The present invention relates to a GPR119 agonist.
Diabetes is a life-style related disease and the number of patients increases all over the world. The treatments for diabetes are classified into diet, exercise and drug therapy (injectable insulin and an oral anti-diabetic drug). Some oral anti-diabetic drugs, for example, α-glucosidase inhibitors (acarbose, voglibose), insulin-sensitizing agents (pioglitazone hydrochloride), biguanides (metformin hydrochloride), sulfonylureas (glibenclamide, glimepiride), and short-acting insulin secretagogues (mitiglinide calcium hydrate) are commercially available.
Recently, an incretin mimetics (excenatide) and a DPP IV inhibitor (sitagliptin), which accelerate secretion of insulin, have been developed and are also commercially available. Further, SGLT inhibitors have been developed.
GPR119 has been reported as a G protein-coupled-receptor (GPCR) whose endogenous ligand is N-oleoylethanolamide and which stimulate insulin secretion from pancreatic β-cells (Non-patent Document 1). It has been reported that GPR119 agonist increases the plasma concentration of Glucagon like peptide-1 (GLP-1), one of incretins (Non-patent Document 2), which may indirectly relate to stimulation of insulin secretion. It has been further reported that GPR119 agonist suppresses a weight increase in rats fed a high-fat diet (Non-patent Document 1), which may relate to energy metabolism. For the reasons mentioned above, the GPR119 agonist has been expected as a drug not only for diabetes but also for life-style related diseases such as obesity and metabolic syndrome.
Compounds such as (A) are described in Patent Document 1 as the GPR119 agonist.
Compounds such as (B) are described in Patent Document 2 as the GPR119 agonist.
Compounds such as (C) are described in Patent Document 3 as the GPR119 agonist.
The compounds of the present invention represented by the below-described formulas (I) and (II) are different from the compounds (A) to (C) because the carbon atom of a cyclic amine such as a piperidine ring is directly combined with a pyrimidine ring or the like in the compounds of the present invention.
Compounds such as (D) are described in Patent Document 4.
Compounds such as (E) are described in Patent Document 5.
The compounds of the present invention represented by the below-described formulas (I) and (II) are clearly different from the compounds (D) and (E) in their structures. Further, there is no description in the Patent Document 4 that the compound (D) has a function of a GPR119 agonist, though the Document 4 uses the compound (D) as an intermediate in preparation of an agent for treating Alzheimer's disease. There is also no description in the Patent Document 5 that the compound (E) has a function of a GPR119 agonist, though the Document 5 describes use of the compound (E) as a cannabinoid receptor-1 (CB1) antagonist.
Patent Documents 6 and 7 have recently been disclosed as International Publications with respect to GPR119 agonists.
The compounds described in Examples of the Patent Document 6 show very low agonist activities of 33 to 73% even at a high concentration of 3 μM.
A pyrimidine ring is combined with a piperidine ring via oxygen or nitrogen atom in the compounds disclosed in the Patent Document 7, while a pyrimidine ring is directly combined with a piperidine ring in the compounds of the present invention represented by the below-described formulas (I) and (II).
The present inventors have filed Patent Document 8.
The nitrogen-containing heterocyclic ring in the center of the compound molecules disclosed in the Document 8 is a pyridine or pyridazine ring, while the corresponding ring in the compounds of the present invention represented by the below-described formulas (I) and (II) is a pyrazine or pyrimidine ring.
The object of the invention is to provide a compound represented by the formula (I) or (II), or a pharmaceutically acceptable salt thereof, and an agent for treating diabetes containing it as an active ingredient.
The present invention relates to a compound having the following formula (I) or a pharmaceutically acceptable salt thereof:
wherein one of T1, T2, T3, and T4 is N, and each of the other three independently is CR4 or, in the alternative, each of T1, T2, T3, and T4 independently is CR4, wherein R4 is hydrogen, a halogen atom, nitro, cyano, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, a C1-8 alkoxy group having one to three halogen atoms, phenoxy, an alkoxycarbonyl group containing a C1-8 alkoxy group, carboxyl, carbamoyl, an acyl group containing a C-s alkyl group, an alkylaminocarbonyl group containing a C1-8 alkyl group, a dialkylaminocarbonyl group containing C2-12 alkyl groups, an alkoxycarbonylmethylcarbonyl group containing a C1-8 alkoxy group, an alkylsulfonylmethyl group containing a C1-8 alkyl group, amino, a C1-8 alkylamino group, a C2-12 dialkylamino group, a C1-8 alkylsulfonylamino group, an acylamino group containing a C1-8 alkyl group, a C1-8 alkylsulfinyl group, a C-s alkylsulfonyl group, a cycloalkylsulfonyl group containing a three-membered to six-membered ring, sulfamoyl, a C1-8 alkylaminosulfonyl group, a C2-12 dialkylaminosulfonyl group, phenylsulfonyl, or a five-membered or six-membered heteroaryl group;
each of R2 and R3 independently is hydrogen or a C1-8 alkyl group;
the double line consisting of a solid line and a broken line means a single or double bond;
A is (CH2)m, C(O), or a bond, wherein m is an integer of 1 to 3;
B is (C(R5)H)n, S, O, NR6, or a bond, wherein n is an integer of 1 to 3, and each of R5 and R6 is hydrogen, a C1-8 alkyl group, or a three-membered to six-membered cycloalkyl group, provided that B is neither S, O, nor NR6 when A is a bond;
one of U and V is N, and the other is CR7, wherein R7 is hydrogen, a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, or a C1-8 alkoxy group having one to three halogen atoms;
R1 is hydrogen, a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, or a C1-8 alkoxy group having one to three halogen atoms;
W is C or CR8, wherein R8 is hydrogen, a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, or a C1-8 alkoxy group having one to three halogen atoms;
X is a C1-3 alkylene group, which optionally has a substituent or substituents selected from the group consisting of a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, and a C1-8 alkoxy group having one to three halogen atoms, and X may combine to W with a double bond when W is C;
Y is a C1-3 alkylene group, which optionally has a substituent or substituents selected from the group consisting of a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, and a C1-8 alkoxy group having one to three halogen atoms;
the substituents of X and Y can be combined to form a C1-3 alkylene group, which optionally has a C1-8 alkyl group; and
Z is C(O)OR9, C(O)R10, SO2R11, C(O)NR12R13, CH2C(O)N(R14) (R15), or a five-membered or six-membered heteroaryl group comprising carbon and nitrogen atoms and optionally comprising oxygen or sulfur atom, one of said carbon atoms combining to the nitrogen atom of the neighboring cyclic amine, and said heteroaryl group optionally having a substituent or substituents selected from the group consisting of a halogen atom, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, and a C1-8 alkoxy group having one to three halogen atoms, wherein each of R9, R10, R1, R12, R13, R14, and R15 independently is a C1-8 alkyl group, a C2-8 alkenyl group, a three-membered to six-membered cycloalkyl group, phenyl, or a C1-8 alkyl group having phenyl.
The invention also relates to a compound having the following formula (II) or a pharmaceutically acceptable salt thereof:
wherein each of R21, R22, and R23 independently is hydrogen, a halogen atom, nitro, cyano, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, a C1-8 alkoxy group having one to three halogen atoms, phenoxy, an alkoxycarbonyl group containing a C1-8 alkoxy group, carboxyl, carbamoyl, an acyl group containing a C1-8 alkyl group, an alkylaminocarbonyl group containing a C1-8 alkyl group, a dialkylaminocarbonyl group containing C2-12 alkyl groups, an alkoxycarbonylmethylcarbonyl group containing a C1-8 alkoxy group, an alkylsulfonylmethyl group containing a C1-8 alkyl group, amino, a C1-8 alkylamino group, a C2-12 dialkylamino group, a C1-8 alkylsulfonylamino group, an acylamino group containing a C1-8 alkyl group, a C1-8 alkylsulfinyl group, a C1-8 alkylsulfonyl group, a cycloalkylsulfonyl group containing a three-membered to six-membered ring, sulfamoyl, a C1-8 alkylaminosulfonyl group, a C2-12 dialkylaminosulfonyl group, phenylsulfonyl, or a five-membered or six-membered heteroaryl group;
Q is N or CH;
A0 is (CH2)p, C(O), S, O, NR24, or a bond, wherein p is an integer of 1 to 3, and R24 is hydrogen, a C1-8 alkyl group, or a three-membered to six-membered cycloalkyl group;
B0 is (C(R25)H)q, O, NR26, or a bond, wherein q is an integer of 1 to 3, and each of R25 and R26 is hydrogen, a C1-8 alkyl group, or a three-membered to six-membered cycloalkyl group, provided that B0 is neither 0 nor NR26 when A0 is S, O, or NR24, and that B0 is not a bond when A0 is a bond;
one of U0 and V0 is N and the other is CR27, wherein R27 is hydrogen, a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, or a C1-8 alkoxy group having one to three halogen atoms;
R20 is hydrogen, a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, or a C1-8 alkoxy group having one to three halogen atoms;
W0 is C or CR28, wherein R28 is hydrogen, a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, or a C1-8 alkoxy group having one to three halogen atoms;
X0 is a C1-3 alkylene group, which optionally has a substituent or substituents selected from the group consisting of a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, and a C1-8 alkoxy group having one to three halogen atoms, and X0 may combine to W0 with a double bond when W0 is C;
Y0 is a C1-3 alkylene group, which optionally has a substituent or substituents selected from the group consisting of a halogen atom, hydroxyl, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, and a C1-8 alkoxy group having one to three halogen atoms;
the substituents of X0 and Y0 can be combined to form a C1-3 alkylene group, which optionally has a C1-8 alkyl group; and
Z0 is C(O)OR29, C(O) R30, SO2R31, C(O)NR32R33, CH2C(O)N(R34) (R35), or a five-membered or six-membered heteroaryl group comprising carbon and nitrogen atoms and optionally comprising oxygen or sulfur atom, one of said carbon atoms combining to the nitrogen atom of the neighboring cyclic amine, and said heteroaryl group optionally having a substituent or substituents selected from the group consisting of a halogen atom, a C1-8 alkyl group, a C1-8 alkoxy group, a C1-8 alkyl group having one to three halogen atoms, and a C1-8 alkoxy group having one to three halogen atoms, wherein each of R29, R30, R31, R32, R33, R34 and R35 independently is a C1-8 alkyl group, a C2-8 alkenyl group, a three-membered to six-membered cycloalkyl group, phenyl, or a C1-8 alkyl group having phenyl.
The invention further relates to an agent for treating diabetes containing the compound of the formula (I) or (II) described above, or a pharmaceutically acceptable salt thereof as an active ingredient.
The invention further relates to a GPR119 agonist containing the compound of the formula (I) or (II) described above, or a pharmaceutically acceptable salt thereof as an active ingredient.
The present invention is described below in detail.
Preferred embodiments of the compound of the formula (I) are described below.
(1) A compound of the above-mentioned formula (I) or a pharmaceutically acceptable salt thereof, wherein each of T1, T2, T3, and T4 independently is CR4.
(2) A compound of the above-mentioned formula (I) or a pharmaceutically acceptable salt thereof, wherein T1 is N, and each of T2, T3, and T4 independently is CR4.
(3) A compound of the above-mentioned formula (I) or described in (1) or (2), or a pharmaceutically acceptable salt thereof, wherein R4 is hydrogen, a halogen atom, a C1-8 alkyl group, cyano, an alkoxycarbonyl group containing a C1-8 alkoxy group, a C1-8 alkylsulfonyl group, sulfamoyl, phenylsulfonyl, or a five-membered or six-membered heteroaryl group.
(5) A compound of the above-mentioned formula (I) or described in (1) or (2), or a pharmaceutically acceptable salt thereof, wherein one of CR4 represented by T1, T2, T3, and T4 is C—(C1-8 alkylsulfonyl), and each of the others of CR4 is selected from CH, C—(C1-8 alkyl), or C-(halogeno).
(6) A compound of the above-mentioned formula (I) or described in (1) or (2), or a pharmaceutically acceptable salt thereof, wherein one of CR4 represented by T1, T2, T3, and T4 is C-(l-tetrazolyl) or C-(1,2,4-triazol-1-yl).
(7) A compound of the above-mentioned formula (I) or described in (1) or (2), or a pharmaceutically acceptable salt thereof, wherein one of CR4 represented by T1, T2, T3, and T4 is C-(1-tetrazolyl) or C-(1,2,4-triazol-1-yl), and each of the others of CR4 is selected from CH, C—(C1-8 alkyl), or C-(halogeno).
(8) A compound of the above-mentioned formula (I) or described in one of (1) to (7), or a pharmaceutically acceptable salt thereof, wherein each of R2 and R3 is hydrogen.
(9) A compound of the above-mentioned formula (I) or described in one of (1) to (8), or a pharmaceutically acceptable salt thereof, wherein A is CH2, and B is a bond.
(10) A compound of the above-mentioned formula (I) or described in one of (1) to (9), or a pharmaceutically acceptable salt thereof, wherein U is CH, and V is N.
(11) A compound of the above-mentioned formula (I) or described in one of (1) to (9), or a pharmaceutically acceptable salt thereof, wherein U is N, and V is CH.
(12) A compound of the above-mentioned formula (I) or described in one of (1) to (11), or a pharmaceutically acceptable salt thereof, wherein each of X and Y is ethylene.
(13) A compound of the above-mentioned formula (I) or described in one of (1) to (11), or a pharmaceutically acceptable salt thereof, wherein W is C, and X combines to W with a double bond.
