GENETICALLY MODIFIED BACTERIUM OF THE SPECIES LISTERIA MONOCYTOGENES

Abstract
The present invention relates to a genetically modified bacterium of the species Listeria monocytogenes, wherein the genomic locus of the transcriptional factor PrfA has been deleted, characterised in that it comprises on genomic level an artificial sequence that acts as internal amplification control, the use of this bacterium as well as a method for detecting and determining qualitatively and/or quantitatively the occurrence of wild type Listeria monocytogenes in a sample suspected to be contaminated with said micro-organism and a kit.
Description

The present invention relates to a genetically modified bacterium of the species Listeria monocytogenes, wherein the genomic locus of the transcriptional factor PrfA has been deleted, characterised in that it comprises on genomic level an artificial sequence that acts as internal amplification control, the use of this bacterium as well as a method for detecting and determining qualitatively and/or quantitatively the occurrence of wild type Listeria monocytogenes in a sample suspected to be contaminated with said micro-organism and a kit.


BACKGROUND OF THE INVENTION


Listeria monocytogenes is a pathogenic gram-positive bacterium. Causing Listeriosis it is one of the most virulent food borne pathogens. The detection of pathogens in samples like food samples or clinical samples like blood, tissue or feces is becoming increasingly important. However, in order to clearly identify and optionally to quantify the cells comprised in a sample reliable methods for their detection and quantification have to be provided.


Since the first implementation of polymerase chain reaction (PCR) this molecular biological tool has been developed to a method providing many opportunities for improved detection of micro-organisms.


An important prerequisite for PCR based methods to become internationally recognized standard is the internal amplification control (IAC). An IAC is a non-target DNA sequence present in the same sample tube, which is co-amplified simultaneously with the target sequence. In a PCR without an IAC, a negative result is not definite as it can mean that there was no target sequence present but also that the amplification reaction was inhibited by various factors. Therefore the European Standardization Committee in collaboration with the International Standard Organisation (ISO) proposed a general guideline for diagnostic PCR that requires the presence of an IAC (ISO/DIS 22174).


The IAC should be competitive using the same primer binding sites as the target PCR and clearly distinguishable from the target DNA amplicons by means of length and fluorescence wavelength of the used probe dye in real-time PCR. In summary the characteristics of the control should be as close to the characteristics of the target nevertheless ensuring negligible interference on target detection.


The implementation of an IAC to PCR assays ensures the reliability of negative results; however, this is only true for the enzymatic reaction facilitating target amplification in PCR and for the quantitative and confirmative detection reaction based on the use of fluorescent probes in real-time PCR. However, preliminary methodical steps such as sample preparation and DNA-isolation/purification from the sample matrix are not covered by this kind of control and if at all, checked by external controls. This does not allow for control of single samples and thus negative results imply the possibility of false verification of the pathogen status of the investigated samples, e.g. food.


Therefore an internal sample process control (ISPC) is necessary which should cover all methodical steps which are necessary for reliable quantitative detection of pathogens with conventional or real-time PCR.


For detection of food and waterborne RNA viruses the use of Feline Calcivirus and the bacteriophage MS2 as internal controls has been reported (Mattison et al. (2009) Int. J. Food Microbiol. 132, 73-77; Di et al. (2010) J. Virol. Methods 165, 57-63; Dreier et al. (2005) J. Clin. Microbiol. 43, 4551-4557).


Murphy et al. (2007, Int. J. Food Microbiol. 120, 110-119) discloses a bacterial internal sample process control for the detection of Listeria monocytogenes and Salmonella enterica. This control is based on a recombinant E. coli strain including fragments of the green fluorescence gene (gfp) and the iroB gene of S. enterica. The control was not used for quantitative purposes and the underlying gram negative E. coli strain will exhibit different characteristics during sample preparation compared to L. monocytogenes.


Consequently, there is a need for new reliable methods allowing the detection and quantification of the pathogen Listeria monocytogenes by real-time PCR in contaminated samples.


Unexpectedly, it has been found that this problem can be solved by using an IAC+, Δ-prfA L. monocytogenes EGDe strain as internal process control covering the whole detection process.


DESCRIPTION OF THE INVENTION

A first aspect of the present invention is, therefore, a genetically modified bacterium of the species Listeria monocytogenes, wherein the genomic locus of the transcriptional factor PrfA has been deleted, characterised in that it comprises on genomic level an artificial sequence that acts as internal amplification control (IAC).


A genetically modified bacterium of the species Listeria monocytogenes means a Listeria monocytogenes species resulting from altering its genetic material using genetic engineering techniques. Genetic modification comprises the insertion and/or deletion of genes. The deletion of the prfA gene can e.g. be accomplished as disclosed in Bockmann et al. (1996) Mol. Microbiol. 22, 643-653.


The genomic locus of the transcriptional factor PrfA means the nucleic acid sequence encoding for the protein PrfA. This is a sequence of 705 base pairs (Leimeister-Wächter et al., 1990; Proc Natl Acad Sci USA, 87, 8336-40; Glaser et al., 2001; Science, 294, 849-52). The gene is located within the chromosomal region around the listeriolysin gene (lisA) of L. monocytogenes (GeneID: 987031; http://www.ncbi.nlm.nih.gov/gene/987031#pageTop). Information concerning the transcriptional factor PrfA is also given in Scortti et al. (2007) Microbes and Infection 9, 1196-1207, which is hereby incorporated by reference. PrfA controls the expression of key virulence determinants of Listeria monocytogenes. PrfA is a 237-residue protein of 27 kDa. The deletion of the genomic locus of the transcriptional factor PrfA renders the mutant non-pathogen.


According to the present invention internal amplification control (IAC) means an artificial nucleic acid sequence present in the sample tube during PCR reaction and co-amplified with a certain target sequence as defined by Hoorfar et al. (2003) Lett. Appl. Microbiol. 38, 79-80. The presence of an IAC allows to determine false-negative results. The IAC sequence may be any polynucleotide sequence. The size of this sequence may vary depended on the specific PCR assay and reaction conditions thereof.


The IAC sequence is preferably a single-copy nucleotide sequence, i.e. a nucleotide sequence present only once in the haploid genome of a Listeria monocytogenes bacterium.


Preferably, the IAC sequence is a sequence not occurring in Listeria monocytogenes or any other species to be expected as naturally occurring within a sample to be investigated, or in the sample matrix itself.


Preferably, the IAC sequence comprises primer binding sequences at the 5′ and 3′ ends.


According to the present invention it is preferred that the IAC is a competitive IAC, i.e. the IAC of the genetically modified Listeria monocytogenes and the target sequence prfA of the wild type Listeria monocytogenes are amplified with one common set of primers under the same conditions and in the same PCR tube during real time PCR. Therefore, the primer binding sequences of the IAC are particularly preferably identical to the primer binding sequences of the genomic prfA locus of wild type Listeria monocytogenes.


In a very particularly preferred embodiment of the present invention the artificial IAC sequence is the 100 bp sequence according to SEQ ID NO: 1: 5′-GAT ACA GAA ACA TCG GTT GGC GTA TTC GAA ATG TCC GTT CGG TTG GCG CTA TGA AGA GAT ACG CGG TGG AAC CTG GAA CCT GAT GGC ATC AAG ATT ACA C-3′.


This IAC sequence is disclosed in Rossmanith et al. (2006) Res. Microbiol. 157, 763-771. According to the present invention IAC sequences of more than 80% homology to SEQ ID NO: 1 can be used. Preferably, the sequence homology is more than 90%, more preferably more than 95%.


According to the present invention a genetically modified Listeria monocytogenes EGDe strain as specified above is preferred.


The Listeria monocytogenes EGDe strain is a Listeria monocytogenes serovar 1/2a clinical preparation. This strain is the most widespread model organism in scientific use (GenBank: AL591978; Glaser et al. (2001) Science 294 (5543), 849-52).


A further aspect of the present invention is a genetically modified Listeria monocytogenes EGDe strain, wherein the genomic locus of the transcriptional factor PrfA has been deleted, comprising the internal amplification control sequence (IAC) of SEQ ID NO:1 as deposited at the DSMZ (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Braunschweig) as Listeria monocytogenes ΔprfA/+IAC under DSM 23639 on Mai 20, 2010.


The genetically modified bacterium of the species Listeria monocytogenes according to the present invention meets the requirements given for a reliable internal sample process control. It is as closely related to wild-type Listeria monocytogenes as possible. It does not interfere with the main detection reaction by means of real-time PCR and the performance of the underlying chemical reaction for the detection of the control is equal to the main reaction. Additionally, the application of Listeria monocytogenes cells as ISPC permit to cover the whole progression of the necessary methods included in food pathogen detection from sample preparation to detection using real-time PCR.


Another aspect of the present invention is the use of genetically modified Listeria monocytogenes as specified above for detecting and determining qualitatively and/or quantitatively the occurrence of wild type Listeria monocytogenes in a sample suspected to be contaminated with said micro-organism.


Preferably, the sample is a food sample, a body fluid, in particular blood, plasma or serum, water or a tissue sample.


Exemplary samples include, but are not limited to, food (e.g. milk of cows, ewes, nanny goats, mares, donkeys, camels, yak, water buffalo and reindeer, milk products, meat of beef, goat, lamb, mutton, pork, frog legs, veal, rodents, horse, kangaroo, poultry, including chicken, turkey, duck, goose, pigeon or dove, ostrich, emu, seafood, including finfish such as salmon and tilapia, and shellfish such as molluscs and crustaceans and snails, meat products, plant products, seeds, cereals from grasses, including maize, wheat, rice, barley, sorghum, and millet, cereals from non-grasses, including buckwheat, amaranth, and quinoa, legumes, including beans, peanuts, peas, and lentils, nuts, including almonds, walnuts, and pine nuts, oilseeds, including sunflower, rape and sesame, vegetables like root vegetables, including potatoes, cassaya and turnips, leaf vegetables, including amaranth, spinach and kale, sea vegetables, including dulse, kombu, and dabberlocks, stem vegetables, including bamboo shoots, nopales, and asparagus, inflorescence vegetables, including globe artichokes, broccoli, and daylilies, and fruit vegetables, including pumpkin, okra and eggplant, fruits, herbs and spices, whole blood, urine, sputum, saliva, amniotic fluid, plasma, serum, pulmonary lavage and tissues, including but not limited to, liver, spleen, kidney, lung, intestine, brain, heart, muscle, pancreas and the like. The skilled artisan will appreciate that lysates, extracts or (homogenized) material obtained from any of the above exemplary samples or mixtures of said exemplary samples or compositions comprising one or more of said exemplary samples are also samples within the scope of the invention.


