Patent Application
20230270855
This application includes a “Sequence Listing” which is provided as an electronic document having the file name “162152-52001_ST25.txt” (317 KB, created Nov. 11, 2020), which is herein incorporated by reference in its entirety.
The present invention relates to the field of cancer biology and immunology. More specifically, the present invention relates to the use of genetically modified immune cells in combination with certain chemotherapeutic agents for the treatment of cancer, wherein the genetically modified immune cells are resistant to said chemotherapeutic agents.
Many types of cancer are very difficult to treat due to their formidable resistance to currently available therapies. For instance, pancreatic ductal adenocarcinoma (PDAC), the third leading cause of cancer-related death in the U.S., has a five-year survival rate of 4%. Chemotherapy and radiation therapy have little impact on PDAC patient survival, and even those patients who are suitable for surgical resection have only a 10% survival rate past five years. Further, currently available immunotherapies, such as checkpoint inhibitors and chimeric antigen receptor T-cell (CAR T-cells), have not demonstrated efficacy against PDAC.
More than 90% of PDACs have oncogenic mutations in the Kras gene.
Phosphoinositide 3-kinase (PI3K) produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate (PIP3) and is a critical downstream effector of Kras that has been strongly implicated in oncogenesis. PI3K enzymes are heterodimers containing a p110α, p110β, p110δ or p110γ catalytic subunit (protein names PI3KCA, PI3KCB, PI3KCD and PI3KCG; gene names PI3Kca, PI3Kcb, PI3Kcd and PI3Kcg, respectively) bound to one of several regulatory subunits. T lymphocytes express all four PI3K catalytic isoforms. There are multiple downstream effectors of PI3K, including the protein kinase B (PKB, also known as Akt). While multiple inhibitors of PI3Ks and of their downstream effector Akt have already been tested in clinical trials, these drugs by themselves did not induce dramatic tumor regression. As such, better treatment options for cancers including PDAC are urgently needed.
In one aspect, the invention relates to genetically modified immune cells that are resistant to phosphoinositide 3-kinase (PI3K) or protein kinase B (Akt) inhibition. In some embodiments, the genetically modified immune cells are T-cells that express a mutant of a PI3K catalytic subunit, wherein the mutant of the PI3K catalytic subunit does not bind to an inhibitor of PI3K, but retains catalytic activity. In some embodiments, the genetically modified T-cells express more than one mutant of a specific PI3K catalytic subunit, and/or more than one type of mutant PI3K catalytic subunit.
In some embodiments, the mutant PI3K catalytic subunit is a class I PI3K catalytic subunit. In some embodiments, the mutant PI3K catalytic subunit is a p110α, p110β, p110δ, or p110γ catalytic subunit. In embodiments, the mutant PI3K catalytic subunit is a p110a catalytic subunit that comprises a mutation selected from one or more of the group consisting of Q859W, Q859A, Q859F, Q859D, and H855E. In further embodiments, the mutant PI3K is resistant to BYL719.
In embodiments of the invention, the mutant PI3K catalytic is a p110δ catalytic subunit that comprises one or more of mutations selected from the group consisting of D787A, D787E, D787V, I825A, I825V, D832E, and N836D.
In some embodiments, the genetically modified immune cells are resistant to one or more inhibitors of PI3K selected from the group of BYL719, GDC-0941, and copanlisib.
In a preferred embodiment, the invention relates to genetically modified T-cells expressing a p110δ mutant PI3K catalytic subunit one or more of mutations selected from one or more of the group consisting of D787A, D787E, D787V, I825A, and I825V, wherein the genetically modified T-cell is resistant to copanlisib.
In another embodiment, the invention relates to genetically modified T-cells expressing a p110δ mutant PI3K catalytic subunit comprising a D832E and/or an N836D mutation, wherein the genetically modified T-cell is resistant to BYL719.
In another aspect, the invention provides nucleotide sequences encoding for PI3K catalytic subunit mutants, as well as nucleic acid vectors comprising one or more nucleotide sequences encoding for PI3K catalytic subunit mutants.
The invention further relates to a method of making a population of modified T-cells resistant to PI3K inhibition, the method comprising:
In some embodiments, the genetically modified immune cells are T-cells that express a mutant of Akt, wherein the Akt mutant is resistant to inhibition by one or more inhibitors of Akt, but retains catalytic activity. In some embodiments, the T-cells express more than one mutant of a specific Akt mutant, and/or more than type of a mutant Akt.
In some embodiments, the Akt mutant is an Akt1 or an Akt2 mutant. In some embodiments, the Akt1 mutant comprises a W80A mutation. In some embodiments, the Akt2 mutant comprises a W80A mutation.
