Patent Application
20090312399
The present invention relates to guanosine-rich oligonucleotides having the capacity to induce cell death, having characteristics of programmed cell death, in non-quiescent cells of higher eukaryotic organisms. The invention also relates to therapeutic methods involving the administration of these nucleic acid molecules to subjects suffering from, or being predisposed to, disorders involving abnormal cell proliferation and migration. The invention also concerns pharmaceutical compositions comprising the guanosine-rich nucleic acid molecules, in association with suitable carriers.
Oligonucleotide (ON) drugs are nucleic acid molecules having therapeutic utility. They vary widely in composition, and bring about their biological responses in many different ways.
A first class of ON drugs has been actively developed to target gene-specific RNA sequences. These ON drugs generally demonstrate a complete or near-complete degree of complementarity with the target sequence. For example, catalytic nucleic acid molecules such as ribozymes, minizymes and DNAzymes, act by specifically binding to and cleaving the target RNA molecule in the cell. Antisense ONs form RNA:DNA heteroduplexes with their targets and may then trigger RNA degradation through activation of RNAseH or produce translational arrest.
Other types of synthetic ONs having therapeutic potential include double-stranded RNA (RNAi), and nucleic acid transcriptional decoys.
It has become clear over the years that many of the actions of synthetic ONs can be mediated by “pleiotropic”, non-antisense mechanisms. These include but are not limited to the binding of oligonucleotides, particularly those that have phosphorothioate-modified inkages, to heparin-binding proteins such as bFGF (Guvakova et al., 1995). This occurs largely through electrostatic interactions. Because oligonucleotides can self-assemble into complex tertiary structures (Wyatt et al., 1996), these effects may be highly sequence-specific. Indeed, synthetic ONs can be screened for their ability to bind to specific ligands. These so-called “aptamer” ONs may be useful therapeutically (Burgstaller et al., 2002).
Synthetic ONs may also bind to specific receptors involved in innate response. Specifically, unmethylated CpG motifs are relatively rare in eukaryotes but common in bacteria and are sensed as foreign DNA by toll-like receptor 9 (TLR-9) (Hemmi et al., 2000). In B-cells, stimulation of TLR-9 triggers a cascade culminating in the secretion of cytokines including TNF-alpha and IL-6. Subtle changes in the DNA sequences flanking the CpG motif and formation of tertiary structures (Wu et al., 2004) can dramatically affect both the magnitude of the response and the specific profile of cytokines involved. CpG and CpG-mimicking ONs may be of use therapeutically as adjuvants for vaccination.
Some ONs that are rich in guanosine bases have been shown to be able to block CpG activation of B-cells in cell culture (Lenert et al., 2001). These “inhibitory” ONs do not appear to have any effect on cells in isolation and only serve to reduce or inhibit cell response to CpG motifs.
Other G-rich ONs have been described that can inhibit cell proliferation significantly (Yaswen et al., 1993). This may be due in part to their ability to form G-quadruplexes in which alignment of G-rich strands results in the formation of coordinated guanosine tetrads. These quadruplexes may bind metal ions and DNA etc. In some cases, these quadruplexes are important for aptameric properties, such as the binding of the protein nucleolin (Jueliger and Bates, 2004).
There thus exists a considerable number of different types of synthetic oligonucleotides, capable of exerting a range of potentially therapeutic effects on cells of living organisms. However, in spite of this significant source of active molecules, it is not always straightforward to efficiently exploit these ONs when seeking therapeutic agents for a given pathology. Indeed, ONs such as antisense, ribozymes and DNAzymes, require complementarity with the target, and therefore in disease contexts where the precise target RNA is unknown, this type of technology is not readily applicable.
Moreover, the above-mentioned “pleiotropic” effects of synthetic oligonucleotides on cells, whilst being of great potential use therapeutically, depend to a large extent on the composition of the oligonucleotide and the system in which they are tested. Prediction of specific activities in cellular systems is difficult to make on the basis of sequence identity and the biological activity of each oligonucleotide needs to be evaluated on a case by case basis (Benimetskaya, 1997). This is explained by the fact that such oligonucleotides display a high degree of polymorphism. Also, the identities of many oligonucleotide-binding cellular proteins remain unknown. A rational approach to ON drug design based on pleiotropic effects is therefore not always feasible.
ON-drug treatment of disorders associated with abnormal cell proliferation is particularly challenging. Indeed, factors involved in cell-cycle progression and de-regulation are numerous and interactions are complex. Knowledge of potential cellular targets is to date still incomplete for many pathologies. In addition, conditions involving aberrant cell proliferation often respond more readily to cytotoxic therapy rather than cytostatic therapy. Consequently it is desirable to develop ON drugs which induce cell death rather than simply inhibiting cell proliferation. The cytotoxic effect must however be specific for the abnormally proliferating cells. The design of ON drugs for treatment of disorders involving aberrant cell proliferation can therefore be more complex than in areas where a defined target is involved.
For example, it has recently been reported that certain molecules belonging to the DNAzyme family of ONs inhibit vascular muscle and endothelial cell proliferation. In particular, workers investigating the properties of DNAzymes targeted to c-Jun mRNA showed that some of these ONs can cleave synthetic c-Jun mRNA in vitro. Inhibition, by such DNAzymes, of serum-inducible proliferation of human and porcine primary vascular smooth muscle cells (Khachigian et al, 2002), and human microvascular endothelial cells in vitro has also been shown (International patent application WO 03/072114; Zhang et al., 2004). The DNAzymes investigated did not all show anti-proliferative effects. It is reported that some of the c-Jun DNAzymes stimulated proliferation of smooth muscle cells, whilst others, which were able to cleave synthetic c-Jun mRNA in vitro, failed to modulate smooth muscle cell proliferation in either rat or human cells. Similarly, some catalytically active c-Jun DNAzymes were found to have little effect on proliferation of human microvascular endothelial cells. The authors conclude that mRNA cleavage alone is not a reliable performance indicator of DNAzyme efficacy in a biological system (Zhang et al., 2004). The capacity of the oligonucleotides to induce cell death was not investigated by these workers.
DNAzymes targeting c-myc oncogene mRNA have -also been reported to cleave synthetic c-myc mRNA In vitro. Inhibition of smooth muscle cell proliferation in rat SV40LT-SMC cell lines has also been observed with these agents (Sun et al., 1999). Inhibition of proliferation of human smooth muscle cells and induction of cell death was not reported.
There thus remains a need for ON molecules which are specific inducers of cell death in proliferating cells. Desirable molecules are suitable for use as therapeutic agents in the treatment and prevention of disorders involving aberrant cell proliferation, and for the manufacture of medicaments for use in such disorders.
It is an object of the present invention to provide such oligonucleotide molecules. In particular, it is an object of the present invention to provide a class of oligonucleotide molecules which induce cell death in proliferating cells of higher eukaryotic organisms. It is also an object of the invention to provide a class of oligonucleotide molecules which specifically induce cell death in proliferating cells without producing detrimental effects in non-proliferating cells.
These and other objects are achieved by the present invention as evidenced by the summary of the invention, description of the preferred embodiments and the claims.
The aims of the invention are met by a new class of G-rich oligonucleotides having a novel combination of unique 5′ region sequences and total length requirements.
The present invention relates to a class of DNA-containing oligonucleotides characterized by a length of 20 to 50 nucleotides, for example 21 to 50, or 25 to 50 nucleotides, and a guanosine-rich region, constituting the 5′ segment of the molecule. The G-rich region has a length of from 6 to 9 nucleotides, and contains a purine tract comprising at least 4 consecutive purine nucleotides. Within the G-rich region, there is a triple G motif (G-G-G), the 5′ extremity of the triple G motif being positioned no more than three nucleotides from the 5′ extremity of the oligonucleotide. The 3′ region of the oligonucleotides can be essentially any nucleotide sequence, there being no particularly rigid sequence requirements in this part of the molecule. According to the invention, these oligonucleotides, which have been found to induce cell death having features typical of programmed cell death in dividing cells, are used in methods of treatment of disorders involving aberrant proliferation of cells, and in the preparation of medicaments for the treatment of such disorders.
Key: Open square: Oligo 1;
Open triangle: Oligo 2;
Inverted open triangle: Oligo 3;
Open circle: Oligo 4;
Cross: Oligo 5;
Star: Oligo 6.
Key: Open square: c-myb antisense (Oligo 32);
Open triangle: bcl-2 antisense (Oligo 33).
Key: Open square: Oligo 4+chloroquine;
Open circle: Oligo 4.
Key: Open diamond: mCpG (Oligo 9);
Inverted Open triangle: Oligo 10.