Particularly preferred is a food sample.


The food sample is preferably a milk product, preferably milk, in particular raw milk, milk powder, yoghurt, cheese or ice cream, a fish product, preferably raw fish, a meat product, preferably raw meat, meat rinse or sausages, salad rinse, chocolate, egg or egg products, like mayonnaise.


Particularly preferred food samples used in the method according to the present invention are samples which are usually known to comprise potentially pathogenic Listeria monocytogenes, e.g. cheese.


Preferably, the genetically modified Listeria monocytogenes as specified above is used as internal sample process control (ISPC) for a real-time PCR based assay.


According to the present invention an ISPC is a model organism added to the original sample prior to sample preparation. An ISPC provides a measure for the efficiency of the whole analytical chain from sample preparation to target molecule detection and covers all methodical steps which are necessary for reliable quantitative detection of pathogens with conventional or real-time PCR.


A further aspect of the present invention is a method for detecting and determining the occurrence of wild type Listeria monocytogenes in a sample suspected to be contaminated with said pathogenic micro-organism, comprising the steps:


(a) adding to said sample a predefined amount of cells of the genetically modified Listeria monocytogenes bacterium as specified above,


(b) incubating the sample with an extraction solution,


(c) isolating the DNA by standard methods;


(d) applying real-time PCR, thereby using (i) primers specific for the genomic prfA locus of wild type Listeria monocytogenes and the IAC sequence of genetically modified Listeria monocytogenes as specified above; and (ii) a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said prfA locus and a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said IAC sequence,


(e) determining qualitatively and/or quantitatively fluorescent signals generated by step (d), and


(f) determining and/or calculating from step (e) the presence and/or the amount of the wild type Listeria monocytogenes cells in the original sample suspected to be contaminated with said micro-organism.


In step (a) a predefined amount of cells of the genetically modified Listeria monocytogenes bacterium as specified above is added to the sample. The amount added to the sample depends on the sample size. Preferably, an amount of 25 to 100000 CFU (colony forming units) of the genetically modified Listeria monocytogenes is added to a sample of e.g. 25 g. Particularly preferred is an amount of 100 to 5000 CFU per 25 g.


Colony forming unit (CFU) is a measure of viable cells in a sample. It can be determined by culture methods, e.g. by evenly spreading the sample on a bacterial culture gel. Incubation at suitable culture conditions results in the formation of colonies. The number of the colonies represents the number of colony forming units in the sample. Alternatively the cell count is determinable by microscopic count of fluorescent stained cells, e.g. using the Live/Dead® BacLight™ Bacterial Viability Kit (Molecular Probes, Willow Creek, Oreg., USA) or comparable commercial methods.


The extraction solution used in step (b) is an aqueous solution or a buffer solution. It typically has a pH value greater than 5 and lower than 9, preferably greater than 6 and lower than 8, more preferably between 6.5 and 7.5. The extraction solution may additionally comprise up to 20% of one or more water-miscible organic solvents.


The buffer which may be used in the method of the present invention is preferably selected from the group of phosphate buffer, phosphate buffered saline buffer (PBS), 2-amino-2-hydroxymethyl-1,3-propanediol (TRIS) buffer, TRIS buffered saline buffer (TBS) and TRIS/EDTA (TE).


In one embodiment of the present invention the extraction solution further comprises MgCl2 and/or an ionic liquid. The MgCl2—if present—is typically present in concentrations between 0.05 and 3 M, preferably between 0.1 and 2 M, more preferably between 0.3 and 1 M.


In another embodiment of the present invention the extraction solution further comprises at least one chaotrope and at least one detergent.


The ionic liquid—if present—is typically present in concentrations between 0.5 and 20% by weight, preferably between 1 and 10% by weight, based on the weight of mixture. The ionic liquid can be one ionic liquid or a mixture of two or more ionic liquids. In a preferred embodiment, the extraction solution comprises either MgCl2 or ionic liquid. Ionic liquids used in the present invention are ionic species which consist of an organic cation and a generally inorganic anion. They do not contain any neutral molecules and usually have melting points below 373 K. Review articles on ionic liquids are, for example, R. Sheldon “Catalytic reactions in ionic liquids”, Chem. Commun., 2001, 2399-2407; M. J. Earle, K. R. Seddon “Ionic liquids. Green solvent for the future”, Pure Appl. Chem., 72 (2000), 1391-1398; P. Wasserscheid, W. Keim “Ionische Flüssigkeiten—neue Lösungen für die Übergangsmetallkatalyse” [Ionic Liquids—Novel Solutions for Transition-Metal Catalysis], Angew. Chem., 112 (2000), 3926-3945; T. Welton “Room temperature ionic liquids. Solvents for synthesis and catalysis”, Chem. Rev., 92 (1999), 2071-2083 or R. Hagiwara, Ya. Ito “Room temperature ionic liquids of alkylimidazolium cations and fluoroanions”, J. Fluorine Chem., 105 (2000), 221-227).


In general, all ionic liquids of the general formula K+ A known to the person skilled in the art, in particular those which are miscible with water, are suit-able in the method according to the invention.


If an ionic liquid or MgCl2 is present, in a further preferred embodiment, the extraction solution comprises no detergent, that means no anionic, zwitterionic or non-ionic detergent like sodium dodecylsulfate, CHAPS, Lutensol AO-7, is added to the extraction solution.


The term “chaotrope” as used herein, refers to a substance that causes disorder in a protein or nucleic acid by, for example, but not limited to, altering the secondary, tertiary or quaternary structure of a protein or a nucleic acid while leaving the primary structure intact. Exemplary chaotropes include, but are not limited to, guanidine hydrochloride (GuHCl), guanidinium thiocyanate (GuSCN), sodium thiocyanate (KSCN), sodium iodide, sodium perchlorate, urea, and the like. Descriptions of chaotropes and chaotropic salts can be found in, for instance, in K. Hamaguchi et al. (Proc. Natl. Acad. Sci. (1962) 62:1129-1136)


As used herein, the term “detergent” refers to molecules having lipophilic as well as hydrophilic (i.e. amphiphilic) characteristics. A detergent according to the present invention may comprise, for instance, a fatty acid residue and a hydrophilic (e.g. anionic or cationic) part.


Furthermore, it is possible to add to the extraction solution one or more additional substances like destabilizing agents or biopolymer degrading enzymes which help to degrade substances present in specific samples. One example is the addition of starch degrading enzymes for food sample comprising high amounts of collagen and/or starch.


The incubation is typically performed at temperatures between 18° C. and 50° C., preferably between 25° C. and 45° C., more preferably between 30° C. and 42° C.


The sample is typically incubated with the extraction solution for a time between 10 minutes and 6 hours, preferably between 20 minutes and 1 hour.


In order to facilitate the dissolution of the sample, said sample can be, for instance, homogenized using a stomacher prior its incubation with the extraction solution. The dissolution is further supported and/or accelerated when the mixture is agitated during the incubation.


Further extraction methods can for example be found in Brehm-Stecher et al. (2009) Journal of Food Protection 72: 1774-1789.


According to the present invention, the DNA of the bacterial material is isolated in step (c). Various methods known in the art may be employed to extract DNA, e.g. the methods disclosed in Sambrook et al. (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.


In general, DNA extraction comprises cell lysis and DNA purification by either precipitation or specific binding on various substrates e.g. silica.


Cell lysis may be accomplished by standard methods, e.g. by enzymatic methods, bead methods, sonication, detergent methods or combinations thereof. Preferably, detergent methods are employed.


Suitable enzymes for enzymatic cell lysis are, e.g., lysozyme, lysostaphin, zymolase, cellulase, mutanolysin, glycanases, proteases, mannase.


Beads suitable for cell disruption are of glass, ceramic, zirconium, or steel. After the addition of beads to the cells agitation by stirring or shaking of the mix is applied. Agitation can for example be applied by a common laboratory vortex mixer or in a specially designed clamp.


According to the present invention, a further method for cell lysis is sonication. This method involves ultrasound application (typically 20-50 kHz) onto the sample.


Detergent-based cell lysis results in the disruption of the lipid barrier surrounding cells. Suitable detergents may be chosen from non-ionic, zwitterionic and ionic detergents, e.g. CHAPS, Triton® X or TWEEN®. Preferably, ionic detergents are used. An example for a suitable ionic detergents is SDS.


In addition to the choice of detergent, other important considerations for optimal cell lysis include the buffer, pH, ionic strength and temperature: The lysis solution typically has a pH value greater than 5 and lower than 9, preferably greater than 6 and lower than 8, more preferably between 6.5 and 7.5.


The buffer which may be used is preferably selected from the group of phosphate buffer, phosphate buffered saline buffer (PBS), 2-amino-2-hydroxymethyl-1,3-propanediol (TRIS) buffer, TRIS buffered saline buffer (TBS) and TRIS/EDTA (TE).


Optionally, one or more chelating agents can be added to the lysis solution to sequester divalent cations. Suitable chelators are, e.g., EDTA (ethylenediamine tetraacetic acid), EGTA (ethylene glycol tetraacetic acid) or ethylenediamine. Preferably, EDTA is used.


The above mentioned cell lysis methods are typically followed by centrifugation in order to separate the DNA from the cellular material. A skilled person can easily determine the parameters for centrifugation. Typically, centrifugation is carried out as disclosed in Sambrook et al. (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.


After cell lysis the DNA is usually precipitated by adding an alcohol, preferably ethanol or isopropanol.


Additionally, the DNA can be provided in a form which is suitable for amplification using a commercially available DNA isolation kit, such as the NucleoSpin® tissue kit and the support protocol for Gram-positive bacteria (Machery-Nagel, Düren, Germany) or the Nexttec® kit for genomic DNA from bacteria (Nexttec GmbH Biotechnologie, Leverkusen, Germany).


In a further embodiment of the present invention the bacterial material is separated prior to DNA isolation in step (c). This further step is particularly preferred since it allows for achieving a higher concentration of DNA in the resulting PCR sample. Separation of the bacterial material can be accomplished by any known method, like centrifugation, filtration, dielectrophoresis and ultrasound or affinity binding, e.g. using antibodies, lectins, viral binding proteins, aptamers or antimicrobial peptides (AMP) which are preferably immobilized on beads. Preferably, the cells are isolated by filtration or centrifugation, most preferred by centrifugation. Filtration of the extracted sample is in particular required when the complex sample comprises material which is hardly or not extractable with the method of the present invention. Typically these materials comprise starch and/or fibres. However, the preferred method for isolation the cells from the extraction mixture is centrifugation.