(14) A compound of the above-mentioned formula (I) or described in one of (1) to (13), or a pharmaceutically acceptable salt thereof, wherein Z is C(O)OR9.
(15) A compound of the above-mentioned formula (I) or described in (14), or a pharmaceutically acceptable salt thereof, wherein R9 is a C1-8 alkyl group.
(16) A compound of the above-mentioned formula (I) or described in one of (1) to (13), or a pharmaceutically acceptable salt thereof, wherein Z is 3-C1-8 alkyl-1,2,4-oxadiazol-5-yl or 5-C1-8 alkyl-1,2,4-oxadiazol-3-yl.
(17) A compound of the above-mentioned formula (I) or described in one of (1) to (13), or a pharmaceutically acceptable salt thereof, wherein Z is 5-C1-8 alkylpyrimidin-2-yl.
(18) A compound of the above-mentioned formula (I) or described in one of (1) to (17), or a pharmaceutically acceptable salt thereof, wherein each of R1 and R7 is hydrogen.
Preferred embodiments of the compound of the formula (II) are described below.
(19) A compound of the above-mentioned formula (II) or a pharmaceutically acceptable salt thereof, wherein Q is CH.
(20) A compound of the above-mentioned formula (II) or described in (19), or a pharmaceutically acceptable salt thereof, wherein each of R21, R22, and R23 independently is hydrogen, a halogen atom, a C1-8 alkyl group, cyano, an alkoxycarbonyl group containing a C1-8 alkoxy group, a C1-8 alkylsulfonyl group, sulfamoyl, phenylsulfonyl, or a five-membered or six-membered heteroaryl group.
(21) A compound of the above-mentioned formula (II) or described in (19), or a pharmaceutically acceptable salt thereof, wherein one of R21, R22, and R23 is a C1-8 alkylsulfonyl group.
(22) A compound of the above-mentioned formula (II) or described in (19), or a pharmaceutically acceptable salt thereof, wherein one of R21, R22, and R23 is a C1-8 alkylsulfonyl group, and each of the others is selected from hydrogen, a C1-8 alkyl group, or a halogen atom.
(23) A compound of the above-mentioned formula (II) or described in (19), or a pharmaceutically acceptable salt thereof, wherein one of R21, R22, and R23 is 1-tetrazolyl or 1,2,4-triazol-1-yl.
(24) A compound of the above-mentioned formula (II) or described in (19), or a pharmaceutically acceptable salt thereof, wherein one of R21, R22, and R23 is 1-tetrazolyl or 1,2,4-triazol-1-yl, and each of the others is selected from hydrogen, a C1-8 alkyl group, or a halogen atom.
(25) A compound of the above-mentioned formula (II) or described in one of (19) to (24), or a pharmaceutically acceptable salt thereof, wherein A0 is O, and B0 is CH2.
(26) A compound of the above-mentioned formula (II) or described in one of (19) to (25), or a pharmaceutically acceptable salt thereof, wherein U0 is CH, and V0 is N.
(27) A compound of the above-mentioned formula (II) or described in one of (19) to (25), or a pharmaceutically acceptable salt thereof, wherein U0 is N, and V0 is CH.
(28) A compound of the above-mentioned formula (II) or described in one of (19) to (27), or a pharmaceutically acceptable salt thereof, wherein each of X0 and Y0 is ethylene.
(29) A compound of the above-mentioned formula (II) or described in one of (19) to (27), or a pharmaceutically acceptable salt thereof, wherein W0 is C, and X0 combines to W0 with a double bond.
(30) A compound of the above-mentioned formula (II) or described in one of (19) to (29), or a pharmaceutically acceptable salt thereof, wherein Z0 is C(O)OR29.
(31) A compound of the above-mentioned formula (II) or described in (30), or a pharmaceutically acceptable salt thereof, wherein R29 is a C1-8 alkyl group.
(32) A compound of the above-mentioned formula (II) or described in one of (19) to (29), or a pharmaceutically acceptable salt thereof, wherein Z0 is 3-C1-8 alkyl-1,2,4-oxadiazol-5-yl or 5-C1-8 alkyl-1,2,4-oxadiazol-3-yl.
(33) A compound of the above-mentioned formula (II) or described in one of (19) to (29), or a pharmaceutically acceptable salt thereof, wherein Z0 is 5-C1-8 alkylpyrimidin-2-yl.
(34) A compound of the above-mentioned formula (II) or described in one of (19) to (33), or a pharmaceutically acceptable salt thereof, wherein each of R20 and R27 is hydrogen.
In the compound of the above-mentioned formula (I) or (II), examples of the halogen atoms include a fluorine atom, a chlorine atom, and a bromine atom.
Examples of the C1-8 alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, t-butyl, pentyl, neopentyl, and hexyl.
Examples of the three-membered to six-membered cycloalkyl groups include cyclopropyl, cyclopentyl, and cyclohexyl.
Examples of the C1-8 alkoxy groups include methoxy, ethoxy, and propoxy.
Examples of the C1-8 alkyl groups having one to three halogen atoms include chloromethyl, fluoromethyl, 2-fluoroethyl, and trifluoromethyl. Examples of the C1-8 alkoxy groups having one to three halogen atoms include fluoromethoxy and trifluoromethoxy.
Examples of the alkoxycarbonyl groups containing a C1-8 alkoxy group include methoxycarbonyl and ethoxycarbonyl. Examples of the acyl groups containing a C1-8 alkyl group include acetyl. Examples of the alkylaminocarbonyl groups containing a C1-8 alkyl group include methylaminocarbonyl and ethylaminocarbonyl. Examples of the dialkylaminocarbonyl groups containing C2-12 alkyl groups include dimethylaminocarbonyl and diethylaminocarbonyl. Examples of the alkoxycarbonylmethylcarbonyl groups containing a C1-8 alkoxy group include methoxycarbonylmethyl-carbonyl and ethoxycarbonylmethyl-carbonyl.
Examples of the alkylsulfonylmethyl groups containing a C1-8 alkyl group include methanesulfonylmethyl and ethanesulfonylmethyl. Examples of the C1-8 alkylamino groups include methylamino and ethylamino. Examples of the C2-12 dialkylamino groups include dimethylamino and diethylamino. Examples of the C1-8 alkylsulfonylamino groups include methanesulfonylamino and ethanesulfonylamino. Examples of the acylamino groups containing a C1-8 alkyl group include acetylamino.
Examples of the C1-8 alkylsulfinyl groups include methylsulfinyl and ethylsulfinyl. Examples of the C1-8 alkylsulfonyl groups include methanesulfonyl and ethanesulfonyl. Examples of the C1-8 alkylaminosulfonyl groups include methylaminosulfonyl and ethylaminosulfonyl. Examples of the C2-12 dialkylaminosulfonyl groups include dimethylaminosulfonyl and diethylaminosulfonyl.
Examples of the C1-8 alkyl groups having phenyl include benzyl.
Examples of the C2-8 alkenyl groups include vinyl and propenyl.
In the formula (I), the bicyclic heterocyclic ring comprising T1 to T4 can be pyrrolopyridines such as pyrrolo[2,3-b]pyridine, pyrrolo[3,2-b]pyridine, and pyrrolo[2,3-c]pyridine, in the case that one of T1, T2, T3, and T4 is N, and each of the other three independently is CR4.
Examples of the five-membered or six-membered heteroaryl groups of R21, R22, or R23 in the formula (II) include 1,2,4-triazolyl and tetrazolyl.
Examples of the five-membered or six-membered heteroaryl groups (comprising carbon and nitrogen atoms and optionally comprising oxygen or sulfur atom, one of said carbon atoms combining to the nitrogen atom of the neighboring cyclic amine) of Z in the formula (I) and Z0 in the formula (II) include pyrimidinyl and oxadiazolyl.
Examples of the pharmaceutically acceptable salts of the compound of the formula (I) or (II) include a salt with an inorganic acid such as a hydrochloride or a sulfate and a salt with an organic acid such as a fumarate or a methanesulfonate.
In the present invention, the compound of the formula (I) or (II) includes a racemic mixture and optically active isomers.
In the present invention, the compound of the formula (I) or (II) includes a hydrate and a solvate.
Processes for preparation of the compound of the formula (I) are described below.
A process for preparation of a compound in which A is CH2, B is a bond, W is CH or C, X is CH2CH2 or CHCH2, Y is CH2CH2 is below exemplified. The other analogous compounds can also be prepared according to similar processes.
In the formulas, Halo is halogen such as chlorine, bromine, and iodine, L is halogen such as chlorine, bromine, and iodine, or a leaving group such as methanesulfonyloxy and p-toluenesulfonyloxy, and each of R1, R2, R3, T1, T2, T3, T4, U, V, and Z is described above.
The starting material (a) can be synthesized according to a known method (cf., Dong Han. Kim et. al., J. Org. Chem., 1970, 35, 455; and WO 2008/130320) or an analogous method thereof. The starting material (b) can be synthesized according to a known method (cf., G. Shya-mali et. al., Can. J. Chem., 2006, 84, 555; and WO 2007/081995) or an analogous method thereof.
The reaction of the starting material (a) with the starting material (b) can be conducted in an inert solvent such as toluene, tetrahydrofuran, dioxane, and N,N-dimethylformamide, in the presence of a base such as potassium carbonate, cesium carbonate, and sodium carbonate, using a catalyst such as tetrakis(triphenylphosphine)palladium and [1,1′-bis(diphenylphosphino)ferrocene]palladium(II) dichloride dichloromethane complex to give the compound of the formula (c). The reaction temperature ranges from 20° C. to 110° C.
The compound of the formula (c) can be converted into the compound of the formula (d) in an inert solvent such as methanol and ethanol, in the presence of a catalyst such as palladium-carbon according to a catalytic hydrogenation method.
The compound of the formula (d) can be converted into the compound of the formula (e) by a reaction of the compound (d) with a reagent such as methanesulfonyl chloride, p-toluenesulfonyl chloride, and thionyl chloride, in an inert solvent such as toluene and dichloromethane, optionally in the presence of a base such as pyridine and triethylamine.
The compound of the formula (e) can be converted into the compound of the formula (g) by a reaction of the compound (e) with the compound of the formula (f) in an inert solvent such as toluene, N,N-dimethylformamide, and acetone, in the presence of a base such as potassium hydroxide, sodium hydroxide, and potassium carbonate, optionally in the presence of an additive such as a crown ether. The reaction temperature ranges from the room temperature to 130° C.
The compound of the formula (g) can also be synthesized according to the following method B.
In the formulas, Halo is halogen such as chlorine, bromine, and iodine, L is halogen such as chlorine, bromine, and iodine, or a leaving group such as methanesulfonyloxy and p-toluenesulfonyloxy, and each of R1, R2, R3, T1, T2, T3, T4, U, V, and Z is described above.
The starting material (a) can be converted into the compound of the formula (h) in the same manner as in the process of the above-mentioned method A.
The compound of the formula (h) can be converted into the compound of the formula (i) in the same manner as in the process of the above-mentioned method A.
The compound of the formula (i) can be converted into the compound of the formula (j) in the same manner as in the process of the above-mentioned method A.
The compound of the formula (j) can be converted into the compound of the formula (g) in the same manner as in the process of the above-mentioned method A.
Processes for preparation of the compound of the formula (II) are described below.
A process for preparation of a compound in which A0 is O, B0 is CH2, W0 is CH or C, X0 is CH2CH2 or CHCH2, Y0 is CH2CH2 is below exemplified. The other analogous compounds can also be prepared according to similar processes.
In the formulas, each of R20, R21, R22, R23, Q, U0, V0, and Z0 is described above.
The starting material (k) can be prepared in the same manner as in the process of the above-mentioned method A.
The compound of the formula (k) can be converted into the compound of the formula (m) by a reaction of the compound (k) with a phenol or heteroaryl alcohol of the formula (1) in an inert solvent such as tetrahydrofuran, dioxane, and toluene, in the presence of an azodicarboxylic ester such as diethyl azodicarboxylate, diisopropyl azodicarboxylate, and in the presence of a reagent such as triphenylphosphine. The reaction temperature ranges from 0° C. to 80° C.
The compound of the formula (k) can also be converted into the compound of the formula (m) according to the following method D.
In the formulas, L is a halogen atom such as chlorine atom, bromine atom, iodine atom, or a leaving group such as methanesulfonyloxy and p-toluenesulfonyloxy, and each of R20, R21, R22, R23, Q, U0, V0, and Z0 is described above.
The compound of the formula (k) can be converted into the compound of the formula (n) in the same manner as in the process of the above-mentioned method A.
The compound of the formula (n) can be converted into the compound of the formula (m) by a reaction of the compound (n) with a phenol or heteroaryl alcohol of the formula (1) in an inert solvent such as N,N-dimethylformamide and acetone, in the presence of a base such as sodium hydride and potassium carbonate. The reaction temperature ranges from 0° C. to 80° C.
The compound of the formula (m) can also be prepared according to the following method E.
In the formulas, Halo is halogen such as chlorine, bromine, and iodine, L is halogen such as chlorine, bromine, and iodine, or a leaving group such as methanesulfonyloxy and p-toluenesulfonyloxy, and each of R20, R21, R22, R23, Q, U0, V0, and Z0 is described above.
The starting material (o) can be synthesized in the same manner as in the process of the above-mentioned method A.
