Group O HIV-1, fragments of such viruses, and uses thereof

Abstract

Group HIV-1 retrovirus strains, particularly the strains known as BCF02, BCF01, BCF06, BCF07, BCF08, BCF11, BCF03, BCF09, BCF12, BCF13 and BCF14, fragments of said retroviruses, and the uses thereof as a diagnostic reagent and as an immunogen, are disclosed.

Description

BACKGROUND OF THE INVENTION

The present invention relates to retrovirus strains of the HIV-1 group, group O, and in particular the strains called BCF02 (ESS), BCF01 (FAN), BCF06 (LOB), BCF07 (MAN), BCF08 (NKO), BCF11 (NAN) and BCF03 (POC), to fragments of the said retroviruses and to their applications as diagnostic reagent and as immunogenic agent.

Two distinct types of HIV (human immunodeficiency virus: HIV-1 and HIV-2) have been described and are the agents responsible for AIDS. Analysis of their nucleic acid sequence has made it possible to identify various subtypes of HIV-1, although no correlation could be established between variability and pathogenicity. Similarly, HIV-2 exhibits a greater genetic and biological diversity than that previously envisaged.

Analysis of nucleotide fragments of various HIV-1 isolates has shown the existence, through the analysis of the env gene, of at least 7 different subtypes, called A to G (MYERS G. et al., Human retroviruses and AIDS, 1993, Los Alamos Nat. Lab.).

More recently, two other isolates, considered to be considerably more distant from the other 7 subtypes, that is to say whose sequence homology is the most distant from that of the reference HIV-1 strains, have also been isolated: HIV-1ANT70 and HIV-1MVP5180, obtained from Cameroonian patients, and have been attached to a new HIV-1 group, group O, as opposed to group M corresponding to the 7 abovementioned A-G subtypes, taking into account their genomic organization (5′ LTR Gag Pol Vif Vpu Vpr Tat Rev Env Nef LTR 3′), (Patent Application WO 89/12094, European Patent Application No. 0,591,914, GÛRTLER L. G. et al., J. Virol., 1994, 68, 1581-85).

Analysis of the DNA sequences has shown 65-70% similarity with HIV-1 and 56% with HIV-2.

By using a competition immunoblotting method, using a peptide V3 from MVP5180, a 7-8% prevalence is found in Yaoundë. This prevalence might be under-estimated since the V3 loop is known, in all the HIV-1 subtypes, to be a highly variable region. Molecular studies also indicate the presence of group O virus in Gabon, France, Spain and Germany.

Ongoing serological studies reveal group O HIV-1 infections in Nigeria, Niger and Senegal.

Knowledge of these various groups and subtypes is particularly important for developing:

reagents for screening for HIV infections which are sufficiently sensitive and specific, that is to say which do not lead to false-negative or false-positive results; and

compositions which protect against all existing subtypes, including the entire group O viruses.

Indeed, it has been shown, in particular, that some detection reagents were not sufficiently sensitive and did not always make it possible to detect group O HIV-1 infections (LOUSSERT-AJAKA I. et al., Lancet, 1994, 343, 1393-94), which has led to the withdrawal of three screening kits and to the declassification of two others on the French market.

The results show that the group O viruses are very distant from the group M HIV-1 subtypes. These results indicate that the HIV-1 viruses ought to be classified in two different groups, namely: HIV-1 M and HIV-1 O. The group O viruses appear to be capable of being transmitted by horizontal and vertical routes, leading to a very wide distribution of this infection. The pathogenicity of these viruses is under study. The divergence of these viruses should be taken into account in the sensitivity of diagnostic tests and in the development of vaccines.

Consequently, the Applicant set itself the objective of providing fragments, derived from selected group O HIV-1 strains, capable of allowing both detection of the entire group O HIV-1 viruses and specific intra-group O differentiation and which are also capable of inducing protection against the entire HIV-1 subtypes, including group O, which fragments make it possible to avoid obtaining false-negative or false-positive results; to do this, the inventors selected a set of strains and sequences, derived essentially from a region of the env gene, in particular at the level of a hypervariable fragment situated in the V3 loop (C2V3) or at the level of gp41 and of a region of the gag gene.

The subject of the present invention is group O HIV-1 strains exhibiting the morphological and immunological characteristics of one of the retroviruses deposited at the Collection Nationale de Cultures de Microorganismes held by Institut Pasteur under the numbers I-1544 (called BCF02 (ESS)), I-1543 (called BCF01 (FAN)), I-1546 (called BCF07 (MAN)), I-1547 (called BCF08 (NKO)), I-1545 (called BCF03 (POC)), on the date of Feb. 24, 1995.

The subject of the present invention is also a nucleic acid fragment, characterized in that its nucleotide sequence is chosen from those which are contained in one of the nucleotide sequences included in the env or gag genes of the group O HIV-1 strains and its variants and comprises:

either one of the following sequences, included in the C2V3-env gene fragment (hypervariable loop of gp120): SEQ ID No. 1 (BCF02 (ESS)), SEQ ID No. 2 (BCF08 (NKO)), SEQ ID No. 3 (BCF03 (POC)), SEQ ID No. 4 (BCF06 (LOB)), SEQ ID No. 5 (BCF07 (MAN)), SEQ ID No. 6 (BCF01 (FAN)), SEQ ID No. 7 (BCF11 (NAN)), SEQ ID No. 50 (BCF09), SEQ ID No. 51 (BCF12), SEQ ID No. 52 (BCF13), SEQ ID No. 53 (BCF14),

or one of the following sequences, included in the gp14 fragment of the env gene: SEQ ID No. 8 (BCF02 (ESS)), SEQ ID No. 9 (BCF08 (NKO)), SEQ ID No. 10 (BCF03 (POC)), SEQ ID No. 11 (BCF06 (LOB)), SEQ ID No. 12 (BCF07 (MAN)), SEQ ID No. 13 (BCF01 (FAN)), SEQ ID No. 14 (BCF11 (NAN)), SEQ ID No. 54 (BCF09), SEQ ID No. 55 (BCF12), SEQ ID No. 56 (BCF13), SEQ ID No. 57 (BCF14),

or one of the following sequences, included in the gag gene: SEQ ID No. 15 (BCF02 (ESS)), SEQ ID No. 16 (BCF08 (NKO)), SEQ ID No. 17 (BCF03 (POC)), SEQ ID No. 18 (BCF05 (LOB)), SEQ ID No. 19 (BCF07 (MAN)), SEQ ID No. 20 (BCF01 (FAN)), SEQ ID No. 21 (BCF11 (NAN)), SEQ ID No. 58 (BCF09), SEQ ID No. 59 (BCF12), SEQ ID No. 60 (BCF13), SEQ ID No. 61 (BCF14),

or, if the sequence is not identical to one of the above nucleotide sequences, or is not complementary to one of these sequences, is nonetheless capable of hybridizing with a nucleic sequence derived from a group O HIV-1 virus.

For the purposes of the present invention, nucleic sequence is understood to mean the sequences, as specified above and their complementary sequences, as well as the sequences containing them.

Such sequences find application both in the specific identification of a group O HIV-1, as diagnostic reagent, alone or in a pool with other reagents, for the identification of any HIV-1 or alternatively, depending on the cases, as reagent for intra-group O differentiation.

These sequences may be used in particular in diagnostic tests comprising either a direct hybridization with the viral sequence to be detected, or an amplification of the said viral sequence, using, as primers, an oligonucleotide, included in any one of the above sequences and in particular one of the following sequences:

* sequences gag

GAG/5′CAM or G5: CAGGGACAAATGGTACATCA (positions 1250-1269) (SEQ ID No. 74)

GAG/3′CAM or G3: AGTAGCTTGCTCAGCTCTTAAT (positions 1768-1747) (SEQ ID No. 75)

* sequences gp41

SEQ ID No. 22 (gp41/5′CAM-1): AGRGAAAAAGAGCAGTAGGAT (positions 7800-7821)

SEQ ID No. 23 (gp41/5′CAM-2): TCTAAGTGCAGCAGGTAGCACTAT (positions 7843-7866)

SEQ ID No. 24 (gp41/3′CAM-2): CTAAGTTGCTCAAGAGTGGTA (positions 8594-8573)

SEQ ID No. 25 (gp41/3′CAM-2): GTTGCTCAAGAGGTGGTAAGT (positions 8590-8570)

sequences C2V3:

C2V3/5′CAM or V3L5: TRGTTACTTGTACACATGGCAT (positions 6991-7012) (SEQ ID No. 76)

C2V3/3′CAM or V3L3: ACAATAAAAGAATTCTCCATGACAGT (positions 7421-7396) (SEQ ID No. 77).

The abovementioned positions correspond to those of the Ant70 sequence (Myers, Korber et al., cited above).

The subject of the present invention is also group O HIV-1 strains, characterized in that they comprise at least one of the sequences selected from the group consisting of the sequences SEQ ID No. 1 to SEQ ID No. 7 or SEQ ID No. 50 to SEQ ID No. 53, at least one of the sequences selected from the group consisting of the sequences SEQ ID No. 8 to SEQ ID No. 14 or SEQ ID No. 54 to SEQ ID No. 57 and at least one of the sequences selected from the group consisting of the sequences SEQ ID No. 15 to SEQ ID No. 21 or SEQ ID No. 58 to SEQ ID No. 61.