The incubation step may—depending on the sample matrix—be repeated once or several times, e.g. twice, three times, four times, five times or ten times. Between these incubation steps the bacterial material and the remnant sample matrix may be separated from the supernatant by e.g. centrifugation.


After the separation of the bacterial material the cells are preferably washed with water, a buffer solution and/or detergent comprising solutions. The wash step may be repeated several times.


In step (d) PCR, preferably real-time PCR is applied. Real-time PCR is a method for detecting and measuring products generated during each cycle of a PCR, which are proportionate to the amount of template nucleic acid prior to the start of PCR. The information obtained, such as an amplification curve, can be used to quantitate the initial amounts of template nucleic acid sequence.


The detection is preferably based on monitoring fluorescence at every cycle at a set temperature. Fluorescence is usually monitored using an optical device to collect the data at specific excitation and emission wavelengths for the particular fluorescent dye present in the sample. The cycle at which the fluorescence from a sample crosses the threshold for detection of fluorescence above background is called the cycle threshold, Ct, and allows the quantification of the starting template.


The PCR conditions are not particularly restricted but optimal conditions may be selected for each PCR apparatus. For example, the following conditions may be used:

    • Thermal denaturation of double-stranded DNA to single-stranded DNA: Heating is generally made at about 90-98° C., preferably at about 92-96° C., generally for about 3 seconds to 1 minute, preferably for about 30 seconds to 1 minute.
    • Annealing: Heating is made generally at about 40-70° C., preferably at 55-65° C., generally for about 5 seconds to 2 minutes, preferably for about 30 seconds to 90 seconds.
    • DNA elongation reaction: Heating is made generally at about 60-75° C., preferably at about 70-74° C., generally for about 10 seconds to 3 minutes, preferably for about 30 seconds to 2 minutes.
    • Mg ion concentration in the reaction liquid: Generally about 1-5 mM, preferably about 1.5-3.5 mM.


This reaction is typically carried out in about 20-50 cycles, preferably in about 45 cycles, whereby the target DNA can be amplified to a detectable level.


Any commercial real-time PCR apparatus can be used.


According to step (d)(i) of the method of the present invention primers specific for the genomic prfA locus of wild type Listeria monocytogenes and the IAC sequence of genetically modified Listeria monocytogenes as defined above are used.


In general, the term “primer” refers to a short nucleic acid molecule, such as a DNA oligonucleotide of 9 nucleotides or more in length, that is complementary to a section along a strand of the target nucleic acid, i.e. the genomic prfA locus and the IAC sequence, wherein the purpose of the primer is to initiate the nucleic acid replication of a longer nucleic acid along the strand. According to the present invention primers of 15 to 40 nucleotides are preferred. In the present invention the term “primers” is used for the primer pair, flanking the targeted sequence to be amplified.


Preferably, the primers used in step (d)(i) are Lip1 and Lip2.











The sequence of Lip1 is:



(SEQ ID NO: 2)



5′-GAT ACA GAA ACA TCG GTT GGC-3′



and







the sequence of Lip2 is:



(SEQ ID NO: 3)



5′-GTG TAA TCT TGA TGC CAT







CAG G-3′.






According to step (d)(ii) of the method of the present invention a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said prfA locus and a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said IAC sequence are used.


According to the present invention the term “specifically hybridize” means to detectably and specifically bind. Polynucleotides, oligonucleotides and fragments thereof selectively hybridize to nucleic acid strands under hybridization conditions that minimize appreciable amounts of detectable binding to non-specific nucleic acids.


A fluorescent labelled oligonucleotide is an oligonucleotide exhibiting a typically covalently attached fluorophor. A fluorophor is a chemical compound, which when excited by exposure to a particular wavelength of light, emits light (fluoresces), for example at a different wavelength of light.


Preferably, the oligonucleotide probes that are able to specifically hybridize with said prfA locus and said IAC sequence exhibit different fluorophors emitting light of different wavelengths. This allows the detection of one probe independently from the other.


The fluorescent labelled probes typically used for real time PCR are e.g. LightCycler (hybridisation) probes, molecular beacons or hydrolysis probes (also called TaqMan® probes). Preferably, hydrolysis probes are used.


LightCycler probes utilize the technique of fluorescence resonance energy transfer (FRET). For this method two different oligonucleotide probes bound to a FRET donor and a FRET acceptor, respectively, are used for each target sequence. These probes bind side by side to the target sequence, bringing the fluorophors in proximity.


Molecular beacons (Tyagi et al., Nat. Biotechnol. 14:303-8, 1996) are oligonucleotide probes bound to a reporter fluorophor and a quencher. The nucleotides on the 5′ end are complementary to the nucleotides on the 3′ end, forming a stem loop structure. Because of the proximity of the fluorophor and the quencher no fluorescence is observed. Hybridization of the probe with the target sequence during real-time PCR leads to an increase in the reporter-quencher distance resulting in fluorescence of the reporter.


Preferably, hydrolysis probes (TaqMan® probes) are used (Lee et al., Nucleic Acids Res. 21:3761-6, 1993). These probes utilize as well the technique of fluorescence resonance energy transfer (FRET). The probes exhibit a fluorescent reporter at one end and a quencher of fluorescence at the opposite end. Because of the close proximity of the reporter to the quencher detection of the reporter fluorescence is suppressed. During the annealing stage of the PCR both primers and the probe anneal to the DNA target. Polymerization of a new DNA strand leads to the degradation of the probe by the 5′-3′ exonuclease activity of the polymerase and physical separation of the fluorescent reporter from the quencher, resulting in an increase in fluorescence. Fluorescence can be detected and measured in the real-time PCR thermocycler, and its geometric increase corresponding to exponential increase of the product is used to determine the threshold cycle (Ct) in each reaction (see below).


Exemplary reporters include, but are not limited to: 6-carboxyfluorescein; carboxyfluorescein (FAM); boron dipyrromethene difluoride (BODIPY); acridine, stilbene, 6-carboxy-fluorescein (HEX), TET (Tetramethyl fluorescein), 6-carboxy-X-rhodamine (ROX), Rhodamine-6G, Texas Red, 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein (JOE), Cy®3, Cy®5, VIC® (Applied Biosystems), LC Red 640, LC Red 705, Texas Red, Yakima Yellow®, as well as derivatives thereof. Preferably, a reporter selected from FAM and HEX is used in the present invention.


Exemplary quenchers include, but are not limited to Black Hole Quenchers (WO 01/86001 A1) as BHQ1™ and BHQ2™, MGB (Minor-groove-binder, EP 0819133 B1), N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA), Eclipse® Dark Quencher, DABCYL, DABSYL, DDQ I and DDQ II According to the present invention, preferably used quenchers are MGB or BHQ1™.


A person skilled in the art can easily chose a suitable reporter-quencher combination. Typically, the absorption spectrum of the quencher needs to have a good overlap with the emission spectrum of the reporter in order to allow for optimal quenching.


Preferably, the fluorescent labelled probe hybridizing with the IAC sequence of step (d)(ii) is pLucLm4 (SEQ ID NO:4) as disclosed in Rossmanith et al. (2006) Res. Microbiol. 157, 763-771. The fluorescent labelled probe hybridizing with the prfA locus is preferably LipProbe (SEQ ID NO:5).


The fluorescent labelled probe pLucLm4 exhibits preferably HEX as reporter fluorophor and BHQ1™ as quencher.


The fluorescent labelled probe LipProbe exhibits preferably FAM as reporter and MGB as quencher.


According to the present invention the fluorescent signals generated by step (d) are qualitatively and/or quantitatively determined in step (e).


The detection is preferably based on monitoring fluorescence at every cycle at a set temperature. Fluorescence is usually monitored using an optical device to collect the data at specific excitation and emission wavelengths for the particular fluorophors present in the sample.


In step (f) the presence and/or the amount of wild type Listeria monocytogenes cells in the original sample suspected to be contaminated with said micro-organism is determined and/or calculated from step (e).


The presence of wild type Listeria monocytogenes cells in the original sample is typically determined by qualitatively determining the fluorescent signals in step (e).


The amount of wild type Listeria monocytogenes cells in the original sample is typically calculated comprising the following steps:

    • Calculating the initial amount of DNA by means of DNA copies of the genetically modified Listeria monocytogenes and wild-type Listeria monocytogenes by using the Ct method (Threshold method) based on the respective fluorescence signal after real-time PCR amplification. The threshold method is based on the comparison of the respective signal of the investigated sample with a calibration standard (Kaltenböck et al. (2005), Advances in Clinical Chemistry 40: 219-259).
    • Calculating the loss during the analytical procedure (comprising sample preparation, DNA purification and isolation and real-time PCR according to steps (b), (c) and (d) of the method of the present invention) based on the known value of initial cells of genetically modified Listeria monocytogenes within the sample and the value of cells as obtained by the Ct method after real-time PCR.
    • Calculating the number of wild type Listeria monocytogenes cells present in the sample suspected to be contaminated with said microorganism based on the calculated loss of genetically modified Listeria monocytogenes cells during the analytical procedure.


The method of the present invention is advantageous since the use of Listeria monocytogenes as an internal sample process control (ISPC) for molecular biological pathogen detection provides most similarity with the target organism and therefore most applicability for bacterial pathogen detection. Even a nearly related species such as Listeria innocua would lead to a non-competitive internal control requiring a second primer pair during real-time PCR. The simple use of a DNA based ISPC derived from an existing IAC, from the very beginning of the detection process, would as well not fulfil the prerequisite of most similarity of control and target. Besides, most of the DNA would get lost during the various methodical steps before PCR detection.


A further aspect of the present invention is a kit for use in an assay for detecting and determining wild type Listeria monocytogenes in a sample suspected to be contaminated with said micro-organism, comprising at least in one or more packages


(i) genetically modified Listeria monocytogenes as specified above;


(ii) the primers specific for the genomic prfA locus of wild type Listeria monocytogenes and the IAC sequence of genetically modified Listeria monocytogenes as specified above; and


(iii) a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said prfA locus and a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said IAC sequence.


Preferably, the primers of the kit are Lip1 (SEQ ID NO:2) and Lip2 (SEQ ID NO:3).


The fluorescent labelled probes are preferably pLucLm4 (SEQ ID NO:4) for detecting the IAC sequence and LipProbe (SEQ ID NO:5) for detecting the prfA locus.


