATTCTACTTGCATGTTGACCCAGGCGATTACATATTGCTTCCACCGGTGCTCTGGTTGG4860TCTGGACCAATCTTTGCTACGGCTACGCGTGTGACGCCTGGTGCCGTTTATTTTTCTTCG4920TAGAGGAGGCGGGAAAGAAAGAACTTGTCCATTCAAGTGAGGAGTTTTCCAGTGACCCGT4980CATCCACGCTCTTGATCCCGACAATGGGAACAAGAGGAGATCACGTGCCACCACGGTTCT5040TCGCCAACATGGCGGTCCTCGCAGGTGTCAAGACCCATCTCTTGAAACTGCAGACTGCGA5100CGTACGGCGATTTGGAGAACCTCAAGAAAGGGAAGCTCGGAAGCTTGTTGCCAGGCTATC5160TTCAGAACCATTACTCGGTGCTGAGGGGTTACAAAGCCGCGTTCACTCCGCATGTCGAGC5220TTGACATGCCGAACGCAACTTCGTACAACTTAGCACCGCCTCGCAGCTACATCAACAAGA5280TACGGTACCTGACCGATGAAAATCGGTCGGGCGCCAGTATGATTGATCGCGCTGTGACCT5340GGTTCGCCGAAGAACTGGCAGACACGTTCTGGCCCGACTGGCAAATTGGTTGCCTTAGAG5400GTTGCAATTTACCGCGTTCCGCGGATGGTGTTTCCCTGATCACCAAACAACCCAACCTTA5460AAACAGGGAAAATCGGATGGCTACATGGCTCCGCTGATCCAGCTGTGGTGCCTAAGGACA5520TCAGGGACAAGTACCCCCTGGTTCCGAACGGTGACCACAACGAGATCTTCAGGCATTATG5580ATAAGATTTACATGCCTGGTGGAGCCGGTGCCGTCCAAACCGCAATCGCTTGTGGATGCG5640AAGTCGTCGTCACAGACGTCAACCTTGACAGAGATTATCACACAATGCCTACGCAGAAAG5700ACTTTCACCAACCCTCCATACTGCCATACTTCGCATGGCTGTGGAGGCAAGGGTTTGATG5760TTAAACTGCCACGCGTGTTGCTCGTCATAGGCTGGCTGAAGTTTCATTACTCCATCCGCT5820ACAAGCATCTGGAATTCGCCGCTGACTTCGTCATCAGGGCTGGGTTGTTCTGGTGGTATG5880GGTGCTTGCACCTACTACCATTCATGGCAGCCGCGATCATGGCACCAAGGTTCGTTAAGA5940AGTACTTGGTTGGCATGGCGTGGTTAACTGAACCCGGTCTCCTAATGCTGAAGGCGCTGT6000GGCGTTTTCCAATTTTCATGGTCACCCCAAGGTGGATGCTGCCGTTCATTGTAACGGTTT6060CGGTATACAATTGGTGGTGGCCGTTATCCCAAGACGGGCTCAACTACGCGAGCAAACGGT6120TTGAATTGATCTTCGAACCGGTAACTCGGGGTAAGCACACGTTTTCCTACCCATTCGGGC6180ACTGGTGTTTGCGTGACACCAACTCGATGATTGTTTACGAAGGAAAATTTGTCAACCCAA6240GTGAGACCTCAATCGGGTCTCCCTTCAAGTTGTCGAAGTCCGTTAGACCGGTCCGACCTG6300GCGCAGTGTTCCACCTGGTGCCTTTCCACGTCCAGAAGCTTCTGGATTCAATGGATGAGG6360CACCACTACCTTACAGCGCGAATCACAATTGCACGACCGTGATCCTCAAGGGGATCATGT6420ACCGTAGTGCACTAGGTTTTGTATTCGCGTATATGGTTTCGTGGGCGGTGTACCTGGTCC6480TCCGGCCTCCTCAAGCCGCGGCTACCGTTTATCACTGGGTGTATCCCGAGCGATCGTGGG6540ACACATCAAGGCTGTATCATCTGCTGCTGGGTTTCGCAGCAGGTGGCACGGTGCCAATGG6600AAGTGATAGACGAAGAGCACGTTGAGGAAAAGCCTTCGGTTGCTGGTCAGTCAGAGCCAG6660CCGCCGAAATCGACAATGACAAAATTTCTGACTATGACCAAGAATGGTGGGGGAGTCAAG6720ACAGTATTGACACAGTGGTTAACGACCTGTGTTACTTGCTGTCCTTCCTGAAAGATACGG6780CGATCCCTGAAGAGGTCAAACTCGATGTAGTCGAACTGGCTTACACCCAGCTTGTCCAGG6840ACGAAAAGGAACGCATACCAGAACCGAAGGGAACTAAGATTCTGGACATGCCGAATTGGA6900AGCCTGGCAACTGGGCCAAGTTAATAGACGAGACGCATCGGGTGCTCTCCCAGTTTACTC6960AATATACACCGCGAGTTCTCAACGAACTCGTCGTGTGGTTGAAAGGACTAGGGGAGAACC7020TCTATAGGGTCGCTGAACCCATTCTTATGCTATTAGTACGTGCGATGAGAGCTGCCAAAT7080CCGTGAGTGATCGTGCCACACGTTCCGTATATCACTGCCTCTGCCATTGGCTAGACGTGA7140TGTATGGCGGCTCCGCCCCTACCAGGGTGAAGACCGTGTGGGGACTCACAGGCCTGGTGG7200CTTCTGGCATGACCAGTCAGAAAGCCATACTCGCTCAGAACATAGCAATGATGGAATACC7260AGGGCAGAGGGAATTTCCTTGATGATTATGACAACTTTGTCTCCAACATCAAGGAACCCG7320GGAAAGGACTACCTGGTATAAACACCATCGGAGGGCCACAACGACGTCCGATTCGATACA7380AGAACCCTGTCATGTCTCACCAGGCTGCCGAAATCTGTGGATTGAAGCCTGGGGAGTATG7440AAGTGGATGATAGGTATCAGGAAAGGATAAACGATTACCTTGCGGAAGGGATCCCGCAGG7500CAGTCGATGGCGTCCTCTTTGGAGACAGGAATCCCGACAGGATCGCGCGATCCATAAGCC7560GATATGAACCCGAATACTCTGGCTGTTCGCCTGAGGACAAGGCCTTGGTGGAGGATACCG7620CCAGGGCCATGTTCGAACAATGGCCAGAAGTGTTCGCCGATCGAGACATCATGCTCCCTA7680AAGGTGTAGAACTTTACATCAAAGAGAAGTACTCGGCGGGCACCCCGTTCATAAGCTCGT7740TCTATAAGAGTAGAAAGGCTCTTAAGCAAGCTGGTGTCATGGATGTGATCCGTAAAAACG7800CACTGGAGTGCATCAGTACCGGTAAATACCCTACGCAATTTTACCACGCGTTCGCGAAGT7860CACAAGCGGTTCCTGGCCAACCTTTGTTGGCTCCCCGCATGAAGGACTTGCGAACGGTGG7920TCTCCGAGGATCTATCCGCTTACATGGTCGACCAGATCTTTCAGATCGAGGCCAACAAGC7980GAATAACCTGGGAAACGTACGGTGCCGGTTCTGGCATGCCTTTGTCACAATCGATGGCTC8040GCATTTGGGACGAGCTGCATGATTTGAGGAAACGCGAAGGAGGGCAGTTCATCATTGCTG8100ATGCGACTGCCTACGACTCAAACTGTAAACCAGCATTGTTCCATGGGGCTGGCAAACTGG8160TTGAGTTAGGTTTCCAAAATCATCCGAGTGGCAAAGGACGACAATTCGCACAAGTTGTCC8220AGTGCAAATTCGAGGCCATGCAAAATGCATGGGTCATGGGGATAACCGAACCTTCCTATA8280CCGCCTTGACTTTCCACGTCCCTGACGTGGCGGTGAGGCATGAACTGGAATCCAAGTACC8340CTGCACACTTTGCGACGTTCAGCGAGCTTCTGGCTCACAATAATGTGAACGTCACTGAGT8400GGAAGAGGTTATCTTGGGAGGAACGGAAAGCATGTGCTCGTGACATGCAGGCCGTTCCTG8460GCAAGGTTTTCCTTACCAATGATCCAGCATTGCGATTGCAAGGCTCGTCATGGCAAGGTT8520CTTTCACCACCGAACCCAAAAGGGACGAATTCCGGAAATACCAAACTTATTTCTATGATT8580CGAAGGCGGCAATGAGAGAAGATATAAAGCGTATTGTCTTCGCCAATCGCGAAGTCATAT8640CCAACGTCCACCACAAGAACCGTGGTGGAGGCACTGGTCAGAGTGCCACTTCGTGGGACA8700ATACAGCTACATTCAAACTTGGCGTCATCAGCGCCTGGGCACGCGCTACTGGTAAACCGC8760CCAAAGATTTCTTTTGTTCAAACAGGCTCTACAATACGAGCGATGACACAGTGTGGTGGT8820CTAAGGACCTGTTATCCTCTGCCGAGGTTGATCGCTTCAAGCAAGCTGCCGCCGATTTTG8880GCATCCTGCTTGAGATCGGGTCGACCAAGAAGATAACAGAAGTGGAATACTTATCGAAGT8940TGCCACGTCGCCCAACCGCAGAAGATTCAGCGGACTATCGGGCATGGAGGCAGGGAAGGA9000TCGAGAACATGCGATCCTCAGGCCGGTTCAGTGAAGAGCAGCTTCTCTCCATTGAACGCG9060AGCAACTACCTCAATTCCTGATGGTCCAGAACCCCACGGCTATTCTAATGCGAAGGACTG9120CTTTCCGTTATTATCAGAGCAGTCCCTCGAAGTTCCTGTACACCTCGTGTGAACGGGGTG9180CCGGTCACGCACTCGTGACGGCATTCCAGCCCGCACTGTACAAGAGGTTCGCAATTGAGT9240ACGCCGAGGACCTGAATCGTCTCTGCAAGGAGCACCACATCAATCAGCGCTACGAGCTCG9300TCAGTCAACAAGATAGGATGAAGATGCAGGTTATAAACGTGAACCCGAACTGGAAACGGA9360ACTTCAAGTTGTCACCAAGACAAGAAGCATTCCTTCGGTGGATCAGGCAGGCCAAGTTTC9420CATCTTATCGACAAGTTCTAGACATACACCTCAGGATAAGGGATCCTGACCCATCCGCGC9480ATGATCGCTTTATCGCCAAACTGGATCGCGCTTGGCGCAATCCAGATGAGGGGATCCGTG9540ATATAGTGGACGGGGTGTATCGCTACACGGACATGATACCTGAGGAGTTTAAAAGGTTCA9600TGCCGTCTACGGACATGCTGTATGCCGAGAATCCGTGGCACACTCACAACCAGTATGTGG9660AGAAATTCATATACCTCAAGTTGCTGGAAACCACGACCGTTGACGAGCTCACGTTCGCCC9720AATTTGATGCCGTCGCTAAGGAGTCCCCTTACGGCATCTGCATGAATACGATAAAGTTCT9780GGGAAGACCTAAGAGACCCTGACTATCTGAAGGATCTCTTGGCCTCCGAGGCCATGATAG9840ATAAGGTGCGCATCTACCAAGGCATGACTGTCATCATCTCGGCCATGTATTTCGCAATGC9900ATTGGGTCGAGCTGTTTATTCAGTCACTGTTCTTGATAGGGCCATTATATAATCTATTCA9960TGTGGTCGTTCTGGGGATTGTCAAAAGTCTACGGACTGGCGAACACGTTTTATTGGCATG10020GTAAAGCCCGCTCGAGCAGAGAAATCAGCTCGATCCTGCCAAGAGACCCATACATGTGGT10080CTAAACGTTTCGTCAGCACGATGGCTGATTTCATCCCTGAACGATTTGCTCTCGGTATCG10140TTCCCGTGACCTTGGTCTTGGATGGTCTCGCCGAGATCATCGAAGTTCTATTTGGGCGCA10200TGTGGAGACTGTTTGCGAATCTGAAATCGGTAGGCACCGACTTCAGTGACGCACGATCTG10260GCAAATCGTTAAATGTGCCGTCCAATCCTTGGGCCGCGTACGCCCACACGTACGCAACAA10320AAGCCATCGAGCACGGTCACGTTACTGTAGCCGCAAAAACCGCTTCCGGTAAGTCCACTT10380TCTTCCCCGCAGCGGTGTGGGCGGAGAGGAGGAACATCGGAATCAAGAAACTGTGGATCG10440TTATGCCAAGGAAGATCCTCCGCGATAACTGGGAGATTCCATTTGACATCCGATCTCAAA10500TCGTGAAACGGGGCAAAACACTAGACCCATCGGCCGATATCTACGTGACCACGTACGGAC10560ATTTCCGAACGAGGATAGGTGGACTGGTCCCGAGGGACAACCTGGTGTTCTTCGATGAGT10620TTCACGAAATGGACGGTTTCATGCTACAGGACGTGGAAGACTGGAAAGGACCAACCATCT10680TCATGAGTGCAACTCCTGTTGCACTTCATGGAATGGCCGGCATCCCTTTTCTTGAGCCAA10740CACTGCCAAAGCGTTTCAATCTTACCGTTTACAAGGTTGATTCCGATGACGTGTTGGAAA10800TGTGGAACCGGGCTCGGAATCAGTTTGCTGATCAGCCCGAATTGTTGGCCCGCCCAATGA10860TCATAGTCCCCACATATAACGAACTCAAGAAGACGATTGCTGGATTGGAGAACTTGGACA10920GGTCTATCACGTGGCATGAGGTGAGCAGTAATAGCCCCCTCGTGCCTAAGACTGGTGGCC10980TCGTGTGCACGCCATATGTACAAACTGGCATCGATATCAAACCCGCGCCGTCGATCTTGA11040TCGACAGCGGCCGAGATGTCATTGTGCATAAGGGTAGGCTAGTCACACCCCACCCCTATA11100CGGACGAGAAGACCAACGAACAGAGGGTCAATCGTGTCGGTAGGACGATGGATGGTGTGG11160TCATACAGCCGCAACTGGCTGGCACAGGCAACCCTCCTGTCAAGTATCCTAGTGGGATTT11220TCTTTTCTTCAGAGTTAGTCGCGGGGCAGTACAAGGTCCCCCGATTAACTAAAGTCAATG11280GTTGTGTCCACCCGGAACTGCCGTACATGTCAATCAAGTACACATCCGAGCTTTCAGACC11340CCGCTAAAGCAAGGGAGGAGGAACAAAGCGTGACGAAATCGCTCCTGTTTATCCATCTCA11400TGGCATTGGCGGGCGTCAGGCAGTCCGAATGGGCCTTGCGTTACAATCGATACTTTGAAC11460TTCACCTTCCTTTCGGGGAAGATGAAGATCATTTGGAGCGCATCTTAACGTCGGGTAAAC11520TGAGGTATGCTAACCACATACCAGTTGACATGGCCATGCAGTTGCTGGGCAACGGGCACG11580TTACATGGGGCATCGGTGGCGTCCCCACAATAACGCGACCAAGATATCCTTGTGATGGGA11640TGTGGGTGGAGGATCCCTCCTCCCGTAAGTCATATGCGCACAAGGTACTTCTACACCAGC11700GGGAACATGCAGAGATCGGCATGTGGCAAGCGCAGGTCAACGAGCTCAGAGCCCAGAACC11760TTGCCCTTCAGTCACAGCTGAGATCAGCATGCACCCGAAGAAGCACAGCAGGTCGCATCT11820TACGACACACCCGTCCTCCGGATATACCTGTTTGCGGTTAACACAAACCGCCTTCCATTT11880GTCATTTCCTTTGTCCTTTCCACGGGAGTAGTGACCCCGTGACACGCCAAAACCAGCACC11940TGAAGTGGATAACTCAAGCCTATGACATGGTCACTGCCCGTCAGTAAAGACGTTAACCCG12000GGAGCTGATTCTGTTAACAGCCGCACCGCGAACGGTACGTAGATTAAATCTACGGTTTTC12060TGCCTCCTGAGAGATTGGCAGGGGAAACCCGCTGAAGAGTCCAGGACCGAACACGACCAC12120CATTCCGGCGAATGGTTAGGCCTCGGGAGATGCAATTGTGCCTCATCACCACACCCACGT12180GACCAATGAGACCAACTCGCAAAGGAGCAGGAAACACAGTGCAACTGTCGGCCAGCAATA12240GGGCTAGAAATACTAAATACCTTTAACTTGGTGGTAGGCGTGTACCGAACGACCCCGGCC12300CAGAAGACCAGGGCTGATGCTTGTTAGGCAACGGCAATAAGACCGAAGCAAGCACAGAGA12360CTGGAAAAGTAAGCCGGATCCGTCGACGTAGGATCGTCTACATGTTCAAGAAATGGGCGA12420AAAGGGTTGCCCGAAAGTATGGGCTACGCGCTTCGTTGTAAAGCTACCCATACAAAACCC12480TTCGGCGCACTCACAACTGAAATGTTAGTGTTTCAACATCTCAGGAGTTTTAGTGTTACC12540GTCCTGCGCAAGCAAAGATGAGAACTATACCTTTGACAACAAAGGGTATAGGGATCGGAA12600AGGCCGCTGCAGTAGGATTCAGACAAATAAATTTTCTCTTGAAAATGTCCGCCGTTTTCT12660TTTGTTGGCTATTCCCTTTCACCGTGCGTACGGTGGGAAGAGAACAACAAAGAAAAAAAA12720AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA12752(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 622 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Endothia parasitica (Cryphonectriaparasitica)(B) STRAIN: EP713(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAlaGlnLeuArgLysProSerGlnSerLeuValLeuSerGluSer151015ValAspProThrThrValAspProPheValSerValArgThrGluGlu202530ValValProAlaGlyCysIleThrLeuTrpGluTyrArgAspSerCys354045GlyAspValProGlyProLeuSerHisGlyAspLeuArgArgLeuArg505560ThrProAspGlyValCysLysCysGlnValHisPheGluLeuProThr65707580ValLeuLysSerGlySerThrGlyThrValProGluHisProAlaVal859095LeuAlaAlaPheIleGlyArgProArgArgCysSerLeuGluGlnArg100105110ThrLysGluLeuAspSerArgPheLeuGlnLeuValHisGlyGlyLeu115120125ProAlaArgProSerTyrMetIleAlaArgProProArgProValArg130135140GlyLeuCysSerSerArgAsnGlySerLeuAlaGlnPheGlyGlnGly145150155160TyrCysTyrLeuSerAlaIleValAspSerAlaArgTrpArgValAla165170175ArgThrThrGlyTrpCysValArgValAlaAspTyrLeuArgLeuLeu180185190GlnTrpValGlyArgArgSerPheGlySerPheGlnIleGluLysSer195200205AlaValAspHisValTyrHisValValValAspAlaGluTyrGlnSer210215220GluGlnAspGlyAlaLeuPheTyrGlnAlaIleLeuGlyLeuAlaGlu225230235240LysAspProLeuAlaArgIleGlyGlyArgLeuAsnProLeuAlaAla245250255GluPheAlaProGlySerAlaLeuArgValGluProValThrProGln260265270ValThrArgArgLysGlySerThrArgMetThrGlyArgAspProThr275280285IleValSerValGlyLysValGlyMetAlaIleThrSerIleGlnAsp290295300AlaLeuValAlaThrGluLeuArgAsnValAsnPheGlyArgArgAsp305310315320ThrGluAlaGluCysArgArgLeuTrpAlaArgTyrGluValAsnAsp325330335TyrPheArgArgHisLysAlaGluLeuLeuLysPheAspAlaArgLeu340345350ArgSerArgMetAlaLysLysProAlaSerSerArgAlaArgProSer355360365AspAlaLysIleGlnCysIleGlyTrpArgAspArgHisLeuLeuPro370375380GlnArgLeuAlaGlyLeuSerLysGlnGlyArgSerLeuValTrpSer385390395400ArgPheAlaThrSerAsnIleArgArgLysThrProProCysValVal405410415AsnProSerAlaAspProValValHisAsnTrpLysAspSerAlaAla420425430LeuAlaValLysLysIleAlaGluAlaArgArgArgGlnGluIleArg435440445AlaAlaAlaTyrAlaGluArgAlaLysAlaArgGlyGlnThrAsnVal450455460ValAlaSerIleSerGluAlaIleGluThrThrLeuArgArgAsnLys465470475480ThrArgPheAlaLeuAspGlyLeuHisLeuAlaAlaSerAlaIleVal485490495ThrThrArgLeuArgSerTrpAsnGlnGluGluIleArgAlaGlyArg500505510GluPheArgLysSerThrThrSerTrpIleTrpArgHisValProSer515520525SerIleGlnAspAlaLeuAsnLeuThrSerValArgAspLysLeuAsp530535540ProGlyArgAlaPheGlyTyrValGlnAlaAlaValAlaGlnGlyMet545550555560SerAspPheArgArgAlaLysArgAlaLeuAlaIleValAlaLysPro565570575ValIleArgAsnIleArgAspProTyrGluHisGlyPheValLysArg580585590AspGlyLysLeuArgHisSerArgAspAlaPheAsnLysLysLeuArg595600605ThrLysAlaValAlaAlaThrLysValHisLysIleLysPhe610615620(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3165 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Endothia parasitica (Cryphonectriaparasitica)(B) STRAIN: EP713(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:MetTyrLysGluAlaGluArgProIleGluValTrpArgThrGlnVal151015MetAspGlyProThrTrpThrAlaLeuSerGluSerCysArgAspArg202530LeuPhePheAlaSerGlyGluGlyGlyGluHisMetThrLeuAspIle354045IleGlnProAspSerTyrThrLysIleArgLeuPheArgSerGlyArg505560PheGluValSerValAspGlyLysSerPheGlyGlnGlyGlyAsnArg65707580TyrArgPheValPheArgTyrAspSerLeuLeuSerThrProPheGly859095TyrProAlaGluAspLysGluIleAlaLeuGlnAspTyrAsnHisLys100105110GlnLeuLeuGlyGluMetPheLeuLysLeuProAspSerTyrValAsp115120125GlyArgProIleAlaGluAlaPhePheArgTyrValAspAspLeuLys130135140TrpAspValGlyValPheArgAspArgArgSerLeuThrGluLeuHis145150155160LeuProAlaSerSerGlyLeuThrThrAlaGlnValSerValAlaLys165170175LeuGluTrpProProLeuProIleIleGlnAlaGlnProThrIleLeu180185190AlaGlyIleIleAspAsnPheLysIleCysPheProValAsnGlyLys195200205TrpIleTyrGlyGlnGlyLeuSerTrpThrArgTyrAspGlyAspAla210215220SerValProThrSerLeuLeuSerAsnArgGlnHisAlaArgPheTrp225230235240AsnGluLysAspIleProThrGlyLeuLysLeuSerLysGluGlyPhe245250255IleLysLeuTrpAlaGlnLysSerArgLysTrpGlnAspHisMetAla260265270ArgSerIleGlyLeuSerHisGluAlaAlaValGluLeuValArgAla275280285ThrArgValAsnGluAlaLysProHisLeuValProMetGluGluAla290295300LysGluAlaProArgGlnGlnLeuValProArgArgSerThrPheVal305310315320AspAsnHisGluGluGluValGluIleAspThrLeuArgValProVal325330335GluGluGlyArgCysPheGluLeuLeuPheAsnAsnGlnValThrPro340345350AlaIlePheAspLysLysProLeuLeuLysAspValLeuGlyValPhe355360365GluGluAsnValCysThrMetAspSerLeuGluIleSerHisSerAsp370375380GlnCysValHisIleValAlaGlyGluThrPheArgAsnTyrAspGlu385390395400IleLysAlaValLeuGluValIleLeuGluAsnGluProAspIleLeu405410415ValGlyAlaGluGluGlySerValAlaAspTyrValLysAlaGlyLys420425430HisPheLeuPheGluAsnHisGlnTrpValArgAsnGlyLeuLysLeu435440445AlaLysGlyLeuAlaGluProGlyGlnArgAlaLysAspAsnThrAsn450455460ProSerThrProArgProIleGluAspAlaAspTyrIleHisProPhe465470475480AspAsnGlyGlnProLeuProGlyArgSerAspGlnTrpValSerGly485490495PheGluValThrArgLeuArgHisHisAspGluMetProHisIleArg500505510SerValArgAsnThrGlyIleHisGlyLeuProGlyAspPheLeuSer515520525AsnTyrProArgLeuProThrProValPheHisArgLeuArgAspLeu530535540TrpAspAspValIleGlyIleLeuMetLysLeuGluPheGlyAspAsn545550555560CysSerProValLeuAsnValThrAlaAsnAlaAspTrpValArgSer565570575GluThrThrIleAsnPheIleSerAspGlnProGlyLysAlaGlnSer580585590ArgProArgGluAspGlyGlyPheAspIleLeuValProCysArgGly595600605IleAlaThrArgSerIleArgLeuLeuProLeuPheIleArgLeuPro610615620AsnArgPheArgAlaValAlaLeuLeuAsnGlyArgGlnSerAspTyr625630635640AspAsnTyrGlyTrpProValPheAsnProValIleProLeuProGln645650655MetAspSerPheTyrValGluAlaValAlaAlaGlyArgSerMetTyr660665670ProProGlyPheLeuLeuGlyArgTyrAspAlaLeuGluTyrLeuVal675680685HisThrAlaThrValTyrGlyAlaGluGluAlaPheLeuLeuProPhe690695700ThrHisHisValArgValTyrProProProArgProGlyArgGluIle705710715720ProPheGlySerTrpCysLysAsnTyrLysPheGluAlaGluArgPhe725730735TrpTyrAspAlaAspTrpLysLeuArgValHisGluThrAsnHisAsp740745750PheAspArgLeuIleGluIleThrLysThrCysArgArgAsnProPro755760765GluGluAsnLeuGlnAlaLysLeuGluAspThrAlaArgLysValCys770775780SerValTrpGlnTyrAsnIleMetIleAlaSerSerValAlaPheLeu785790795800ValProLeuTyrPheThrLeuTyrValProTyrLeuGlnPheTyrLeu805810815HisValAspProGlyAspTyrIleLeuLeuProProValLeuTrpLeu820825830ValTrpThrAsnLeuCysTyrGlyTyrAlaCysAspAlaTrpCysArg835840845LeuPhePhePheValGluGluAlaGlyLysLysGluLeuValHisSer850855860SerGluGluPheSerSerAspProSerSerThrLeuLeuIleProThr865870875880MetGlyThrArgGlyAspHisValProProArgPhePheAlaAsnMet885890895AlaValLeuAlaGlyValLysThrHisLeuLeuLysLeuGlnThrAla900905910ThrTyrGlyAspLeuGluAsnLeuLysLysGlyLysLeuGlySerLeu915920