In some embodiments, the genetically modified immune cell is resistant to the Akt inhibitor MK2206.
Further contemplated is a method of making a population of modified T-cells resistant to Akt inhibition, the method comprising:
In some embodiments, the population of T-cells that is genetically modified is provided from a patient with cancer. In embodiments, the T-cells are autologous. In embodiments, the population of T-cells that is genetically modified is provided from a patient with pancreatic cancer. In further embodiments, the population of T-cells that is genetically modified is provided from a patient with pancreatic ductal adenocarcinoma.
In another aspect, the genetically modified T-cells that are resistant to PI3K and/or Akt inhibition express a chimeric antigen receptor (CAR). Further contemplated are methods of generating such CAR-expressing T-cells and methods of using such CAR-expressing T-cells in methods of treating cancer in a patient.
In another aspect the invention provides pharmaceutical compositions that comprise modified T-cells resistant to one or more PI3K and/or Akt inhibitors and a pharmaceutically acceptable carrier. In embodiments, he pharmaceutical compositions comprise T-cells that express one or more mutants of a PI3K catalytic subunit, wherein the mutants of the PI3K catalytic subunit do not bind to an inhibitor of PI3K, but retain catalytic activity, and a pharmaceutically acceptable carrier. In embodiments, the pharmaceutical compositions comprise T-cells that express one or more mutants of Akt, wherein the Akts mutant do not bind to an inhibitor of Akt but retain catalytic activity, and a pharmaceutically acceptable carrier.
In one aspect, the invention provides a genetically modified immune cell/drug combination immunotherapy that combines a small molecule inhibitor of PI3K and/or Akt with genetically modified immune cells resistant to PI3K and/or Akt inhibitors. Contemplated methods include a method of treating cancer in a patient in need thereof, the method comprising
Also contemplated by the invention is a method of treating cancer in a patient in need thereof, the method comprising
The invention also provides genetically modified T-cells resistant to PI3K and/or Akt inhibition for the use in treating cancer in a subject.
Unless indicated otherwise, the terms below have the following meaning:
The singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to “an” agent is a reference to one or more agents and equivalents thereof known to those skilled in the art, and so forth.
As used herein, the term “amino acid sequence” refers to an oligopeptide, peptide, polypeptide, peptidomimetic or protein sequence, or to a fragment, portion, or subunit of any of these, and to naturally occurring or synthetic molecules contemplated by the invention, or a biologically active fragment thereof.
The term “polynucleotide” or “nucleic acid” as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
As used herein, the term “identity” refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. For example, when a position in the compared nucleotide sequence is occupied by the same base, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at shared positions. Various alignment algorithms and/or programs may be used to calculate the similarity and/or identity between two sequences, including FASTA or BLAST, and can be used with, e.g., default setting. For example, polypeptides having at least 70%, 85%, 90%, 95%, 98% or 99% identity to specific polypeptides described herein and preferably exhibiting substantially the same functions, as well as polynucleotides encoding such polypeptides, are contemplated.
As used herein, the term “inhibitor” or “inhibits” refers to an agent that reduces, diminishes, or abolishes the activity of an interaction partner. As a non-limiting example, a PI3K inhibitor reduces, diminishes, or abolishes the activity of PI3K.
As used herein, the term “mutant” or “mutation” refers to the substitution, deletion, insertion of one or more nucleotides/amino acids in a polynucleotide (cDNA, gene) or a polypeptide sequence. Said mutation can affect the coding sequence of a gene or its regulatory sequence. It may also affect the structure of the genomic sequence or the structure/stability of the encoded mRNA.
As used herein, the terms “resistance to inhibition” or “resistant to an inhibitor” refers to a reduced degree by which a protein (or cell expressing the protein) is inhibited by an inhibitor, as compared to a non-resistant (e.g., wild-type) counterpart of said protein (or cell expressing the protein). As a non-limiting example, a PI3K mutant that exhibits resistance to PI3K inhibition shows less reduction in PI3K activity in presence of the inhibitor as compared to a non-mutated PIK3 protein in presence of the inhibitor. The activity of a PI3K mutant that exhibits resistance to PI3K inhibition may, in presence of the inhibitor, exhibit reduced, equal, or increased PI3K activity as compared to wild type PI3K in absence of the inhibitor.