The starting material (o) can be converted into the compound of the formula (p) in the same manner as in the process of the above-mentioned method D.
The compound of the formula (p) can be converted into the compound of the formula (q) in the same manner as in the process of the above-mentioned method A.
The compound of the formula (q) can be converted into the compound of the formula (m) in the same manner as in the process of the above-mentioned method A.
The compound represented by the formula (I) or (II) can also be prepared, for example by referring to the above-described methods, the below-described examples, and the Patent Documents 1 to 5.
Examples of the representative compounds of the present invention are shown below.
In the formula, R42, R43, R44, R45, R46, R47, U, V, Q, and R41 are set forth in Tables 1 to 3.
In the formula, R42, R43, R44, R45, R46, R47, U, V, Q, and R41 are set forth in Tables 4 and 5.
In the formula, R52, R53, R54, R55, R56, A0, B0, U0, V0, Q0, and R51 are set forth in Tables 6 and 7.
In the formula, R52, R53, R54, R55, R56, A0, B0, U0, V0, Q0, and R51 are set forth in Tables 8 and 9.
In the formula, Ar, A, B, U, V, X40, Q0, and R41 are set forth in Tables 10 and 11.
The pharmacological tests are described below.
The GPR119 agonist effect is studied by measuring the effect of an analyte on increase of intracellular amount of cAMP in human GPR119 introduced cells. The testing method is described below.
Human GPR119 gene (NM 178471) is purchased from ATCC (ATCC No. 10807349), and is amplyfied according to PCR to form BamHI site at 5′ side and Apa I site at 3′ side. The forward side primer is tcctggatccatggaatcatctttctcatt (sequence No. 1), and the reverse side primer is tcctgggcccttagccatcaaactctgagc (sequence No. 2). The PCR conditions are described below.
The double-stranded DNA is thermally denatured using a DNA polymerase (KOD-Plus-Ver. 2; TOYOBO #KOD-211) at 98° C. for 10 seconds in one cycle. The denatured single-stranded DNA is annealed with the primers at 55° C. for 30 seconds. The DNA is subjected to an extension reaction at 68° C. for 1 minute and 15 seconds. The above-mentioned steps are repeated in 35 cycles. The PCR product is inserted into pcDNA5/FRT/TO (Invitrogen #V6520-20) plasmid. Flp-in T-Rex-293 cells (Invitorogen #R78007) are transfected with the obtained plasmid. The method of transfection is conducted in accordance with the protocol of the product.
(2) Measurement of Intracellular cAMP
The stable cell line expressing human GPR119 prepared in the above-mentioned method is plated on a 96-well plate at the concentration of 2,500 cells/well using Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS). Twenty-four hours after plating, tetracyclin (Invitrogen #Q10019) is added at the final concentration of 20 ng/mL to induce hGPR119 gene expression. Twenty-four hours after, the medium is removed, and the cells are stimulated with an assay buffer (0.5 mM IBMX PBS(−)) containing the test compound at 37° C. for 30 minutes. The amount of the intracellular cAMP is measured using a commercially available kit (HitHunter™ cAMP XS+ Assay: GE Healthcare #90007503) and a reader (FLUOstar Optima: BMG LABTECH). The test compound is dissolved in 100% DMSO, and added at the final concentration of 1%.
As is evident from Table 12 of Example 61 described below, the compounds of the present invention described in Examples 9, 20, 21, or the like show an excellent GPR119 agonist effect.
As is also evident from Table 13 of Example 62 (Pharmacological test 2) described below, the compounds of the present invention described in Examples 28, 34, 42, 51, or the like show an excellent GPR119 agonist effect.
Oral glucose tolerance is tested in normal mice.
In this experiment, the inhibitory effect of a test compound on glycemic excursions is examined after glucose administration in normal mice. The test methods are described below.
Male 9-week-old ICR mice, habituated to the experimental environment for two weeks, are fasted for 18 hours and used to this experiment. Mice are orally administered the analyte or vehicle (polyethylene glycol 400:ethanol:Tween 80=8:1:1). After 30 minutes, they were orally given glucose at the dose of 3 g/kg.
Blood is collected at just before the analyte or vehicle administration (−30 minutes), immediately before glucose challenge (0 minute), 20 minutes, 40 minutes, 60 minutes, and 120 minutes after glucose ingestion to determine blood glucose levels.
Inhibition rate (%) of the test compound versus vehicle in areas under the glycemic excursion curve between 0 minute and 120 minutes after glucose challenge is determined.
(2) Experimental Results
As is evident from Table 14 of Example 63 described below, the compounds of the present invention described in Example 9 show an excellent inhibitory effect on glycemic excursions.
As is described above, the compound represented by the formula (I) or (II), or a pharmaceutically acceptable salt thereof has a GPR119 agonist effect and an inhibitory effect on glycemic excursions. Therefore, they are expected to be used for treatment of diabetes. They are also expected to be used for a life-style related diseases such as obesity and metabolic syndrome.
The compound represented by the formula (I) or (II), or a pharmaceutically acceptable salt thereof can be used in combination with a conventional agent for treatment of diabetes.
The compound represented by the formula (I) or (II), or a pharmaceutically acceptable salt thereof can be administered to human beings by suitable administration methods such as oral administration or parenteral administration. It can also be used in combination with another agent for treatment of diabetes.
The compound or salt can be granulated in suitable manners for the preparation of pharmaceuticals. For instance, the compound or salt can be processed to give tablets, granule, powder, capsule, suspension, injection, suppository, and the like.
For the preparation of these pharmaceuticals, when they are tablets, appropriate additives such as excipients, disintegrators, binders, lubricants and dyes can be used. Lactose, D-mannitol, crystalline cellulose and glucose can be used as the excipients. Starch and carboxymethylcellulose calcium (CMC-Ca) can be used as the disintegrators, magnesium stearate, and talc as the lubricants. Hydroxypropylcellulose (HPC), gelatin and polyvinylpyrrolidone (PVP) can be used as the binders. For the preparation of injection, a solvent, a stabilizer, a solubilizer, a suspending agent, an emulsifier, an analgesic, a buffer, and a preservative can be used.
The compound represented by the formula (I) or (II), or a pharmaceutically acceptable salt thereof can be administered to an adult generally in an amount of 0.01 mg to 100 mg a day by injection and 1 mg to 2,000 mg a day by oral administration. The dosage can be adjusted according to age and conditions of the patient.
The invention is further described by the following non-limiting examples.
To a solution of 5-bromo-2-hydroxymethylpyrimidine (50 mg, 0.265 mmol) and 2-trimethylsilylethyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (103 mg, 0.291 mmol) in dry N,N-dimethylformamide (2 mL) was added [1,1′-bis(diphenylphosphino)ferrocene]dichloropalladium(II) dichloromethane adduct (13 mg, 15.9 μmol) and cesium carbonate (129 mg, 0.397 mmol). After stirring at 80° C. overnight, cooled to room temperature, the reaction mixture was added water, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=1/2), to give the title compound (40 mg, yield 45%).
1H NMR (CDCl3, 400 MHz): δ=0.06 (9H, s), 1.0-1.1 (2H, m), 2.54 (2H, br s), 3.60 (1H, br s), 3.73 (2H, t, J=5 Hz), 4.1-4.3 (4H, m), 4.84 (2H, s), 6.18 (1H, br s), 8.72 (2H, s).
To a solution of 2-trimethylsilylethyl 4-(2-hydroxymethylpyrimidin-5-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (40 mg, 0.119 mmol) in methanol (1 mL) was added 10% palladium-carbon (4 mg) and then the mixture was hydrogenated at room temperature for 3 hours under 1 atm of H2. The reaction mixture was filtered through a celite pad, and the residue was purified by silica gel column chromatography (hexane/ethyl acetate=1/2), to give the title compound (25 mg, yield 62%).
1H NMR (CDCl3, 400 MHz): 5=0.06 (9H, s), 0.9-1.1 (2H, m), 1.5-1.7 (2H, m), 1.8-2.0 (2H, m), 2.6-3.0 (3H, m), 3.61 (1H, t, J=5 Hz), 4.1-4.5 (4H, m), 4.83 (2H, d, J=5 Hz), 8.59 (2H, s).
2-Trimethylsilylethyl 4-(2-hydroxymethylpyrimidin-5-yl)piperidine-1-carboxylate (25 mg, 74.1 μmol), 4-methanesulfonylphenol (19 mg, 0.111 mmol) and triphenylphosphine (29 mg, 0.111 mmol) was dissolved in dry tetrahydrofuran (1 mL). The mixture was cooled to 0° C., and then added 2.2 mol/L toluene solution of diethyl azodicarboxylate (51 μL, 0.111 mmol). After stirring at room temperature overnight, the reaction mixture was poured into water, extracted with ethyl acetate, the organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (chloroform/methanol=98/2 and hexane/ethyl acetate=2/3), to give the title compound (17 mg, yield 46%).
1H NMR (CDCl3, 400 MHz): δ=0.05 (9H, s), 0.9-1.1 (2H, m), 1.6-1.8 (2H, m), 1.8-2.0 (2H, m), 2.6-3.0 (3H, m), 3.02 (3H, s), 4.1-4.5 (4H, m), 5.36 (2H, s), 7.14 (2H, d, J=9 Hz), 7.86 (2H, d, J=9 Hz), 8.63 (2H, s).
To a solution of 2-trimethylsilylethyl 4-[2-(4-methanesulfonylphenoxymethyl)pyrimidin-5-yl]piperidine-1-carboxylate (16 mg, 32.5 μmol) in dry tetrahydrofuran (0.5 mL) was added 1.0 M tetrabutylammonium fluoride-tetrahydrofuran solution (49 μL, 48.8 μmol), and the mixture was stirred at room temperature overnight. The reaction mixture was added chloroform, the organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure.
To a solution of the resulting mixture in tetrahydrofuran (0.5 mL)-water (0.1 mL) was added di-tert-butyl dicarbonate (11 mg, 48.8 μmol) in dry tetrahydrofuran (0.3 mL), and stirred at room temperature for 1.5 hours. The reaction mixture was poured into saturated aqueous sodium hydrogen carbonate solution, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=2/3→1/2), to give the title compound as a white crystal (11 mg, yield 77%).
1H NMR (CDCl3, 400 MHz): b=1.48 (9H, s), 1.6-1.8 (2H, m), 1.8-2.0 (2H, m), 2.6-2.9 (3H, m), 3.02 (3H, s), 4.2-4.4 (2H, m), 5.36 (2H, s), 7.14 (2H, d, J=9 Hz), 7.86 (2H, d, J=9 Hz), 8.63 (2H, s).
4-methanesulfonylphenol (211 mg, 1.23 mmol) was dissolved in N,N-dimethylformamide (2 mL). Under cooling in ice-bath, to the mixture was added 60% sodium hydride (49 mg, 1.23 mmol), and stirred for 30 minutes. To the mixture was added 2-chloro-5-chloromethylpyrazine (200 mg, 1.23 mmol), and the mixture was stirred at room temperature for 3 hours. The reaction mixture was poured into water, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=1/1), to give the title compound (273 mg, yield 74%).
1H NMR (CDCl3, 400 MHz): δ=3.04 (3H, s), 5.30 (2H, s), 7.14 (2H, d, J=9 Hz), 7.91 (2H, d, J=9 Hz), 8.59 (1H, s), 8.60 (1H, d, J=1 Hz).
The title compound was prepared from 2-chloro-5-(4-methanesulfonylphenoxymethyl)pyrazine (100 mg, 0.335 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (103 mg, 0.335 mmol) by the similar manner as described in Example 1(1) as a white crystal (48 mg, yield 32%).
1H NMR (CDCl3, 400 MHz): δ=1.50 (9H, s), 2.6-2.7 (2H, m), 3.03 (3H, s), 3.6-3.7 (2H, m), 4.1-4.2 (2H, m), 5.30 (2H, s), 6.72 (1H, br s), 7.14 (2H, d, J=9 Hz), 7.89 (2H, d, J=9 Hz), 8.69 (2H, s).
The title compound was prepared from tert-butyl 4-[5-(4-methanesulfonylphenoxymethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 2) (44 mg, 98.8 μmol) by the similar manner as described in Example 1(2) as a white crystal (36 mg, yield 82%).
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 1.7-2.0 (4H, m), 2.7-3.0 (3H, m), 3.04 (3H, s), 4.1-4.4 (2H, m), 5.28 (2H, s), 7.14 (2H, d, J=9 Hz), 7.90 (2H, d, J=9 Hz), 8.48 (1H, d, J=1 Hz), 8.70 (1H, s).
To a solution of 2-trimethylsilylethyl 4-[2-(hydroxymethyl)pyrimidin-5-yl]piperidine-1-carboxylate (Example 1(2)) (26 mg, 74.1 μmol) in dichloromethane (0.7 mL) was added triethylamine (15.5 μL, 0.111 mmol) under ice-cooling. To this was added dropwise a solution of methanesulfonyl chloride (7 μL, 88.9 μmol) in dichloromethane (0.5 mL). After stirring at room temperature for 1 hour, the solvent was removed under reduced pressure, to give the crude title compound as a red oil (31 mg).