According to an advantageous embodiment of the said strain, it comprises the sequences SEQ ID No. 50, SEQ ID No. 54, SEQ ID No. 58; this strain has been called BCF09.

According to another advantageous embodiment of the said strain, it comprises the sequences SEQ ID No. 51, SEQ ID No. 55, SEQ ID No. 59; this strain has been called BCF12.

According to yet another advantageous embodiment of the said strain, it comprises the sequences SEQ ID No. 52, SEQ ID No. 56, SEQ ID No. 60; this strain has been called BCF13.

According to yet another advantageous embodiment of the said strain, it comprises the sequences SEQ ID No. 53, SEQ ID No. 57, SEQ ID No. 61; this strain has been called BCF14.

According to another advantageous embodiment of the said strain, it comprises the sequences SEQ ID No. 7, SEQ ID No. 14, SEQ ID No. 21; this strain has been called BCF11.

According to yet another advantageous embodiment of the said strain, it comprises the sequences SEQ ID No. 4, SEQ ID No. 11, SEQ ID No. 18; this strain has been called BCF06.

The subject of the invention is also the use of the sequences described above for carrying out a process of hybridization or gene amplification of nucleic sequences of the HIV-1 type, these processes being applicable to the in vitro diagnosis of the potential infection of an individual with an HIV-1 type virus, including group O.

This in vitro diagnostic method is carried out using a biological sample (serum, circulating lymphocytes) and comprises:

a step of extracting the nucleic acid to be detected, belonging to the genome of the HIV-1 type virus, which may be present in the biological sample and, where appropriate, a step of treating the nucleic acid with the aid of a reverse transcriptase, if the latter is in RNA form,

at least one cycle comprising the steps of denaturation of the nucleic acid, annealing with at least one sequence in accordance with the invention and extension of the hybrid formed, in the presence of the appropriate reagents (polymerizing agent such as DNA polymerase and dNTP), and

a step of detecting the possible presence of the nucleic acid belonging to the genome of a group O HIV-1 type virus (group specificity).

The subject of the invention is also a peptide characterized in that it is expressed by a nucleotide sequence as defined above.

Among these peptides, there may be mentioned in particular:

those expressed by the C2V3-env gene fragment in accordance with the invention: SEQ ID No. 26 (BCF02 (ESS)), SEQ ID No. 27 (BCF01 (FAN)), SEQ ID No. 28 (BCF01 (FAN)), SEQ ID No. 29 (BCF06 (LOB)), SEQ ID No. 30 (BCF07 (MAN)), SEQ ID No. 31 (BCF11 (NAN)), SEQ ID No. 32 (BCF08 (NKO)), SEQ ID No. 33 (BCF08 (NKO)), SEQ ID No. 34 (BCF03 (POC)), SEQ ID No. 35 (BCF03 (POC)), SEQ ID No. 62 (BCF09), SEQ ID No. 63 (BCF12), SEQ ID No. 64 (BCF13), SEQ ID No. 65 (BCF14),

those expressed by the gp41 env gene fragment in accordance with the invention: SEQ ID No. 36 (BCF02 (ESS)), SEQ ID No. 37 (BCF01 (FAN)), SEQ ID No. 38 (BCF06 (LOB)), SEQ ID No. 39 (BCF07 (MAN)), SEQ ID No. 40 (BCF08 (NKO)), SEQ ID No. 41 (BCF03 (POC)), SEQ ID No. 42 (BCF11 (NAN)), SEQ ID No. 66 (BCF09), SEQ ID No. 67 (BCF12), SEQ ID No. 68 (BCF13), SEQ ID No. 69 (BCF14),

those expressed by the gag gene fragment in accordance with the invention: SEQ ID No. 43 (BCF02 (ESS)), SEQ ID No. 44 (BCF01 (FAN)), SEQ ID No. 45 (BCF06 (LOB)), SEQ ID No. 46 (BCF07 MAN)), SEQ ID No. 47 (BCF11 (NAN)), SEQ ID No. 48 (BCF08 (NKO)), SEQ ID No. 49 (BCF03 (POC)), SEQ ID No. 70 (BCF09), SEQ ID No. 71 (BCF12), SEQ ID No. 72 (BCF13), SEQ ID No. 73 (BCF14).

The subject of the invention is also immunogenic compositions comprising one or more products of translation of the nucleotide sequences according to the invention or a fragment thereof and/or at least one of the peptides as defined above.

The subject of the invention is also the antibodies directed against one or more of the peptides described above and their use for carrying out methods of in vitro diagnosis of the infection of an individual with an HIV-1 type virus, according to processes known to persons skilled in the art.

By way of illustration, such an in vitro diagnostic method according to the invention comprises bringing a biological sample collected from a patient into contact with antibodies according to the invention, and detecting, with the aid of any appropriate process, in particular with the aid of anti-labelled immunoglobulins, the immunological complexes formed between the antigens of the HIV-1 type viruses which may be present in the biological sample and the said antibodies.

The subject of the present invention is also a process for screening and typing group O HIV-1, characterized in that it comprises bringing any of the nucleotide fragments in accordance with the invention into contact with the nucleic acid of the virus to be typed and detecting the hybrid formed.

In addition to the preceding arrangements, the invention further comprises other arrangements, which will emerge from the description which follows, which refers to examples for carrying out the process which is the subject of the present invention as well as to the accompanying drawings, in which:

FIG. 1 represents the compared sequences of amino acids expressed by the env C2V3 gene fragment;

FIG. 2 represents the compared sequences of amino acids expressed by the gag gene fragment;

FIG. 3 illustrates the results obtained with the 7 strains BCF02 (ESS), BCF01 (FAN), BCF07 (MAN), BCF11 (NAN), BCF08 (NKO), BCF03 (POC) and BCF06 (LOB) on agarose gel, of a PCR carried out with the abovementioned C2V3 primers;

FIG. 4 illustrates the results obtained with the 7 strains BCF02 (ESS), BCF01 (FAN), BCF07 (MAN), BCF11 (NAN), BCF08 (NKO), BCF03 (POC) and BCF06 (LOB) on agarose gel, of a PCR carried out with the abovementioned Gag primers;

FIG. 5 represents the markers used in FIGS. 3 and 4 ;

FIG. 6 illustrates the reactivity of the sera corresponding to the strains according to the invention, relative to the phenetic organization of these variants;

FIG. 7 illustrates a phylogenetic analysis based on the gag region.

It should be understood, however, that these examples are given solely by way of illustration of the subject of the invention and do not in any way constitute a limitation thereto.

EXAMPLE 1

Production of the Sequences in Accordance with the Invention

Patients

Seven Cameroonian patients, consulting or hospitalized in Paris hospitals are included in this study.

At the time of diagnosis of the seropositive state, four patients are at the AIDS stage (CDC IVA n=1, CDC IVC1 n=3) and 3 patients are asymptomatic (CDC LI). The age group varies between 22 and 44 years for the symptomatic patients and it ranges between 22 and 68 years for the asymptomatic patients.

Four patients have a CD4+ level<200×10 6 /μl (10, 19, 91, 97), 2 patients have CD4+ levels of between 200 and 500×10 6 /μl (384, 420) and one patient has CD4+ levels>500×10 6 /μl (575).

Cultures

Ten to twenty ml of total blood for these 7 patients were collected over lithium heparin. The peripheral blood mononuclear cells (PBMC) are isolated on a Ficoll-Hypaque centrifugation gradient (Pharmacia). The cellular pellet obtained is washed twice with RPMI 1640 and resuspended in culture medium at a concentration of 2×10 6 cells/ml. This culture medium contains RPMI 1640 supplemented with 20% foetal calf serum, 10% human interleukin, 150 μg/ml of streptomycin, 250 units/ml of penicillin G and 5% L-glutamin. One million of the patient's cells is cocultured in duplicate with one million cells from donors stimulated with PHA in 24-well culture plates (Costar). The culture medium is changed twice per week, and 3×10 5 donor cells are added to each well on d7, d14 and d21.

The viral replication is monitored in the culture supernatants for 28 days, simultaneously by a microtechnique (measurement of the reverse transcriptase activity) and the detection of the p24 antigen (ELAVIA® p24 Ag, Sanofi-Diagnostic Pasteur). The positive-culture supernatants are collected and kept at −80° C. for the reinoculations.

Preparation of the DNA

A PCR is carried out using the DNA of fresh lymphocytes extracted from a patient or of lymphocytes, after 6 days of coculture or plasma after RT. Using 100 μl of a reaction mixture, containing Tris-HCl 10 mmol/l pH 8.3, KCl 50 mmol/l, MgCl 2 2 mmol/l, 0.2 mmol/l of each dNTP, 40 pmol of each primer, 2.5 U of Taq polymerase (Perkin Elmer Cetus, St Quentin Yvelines, France) and 1 μg of cellular DNA. The primers used are those specified above, namely:

* sequences gag:

GAG/5′CAM: CAGGGACAAATGGTACATCA (positions 1250-1269) (SEQ ID No. 74); GAG/3′CAM: AGTAGCTTGCTCAGCTCTTAAT (positions 1768-1747) (SEQ ID No. 75)

* sequences gp41

gp41/5′CAM-1: AGRGAAAAAAGAGCAGTAGGAT (positions 7800-7821) (SEQ ID No. 22)

gp41/5′CAM-2: TCTAAGTGCAGCAGGTAGCACTAT (positions 7843-7866) (SEQ ID No. 23)

gp41/3′CAM-2: CTAAGTTGCTCAAGAGTGGTA (positions 8594-8573) (SEQ ID No. 24)

gp41/3′CAM-1: GTTGCTCAAGAGGTGGTAAGT (positions 8590-8570) (SEQ ID No. 25)

* or alternatively one of the following sequences: SEQ ID No. 76 and SEQ ID No. 77 for the env region and SEQ ID No. 74 and SEQ ID No. 75 for the gag region, corresponding respectively to nucleotides 6991-7012, 7421-7396 and 1250-1269, 1768-1747 of the HIV1 Ant70 sequence.