Key: Open square: Oligo 4;
Open triangle: Oligo 36;
Inverted open triangle: Oligo 37;
Open diamond: Oligo 4+Oligo 36 (100 nM)
Open circle: Oligo 4+Oligo 37 (100 nM).
Key: Open square: Oligo 38;
Open triangle: Oligo 39;
Inverted open triangle: Oligo 40;
Open circle: Oligo 4.
Key: Open square: CGGGAGGMG(N5) (Oligo 41)
Open triangle: CGGGAGGAAG(N10) (Oligo 42);
Inverted open triangle: CGGGAGGAAG(N15) (Oligo 43)
Open diamond: CGGGAGGAAG(N20) (Oligo 12)
Cross: CGGGAGGMG(N25) (Oligo 13)
Key: Open square: 3T3;
Open triangle: Hela;
Inverted open triangle: HEK 293;
Open diamond: CaSki
Open circle: A549;
Cross: HMEC1;
Star: MDA-MB231.
Key: Open square: 9+9 PS (Oligo 16);
Open triangle: 7+7 PS (Oligo 17);
Inverted open triangle: 5+5 PS (Oligo 18);
Open diamond: All PS (Oligo 44);
Key: Open circle: 3′-3′C (Oligo 1)
Open square: 5′-5′T (Oligo 14)
Open triangle: 3′-3′C+5′-5′T (Oligo 15);
Key: Open square: 2+2 2′O Methyl (Oligo 20)
Open triangle: unmodified (Oligo 19);
Open circle: 3′-3′T (Oligo 4)
Key: Open square: Oligo 4 3′ cholesteryl (Oligo 11)
Open circle: Oligo 4
Key: Non-shaded open bar: Sub G0
Spotted bar: G0/G1
Horizontally striped bar: S
Vertically striped bar: G2/M
Key: Non-shaded open bar: 24 hours
Shaded bar: 48 hours
Key: Open square: Oligo 77
Open triangle: Oligo 79
Open diamond: Oligo 80
Cross: Oligo 81
Inverted open triangle: Oligo 82
Key: Open triangle: Oligo 27
Inverted open triangle: Oligo 4
Open circle: Oligo 47
Key: Open square: Oligo 23
Open triangle: Oligo 24
Inverted open triangle: Oligo 25
Open diamond: Oligo 1
Key: Open triangle: Oligo 48
Open diamond: Oligo 26
Key: Open square: Oligo 27
Open triangle: Oligo 50
Inverted open triangle: Oligo 51
Open diamond: Oligo 52
Key: Open triangle: Oligo 53
Inverted open triangle: Oligo 28
Open diamond: Oligo 54
Open circle: Oligo 1
Key: Open square: Oligo 1
Open triangle: Oligo 55
Inverted open triangle: Oligo 56
Open diamond: Oligo 57
Key: Inverted open triangle: Oligo 29
Open diamond: Oligo 30
Open circle: Oligo 58
Key: Open square: Oligo 59
Inverted open triangle: Oligo 60
Open diamond: Oligo 31
Key: Shaded triangle: ss Oligo 4
Shaded square: ss complement of Oligo 4
Inverted shaded triangle: ds Oligo 4
Key: Shaded square: Oligo 66
Shaded triangle: Oligo 67
Inverted shaded triangle: Oligo 68
Shaded diamond: Oligo 69
Shaded circle: Oligo 25
Key: Shaded square: Oligo 7 “high”
Shaded triangle: Oligo 4 “high”
Inverted shaded triangle: Oligo 7 “low”
Shaded diamond: Oligo 4 “low”
Key: Non-shaded open bar: mock
Stippled bar: Oligo 7
Fully Shaded bar: Oligo 4.
In the context of the present invention, the following terms have the following meanings:
Turning now more particularly to the cytotoxic G-rich oligonucleotides of the invention, they consist of two contiguous regions, namely:
the combined length of the G-rich region and the 3′ tail region being from 20 to 50 nucleotides, particularly 25 to 50 nucleotides.
The 5′ G-rich region of the oligonucleotides of the invention has the formula 1:
wherein:
provided that:
In the above Formula 1, each of X1, X2 X3, X4, X5, X6 and X7 independently represents a purine or pyrimidine nucleotide, particularly A, C, G or T, provided that the stretch represented by X3-X4-X5-X6-X7 does not contain a thymidine nucleotide downstream (i.e. 3′) of a guanosine nucleotide. In other words, the portion of the G-rich region represented by X3-X4-X5-X6-X7 is free of GT motifs. Preferably, the whole of the G-rich region is free of GT dinucleotide motifs. In a further embodiment the portion of the G-rich region represented by X3-X4-X5-X6-X7 contains no thymidine nucleotides, i.e. each of X3, X4, X5, X6and X7 independently represents a guanosine, adenosine or cytosine nucleotide, subject to the conditions imposed by the provisos defined in Formula 1.
When determining the length of the G-rich region of an oligonucleotide according to the invention, the length is the shortest stretch of nucleotides which simultaneously meets the triple requirement of
For example, in the case of an oligonucleotide having a 5′ extremity having the sequence 5′-GAGGGGCAG-3′, the G-rich region has 6 nucleotides and consists of the sequence of GAGGGG. This rule for defining the length of the G-rich region applies to each of Formulae 1 to 7 as defined herein.
The 3′ tail region of the oligonucleotides is essentially any nucleotide sequence i.e. there are no stringent sequence requirements for this part of the molecule.
Within the main class of molecules whose G-rich region is defined by Formula 1 above, a number of preferred sub-classes can be distinguished. The G-rich regions of these preferred sub-groups of oligonucleotides are also defined by a series of Formulae 1a to 7, presented below.
According to a first sub-class, oligonucleotides of the invention have a G-rich region having the Formula 1a:
wherein R, X1, X3, X4, X5 and X6 have the meanings defined in Formula 1, with the additional proviso that if the first 4 nucleotides at the 5′ end of the G-rich region are 4 consecutive guanosine nucleotides, the fifth nucleotide of the G-rich region is a cytosine nucleotide.
According to a second sub-class, oligonucleotides of the invention wherein the purine tract of Formula 1 is immediately flanked by a pyrimidine nucleotide on the 5′ side, have G-rich regions defined by Formula 2:
According to a particularly preferred embodiment of the invention, Py in Formula 2 is a cytosine nucleotide. Such embodiments include oligoriucleotides wherein the G-rich region comprises the sequence:
An example of a cytotoxic oligonucleotide of the invention having this type of G-rich region is:
Alternatively, oligonucleotides of the invention wherein the purine tract of Formula 1 is immediately flanked by a pyrimidine nucleotide on the 3′ side, and wherein X1 and X2 in Formula 1 above are both absent, have G-rich regions defined by Formula 3:
wherein R, X4, X5, X6 and X7 have the meanings defined in Formula 1,
An example of an oligonucleotide of the invention having a G-rich region according to Formula 3 is one in which the G-rich region has the sequence
for example the following oligonucleotide:
According to another sub-class of the invention, the purine tract defined in Formula 1 above is flanked on at least one side by a further purine nucleotide, thereby creating a tract of at least 5 consecutive purine nucleotides. A first example of oligonucleotides of the invention having a purine tract of at least 5 nucleotides are those in which the 5′ G-rich region has the Formula 4:
wherein:
An example of a sub-class of oligonucleotides of the invention having a purine tract of at least 5 nucleotides according to Formula 4, are those in which the 5′ G-rich region has the Formula 5:
wherein:
A third example of oligonucleotides of the invention having a purine tract of at least 5 nucleotides are those in which the 5′ G-rich region has the Formula 6:
wherein:
Within the preferred sub-classes of molecules having G-rich regions defined by Formulae 4, 5 and 6, there are further preferred groupings according to whether the (R5-R1-R2-R3-R4) purine tract is adenosine-containing or not.
More specifically, a preferred group of oligonucleotides having G-rich regions according to Formula 5 are those wherein the (R5-R1-R2-R3-R4) purine tract is adenosine-containing, the G-rich region thereby having the formula 5.1
wherein at least one of R5, R1, R3 and R4 represents A,
A particularly preferred sub-group of oligonucleotides having a G-rich region in accordance with Formula 5.1 are those wherein at least one of R5 and R1 is an adenosine nucleotide, and the G-rich region has the formula 5.1a:
wherein (R5-R1-R2-R3-R4) again represents a tract of five consecutive purine nucleotides containing a triple guanosine (G-G-G) motif, at least one of R5 and R1 represents A, X1 represents a purine or pyrimidine nucleotide, and X3, X4, and X5 have the meanings defined in Formula 1, and may be present or absent such that the total number of nucleotides in the G-rich region is from 6 to 9.