Above crude 2-trimethylsilylethyl 4-[2-(methanesulfonyloxymethyl)pyrimidin-5-yl]piperidine-1-carboxylate (31 mg), 5-methanesulfonylindol (12 mg, 62.2 μmol), potassium hydroxide (3.5 mg, 62.2 μmol), potassium iodide (15.5 mg, 93.2 μmol) and 18-crown-6-ether (16 mg, 62.2 μmol) was dissolved in toluene (0.6 mL). The mixture was stirred at 80° C. for 15 hours, then, cooled to room temperature. The reaction mixture was added water, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=7/1→0/100), to give the title compound as a pale yellow oil (31 mg, yield 81% (2 steps)).
1H NMR (CDCl3, 400 MHz): δ=0.04 (9H, s), 0.9-1.1 (2H, m), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.8 (1H, m), 2.8-2.9 (2H, m), 3.05 (3H, s), 4.1-4.3 (2H, m), 4.2-4.4 (2H, m), 5.54 (2H, s), 6.72 (1H, dd, J=1 Hz, 2 Hz), 7.45 (1H, d, J=2 Hz), 7.53 (1H, d, J=9 Hz), 7.70 (1H, dd, J=2 Hz, 9 Hz), 8.27 (1H, d, J=1 Hz), 8.53 (2H, s).
The title compound was prepared from 2-trimethylsilylethyl 4-[2-(5-methanesulfonylindol-1-ylmethyl)pyrimidin-5-yl]piperidine-1-carboxylate (31 mg, 60.0 μmol) by the similar manner as described in Example 1(4) as a pale yellow amorphous (23 mg, yield 81%).
FAB-MS(m/z): 471 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.47 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.7 (1H, m), 2.7-2.9 (2H, m), 3.05 (3H, s), 4.2-4.3 (2H, m), 5.54 (2H, s), 6.72 (1H, d, J=2 Hz), 7.45 (1H, d, J=2 Hz), 7.54 (1H, d, J=8 Hz), 7.71 (1H, dd, J=2 Hz, 8 Hz), 8.27 (1H, d, J=2 Hz), 8.53 (2H, s).
The title compound was prepared from 2-trimethylsilylethyl 4-(2-hydroxymethylpyrimidin-5-yl)piperidine-1-carboxylate (25 mg, 0.130 mmol) (Example 1(2)) and 2-fluoro-4-nitrophenol (20 mg, 0.130 mmol) by the similar manner as described in Example 1(3) as a colorless oil (33 mg, yield 93%).
1H NMR (CDCl3, 400 MHz): δ=0.05 (9H, s), 1.02 (2H, t, J=8 Hz), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.7-2.8 (1H, m), 2.8-3.0 (2H, m), 4.21 (2H, t, J=8 Hz), 4.3-4.4 (2H, m), 5.45 (2H, s), 7.10 (1H, t, J=8 Hz), 7.9-8.1 (2H, m), 8.63 (2H, s).
The title compound was prepared from 2-trimethylsilylethyl 4-[2-(2-fluoro-4-nitrophenoxymethyl)pyrimidin-5-yl]piperidine-1-carboxylate (33 mg, 69.2 μmol) by the similar manner as described in Example 1(4) as a pale yellow oil (28 mg, yield 94%).
1H NMR (CDCl3, 400 MHz): δ=1.50 (9H, s), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.7-2.8 (1H, m), 2.8-3.0 (2H, m), 4.3-4.4 (2H, m), 5.45 (2H, s), 7.10 (1H, t, J=8 Hz), 7.9-8.1 (2H, m), 8.63 (2H, s).
A suspension of zinc powder (154 mg, 2.36 mmol) in 0.5 mol/L hydrogen chloride (2 mL) was stirred at room temperature for 5 minutes, and then filtered. After washing by water and ethanol, the zinc solid was added to a solution of calcium chloride (7 mg, 64.8 μmol) in water (2 mL)-ethanol (2 mL), and then warmed to 90° C. To this was added a solution of tert-butyl 4-[2-(2-fluoro-4-nitrophenoxymethyl)pyrimidin-5-yl]piperidine-1-carboxylate (Example 5) (28 mg, 64.8 μmol) in ethanol (1 mL). After stirring at 90° C. for 1 hour, the mixture was cooled to room temperature and the insoluble material was filtered off. The filtrate was concentrated to dryness, and the residue was diluted with ethyl acetate, the organic layer was dried over anhydrous sodium sulfate. The solvent was removed under reduced pressure, to give the title compound as a brown oil (22 mg, yield 84%).
1H NMR (CDCl3, 400 MHz): b=1.49 (9H, s), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H, m), 4.2-4.4 (2H, m), 5.23 (2H, s), 6.3-6.4 (1H, m), 6.46 (1H, dd, J=2 Hz, 12 Hz), 6.89 (1H, t, J=9 Hz), 8.63 (2H, s).
To a solution of tert-butyl 4-[2-(4-amino-2-fluorophenoxymethyl)pyrimidin-5-yl]piperidine-1-carboxylate (Example 6) (22 mg, 54.7 μmol) in acetic acid (1 mL) was added triethyl orthoformate (50 μL, 0.301 mmol) and sodium azide (16 mg, 0.246 mmol), and the mixture was warmed up to 90° C. After stirring at the same temperature for an additional 3 hours, then cooled, the reaction mixture was added water and saturated aqueous sodium hydrogen carbonate solution, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=7/1→0/100), and recrystallized from ethyl acetate and hexane to give the title compound as a pale yellow crystal (7 mg, yield 28%).
FAB-MS(m/z): 456 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H, m), 4.2-4.4 (2H, m), 5.42 (2H, s), 7.22 (1H, t, J=9 Hz), 7.38 (1H, td, J=2 Hz, 9 Hz), 7.51 (1H, dd, J=2 Hz, 11 Hz), 8.64 (2H, s), 8.89 (1H, s).
The title compound was prepared from 2-chloro-5-chloromethylpyrazine (105 mg, 0.64 mmol) and 5-methanesulufonylindole (126 mg, 0.64 mmol) by the similar manner as described in Example 4(2) as a pale yellow amorphous (86 mg, yield 42%).
1H NMR (CDCl3, 400 MHz): δ=3.06 (3H, s), 5.50 (2H, s), 6.75 (1H, d, J=3 Hz), 7.37 (1H, d, J=3 Hz), 7.44 (1H, d, J=9 Hz), 7.74 (1H, dd, J=2 Hz, 9 Hz), 8.0-8.1 (1H, m), 8.29 (1H, d, J=2 Hz), 8.5-8.6 (1H, m).
The title compound was prepared from 2-chloro-5-(5-methanesulfonylindol-1-ylmethyl)pyrazine (86 mg, 0.27 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (83 mg, 0.27 mmol) by the similar manner as described in Example 1(1) as a pale yellow amorphous (40 mg, yield 32%).
FAB-MS(m/z): 469 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.5-2.7 (2H, m), 3.06 (3H, s), 3.6-3.7 (2H, m), 4.0-4.2 (2H, m), 5.50 (2H, s), 6.66 (1H, s), 6.74 (1H, d, J=3 Hz), 7.39 (1H, d, J=3 Hz), 7.47 (1H, d, J=9 Hz), 7.73 (1H, dd, J=2 Hz, 9 Hz), 8.1-8.2 (1H, m), 8.28 (1H, d, J=2 Hz), 8.6-8.7 (1H, m).
The title compound was prepared from tert-butyl 4-[5-(5-methanesulfonylindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 8) (28 mg, 60 μmol) by the similar manner as described in Example 1(2) as a white amorphous (8 mg, yield 28%).
FAB-MS(m/z): 471 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.46 (9H, s), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.7-2.9 (3H, m), 3.06 (3H, s), 4.1-4.4 (2H, m), 5.49 (2H, s), 6.74 (1H, d, J=3 Hz), 7.39 (1H, d, J=3 Hz), 7.49 (1H, d, J=9 Hz), 7.74 (1H, dd, J=2 Hz, 9 Hz), 8.1-8.2 (1H, m), 8.29 (1H, d, J=2 Hz), 8.4-8.5 (1H, m).
The title compound was prepared from 2-chloro-5-(4-methanesulfonylphenoxymethyl)pyrazine (100 mg, 0.335 mmol) and tert-butyl 3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-8-azabicyclo[3.2.1]oct-2-ene-8-carboxylate (112 mg, 0.335 mmol) by the similar manner as described in Example 1(1) as a white crystal (36 mg, yield 22%).
1H NMR (CDCl3, 400 MHz): δ=1.45 (9H, s), 1.6-1.8 (1H, m), 1.9-2.1 (2H, m), 2.2-2.4 (1H, m), 2.3-2.5 (1H, m), 2.8-3.3 (1H, m), 3.03 (3H, s), 4.4-4.7 (2H, m), 5.29 (2H, s), 7.07 (1H, br d), 7.12 (2H, d, J=9 Hz), 7.88 (2H, d, J=9 Hz), 8.66 (2H, s).
The title compound was prepared from tert-Butyl 3-[5-(4-methanesulfonylphenoxymethyl)pyrazin-2-yl]-8-azabicyclo[3.2.1]oct-2-ene-8-carboxylate (Example 10) (25 mg, 53.0 μmol) by the similar manner as described in Example 1(2) as a white crystal (15 mg, yield 59%, diastereomer ratio=3:7).
1H NMR (CDCl3, 400 MHz): δ=1.49 (6.3H, s), 1.51 (2.7H, s), 1.4-2.1 (7.3H, m), 2.3-2.6 (0.7H, m), 3.04 (3H, s), 3.0-3.2 (0.3H, m), 3.2-3.4 (0.7H, m), 4.2-4.5 (2H, m), 5.27 (1.4H, s), 5.28 (0.6H, s), 7.1-7.2 (2H, m), 7.8-8.0 (2H, m), 8.46 (0.7H, d, J=1 Hz), 8.57 (0.3H, d, J=1 Hz), 8.6-8.7 (1H, m).
To a solution of 2-fluoro-4-(tetrazol-1-yl)phenol (100 mg, 0.555 mmol) in ethanol (6 mL) was added 0.5M potassium hydroxide ethanol solution (1.2 mL, 0.600 mmol), and stirred at room temperature for 40 minutes. The reaction mixture was concentrated under reduced pressure to give the crude potassium 2-fluoro-4-(tetrazol-1-yl)phenolate. To a solution of crude potassium salt in dimethylsulfoxide (6 mL) was added 2-Chloro-5-chloromethylpyrazine (101 mg, 0.617 mmol), and stirred at room temperature for 1 hour. The reaction mixture was poured into water, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (chloroform/methanol=100/1), to give the title compound as a pale brown crystal (134 mg, yield 79%).
1H NMR (CDCl3, 400 MHz): δ=5.37 (2H, s), 7.2-7.3 (1H, m), 7.4-7.5 (1H, m), 7.56 (1H, dd, J=2 Hz, 11 Hz), 8.61 (1H, br s), 8.66 (1H, br s), 8.92 (1H, s).
The title compound was prepared from 2-Chloro-5-[2-fluoro-4-(tetrazol-1-yl)phenoxymethyl]pyrazine (50 mg, 0.163 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (50 mg, 0.163 mmol) by the similar manner as described in Example 1(1) as a pale yellow amorphous (19 mg, yield 25%).
FAB-MS(m/z): 454 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.6-2.8 (2H, m), 3.6-3.8 (2H, m), 4.1-4.3 (2H, m), 5.37 (2H, s), 6.73 (1H, br s), 7.26 (1H, t, J=9 Hz), 7.3-7.5 (1H, m), 7.54 (1H, dd, J=2 Hz, 11 Hz), 8.70 (1H, d, J=1 Hz), 8.76 (1H, br s), 8.92 (1H, s).
The title compound was prepared from 4-(1,2,4-triazol-1-yl)phenol (100 mg, 0.621 mmol) by the similar manner as described in Example 2(1) as a pale brown amorphous (144 mg, yield 81%).
1H NMR (DMSO-d6, 400 MHz): δ=5.30 (2H, s), 7.24 (2H, d, J=9 Hz), 7.78 (2H, d, J=9 Hz), 8.17 (1H, s), 8.70 (1H, s), 8.83 (1H, s), 9.17 (1H, s).
The title compound was prepared from 2-chloro-5-[4-(1,2,4-triazol-1-yl)phenoxymethyl]pyrazine (70 mg, 0.243 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (75 mg, 0.243 mmol) by the similar manner as described in Example 1(1) as a white crystal (54 mg, yield 51%).
FAB-MS(m/z): 435 (M+1)
m.p.152-154° C.
1H NMR (CDCl3, 400 MHz): δ=1.50 (9H, s), 2.6-2.8 (2H, m), 3.6-3.8 (2H, m), 4.1-4.3 (2H, m), 5.28 (2H, s), 6.71 (1H, br s), 7.12 (2H, d, J=9 Hz), 7.60 (2H, d, J=9 Hz), 8.08 (1H, s), 8.45 (1H, s), 8.69 (1H, s), 8.72 (1H, s).
IR(KBr, cm−1): 3122, 2976, 2929, 1685, 1651, 1525, 1483, 1448, 1410, 1394, 1363, 1300, 1277, 1255, 1236, 1273, 1155, 1117, 1066, 1030, 982, 958, 903, 858, 829, 674, 521.
The title compound was prepared from 2-chloro-5-chloromethylpyrazine (135 mg, 0.69 mmol) by the similar manner as described in Example 4(2) (142 mg, yield 64%).
1H NMR (CDCl3, 400 MHz): δ=3.12 (3H, s), 5.67 (2H, s), 6.70 (1H, d, J=3 Hz), 7.53 (1H, d, J=3 Hz), 8.35 (1H, s), 8.49 (1H, d, J=2 Hz), 8.53 (1H, d, J=1 Hz), 8.86 (1H, d, J=2 Hz).