The samples are subjected to 40 amplification cycles, each cycle comprising the following three steps: denaturation at 94° C. for one minute, annealing of the primers at 50° C. for the gag sequence and at 55° C. for the env sequence, for one minute and extension at 72° C. for one minute. During the first cycle, the denaturation is carried out for 4 minutes and for the last cycle, the extension is carried out for 5 minutes. The amplified products are subjected to enzymatic digestion (Xho1, EcoR1), purified and cloned into a vector M13mp18, digested with the restriction enzymes Sal1 and EcoR.

For each patient, between 3 and 4 clones are sequenced (Applied 373A sequencer), in a 406-bp region of the gag gene, in a 320-bp region of the env gene included in the V3 region and at the level of the region encoding gp41.

EXAMPLE 2

Imunodotection of a Group O HIV-1

ELISA tests are carried out in microtitre plates (Falcon 3912, microtest III®, Becton Dickinson).

The wells are covered with 100 μl of one of the V3 peptides defined above: BCF08 (NKO): R T I Q E I H S G P M A W Y S L G L K R N T T V R (SEQ ID No. 33); BCF01 (FAN): R S V Q E M K I G P L S W Y S M G L A A N S S I K (SEQ ID No. 28); BCF03 (POC): R I K Q I G I G P M S V Y S G S L A D L G N N N (SEQ ID No. 35), diluted to 10 μg.ml −1 in a 0.05 M carbonate buffer pH 9.6 by overnight incubation, at +4° C.

The plates are then washed three times with a PBS buffer containing Tween® 20 (Prolabo, France), (PBS-Tween®) 0.1%, and then they are saturated with PBS, which is supplemented with 1% milk (Gloria Co., France), for 1 h at 37° C.

Sera (1/100), diluted in a PBS-milk mixture containing Tween® 20 at 0.1% (PBS-milk-Tween ), are incubated for 2 h at 37° C.

After three washes, anti-human polyvalent antibodies, conjugated with alkaline phosphatase (Sigma), diluted 1:10,000 in PBS-milk-Tween, are added and incubated for 1 h at 37° C. After the last wash, the coloured reaction is developed at 37° C., with an alkaline phosphatase substrate, p-nitrophenylphosphate (Sigma), diluted in a 0.05 M carbonate buffer pH 9.5, containing 2 mM MgCl 2 , in order to obtain a concentration of 1 mg.ml −1 . The absorbance, measured at 405 nm (A 405 ) is recorded with an apparatus (MR 5000, Dynatech). A cut-off is determined for each serum tested and corresponds to three times the A 405 value obtained with the peptide E19S, derived from Plasmodium malariae.

Table 1 below shows the results obtained.

The consensus and FR 15-1 sequences correspond to those obtained from the B subtype, found in France.

	Seronegative and seropositive African patients (group M)
Peptides/Serum	8189	8362	8364	8365	8366	8370	8429	8499	8503	8116	8122	8186	3171
HIV Serology	−	−	−	−	−	−	+	+	+	+	+	+	+
Neg	0.129	0.319	0.158	0.158	0.328	0.152	0.17	0.157	0.28	0.201	0.14	0.171	0.17
CONS							1.46		0.65	2.52	1.72	1.92
FR15-1							2.64		1.04	2.77	2.3	2.86
MVP5180
ANT70
BCF08 (NKO)
BCF01 (FAN)
BCF03 (POC)
	Group O patients
	Peptides/Serum	BCF06	BCF07	BCF01	BCF03	BCF09	VAU	BCF08	Neg	Blan
	HIV Serology	+	+	+	+	+	+	−
	Neg	0.299	0.175	0.197	0.257	0.146	0.181	0.327	0.193	0.127
	CONS							0.72
	FR15-1							0.67
	MVP5180		0.76
	ANT70		>3	1.83			0.5
	BCF08 (NKO)	0.68	1.76	1.16
	BCF01 (FAN)	1.08	2.28	1.51		0.68	0.59
	BCF03 (POC)
Only the results greater than twice the background have been kept
Sequence of the peptides
Consenus	NTRKSINIGPGRAFYATGEII
FR 15-1	NTRKGINIGPGRAFYTTGEII
MVP5180	REVQDIYTGPMRWRSMTLKRSNNTS
ANT70	RDIQEMRIGPMAWYSMGIGGTAGNS
BCF08 (NKO)	RTIQEIHSGPMAWYSLGLKRNTTVR
BCF01 (FAN)	RSVQEMKIGPLSWYSMGLAANSSIK
BCF03 (POC)	RIKQIGIGPMSVYSGSLADLGNNN

This Table I shows the specificity of :he peptides according to the invention.

EXAMPLE 3

Serotype, Phenotype and Genotype Characteristics of the Strains According to the Invention

These characteristics are illustrated in Tables II and III below.

	TABLE II
	SEROTYPE	PHENOTYPE
	Antigen E1A	V3	Sensitivity to antiviral agents
	HIV-1	ANT70	TIBO	DELA-	SAQUINA-
	1	2	3	4	5	6	7	RO82913	VERDINE	VIR
BCF01	−	+	+	+	+	+	+	R	R	R
BCF02	−	−	−	−	−	+	+	R	R	S
BCF03	+	−	+	+	−	−	−	R	R	S
BCF06	+	−	+	+	+	±	+	R	R	S
BCF07	+	−	−	+	+	+	+	R	R	S
BCF08	+	−	+	+	+	−	±	R	R	S
BCF11	+	−	+	+	+	+	±	R	S	R
VAU	+	−	+	+	+	+	+	S	S	S
1 Test WELLCOME competition HIV-1
2 Test CLONATEC indirect HIV-1/2
3 Test ABBOTT 3rd
4 Test WELLCOME 3rd
5 Test BOEHRINGER
6 EIA ANT70 V3
7 Dot blot ANT70 V3 INNOLIA
R: Resistant
S: Sensitive

	TABLE III
	PHENOTYPE	GENOTYPE
	on MT2 cells	PCR
	SI/NSI	p24	ROCHE	V3 LOOP SUMMIT
BCF01	NSI	+	−	K	I	G	P	L	S	W
BCF02	NSI	+	−	R	I	G	P	M	A	W
BCF03	SI	+	−	G	I	G	P	M	S	V
BCF06	NSI	+	−	A	T	G	P	L	R	W
BCF07	NSI	+	−	K	I	G	P	M	A′	W
BCF08	NSI	+	−	H	S	G	P	M	A	W
BCF11	NSI/NR	−	−	G	I	G	P	L	S	W
VAU	Not	Not	Not	M	A	G	P	M	A	W
	tested	tested	tested
SI: Induction of syncytia on MT2 cells
NSI: No induction of syncytia on MT2 cells
NR: Non-replicative
p24: Production (+) or absence (−) of p24 antigen on cultures of MT2 cells

Serotype analysis on a set of commercialized tests (Table II) (with the exception of Test No. 6, EIA Ag V3 ANT70, non-commercialized research product) reveals the great diversity of antibody response towards the subtype B antigens which dominate in the west and relative to the antigen of the V3 loop of the ANT70 strain. The sera, corresponding to each of the isolates according to the invention, exhibit a unique and characteristic profile. BCF 01 is the only one positive on Test 2 (Clonatec®). BCF 02 is completely negative on the subtype B antigens. BCF 03, conversely, reacts with subtype B but is negative on the ANT70 antigens. BCF 07 is the only one negative on Tests No. 2 (Clonatec) and No. 3 (Abbott 3rd), but reactive on all the other tests with group M antigen. BCF 08 is strictly negative on the EIA V3 ANT70 test but, like BCF 11, is weakly reactive on this antigen by Test 7 (InnoLIA). By comparison, the serum corresponding to the VAU strain, which has been molecularly characterized by CHARNEAU et al. (Virology, 1994, 205, 247-253), is positive on all these antigens with the exception of Test 2 (Clonatec®). This diversity in antibody response should be interpreted as a reflection of the antigenic diversity of these strains. A link with immunodepression is excluded, the patients BCF 07, 08 and 11 being completely asymptomatic with a CD4 number>400/ml. FIG. 6 indicates the reactivity of the sera corresponding to the strains according to the invention relative to the phenetic organization of these variants.

The phenotype characterization of the isolates according to the invention shows the importance and the need to have a large number of sensitive reagents. All are naturally resistant to the molecule Tibo Ro82913 (Table III) as already reported for HIV-2. An absence of an in vitro growth-inhibiting activity outside a treatment with Ro82913 has never been reported for HIV-1 before. In contrast, the VAU strain is perfectly sensitive to Ro82913.

The strains are also resistant to another non-nucleoside inhibitor, Delaverdine, with the exception of the BCF 11 strain, which is sensitive.

Conversely, this strain is resistant to Saquinavir, an anti-protease, whereas the other strains are sensitive to it.

This diversity in response to the anti-retroviral agents reinforces the notion of a high dispersion right inside the Cameroon variants.