According to the present invention the kit may additionally comprise an extraction solution.


Another aspect of the present invention is a method for manufacturing a genetically modified Listeria monocytogenes bacterium as specified above comprising the steps:


(a) deleting the genomic locus of the transcriptional factor PrfA of the bacterial species Listeria monocytogenes,

(b) cloning of a vector comprising an IAC,


(c) transforming the vector of step (b) into the bacterial species of step (a).


The deletion of the genomic locus of PrfA according to step (a) is accomplished by techniques known in the art and can for example be accomplished as disclosed in Bockmann et al. (1996) Mol. Microbiol. 22, 643-653. In principle, a knock-out plasmid is constructed. This plasmid is transformed into Listeria monocytogenes cells. Crossing-over results in the excision of the prfA gene. The resulting organism is also referred to as Δ-prfA Listeria monocytogenes.


Optimal culture conditions for Listeria monocytogenes bacteria can easily be determined by a skilled person. Typically, the bacteria are grown in TSB-Y (Trypton soya broth with yeast extract) at 37° C. with aeration.


In step (b) a vector comprising the IAC is produced.


Adequate amounts of the IAC sequence for cloning are typically produced by amplification of the sequence by conventional PCR (Rossmanith et al. (2006) Res. Microbiol. 157, 763-771). The primers used for PCR typically comprise restriction sites for special restriction enzymes allowing for later integration into the vector. For an IAC sequence according to SEQ ID NO:1 the modified primers LipBam (SEQ ID NO:6) and LipSaI (SEQ ID NO:7) comprising the restriction sites BamHI and SaII, respectively, are preferably used.











The sequence of LipBam is:



(SEQ ID NO: 6)



5′GCG CGG ATC CGA TAC AGA AAC ATC







GGT TGG C′3.







The sequence of LipSal is



(SEQ ID NO: 7)



5′GCG CGT CGA CGT GTA ATC TTG ATG







CCA TCA GG′3.






After purification of the amplification product restriction digestion, dephosphorylation and ligation with a suitable integration vector are performed.


Restriction digestion is typically performed by incubation of the amplification product with commercially available restriction enzymes corresponding to the restriction sites of the primers used for PCR. Preferably, BamHI and SaII are used.


Dephosphorylation of the IAC fragments can be accomplished by incubation with a suitable phosphatase, e.g. Fast AP™ Thermosensitive Alkaline Phosphatase (Fermentas). A suitable integration vector can easily be chosen by a skilled person. The vector comprises a gene sequence giving resistance to an antibiotic that the intended recipient strain of bacteria is sensitive to (e.g. chloramphenicol) in order to allow for later selection of positive clones. Preferably, a phage insertion vector, e.g. pPL1 or pPL2 as disclosed in Lauer et al. (2002) J. Bacteriol. 184, 4177-4186 is used. The phage insertion vector pPL2 (6123 bp) is particularly preferred since it provides stable single copy insertion into the genome of Listeria monocytogenes.


Adequate amounts of the insertion vector can be produced by amplifying the vector in a bacterium, e.g. in E. coli TOP10F′, and subsequent isolation, restriction digestion and dephosphorylation as described above. Typically, the restriction sites can be found in a multiple cloning site (MCS) of the vector.


Ligation is typically performed by the addition of a DNA ligase, e.g. T4 DNA ligase available from Fermentas.


The resulting vector is transformed into a suitable bacterium, e.g. E. coli TOP10F′ for amplification and for the selection of positive clones. This selection is typically accomplished by plating the bacteria on a medium comprising the above mentioned antibiotic.


In step (c) the vector of step (b) is transferred into the Listeria monocytogenes cells of step (a). The transformation can be carried out using the various methods well-known in the state of the art. Examples are transformation by heat shock or electroporation. Preferably, transformation is effectuated by electroporation.


Transformation by heat shock is accomplished by chilling the cells in the presence of divalent cations such as Ca2+ (in CaCl2) or Rb2+ (RbCl2) preparing the cell membrane to become permeable to plasmid DNA. Cells are incubated on ice with the DNA and then briefly heat shocked (typically at 41 to 43° C. for 30 to 120 seconds).


For electroporation the cells are briefly shocked with an electric field of 10-25 kV/cm. Preferably, electroporation is accomplished according to Park et al. (1990) Gene 94, 129-132.


The resulting organism can be tested upon successful cloning. Successful insertion of the vector into the Δ-prfA Listeria monocytogenes genome can be tested by amplification of the 499 bp fragment by PCR (according to Lauer et al. (2002) J. Bacteriol. 184, 4177-4186) and by sequencing.


Single copy insertion of the IAC into the genome of Δ-prfA Listeria monocytogenes can be verified by comparison of the genomic DNA amounts of transformed Listeria monocytogenes measured by UV/VIS spectroscopy with the data after real-time PCR in comparison to wild-type data, based on the known size of the Listeria genome (Nelson et al.(2004) Nucleic Acids Res. 32, 2386-2395).





The present invention is further illustrated by the following figures and examples, however, without being restricted thereto.



FIG. 1. Confirmation of pPL2-IAC, E. coli and IAC+, Δ-prfA L. monocytogenes EGDe (according to Examples 1.4 and 1.6). (A) Real-time PCR amplification of pPL2-IAC, E. coli clones after transformation and plasmid isolation targeting the artificial IAC within the plasmid. The amplification plots on the left side include the plasmid preparation as target. The amplification plots on the right side (ss IAC) represent the calibration function (Efficiency.: 96.8%; Rsq: 0.999). (B) Real-time PCR amplification of IAC+, Δ-prfA L. monocytogenes EGDe clones targeting the artificial IAC within the genome for confirmation of integration of the vector pPL2-IAC into the Listeria genome (Eff.: 96.0%; Rsq.: 0.999). The amplification plots on the left side include genomic DNA of four IAC+, Δ-prfA L. monocytogenes EGDe clones as target.



FIG. 2. Confirmation of positive integration of pPL2-IAC into the Listeria genome and confirmation of the resulting IAC+, Δ-prfA L. monocytogenes EGDe strain by conventional PCR (according to Example 1.6.). (A) Agarose gel of the cloned strains, confirmed as L. monocytogenes. M, Marker; 1, L. ivanovii, L. seeligeri and L. welshimeri; 2, L. innocua; 3, L. monocytogenes; 4, L. grayi; 5-8, Four IAC+, Δ-prfA L. monocytogenes EGDe clones. (B) Confirmation of the IAC+, Δ-prfA L. monocytogenes EGDe amplifying the 16S rRNA gene specific for all Listeria spp. and the hly gene specific for L. monocytogenes. 9, L. spp.; 10, L. monocytogenes; 11-14, Four IAC+, Δ-prfA L. monocytogenes EGDe clones. (C) Confirmation of the integration of the pPL2-IAC into the genome of the Δ-prfA L. monocytogenes EGDe strain. 1-4, Four IAC+, Δ-prfA L. monocytogenes EGDe clones. The resulting 499 bp fragment after PCR indicates integration. PCR products are separated in a 1% agarose gel and stained with ethidium bromide.





The entire disclosures of all applications, patents, and publications cited above and below are hereby incorporated by reference.


1. EXAMPLES

The following examples describe practical applications of the invention.


1.1. Bacterial Strains and Culture Conditions


L. monocytogenes EGDe (1/2a, internal number 2964) is part of the collection of bacterial strains at the Institute of Milk Hygiene, Milk Technology and Food Science, Department of Veterinary Public Health and Food Science, University of Veterinary Medicine, Vienna, Austria (IMML). Δ-prfA L. monocytogenes EGDe (1/2a) is part of the collection of bacterial strains at the Department of Microbiology, Theodor Boveri Institute, University of Würzburg, Würzburg, Germany. Electro-competent E. coli TOP10F′ are available at Invitrogen (Carlsbad, Calif., USA). All bacterial strains are maintained at −80° C. using MicroBank™ technology (Pro-Lab Diagnostics, Richmont Hill, Canada).


Measurement of the optical density of bacterial cultures is performed at 600 nm (OD600) in duplicate with an HP 8452 spectrophotometer (Hewlett Packard, Paolo Alto, Calif., USA). Selective plating of L. monocytogenes EGDe wt and IAC+, Δ-prfA L. monocytogenes EGDe is performed on RAPID′ L. mono (Bio-Rad laboratories GmbH, München, Germany), OCLA (Oxoid Chromogenic Listeria agar; Oxoid, Hampshire, UK), PALCAM (Solabia Biokar Diagnostics, Pantin Cedex, France) and blood agar (Biomerieux, Marcy l'Etoile, France) whether by streaking 100 μl bacterial culture to the plates or by loop technique.


Enumeration of bacterial suspensions is performed using the plate count method or the Live/Dead® BacLight™ Bacterial Viability Kit (Molecular Probes, Willow Creek, Oreg., USA) according to manufacturer's instructions.


1.2. Oligonucleotides, Plasmids and Enzymatic Reactions

The sequences of oligonucleotides and plasmids are presented in Table 1. Primers for conventional and real-time PCR and the HEX-labelled probe pLuclm4 are available from MWG Biotech (Ebersberg, Germany); the MGB-modified Lip-probe from Applied Biosystems (Foster City, Calif., USA). The artificial 100 bp target for the IAC is synthesized by VBC Genomics (Vienna, Austria). The pPL2 phage insertion vector according to Lauer et al. (2002) J. Bacteriol. 184, 4177-4186.