The title compound was prepared from 2-chloro-5-(5-methanesulfonyl-1H-pyrrolo[2,3-b]pyridin-1-ylmethyl)pyrazine (30 mg, 0.093 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (29 mg, 0.093 mmol) by the similar manner as described in Example 1(1) as a pale yellow amorphous (38 mg, yield 87%).
FAB-MS(m/z): 470 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.5-2.7 (2H, m), 3.12 (3H, s), 3.6-3.7 (2H, m), 4.0-4.2 (2H, m), 5.67 (2H, s), 6.65 (1H, br s), 6.68 (1H, d, J=3 Hz), 7.54 (1H, d, J=3 Hz), 8.46 (1H, s), 8.49 (1H, d, J=2 Hz), 8.62 (1H, s), 8.86 (1H, d, J=2 Hz).
The title compound was prepared from 2-chloro-5-(5-methanesulfonyl-1H-pyrrolo[2,3-b]pyridin-1-ylmethyl)pyrazine (Example 14(1)) (30 mg, 0.093 mmol) and tert-butyl 3-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (30 mg, 0.093 mmol) by the similar manner as described in Example 1(1) as a pale yellow amorphous (14 mg, yield 31%).
FAB-MS(m/z): 484 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.06 (3H, d, J=7 Hz), 1.48 (9H, s), 3.0-3.2 (2H, m), 3.12 (3H, s), 3.7-4.1 (2H, m), 4.3-4.7 (1H, m), 5.68 (2H, s), 6.48 (1H, br s), 6.69 (1H, d, J=3 Hz), 7.55 (1H, d, J=3 Hz), 8.46 (1H, s), 8.49 (1H, d, J=2 Hz), 8.63 (1H, s), 8.87 (1H, d, J=2 Hz).
The title compound was prepared from 2-chloro-5-chloromethylpyrazine (106 mg, 0.65 mmol) and 4,6-difluoro-5-methanesulfonylindole (150 mg, 0.65 mmol) by the similar manner as described in Example 4(2) (28 mg, yield 12%).
1H NMR (CDCl3, 400 MHz): δ=3.29 (3H, s), 5.41 (2H, s), 6.77 (1H, d, J=3 Hz), 7.00 (1H, d, J=11 Hz), 7.26 (1H, d, J=3 Hz), 8.14 (1H, s), 8.55 (1H, d, J=1 Hz).
The title compound was prepared from 2-chloro-5-(4,6-difluoro-5-methanesulfonylindol-1-ylmethyl)pyrazine (28 mg, 0.078 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (28 mg, 0.078 mmol) by the similar manner as described in Example 1(1) as a pale yellow amorphous (8 mg, yield 20%).
FAB-MS(m/z): 505 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.5-2.7 (2H, m), 3.29 (3H, s), 3.6-3.7 (2H, m), 4.1-4.2 (2H, m), 5.39 (2H, s), 6.68 (1H, br s), 6.77 (1H, d, J=3 Hz), 7.01 (1H, d, J=11 Hz), 7.27 (1H, d, J=3 Hz), 8.26 (1H, d, J=1 Hz), 8.65 (1H, d, J=1 Hz).
The title compound was prepared from 2-chloro-5-[4-(1,2,4-triazol-1-yl)phenoxymethyl]pyrazine (Example 13(1)) (72 mg, 0.250 mmol) and tert-butyl 3-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (81 mg, 0.250 mmol) by the similar manner as described in Example 1(1) as a pale yellow amorphous (2.3 mg, yield 2%).
FAB-MS(m/z): 449 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.11 (3H, d, J=7 Hz), 1.50 (9H, s), 3.0-3.3 (2H, m), 3.7-4.1 (2H, m), 4.2-4.7 (1H, m), 5.28 (2H, s), 6.54 (1H, br s), 7.13 (1H, d, J=9 Hz), 7.60 (1H, d, J=9 Hz), 8.08 (1H, s), 8.46 (1H, s), 8.70 (1H, s), 8.73 (1H, s).
The title compound was prepared from 2,3-difluoro-4-methanesulfonylphenol (150 mg, 0.721 mmol) by the similar manner as described in Example 2(1) (165 mg, yield 68%).
1H NMR (CDCl3, 400 MHz): δ=3.21 (3H, s), 5.37 (2H, s), 6.9-7.1 (1H, m), 7.6-7.8 (1H, m), 8.61 (1H, d, J=1 Hz), 8.62 (1H, s).
The title compound was prepared from 2-chloro-5-(2,3-difluoro-4-methanesulfonylphenoxymethyl)pyrazine (50 mg, 0.149 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (46 mg, 0.149 mmol) by the similar manner as described in Example 1(1) as a white crystal (44 mg, yield 61%).
FAB-MS(m/z): 482 (M+1)
m.p.176-179° C.
1H NMR (CDCl3, 400 MHz): δ=1.50 (9H, s), 2.6-2.8 (2H, m), 3.21 (3H, s), 3.6-3.8 (2H, m), 4.1-4.3 (2H, m), 5.37 (2H, s), 6.74 (1H, br s), 6.9-7.1 (1H, m), 7.6-7.8 (1H, m), 8.69 (1H, s), 8.72 (1H, s).
IR(KBr, cm−1): 3008, 2976, 2929, 1689, 1618, 1512, 1464, 1412, 1396, 1365, 1306, 1238, 1169, 1130, 1095, 1026, 993, 897, 866, 812, 771, 528, 490.
The title compound was prepared from 2-chloro-5-(4,6-difluoro-5-methanesulfonylindol-1-ylmethyl)pyrazine(Example 16(1)) (25 mg, 0.08 mmol) and tert-butyl 3-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (26 mg, 0.08 mmol) by the similar manner as described in Example 1(1) as a pale yellow amorphous (9 mg, yield 24%).
FAB-MS(m/z): 519 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.08 (3H, d, J=7 Hz), 1.49 (9H, s), 3.0-3.2 (2H, m), 3.30 (3H, s), 3.7-4.1 (2H, m), 4.3-4.6 (1H, m), 5.39 (2H, s), 6.52 (1H, br s), 6.77 (1H, d, J=3 Hz), 7.03 (1H, d, J=11 Hz), 7.27 (1H, d, J=3 Hz), 8.26 (1H, d, J=1 Hz), 8.66 (1H, d, J=1 Hz).
The title compound was prepared from 2-chloro-5-chloromethylpyrazine (57 mg, 0.35 mmol) and 6,7-difluoro-5-methanesulfonylindole (82 mg, 0.35 mmol) by the similar manner as described in Example 4(2) as a pale yellow crystal (89 mg, yield 71%).
1H NMR (CDCl3, 400 MHz): δ=3.23 (3H, s), 5.61 (2H, s), 6.71 (1H, d, J=3 Hz), 7.34 (1H, d, J=3 Hz), 7.99 (1H, d, J=6 Hz), 8.20 (1H, s), 8.52 (1H, s).
The title compound was prepared from 2-chloro-5-(6,7-difluoro-5-methanesulfonylindol-1-ylmethyl)pyrazine (30 mg, 0.084 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (26 mg, 0.084 mmol) by the similar manner as described in Example 1(1) as a pale yellow amorphous (26 mg, yield 61%).
FAB-MS(m/z): 505 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.5-2.7 (2H, m), 3.23 (3H, s), 3.6-3.7 (2H, m), 4.1-4.2 (2H, m), 5.60 (2H, s), 6.66 (1H, br s), 6.69 (1H, dd, J=1 Hz, 3 Hz), 7.34 (1H, d, J=3 Hz), 8.00 (1H, d, J=6 Hz), 8.31 (1H, s), 8.63 (1H, d, J=1 Hz).
The title compound was prepared from 2-chloro-5-(6,7-difluoro-5-methanesulfonylindol-1-ylmethyl)pyrazine (Example 20(1)) (20 mg, 0.056 mmol) and tert-butyl 3-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (18 mg, 0.056 mmol) by the similar manner as described in Example 1(1) as a pale yellow amorphous (3.7 mg, yield 13%).
FAB-MS(m/z): 519 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.07 (3H, d, J=7 Hz), 1.49 (9H, s), 3.0-3.2 (2H, m), 3.23 (3H, s), 3.7-4.1 (2H, m), 4.3-4.6 (1H, m), 5.60 (2H, s), 6.50 (1H, br s), 6.71 (1H, t, J=3 Hz), 7.34 (1H, d, J=3 Hz), 8.01 (1H, d, J=6 Hz), 8.32 (1H, s), 8.64 (1H, d, J=1 Hz).
The title compound was prepared from 2-chloro-5-chloromethylpyrazine (150 mg, 0.81 mmol) and 5-(1,2,4-triazol-1-yl)indole (133 mg, 0.81 mmol) by the similar manner as described in Example 4(2) as a pale yellow crystal (80 mg, yield 32%).
1H NMR (CDCl3, 400 MHz): δ=5.48 (2H, s), 6.67 (1H, d, J=3 Hz), 7.31 (1H, d, J=3 Hz), 7.38 (1H, d, J=9 Hz), 7.48 (1H, dd, J=2 Hz, 9 Hz), 7.89 (1H, d, J=2 Hz), 7.97 (1H, s), 8.10 (1H, s), 8.50 (1H, s), 8.55 (1H, s).
The title compound was prepared from 2-chloro-5-[5-(1,2,4-triazol-1-yl)indol-1-ylmethyl]pyrazine (25 mg, 0.08 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (25 mg, 0.08 mmol) by the similar manner as described in Example 1(1) as a yellow amorphous (26 mg, yield 71%).
FAB-MS(m/z): 458 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.5-2.7 (2H, m), 3.6-3.7 (2H, m), 4.1-4.2 (2H, m), 5.67 (2H, s), 6.65 (1H, br s), 6.68 (1H, d, J=3 Hz), 7.34 (1H, d, J=3 Hz), 7.41 (1H, d, J=8 Hz), 7.47 (1H, dd, J=2 Hz, 8 Hz), 7.88 (1H, d, J=2 Hz), 8.10 (1H, s), 8.15 (1H, s), 8.50 (1H, s), 8.66 (1H, s).
The title compound was prepared from 2-chloro-[5-(1,2,4-triazol-1-yl)indol-1-ylmethyl]pyrazine (Example 22(1)) (25 mg, 0.08 mmol) and tert-butyl 3-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (26 mg, 0.08 mmol) by the similar manner as described in Example 1(1) as a white amorphous (9 mg, yield 24%).
FAB-MS(m/z): 472 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.06 (3H, d, J=7 Hz), 1.48 (9H, s), 3.0-3.2 (2H, m), 3.7-4.1 (2H, m), 4.1-4.6 (1H, m), 5.50 (2H, s), 6.49 (1H, br s), 6.68 (1H, d, J=3 Hz), 7.35 (1H, d, J=3 Hz), 7.43 (1H, d, J=9 Hz), 7.48 (1H, dd, J=2 Hz, 9 Hz), 7.89 (1H, d, J=2 Hz), 8.10 (1H, s), 8.15 (1H, s), 8.50 (1H, s), 8.66 (1H, s).
The title compound was prepared from 5-bromo-2-hydroxymethylpyrimidine (30 mg, 0.159 mmol) and 2,3-difluoro-4-methanesulfonylphenol (33 mg, 0.159 mmol) by the similar manner as described in Example 1(3) as a pale yellow crystal (34 mg, yield 56%).
1H NMR (CDCl3, 400 MHz): δ=3.20 (3H, s), 5.42 (2H, s), 6.8-7.0 (1H, m), 7.5-7.7 (1H, m), 8.82 (2H, s).
The title compound was prepared from 5-bromo-2-(2,3-difluoro-4-methanesulfonylphenoxymethyl)pyrimidine (34 mg, 89.7 μmol) and tert-butyl 3-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (30 mg, 89.7 μmol) by the similar manner as described in Example 1(1) as a yellow amorphous (8 mg, yield 18%).
FAB-MS(m/z): 496 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.05 (3H, d, J=7 Hz), 1.50 (9H, s), 2.7-2.9 (1H, m), 3.20 (3H, s), 3.33 (1H, dd, J=4 Hz, 13 Hz), 3.8-4.0 (1H, m), 3.86 (1H, dd, J=3 Hz, 13 Hz), 4.1-4.5 (1H, m), 5.46 (2H, s), 6.03 (1H, br s), 6.9-7.0 (1H, m), 7.5-7.7 (1H, m), 8.72 (2H, s).
The title compound was prepared from 5-bromo-2-hydroxymethylpyrimidine (175 mg, 0.928 mmol) and tert-butyl 3-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (300 mg, 0.928 mmol) by the similar manner as described in Example 1(1) as a yellow oil (46 mg, yield 16%).
1H NMR (CDCl3, 400 MHz): δ=1.04 (3H, d, J=7 Hz), 1.50 (9H, s), 2.7-2.9 (1H, m), 3.34 (1H, dd, J=4 Hz, 13 Hz), 3.57 (1H, t, J=5 Hz), 3.8-4.0 (1H, m), 3.86 (1H, dd, J=3 Hz, 13 Hz), 4.1-4.5 (2H, m), 4.85 (2H, d, J=5 Hz), 6.00 (1H, br s), 8.69 (2H, s).