Furthermore, the results of syncytia formation on the continuous line MT2 complicates any classification since there is no correlation with the preceding serotype or genotype results and no relationship with the clinical stage. These strains do not induce syncytial formation whereas the detection of p24 antigen in the supernatants confirms the replication on this line.

Finally, at the genotype level, all the amplifications of the genomes of the strains according to the invention are negative by PCR using a kit marketed by Roche Diagnostics, which uses primers and probes corresponding to a conserved region of the HIV-1 Gag gene; a negative result was also possible for this test in the HIV-1 A subtypes (LOUSSERT-AJAKA et al., 1995, Lancet, 346, 912-913; LOUSSERT-AJAKA et al., 1995, 346, 1489). This negative result within variant isolates from Cameroon but also within the A subtypes reinforces this notion of high HIV-1 variability and shows the need for the detection of the HIV-1 nucleic acids, to use a large panel of sequences and in particular those according to the present invention.

FIGS. 6 and 7 correspond to a phylogenetic analysis based on the gag region.

The phylogeny of the gag genes confirms the dispersion of these variants and the difficulty in regrouping them either into subtype, or even into an exclusion group and shows the need for a selection of variants exhibiting particular phenetic and genetic characters and whose corresponding sera have characteristic reactivity and non-reactivity profiles capable of allowing the detection of HIV-1 in sera previously considered to be false-negative.

As evident from the above, the invention is not at all limited to its embodiment, implementation and application which have just been defined more explicitly; it embraces, on the contrary, all the variants which may occur to a specialist in this field, without departing from the framework or the scope of the present invention.