As used herein, a “substantially identical” amino acid sequence also can include a sequence that differs from a reference sequence (e.g., an exemplary sequence of the invention, e.g., a protein comprising an amino acid selected from the group consisting of SEQ ID NOs. 1-19) by one or more conservative or non-conservative amino acid substitutions, deletions, or insertions, provided that the polypeptide essentially retains its functional properties. A conservative amino acid substitution, for example, substitutes one amino acid for another of the same class (e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid or glutamine for asparagine). One or more amino acids can be deleted, for example, from PI3K or Akt, resulting in modification of the structure of the polypeptide without significantly altering its biological activity. For example, amino- or carboxyl-terminal amino acids that are not required for PI3K or Akt can be removed.
The terms “treat,” “treated,” “treating” or “treatment” as used herein refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results. For the purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (i.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of the condition, disorder or disease; amelioration of the condition, disorder or disease state; and remission (whether partial or total), whether detectable or undetectable, or enhancement or improvement of the condition, disorder or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
The terms “vector” refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. A “vector” in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non-chromosomal, semi-synthetic or synthetic nucleic acids. In some embodiment, the vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available. Viral vectors include retrovirus, adenovirus, parvovirus (e. g. adeno associated viruses, AAV), coronavirus, negative strand RNA viruses such as orthomyxovirus (e. g., influenza virus), rhabdovirus (e. g., rabies and vesicular stomatitis virus), paramyxovirus (e. g. measles and Sendai), positive strand RNA viruses such as picornavirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e. g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e. g. vaccinia, fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example. Examples of retroviruses include: avian leukosis-sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, and spumavirus.
It is to be understood that this invention is not limited to the particular molecules, compositions, methodologies, or protocols described, as these may vary. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention. It is further to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention, or a particular claim, that feature can also be used, to the extent possible, in combination with and/or in the context of other particular aspects and embodiments of the invention, and in the invention generally.
Where reference is made herein to a method comprising two or more defined steps, the defined steps can be carried out in any order or simultaneously (except where the context excludes that possibility), and the method can include one or more other steps which are carried out before any of the defined steps, between two of the defined steps, or after all the defined steps (except where the context excludes that possibility).
The present invention provides a novel method for the treatment of cancer by inhibiting PI3K/Akt signaling in cancer cells without inhibiting PI3K/Akt signaling in cytotoxic T-cells (CTL). The invention relates to the discovery that cancer cells (e.g., pancreatic cancer cells) use the PI3K/Akt signaling pathway to evade the immune system, and that inhibiting PI3K/Akt signaling can induce tumor cells to reveal their antigens to the immune system. As such, drug inhibition of PI3K/Akt signaling in such cancer cells can render these cells susceptible to an anti-tumor immune response, including by the patient's immune response and/or by immunotherapies. However, since PI3K/Akt signaling is also involved in T cell function, the systemic use of PI3K or Akt inhibitors will block their anti-cancer effects. The present invention solves this problem by providing a combination therapy, in which inhibitors of PI3K/Akt signaling are employed to enhance antigen presentation on tumor cells, which in turn can be recognized by genetically modified T-cells that are resistant to the PI3K/Akt sign inhibitors, allowing the genetically modified T-cells to recognize the cancer cells. This concept is illustrated in
PI3K and Akt Inhibitors
The PI3K and Akt inhibitors that can be used for the methods of the invention, can be any such inhibitors where mutant PI3K or Akt proteins can be identified that are not inhibited by the inhibitor (for example do not bind to the inhibitor), but retain catalytic activity. Such mutant PI3K and Akt proteins can be identified and verified by the methods described herein.
Genetically modified T-cells contemplated by the invention may be resistant to PI3K inhibitors including, but not limited to, BYL719 (Alpelisib), BKM120 (Buparlisib), BAY80-6946 (Copanlisib), WX-037, GDC-0941 (Pictilisib), BEZ235, Taselisib (GDC-0032), Duvelisib (IPI-145), tenalisib (RP6530), CUDC-907, PQR309, PX-866, ZSTK474, GSK2126458, TGR-1202, SF1126, VS-5584, Idelalisib (GS-1101), SAR245409 (XL765), AZD8186, P7170, PF-05212384 (Gedatolisib or PKI-587), PF-04691502, and KA2237.
Genetically modified T-cells contemplated by the invention may be resistant to Akt inhibitors including, but not limited to, GSK2141795 (Uprosertib), ARQ 092, MK2206, GSK2110183 (Afuresertib), GSK690693, AZD5363, SR13668, TAS-117, MSC2363318A, LY2780301, Triciribine, GDC-0068 (Ipatasertib), and BAY1125976.
PI3K and Akt Mutants
In some embodiments, the genetically modified T-cells contemplated by the invention express one or more mutant versions of one of the four PI3K catalytic subunits (p110α, p110(3, p110δ or p110γ). Alternatively or additionally, genetically modified T-cells may express mutant versions of more than one of the four PI3K catalytic subunits.