925LeuProGlyTyrLeuGlnAsnHisTyrSerValLeuArgGlyTyrLys930935940AlaAlaPheThrProHisValGluLeuAspMetProAsnAlaThrSer945950955960TyrAsnLeuAlaProProArgSerTyrIleAsnLysIleArgTyrLeu965970975ThrAspGluAsnArgSerGlyAlaSerMetIleAspArgAlaValThr980985990TrpPheAlaGluGluLeuAlaAspThrPheTrpProAspTrpGlnIle99510001005GlyCysLeuArgGlyCysAsnLeuProArgSerAlaAspGlyValSer101010151020LeuIleThrLysGlnProAsnLeuLysThrGlyLysIleGlyTrpLeu1025103010351040HisGlySerAlaAspProAlaValValProLysAspIleArgAspLys104510501055TyrProLeuValProAsnGlyAspHisAsnGluIlePheArgHisTyr106010651070AspLysIleTyrMetProGlyGlyAlaGlyAlaValGlnThrAlaIle107510801085AlaCysGlyCysGluValValValThrAspValAsnLeuAspArgAsp109010951100TyrHisThrMetProThrGlnLysAspPheHisGlnProSerIleLeu1105111011151120ProTyrPheAlaTrpLeuTrpArgGlnGlyPheAspValLysLeuPro112511301135ArgValLeuLeuValIleGlyTrpLeuLysPheHisTyrSerIleArg114011451150TyrLysHisLeuGluPheAlaAlaAspPheValIleArgAlaGlyLeu115511601165PheTrpTrpTyrGlyCysLeuHisLeuLeuProPheMetAlaAlaAla117011751180IleMetAlaProArgPheValLysLysTyrLeuValGlyMetAlaTrp1185119011951200LeuThrGluProGlyLeuLeuMetLeuLysAlaLeuTrpArgPhePro120512101215IlePheMetValThrProArgTrpMetLeuProPheIleValThrVal122012251230SerValTyrAsnTrpTrpTrpProLeuSerGlnAspGlyLeuAsnTyr123512401245AlaSerLysArgPheGluLeuIlePheGluProValThrArgGlyLys125012551260HisThrPheSerTyrProPheGlyHisTrpCysLeuArgAspThrAsn1265127012751280SerMetIleValTyrGluGlyLysPheValAsnProSerGluThrSer128512901295IleGlySerProPheLysLeuSerLysSerValArgProValArgPro130013051310GlyAlaValPheHisLeuValProPheHisValGlnLysLeuLeuAsp131513201325SerMetAspGluAlaProLeuProTyrSerAlaAsnHisAsnCysThr133013351340ThrValIleLeuLysGlyIleMetTyrArgSerAlaLeuGlyPheVal1345135013551360PheAlaTyrMetValSerTrpAlaValTyrLeuValLeuArgProPro136513701375GlnAlaAlaAlaThrValTyrHisTrpValTyrProGluArgSerTrp138013851390AspThrSerArgLeuTyrHisLeuLeuLeuGlyPheAlaAlaGlyGly139514001405ThrValProMetGluValIleAspGluGluHisValGluGluLysPro141014151420SerValAlaGlyGlnSerGluProAlaAlaGluIleAspAsnAspLys1425143014351440IleSerAspTyrAspGlnGluTrpTrpGlySerGlnAspSerIleAsp144514501455ThrValValAsnAspLeuCysTyrLeuLeuSerPheLeuLysAspThr146014651470AlaIleProGluGluValLysLeuAspValValGluLeuAlaTyrThr147514801485GlnLeuValGlnAspGluLysGluArgIleProGluProLysGlyThr149014951500LysIleLeuAspMetProAsnTrpLysProGlyAsnTrpAlaLysLeu1505151015151520IleAspGluThrHisArgValLeuSerGlnPheThrGlnTyrThrPro152515301535ArgValLeuAsnGluLeuValValTrpLeuLysGlyLeuGlyGluAsn154015451550LeuTyrArgValAlaGluProIleLeuMetLeuLeuValArgAlaMet155515601565ArgAlaAlaLysSerValSerAspArgAlaThrArgSerValTyrHis157015751580CysLeuCysHisTrpLeuAspValMetTyrGlyGlySerAlaProThr1585159015951600ArgValLysThrValTrpGlyLeuThrGlyLeuValAlaSerGlyMet160516101615ThrSerGlnLysAlaIleLeuAlaGlnAsnIleAlaMetMetGluTyr162016251630GlnGlyArgGlyAsnPheLeuAspAspTyrAspAsnPheValSerAsn163516401645IleLysGluProGlyLysGlyLeuProGlyIleAsnThrIleGlyGly165016551660ProGlnArgArgProIleArgTyrLysAsnProValMetSerHisGln1665167016751680AlaAlaGluIleCysGlyLeuLysProGlyGluTyrGluValAspAsp168516901695