81 291 base pairs nucleic acid single linear DNA (genomic) not provided 1GTGGTTACTT GTACACATGG CATCAAGCCA ACAGTAAGTA CTCAGCTAAT ATTAAATGGA 60ACACTCTCAG AAGGAAAGAT AAGAATGATG GCAAAAAATA TTTCGGATAG TGGCCAAAAT 120ATCATAGTGA CCCTAAATAC TACTATAAAC ATGACCTGCC AGAGACCAGG ACATCAAACA 180GTACAAGAGA TAAGGATAGG TCCAATGGCC TGGTACAGCA TGGGCTTAGC GGCAGGAAAC 240GGATCTGAGT CAAGAAGAGC TTATTGTGAA TATAATACCA CTAATTGGAT A 291 294 base pairs nucleic acid single linear DNA (genomic) not provided 2GTAGTTACTT GTACACATGG CATCAAGCCA ACAGTGAGTA CTCATCTAAT ATTAAATGGG 60ACAATCTCTG AAGGAGAAAT AAGAATTATG GGAAAAAATA TTCGGGAAAA TGCTAAAAAT 120ATCATAGTGA CCCTAAATTC TACTATAAAC ATGACCTGTG AGAGACCAGA GGGAAATCTG 180ACAATACAAG AGATACACTC AGGACCAATG GCCTGGTACA GCTTGGGACT AAAGAGAAAT 240ACAACCGTAA GATCAAGATC AGCTCATTGC AAGTATAACA CCACTAATTG GGAA 294 297 base pairs nucleic acid single linear DNA (genomic) not provided 3GTGGTTACTT GTACACATGG CATCAAGCCA GCAGTAAGTA CTCAGCTAAT ATTAAATGGG 60ACACTCTCTA AAGGAAAAAT AAGAATTATG GCAAAAAATA TTACAAACAC TGGGAATAAT 120ATCATAGTGA CTCTAAATTC CACCATAAAC ATAACCTGTA ACAGACCAGG AAGGGGAATA 180AAACAGATAG GTATAGGTCC AATGTCCGTA TACAGCGGGA GCTTAGCGGA CTTAGGGGGA 240AACAACAACT CAAGGATAGC TTATTGCGAT TATGACATCA CTAAGTGGAA CGAAACA 297 294 base pairs nucleic acid single linear DNA (genomic) not provided 4GTAGTTACTT GTACACATGG CATCAAGCCA ACAGTAAGTA CTCAATTAAT AATGAATGGG 60ACACTCTCTA GAGGGAAGAT AAGAATTATG GGAAGAAATA TTACAGACAA TACAAAGAAT 120ATTATAGTAA CCTTAAACAC TTCTATAAAC ATGACATGTA TGAGAAAAGG AAGAGGTAAA 180ATACAAAGGA TAGCGACAGG TCCACTGCGA TGGGTCAGTA TGGCAGCTAA AACAGAGTCA 240CAGAACACAG GGTCAAGGAT AGCTTATTGT ATGTATAATA ACACTGAATG GATA 294 291 base pairs nucleic acid single linear DNA (genomic) not provided 5GTGGTTACTT GTACACATGG CATCAAGCCA ACAGTAAGTA CTCAGCTAAT ATTAAATGGA 60ACACTCTCGA AAGGAAAGAT AAGACTGATG GCAAAAAATA TTTCGGATAG TGGCCAAAAT 120ATCATAGTGA CCCTAAATAC TACTATAAAC ATGACCTGCC ATAGACCAGG AAATCTAAAA 180GTACAGGAGA TAAAGATAGG TCCAATGGCC TGGTACAGCA TGGGCATAGA GAATGAAAAC 240ATACCTGATT CAAGAAAAGC TTATTGTGAT TATAATACCA CTAAGTGGGT A 291 291 base pairs nucleic acid single linear DNA (genomic) not provided 6GTAGTTACTT GTACACATGG CATCAAGCCC ACAGTGAGTA CTCAACTGAT ATTAAATGGG 60ACACTCTCTG AAAAGGGAAT AAGAATTATG GGAAAAAACA TTTCAAAAAC TGGGGAAAAT 120ATCATAGTGA CCCTAAATGT AAGCATAAAC ATTACTTGTC ATAGACCAGG AAATCTGTCA 180GTACAAGAGA TGAAAATAGG TCCACTGTCC TGGTACAGCA TGGGCCTAGC GGCAAACTCA 240AGCATAAAGT CAAGGGTAGC TTATTGCAAT TATAGTACCA CTGAATGGAC A 291 296 base pairs nucleic acid single linear DNA (genomic) not provided 7GTGGTTACTT GACACATGGC ATCAAGCCAG CAGTAAGTAC TCAACTAATA CTAAATGGGA 60CACTCTCTGA AGGGAAGATA AGAATTATGG GACAAAATAT CTCTGACAGT GGAAAGAATA 120TCATAGTAAC CCTAAATAAG ACTGTAAACA TGAACATAAC CTGCACAAGA GATGGAGATC 180AGAAGGTACA AGAGATAGGG ATAGGTCCAC TGTCATGGTA CAGTATGAGC ATTGCAGAAG 240ACAGCGCTAA AAACACAAGA GCAGCTTATT GTAACTATAG TGCAAGTAGT TGGAAG 296 120 base pairs nucleic acid single linear DNA (genomic) not provided 8AGACAACTCC GAGCTCGCCT GCTAGCCTTA GAAACCTTAA TACAGAATCA GCAACTCCTA 60AACTCGTGGG GCTGTAAGGG AAGGATAGTC TGCTACACAT CAGTAAAATG GAACTGGACA 120 120 base pairs nucleic acid single linear DNA (genomic) not provided 9AGACAACTCC GAGCTCGCCT GCTAGCCTTA GAAACCTTAA TACAGAATCA GCAACTCCTA 60AACCTATGGG GCTGTAAGGG AAGGCTACTC TGCTACACAT CAGTAAAATG GAATACGACA 120 120 base pairs nucleic acid single linear DNA (genomic) not provided 10AGACAACTCC GAGCTCGCCT GCAAGCCTTA GAAACCTTAA TCCAGAATCA GCAACTCCTA 60AGCCTGTGGG GCTGTAAAGG AAGGCTAGTC TGCTACACAT CAGTAAAATG GCACAACACA 120 120 base pairs nucleic acid single linear DNA (genomic) not provided 11AGACAACTCC GAGCTCGCCT GCAAGCCTTA GAACCCCTTA TACAGAATCA GCAACGCCTA 60AGCCTATGGG GATGTAAGGG AAGGATAATA TGTTACACAT CAGCAAAATG GAACAACACA 120 120 base pairs nucleic acid single linear DNA (genomic) not provided 12AGACAACTCC GAGCTCGCCT GCTAGCCTTA GAAACCTTAA TACAGAATCA GCAACTCCTA 60AACTCATGGG GCTGTAAGGG AAGGCTAGTC TGTTACACAT CAGTAAAATG GAACGAGACA 120 120 base pairs nucleic acid single linear DNA (genomic) not provided 13AGACAACTCC GAGCTCGCCT GCTAGCCTTA GAAACCTTGA TACAGAATCA GCAACTCCTA 60AACCTATGGG GCTGTAAGGG AAGGCTACTC TGCTACACAT CAGTAAAATG GAACAGTACA 120 120 base pairs nucleic acid single linear DNA (genomic) not provided 14AGACAACTCC GAGCTCGCCT GGTTGCCTTA GAAACCCTTG TACAGAATCA GCAACTCCTA 60AACCTATGGG GCTGTAAAGG AAGACTAACA TGCTATACAT CAGTAAAATG GAATGACACA 120 399 base pairs nucleic acid single linear DNA (genomic) not provided 15CCCATTTCTC CTAGAACTTT AAATGCATGG GTAAAGGCAG TAGAAGAGAA AGCCTTTAAC 60CCTGAAATCA TTCCTATGTT CATGGCATTG TCAGAGGGAG CTGTTCCCTA TGATATTAAT 120ACTATGCTAA ATGCCATAGG AGAACATCAA GGGGCTTTAC AAGTGCTAAA GGAAGTAATC 180AATGAGGAAG CATTGGAGTG GGATAGAACT CACCCACCAC CGATAGGGCC GTTACCACCA 240GGGCAGATAA GGGACCCAAC AGGAAGTGAC ATTGCTGGAA CAACTAGCAC TCAGCAAGAG 300CAAGTTCACT GGGTGACCAG GAACCCCAAC CCTATCCCAG TAGGAGACAT CTATTGGAAA 360TGGATAGTGT TTGGGCTTAA CAAATTGGTT AAAATGTAC 399 399 base pairs nucleic acid single linear DNA (genomic) not provided 16CCCCTCTCCC CCAGGACTTT AAATGCATGG GTAAAGGCAG TAGAAGAAAA AGCCTTTAAC 60CCTGAGATCA TTCCTATGTT CATGGCATTG TCAGAGGGAG CTATTCCCTA TGATATTAAT 120ACTATGCTAA ATGCCATAGG AGGACATCAA GGAGCCCTAC AAGTGCTAAA GGAAGTAATC 180AATGAGGAAG CAGCAGATTG GGATAGAACT CACCCGCCAC CGATAGGGCC ATTACCACCA 240GGGCAGATAA GGGAACCAAC AGGAAGTGAC ATTGCTGGGA CAACTAGCAC CCAGCAAGAG 300CAAGTTCACT GGATTACCAG AGCCAACCAA TCTATCCCAG TAGGAGACAT CTATAGAAAA 360TGGATAGTGT TAGGACTAAA CAAAATGGTA AAAATGTAC 399 399 base pairs nucleic acid single linear DNA (genomic) not provided 17CCCCTCTCCC CCAGGACTCT AAATGCATGG GTAAAGGCAG TAGAAGAAAA AGCCTTTAAC 60CCTGAAATCA TTCCTATGTT CATGGCATTG TCAGAGGGAG CAATTCCCTA TGATATTAAT 120ACTATGCTAA ATGCCATAGG AGGACATCAA GGAGCTTTAC AAGTGTTAAA GGAAGTAATC 180AATGAGGAAG CATCAGATTG GGATAGAACT CACCCACCAC CGATAGGGCC GCTGCCTCCA 240GGGCAAATAA GGGAACCAAC AGGAAGTGAC ATTGCTGGGA CAACTAGTAC CCAGCAAGAG 300CAAGTTCACT GGACTACCAG ACCCAATCAA CCTATCCCAG TAGGAGACAT CTATAGAAAA 360TGGATAGTGT TAGGACTAAA CAAAATGGTA AAAATGTAC 399 399 base pairs nucleic acid single linear DNA (genomic) not provided 18GCCCTCTCCC CCAGGACGTT AAATGCATGG GTAAAGGCAG TAGAAGAAAA GGCCTTTAAC 60CCTGAAATTA TTCCTATGTT TATGGCATTA TCAGAAGGAG CTGTTCCCTA TGATATCAAT 120ACCATGCTAA ATGCCATAGG AGGACACCAA GGGGCTTTAC AAGTGTTGAA GGAAGTAATC 180AATGAGGAAG CAGCAGAATG GGATAGAACT CATCCACCAG CAATGGGGCC GTTACCACCA 240GGGCAGCTAA GAGATCCAAC AGGAAGTGAC ATTGCTGGAA CAACTAGCAC ACAGCAAGAG 300CAAATTAACT GGATTACTAG ACCAAATAAC CCTGTCCCTG TAGGAGACAT CTATAGAAAA 360TGGATAGTGC TAGGATTAAA TAAAATGGTA AAGTTGTAC 399 399 base pairs nucleic acid single linear DNA (genomic) not provided 19GCCCTTTCCC CTAGAACTTT AAATGCATGG GTAAAGGCAG TAGAAGAAAA AGCCTTTAAC 60CCTGAAATCA TTCCTATGTT CATGGCATTG TCAGAGGGAG CTATTTCCTA TGACATTAAT 120ACTATGCTAA ATGCCATAGG AGGACATCAA GGGGCTTTAC AAGTGCTAAA GGAAGTAATC 180AATGAGGAAG CAGCAGAGTG GGATAGAACT CACCCAATAC CGGTAGGGCC GTTACCACCA 240GGGCAGATAA GGGACCCAAC AGGAAGTGAC ATTGCTGGGA CAACTAGCAC CCAGCAAGAA 300CAAGTTCACT GGACAACCAG ACCCAACAAC CCTATCCCAG TAGGAGACAT CTATAGGAAA 360TGGATAGTGT TGGGGCTTAA CAAAATGGTA AAAATGTAC 399 399 base pairs nucleic acid single linear DNA (genomic) not provided 20GCTATCTCCC CCAGGACTTT AAATGCATGG GTAAAGGCAG TAGAAGAGAA GGCCTTTAAC 60CCTGAAATCA TTCCTATGTT CATGGCATTG TCAGAGGGAG CTATTCCCTA CGATATTAAT 120ACCATGCTAA ATGCCATAGG AGGACATCAA GGAGCCTTGC AGGTGCTAAA GGAAGTAATC 180AATGATGAAG CAGCAGATTG GGATAGAACT CACACACCAC CGGTAGGGCC GTTGCCACCA 240GGGCAGATAA GGGAACCAAC AGGAAGTGAC ATTGCTGGGA CAACTAGCAC CCAGCAAGAG 300CAAGTTCATT GGATTACTAG GCCCAACAAC CCTATCCCAG TAGGAGACAT CTATAGAAAA 360TGGATAGTGT TAGGGTTAAA CAAAATGGTA AAAATGTAC 399 399 base pairs nucleic acid single linear DNA (genomic) not provided 21GCCCTCTCCC CCAGGACTTT AAATGCATGG GTAATAGCAG TAGAAGAGAA AGCCTTTAAC 60CCTGAAATTA TTCCTATGTT TATGGCATTA TCAGAAGGAG CTGTTCCCTA TGATATCAAT 120ACCATGCTAA ATGCCATAGG AGGACACCAG GGGGCTTTAC AAGTGTTGAA GGAAGTGATC 180AATGAAGAAG CAGCAGATTG GGACAGAACT CATCCACCAC CAGTAGGGCC GTTACCACCA 240GGTCAGATAA GGGAACCAAC AGGGAGTGAT ATTGCTGGAA CCACTAGCAC ACAGCAAGAG 300CAAATTCACT GGATTACTAG GGGAGGTAAT TCTATCCCAG TAGGAGACAT ATATAGGAAA 360TGGATAGTGC TAGGATTAAA CAAAATGGTA AAAATGTAC 399 22 base pairs nucleic acid single linear other nucleic acid /desc = “PRIMER” not provided 22AGRGAAAAAA GAGCAGTAGG AT 22 24 base pairs nucleic acid single linear other nucleic acid /desc = “PRIMER” not provided 23TCTAAGTGCA GCAGGTAGCA CTAT 24 21 base pairs nucleic acid single linear other nucleic acid /desc = “PRIMER” not provided 24CTAAGTTGCT CAAGAGTGGT A 21 21 base pairs nucleic acid single linear other nucleic acid /desc = “PRIMER” not provided 25GTTGCTCAAG AGGTGGTAAG T 21 97 amino acids amino acid single linear protein not provided 26Val Val Thr Cys Thr His Gly Ile Lys Pro Thr Val Ser Thr Gln Leu1 5 10 15Ile Leu Asn Gly Thr Leu Ser Glu Gly Lys Ile Arg Met Met Ala Lys 20 25 30Asn Ile Ser Asp Ser Gly Gln Asn Ile Ile Val Thr Leu Asn Thr Thr 35 40 45Ile Asn Met Thr Cys Gln Arg Pro Gly His Gln Thr Val Gln Glu Ile 50 55 60Arg Ile Gly Pro Met Ala Trp Tyr Ser Met Gly Leu Ala Asn Gly Asn65 70 75 80Gly Ser Glu Ser Arg Arg Ala Tyr Cys Glu Tyr Asn Thr Thr Asn Trp 85 90 95Ile 97 amino acids amino acid single linear protein not provided 27Val Val Thr Cys Thr His Gly Ile Lys Pro Thr Val Ser Thr Gln Leu1 5 10 15Ile Leu Asn Gly Thr Leu Ser Glu Lys Gly Ile Arg Ile Met Gly Lys 20 25 30Asn Ile Ser Lys Thr Gly Glu Asn Ile Ile Val Thr Leu Asn Val Ser 35 40 45Ile Asn Ile Thr Cys His Arg Pro Gly Asn Leu Ser Val Gln Glu Met 50 55 60Lys Ile Gly Pro Leu Ser Trp Tyr Ser Met Gly Leu Ala Ala Asn Ser65 70 75 80Ser Ile Lys Ser Arg Val Ala Tyr Cys Asn Tyr