Another preferred sub-group of oligonucleotides having a G-rich region in accordance with Formula 5.1 are those wherein at least one of R3 and R4 is an adenosine nucleotide, and X1 is any nucleotide other than G. According to this variant of the invention, the G-rich region has the formula 5.1b
wherein (R5-R1-R2-R3-R4) again represents a tract of five consecutive purine nucleotides containing a triple guanosine (G-G-G) motif, at least one of R3 and R4 represents A, X1 represents A, C or T and X3, X4, and X5 have the meanings defined in Formula 1, and may be present or absent such that the total number of nucleotides in the G-rich region is from 6 to 9.
Typical examples of molecules having G-rich regions according to Formula 5.1 are those wherein the 5′ G-rich region has 6 nucleotides and is chosen from the group consisting of:
wherein A represents an adenosine nucleotide, and G represents a guanosine nucleotide, and X1 represents a purine or pyrimidine nucleotide, e.g. A, C, T or G.
Further examples of molecules according to Formula 5.1 are those wherein the 5′ G-rich region has 7 to 9 nucleotides and is chosen from the group consisting of:
wherein A represents adenosine and G represents guanosine,
X1 represents a purine or pyrimidine nucleotide e.g. A, C, T or G,
X3, X4, and X5 have the meanings defined in Formula 1, and
X4 and X5 may be present or absent such that the total number of nucleotides In the G-rich region is 7, 8 or 9.
The nucleotide X3 in any one of Formulae 5.1.4 or 5.1.5 may be chosen from any of A, C, G or T. If X3 represents A, C or T, the G-rich region has 8 or 9 nucleotides.
Preferred variants of oligonucleotides having G-rich regions according-to Formula 5.1.3 and Formula 5.1.4 are those wherein X1 represents any nucleotide other than G. According to these variants, the 5′ G-rich region is chosen from the group consisting of:
wherein A represents an adenosine nucleotide and G represents a guanosine nucleotide, X1 represents A, C or T, X3, X4, and X5 have the meanings defined in Formula 1, and X4 and X5 may be present or absent such that the total number of nucleotides in the G-rich region is 7, 8 or 9.
The nucleotide X1 in any one of Formulae 5.1.1, 5.1.2, 5.1.3, 5.1.4 or 5.1.5 above may typically be T or C. In such cases, the 5′ G-rich region preferably has one of the following sequences
Alternatively, the nucleotide X1 in any one of Formulae 5.1.1, 5.1.2, 5.1.3, 5.1.4 or 5.1.5 above, may represent A or G. In such cases, preferred examples of 5′ G-rich regions are those having the sequence
Specific examples of cytotoxic oligonucleotides having G-rich regions according to Formula 5.1.2 are the following:
wherein each N independently represents G, T, C or A, and may be the same or different, and (3′-3′) and (5′-5′) signifies an inverted 3′ or 5′ linkage respectively.
Specific examples of cytotoxic oligonucleotides having G-rich regions according to Formula 5.1.3 are the following:
wherein each N independently represents G, T, C or A, and may be the same or different, X represents cholesteryl-TEG, (5′P) represents a 5′ phosphorylation, Cm represents a methylated cytosine, B represents biotin, and (3′-3′) and (5′-5′) signifies an inverted 3′ or 5′ linkage respectively.
Specific examples of cytotoxic oligonucleotides having G-rich regions according to Formula 5.1.1 are the following:
A further preferred group of oligonucleotides having G-rich regions according to Formula 5 are those wherein the (R5-R1-R2-R3-R4) purine tract is devoid of adenosine nucleotides and the G-rich region has the formula 5.2:
wherein X1 represents A, C or T.
Another preferred group of oligonucleotides are those having G-rich regions according to Formula 6, wherein the (R5-R1-R2-R3-R4) purine tract is adenosine-containing. These molecules have G-rich regions having the formula 6.1
wherein at least one of R5, R1, R3 and R4 represents A,
X3, X4, X5 and X6 have the meanings defined in Formula 1 and may be present or absent such that the total number of nucleotides in the G-rich region is from 7 to 9.
Typical examples of molecules having G-rich regions according to Formula 6.1 are those wherein the 5′ G-rich region is chosen from the group consisting of:
The nucleotide X3 in any one of Formulae 6.1.1, 6.1.2, 6.1.3, 6.1.4, 6.1.5 may typically be A or C and the G-rich region has 7, 8 or 9 nucleotides. An example of such a G-rich region is:
Alternatively, the nucleotide X3 in any one of Formulae 6.1.1, 6.1.2, 6.1.3, 6.1.4 or 6.1.5 may be G, and the G-rich region thus has 6 nucleotides. Examples of such 5′ G-rich regions include:
The nucleotide X3 in any one of Formulae 6.1.4 or 6.1.5 may be T, and the G-rich region has 7, 8 or 9 nucleotides.
Specific examples of cytotoxic oligonucleotides having G-rich regions according to Formula 6.1.3 are the following:
where each N independently represents G, T, C or A, and may be the same or different, and (3′-3′) signifies an inverted 3′ linkage.
Specific examples of cytotoxic oligonucleotides having G-rich regions according to Formula 6.1.5 are the following:
A specific example of a cytotoxic oligonucleotide having a G-rich region according to Formula 6.1.1 is the following:
Yet another preferred group of oligonucleotides are those having G-rich regions according to Formula 6, wherein the (R5-R1-R2-R3-R4) purine tract is devoid of adenosine nucleotides and the G-rich region has the formula 6.2:
wherein X3 represents A or C, and
X4, X5 and X6 have the meanings defined in Formula 1 and may be present or absent such that the total number of nucleotides in the G-rich region is from 7 to 9.
According to a further variant of the invention, the oligonucleotide capable of inducing cell death in non-quiescent eukaryotic cells, is an oligonucleotide consisting exclusively of purine nucleotides. According to this variant, the oligonucleotide has a length of 20 to 50 nucleotides, for example 25 to 50 nucleotides, and consists of
in which
Examples of all-purine oligonucleotides according to this embodiment of the invention are those having G-rich regions chosen from the group consisting of:
wherein each of R6, R7, R8, R9, R10 independently represent a purine nucleotide, and may be present or absent such that the total number of nucleotides in the G-rich region is from 6 to 9.
The all-purine oligonucleotides of the invention have a length of from 20 to 50 nucleotides, particularly 21 to 50 nucleotides. Molecules of this type having lengths as short as 20, 21, 22, 23 or 24 nucleotides have been shown to have efficacy in inducing cell-death, having characteristics of programmed cell death. Particularly preferred lengths of all-purine cytotoxic oligonucleotides of the invention are 21 to 50 nucleotides, for example 22 to 48 nucleotides, or 24 to 45 nucleotides, or 25 to 40 nucleotides.
Specific examples of active all-purine oligonucleotides of the invention include the following
It can thus be seen from the above that cytotoxic oligonucleotides of the invention can have G-rich regions corresponding to any one of the Formulae 1, 2, 3, 4, 5, 6 and 7 or to any of the above-defined sub-groups of these Formulae, covalently linked to a 3′ tail region, giving rise to a molecule having a total length of 20 to 50 nucleotides, or 25 to 50 nucleotides.
The 3′-tail region of the oligonucleotides can be substantially any nucleotide sequence. Indeed, there are no rigid sequence requirements for this part of the molecule, as shown by the conservation of cytotoxic activity even after randomization of tail sequences. It is however preferred that the 3′-tail region be composed of a mixture of at least 2 different nucleotides, preferably a mixture of purine and pyrimidine nucleotides, and most preferably a mixture of the four principal nucleotides A, C, T and G.
According to a preferred embodiment, the 3′ tail region is generated randomly from an equimolar mix of A, C, T and G nucleotides. This gives rise to a pool of oligonucleotides. The pool has cytotoxic activity according to the invention, and can be used as such for inducing cell death, or can be further purified to isolate individual cytotoxic oligonucleotides. The invention thus also encompasses pools or mixtures of oligonucleotides wherein at least one oligonucleotide within the mixture has a G-rich region according to any one of Formulae 1 to 7, and has cytotoxic activity as defined herein.
Alternatively, the 3′ tail region may contain only purine nucleotides. In this case, it is preferred that the 3′ tail be a mixture of A's and G's rather than exclusively A's or G's.
Typical oligonucleotides of the invention are those consisting of a G-rich region according to any one of Formula 1 to 7 as defined above, covalently linked to a 3′ tail containing at least two different nucleotides, preferably at least 3 different nucleotides including G, and most preferably four different nucleotides generated randomly. Tails consisting of a single nucleotide such as polyA tails, or homoG polymers are not preferred.