ArgTyrGlnGluArgIleAsnAspTyrLeuAlaGluGlyIleProGln170017051710AlaValAspGlyValLeuPheGlyAspArgAsnProAspArgIleAla171517201725ArgSerIleSerArgTyrGluProGluTyrSerGlyCysSerProGlu173017351740AspLysAlaLeuValGluAspThrAlaArgAlaMetPheGluGlnTrp1745175017551760ProGluValPheAlaAspArgAspIleMetLeuProLysGlyValGlu176517701775LeuTyrIleLysGluLysTyrSerAlaGlyThrProPheIleSerSer178017851790PheTyrLysSerArgLysAlaLeuLysGlnAlaGlyValMetAspVal179518001805IleArgLysAsnAlaLeuGluCysIleSerThrGlyLysTyrProThr181018151820GlnPheTyrHisAlaPheAlaLysSerGlnAlaValProGlyGlnPro1825183018351840LeuLeuAlaProArgMetLysAspLeuArgThrValValSerGluAsp184518501855LeuSerAlaTyrMetValAspGlnIlePheGlnIleGluAlaAsnLys186018651870ArgIleThrTrpGluThrTyrGlyAlaGlySerGlyMetProLeuSer187518801885GlnSerMetAlaArgIleTrpAspGluLeuHisAspLeuArgLysArg189018951900GluGlyGlyGlnPheIleIleAlaAspAlaThrAlaTyrAspSerAsn1905191019151920CysLysProAlaLeuPheHisGlyAlaGlyLysLeuValGluLeuGly192519301935PheGlnAsnHisProSerGlyLysGlyArgGlnPheAlaGlnValVal194019451950GlnCysLysPheGluAlaMetGlnAsnAlaTrpValMetGlyIleThr195519601965GluProSerTyrThrAlaLeuThrPheHisValProAspValAlaVal197019751980ArgHisGluLeuGluSerLysTyrProAlaHisPheAlaThrPheSer1985199019952000GluLeuLeuAlaHisAsnAsnValAsnValThrGluTrpLysArgLeu200520102015SerTrpGluGluArgLysAlaCysAlaArgAspMetGlnAlaValPro202020252030GlyLysValPheLeuThrAsnAspProAlaLeuArgLeuGlnGlySer203520402045SerTrpGlnGlySerPheThrThrGluProLysArgAspGluPheArg205020552060LysTyrGlnThrTyrPheTyrAspSerLysAlaAlaMetArgGluAsp2065207020752080IleLysArgIleValPheAlaAsnArgGluValIleSerAsnValHis208520902095HisLysAsnArgGlyGlyGlyThrGlyGlnSerAlaThrSerTrpAsp210021052110AsnThrAlaThrPheLysLeuGlyValIleSerAlaTrpAlaArgAla211521202125ThrGlyLysProProLysAspPhePheCysSerAsnArgLeuTyrAsn213021352140ThrSerAspAspThrValTrpTrpSerLysAspLeuLeuSerSerAla2145215021552160GluValAspArgPheLysGlnAlaAlaAlaAspPheGlyIleLeuLeu216521702175GluIleGlySerThrLysLysIleThrGluValGluTyrLeuSerLys218021852190LeuProArgArgProThrAlaGluAspSerAlaAspTyrArgAlaTrp219522002205ArgGlnGlyArgIleGluAsnMetArgSerSerGlyArgPheSerGlu221022152220GluGlnLeuLeuSerIleGluArgGluGlnLeuProGlnPheLeuMet2225223022352240ValGlnAsnProThrAlaIleLeuMetArgArgThrAlaPheArgTyr224522502255TyrGlnSerSerProSerLysPheLeuTyrThrSerCysGluArgGly226022652270AlaGlyHisAlaLeuValThrAlaPheGlnProAlaLeuTyrLysArg227522802285PheAlaIleGluTyrAlaGluAspLeuAsnArgLeuCysLysGluHis229022952300HisIleAsnGlnArgTyrGluLeuValSerGlnGlnAspArgMetLys2305231023152320MetGlnValIleAsnValAsnProAsnTrpLysArgAsnPheLysLeu232523302335SerProArgGlnGluAlaPheLeuArgTrpIleArgGlnAlaLysPhe234023452350ProSerTyrArgGlnValLeuAspIleHisLeuArgIleArgAspPro235523602365AspProSerAlaHisAspArgPheIleAlaLysLeuAspArgAlaTrp237023752380ArgAsnProAspGluGlyIleArgAspIleValAspGlyValTyrArg2385239023952400TyrThrAspMetIleProGluGluPheLysArgPheMetProSerThr240524102415AspMetLeuTyrAlaGluAsnProTrpHisThrHisAsnGlnTyrVal242024252430GluLysPheIleTyrLeuLysLeuLeuGluThrThrThrValAspGlu243524402445LeuThrPheAlaGlnPheAspAlaValAlaLysGluSerProTyrGly245024