Ser Thr Thr Glu Trp 85 90 95Thr 25 amino acids amino acid single linear peptide not provided 28Arg Ser Val Gln Glu Met Lys Ile Gly Pro Leu Ser Trp Tyr Ser Met1 5 10 15Gly Leu Ala Ala Asn Ser Ser Ile Lys 20 25 98 amino acids amino acid single linear protein not provided 29Val Val Thr Cys Thr His Gly Ile Lys Pro Thr Val Ser Thr Gln Leu1 5 10 15Ile Met Asn Gly Thr Leu Ser Arg Gly Lys Ile Arg Ile Met Gly Arg 20 25 30Asn Ile Thr Asp Asn Thr Lys Asn Ile Ile Val Thr Leu Asn Thr Ser 35 40 45Ile Asn Met Thr Cys Met Arg Lys Gly Arg Gly Lys Ile Gln Arg Ile 50 55 60Ala Thr Gly Pro Leu Arg Trp Val Ser Met Ala Ala Lys Thr Glu Ser65 70 75 80Gln Asn Thr Gly Ser Arg Ile Ala Tyr Cys Met Tyr Asn Asn Thr Glu 85 90 95Trp Ile 97 amino acids amino acid single linear protein not provided 30Val Val Thr Cys Thr His Gly Ile Lys Pro Thr Val Ser Thr Gln Leu1 5 10 15Ile Leu Asn Gly Thr Leu Ser Lys Gly Lys Ile Arg Leu Met Ala Lys 20 25 30Asn Ile Ser Asp Ser Gly Gln Asn Ile Ile Val Thr Leu Asn Thr Thr 35 40 45Ile Asn Met Thr Cys His Arg Pro Gly Asn Leu Lys Val Gln Glu Ile 50 55 60Lys Ile Gly Pro Met Ala Trp Tyr Ser Met Gly Ile Glu Ala Glu Asn65 70 75 80Ile Pro Asp Ser Arg Lys Ala Tyr Cys Asp Tyr Asn Ala Thr Lys Trp 85 90 95Val 99 amino acids amino acid single linear protein not provided 31Val Val Thr Cys Thr His Gly Ile Lys Pro Ala Val Ser Thr Gln Leu1 5 10 15Ile Leu Asn Gly Thr Leu Ser Glu Gly Lys Ile Arg Ile Met Gly Gln 20 25 30Asn Ile Ser Asp Ser Gly Lys Asn Ile Ile Val Thr Leu Asn Lys Thr 35 40 45Val Asn Met Asn Ile Thr Cys Thr Arg Asp Gly Asp Gln Lys Val Gln 50 55 60Glu Ile Gly Ile Gly Pro Leu Ser Trp Tyr Ser Met Ser Ile Ala Glu65 70 75 80Asp Ser Ala Lys Asn Thr Arg Ala Ala Tyr Cys Asn Tyr Ser Ala Ser 85 90 95Ser Trp Lys 98 amino acids amino acid single linear protein not provided 32Val Val Thr Cys Thr His Gly Ile Lys Pro Thr Val Ser Thr His Leu1 5 10 15Ile Leu Asn Gly Thr Ile Ser Glu Gly Glu Ile Arg Ile Met Gly Lys 20 25 30Asn Ile Arg Glu Asn Ala Lys Asn Ile Ile Val Thr Leu Asn Ser Thr 35 40 45Ile Asn Met Thr Cys Glu Arg Pro Glu Gly Asn Leu Thr Ile Gln Glu 50 55 60Ile His Ser Gly Pro Met Ala Trp Tyr Ser Leu Gly Leu Lys Arg Asn65 70 75 80Thr Thr Val Arg Ser Arg Ser Ala His Cys Lys Tyr Asn Thr Thr Asn 85 90 95Trp Glu 25 amino acids amino acid single linear peptide not provided 33Arg Thr Ile Gln Glu Ile His Ser Gly Pro Met Ala Trp Tyr Ser Leu1 5 10 15Gly Leu Lys Arg Asn Thr Thr Val Arg 20 25 99 amino acids amino acid single linear protein not provided 34Val Val Thr Cys Thr His Gly Ile Lys Pro Ala Val Ser Thr Gln Leu1 5 10 15Ile Leu Asn Gly Thr Leu Ser Lys Gly Lys Ile Arg Ile Met Ala Lys 20 25 30Asn Ile Thr Asn Thr Gly Asn Asn Ile Ile Val Thr Leu Asn Ser Thr 35 40 45Ile Asn Ile Thr Cys Asn Arg Pro Gly Arg Gly Ile Lys Gln Ile Gly 50 55 60Ile Gly Pro Met Ser Val Tyr Ser Gly Ser Leu Ala Asp Leu Gly Gly65 70 75 80Asn Asn Asn Ser Arg Ile Ala Tyr Cys Asp Tyr Asp Ile Thr Lys Trp 85 90 95Asn Glu Thr 24 amino acids amino acid single linear peptide not provided 35Arg Ile Lys Gln Ile Gly Ile Gly Pro Met Ser Val Tyr Ser Gly Ser1 5 10 15Leu Ala Asp Leu Gly Asn Asn Asn 20 40 amino acids amino acid single linear peptide not provided 36Arg Gln Leu Arg Ala Arg Leu Leu Ala Leu Glu Thr Leu Ile Gln Asn1 5 10 15Gln Gln Leu Leu Asn Ser Trp Gly Cys Lys Gly Arg Ile Val Cys Tyr 20 25 30Thr Ser Val Lys Trp Asn Trp Thr 35 40 40 amino acids amino acid single linear peptide not provided 37Arg Gln Leu Arg Ala Arg Leu Leu Ala Leu Glu Thr Leu Ile Gln Asn1 5 10 15Gln Gln Leu Leu Asn Leu Trp Gly Cys Lys Gly Arg Leu Leu Cys Tyr 20 25 30Thr Ser Val Lys Trp Asn Ser Thr 35 40 40 amino acids amino acid single linear peptide not provided 38Arg Gln Leu Arg Ala Arg Leu Gln Ala Leu Glu Pro Leu Ile Gln Asn1 5 10 15Gln Gln Arg Leu Ser Leu Trp Gly Cys Lys Gly Arg Ile Ile Cys Tyr 20 25 30Thr Ser Ala Lys Trp Asn Asn Thr 35 40 40 amino acids amino acid single linear peptide not provided 39Arg Gln Leu Arg Ala Arg Leu Leu Ala Leu Glu Thr Leu Ile Gln Asn1 5 10 15Gln Gln Leu Leu Asn Ser Trp Gly Cys Lys Gly Arg Leu Val Cys Tyr 20 25 30Thr Ser Val Lys Trp Asn Glu Thr 35 40 40 amino acids amino acid single linear peptide not provided 40Arg Gln Leu Arg Ala Arg Leu Leu Ala Leu Glu Thr Leu Ile Gln Asn1 5 10 15Gln Gln Leu Leu Asn Leu Trp Gly Cys Lys Gly Arg Leu Leu Cys Tyr 20 25 30Thr Ser Val Lys Trp Asn Thr Thr 35 40 40 amino acids amino acid single linear peptide not provided 41Arg Gln Leu Arg Ala Arg Leu Gln Ala Leu Glu Thr Leu Ile Gln Asn1 5 10 15Gln Gln Leu Leu Ser Leu Trp Gly Cys Lys Gly Arg Leu Val Cys Tyr 20 25 30Thr Ser Val Lys Trp His Asn Thr 35 40 40 amino acids amino acid single linear peptide not provided 42Arg Gln Leu Arg Ala Arg Leu Val Ala Leu Glu Thr Leu Val Gln Asn1 5 10 15Gln Gln Leu Leu Asn Leu Trp Gly Cys Lys Gly Arg Leu Thr Cys Tyr 20 25 30Thr Ser Val Lys Trp Asn Asp Thr 35 40 133 amino acids amino acid single linear protein not provided 43Pro Ile Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Val Pro Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Glu 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Leu Glu Trp Asp Arg Thr His Pro Pro Pro Ile Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Asp Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Val His Trp Val Thr Arg Asn Pro Asn Pro Ile 100 105 110Pro Val Gly Asp Ile Tyr Trp Lys Trp Ile Val Phe Gly Leu Asn Lys 115 120 125Leu Val Lys Met Tyr 130 133 amino acids amino acid single linear protein not provided 44Ala Ile Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Ile Pro Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Asp Glu Ala 50 55 60Ala Asp Trp Asp Arg Thr His Thr Pro Pro Val Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Glu Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Val His Trp Ile Thr Arg Pro Asn Asn Pro Ile 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Asn Lys 115 120 125Met Val Lys Met Tyr 130 133 amino acids amino acid single linear protein not provided 45Ala Leu Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Val Pro Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Ala Glu Trp Asp Arg Thr His Pro Pro Ala Met Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Asp Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Ile Asn Trp Ile Thr Arg Pro Asn Asn Pro Val 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Asn Lys 115 120 125Met Val Lys Leu Tyr 130 133 amino acids amino acid single linear protein not provided 46Ala Leu Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Ile Ser Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Ala Glu Trp Asp Arg Thr His Pro Ile Pro Val Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Asp Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Val His Trp Thr Thr Arg Pro Asn Asn Pro Ile 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Asn Lys 115 120 125Met Val Lys Met Tyr 130 133 amino acids amino acid single linear protein not provided 47Ala Leu Ser Pro Arg Thr Leu Asn Ala Trp Val Ile Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Val Pro Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Ala Asp Trp Asp Arg Thr His Pro Pro Pro Val Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Glu Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Ile His Trp Ile Thr Arg Gly Gly Asn Ser Ile 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Asn Lys 115 120 125Met Val Lys Met Tyr 130 133 amino acids amino acid single linear protein not provided 48Pro Leu Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Ile Pro Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Ala Asp Trp Asp Arg Thr His Pro Pro Pro Ile Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Glu Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Val His Trp Ile Thr Arg Ala Asn Gln Ser Ile 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Asn Lys 115 120 125Met Val Lys Met Tyr 130 133 amino acids amino acid single linear protein not provided 49Pro Leu Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Ile Pro Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Ser Asp Trp Asp Arg Thr His Pro Pro Pro Ile Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Glu Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Val His Trp Thr Thr Arg Pro Asn Gln Pro Ile 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Asn Lys 115 120 125Met Val Lys Met Tyr 130 282 base pairs nucleic acid single linear DNA (genomic) not provided 50TGTACACATG GCATCAAACC AACAGTGAGT ACTCACCTAA TATTAAATGG GACACTCTCT 60GAAGGAAAAA TAAGAATTAT GGGAAAAAAT ATCTCGGACA CTGGGAAAAA TATCATAGTG 120ACCCTAAATT CTACTATAAA CATAACCTGT GTGAGACCAT GGAATCAGAC AGTACAAACG 180ATAGGAATAG GACCAATGTC CTGGCTCAGC ATGGACATAA ATGCAGATAA AAACAATAAC 240TCAAGAATAG CTTATTGCGA GTATAACACC ACGGATTGGG AA 282 279 base pairs nucleic acid single linear DNA (genomic) not provided 51TGTACACATG GCATCAAGCC CACAGTGAGC ACCCACCTGA TATTAAATGG GACACTCTCT 60GAAGGAAAAA TAAGAATTAT GGGAAAAAAC ATTTCAGATA ATGCGAAAAA TATCATAGTG 120ACCCTAAAAC AGACTATAAG CATAACTTGT GAGAGACCAG GAAATCTTTC AGTACAAGAG 180ATAAAAATAG GTCCAATGGC CTGGTACAGC ATGGCCGTAG AGCAAGATAA GTCAACCTCC 240AGGACAGCTT ATTGCAAGTA TAATGTCACT AAGTGGAAA 279 282 base pairs nucleic acid single linear DNA (genomic) not provided 52TGTACACATG GCATCAAGCC AACAGTAAGT ACTCAGTTAA TATTAAATGG AACACTCTCG 60GAAGGAAAGA TAAGAATAAT GGCAAAAGAT ATTTTAAATA GTGGCAAAAA TATCATAGTG 120ACCCTAAATA CTACTGTAAA CATGACCTGC GTGAGACCAG GAAATATAAC AATACAAACG 180TTAAAGATAG GTCCACTGGC CTGGTACAGC ATGGACATAG CGAATGAAAA AGACCATAAG 240TCAAGAACAG CTTATTGTGA GTATAATACC ACTAATTGGG TA 282 279 base pairs nucleic acid single linear