Whilst the oligonucleotides of the invention are single stranded, it has nevertheless been observed by the inventors that 3′ tail regions containing two sequences capable of together forming a hairpin structure within the tail, do not have reduced cytotoxicity. Thus a region of double strandedness within the 3′ tail of the oligonucleotide may be tolerated. However, it is preferred that the tail region of the oligonucleotide be devoid of sequences capable of forming a hairpin structure with sequences within the G-rich region, as such hairpin formation may have a detrimental effect on the cytotoxicity of the oligonucleotide.
According to a further embodiment of the invention, the cytotoxic oligonucleotides are devoid of sequences defining ribozyme or DNAzyme catalytic regions, for example sequences defining functional ribozyme or DNAzyme catalytic regions. Indeed, the inventors have demonstrated that the cytotoxic activity of G-rich oligonucleotides herein which comprise functional DNAzyme catalytic regions, does not correlate with their catalytic activity. Cytotoxic activity of the oligonucleotides of the invention is thus independent of their catalytic activity. In other words, this invention demonstrates the cytotoxic acitivity is related to the Formulae, as disclosed in this invention, and this activity is separate and distinct from a determination of whether or not the oligonucleotides have catalytic activity. Examples of such a further class of oligonucleotides of the invention are those which do not contain the DNAzyme catalytic region having the sequence 5′-GGCTAGCTACMCGA-3′ or its reverse sequence 5′-AGCMCATCGATCGG-3′, or variants of these sequences having one or two base substitutions or deletions. In particular, according to this embodiment, the cytotoxic oligonucleotides are free of the sequence 5′-GGCTANCTACMCGA-3′, where N represents a guanosine or a cytosine nucleotide, or its reverse sequence 5′-AGCAACATCNATCGG-3′. According to this variant, the oligonucleotides of the invention thus consist of a G-rich region according to any one of Formulae 1 to 7 as defined above, and a 3′ tail region, the oligonucleotide being devoid of the sequence 5′-GGCTANCTACAACGA-3′, or its reverse sequence. As an example, this category of oligonucleotides of the invention may have a G-rich region according to any one of Formulae 1 to 7 as defined above, and a 3′ tail region which does not comprise the sequence GGCTAGCTACMCGA, or its reverse sequence.
For example, in accordance with this variant of the invention, the 3′ tail region of the oligonucleotide does not comprise:
Further examples of oligonucleotides according to this embodiment, are those wherein the 3′ tail region of the oligonucleotide does not consist of:
Specific examples of oligonucleotides of the invention which are free of DNAzyme catalytic regions such as 5′-GGCTANCTACAACGA-3′ and its reverse sequence as defined above include the following:
According to another embodiment of the invention, the oligonucleotides of the invention may contain sequences defining DNAzyme catalytic regions, for example the GGCTAGCTACAACGA sequence referred to above, particularly when the G-rich regions of the oligonucleotide have a sequence corresponding to any one of Formulae 5.1.4, 5.1.5, 5.2 and 6.2 as herein defined.
The oligonucleotides of the invention have a length of 25 to 50 nucleotides, for example 26 to 45 nucleotides. Particularly preferred oligoucleotides have a length of 30 to 44 nucleotides, for example 31 to 42 nucleotides.
The oligonucleotides of the invention are active in a chemically unmodified form. However various substitutions by analogues and chemical derivatives of nucleotides can be made to improve characteristics such as stability, bioavailability, solubility, transfection efficiency etc. For example, oligonucleotides having 2′-OH modified nucleotides such as 2′O-methyl, 2′O-alkyl, 2′-methoxyethyl or those with other modified ribose chemistries may have desirable properties. Such modifications can be made throughout the molecule. Further examples of analogues and derivatives are listed in Table A above.
The oligonucleotides of the invention having a native phosphodiester backbone are active. However, activity may be modulated, and secondary properties enhanced, by judicious use of modified backbone chemistries such as phosphoroamidate, phosphorothioate, amide-3, methylenemethylimino, peptide nucleic acid, methyl phosphonate, phosphorodithioate chemistries among others. Extensive modification of the sequence with alternative base, sugar and backbone chemistries may, however, have a deleterious effect on the biological activity. In particular, total replacement of the phosphodiester backbone with phosphorothioate linkages greatly reduces the activity of these oligonucleotide sequences. Partial replacement is therefore preferred.
Chemical modifications that protect the termini of the oligonucleotides from exonucleases are particularly beneficial. These include but are not limited to the use of 3′-3′ and 5′-5′ linked nucleotides (inverted linkages).
The oligonucleotides may also be substituted using groups such as cholesterol, biotin, dyes with linkers etc. These substitutions are made at the 3′ end of the molecule, so as not to adversely affect cytotoxicity.
Thus, according to a preferred embodiment, an oligonucleotide of the invention, consisting of a 5′ G-rich region according to any one of Formulae 1 to 7 as defined above, and a 3′ tail region, can be chemically modified such that it comprises one or more of the following:
Typical examples of modified oligonucleotides according to the invention are those derived from Oligo 4 by any one or more of the above modifications. Examples include Oligo 9 (methylated cytosines), Oligo 11 (cholesterol substitution), Oligo 83 (3′ biotinylated), Oligo 20 (2′-O-methyl substitutions) and Oligo 31 (5′ phosphorylation). Other examples include molecules derived from Oligo 1 by any one or more of the above modifications, for example Oligos 16, 17 and 18 (phosphorothioate linkages), and Oligos 14 and 15 (inverted 5′-5′ and/or 3′-3′ linkages).
With regard to the biological effect of the oligonucleotides of the invention, they specifically induce cell death in non-quiescent eukaryotic cells when they are introduced into the cells. The induced cell death has features characteristic of programmed cell death, including caspase activation, phospholipid phosphatidylserine translocation and mitochondrial depolarisation. According to the invention, within a population of cells, whilst the majority of cells undergo cell death having features of the programmed-type, cell death by necrosis may also occur in a minority of cells. In the context of the invention, the programmed cell death induced by the cytotoxic oligonucleotides is mediated by mechanisms intrinsic to the cell, not by the suppression of genes of infectious agents such as viruses or bacteria, or the products of such genes, for example LMP1 encoded by EBV etc. The cytotoxic effect of the oligonucleotides of the invention can therefore be obtained in cells and cell-lines which are not infected by infectious agents.
The cytotoxic effect according to the invention is non-species specific i.e., following appropriate transfection, an oligonucleotide of the invention induces cell death in cell lines originating from different species, for example from human or rodent species. Moreoever, within a given species, the cytotoxic effect is seen in cells of different tissue or neoplastic origin for example in vascular endothelial cells, smooth muscle cells, embryonic kidney cells, cervical cancer cell lines etc. The cytotoxic effect is thus not tissue-specific in any given species.
Within a population of cells, the cell death obtained according to the invention may be accompanied by inhibition of cell-cycling, proliferation and migration, and by reductions in the secretion of cytokines.
According to the invention, the oligonucleotides produce the cytotoxic effect with marked potency in actively proliferating and/or migrating cells, but show no significant cytotoxic effect on quiescent cells, particularly in contact-inhibited quiescent cells. Cell death induced by the oligonucleotides of the invention is thus specific for proliferating and/or migrating cells.
The design rules elaborated in the context of the present invention and summarised in Formulae 1 to 7, define groups of oligonucleotides, the vast majority of which have the desired cytotoxic effect. Once the rules have been used to design an oligonucleotide having a length of 20 to 50 nucleotides, for example 21 to 50, preferably 25 to 50 nucleotides, and a 5′ G-rich region according to the invention, the oligonucleotide is tested for its capacity to induce cell death by carrying out the following cytotoxicity assay (a), together with at least one of additional tests (b) to (e):
Positivity of staining with Annexin V is considered characteristic of programmed forms of death such as apoptosis and autophagy. Cells that are positive only for propidium iodide staining are understood to be undergoing necrotic cell death. Active oligonucleotides according to the invention may give rise to positive staining with Annexin V, and additionally may also be positive for propidium iodide staining.
Preferably, in determining whether oligonucleotides fitting the design rules are cytotoxic according to the invention, the cytotoxicity assay (a) is carried out in association with at least one of the tests (b) to (e), for example tests (b), (d) and (e). Oligonucleotides which give positive results in test (a) and in one of tests (b) to (e) are considered to be active in the context of the invention. Whilst a variety of cells or cell lines can be used for the above tests, it is preferred that human microvascular endothelial cells (HMEC-1 cells) and rat smooth muscle cells (RSMCs) be used.
Full details of the activity tests (a) to (e) are presented in Example 5 in the Experimental Section below.