In some embodiments, the mutant PI3K is a mutant PI3K p110α catalytic subunit that comprises a mutation selected from the group consisting of Q859W, Q859A, Q859F, Q859D and H855E. In other embodiments, the mutant PI3K is a mutant PI3K p110δ catalytic subunit that comprises one or more of mutations selected from the group consisting of D787A, D787E, D787V, I825A, I825V, D832E, and N836D.
In some embodiments, the genetically modified T-cells contemplated by the invention express one or more mutant versions of Akt. In embodiments, the mutant Akt is Akt1 and/or Akt2. In some embodiments, the mutant version of Akt is a W80A mutant of Akt1 or a W80A mutant of Akt2.
PI3K and Akt mutants contemplated by the invention include, but are not limited to, polypeptides that comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 2-6, 8-15, 17, and 19. The present invention further relates to polypeptides comprising a polypeptide sequence that has at least 70%, preferably at least 80%, more preferably at least 90%, 95% 97% or 99% sequence identity with amino acid sequence selected from the group consisting of SEQ ID NO: 1-19. In some embodiments, the contemplated mutants of PI3K catalytic subunits or of Akt are substantially identical to polypeptides that comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 1-19.
Further contemplated by the invention are nucleic acid molecules encoding the amino acid sequences of SEQ ID NO: 2-6, 8-15, 17, and 19, as well as nucleic acid molecules encoding mutants of PI3K catalytic subunits or mutants of Akt that are substantially identical to polypeptides that comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 2-6, 8-15, 17, and 19. Contemplated nucleic acid molecules include, but are not limited to, the nucleic acid sequences described by SEQ ID NO: 20-23, wherein said sequences are mutated to produce the respective PI3K and Akt mutants described by SEQ ID NO: 2-6, 8-15, 17, and 19 (e.g., SEQ ID NO: 24-34, 35-56, 57-60, and 61-64).
The invention also relates to expression cassettes, expression constructs, plasmids, and vectors comprising the contemplated nucleotide sequences. Different methods may be used to achieve the expression of the contemplated PI3K and Akt mutants in T-cells. Polypeptides may be expressed in the cell as a result of the introduction of polynucleotides encoding said polypeptides into the cell. Methods for introducing a polynucleotide construct into cells are known in the art and include as non-limiting examples stable transformation methods wherein the polynucleotide construct is integrated into the genome of the cell, transient transformation methods wherein the polynucleotide construct is not integrated into the genome of the cell and virus mediated methods. Said polynucleotides may be introduced into a cell by for example, recombinant viral vectors (e.g. retroviruses, adenoviruses, lentiviruses), liposome and the like. Transient transformation methods include for example microinjection, electroporation or particle bombardment. Polynucleotides may be included in vectors, more particularly plasmids or virus. Vectors can comprise a selection marker which provides for identification and/or selection of cells which received said vector. Different transgenes encoding PI3K and/or Akt proteins can be included in one vector. Said vector can comprise a nucleic acid sequence encoding ribosomal skip sequence such as a sequence encoding a 2A peptide.
In other embodiments, the modified PI3K and/or Akt proteins are provided to the T cells by gene editing (e.g., using the CRISPER/Cas9 system) to introduce the desired mutation(s) into the endogenous PI3K and/or Akt genes.
Genetically Modified T-Cells
The invention further relates to populations of genetically modified T-cells that express a PI3K and/or Akt mutant that is resistant to the respective inhibitor and retains catalytic activity. More than one mutant PI3K and/or mutant Akt constructs may be introduced a population of T-cells. The present invention encompasses the isolated cells or cell lines obtainable by the method of the invention, more particularly isolated immune cells comprising any of the proteins, polypeptides, genes or vectors described herein. The immune cells of the present invention or cell lines can further comprise exogenous recombinant polynucleotides, in particular CARs or suicide genes or they can comprise altered or deleted genes coding for checkpoint proteins or ligands thereof that contribute to their efficiency as a therapeutic product, ideally as an “off the shelf” product. Further contemplated are mixtures of two or more T-cell populations, in which each T-cell population expresses one or more PI3K or Akt mutants. T-cell populations contemplated by the invention include T-cell populations in which less than 100% of all cells in the population express one or more PI3K or Akt mutants.
In one embodiment, the genetically modified T-cells are isolated from one or more individual patients or are genetically engineered such that they can be used allogenically. In some embodiments, the T-cells are tumor-infiltrating lymphocytes.
Further contemplated are methods of making a population of modified T-cells that are resistant to P31K and/or Akt inhibition. Such methods may comprise the following steps:
Activation and Expansion of T-Cells
Whether prior to or after genetic modification of the T-cells, the T-cells can be activated and expanded generally using methods as described, for example, in U.S. Pat. Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application Publication No. 20060121005 (said methods incorporated herein by reference). T-cells can be expanded in vitro or in vivo. Generally, the T-cells of the invention are expanded by contact with an agent that stimulates a CD3 TCR complex and a co-stimulatory molecule on the surface of the T-cells to create an activation signal for the T-cell. For example, chemicals such as calcium ionophore A23187, phorbol 12-myristate 13-acetate (PMA), or mitogenic lectins like phytohemagglutinin (PHA) can be used to create an activation signal for the T-cell. As non-limiting examples, T-cell populations may be stimulated in vitro such as by contact with an anti-CD3 antibody, or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore. For co-stimulation of an accessory molecule on the surface of the T-cells, a ligand that binds the accessory molecule is used. For example, a population of T-cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the T-cells. To stimulate proliferation of either CD4+ T-cells or CD8+ T-cells, an anti-CD3 antibody and an anti-CD28 antibody. For example, the agents providing each signal may be in solution or coupled to a surface. As those of ordinary skill in the art can readily appreciate, the ratio of particles to cells may depend on particle size relative to the target cell.
Conditions appropriate for T-cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 5, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, -10, -2, IL-15, TGFp, IL-21 and TNF—or any other additives for the growth of cells known to the skilled artisan. Other additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol. Media can include RPMI 1640, A1M-V, DMEM, MEM, a-MEM, F-12, X-Vivo 1, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of T-cells. Antibiotics, e.g., penicillin and streptomycin, are included only in experimental cultures, not in cultures of cells that are to be infused into a subject. The targeT-cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37° C.) and atmosphere (e.g., air plus 5% CO2). T-cells that have been exposed to varied stimulation times may exhibit different characteristics.
Methods of Treatment
In another aspect, the present invention provides a method for treating or preventing cancer in the patient by administrating to the patient (i) an inhibitor or PI3K and/or an inhibitor of Akt and (ii) one or more populations of T-cells resistant to PI3K and/or Akt inhibition. The one or more populations of T-cells resistant to PI3K and/or Akt inhibition may be administered concurrently, consecutively, separately, or as a mixture.
Cancers that may be treated by the compositions and methods contemplated by the invention include tumors that are not vascularized, or not yet substantially vascularized, as well as vascularized tumors. The cancers may comprise nonsolid tumors (such as hematological tumors, for example, leukemias and lymphomas) or may comprise solid tumors. Types of cancers to be treated include, but are not limited to, pancreatic cancer, particularly pancreatic ductal adenocarcinoma, carcinoma, blastoma, and sarcoma, and certain leukemia or lymphoid malignancies, benign and malignant tumors, and malignancies e.g., sarcomas, carcinomas, and melanomas. Adult tumors/cancers and pediatric tumors/cancers are also included.
The administration of the population of cells according to the present invention may be carried out in any convenient manner, including by injection, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, intracranially, by intravenous or intralymphatic injection, or intraperitoneally. In one embodiment, the cell compositions of the present invention are preferably administered by intravenous injection.
In some embodiments, the methods of treating are combined with CAR-T-cell therapy. For example, T-cells can be transduced with CAR and with PI3K and/or Akt mutants prior to being introduced to the patient.
The methods of treatment contemplated by the invention can relate to a treatment in combination with one or more cancer therapies selected from the group of antibody therapy, chemotherapy, cytokine therapy, dendritic cell therapy, gene therapy, hormone therapy, laser light therapy and radiation therapy.
To facilitate a better understanding of the present invention, the following examples of specific embodiments are given. The following examples should not be read to limit or define the entire scope of the invention.
PI3Kca is not Essential for KPC Cell Survival in 2-D or 3-D Culture, but the Loss of this Gene Slows Proliferation.
To generate a PI3Kca knockout cell line, we first generated a stable bioluminescent cell line by infecting KPC cells with lentivirus expressing firefly luciferase under the control of a CMV promoter (Cellomics Technology #PLV-10064). These cells, referred to as WT KPC, were then transfected concurrently with PI3Kca CRISPR/Cas9 KO and HDR plasmids (Santa Cruz Biotechnology). We also generated an Egfr−/− cell line as a control for CRISPR/Cas9 processing. Gene-deleted cells were selected with puromycin followed by fluorescence-activated cell sorting to collect red fluorescent protein-positive cells. Both Egfr−/− and PI3Kca−/− KPC cells are viable, and multiple clones for each cell type were obtained. DNA sequencing of clonal cell lines confirmed the deletion of the PI3Kca or Egfr gene (data not shown), and Western blotting demonstrated the loss of EGFR or PI3K p110α protein (
These results demonstrate that PI3Kca is not essential for KPC cell survival in 2-D or 3-D culture, but the loss of this gene slows proliferation.