DNA (genomic) not provided 53TGTACACATG GCATCAAGCC AACAGTAAGT ACTCAGCTAA TATTAAATAG AACACTCTCG 60GAAGGAAAGA TAAAAATAAT GACAAAAAAT ATTTCGGAGA ATGGAAATAT TATAGTGACC 120CTAAATACTA CTATAAACAT GACCTGCGAG AGACCAGGAA ATCTATCAGT ACAAGAGATA 180AACATAGGTC CACTGGCCTG GTACAGCATG AGCATAAAGA ATGAAGGAAA AACTGAGTCA 240AGAGTAGCTT ATTGTGAGTA TAACAGCACT AATTGGGTA 279 120 base pairs nucleic acid single linear DNA (genomic) not provided 54AGACAACTCC GAGCTCGCCT GCTAGCCTTA GAAACCTTAA TACAGAATCA GCAACTCCTA 60AACCTATGGG GCTGTAAGGG AAGGCTGGTC TGTTACACAT CAGTAAAATG GAACATGTCA 120 120 base pairs nucleic acid single linear DNA (genomic) not provided 55AGACAACTCC GAGCTCGCCT GCTAGCCTTA GAAACCTTAA TACAGAATCA GCAACTCCTA 60AACCTATGGG GCTGTAAGGG AAGACTAATC TGCTACACAT CAGTAAAATG GAACTCGACA 120 119 base pairs nucleic acid single linear DNA (genomic) not provided 56AGACAACTCC GAGCTCGCCT GCTAGCCTTA GAAACCTTAA TACAGAATCA GCAACTCCTA 60AACTCGTGGG GCTGTTGGGA AGACTAGTCT GTTACACATC AGTAGAATGG AACTGGACA 119 120 base pairs nucleic acid single linear DNA (genomic) not provided 57AGACAACTCC GAGCTCGCCT GCTAGCCTTA GAAACCTTAA TTCAGAATCA GCAACTCCTA 60AACTCGTGGG GCTGTAAGGG AAGACAAGTC TGTTACACAT CAGTAAAATG GAACAATACA 120 399 base pairs nucleic acid single linear DNA (genomic) not provided 58GCCCTCTCCC CCAGGACTTT AAATGCATGG GTAAAGGCAG TAGAAGAAAA GGCCTTTAAC 60CCGGAAATCA TTCCTATGTT CATGGCATTG TCAGAGGGAG CTGTTCCCTA TGATATTAAT 120ACTATGCTAA ATGCCATAGG AGGACATCAA GGAGCATTAC AAGTGCTAAA AGAAGTAATC 180AATGAGGAAG CAGCAGAGTG GGATAGAACT CACCCACAAG CAGTAGGGCC ATTGCCACCA 240GGACAGATAA GGGAACCAAC AGGAAGTGAC ATTGCTGGAA CAACCAGTAC CCAGCAAGAG 300CAAATTCACT GGACTACCAG GGCCAACCCC CCTATCCCAG TAGGAGACAT CTATAGAAAA 360TGGATAGTGT TAGGGCTAAA CAAAATGGTA AAAATGTAC 399 399 base pairs nucleic acid single linear DNA (genomic) not provided 59GCCCTCTCCC CCAGGACTTT AAATGCATGG GTAAAGGCAG TAGAAGAAAA GGCCTTTAAC 60CCTGAAATCA TTCCTATGTT CATGGCATTA TCAGAGGGAG CTATTTCCTA TGATATTAAT 120ACCATGCTAA ATGCCATAGG AGGACATCAA GGGGCTCTAC AGGTGCTAAA GGAAGTAATC 180AATGAAGAAG CAGCAGATTG GGATAGAGCT CACCCACCAG TGGTAGGGCC GTTGGCACCA 240GGGCAGATGA GGGACCCAAC AGGAAGTGAC ATCGCTGGGA CAACTAGCAC CCAGCAAGAG 300CAAATTCATT GGACTACCAG GCCCAACAAC CCTATCCCAG TAGGAGACAT CTATAGAAAA 360TGGATAGTGT TAGGACTAAA CAAAATGGTA AAAATGTAC 399 397 base pairs nucleic acid single linear DNA (genomic) not provided 60GCCATTTCCC CTAGGACTTT AAATGCATGG GTAAAGGCAG TAGAAGAAAA AGCCTTTAAC 60CCTAAAATCA TTCCTATGTT CATGGCATTG TCAGAGGGAG CTGTTCCCTA TGATATTAAT 120ACTATGCTAA ATGCCATAGG AGGACATCAA GGGGCTTTAC AAGTGCTAAA GGAAGTAATC 180AATGAGGAAG CATCGGAGTG GGATAGAACT CACCCACCAC CGATAGGGCC GTTACCACCA 240GGCAGATAAG GGACCCAACA GGAAGTGACA TTGCTGGACA ACTAGCACCC AGCAAGAGCA 300AGTTCACTGG ATTACCAGGG CCCCCAACCC TATCCCAGTA GGAGACATCT ATAGAAAATG 360GATAGTGTTG GGACTAAACA AAATGGTAAA AATGTAC 397 399 base pairs nucleic acid single linear DNA (genomic) not provided 61GCCATTTCCC CTAGGACTCT AAATGCATGG GTAAAGGCAG TAGAAGAAAA GGCCTTTAAC 60CCTGAAATCA TTCCTATGTT CATGGCATTG TCAGAGGGAG CTATTCCCTA TGATATTAAT 120ACCATGCTAA ATGCCATAGG AGGACATCAA GGGGCTTTAC AAGTGCTAAA GGAAGTAATC 180AATGAGGAAG CATCAGAATG GGATAGAACT CACCCACAAC AGGCAGGGCC GTTACCACCA 240GGGCAGATAA GGGACCCAAC AGGAAGTGAC ATTGCTGGGA CAACTAGCAC CCAGCAAGAG 300CAAGTTCACT GGACTACCAG GGCCGCCAAC CCTATCCCAG TAGGAGACAT CTATAGAAAA 360TGGATAGTGT TGGGACTAAT CAAAATGGTA AAAATGTAC 399 94 amino acids amino acid single linear protein not provided 62Cys Thr His Gly Ile Lys Pro Thr Val Ser Thr His Leu Ile Leu Asn1 5 10 15Gly Thr Leu Ser Glu Gly Lys Ile Arg Ile Met Gly Lys Asn Ile Ser 20 25 30Asp Thr Gly Lys Asn Ile Ile Val Thr Leu Asn Ser Thr Ile Asn Ile 35 40 45Thr Cys Val Arg Pro Trp Asn Gln Thr Val Gln Thr Ile Gly Ile Gly 50 55 60Pro Met Ser Trp Leu Ser Met Asp Ile Asn Ala Asp Lys Asn Asn Asn65 70 75 80Ser Arg Ile Ala Tyr Cys Glu Tyr Asn Thr Thr Asp Trp Glu 85 90 93 amino acids amino acid single linear protein not provided 63Cys Thr His Gly Ile Lys Pro Thr Val Ser Thr His Leu Ile Leu Asn1 5 10 15Gly Thr Leu Ser Glu Gly Lys Ile Arg Ile Met Gly Lys Asn Ile Ser 20 25 30Asp Asn Ala Lys Asn Ile Ile Val Thr Leu Lys Gln Thr Ile Ser Ile 35 40 45Thr Cys Glu Arg Pro Gly Asn Leu Ser Val Gln Glu Ile Lys Ile Gly 50 55 60Pro Met Ala Trp Tyr Ser Met Ala Val Glu Gln Asp Lys Ser Thr Ser65 70 75 80Arg Thr Ala Tyr Cys Lys Tyr Asn Val Thr Lys Trp Lys 85 90 94 amino acids amino acid single linear protein not provided 64Cys Thr His Gly Ile Lys Pro Thr Val Ser Thr Gln Leu Ile Leu Asn1 5 10 15Gly Thr Leu Ser Glu Gly Lys Ile Arg Ile Met Ala Lys Asp Ile Leu 20 25 30Asn Ser Gly Lys Asn Ile Ile Val Thr Leu Asn Thr Thr Val Asn Met 35 40 45Thr Cys Val Arg Pro Gly Asn Ile Thr Ile Gln Thr Leu Lys Ile Gly 50 55 60Pro Leu Ala Trp Tyr Ser Met Asp Ile Ala Asn Glu Lys Asp His Lys65 70 75 80Ser Arg Thr Ala Tyr Cys Glu Tyr Asn Thr Thr Asn Trp Val 85 90 93 amino acids amino acid single linear protein not provided 65Cys Thr His Gly Ile Lys Pro Thr Val Ser Thr Gln Leu Ile Leu Asn1 5 10 15Arg Thr Leu Ser Glu Gly Lys Ile Lys Ile Met Thr Lys Asn Ile Ser 20 25 30Glu Asn Gly Asn Ile Ile Val Thr Leu Asn Thr Thr Ile Asn Met Thr 35 40 45Cys Glu Arg Pro Gly Asn Leu Ser Val Gln Glu Ile Asn Ile Gly Pro 50 55 60Leu Ala Trp Tyr Ser Met Ser Ile Lys Asn Glu Gly Lys Thr Glu Ser65 70 75 80Arg Val Ala Tyr Cys Glu Tyr Asn Ser Thr Asn Trp Val 85 90 42 amino acids amino acid single linear peptide not provided 66Arg Gln Leu Arg Ala Arg Leu Leu Ala Leu Glu Thr Leu Ile Gln Asn1 5 10 15Gln Gln Leu Leu Asn Leu Trp Gly Cys Lys Gly Arg Leu Val Cys Tyr 20 25 30Thr Ser Val Lys Trp Asn Met Ser Trp Ala 35 40 41 amino acids amino acid single linear peptide not provided 67Arg Gln Leu Arg Ala Arg Leu Leu Ala Leu Glu Thr Leu Ile Gln Asn1 5 10 15Gln Gln Leu Leu Asn Leu Trp Gly Cys Lys Gly Arg Leu Ile Cys Tyr 20 25 30Thr Ser Val Lys Trp Asn Ser Thr Trp 35 40 40 amino acids amino acid single linear peptide not provided 68Arg Gln Leu Arg Ala Arg Leu Leu Ala Leu Glu Thr Leu Ile Gln Asn1 5 10 15Gln Gln Leu Leu Asn Ser Trp Gly Cys Lys Gly Arg Leu Val Cys Tyr 20 25 30Thr Ser Val Glu Trp Asn Trp Thr 35 40 41 amino acids amino acid single linear peptide not provided 69Arg Gln Leu Arg Ala Arg Leu Leu Ala Leu Glu Thr Leu Ile Gln Asn1 5 10 15Gln Gln Leu Leu Asn Ser Trp Gly Cys Lys Gly Arg Gln Val Cys Tyr 20 25 30Thr Ser Val Lys Trp Asn Asn Thr Trp 35 40 133 amino acids amino acid single linear peptide not provided 70Ala Leu Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Val Pro Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Ala Glu Trp Asp Arg Thr His Pro Gln Ala Val Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Glu Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Ile His Trp Thr Thr Arg Ala Asn Pro Pro Ile 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Asn Lys 115 120 125Met Val Lys Met Tyr 130 133 amino acids amino acid single linear protein not provided 71Ala Leu Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Ile Ser Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Ala Asp Trp Asp Arg Ala His Pro Pro Val Val Gly Pro Leu Ala Pro65 70 75 80Gly Gln Met Arg Asp Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Ile His Trp Thr Thr Arg Pro Asn Asn Pro Ile 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Asn Lys 115 120 125Met Val Lys Met Tyr 130 133 amino acids amino acid single linear protein not provided 72Ala Ile Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Val Pro Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Ser Glu Trp Asp Arg Thr His Pro Pro Pro Ile Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Asp Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Val His Trp Ile Thr Arg Ala Pro Asn Pro Ile 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Asn Lys 115 120 125Met Val Lys Met Tyr 130 133 amino acids amino acid single linear protein not provided 73Ala Ile Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu1 5 10 15Lys Ala Phe Asn Pro Glu Ile Ile Pro Met Phe Met Ala Leu Ser Glu 20 25 30Gly Ala Ile Pro Tyr Asp Ile Asn Thr Met Leu Asn Ala Ile Gly Gly 35 40 45His Gln Gly Ala Leu Gln Val Leu Lys Glu Val Ile Asn Glu Glu Ala 50 55 60Ser Glu Trp Asp Arg Thr His Pro Gln Gln Ala Gly Pro Leu Pro Pro65 70 75 80Gly Gln Ile Arg Asp Pro Thr Gly Ser Asp Ile Ala Gly Thr Thr Ser 85 90 95Thr Gln Gln Glu Gln Val His Trp Thr Thr Arg Ala Ala Asn Pro Ile 100 105 110Pro Val Gly Asp Ile Tyr Arg Lys Trp Ile Val Leu Gly Leu Ile Lys 115 120 125Met Val Lys Met Tyr 130 20 base pairs nucleic acid single linear other nucleic acid /desc = “PRIMER” not provided 74CAGGGACAAA TGGTACATCA 20 22 base pairs nucleic acid single linear other nucleic acid /desc = “PRIMER” not provided 75AGTAGCTTGC TCAGCTCTTA AT 22 22 base pairs nucleic acid single linear other nucleic acid /desc = “PRIMER” not provided 76TRGTTACTTG TACACATGGC AT 22 26 base pairs nucleic acid single linear other nucleic acid /desc = “PRIMER” not provided 77ACAATAAAAG AATTCTCCAT GACAGT 26 21 amino acids amino acid single linear peptide not provided 78Asn Thr Arg Lys Ser Ile Asn Ile Gly Pro Gly Arg Ala Phe Tyr Ala1 5 10 15Thr Gly Glu Ile Ile 20 21 amino acids amino acid single linear peptide not provided 79Asn Thr Arg Lys Gly Ile Asn Ile Gly Pro Gly Arg Ala Phe Tyr Thr1 5 10 15Thr Gly Glu Ile Ile 20 25 amino acids amino acid single linear peptide not provided 80Arg Glu Val Gln Asp Ile Tyr Thr Gly Pro Met Arg Trp Arg Ser Met1 5 10 15Thr Leu Lys Arg Ser Asn Asn Thr Ser 20 25 25 amino acids amino acid single linear peptide not provided 81Arg Asp Ile Gln Glu Met Arg Ile Gly Pro Met Ala Trp Tyr Ser Met1 5 10 15Gly Ile Gly Gly Thr Ala Gly Asn Ser 20 25