The precise mechanism by which the ODNs of the invention bring about cell death is not yet fully elucidated. However, it is postulated that the oligonucleotides are recognised by an intracellular protein, triggering the engagement of cell death programmes. In particular, the inventors have demonstrated the binding of the oligonucleotides of the invention to eukaryotic elongation factor 1 alpha 1 (eEFA1,A1, formerly designated EF1alpha1). This “moonlighting” protein is, amongst other things, a major sensor of growth-related signals and an apoptotic regulator in times of endoplasmic reticulum stress. It is a key factor in protein synthesis, where it promotes the transfer of aminoacylated tRNAs to the A site of the ribosome (Ejiri S. I. 2002). The induction of cell death in non-quiescent cells by the oligonucleotides of the invention is thus possibly related to their ability to bind to eEF1A-1.
Furthermore, it has been demonstrated that the mechanism underlying the cytotoxic effect of the oligonucleotides of the invention is unrelated to “CpG” effects. Indeed, methylation of CpG motifs contained within the oligonucleotides of the invention does not affect cytotoxic potency compared to the unmethylated version of the same molecule, and inversion of the CpG motif to GpC also has no effect on capacity of the molecules to induce cell death.
It has also been demonstrated that the cytotoxic effect of the oligonucleotides of the invention is apparently not brought about by known or hypothesized RNA targeting mechanisms. According to the invention, cytotoxicity is maintained after scrambling (or randomizing) of the 3′ region of the oligonucleotides. As a result of scrambling, any complementarity which the oligonucleotide might have had towards a cellular target molecule, is destroyed, and yet the cytotoxicity is conserved. Consequently, the mechanism underlying the activity of the oligonucleotides of the invention appears to be distinct from that underlying antisense, ribozyme, DNAzyme, RNAi effects.
The oligonucleotide-induced cell death according to the invention Is thus characterised by:
It can therefore be determined whether an oligonucleotide is inducing cell death by the present invention by testing one or both of the above parameters.
According to the invention, the cytotoxic oligonucleotides induce cell death having features of programmed cell death, in a variety of different types of cells and cell lines of higher eukaryotic organisms, particularly mammalian cells such as human, mouse, rat, pig, horse, dog, monkey, cat, rabbit cells etc. With regard to tissue origin of the cells which are sensitive to the oligonucleotides of the invention, it has been found that vascular endothelial and smooth muscle cells, fibroblasts, retinal epithelium and embryonic kidney cells are particularly sensitive. Cell death can be induced according to the invention in both primary cells and established cell lines. Moreover, a variety of cell types of neoplastic origin are susceptible to the cytotoxic oligonucleotides, for example human cervical carcinoma cell lines, lung carcinoma etc.
The invention also relates to a method of inducing, in a population of non-quiescent eukaryotic cells, cell death having at least one characteristic of programmed cell death, the method comprising contacting cells of said population in vitro, in vivo or ex vivo with at least one G-rich oligonucleotide, said oligonucleotide consisting of two contiguous regions, namely:
According to this method, the G-rich oligonucleotides are used in an amount sufficient to induce cell death in at least a portion of the population of cells containing said oligonucleotide. Preferably, at least 20%, for example at least 25%, and preferably at least 40%, of the cells in the population undergo cell death having features of programmed cell death, within 24 to 48 hours of the introduction of the oligonucleotide(s).
When the method is carried out in vitro, the cells may be primary cells or established cell lines, and may be of mammalian, for example human origin. They are used in conditions in which the cells proliferate. Such in vitro methods are useful for screening cytotoxic oligonucleotides of the invention for example with a view to selecting oligonucleotides having optimized properties as a result of sequence variations, chemical modifications, inclusion of analogues, substituents etc. The in vitro method of the invention may also provide a diagnostic method, for example for the detection of proliferating cells, or for the selection of quiescent cells. The method may also be an ex-vivo method.
When the method is carried out in vivo the cell population is a population within a higher eukaryotic organism, for example a mammal, particularly a human. Such in vivo methods include therapeutic and/or prophylactic methods in the context of diseases involving aberrant proliferation of cells. In vivo methods may also include in vivo screening of cytotoxic oligonucleotides of the invention with a view to selecting oligonucleotides having optimized cytotoxic activity, stability, absence of side-effects etc. In such methods, the higher eukaryotic organism may or may not be suffering from a disorder involving aberrant proliferation of cells.
Thus, according to the invention, the cytotoxic oligonucleotides having G-rich regions of any one of Formulae 1 to 7 as defined above are used in methods of treatment or prevention of disorders involving aberrant cell proliferation and/or migration. They are also used in the manufacture of medicaments for the treatment or prevention of such disorders.
Specifically, this aspect of the invention relates to a method of treating or preventing a disorder involving aberrant cell proliferation, comprising administering to a patient in need of such treatment a cytotoxic oligonucleotide of the invention to induce cell death in abnormally proliferating cells and to treat or prevent the disorder.
More particularly, in a first aspect, the invention relates to a method of inducing, in non-quiescent eukaryotic cells, cell death having at least one characteristic of programmed cell death for treating or preventing a disorder involving abnormal cell proliferation or migration comprising administering to a subject in need of such treatment a pharmaceutically effective amount of an oligonucleotide, wherein said oligonucleotide has a length of 25 to 50 nucleotides and consists of:
in which
Examples of compounds which are useful in this first method of treatment or prevention are compounds having G-rich regions which meet any of the following formulae as defined herein: Formula 1, Formula 2, Formula 3, Formula 4, Formula 5, Formula 5.1, Formula (5.1.1); Formula (5.1.2); Formula (5.1.3), Formula (5.1.4); Formula (5.1.5); Formula 5.2; Formula 6; Formula 6.1; Formula (6.1.1); Formula.(6.1.2); Formula (6.1.3); Formula (6.1.4); Formula (6.1.5) or Formula 6.2, the provisos and definitions of the 3′ tail region as listed above for the first aspect also applying to these compounds.
In a second aspect, the invention relates to another method of inducing, in non-quiescent eukaryotic cells, cell death having at least one characteristic of programmed cell death for treating or preventing a disorder involving abnormal cell proliferation or migration comprising administering to a subject in need of such treatment a pharmaceutically effective amount of an oligonucleotide, wherein said oligonucleotide has a length of 20 to 50 nucleotides and consists of
in which
Examples of compounds which are useful in this second method of treatment or prevention are compounds having G-rich regions which meet any of the following formulae as defined herein: Formula 7, Formula 7.1, Formula 7.2, Formula 7.3, Formula 7.4, Formula 7.5, Formula 7.6, Formula 7.7, Formula 7.8, Formula 7.9, Formula 7.10, the provisos and definitions of the 3′ tail region as listed above for the second aspect also applying to these compounds.
In a third aspect, the invention relates to yet another method of inducing, in non-quiescent eukaryotic cells, cell death having at least one characteristic of programmed cell death for treating or preventing a disorder involving abnormal cell proliferation or migration comprising administering to a subject in need of such treatment a pharmaceutically effective amount of an oligonucleotide, said oligonucleotide having a length of 25 to 50 nucleotides and consisting of
in which
(R1-R2-R3-R4) represents a tract of four consecutive purine nucleotides, each R representing a purine nucleotide,
each of X1, X2, X3, X4, X5, X6 and X7 independently represents a nucleotide which may be present or absent, such that the total number of nucleotides in the G-rich region is from 6 to 9,
each of X1, X2 X3, X4, X5, X6 and X7 independently represents a purine or pyrimidine nucleotide,
provided that:
provided the oligonucleotide does not contain the sequence 5′-GGCTANCTACMCGA-3′, or its inverse sequence 5′-AGCAACATCNATCGG-3′ wherein N represents a guanosine or cytosine nucleotide.
Examples of compounds which are useful in this third method of treatment or prevention are compounds having G-rich regions which meet any of the following formulae as defined herein: Formula 2, Formula 3, Formula 5.1a, Formula 5.1b, Formula (5.1.1), Formula (5.1.2), Formula (5.1.5), Formula (5.1.3b), Formula (5.1.4b), Formula 5.2, Formula 6.1, Formula (6.1.1), Formula (6.1.2), Formula (6.1.3), Formula (6.1.5), the provisos and definitions of the 3′ tail region as listed above for the third aspect also applying to these compounds.
The conditions in which the oligonucleotide is administered to the subject (for example the dose, schedule, mode of administration etc) are in pharmaceutically acceptable amounts such that cell death having at least one characteristic of programmed cell death, is obtained in the abnormally proliferating cells. In general, the oligonucleotides of the invention are administered at doses ranging from 0.1 to 100 mg per kilo of patient body weight, for example 0.1 to 50 mg/kg. Systemic administration may require doses in the upper part of said range, for example 5 to 100 mg/kg, whereas routes of administration directly at the site of the lesion may require lower doses such as 0.1 to 10 mg/kg. The dose is preferably such as to achieve a concentration of active agent at the site of action of 1 to 200 nM.