To a solution of tert-butyl 4-(2-hydroxymethylpyrimidin-5-yl)-3-methyl-3,6-dihydro-2H-pyridine-1-carboxylate (46 mg, 0.151 mmol) in dichloromethane (1 mL) was added triethylamine (30 μL, 0.226 mmol) under ice-cooling. To this was added dropwise a solution of methanesulfonyl chloride (14 μL, 0.181 mmol) in dichloromethane (0.5 mL). After stirring at same temperature for 2 hour and at room temperature for 1 hours, the solvent was removed under reduced pressure, to give tert-Butyl 4-[2-(methanesulfonyloxymethyl)pyrimidin-5-yl]-3-methyl-3,6-dihydro-2H-pyridine-1-carboxylate.
This crude material, 4-(1,2,4-triazol-1-yl)phenol (12 mg, 77.2 μmol) and potassium iodide (14 mg, 84.9 μmol) was dissolved in tetrahydrofuran (1 mL), added sodium hydride (3.4 mg, 84.9 μmol), and stirred at 70° C. for 5 hours. The reaction mixture was cooled to room temperature, poured into water, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=1/2), to give the title compound as a yellow amorphous (13 mg, yield 37%).
FAB-MS(m/z): 449 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.05 (3H, d, J=7 Hz), 1.50 (9H, s), 2.7-2.9 (1H, m), 3.33 (1H, dd, J=4 Hz, 13 Hz), 3.8-4.0 (1H, m), 3.85 (1H, dd, J=3 Hz, 13 Hz), 4.1-4.5 (1H, m), 5.36 (2H, s), 6.02 (1H, br s), 7.14 (2H, d, J=9 Hz), 7.57 (2H, d, J=9 Hz), 8.07 (1H, s), 8.44 (1H, s), 8.74 (2H, s).
To a solution of tert-butyl 4-[5-(2,3-difluoro-4-methanesulfonylphenoxymethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 18) (25 mg, 51.9 μmol) in dichloromethane (1 mL) was added trifluoroacetic acid (0.3 mL). After stirring at room temperature for 3 hours, the solvent was removed under reduced pressure. The resulting crude material was dissolved in dry acetonitrile (2 mL), and was added potassium carbonate (36 mg, 0.260 mmol) and 2-chloro-5-ethylpyrimidine (12.4 μL, 0.104 mmol). After stirring at 80° C. overnight, cooled to room temperature, the reaction mixture was poured into water, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=1/2), to give the title compound as a pale yellow crystal (8.2 mg, yield 32%).
FAB-MS(m/z): 488 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.20 (3H, t, J=8 Hz), 2.49 (2H, q, J=8 Hz), 2.7-2.8 (2H, m), 3.20 (3H, s), 4.0-4.2 (2H, m), 4.4-4.5 (2H, m), 5.38 (2H, s), 6.8-7.0 (1H, m), 6.9-7.1 (1H, m), 7.6-7.8 (1H, m), 8.22 (2H, s), 8.73 (2H, s).
IR(KBr, cm−1): 3010, 2960, 2929, 1604, 1539, 1512, 1489, 1464, 1396, 1365, 1309, 1238, 1169, 1130, 1097, 993, 970, 933, 897, 812, 771, 652, 615, 526, 490, 409.
The title compound was prepared from 2-chloro-5-chloromethylpyrazine (34 mg, 0.206 mmol) and 7-fluoro-5-methanesulfonylindole (40 mg, 0.188 mmol) by the similar manner as described in Example 4(2) as a brown oil (50 mg, yield 78%).
1H NMR (CDCl3, 400 MHz): δ=3.07 (3H, s), 5.64 (2H, s), 6.7-6.8 (1H, m), 7.37 (1H, d, J=3 Hz), 7.42 (1H, d, J=11 Hz), 8.07 (1H, s), 8.16 (1H, s), 8.52 (1H, s).
The title compound was prepared from 2-chloro-5-(7-fluoro-5-methanesulfonylindol-1-ylmethyl)pyrazine (50 mg, 0.142 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (50 mg, 0.162 mmol) by the similar manner as described in Example 1(1) as a colorless oil (59 mg, yield 82%).
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.5-2.7 (2H, m), 3.06 (3H, s), 3.6-3.7 (2H, m), 4.1-4.2 (2H, m), 5.64 (2H, s), 6.65 (1H, br s), 6.7-6.8 (1H, m), 7.39 (1H, d, J=3 Hz), 7.41 (1H, dd, J=1 Hz, 10 Hz), 8.06 (1H, d, J=1 Hz), 8.29 (1H, s), 8.62 (1H, d, J=1 Hz).
The title compound was prepared from tert-butyl 4-[5-(7-fluoro-5-methanesulfonylindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 27) (59 mg, 0.121 mmol) by the similar manner as described in Example 1(2) as a white amorphous (43 mg, yield 73%).
FAB-MS(m/z): 488 (M)
1H NMR (CDCl3, 400 MHz): δ=1.46 (9H, s), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.7-3.0 (3H, m), 3.06 (3H, s), 4.1-4.3 (2H, m), 5.62 (2H, s), 6.75 (1H, t, J=3 Hz), 7.39 (1H, d, J=3 Hz), 7.42 (1H, dd, J=1 Hz, 10 Hz), 8.06 (1H, d, J=1 Hz), 8.29 (1H, s), 8.40 (1H, d, J=1 Hz).
The title compound was prepared from 2-chloro-5-(6,7-difluoro-5-methanesulfonylindol-1-ylmethyl)pyrazine (Example 20(1)) (37 mg, 0.103 mmol) and isopropyl 3-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (32 mg, 0.103 mmol) by the similar manner as described in Example 1(1) as a colorless oil (5.2 mg, yield 10%).
FAB-MS(m/z): 505 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.07 (3H, d, J=6 Hz), 1.2-1.3 (6H, m), 3.1-3.2 (2H, m), 3.23 (3H, s), 3.7-4.1 (2H, m), 4.3-4.6 (1H, m), 4.9-5.1 (1H, m), 5.60 (2H, s), 6.50 (1H, br s), 6.71 (1H, t, J=3 Hz), 7.35 (1H, d, J=3 Hz), 8.00 (1H, d, J=6 Hz), 8.32 (1H, s), 8.64 (1H, s).
The title compound was prepared from 2-chloro-5-(4,6-difluoro-5-methanesulfonylindol-1-ylmethyl)pyrazine (Example 16(1)) (27 mg, 0.075 mmol) and isopropyl 3-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (23 mg, 0.075 mmol) by the similar manner as described in Example 1(1) as a colorless oil (8.9 mg, yield 23%).
FAB-MS(m/z): 505 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.07 (3H, d, J=6 Hz), 1.2-1.3 (6H, m), 3.0-3.3 (2H, m), 3.30 (3H, s), 3.7-4.2 (2H, m), 4.3-4.7 (1H, m), 4.9-5.1 (1H, m), 5.40 (2H, s), 6.52 (1H, br s), 6.77 (1H, d, J=3 Hz), 7.03 (1H, d, J=10 Hz), 7.28 (1H, d, J=3 Hz), 8.27 (1H, s), 8.66 (1H, s).
The title compound was prepared from 2-chloro-5-chloromethylpyrazine (109 mg, 0.669 mmol) and 7-fluoro-5-nitroindole (120 mg, 0.669 mmol) by the similar manner as described in Example 4(2) as pale yellow crystal (165 mg, yield 68%).
1H NMR (CDCl3, 400 MHz): δ=5.63 (2H, s), 6.80 (1H, t, J=3 Hz), 7.37 (1H, d, J=3 Hz), 7.81 (1H, dd, J=2 Hz, 12 Hz), 8.19 (1H, s), 8.41 (1H, d, J=2 Hz), 8.53 (1H, d, J=1 Hz).
The title compound was prepared from 2-chloro-5-(7-fluoro-5-nitroindol-1-ylmethyl)pyrazine (475 mg, 1.55 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (575 mg, 1.86 mmol) by the similar manner as described in Example 1(1) as a pale yellow crystal (431 mg, yield 61%).
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.5-2.7 (2H, m), 3.5-3.7 (2H, m), 4.1-4.2 (2H, m), 5.63 (2H, s), 6.66 (1H, br s), 6.79 (1H, t, J=3 Hz), 7.39 (1H, d=3 Hz), 7.80 (1H, dd, J=2 Hz, 12 Hz), 8.32 (1H, s), 8.40 (1H, d, J=2 Hz), 8.63 (1H, d, J=1 Hz).
The title compound was prepared from tert-butyl 4-[5-(7-fluoro-5-nitroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 31) (66 mg, 0.146 mmol) by the similar manner as described in Example 6 as a brown oil (38 mg, yield 61%).
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.5-2.7 (2H, m), 3.52 (2H, br s), 3.5-3.7 (2H, m), 4.1-4.2 (2H, m), 5.50 (2H, s), 6.3-6.4 (2H, m), 6.62 (1H, br s), 6.66 (1H, d, J=2 Hz), 7.10 (1H, d, J=3 Hz), 8.14 (1H, s), 8.61 (1H, d, J=1 Hz).
The title compound was prepared from tert-butyl 4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 32) (38 mg, 89.7 μmol) by the similar manner as described in Example 7 as a brown oil (35 mg, yield 81%).
1H NMR (CDCl3, 400 MHz): δ=1.48 (9H, s), 2.5-2.7 (2H, m), 3.5-3.7 (2H, m), 4.1-4.2 (2H, m), 5.64 (2H, s), 6.66 (1H, br s), 6.71 (1H, t, J=3 Hz), 7.2-7.3 (1H, m), 7.39 (1H, d, J=3 Hz), 7.69 (1H, d, J=1 Hz), 8.30 (1H, s), 8.64 (1H, s), 8.94 (1H, s).
The title compound was prepared from tert-butyl 4-[5-[7-fluoro-5-(tetrazol-1-yl)indol-1-ylmethyl]pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 33) (34 mg, 71.4 μmol) by the similar manner as described in Example 1(2) as a pale brown amorphous (24 mg, yield 70%).
FAB-MS(m/z): 479 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.46 (9H, s), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.7-3.0 (3H, m), 4.1-4.4 (2H, m), 5.63 (2H, s), 6.71 (1H, t, J=3 Hz), 7.26 (1H, dd, J=2 Hz, 12 Hz), 7.39 (1H, d, J=3 Hz), 7.69 (1H, d, J=2 Hz), 8.30 (1H, s), 8.41 (1H, d, J=1 Hz), 8.94 (1H, s).
Isopropyl 4-[5-(7-fluoro-5-nitroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate A solution of tert-butyl 4-[5-(7-fluoro-5-nitroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 31) (80 mg, 0.176 mmol) in trifluoroacetic acid (0.8 mL) was stirred at room temperature for 1 hour, and then the solvent was removed under reduced pressure. The resulting mixture was dissolved in tetrahydrofuran (1 mL)-water (1 mL), and was added triethylamine (0.25 mL, 1.76 mmol) and isopropyl chloroformate (30 μL, 0.265 mmol) under ice-cooling. After stirring at room temperature for 2 hours, the reaction mixture was added water, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=2/1→3/2), to give the title compound as a pale yellow crystal (76 mg, yield 98%).
1H NMR (CDCl3, 400 MHz): δ=1.26 (6H, d, J=6 Hz), 2.5-2.7 (2H, m), 3.6-3.8 (2H, m), 4.1-4.2 (2H, m), 4.8-5.0 (1H, m), 5.63 (2H, s), 6.66 (1H, br s), 6.79 (1H, t, J=3 Hz), 7.39 (1H, d=3 Hz), 7.80 (1H, dd, J=2 Hz, 12 Hz), 8.32 (1H, s), 8.40 (1H, d, J=2 Hz), 8.63 (1H, d, J=1 Hz).
Isopropyl 4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
The title compound was prepared from isopropyl 4-[5-(7-fluoro-5-nitroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 35) (75 mg, 0.171 mmol) by the similar manner as described in Example 6 as a brown oil (42 mg, yield 60%).
1H NMR (CDCl3, 400 MHz): δ=1.26 (6H, d, J=6 Hz), 2.5-2.7 (2H, m), 3.52 (2H, br s), 3.5-3.7 (2H, m), 4.1-4.2 (2H, m), 4.9-5.0 (1H, m), 5.50 (2H, s), 6.3-6.4 (2H, m), 6.62 (1H, br s), 6.65 (1H, d, J=2 Hz), 7.10 (1H, d, J=3 Hz), 8.14 (1H, s), 8.61 (1H, d, J=1 Hz).
Isopropyl 4-[5-[7-fluoro-5-(tetrazol-1-yl) indol-1-ylmethyl]pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
The title compound was prepared from isopropyl 4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 36) (42 mg, 0.103 mmol) by the similar manner as described in Example 7 as a brown oil (36 mg, yield 76%).
1H NMR (CDCl3, 400 MHz): δ=1.26 (6H, d, J=6 Hz), 2.5-2.7 (2H, m), 3.5-3.7 (2H, m), 4.1-4.2 (2H, m), 4.8-5.0 (1H, m), 5.65 (2H, s), 6.6-6.8 (2H, m), 7.2-7.3 (1H, m), 7.39 (1H, d, J=3 Hz), 7.69 (1H, s), 8.30 (1H, s), 8.64 (1H, s), 8.94 (1H, s).
The title compound was prepared from isopropyl 4-[5-[7-fluoro-5-(tetrazol-1-yl)indol-1-ylmethyl]pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 37) (36 mg, 77.8 μmol) by the similar manner as described in Example 1(2) as a pale brown amorphous (28 mg, yield 78%).