Claims

1. An isolated nucleic acid obtained from a group of O HIV-1, wherein the sequence of said nucleic acid is selected from the group consisting of:SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ D NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO: 14, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO: 18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, and SEQ ID NO:61.

2. A process for detecting a group of O HIV-1 comprising the steps:extracting HIV-1 nucleic acid material from a biological sample containing said HIV-1 nucleic acid; denaturing said HIV-1 nucleic acid; annealing said denatured HIV-1 nucleic acid with at least one nucleic acid as claimed in claim 1 to form a hybrid; extending the hybrid; detecting the extended hybrid.

3. The process of claim 2, wherein said biological sample is obtained from serum or circulating lymphocytes.

4. The process of claim 2, wherein said step of extending the hybrid comprises addition of DNA polymerase and deoxyribonucleic acids.

5. The process of claim 2, wherein after said extracting the nucleic acid is treated with reverse transcriptase.

6. A process for screening and typing group O HIV-1, comprising bringing any of the nucleotide fragments in accordance with claim 1 into contact with the nucleic acid of the virus to be typed and detecting the hybrid formed.

7. An in vitro diagnostic reagent for a group of O HIV-1, comprising a sequence according to claim 1.

8. An in vitro diagnostic reagent for a group of O HIV-1, wherein said diagnostic reagent is selected from the group consisting of SEQ ID NOS: 22, 23, 24, and 25, which sequences may be used as primers for the amplification of a gp41 fragment from a group O HIV-1 viruses.