PI3Kca is not Required for Establishment of KPC Tumors in the Pancreas, but the Gene is Essential for Tumor Progression In Vivo.
To study the growth characteristics of PI3Kca−/− KPC cells in vivo, WT, Egfr−/− and PI3Kca−/− KPC cells were trypsinized and washed twice with PBS. C57BL/6 mice were anesthetized with a mixture of 100 mg/kg ketamine and 10 mg/kg xylazine. The abdomen was shaved and swabbed with a sterile alcohol pad followed by povidone-iodide scrub. A small vertical incision was made over the left lateral abdominal area, to the left of the spleen. The head of the pancreas attached to the duodenum was located. Using a sterile Hamilton syringe, 0.5 million cells in 30 μl PBS were injected into the head of the pancreas. The abdominal and skin incisions were closed with 4-0 silk braided sutures. To monitor tumor growth, the animals were injected intraperitoneally with 100 mg/kg RediJect D-Luciferin (PerkinElmer) and imaged on an IVIS Lumina III imaging system (Xenogen). Data were analyzed using Living Image® v4.3.1 software. As expected, WT KPC cell implantation led to rapid tumor growth and death of all the animals by 20 days (
In summary, implanted PI3Kca−/− KPC pancreatic tumors completely regressed in immunocompetent C57BL/6 mice, leading to 100% survival of the animals, whereas implanted wildtype (WT) KPC tumors killed all of the mice. As such, PI3Kca is not required for establishment of KPC tumors in the pancreas, but the gene is essential for tumor progression in vivo.
PI3Kca−/− KPC Tumors were Infiltrated with T-Cells but WT KPC Tumors were not.
CD3 IHC staining revealed that PI3Kca−/−KPC tumors implanted in WT mice are heavily infiltrated with T-cells as compared to WT KPC tumors (
Implanted PI3Kca−/− KPC Tumors Killed 100% of Immunodeficient SCID or CD8−/− C57BL/6 Mice, which Lack Cytotoxic T Lymphocytes (CTLs).
The growth of PI3Kca−/− KPC cells in immunodeficient B6.CB17-Prkdcscid/SzJ mice (SCID; Jackson Laboratory) that have no functional T or B cells was assessed. After injection of 0.5 million PI3Kca−/− KPC cells into the pancreas of SCID mice, IVIS imaging showed that the implanted tumors had grown larger over 14 days (
Adoptive Transfer of T-Cells Isolated from WT Mice Previously Implanted with PI3Kca−/− KPC Tumors Completely Protected SCID Mice from PI3Kca−/− KPC Tumor Implantation.
Spleens from WT mice that had recovered from implanted PI3Kca−/− KPC tumors (see
Taken together, these results support that deletion of PI3Kca causes KPC cells to elicit an immune response in the host animal that results in T cell-mediated regression of pancreatic tumors.
Inhibition of PI3K/Akt Signaling in KPC and Human PDAC Cell Lines Upregulates MHC Class I Molecules and CD80 Molecules in Pancreatic Cancer Cells, Leading to Recognition of the Tumor Cells by Immune Cells.
CD8-positive CTLs recognize antigens presented by MHC class 1 molecules on target T-cells. Downregulation of MHC class I molecules is a highly prevalent mechanism of immune evasion found in human cancers and has been described to occur in human PDAC. CTLs recognize target cells via antigens presented by MHC class I in a complex with B2M, and CD80 provides a co-stimulatory signal for sustained T cell activation. We assessed the level of cell surface H-2Kb (MHC class I protein in C57BL/6 mice) and CD80 in WT vs. PI3Kca−/− KPC cells by flow cytometry and found that the level is much higher on PI3Kca−/− cells (
Next, we tested if a human PDAC cell line (PANC-1) responds in a similar manner to Akt inhibition. PANC-1 cells contain the KrasG12D and Trp53R273H mutations. When these cells were treated with Akt inhibitor (Akti), cell surface human leukocyte antigens (HLA-A/B/C; MHC class I proteins in humans) were increased (
In summary, these results demonstrated that suppression of PI3K signaling in pancreatic cancer cells upregulates MHC class 1 expression, activates anti-tumor CTLs and leads to cancer regression. However, PI3K signaling is also important for proper T lymphocyte function and development. Therefore, systemic use of PI3K inhibitors for cancer treatment will inhibit T lymphocytes and block their anti-cancer effects.