FAB-MS(m/z): 465 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.24 (6H, d, J=6 Hz), 1.6-1.8 (2H, m), 1.8-2.0 (2H, m), 2.7-3.0 (3H, m), 4.1-4.4 (2H, m), 4.8-5.0 (1H, m), 5.63 (2H, s), 6.6-6.8 (1H, m), 7.2-7.3 (1H, m), 7.39 (1H, d, J=3 Hz), 7.69 (1H, d, J=1 Hz), 8.30 (1H, s), 8.41 (1H, s), 8.94 (1H, s).
The title compound was prepared from tert-butyl 4-[5-(7-fluoro-5-nitroindol-1-ylmethyl) pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 31) (120 mg, 0.265 mmol) by the similar manner as described in Example 26 as a pale yellow crystal (68 mg, yield 56%).
1H NMR (CDCl3, 400 MHz): δ=1.19 (3H, t, J=8 Hz), 2.48 (2H, q, J=8 Hz), 2.6-2.8 (2H, m), 4.0-4.2 (2H, m), 4.4-4.5 (2H, m), 5.63 (2H, s), 6.7-6.9 (2H, m), 7.39 (1H, d=3 Hz), 7.80 (1H, dd, J=2 Hz, 12 Hz), 8.21 (2H, s), 8.33 (1H, s), 8.40 (1H, d, J=2 Hz), 8.66 (1H, d, J=1 Hz).
The title compound was prepared from 5-ethyl-2-[4-[5-(7-fluoro-5-nitroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridin-1-yl]pyrimidine (Example 39) (67 mg, 0.146 mmol) by the similar manner as described in Example 6 as a brown oil (17 mg, yield 27%). 1H NMR (CDCl3, 400 MHz): δ=1.19 (3H, t, J=7 Hz), 2.47 (2H, q, J=7 Hz), 2.6-2.8 (2H, m), 3.52 (2H, br s), 4.0-4.1 (2H, m), 4.4-4.5 (2H, m), 5.50 (2H, s), 6.3-6.4 (2H, m), 6.65 (1H, d, J=2 Hz), 6.7-6.8 (1H, m), 7.10 (1H, d, J=3 Hz), 8.14 (1H, s), 8.21 (2H, s), 8.65 (1H, d, J=1 Hz).
The title compound was prepared from 2-[4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridin-1-yl]-5-ethylpyrimidine (Example 40) (17 mg, 39.6 μmol) by the similar manner as described in Example 7 as a brown oil (14 mg, yield 73%).
1H NMR (CDCl3, 400 MHz): δ=1.19 (3H, t, J=7 Hz), 2.47 (2H, q, J=7 Hz), 2.6-2.8 (2H, m), 4.0-4.1 (2H, m), 4.4-4.5 (2H, m), 5.64 (2H, s), 6.6-6.9 (2H, m), 7.2-7.3 (1H, m), 7.39 (1H, d, J=3 Hz), 7.69 (1H, d, J=1 Hz), 8.21 (2H, s), 8.30 (1H, s), 8.67 (1H, s), 8.94 (1H, s).
The title compound was prepared from 5-ethyl-2-[4-[5-[7-fluoro-5-(tetrazol-1-yl)indol-1-ylmethyl]pyrazin-2-yl]-3,6-dihydro-2H-pyridin-1-yl]pyrimidine (Example 41) (14 mg, 77.8 μmol) by the similar manner as described in Example 1(2) as a pale brown crystal (12 mg, yield 92%).
FAB-MS(m/z): 485 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.19 (3H, t, J=7 Hz), 1.7-1.9 (2H, m), 1.9-2.0 (2H, m), 2.46 (2H, q, J=7 Hz), 2.9-3.1 (3H, m), 4.7-5.0 (2H, m), 5.63 (2H, s), 6.6-6.8 (1H, m), 7.2-7.3 (1H, m), 7.39 (1H, d, J=3 Hz), 7.69 (1H, d, J=1 Hz), 8.17 (2H, s), 8.30 (1H, s), 8.43 (1H, s), 8.93 (1H, s).
The title compound was prepared from tert-butyl 4-[5-(5-methanesulfonyl-1H-pyrrolo[2,3-b]pyridin-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 14) (53 mg, 0.113 mmol) by the similar manner as described in Example 1(2) as a white amorphous (48 mg, yield 90%).
FAB-MS(m/z): 471 (M)
1H NMR (CDCl3, 400 MHz): δ=1.46 (9H, s), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.7-2.9 (3H, m), 3.12 (3H, s), 4.2-4.4 (2H, m), 5.66 (2H, s), 6.69 (1H, d, J=3 Hz), 7.55 (1H, d, J=3 Hz), 8.40 (1H, d, J=1 Hz), 8.45 (1H, s), 8.49 (1H, d, J=1 Hz), 8.87 (1H, d, J=1 Hz).
The title compound was prepared from tert-butyl 4-[5-(5-methanesulfonyl-1H-pyrrolo[2,3-b]pyridin-1-ylmethyl)pyrazin-2-yl]piperidine-1-carboxylate (Example 43) (20 mg, 0.0424 mmol) and 5-bromo-2-chloropyrimidine (16 mg, 0.0848 mmol) by the similar manner as described in Example 35 as a white amorphous (18 mg, yield 93%).
FAB-MS(m/z): 458 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.24 (6H, d, J=6 Hz), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.8-3.0 (3H, m), 3.12 (3H, s), 4.2-4.4 (2H, m), 4.8-5.0 (1H, m), 5.66 (2H, s), 6.69 (1H, d, J=3 Hz), 7.54 (1H, d, J=3 Hz), 8.40 (1H, d, J=1 Hz), 8.45 (1H, s), 8.49 (1H, d, J=2 Hz), 8.87 (1H, d, J=2 Hz).
The title compound was prepared from tert-butyl 4-[5-(5-methanesulfonyl-1H-pyrrolo[2,3-b]pyridin-1-ylmethyl)pyrazin-2-yl]piperidine-1-carboxylate (Example 43) (20 mg, 0.0424 mmol) by the similar manner as described in Example 26 as a pale yellow crystal (13 mg, yield 58%).
FAB-MS(m/z): 528 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.7-1.9 (2H, m), 1.9-2.0 (2H, m), 2.9-3.1 (3H, m), 3.12 (3H, s), 4.8-4.9 (2H, m), 5.66 (2H, s), 6.69 (1H, d, J=3 Hz), 7.54 (1H, d, J=3 Hz), 8.28 (2H, s), 8.42 (1H, d, J=1 Hz), 8.44 (1H, d, J=1 Hz), 8.49 (1H, d, J=2 Hz), 8.86 (1H, d, J=2 Hz).
To a solution of 5-bromo-2-hydroxymethylpyrimidine (177 mg, 0.937 mmol) in N,N-dimethylformamide (9.4 mL) was added triethylamine (0.26 mL, 1.87 mmol) and tertbutyldimethylsilyl chloride (155 mg, 1.03 mmol) under N2. After stirring at room temperature for 2 hours, the reaction mixture was added water, and was extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=100/1→4/1), to give the title compound as a pale yellow oil (215 mg, yield 76%).
1H NMR (CDCl3, 400 MHz): δ=0.13 (6H, s), 0.94 (9H, s), 4.88 (2H, s), 8.77 (2H, s).
The title compound was prepared from 5-bromo-2-(tert-butyldimethylsilyloxymethyl)pyrimidine (215 mg, 0.709 mmol) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (219 mg, 0.709 mmol) by the similar manner as described in Example 1(1) as a pale yellow crystal (293 mg, yield 100%).
1H NMR (CDCl3, 400 MHz): δ=0.14 (6H, s), 0.94 (9H, s), 1.49 (9H, s), 2.4-2.6 (2H, m), 3.6-3.7 (2H, m), 4.0-4.2 (2H, m), 4.92 (2H, s), 6.15 (1H, br s), 8.72 (2H, s).
tert-Butyl 4-[2-(tert-butyldimethylsilyloxymethyl)pyrimidin-5-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (435 mg, 1.07 mmol) was dissolved in dry tetrahydrofuran, and was added dropwise 1.0 M tetrabutylammonium fluoride-tetrahydrofuran solution (1.3 mL, 1.29 mmol). After stirring at room temperature for 3 hours, the reaction mixture was added water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=6/1→0/100), to give the title compound as a pale yellow oil(296 mg, yield 86%). 1H NMR (CDCl3, 400 MHz): δ=1.50 (9H, s), 2.5-2.6 (2H, m), 3.59 (1H, t, J=5 Hz), 3.6-3.7 (2H, m), 4.1-4.2 (2H, m), 4.84 (2H, d, J=5 Hz), 6.17 (1H, br s), 8.72 (2H, s).
The title compound was prepared from tert-butyl 4-(2-hydroxymethylpyrimidin-5-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (296 mg, 1.02 mmol) by the similar manner as described in Example 1(2) as a colorless oil (133 mg, yield 47%).
1H NMR (CDCl3, 400 MHz): δ=1.49 (9H, s), 1.5-1.8 (2H, m), 1.8-1.9 (2H, m), 2.6-2.8 (1H, m), 2.8-2.9 (2H, m), 3.58 (1H, br s), 4.2-4.4 (2H, m), 4.82 (2H, s), 8.59 (2H, s).
The title compound was prepared from tert-butyl 4-(2-hydroxymethylpyrimidin-5-yl)piperidine-1-carboxylate (40 mg, 0.136 mmol) by the similar manner as described in Example 4(1) and 4(2) as a yellow amorphous (35 mg, yield 69%).
FAB-MS(m/z): 472 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.47 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.7 (1H, m), 2.7-2.9 (2H, m), 3.11 (3H, s), 4.2-4.4 (2H, m), 5.78 (2H, s), 6.71 (1H, d, J=3 Hz), 7.54 (1H, d, J=3 Hz), 8.49 (1H, d, J=2 Hz), 8.52 (2H, s), 8.85 (1H, d, J=2 Hz).
The title compound was prepared from tert-butyl 4-(2-hydroxymethylpyrimidin-5-yl)piperidine-1-carboxylate (Example 46(4)) (93 mg, 0.317 mmol) and 7-fluoro-5-nitroindole (63 mg, 0.351 mmol) by the similar manner as described in Example 4(1) and 4(2) as a yellow crystal (111 mg, yield 70%).
1H NMR (CDCl3, 400 MHz): δ=1.47 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.7 (1H, m), 2.7-2.9 (2H, m), 4.2-4.4 (2H, m), 5.71 (2H, s), 6.79 (1H, t, J=3 Hz), 7.33 (1H, d, J=3 Hz), 7.77 (1H, dd, J=2 Hz, 10 Hz), 8.42 (1H, d, J=2 Hz), 8.51 (2H, s).
The title compound was prepared from tert-butyl 4-[2-(7-fluoro-5-nitroindol-1-ylmethyl)pyrimidin-5-yl]piperidine-1-carboxylate (Example 47) (111 mg, 0.244 mmol) by the similar manner as described in Example 6 as a brown amorphous (97 mg, yield 94%).
1H NMR (CDCl3, 400 MHz): δ=1.47 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.5-2.7 (1H, m), 2.7-2.9 (2H, m), 4.2-4.4 (2H, m), 5.59 (2H, s), 6.2-6.4 (2H, m), 6.66 (1H, s), 7.10 (1H, d, J=3 Hz), 8.51 (2H, s).
The title compound was prepared from tert-butyl 4-[2-(5-amino-7-fluoroindol-1-ylmethyl)pyrimidin-5-yl]piperidine-1-carboxylate (Example 48) (97 mg, 0.228 mmol) by the similar manner as described in Example 7 as a brown amorphous (57 mg, yield 52%).
FAB-MS(m/z): 479 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.47 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H, m), 4.2-4.3 (2H, m), 5.73 (2H, s), 6.72 (1H, t, J=3 Hz), 7.22 (1H, dd, J=2 Hz, 12 Hz), 7.35 (1H, d, J=3 Hz), 7.69 (1H, d, J=2 Hz), 8.53 (2H, s), 8.94 (1H, s).
Isopropyl 4-[2-[7-fluoro-5-(tetrazol-1-yl)indol-1-ylmethyl]pyrimidin-5-yl]piperidine-1-carboxylate
The title compound was prepared from tert-butyl 4-[2-[7-fluoro-5-(tetrazol-1-yl)indol-1-ylmethyl]pyrimidin-5-yl]piperidine-1-carboxylate (Example 49) (45 mg, 0.0940 mmol) by the similar manner as described in Example 35 as a brown amorphous (34 mg, yield 78%).
FAB-MS(m/z): 465 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.25 (6H, d, J=6 Hz), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H, m), 4.2-4.4 (2H, m), 4.9-5.0 (1H, m), 5.73 (2H, s), 6.72 (1H, t, J=3 Hz), 7.22 (1H, dd, J=2 Hz, 12 Hz), 7.34 (1H, d, J=3 Hz), 7.69 (1H, d, J=2 Hz), 8.53 (2H, s), 8.93 (1H, s).
The title compound was prepared from tert-butyl 4-[5-(7-fluoro-5-methanesulfonylindol-1-ylmethyl)pyrazin-2-yl]piperidine-1-carboxylate (Example 28) (33 mg, 0.0675 mmol) by the similar manner as described in Example 26 as a pale yellow crystal (26 mg, yield 71%).