TABLE 1







Oligonucleotide and primer sequences and organisms












Sequence/Label
Ref./Source





Oligonucleotides





Lip 1
Forward primera
5′-GAT ACA GAA ACA TCG GTT GGC-3′
D'Agostino 





et al., 2004





Lip 2
Reverse primera
5′-GTG TAA TCT TGA TGC CAT CAG G-3′
D'Agostino 





et al., 2004





Lip Bam
Forward primerb
5′GCG CGG ATC CGA TAC AGA AAC ATC
SEQ ID NO: 6




 GGT TGG C′3






Lip Sal
Reverse primerc
5′GCG CGT CGA CGT GTA ATC TTG ATG 
SEQ ID NO: 7




CCA TCA GG′3






LipProbe
Probe binding 
FAM-CAG GAT TAA AAG TTG ACC 
Rossmanith 



prfA locusa
GCA-MGB
et al., 2006,





SEQ ID NO: 5





pLucLm 4
Probe binding 
HEX-TTC GAA ATG TCC GTT CGG 
Rossmanith 



artificial 
TTG GC-BHQ1
et al., 2006,



target

SEQ ID NO: 4





IAC
Artificial 
5′-GAT ACA GAA ACA TCG GTT GGC 
Rossmanith 



target
GTA TTC GAA ATG TCC GTT CGG TTG 
et al., 2006,




GCG CTA TGA AGA GAT ACG CGG TGG 
SEQ ID NO: 1




AAC CTG GAA CCT GAT GGC ATC AAG 





ATT ACA C-3′






NC 16
Confirmation of 
5′-GTC AAA ACA TAC GCT CTT 
Lauer 



pPL2 insertion
ATC-3′
et al., 2002





PL 95
Confirmation of 
5′-ACA TAA TCA GTC CAA AGT 
Lauer 



pPL2 insertion
AGA TGC-3′
et al., 2002





Sequ. 1 
Confirmation of 
Sequence included in Table 1A
This work


(NC 16)
pPL2 insertion







Sequ. 2 
Confirmation of 
Sequence included in Table 1A
This work


(PL 95)
pPL2 insertion







Species/Plasmid
Strain





L. monocyto-

EGDe (1/2a)
Wild type strain detected by 
IMMLd Strain 



genes wt


prfA real-time PCR
Nr. 2964






L. 

EGDe (1/2a) 

L. monocytogenes EGDe strain  

Böckmann 



monocytogenes

ΔprfA
with total deletion of the 
et al., 1996


Δtarget

prfA locus







E. coli TOP10F′


Chemically competent E. coli
Invitrogen





pPL2 Phage 

L. monocyto-

PSA intergration site.  
Lauer 


insertion

genes

Stable single copy
et al., 2002


vector
specific
integrants: ~10−4/donor cell.






aSpecific to L. monocytogenes wt




bPrimer containing Bam HI restriction site.




cPrimer containing Sal I restriction site.




dIMML: Institute of Milk Hygiene, Milk Technology and Food Science, University of Veterinary Medicine














TABLE 1A







Sequences and blast reports of the analysis of the amplification products


of the PCR according to Lauer et al., 2002










Name/Primer
Blast report
Referencea
Sequenceb





Sequence 1
Identities =
emb AJ417449.2
ANNNANNNACGTATCCAGTTCGATTCATGGACCGAGATGAC


Clone 
210/210 (100%),
Shuttle integra- 
AACGAACTAACAGACCTAACCCAAACCTTCCCATTAACGAAG


1/NC16
Gaps = 0/210 (0%),
tion vector pPL2
CGTAACTAGGTCAAAAGACACCCGAAAAAGAAAAAATGCAT



Strand = Plus/Plus
emb AL591978.1
AACTTAAAGAAAACCATTGACAAACAAGCGATTTAAACATA



Identities =

Listeria 

AAATGGTATTTGGCTGTTGAAAAGACAGTGCCATTTGTCCTG



267/268 (99%),

monocytogenes 

ATAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGT



Gaps = 1/268 (0%),
strain EGD, 
CGGGGGTTCGAATCCCTCTCAGGACGTTAAATAGTAATGTAA



Strand = Plus/Plus
complete genome,
AGAAATCTCTAAAACGTTGAAAAGCCTTGATATTAAAGGGCG




segment 6/12
GATGAATGTTTTGGAGTTTTTTTTATATCGTATAATACCCGTT





TTATTCCGTTGTTTTTGTGGCATTTGTGGTAAAATTTGTGGTA





TTTTCATCTGTTTTTAGTGTGAAAAAAGCATCTACTTTGGACT





GATTATGGTAAAACCACCAACTTGGAATGGATAAGGTCATCT





CCATTGGAGAGAGTATGTGCACCCACTACTTACGGATGATTT





AG





Sequence 1
Identities =
emb AJ417449.2
GGNNNTGAAACGNNCNAGTTCGATTCATGGACCGAGATGAC


Clone 
210/210 (100%),
Shuttle integra- 
AACGAACTAACAGACCTAACCCAAACCTTCCCATTAACGAAG


1/NC16
Gaps = 0/210 (0%),
tion vector pPL2
CGTAACTAGGTCAAAAGACACCCGAAAAAGAAAAAATGCAA



Strand = Plus/Plus
emb AL591978.1
TAACTTAAAGAAAACCATTGACAAACAAGCGATTTAAACATA



Identities =

Listeria 

AAATGGTATTTGGCTGTTGAAAAGACAGTGCCATTTGTCCTG



261/261 (100%),

monocytogenes 

ATAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGT



Gaps = 0/261 (0%),
strain EGD, 
CGGGGGTTCGAATCCCTCTCAGGACGTTAAATAGTAATGTAA



Strand = Plus/Plus
complete genome,
AGAAATCTCTAAAACGTTGAAAAGCCTTGATATTAAAGGGCG




segment 6/12
GATGAATGTTTTGGAGTTTTTTTTATATCGTATAATACCCGTT





TTATTCCGTTGTTTTTGTGGCATTTGTGGTAAAATTTGTGGTA





TTTTCATCTGTTTTTAGTGTGAAAAAAGCATCTACTTTGGACT





GATTATGGTAAAAACAACCTACTTGGGATGGTTAAGGGCACA





TCCATTGGAGAGAGTATGTGTANCCTCTTTGGAGGACTGATG





AGG





Sequence 1
Identities =
emb AJ417449.2
NNAANNNGTATCCAGTTCGATTCATGGACCGAGATGACAAC


Clone 
209/210 (99%),
Shuttle integra- 
GAACTAACAGACCTAACCCAAACCTTCCCATTAACGAAGCGT


1/NC16
Gaps = 1/210 (0%),
tion vector pPL2
AACTAGGTCAAAAGACACCCGAAAAAGAAAAAATGCAATAA



Strand = Plus/Plus
emb AL591978.1
CTTAAAGAAAACCATTGACAAACAAGCGATTTAAACATAAA



Identities =

Listeria 

ATGGTATTTGGCTGTTGAAAAGACAGTGCCATTTGTCCTGAT



267/268 (99%),

monocytogenes

AGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCG



Gaps = 1/268 (0%),
strain EGD,  
GGGGTTCGAATCCCTCTCAGGACGTTAAATAGTAATGTAAAG



Strand = Plus/Plus
complete genome,
AAATCTCTAAAACGTTGAAAAGCCTTGATATTAAAGGGCGGA




segment 6/12
TGAATGTTTTGGAGTTTTTTTTATATCGTATAATACCCGTTTT





ATTCCGTTGTTTTTGTGGCATTTGTGGTAAAATTTGTGGTATT





TTCATCTGTTTTTAGTGTGAAAAAAGCATCTACTTTGGCTGAT





TATGGTAAATCCACCTACTTTGAATGGATAAGGTCATCTCCA





TTGGAGAGAGTATGTGTATCTACTTTGTAGGGATGATGATGT





ACCACCTAGGTTGGACTGAATAGGTCCCCCCTTCTTCGATTA





AACAACGGGATAAAGTA





Sequence 1
Identities =
emb AJ417449.2
NNNNTNNCNAAGTATCCAGTTCGATTCATGGACCGAGATGA


Clone 
211/211 (100%),
Shuttle integra- 
CACGAACTAACAGACCTAACCCAAACCTTCCCATTAACGAAG


1/NC16
Gaps = 0/211 (0%),
tion vector pPL2
CGTAACTAGGTCAAAAGACACCCGAAAAAGAAAAAATGCAA



Strand = Plus/Plus
emb AL591978.1
TAACTTAAAGAAAACCATTGACAAACAAGCGATTTAAACATA



Identities =

Listeria 

AAATGGTATTTGGCTGTTGAAAAGACAGTGCCATTTGTCCTG



266/268 (99%),

monocytogenes 

ATAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGT



Gaps = 2/268 (0%),
strain EGD, 
CGGGGGTTCGAATCCCTCTCAGGACGTTAAATAGTAATGTAA



Strand = Plus/Plus
complete genome,
AGAAATCTCTAAAACGTTGAAAAGCCTTGATATTAAAGGGCG




segment 6/12
GATGAATGTTTTGGAGTTTTTTTTATATCGTATAATACCCGTT





TTATTCCGTTGTTTTTGTGGCATTTGTGGTAAAATTTGTGGTA





TTTTCATCTGTTTTTAGTGTGAAAAAAGCATCTACTTTGGACT





GATTATGTAAAACAACCTACTTTGGATGGATTAGGTAATATC





TTTTTGACAGAGTATGTGTACCATCTTTTTAGGACTGATTATG





TA





Sequence 1
Identities =
emb AJ417449.2
NNNNANNAAAAACGNATGAAATACCACAAATTTTACCACAA


Clone 
172/176 (97%),
Shuttle integra- 
ATGCCACAAAAACAACGGAATAAAACGGGTATTATACGATA


1/PL95
Gaps = 3/176 (1%),
tion-vector pPL2
TAAAAAAAACTCCAAAACATTCATCCGCCCTTTAATATCAAG



Strand = Plus/Minus
emb AL591978.1
GCTTTTCAACGTTTTAAAGATTTCTTTACATTACTATTTAACG



Identities =

Listeria 

TCCTGAGAGGGATTCGAACCCCCGACCGACGGCTTAAAAGG



300/302 (99%),

monocytogenes 

CCGTTGCTCTATCCAGCTGAGCTATCAGGACAAATGGCACTG



Gaps = 0/302 (0%),
strain EGD,
TCTTTTCAACAGCCAAATACCATTTTATGTTTAAATCGCTTGT



Strand = Plus/Minus
complete genome, 
TTGTCAATGGTTTTCTTTAAGTTATTGCATTTTTTCTTTTTCG




segment 6/12
GGTGTCTTTTGACCTATTTACGCTTCGTTAATGGGAAGGTTT





GGGTTAGGTCTGTTAGTTCGTTGTCATCTCGGTCCATGAATC





GAACTTGGATACCTTCTGGTGTTGAATCGATAAGAGCGTATG





TTTTGAACAACCACCTACTTTGGACTGATTAGGTAA





Sequence 1
Identities =
emb AJ417449.2
TNNTNNANACGATGACATACCACAAATTTTACCACAAATGCC


Clone 
165/168 (98%),
Shuttle integra- 
ACAAAAACAACGGAATAAAACGGGTATTATACGATATAAAA


1/PL95
Gaps = 1/168 (0%),
tion vector pPL2
AAAACTCCAAAACATTCATCCGCCCTTTAATATCAAGGCTTT