Mutants of PI3K Catalytic Subunit p110α that are Resistant to Inhibition by BYL719.
T-cells express all four Class 1 PI3K catalytic isoforms (p110α, p110(3, p110δ and p110γ). p110δ appears to play a prominent role in the cytotoxic T-cell response, but little is known about the role of p110α in CTLs. BYL719 is a PI3K inhibitor that is selective against p110α (IC50=5 nM), but inhibits other PI3K isoforms at higher concentrations.
Based on the structure of the catalytic domain of p110α bound to BYL719, we predicted that changing Q859 to tryptophan (W) or alanine (A) will hinder the ability of BYL719 to enter the catalytic pocket, but will not affect binding of ATP (
Site-directed mutagenesis was used to generate the Q859W and Q859A p110α mutants. The FLAG-tagged constructs were expressed in HEK293 cells and the proteins were immunoprecipitated using FLAG antibody. Assays of PI3K activity in the immunoprecipitates (procedure described in Ballou et al., J. Biol. Chem. 275, 4803-4809 (2000), incorporated herein by reference) showed that both mutants were relatively resistant to inhibition by 100 nM BYL719 as compared to WT p110α (
Mutants of PI3K Catalytic Subunit p110δ that are Resistant to Inhibition by Copanlisib.
Copanlisib (Aliqopa) is a pan-isoform PI3K inhibitor. An X-ray crystal structure of p110γ bound to copanlisib is available (Scott et al., ChemMedChem 11, 1517-1530 (2016), incorporated herein by reference). Since the catalytic domains of p110γ and p110δ are nearly identical, we used the cocrystal structure of p110γ and copanlisib to model the catalytic domain of p110δ with copanlisib (
Mutants of PI3K Catalytic Subunit p110δ that are Resistant to Inhibition by BYL719.
A crystal structure of the catalytic domain of p110δ with BYL719 is not available, so a model based on its similarity to p110α is shown (see
Expression of Inhibitor-Resistant PI3K Mutants in CTLKPC.
Expansion of CTLs against KPC cells (referred to as CTLKPC) in culture allows us to test their cytotoxic activity in vitro. Spleen cells harvested from WT mice challenged with PI3Kca−/− KPC tumors will be placed into RPMI medium containing 10% FBS and IL-2. Irradiated PI3Kca−/− KPC cells are added to provide antigen stimulation. The enrichment procedure is repeated weekly by providing fresh irradiated naïve spleen cells (to provide antigen-presenting cells) and PI3Kca−/− KPC cells. The CTLKPC will proliferate and enrich in the culture. To counteract the negative effect of PI3K inhibitors on CTLKPC, inhibitor-resistant PI3K mutants are introduced into the cells: PI3K p110α mutants include, but are not limited to, Q859W, Q859A, Q859F, Q859D, and/or H855E; PI3K p110δ mutants include, but are not limited to mutants that contain one or more mutations selected from D787A, D787E, D787V, I825A, I825V, D832E, and N846D. Lentiviruses will be used to transduce cultured T-cells and produce cell lines named that express one or more PI3K p110α mutants, one or more PI3K p110δ mutants and combinations of PI3K p110α and p110δ mutants, respectively. The mutant PI3Ks are dominant over endogenous kinases in the presence of PI3K inhibitors. These mutant CTLKPC clones are then be assayed for cytolytic activity as described above. It is expected that the mutant CTLKPC clones will have (a) have normal activity against PI3Kca−/−KPC cells in the absence of PI3K inhibitors, and (b) have gained the ability to kill PI3Kca−/− KPC and WT KPC cells in the presence of the respective PIK inhibitor that the expressed PI3K mutant or mutants confer resistance to.
Adoptive Transfer of Genetically Modified T-Cells Expressing PI3K Mutants Plus Treatment with a PI3K Inhibitor to Induce Regression of WT KPC Tumors.