FAB-MS(m/z): 545 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.7-1.9 (2H, m), 1.9-2.0 (2H, m), 2.9-3.1 (3H, m), 3.06 (3H, s), 4.8-4.9 (2H, m), 5.62 (2H, s), 6.7-6.8 (1H, m), 7.38 (1H, d, J=3 Hz), 7.42 (1H, dd, J=1 Hz, 10 Hz), 8.06 (1H, d, J=1 Hz), 8.28 (2H, s), 8.29 (1H, s), 8.42 (1H, d, J=1 Hz).
To a solution of tert-Butyl 4-[5-(7-fluoro-5-nitroindol-1-ylmethyl)pyrazin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (Example 31) (150 mg, 0.331 mmol) in methanol (1.6 mL)-tetrahydrofuran (1.6 mL) was added 5% palladium-carbon (wetted with ca. 52% Water, BNA-5D (N.E. CHEMCAT Corporation)) (15 mg) and then the mixture was hydrogenated at room temperature for 3 hours under 1 atm of H2. The reaction mixture was filtered through a celite pad, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane/ethyl acetate=1/1), to give the title compound as a yellow amorphous (125 mg, yield 89%).
1H NMR (CDCl3, 400 MHz): δ=1.46 (9H, s), 1.6-1.8 (2H, m), 1.8-1.9 (2H, m), 2.7-2.9 (3H, m), 3.52 (2H, br s), 4.1-4.3 (2H, m), 5.49 (2H, s), 6.34 (1H, dd, J=2 Hz, 8 Hz), 6.37 (1H, d, J=3 Hz), 6.65 (1H, d, J=2 Hz), 7.10 (1H, d, J=3 Hz), 8.16 (1H, s), 8.39 (1H, d, J=2 Hz).
The title compound was prepared from tert-butyl 4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]piperidine-1-carboxylate (Example 52) (25 mg, 0.588 mmol) and 5-bromo-2-chloropyrimidine (16 mg, 0.0811 mmol) by the similar manner as described in Example 26 as a brown oil (19 mg, yield 67%).
1H NMR (CDCl3, 400 MHz): δ=1.7-1.9 (2H, m), 1.9-2.0 (2H, m), 2.9-3.1 (3H, m), 3.50 (2H, br s), 4.8-4.9 (2H, m), 5.48 (2H, s), 6.3-6.4 (1H, m), 6.36 (1H, d, J=3 Hz), 6.65 (1H, d, J=1 Hz), 7.10 (1H, d, J=3 Hz), 8.16 (1H, s), 8.27 (2H, s), 8.40 (1H, s).
The title compound was prepared from 2-[4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]piperidin-1-yl]-5-bromopyrimidine (Example 53) (19 mg, 0.0394 mmol) by the similar manner as described in Example 7 as a pale yellow amorphous (17 mg, yield 81%).
FAB-MS(m/z): 535 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.7-1.9 (2H, m), 1.9-2.0 (2H, m), 2.9-3.1 (3H, m), 4.8-4.9 (2H, m), 5.63 (2H, s), 6.7-6.8 (1H, m), 7.26 (1H, dd, J=2 Hz, 11 Hz), 7.38 (1H, d, J=3 Hz), 7.69 (1H, d, J=2 Hz), 8.28 (2H, s), 8.2-8.4 (1H, m), 8.43 (1H, d, J=2 Hz), 8.93 (1H, s).
The title compound was prepared from tert-butyl 4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]piperidine-1-carboxylate (Example 52) (41 mg, 0.0964 mmol) and 2-chloro-5-trifluoromethylpyrimidine (19 mg, 0.106 mmol) by the similar manner as described in Example 26 as a brown crystal (23 mg, yield 51%).
1H NMR (CDCl3, 400 MHz): δ=1.7-1.9 (2H, m), 1.9-2.1 (2H, m), 3.0-3.1 (3H, m), 3.50 (2H, br s), 4.9-5.1 (2H, m), 5.49 (2H, s), 6.34 (1H, dd, J=2 Hz, 10 Hz), 6.36 (1H, d, J=3 Hz), 6.65 (1H, d, J=2 Hz), 7.10 (1H, d, J=3 Hz), 8.16 (2H, s), 8.41 (1H, d, J=2 Hz), 8.47 (1H, s).
The title compound was prepared from 2-[4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]piperidin-1-yl]-5-trifluoromethylpyrimidine (Example 55) (23 mg, 0.0488 mmol) by the similar manner as described in Example 7 as a pale brown amorphous (22 mg, yield 86%).
FAB-MS(m/z): 525 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.7-1.9 (2H, m), 1.9-2.1 (2H, m), 3.0-3.2 (3H, m), 4.9-5.1 (2H, m), 5.63 (2H, s), 6.7-6.8 (1H, m), 7.26 (1H, dd, J=2 Hz, 11 Hz), 7.39 (1H, d, J=3 Hz), 7.69 (1H, d, J=2 Hz), 8.30 (1H, s), 8.44 (1H, d, J=2 Hz), 8.47 (2H, s), 8.93 (1H, s).
The title compound was prepared from tert-butyl 4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]piperidine-1-carboxylate (Example 52) (41 mg, 0.0964 mmol) and 2,5-dichloropyrimidine (16 mg, 0.106 mmol) by the similar manner as described in Example 26 as a pale yellow oil (1.9 mg, yield 4.5%).
1H NMR (CDCl3, 400 MHz): δ=1.7-1.9 (2H, m), 1.9-2.0 (2H, m), 2.9-3.1 (3H, m), 3.50 (2H, br s), 4.8-4.9 (2H, m), 5.48 (2H, s), 6.34 (1H, dd, J=2 Hz, 10 Hz), 6.36 (1H, d, J=2 Hz), 6.65 (1H, d, J=2 Hz), 7.10 (1H, d, J=2 Hz), 8.16 (1H, s), 8.21 (2H, s), 8.40 (1H, d, J=2 Hz).
The title compound was prepared from tert-butyl 4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]piperidine-1-carboxylate (Example 52) (41 mg, 0.0964 mmol) and 2-chloro-5-fluoropyrimidine (14 mg, 0.106 mmol) by the similar manner as described in Example 26 as a brown oil (6.2 mg, yield 15%).
1H NMR (CDCl3, 400 MHz): =1.7-1.9 (2H, m), 1.9-2.0 (2H, m), 2.9-3.1 (3H, m), 3.40 (2H, br s), 4.7-4.9 (2H, m), 5.48 (2H, s), 6.34 (1H, dd, J=2 Hz, 10 Hz), 6.36 (1H, d, J=3 Hz), 6.65 (1H, d, J=2 Hz), 7.10 (1H, d, J=3 Hz), 8.1-8.2 (1H, m), 8.18 (2H, s), 8.41 (1H, d, J=2 Hz).
The title compound was prepared from 2-[4-[5-(5-amino-7-fluoroindol-1-ylmethyl)pyrazin-2-yl]piperidin-1-yl]-5-fluoropyrimidine (Example 58) (6 mg, 0.0142 mmol) by the similar manner as described in Example 7 as a white amorphous (6 mg, yield 89%).
FAB-MS(m/z): 475 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.7-1.9 (2H, m), 1.9-2.0 (2H, m), 2.9-3.1 (3H, m), 4.7-4.9 (2H, m), 5.63 (2H, s), 6.6-6.8 (1H, m), 7.2-7.3 (1H, m), 7.39 (1H, d, J=3 Hz), 7.69 (1H, d, J=2 Hz), 8.19 (2H, s), 8.30 (1H, s), 8.43 (1H, d, J=2 Hz), 8.93 (1H, s).
To a solution of tert-butyl 4-[5-[7-fluoro-5-(tetrazol-1-yl)indol-1-ylmethyl]pyrazin-2-yl]piperidine-1-carboxylate (Example 34) (84 mg, 0.176 mmol) in dichloromethane (1 mL) was added trifluoroacetic acid (0.9 mL). After stirring at room temperature for 1 hour, the solvent was removed under reduced pressure. The resulting residue was dissolved in dichloromethane (1.8 mL), and was added sodium hydrogen carbonate (30 mg, 0.351 mmol). To this was added a 3.0 M solution of cyanogen bromide in dichloromethane (0.07 mL, 0.211 mmol) under ice-cooling and stirred at 0° C. for 30 minutes. After stirring at room temperature for an additional 16 hours, the reaction mixture was added saturated aqueous sodium hydrogen carbonate solution, and was extracted with chloroform. The organic layer was dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (chloroform/methanol=98/2-6/1), to give the title compound as a colorless oil (72 mg, yield 100%).
1H NMR (CDCl3, 400 MHz): δ=1.9-2.1 (4H, m), 2.8-2.9 (1H, m), 3.1-3.3 (2H, m), 3.5-3.6 (2H, m), 5.65 (2H, s), 6.7-6.8 (1H, m), 7.27 (1H, dd, J=2 Hz, 12 Hz), 7.39 (1H, d, J=3 Hz), 7.70 (1H, d, J=2 Hz), 8.32 (1H, s), 8.41 (1H, s), 8.97 (1H, s).
Under N2 atmosphere, 4-[5-[7-fluoro-5-(tetrazol-1-yl)indol-1-ylmethyl]pyrazin-2-yl]piperidine-1-carbonitrile (72 mg, 0.179 mmol) was dissolved in dioxane (1.5 mL), added dioxane solution of N-hydroxyisobutylimidamide (27 mg, 0.268 mmol) and zinc chloride (37 mg, 0.268 mmol), and stirred at 90° C. for 3 hours. After cooling to room temperature, the reaction mixture was added 10% sodium hydroxide solution, and was extracted with ethyl acetate. The organic layer was washed with water and brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (chloroform/methanol=20/1, hexane/ethyl acetate 7/1→0/100), to give the title compound as a white amorphous (19 mg, yield 22%).
FAB-MS(m/z): 489 (M+1)
1H NMR (CDCl3, 400 MHz): δ=1.28 (6H, d, J=7 Hz), 1.8-2.0 (4H, m), 2.8-3.1 (2H, m), 3.1-3.3 (2H, m), 4.2-4.3 (2H, m), 5.64 (2H, s), 6.72 (1H, t, J=3 Hz), 7.2-7.3 (1H, m), 7.39 (1H, d, J=3 Hz), 7.69 (1H, d, J=2 Hz), 8.31 (1H, s), 8.43 (1H, d, J=2 Hz), 8.94 (1H, s).
Human GPR119 gene (NM 178471) was purchased from ATCC (ATCC No. 10807349), and is amplyfied according to PCR to form BamHI site at 5′ side and Apa I site at 3′ side. The primers were tcctggatccatggaatcatctttctcatt (sequence No. 1) and tcctgggcccttagccatcaaactctgagc (sequence No. 2). The PCR conditions are described below.
The double-stranded DNA was thermally denatured using a DNA polymerase (KOD-Plus-Ver. 2; TOYOBO #KOD-211) at 98° C. for 10 seconds in one cycle. The denatured single-stranded DNA was annealed with the primers at 55° C. for 30 seconds. The DNA was subjected to an extension reaction at 68° C. for 1 minute and 15 seconds. The above-mentioned steps were repeated in 35 cycles. The PCR product was inserted into pcDNA5/FRT/TO (Invitrogen #V6520-20) plasmid. Flp-in T-Rex-293 cells (Invitorogen #R78007) were transfected with the obtained plasmid. The method of transfection was conducted in accordance with the protocol of the product.
The stable cell line expressing human GPR119 prepared in the above-mentioned method was plated on a 96-well plate at the concentration of 2,500 cells/well using Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS). Twenty-four hours after plating, tetracyclin (Invitrogen #Q10019) was added at the final concentration of 20 ng/mL to induce hGPR119 gene expression. Twenty-four hours after, the medium was removed, and the cells were stimulated with an assay buffer (0.5 mM IBMX PBS (−)) containing the test compound at 37° C. for 30 minutes. The amount of the intracellular cAMP was measured using a commercially available kit (HitHunter™ cAMP XS+ Assay: GE Healthcare #90007503) and a reader (FLUOstar Optima: BMG LABTECH). The test compound was dissolved in 100% DMSO, and added at the final concentration of 1%.
Examination results are shown in Table 12.
As is clear from Table 12, the compounds of example mention showed an excellent GPR119 agonist effect.
The examination was performed by the method similar to Example 61 Pharmacological experiment 1-(1), 1-(2). Those results are shown in Table 13.
In this experiment, we examined the inhibitory effect of test compound on glycemic excursions after glucose administration in normal mice. The test methods are shown as follows.
Male 9-week-old ICR mice, habituated to the experimental environment for two weeks, were fasted for 18 hours and used to this experiment. Mice were orally administered the test compound or vehicle (polyethylene glycol 400:ethanol:Tween80=8:1:1), and after 30 minutes, they were orally given glucose at the dose of 3 g/kg.
Blood was collected at just before the test compound or vehicle administration (−30 min), immediately before glucose challenge (0 min), 20 min, 40 min, 60 min and 120 min after glucose ingestion and then blood glucose levels were determined.
Inhibition rate (%) of the test compound versus vehicle in areas under the glycemic excursion curve between 0 and 120 min after glucose challenge was determined.
As is clear from Table 14, the compounds of example mention showed an excellent inhibitory effect of glycemic excursions.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2010-020568 | Feb 2010 | JP | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/JP2011/051972 | 2/1/2011 | WO | 00 | 9/14/2012 |