Strand = Plus/Minus
emb AL591978.1
TCAACGTTTTAAAGATTTCTTTACATTACTATTTAACGTCCTG



Identities =

Listeria 

AGAGGGATTCGAACCCCCGACCGACGGCTTAAAAGGCCGTT



292/293 (99%),

monocytogenes

GCTCTATCCAGCTGAGCTATCAGGACAAATGGCACTGTCTTT



Gaps = 0/293 (0%),
strain EGD, 
TCAACAGCCAAATACCATTTTATGTTTAAATCGCTTGTTTGTC



Strand = Plus/Minus
complete genome,
AATGGTTTTCTTTAAGTTATTGCATTTTTTCTTTTTCGGGTGT




segment 6/12
CTTTTGACCTAGTTACGCTTCGTTAATGGGAAGGTTTGGGTT





AGGTCTGTTAGTTCGTTGTCATCTCGGTCCATGAATCGAACT





TGGATACCTTCTGGTGTTGAATCGATAAGAGCNNTGGTTTTT





GTANACAAAACCTTTTACTTTGGACTGAATAAGGTACCCCCC





CTTGTAAAGGTTTTATGTGAACCNCCTTTGTAGAGTTAATTT





GGAACCACCGAGGGGGGATTGATTAGGCCACCCTGCCTTTAA





GTTCAGGTGGGCGACAN





Sequence 1
Identities =
emb AJ417449.2
NNTTAGNTAAAACGATGAAATACCACAAATTTTACCACAAAT


Clone 
171/174 (98%),
Shuttle integra-
GCCACAAAAACAACGGAATAAAACGGGTATTATACGATATA


1/PL95
Gaps = 2/174 (1%),
tion vector pPL2
AAAAAAACTCCAAAACATTCATCCGCCCTTTAATATCAAGGC



Strand = Plus/Minus
emb AL591978.1
TTTTCAACGTTTTAAAGATTTCTTTACATTACTATTTAACGTC



Identities =

Listeria 

CTGAGAGGGATTCGAACCCCCGACCGACGGCTTAAAAGGCC



301/302 (99%),

monocytogenes 

GTTGCTCTATCCAGCTGAGCTATCAGGACAAATGGCACTGTC



Gaps = 0/302 (0%),
strain EGD, 
TTTTCAACAGCCAAATACCATTTTATGTTTAAATCGCTTGTTT



Strand = Plus/Minus
complete genome,
GTCAATGGTTTTCTTTAAGTTATTGCATTTTTTCTTTTTCGGG




segment 6/12
TGTCTTTTGACCTAGTTACGCTTCGTTAATGGGAAGGTTTGG





GTTAGGTCTGTTAGTTCGTTGTCATCTCGGTCCATGAATCGA





ACTTGGATACCTTCTGGTGTTGAATCGATAAGAGCGTATGTT





TTTGACCAACCATCAACTTTGGACGGATTAGGTAACCTCCAT





TTGAGAGAGTATATGTAACACCTATTTTGGGAGGTATGATGA





AAAN





Sequence 1
Identities =
emb AJ417449.2
TNNNNGTANAAANGATGAAATACCACAAATTTTACCACAAA


Clone 
167/168 (99%),
Shuttle integra- 
TGCCACAAAAACAACGGAATAAAACGGGTATTATACGATAT


1/PL95
Gaps = 1/168 (0%),
tion vector pPL2
AAAAAAAACTCCAAAACATTCATCCGCCCTTTAATATCAAGG



Strand = Plus/Minus
emb AL591978.1
CTTTTCAACGTTTTAGAGATTTCTTTACATTACTATTTAACGT



Identities =

Listeria 

CCTGAGAGGGATTCGAACCCCCGACCGACGGCTTAAAAGGC



300/302 (99%),

monocytogenes 

CGTTGCTCTATCCAGCTGAGCTATCAGGACAAATGGCACTGT



Gaps = 0/302 (0%),
strain EGD, 
CTTTTCAACAGCCAAATACCATTTTATGTTTAAATCGCTTGTT



Strand = Plus/Minus
complete genome,
TGTCAATGGTTTTCTTTAAGTTATTGCATTTTTTCTTTTTCGG




segment 6/12
GTGTCTTTTGACCTAGTTACGCTTCGTTAATGGGAAGGTTTG





GGTTAGGTCTGTTAGTTCGTTGTCATCTCGGTCCATGAATCG





AACTTGGATACCTTCTGGTGTTGAATCGATAAAAGCGTATGT





TTTGAAAAACCATCAACTTTGAACGGATTAGGTAACCTCCAT





TTTGGAGAGA






aRefered to by blast report




bAs obtained by sequencing







Restriction digestion is performed using FastDigest restriction enzymes BamHI and SaII available from Fermentas (Fermentas International Inc., Burlington, Canada) according to manufacturer's instructions. A total reaction volume of 20 μl is incubated for one hour at 37° C. Dephosphorylation of the vector and the IAC fragments before ligation is performed using FastAP™ Thermosensitive Alkaline Phosphatase (Fermentas) according to manufacturer's instructions for 30 min at 37° C. T4 DNA ligase (Fermentas) is used for ligation of the vector pPL2 and the artificial IAC fragment over night at 4° C.


Real-time PCR detection of L. monocytogenes by targeting a 274 bp fragment of the prfA gene is performed according to previously published format using the primers Lip1 and Lip2 and FAM-labelled Lip-probe (D'Agostino et al. (2004) J. Food Prot. 67, 1646-1655; Rossmanith et al. (2006) Res. Microbiol. 157, 763-771). Real-time PCR detection of the artificial IAC fragment is performed according to Rossmanith et al. (2006) using Lip1 and Lip2 and HEX-labelled pLucLm4.


The forward primer (Lip1:5′-GATACAGAAACATCGGTTGGC-3′) and the reverse primer (Lip2:5′-GTGTAATCTTGATGCCATCAGG-3′) amplify a 274 bp fragment of the prfA gene. Two different TaqMan™ probe formats with increased melting temperature are used. The Lip-probe (5′-FAM-CAGGATTAAAAGTTGACCGCA-MGB-3′) uses an MGB modification. The probe for the IAC of the assay (pLucLm 4: 5′-HEX-TTCGAAATGTCCGTTCGGTTGGC -BHQ1-3′) is HEX labelled. Primers and probe pLucLm 4 can be purchased at MWG Biotech (Ebersberg, Germany). The MGB-modified probe is purchased at Applied Biosystems. Conventional PCR for confirmation of the insertion of pPL2-IAC into the Δ-prfA L. monocytogenes EGDe genome is performed using primers NC16 and PL95 (Lauer et al. (2002) J. Bacteriol. 184, 4177-4186). IAC+, Δ-prfA L. monocytogenes EGDe is identified as L. monocytogenes EGDe by amplifying the iap-locus of L. monocytogenes according to Bubert et al. (1999, Appl. Environ. Microbiol. 65, 4688-4692) and targeting the 16S rRNA gene specific for all Listeria spp. and the hly gene specific for L. monocytogenes according to Border et al. (1990, Lett. Appl. Microbiol. 11, 158-162).


Conventional and real-time PCR reactions are performed in an Mx3000p real-time PCR thermocycler (Stratagene, La Jolla, Calif., USA). The 25 μl volume contains 20 mM Tris-HCl, 50 mM KCl, 3.5 mM MgCl2, 500 nM of each primer, 250 nM of each probe, 200 μM (each) of dATP, dTTP, dGTP and dCTP, 1.5 U of Platinum© Taq DNA polymerase (Invitrogen, Lofer, Austria) and 5 μl isolated DNA. Amplification following initial denaturation at 94° C. for 2 min is performed in 45 cycles, at 94° C. for 15 s, and 64° C. for 1 minute.


For the DNA standard for real-time PCR quantification one millilitre of a pure culture of L. monocytogenes strain EGDe is subjected to DNA isolation using the NucleoSpin© tissue kit and the support protocol for Gram-positive bacteria. The DNA concentration is measured fluorimetrically using a Hoefer DyNA Quant200 device (Pharmacia Biotech). The copy number of the prfA gene is determined by assuming that, based on the molecular weight of the genome of L. monocytogenes, 1 ng of DNA equals 3.1×105 copies of the entire genome, and that the prfA gene is a single-copy gene. The slope (s) of the standard curve is used for calculation of the PCR efficiency (E) with the following equation: E=10−1/s−1 [21].


Real-time PCR results are expressed as bacterial cell equivalents (BCE). The copy number of the prfA gene and the IAC insert is determined by assuming that, based on the molecular weight of the genome of L. monocytogenes, 1 ng of DNA equalled 3.1×105 copies of the entire genome, and that the prfA gene and the IAC insert are a single-copy gene and a single copy insert within the genome respectively (Nelson et al.(2004) Nucleic Acids Res. 32, 2386-2395). All real-time PCR reactions are performed in duplicate except as noted otherwise.


PCR products of conventional PCR are separated in 1.5% agarose gels at 90 V for 25 min and stained with 0.5 μg/ml ethidium bromide (Sigma-Aldrich GmbH, Steinheim, Germany). GeneRuler 100 bp (MBI Fermentas, St. Leon-Rot, Germany) was used as a standard.


1.3. DNA extraction and measurement

The genomic DNA of one millilitre overnight bacterial culture is extracted by using the NucleoSpin® tissue kit (Macherey—Nagel) and the support protocol for Gram-positive bacteria. Plasmid DNA for cloning experiments is extracted using the Quiagen Plasmid Midi Kit (Hilden, Germany) according to manufacturer's instructions. DNA concentration is analytically determined by fluorimetric measurement using a Hoefer DyNA Quant200 apparatus (Pharmacia Biotech, San Francisco, Calif., USA) and a 8452A Diode Array Spectrophotometer (Hewlett Packard, Palo Alto, Calif., USA).


1.4. Cloning of pPL2-IAC

Adequate amounts of the IAC (IAC: 5′-GAT ACA GAA ACA TCG GTT GGC GTA TTC GAA ATG TCC GTT CGG TTG GCG CTA TGA AGA GAT ACG CGG TGG AAC CTG GAA CCT GAT GGC ATC AAG ATT ACA C-3′) for cloning are produced by amplification of the 100 bp fragment by conventional PCR according to Rossmanith et al. (2006, Res. Microbiol. 157, 763-771) using the modified primers LipBam and LipSaI containing the restriction sites BamHI and SaII. After purification of the amplification product using NucleoSpin® Extract II (Macherey-Nagel) restriction digestion and dephosphorylation are performed as described above, following ligation with the vector pPL2. Prior to ligation the phage integration vector pPL2 is transformed into E. coli TOP10F′ by standard heat shock techniques (Sambrook et al. (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) for amplification. The vector is extracted as described above and used for ligation after purification, restriction digestion and dephosphorylation. The resulting plasmid pPL2-IAC is then transformed into E. coli TOP10F′ via heat-shock. pPL2-IAC positive clones are selected by plating on Luria-Bertani broth (LB; Oxoid) containing 25 μg/ml of chloramphenicol.