552460IleCysMetAsnThrIleLysPheTrpGluAspLeuArgAspProAsp2465247024752480TyrLeuLysAspLeuLeuAlaSerGluAlaMetIleAspLysValArg248524902495IleTyrGlnGlyMetThrValIleIleSerAlaMetTyrPheAlaMet250025052510HisTrpValGluLeuPheIleGlnSerLeuPheLeuIleGlyProLeu251525202525TyrAsnLeuPheMetTrpSerPheTrpGlyLeuSerLysValTyrGly253025352540LeuAlaAsnThrPheTyrTrpHisGlyLysAlaArgSerSerArgGlu2545255025552560IleSerSerIleLeuProArgAspProTyrMetTrpSerLysArgPhe256525702575ValSerThrMetAlaAspPheIleProGluArgPheAlaLeuGlyIle258025852590ValProValThrLeuValLeuAspGlyLeuAlaGluIleIleGluVal259526002605LeuPheGlyArgMetTrpArgLeuPheAlaAsnLeuLysSerValGly261026152620ThrAspPheSerAspAlaArgSerGlyLysSerLeuAsnValProSer2625263026352640AsnProTrpAlaAlaTyrAlaHisThrTyrAlaThrLysAlaIleGlu264526502655HisGlyHisValThrValAlaAlaLysThrAlaSerGlyLysSerThr266026652670PhePheProAlaAlaValTrpAlaGluArgArgAsnIleGlyIleLys267526802685LysLeuTrpIleValMetProArgLysIleLeuArgAspAsnTrpGlu269026952700IleProPheAspIleArgSerGlnIleValLysArgGlyLysThrLeu2705271027152720AspProSerAlaAspIleTyrValThrThrTyrGlyHisPheArgThr272527302735ArgIleGlyGlyLeuValProArgAspAsnLeuValPhePheAspGlu274027452750PheHisGluMetAspGlyPheMetLeuGlnAspValGluAspTrpLys275527602765GlyProThrIlePheMetSerAlaThrProValAlaLeuHisGlyMet277027752780AlaGlyIleProPheLeuGluProThrLeuProLysArgPheAsnLeu2785279027952800ThrValTyrLysValAspSerAspAspValLeuGluMetTrpAsnArg280528102815AlaArgAsnGlnPheAlaAspGlnProGluLeuLeuAlaArgProMet282028252830IleIleValProThrTyrAsnGluLeuLysLysThrIleAlaGlyLeu283528402845GluAsnLeuAspArgSerIleThrTrpHisGluValSerSerAsnSer285028552860ProLeuValProLysThrGlyGlyLeuValCysThrProTyrValGln2865287028752880ThrGlyIleAspIleLysProAlaProSerIleLeuIleAspSerGly288528902895ArgAspValIleValHisLysGlyArgLeuValThrProHisProTyr290029052910ThrAspGluLysThrAsnGluGlnArgValAsnArgValGlyArgThr291529202925MetAspGlyValValIleGlnProGlnLeuAlaGlyThrGlyAsnPro293029352940ProValLysTyrProSerGlyIlePhePheSerSerGluLeuValAla2945295029552960GlyGlnTyrLysValProArgLeuThrLysValAsnGlyCysValHis296529702975ProGluLeuProTyrMetSerIleLysTyrThrSerGluLeuSerAsp298029852990ProAlaLysAlaArgGluGluGluGlnSerValThrLysSerLeuLeu299530003005PheIleHisLeuMetAlaLeuAlaGlyValArgGlnSerGluTrpAla301030153020LeuArgTyrAsnArgTyrPheGluLeuHisLeuProPheGlyGluAsp3025303030353040GluAspHisLeuGluArgIleLeuThrSerGlyLysLeuArgTyrAla304530503055AsnHisIleProValAspMetAlaMetGlnLeuLeuGlyAsnGlyHis306030653070ValThrTrpGlyIleGlyGlyValProThrIleThrArgProArgTyr307530803085ProCysAspGlyMetTrpValGluAspProSerSerArgLysSerTyr309030953100AlaHisLysValLeuLeuHisGlnArgGluHisAlaGluIleGlyMet3105311031153120TrpGlnAlaGlnValAsnGluLeuArgAlaGlnAsnLeuAlaLeuGln312531303135SerGlnLeuArgSerAlaCysThrArgArgSerThrAlaGlyArgIle314031453150LeuArgHisThrArgProProAspIleProValCysGly315531603165__________________________________________________________________________

Genetically engineered transmissible hypovirulence

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

Non-Patent Literature Citations (13)

Divisions (1)