To test the anti-tumor efficacy of CTLKPC clones that express one or more PI3K p110α mutants, one or more PI3K p110δ mutants or combinations of PI3K p110α and p110δ mutants, respectively, in vivo, WT mice are implanted with 0.5 million WT KPC cells in the pancreas. After 2 weeks, the pancreatic tumors are well established and are quantified by IVIS imaging. These mice are then injected with 5 million PI3K mutant-expressing T-cells into the retro-orbital sinus and on the same day started on BYL719 (25 mg/kg/d) by oral gavage. Three control groups are mice implanted with WT KPC cells and then (1) left without further interventions, (2) treated with BYL719 (25 mg/kg/d), or (3) injected with 5 million cells expressing the PI3K mutants as described above (N=12 in each group, equal number of males and females). Changes in tumor size are monitored by IVIS imaging and survival curves are constructed. Post-mortem examination is performed as described above for analyzing the pancreas. Tumor regression is observed only in the groups that receive adoptive transfer of PI3K mutant-expressing T-cells, plus concurrent treatment with the appropriate PI3K inhibitor. Consequently, the groups of mice expressing one or more PI3K mutants survive, whereas the 3 control groups of mice all die from pancreatic tumor progression.
Expression of Inhibitor-Resistant Akt Mutants in CTLKPC.
Previous studies showed that Akt1W80A and Akt2W80A mutants are completely resistant to inhibition by MK2206 (Trapnell, C. et al. L. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25:1105-1111 (2009)). Retroviruses are used to transduce cultured CTLKPC, and three cell lines named Akt1W80ACTLKPC (expressing a W80A mutant of Akt1), Akt2W80ACTLKPC (expressing a W80A mutant of Akt2), and Akt1/2W80ACTLKPC (expressing a W80A mutant of Akt1 and a W80A mutant of Akt2) are produced. The mutant Akt isoforms are dominant over endogenous kinases in the presence of MK2206. Mutant CTLKPC clones are then assayed for cytolytic activity as described herein. It is expected that the CTLKPC clones will kill PI3Kca−/− KPC, and more importantly, WT KPC cells in the presence of the Akt inhibitor.
Adoptive Transfer of Genetically Modified T-Cells Expressing Akt Mutants Plus Treatment with a Akt Inhibitor to Induce Regression of WT KPC Tumors.
To test the anti-tumor efficacy of Akt1W80ACTLKPC, Akt2W80ACTLKPC, and Akt1/2W80ACTLKPC in vivo, WT mice are implanted with 0.5 million WT KPC cells in the pancreas. After 1 week, the pancreatic tumors are well established and are quantified by IVIS imaging. These mice are then started on MK2206 (120 mg/kg every other day by oral gavage) for 1 dose prior to injection with 5 million T-cells expressing Akt mutants into the retro-orbital sinus. The drugs are continued after the T cell infusion until the end of the experiment. Control groups are mice implanted with WT KPC cells and then (a) left without further interventions, (b) treated with MK2206 alone, or (c) injected with 5 million of the different Akt mutant-expressing T-cells alone (N=6 males and 6 females in each group (sex-matched donor cells and hosts)). Tumor size is monitored by IVIS imaging and survival curves are constructed. Pancreas sections are stained by H&E to assess the tumors and surrounding stromal response. IHC studies are performed to assess the presence of immune cells, including CD4 and CD8 T-cells. Sections are also stained for phospho-Akt and total Akt to confirm that PI3K/Akt signaling is inhibited in the tumor cells by the drugs. Treating WT KPC cells with inhibitors of PI3K or Akt will enhance their sensitivity to CTLKPC killing if the T-cells are protected from or not exposed to the drugs. T-cells expressing Akt mutants will kill WT KPC cells in the presence of MK2206 in vitro and tumors will regress in mice that receive adoptive T-cell therapy with T-cells expressing Akt mutants in combination with MK2206 treatment.
While the foregoing written description of the invention enables one of ordinary skill to make and use what is considered presently to be the best mode thereof, those of ordinary skill will understand and appreciate the existence of variations, combinations, and equivalents of the specific embodiments, methods, and examples herein.
ac
tattatgcaaattcagtgcaaaggcggcttgaaaggtgcactgcagttcaacagccacacactacatcagtggctcaaagacaaga
Changes to the encoded amino acid sequence are achieved by making one of the following changes in SEQ ID NO:20 as indicated in Table 1:
Changes to the encoded amino acid sequence are achieved by making one of the following changes in in SEQ ID NO:21 as indicated in Table 2:
Changes to the encoded amino acid sequence are achieved by making one of the following changes in in SEQ ID NO:22 as indicated in Table 3:
GCG
Changes to the encoded amino acid sequence are achieved by making one of the following changes in in SEQ ID NO:23 as indicated in Table 4:
GCG
This application is a 371 application of PCT/US2019/026627, filed Apr. 9, 2019, which claims the benefit of priority to U.S. Provisional Application No. 62/655,022 filed Apr. 9, 2018, each of which is incorporated herein by reference in its entirety.
This invention was made with government support under CA194836 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2019/026627 | 4/9/2019 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 62655022 | Apr 2018 | US |