Single bacterial colonies are picked up and screened for positive transformation of E. coli with pPL2-IAC. Restriction digestion analysis results in two fragments of a length of ˜6,000 bp and 100 bp corresponding to the lengths of vector and insert indicating transformation of pPL2-IAC into E. coli. Real-time PCR targeting the IAC using pLucLm4 results in amplification of the target, thus confirming the restriction digestion analysis (FIG. 1A).


1.5. Transformation of pPL2-IAC into Δ-prfA L. Monocytogenes EGDe

Δ-prfA L. monocytogenes EGDe is transformed with pPL2-IAC using a modified electroporation protocol (Park et al. (1990) Gene 94, 129-132). Electro-competent Δ-prfA L. monocytogenes EGDe cells are prepared as follows: Cells are grown in brain heart infusion broth (BHI; Oxoid) containing 5 μg/ml penicillinG to an OD600 of 0.3 at 37° C. Cells are harvested at 8000×g, 10 min at 4° C. and the pellet is washed twice in 1/10 vol. 3.5×SMHEM buffer (72 mM sucrose, 1 mM MgCl2, and 2 mM HEPES). After resuspending the pellet in 1/100 vol. 3.5×SMHEM buffer 100 μl aliquots are stored at −80° C.


For electroporation 100 μl aliquots of electro-competent Δ-prfA L. monocytogenes EGDe are thawed on ice and mixed with 5 μl DNA suspension (˜1 μg/reaction) containing pPL2-IAC. After incubation for one min on ice, electroporation is performed (100 Ω, 50 μF, 1000 V) in a Gene Pulser Xcell™ electroporation system (Bio-Rad Laboratories, Inc, Hercules, Calif., USA). One millilitre of pre warmed BHI is added, the sample is incubated 6 h at 37° C. and subsequently plated on BHI agar containing 25 μg/ml of chloramphenicol. After 24-48 h incubation at 37° C. individual colonies are picked and screened for pPL2-IAC positive Δ-prfA L. monocytogenes EGDe clones.


1.6. Confirmation of IAC+, Δ-prfA L. Monocytogenes EGDe

Four chloramphenicol screening positive clones of IAC+, Δ-prfA L. monocytogenes EGDe are confirmed by testing the presence of the IAC sequence in Δ-prfA L. monocytogenes EGDe. This is performed by amplifying the 100 bp fragment of the IAC using the probe pLucLm4. Genomic DNA from IAC+, Δ-prfA L. monocytogenes EGDe is subjected to real-time PCR resulting in positive amplification (FIG. 1B). The tested clones achieve a mean Ct-value of 11.5 (SD (standard deviation): 0.16) corresponding to a mean of 5.36×107 copies. The Δ-prfA status of the cloned strain is tested by real-time PCR using the probe Lip-probe hybridizing the 274 bp fragment of the prfA locus of the wild type L. monocytogenes resulting in no amplification.


Integration of the vector within the genome is tested with conventional PCR as described under paragraph 1.2. The resulting fragments after electrophoresis correspond to the proposed length of the amplification product of 499 bp (FIG. 2C). This indicates insertion of the vector into the Listeria genome as the primers NC16 and PL95 allow amplification across the attachment site tRNAArg-attBP′ in L. monocytogenes serotype 1/2a resulting in a hybrid amplificate containing parts of the sequences of the vector (3′) and of the Listeria genome (5′).


Sequencing analysis of IAC+, Δ-prfA L. monocytogenes EGDe is performed using this hybrid PCR amplificate using primers NC16 and PL95. The obtained sequence is 100% identical with a 210 bp fragment of the shuttle integration vector pPL2 and 100% identical to a 261 bp fragment of L. monocytogenes including the proposed attachment site tRNAArg-attBP′ (Strain EGDe, complete genome, segment 6/12; emb/AL591978.1) Confirmation testing of the resulting IAC+, Δ-prfA strain to be L. monocytogenes EGDe is additionally performed by conventional PCR as described under paragraph 1.2. The results are presented in FIGS. 2A and B. demonstrating matching fragment sizes for IAC+, Δ-prfA L. monocytogenes EGDe and the control L. monocytogenes EGDe for both PCR assays.


1.6. IAC+, Δ-prfA L. Monocytogenes EGDe Sequencing

PCR products from positive clones after amplification are purified using the NucleoSpin® Extract II Kit (Macherey-Nagel), following the manufacturer's instructions. Purified PCR products are submitted to Macrogen Inc. (Seoul, Korea) for DNA sequencing. Samples are sequenced on both strands using NC16 and PL95 primers on the cycle sequencing reaction.


The obtained sequences are analyzed and aligned using the BLAST server available at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST/).


1.7. Quantitative Real-Time PCR for Confirmation of Single Copy Insertion of pPL2-IAC into the Genome of Δ-prfA L. Monocytogenes EGDe and Calibration Against L. Monocytogenes EGDe Wild Type Data

Calibration standards of genomic IAC+, Δ-prfA L. monocytogenes EGDe DNA and L. monocytogenes EGDe wild type are compared using the prfA real-time PCR assay in a multiplex system with the probes pLucLm4 and Lip-probe. Based on the assumption that prfA is a single copy gene ten fold dilutions of both DNA targets are compared. The ten-fold dilutions are starting at 1.58×106 copies equaling 5 ng of genomic DNA as determined by fluorimetric and UV-VIS measurement. The results are presented in Table 3 and show good concordance of the Ct-values of both standard series. This also demonstrates comparable performance of both probes within the reactions. The underlying data result from duplicates repeated in four real-time PCR runs. For confirmation of these results the concentrations of cultures of IAC+, Δ-prfA L. monocytogenes EGDe are determined by viability staining and compared to real-time PCR results. The number of 3.2×103 (RSD.: 6.7%) BCE per sample as obtained by real-time PCR compares to 2.8×103 (RSD.: 25.0%) CFU per sample as determined by viable staining.









TABLE 3







Comparsion of Ct-values after real-time PCR derived from a ten-fold


standard dilution of genomic DNA of L. monocytogenes EGDe wild


type and the cloned EGDe Δ-prf; IAC+ strain demonstrating single


copy insertion of pPL2-IACa into the genome of L. monocytogenes


EGDe Δ-prfA.









Strain













EGDe wt against EGDe



EGDe Δ-prfA,

Δ-prfA,



IAC+
EGDe wt
IAC+ background









Target
Monoplex PCR
Duplex PCR










Copy Nr.b
Ct-values (SD)c
Ct-values (SD)d
Ct-values (SD)d,e





1.58 × 106
16.8 (0.08)
16.6 (0.11)



1.58 × 105
20.1 (0.13)
20.0 (0.02)
19.9 (0.13)


1.58 × 104
23.4 (0.14)
23.1 (0.18)
23.4 (0.26)


1.58 × 103
26.8 (0.13)
26.7 (0.06)
26.7 (0.31)


1.58 × 102
30.4 (0.07)
30.1 (0.02)
29.9 (0.68)


1.58 × 101
33.8 (0.27)
34.1 (0.91)
33.4 (0.77)





a Based on the assumption that prfA is a single copy gene.



bDilution series derived from a solution containing 1 ng/μl genomic DNA representing 1.58 × 106 copies in 5 μl DNA template.




cprfA real-time PCR assay using HEX labelled pLucLM4 probe, amplifiying the artificial IAC sequence.




dprfA real-time PCR assay using FAM labelled Lip-probe, amplifiying 274 bp of the prfA locus sequence.




eGenomic DNA of L. monocytogenes EGDe against 1.58 × 105 copies background of the genome of the EGDe Δ-prfA, IAC+ strain in a multiplex reaction.







The influence of increasing amounts of genomic DNA derived from IAC+, Δ-prfA L. monocytogenes EGDe on the performance of the main reaction amplifying the prfA locus of the wild type strain and main bacterial target is investigated with multiplex real-time PCR. Using Lip-probe and pLucLm4, ten-fold dilutions of genomic L. monocytogenes EGDe wild type DNA starting at 1.58×106 copies to 1.58×101 are tested in an ascending as well as descending matrix against a background of ten-fold dilutions of 1.58×106 to 1.58×101 copies of genomic IAC+, Δ-prfA L. monocytogenes EGDe DNA. The resulting Ct values for all tested combinations deviate from the respective values as obtained by the monoplex experiments of the genomic standards of both strains with a mean standard deviation of 0.3 for all combinations of standard concentration. Exemplarily the resulting Ct-values for a tenfold dilution of genomic DNA of L. monocytogenes EGDe are presented in Table 3 against a background of 1.58×105 copies of IAC+, Δ-prfA L. monocytogenes EGDe.


1.8. Artificially and Naturally Contaminated Food Samples

UHT milk for artificial contamination is purchased at local supermarkets and tested to be L. monocytogenes negative prior to inoculation performing real-time PCR targeting the prfA locus of L. monocytogenes. Artificial contamination is performed using a 10-fold dilution series in Ringer's solution (Oxoid) of a pure culture of L. monocytogenes EGDe containing 8.5×108 CFU/ml. 100 μl of the appropriate dilutions are added to the samples. The dilution series is prepared to contain 101-102, 102-103, 103-104 and 104-105 CFU/ml. The number of CFU for each step of the dilution series is obtained by the plate count method using tryptone soy agar with 0.6% yeast (TSA-Y; Oxoid). The experiment is performed in triplicates.


Naturally contaminated soft cheese samples are provided by regulatory authority and originated from a recent L. monocytogenes outbreak in Styria, Austria and are stored at 4° C. Two samples from two different production charges are processed in quadruplicates resulting in eight individual samples. Additionally, ISO 11290-2 is carried out accordingly for each sample to compare the quantitative results of the experiments with this standard method (ISO 11290-2; ISO 11290-2/Amd1).


1.9. Sample Treatment

Sample treatment is performed using the matrix lysis protocol as published by Mester et al. (2010) J. Food Protect. 73, 680-687 and Rossmanith et al. (2007) J. Microbiol. Methods 69, 504-511.