Cell death induced by the oligonucleotides of the invention has been shown to be specific for proliferating cells. Consequently, it is envisaged that treatment according to the invention will be free from harmful side effects arising from non-specific cell death. Cell death, having characteristics of programmed cell death, is induced in at least a part of the abnormally proliferating cellular population.
The oligonucleotides of the present invention can be administered in a variety of dosage forms adapted to the chosen route of administration. Thus, the oligonucleotides can be administered, orally or parenterally, intravenously, intra-arterially, intramuscularly, topically, subcutaneously, intradermally, vaginally, rectally, or nasally or as an inhalation. Additional routes of administration include intraocular, intravitreal, juxtascleral, subretinal, intraconjunctival, intra-articular, intra-lesional, intra-vesicular, intraportal, intraperitoneal or intrathecal routes. The oligonucleotides can be systemically administered by infusion or injection. Solutions of the oligonucleotides can be prepared in sterile water that can be mixed with a nontoxic surfactant. Dispersions can be prepared in glycerol liquid polyethylene glycols, and oils. Drug-eluting solid forms may also be used. The preparations may contain a preservative to prevent the growth of microorganisms.
Formulations for oral administration can be presented in the form of capsules, cachets, or tablets each containing a pharmaceutically acceptable amount of the oligonucleotide of the present invention. They can also be in the form of powder or granules, as a solution or suspension in an aqueous or non-aqueous liquid or an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The oligonucleotide may be presented as a bolus, electuary or paste.
Tablets may be made by compression or molding. One or more accessory ingredients such as binders, lubricants, diluents, preservatives, disintegrants, surface-active or dispersing agents may be added. The tablets may be compressed using a suitable machine. Molded tablets can be made by molding In a suitable machine a mixture of the powdered oligonucleotide moistened with an inert diluent. The tablets may further be optionally coated or formulated with hydroxypropylmethyl cellulose in varying proportions to provide a sustained release tablet.
In another aspect the oligonucleotides of the present invention can be formulated in the form of lozenges for oral application. The lozenges may contain a flavoring, as well as the oligonucleotides of the present invention in a pharmaceutically acceptable amount. Pastilles comprising the oligonucleotide in an inert vehicle such as gelatin and glycerin are also contemplated by the present invention.
The liquid formulation may contain inert diluents commonly used in the art such as water and other drinkable solvents. This formulation may contain solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, propylene glycol, various oils and glycerol.
Vaginal or rectal formulations can be prepared, for example, using cocoa butter, polyethylene glycol, a suppository wax or a salicylate. They can be delivered as a suppository and therefore are solid at room temperature, but liquid at body temperature and therefore melt in the rectum or vaginal cavity.
According to the Invention, the patient to be treated is a human or animal subject.
Moreover, because the oligonucleotides of the invention induce cell death rather than simply exerting a cytostatic effect, beneficial effects going beyond disease stabilization are to be expected. Such effects include cell shrinkage and regression of lesions and neoformations resulting from aberrant proliferation, for example tumour regression and vessel regression in cases of unwanted neovascularization.
In another embodiment the present invention relates to a method for shrinking cells and regressing lesions, said method comprising administering to a patient in need of such treatment a pharmaceutically acceptable amount of the oligonucleotides of the present invention in a pharmaceutically acceptable carrier. In this case the pharmaceutically acceptable amounts are those which cause shrinkage of the cells and regression of lesions.
In accordance with the invention, the in vivo cytotoxic effects of the oligonucleotides may be observed in a number of different forms, and may be tested using a variety of models. For example, in the area of ocular angiogenesis, a widely-recognized model is the laser-induced Choroidal Neovascularization (CNV) in rats, as described in the examples below, or any other suitable model representative of angiogenesis. The oligonucleotides of the invention, when administered after onset of aberrant proliferation, cause significant shrinkage of neoformations and prevent their further development. In a clinical setting, the oligonucleotides give rise to a regression of lesions through cell death which can be detected inter alia by in situ assays for apoptosis (e.g. TUNEL method) and/or caspase activation or other suitable in situ techniques.
Disorders involving aberrant cell proliferation which are treated or prevented in accordance with the present invention include angiogenesis related disorders, cancer, proliferative dermatological and muscle disorders and inflammatory diseases. The highly specific cytotoxic treatments according to the invention are particularly suitable for individuals in whom significant pathological cell proliferation has already taken place.
Angiogenesis related disorders include solid tumors; blood-borne tumors such as leukemias; tumor metastasis; benign tumors, for example hemangiomas, neurofibromas, trachomas; pre-malignant tumors; rheumatoid arthritis; psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, age-related macular degeneration (AMD), corneal graft rejection, neovascular glaucoma myocardial angiogenesis; plaque neovascularization; angiofibroma; restenosis, pre-neoplastic lesions.
In yet another embodiment, the present invention relates to a method of treating angiogenesis related disorders, the method comprising administering to a patient in need of such treatment a pharmaceutically acceptable amount of the cytotoxic oligonucleotides of the present invention in a pharmaceutically acceptable carrier. For ophthalmic applications the oligonucleotide of the present invention can be formulated in a solution or as eye drops or for injection or eye ointments. Conventional additives in this type of formulation include isotonizing agents such as sodium chloride, mannitol and sorbitol, buffers such as phosphate, borate or citrate, pH adjusting agents, preservatives such as paraoxybenzoic acid esters, sorbic acid and chlorhexidine and chelating agents.
Cancers which can be treated using the oligonucleotides of the invention include melanoma, skin, bladder, non-small cell lung, small cell lung, lung, hepatocarcinoma, retinoblastoma, astrocytoma, glioblastoma, neuroblastoma, head, neck, breast, pancreatic, prostate, renal, bone, testicular, ovarian, cervical, gastrointestinal lymphoma, brain, and colon cancer.
In yet another aspect the present invention concerns a method for treating cancer said method comprising administering to a patient in need of such treatment a pharmaceutically acceptable amount of an oligonucleotide of the present invention in a pharmaceutically acceptable carrier. This pharmaceutically acceptable amount may vary depending on the type of cancer one wants to treat.
Proliferative dermatologic disorders include conditions such as keloids, seborrheic keratosis, verruca arising from papilloma virus infection, eczema and psoriasis.
Thus, the present invention also relates to treating or preventing dermatological disorders by topically administering to a patient in need of such treatment a pharmaceutically acceptable amount of an oligonucleotide of the present invention in a pharmaceutically acceptable carrier. In this particular aspect the oligonucleotide can be formulated in a cream, a gel, lotions, ointments, foams, patches, solutions and sprays for topical application. In another aspect the oligonucleotides can be formulated into a skin covering or a dressing containing a pharmaceutically acceptable amount. In another aspect the oligonucleotides of the present invention can be formulated in a controlled release system. The skin coverings or dressing material can be any material used in the art such as bandage, gauze, sterile wrapping, hydrogel, hydrocolloid and similar materials. The oligonucleotide may also be administered via the intra-lesion route.
The ointments, pastes, creams and gels may contain in addition to the pharmaceutically acceptable amount of the oligonucieotide of the present invention, excipients such as animal and vegetable fats, silicones, starch, tragacanth, cellulose derivatives, oils, waxes, parrafins, zinc oxide and talc, or mixtures thereof.
Sprays can contain in addition to the oligonucleotides of the present invention, excipients such -as aluminium hydroxides and calcium silicates, as well as propellants such as chlorofluorohydrocarbons, butane and/or propane.
Inflammatory diseases include rheumatoid arthritis, uveitis and retinitis. In yet another aspect the present invention relates to a method of treating or preventing inflammatory diseases by administering to a patient in need of such treatment a pharmaceutically effective amount of the oligonucleotide of the present invention in a pharmaceutically acceptable carrier.
An oligonucleotide of the invention, which may be wholly synthetic, is administered to an animal or human in a suitable pharmaceutical carrier at an appropriate dose to generate the desired therapeutic effect i.e., the effect of induction of cell death.
The oligonucleotides may also be expressed in the target cells by transfection with a plasmid encoding for the sequence or by transduction with a genetically-engineered virus encoding the sequence.
Acceptable pharmaceutical carriers include aqueous solutions such as, but not limited to: water, saline, buffers, dextrose-saline. Non-aqueous carriers include oils, oil-water emulsions, liposomes, nanoparticulate carriers, cationic lipids, dendrimers, poly-lysine and other poly-cationic macromolecules or polymers. Both aqueous and non-aqueous carriers may include excipients, stabilisers, anti-microbials, bacteriostats, anti-oxidants as well as bulking agents.