1.10. Statistical Analysis

Two-group comparisons are analyzed by chi square test. P values are calculated, and values ≦0.05 are considered significant.


2. APPLICATION EXAMPLES
2.1. Phenotype of IAC+, Δ-prfA L. Monocytogenes EGDe on OCLA, PALCAM, Blood Agar and RAPID′ L.Mono Agar Media

On blood agar IAC+, Δ-prfA L. monocytogenes EGDe show no haemolysis. On PALCAM agar IAC+, Δ-prfA L. monocytogenes EGDe show the same phenotype as the L. monocytogenes EGDe wild type, as presented in Table 2. The morphology and colour of IAC+, Δ-prfA L. monocytogenes EGDe on OCLA is also similar to the wild type except the halo formation which is not observable for IAC+, Δ-prfA L. monocytogenes EGDe after 24 and 48 h of incubation. After 72 h of incubation IAC+, Δ-prfA L. monocytogenes EGDe show some weak halo formation as well. Plated on RAPID′ L.mono the cloned strain develops white colour, lacking the characteristic green colour of the L. monocytogenes EGDe wild type strain on RAPID′ L.mono agar.









TABLE 2







Colony morphology of the cloned L. monocytogenes EGDe ΔprfA, IAC+ strain in


comparsion to the wild type L. monocytogenes EGDe and L. innocua on selected


selective and chromogenic agar media.












Strain/Media

RAPID′ L. mono
OCLA
PALCAM
Blood agar






L. monocytogenes

Morphology

Halo formationa
Fish eye



EGDe Wildtype
Colour
Green
Blue
Green




Agar staining
no

Black
Haemolysis



L. monocytogenes

Morphology

Halo after 72 hb
Fish eye



EGDe ΔprfA,
Colour
White
Blue
Green



IAC+
Agar staining
no

Black
No haem.



L. innocua

Morphology

No halo
Fish eye




Colour
White
Blue
Green




Agar staining
Yellow

Black
No haem.






aHalo formation was finished after 24 h incubation at 37° C. for L. monocytogenes EGDe wildtype.




bNo halo was observed for L. monocytogenes EGDe ΔprfA, IAC+ after 24 h and 48 h of incubation.







2.2. Application of IAC+, Δ-prfA L. Monocytogenes EGDe as Internal Process Control to Artificial Contaminated UHT Milk and Naturally Contaminated Quargel Cheese

Artificially as well as naturally contaminated food samples are processed according to the method disclosed by Rossmanith et al. (2007) J. Microbiol. Methods 69, 504-511: This method is based on sample preparation by lysis of the food matrix and subsequent separation of the target bacteria using centrifugation followed by DNA isolation and real-time PCR detection. The ionic liquid 1-ethyl-3-methylimidazolium thiocyanate ([emim]SCN) is used as solvent during sample preparation.


For artificial contamination 12.5 g samples of UHT milk are spiked with a four-step decimal dilution series of L. monocytogenes EGDe wild type as described in section 1.8. Additionally, 1.4×103 (RSD.: 29.0%) CFU per sample of the internal sample process control IAC+, Δ-prfA L. monocytogenes EGDe are added.


The main target pathogen L. monocytogenes EGDe wild type is recovered from UHT milk by a factor of 55% (RSD (relative standard deviation): 10.9%) compared with microscopy count. The relative standard deviation within the log-scales is 10.9% representing a high level of precision and reproducibility in terms of log scale recovery and indicating no biasing influence of the internal sample process control by means of IAC+, Δ-prfA L. monocytogenes EGDe cells.


The internal sample process control indicates a recovery of 49% (RSD.: 27.1%) compared with microscopic count. Initially 1.4×103 (RSD.: 29.0%) CFU (colony forming unit) per sample results in 6.9×102 (RSD.: 27.0%) BCE after recovery and real-time PCR detection.


The system is then applied to naturally contaminated samples of Quargel cheese. Additionally 1.4×103 (RSD.: 29.0%) CFU IAC+, Δ-prfA L. monocytogenes EGDe are added per sample.


The samples are processed in two ways: A direct quantification of the value of L. monocytogenes is obtained by matrix lysis and subsequent real-time PCR. Also ISO 11290-2 is performed for comparison. Additionally the samples are processed by matrix lysis and subsequent real-time PCR using a DNA isolation protocol omitting the Proteinase K step. This artificially biases the digestion performance and resulting thereof the efficiency of the whole protocol.


The values of L. monocytogenes contamination of the samples directly obtained after real-time PCR reach an average of 1.4×106 (RSD.: 5.9%) BCE and 1.1×108 (RSD.: 8.9%) BCE for the two respective Quargel cheese charges. These values are corrected according to the rate of efficiency for each sample as obtained by comparing the values of each replicate to the average value of the IAC+, Δ-prfA L. monocytogenes EGDe process control of 6.9×102 (RSD.: 5.9%) BCE after real-time PCR. After this correction the L. monocytogenes contamination average 1.1×106 (RSD.: 35.8%) BCE and 2.3×108 (RSD.: 10.2%) for the two charges. A further correction including the overall loss of IAC+, Δ-prfA L. monocytogenes EGDe process control cells from initially 1.4×103 (RSD.: 29.0%) CFU to 6.9×102 (RSD.: 5.9%) BCE after real-time PCR is done. This results in 2.32×106 (RSD.: 36.0%) BCE/g and 5.0×108 (RSD.: 9.9%) BCE/g for the two cheese charges comparing to 2.07×106 (RSD.: 91.1%) CFU/g and 4.9×108 (RSD.: 73.2%) CFU/g as obtained by ISO 11290-2. The samples processed by artificially biased DNA isolation average in basic values of 4.9×105 (RSD.: 6.3%) BCE and 3.7×107 (RSD.: 2.9%) for the respective cheese charges. After correction as prescribed above the respective L. monocytogenes contamination is 1.8×106 (RSD.: 47%) BCE and 4.6×108 (RSD.: 10.1%) BCE.

Claims
  • 1. A genetically modified bacterium of the species Listeria monocytogenes, wherein the genomic locus of the transcriptional factor PrfA has been deleted, characterised in that it comprises on genomic level an artificial sequence that acts as internal amplification control (IAC).
  • 2. The Listeria monocytogenes bacterium of claim 1, wherein the artificial sequence that acts as IAC comprises primer binding sequences at the 5′ and 3′ ends.
  • 3. The Listeria monocytogenes bacterium of claim 2, wherein the primer binding sequences are identical to the primer binding sequences of the genomic prfA locus of wild type Listeria monocytogenes.
  • 4. A Listeria monocytogenes bacterium of claim 1, wherein the artificial sequence that acts as IAC is a 100 bp sequence according to SEQ ID NO: 1.
  • 5. A genetically modified Listeria monocytogenes EGDe strain of claim 1.
  • 6. A genetically modified Listeria monocytogenes EGDe strain, wherein the genomic locus of the transcriptional factor PrfA has been deleted, comprising the internal amplification control sequence (IAC) of SEQ ID NO:1 deposited at the DSMZ as Listeria monocytogenes ΔprfA/+IAC under DSM 23639 on Mai 20, 2010.
  • 7. Use of genetically modified Listeria monocytogenes as specified in claim 1 for detecting and determining qualitatively and/or quantitatively the occurrence of wild type Listeria monocytogenes in a sample suspected to be contaminated with said micro-organism.
  • 8. Use according to claim 7, characterized in that the sample is food.
  • 9. Use of genetically modified Listeria monocytogenes as specified in claim 1 as internal sample process control (ISPC) for a real-time PCR based assay.
  • 10. A method for detecting and determining the occurrence of wild type Listeria monocytogenes in a sample suspected to be contaminated with said pathogenic micro-organism, comprising the steps: (a) adding to said sample a predefined amount of cells of the genetically modified Listeria monocytogenes bacterium as specified in claim 1,(b) incubating the sample with an extraction solution,(c) isolating the DNA by standard methods;(d) applying real-time PCR, thereby using (i) primers specific for the genomic prfA locus of wild type Listeria monocytogenes and the IAC sequence of genetically modified Listeria monocytogenes as specified in claim 1; and (ii) a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said prfA locus and a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said IAC sequence,(e) determining qualitatively and/or quantitatively fluorescent signals generated by step (d), and(f) determining and/or calculating from step (e) the presence and/or the amount of the wild type Listeria monocytogenes cells in the original sample suspected to be contaminated with said micro-organism.
  • 11. The method according to claim 10, wherein the primers used in step (d)(i) are Lip1 (SEQ ID NO: 2) and Lip2 (SEQ ID NO: 3).
  • 12. The method of claim 10, wherein the fluorescent labelled probes used in step (d)(ii) are pLucLm4 (SEQ ID NO:4) for detecting the IAC sequence, and LipProbe (SEQ ID NO:5) for detecting the prfA locus.
  • 13. A method according to claim 10, wherein the extraction solution of step (b) comprises at least MgCl2 and/or an ionic liquid.
  • 14. A kit for use in an assay for detecting and determining wild type Listeria monocytogenes in a sample suspected to be contaminated with said micro-organism, comprising at least in one or more packages (i) genetically modified Listeria monocytogenes as specified in claim 1;(ii) the primers specific for the genomic prfA locus of wild type Listeria monocytogenes and the IAC sequence of genetically modified Listeria monocytogenes as specified in claim 1; and(iii) a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said prfA locus and a fluorescent labelled oligonucleotide probe that is able to specifically hybridize with said IAC sequence.
  • 15. The kit according to claim 14, wherein the primers are Lip1 (SEQ ID NO:2) and Lip2 (SEQ ID NO:3).
  • 16. The kit according to claim 14, wherein the fluorescent labelled probes are pLucLm4 (SEQ ID NO:4) for detecting the IAC sequence and LipProbe (SEQ ID NO:5) for detecting the prfA locus.
  • 17. A method for manufacturing a genetically modified Listeria monocytogenes bacterium as specified in claim 1 comprising the steps: (a) deleting the genomic locus of the transcriptional factor PrfA of the bacterial species Listeria monocytogenes, (b) cloning of a vector comprising an IAC,(c) transforming the vector of step (b) into the bacterial species of step (a).
Priority Claims (1)
Number Date Country Kind
10005731.4 Jun 2010 EP regional
PCT Information
Filing Document Filing Date Country Kind 371c Date
PCT/EP2011/002147 4/29/2011 WO 00 11/30/2012