Direct conjugation of the oligonucleotide to targeting ligands such as the RGB peptide sequence, folic acid, transferrin and cholesterol is considered for cell-specific delivery of the sequence when direct application of the sequence to the target cell is not practicable. Additionally, conjugation with other moieties such as poly-ethylene glycol, albumin and other carrier polymers and macromolecules may enhance the biopharmaceutical properties of the sequence. In particular, these may assist with preventing non-specific uptake of the sequence by non-target tissues.
The desired sequences can be administered alone or as a combination of several active sequences. Judicious mixing of several active sequences can result in synergistic activity.
As discussed above, the desired route of administration may include the intravenous, sub-cutaneous, inhalation, intramuscular, intradermal, oral, nasal, topical and rectal routes of administration. In addition, specific anatomical sites of injection such as intra-articular, intra-vesicular, intraperitoneal, intraocular, juxtascleral, subretinal, intravitreal, transdermal may also be used to achieve the desired therapeutic effect. In general, the preferred routes of administration for particular medical conditions are exemplified below in Table 3.
The mode of administration will depend on the route of delivery and will include but not be limited to the use of syringe, catheter, suppository, nebulizer, inhaler, particle-gun, transdermal patch, iontophoresis device, implant, stent, cream, ointment, salve, drops, tablet, capsule and powder.
The required dose is commensurate with the mode of administration and the properties of the sequence in relation to administration of the said sequence.
The duration and frequency of treatment will be as required for the generation and maintenance of the desired therapeutic effect.
Treatment with the sequence may take the form of monotherapy or be part of a broader treatment involving other active treatment modalities as required, for example with one or more additional pharmaceutical agents as a combined preparation for separate, simultaneous or sequential use in therapy.
A number of embodiments of the Invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention.
The SV-40 transformed human dermal microvascular endothelial cell line (HMEC-1) was maintained in MCDB131 medium containing 10% fetal bovine serum (FBS), 2 mM L-glutamine, 10 ng/mL epidermal growth factor, 1 μg/mL hydrocortisone and 5 U/mL penicillin-streptomycin. The SV-40 transformed rat smooth muscle cells (RSMC) were grown in Waymouth's medium containing 10% FBS, 2-mM L-glutami ne and 5 U/mL penicillin-streptomycin. Cytotoxicity assays were performed as follows: cells were seeded at 5000 cells per well in 96-well black microclear plates (Greiner). After 24 hours, HMEC-1 cells in growth medium containing 5% FBS or RSMCs in growth medium containing 10% FBS were transfected with different concentrations of ODNs in triplicates using FuGENE6 (Roche). FuGENE6: DNA ratio of 3:1 (μL FuGENE6/μg DNA) was used for all transfections. FuGENE6 reagent alone was used as the mock transfection control. Complexation was routinely performed at an ODN concentration of 2 μM and the DNA complex was then serially diluted two-fold prior to a further 10× dilution upon addition to cells. Cell survival was assessed 48 hours post-transfection using a fluorometric cell viability assay for viable cell dehydrogenase activity (CellTiter™-Blue Cell Viability Assay; Promega). Media in wells were replaced with 100 μL OptiMEM to which 20 μL of the assay mix was added. After 2 hours at 37° C., fluorescence was measured at 544Ex/590Em using FLUOstar OPTIMA (BMG Labtechnologies).
TGAGGGGCAGGCTAGCTACAACGACGTCGTGA(3′-3′C)
TGAGGGGCAAGCAACATCGATCGGCGTCGTGA(3′-3′C)
TGAGGGGCAGGCTAGCTACAACGACGTCGCGG(3′-3′G)
CGGGAGGAAGGCTAGCTACAACGAGAGGCGTTG(3′-3′T)
A comprehensive list of oligonucleotides that induced HMEC-1 (human microvascular endothelial cell) cell death at less than or equal to 100 nM is shown in Table 1. Oligonucleotides which were ineffective (at ≦100 nM) are presented in Table 2. Representative dose response curves for oligonucleotides from Tables 1 and 2 are shown in the Figures.
Fully phosphorothioated antisense molecules reported to have “pleiotropic”, non-antisense-mediated effects due to CpG or polyG motifs were tested against HMEC-1 cells. These include the antisense to c-myb, GTGCCGGGGTCTTCGGGC (Oligo 32) (Anfossi et al, 1989) and the antisense to bcl-2, G3139, TCTCCCAGCGTGCGCCAT (Oligo 33) (Cotter et al., 1994). Both molecules were inactive (
Additional oligonucleotides with 5′ G-rich sequences that have been reported to act by non-antisense mechanisms were investigated using the same procedures.
The nucleolin binding GRO29A (Oligo 84) was without activity over the same concentration range. Likewise, Oligo 87, a topoisomerase I binding aptamer was without activity. Oligo 86, a 36mer ATM-inducing oligonucleotide (nur-E-karnal, JBC 278:12475-12481, 2003) was active, but only appreciably so in the HMEC-1 cells and not the RSMC. Investigation of ATM function in response to Oligo 4 in HMEC-1 cells showed a lack of induction of p53 and no increased phosphorylation of NBS-1 (an ATM substrate). Furthermore, the cytotoxicity of Oligo 4 was not inhibited by Wortmannin, an inhibitor of ATM. This indicates that Oligo 86 acts on cells by a mechanism different to that of the class of oligonucleotides according to the present invention.
There are several classes of immunostimulatory oligonucleotides and these are broadly referred to as CpG oligonucleotide's. The immunostimulatory mechanism has been shown to involve the Toll-like receptor 9 (TLR9). It has evolved to recognize the presence of bacterial pathogens, exploiting the fact that unmethylated CpG motifs are much less frequent in mammalian genomes as compared to bacteria.
Many of the active oligonucleotides, in the context of this invention, contain several CpG motifs, although none appeared to have the optimum flanking sequences that have been documented by other researchers. For example, Oligo 4 contains 3 CpG motifs:
CGGGAGGAAGGCTAGCTACAACGAGAGGCGTTG(3′-3′T)
Therefore, the cytotoxicity of several variants of Oligo 4 were tested in the Cell-Titer Blue assay with HMEC-1 cells as described in other sections. It is demonstrated that these motifs do not account for its cytotoxic effect (3′-3′T denotes a 3′-inverted T modification).
a) Inhibition of Endosomal Maturation:
This was first ascertained by using chloroquine, an inhibitor of endosomal maturation. CpG ODN activation is dependent on internalization and endosomal maturation in macrophages and other immune cells. CpG DNA is recognized by toll-like receptor 9 (TLR-9), which is expressed mainly on the inner surface of endosomes (Hemmi et al, 2000). Oligo 4 retained substantial activity relative to the inactive control oligonucleotide (Oligo 7) in HMEC-1 cells preincubated with 25-100 μM chloroquine, although chloroquine alone was slightly toxic to the cells (
The inability of chloroquine to diminish the activity of Oligo 4 (as shown in
Moreover, HEK-293 cells do not express the TLR-9 receptor and these cells have been shown to be sensitive to CpG oligonucleotides only following transfection of this cell line with recombinant TLR-9. However, Oligo 4 was fully active in HEK-293 cells, indicating that the mechanism of toxicity of these novel oligonucleotides is independent of the CpG receptor TLR-9.
b) Methylation of CpG Cytosines:
Secondly, methylation of the CpG cytosines, which is known to prevent CpG immunostimulation (Goeckeritz, et al., 1999), produced an oligonucleotide (Oligo 9) with similar potency to Oligo 4. Oligo 10, in which two of the three CpG dinucleotides were inverted into GC dinucleotides
was less potent (
c) Effect of CpG Oligonucleotides:
Thirdly, two CpG inhibitory ODNs were tested:
Oligo 36 is a repetitive element in mammalian telomeres which blocks the colocalization of CpG DNA with TLR-9 within endosomal vesicles (Gursel, 2003). Oligo 37 is a CpG inhibitory sequence motif which blocks AP-1 transcriptional activation by CpG DNA (Lenert, 2003).
Both ODNs failed to inhibit the cytotoxic effect of Oligo 4 further demonstrating that CpG immune activation is not involved in the process (
This example demonstrates that the G triplet at the 5′end of the oligonucleotides is essential for cytotoxic activity.
a) Mutation Analysis:
Base mutation of the first guanosine of oligo 4 to thymine:
yielded an oligonucleotide (Oligo 34) with no cytotoxic activity (
Deleting two bases at the 5′ (which includes the first G of the triplet) and 3′ends:
also abolished this activity (
b) Formation of Tertiary Structures:
The involvement of the G triplet in the formation of tertiary structures such as G quadruplexes was tested by substituting either one of the three Gs in the triplet with 7-deaza guanine (7-dG), which inhibits the formation of Hoogsteen-type hydrogen bonds between the guanines (Beriimetskaya et al., 1997).
As shown in
To further investigate the possible role of tertiary structures in the cytotoxic effect, circular dichroism studies, examining the rotational bias in the absorption of polarized light, were carried out. Solutions of G-quartet oligonucleotides have characteristic spectra when examined by circular dichroism (CD). Circular dichroism studies of Oligo 4 in solution were performed by Dr Max Keniry from the Australian National University. Solutions of Oligo 4 were prepared at a final concentration of 25 μmL (A260=0.73) in 10 mM Tris pH 7.0 containing either 100 mM NaCl (Sample A) or 50 mM KCl (Sample B). Although previous experiments had indicated that the choice of monovalent cation during complexation did not impact on Oligo 4 cytotoxicity, the presence of each of K+ and Na+ was studied. Spectra were recorded at room temperature on a Jobin Yvon CD6 spectrometer using a 1 cm path length. Both samples demonstrated significant peaks at λ=218 and 275 nm, a trough at λ 245 nm and a cross-over point at λ 260 nm. This CD spectrum is typical of unstructured DNA, indicating the lack of formation of quadruplex structures under these conditions. Folded quadruplexes have a characteristic positive CD band at 295 nm and a negative band at 260 nm, whereas linear quadruplexes have a strong positive band at 260 nm and a negative band at 240 nm. Therefore, this indicates that the mechanism of cytotoxicity of Oligo 4 is different from that of other reported G-rich oligonucleotides, for which activity correlated closely with the ability to form G-quadruplex structures.
Besides the requirement of a polyG motif at the 5′end, there also appears to be a length requirement for this cytotoxic effect. This was tested by adding random nucleotides to the first 10 bases of Oligo 4 (CGGGAGGMG). Results show that the cytotoxic effect was length-dependent; the potency of the ODN increased as the 3′end was extended with random bases (
Similar results were obtained with the analogous variations to Oligo 1, with a reduced potency of the shorter tailed random oligonucleotide mixtures.
Finally, the same approach was taken using the sequence of GGGAGGAAAG as the 5′ sequence for random tailed oligonucleotide mixtures. Again, there was a length-dependence of the cytotoxic potential, with the 35 mer (Oligo 72) being the most potent.
The sequence requirements for the 5′ terminus were further defined using 35 mer variants of Oligo 13, in which the 5′ sequence was increasingly replaced with random base mixes. Although Oligo 65, with only the first 4 bases of Oligo 4, still retained some activity, the requirement for a longer purine-rich stretch was seen with Oligo 63 and Oligo 13. In Oligo 65, although the defined G-rich region in the non-random part of the molecule is only 4 bases long, one skilled in the art would appreciate that a substantial proportion of this synthetic random pool would meet the required structural criteria. Indeed, by probability alone, one half of the random pool mix would satisfy the requirement for a 4 purine stretch containing one guanosine triplet.
Similar experiments with the first 10 bases of Oligo 1 (Oligo 66) provided further supporting data and, in particular, further stressed the need for 3 consecutive guanosines in this sequence. These results are shown in
The fact that mixtures of random tailed oligonucleotides such as Oligo 13 or Oligo 66 are as active as Oligo 4 and Oligo 1, respectively, appears to indicate a lack of specific sequence requirements in the non 5′ sequence of these active oligonucleotides. However, Oligo 58 was inactive and Oligo 10 less active than Oligo 4, indicating that some tail sequences might have deleterious effects on the desired biological activity. Oligo 60, which has a G-free tail, was also substantially inactive. Oligonucleotides with tails consisting of ordered repeats of TAG (Oligo 70) and TAGGAT (Oligo 71), respectively also had reduced activity.
A series of oligonucleotides entirely composed of purines with repeated GGG sequences was tested. Again, there was a marked dependency on length with the 16 mer oligonucleotide (Oligo 77) having little activity. Although less active than Oligo 4 in HMEC-1, the 20 mer Oligo 78 had some activity, indicating that for some sequences, reduced length requirements might be obtainable. Nevertheless, Oligo 78 was clearly less potent than its longer congeners, particularly when tested with RSMC cells. The hexameric repeat oligonucleotide (Oligo 82) was more potent than Oligo 4 in HMEC-1 cells and had similar potency against the RSMC cells.
The requirement for single strandedness was investigated with Oligo 4. The complementary sequence to Oligo 4 (Oligo 61—inactive) was synthesised and annealed to Oligo 4 prior to complexation into HMEC-1 cells. As shown in
Furthermore, oligonucleotides that are predicted to hybridize substantially in the 5′ region, i.e. form double-stranded regions within the 5′ region, could have diminished cytotoxic activity as exemplified by Oligo 47. Several available software programmes are able to predict DNA folding and these can be used to screen possible candidates for potential folding in this region, permitting elimination of such molecules.
The activity of Oligo 4 was investigated in a variety of cell lines of different tissue- and species origin. The results are shown in
Oligo 4 showed concentration-dependent cytotoxic activities in many of the cell lines tested which include mouse embryonic fibroblasts (3T3), transformed human embryonic kidney cells (HEK 293), human cervical cancer cell lines (HeLa and CaSki) and lung carcinoma (A549). A range in potency was observed in the human cancer cell lines tested.
Chemical modifications designed to improve intracellular stability and uptake were envisaged to improve the cytotoxic activity of these ODNs. Results of the effect of different chemical modifications on Oligos 1 and 4 are presented in
Protecting the termini of the sequence from exonucleases by using partial phosphorothioate modifications (i.e. 5+5 PS denotes five phosphorothioate linkages at both 5′ and 3′ends; Oligo 18), and 5′ and 3′ inversions (Oligos 14 & 15) yielded active ODNs so that dose-dependent cytotoxic effects were maintained. A bulky 3′ modification such as cholesterol, designed for target cell-specific delivery, also preserved activity (Oligo 11). 2′O-methyl modifications were partially tolerated (Oligo 20) whereas total replacement of the phosphodiester backbone with phosphorothioate linkages (Oligo 44) greatly suppressed the activity.
The HMEC-1 cell cytotoxicity work with Oligo 4 revealed morphological evidence of cell death at early times during the incubation (blebbing, nucleolar condensation) and by 48 hours, very few live cells remained in the wells treated at the high end of the concentration range. Extensive debris formation was observed in these wells. The survival decline in the presence of Oligo 4 could be due to induction of either cell necrosis or apoptosis. To decipher the specific mechanism, flow cytometry was employed in examining nuclear DNA content and measuring plasma membrane asymmetry and caspase activation. All studies were performed using HMEC-1 cells (1.2×105 cells in a 6-well plate) transfected with either Oligo 4, or its “partially scrambled” counterpart which lacks the polyG motif, Oligo 7, GCGACGTGAGGCTAGCTACAACGAGTGGAGGAG(3′-3′T), complexed with Fugene6 at 100 nM final concentration. FuGENE6 reagent alone was used as the mock transfection control and FACS analyses were performed 24 h or 48 h post-transfection.
a) Cell-Cycle Analyses: ODNs Cause Accumulation of sub G0 Cells:
For DNA cell cycle analyses, cells were harvested 24 h post transfection, permeabilised with 1% (v/v) Triton X-100/PBS and labeled with 10 μg/mI Propidium Iodide (PI). DNA content distribution was analysed and the percentage of cells in each distinct phase of the cell cycle is represented in
b) Annexin V Analysis:
Forms of programmed cell death are often accompanied in the early stages by the translocation of the phospholipid phosphatidylserine (PS) from the inner to the outer leaflet of the plasma membrane. Once exposed extracellularly, PS can bind to Annexin V, a phospholipid binding protein with high affinity for PS. Later in programmed cell death, cells may become positive also for Propidium Iodide staining.
Cells were dual labelled with both FITC-conjugated antibody against Annexin V and Propidium Iodide (PI). PI intercalates double-stranded DNA of non-viable cells that have lost plasma membrane integrity as occurs in both necrosis and late stage apoptosis. Analyses of the dual labeled cells at both 24 and 48 h post transfection are represented as dot plots in
c) Activation of Caspases:
Apoptosis, a form of programmed cell death, usually involves activation of caspases in the death signaling pathways. In a concurrent set of experiments, transfected cells were stained with CaspACE FITC-VAD-FMK (Promega, Wis.), a polycaspase substrate which irreversibly binds to the intracellular active site of caspases. As shown in
To investigate the potential involvement of initiator caspases -8 and -10 (which are immediately downstream of the death receptors Fas, TRAIL and TNFR1) through their recruitment via the death effector domain of the receptor signaling complex, FAM-conjugated caspase substrates (Immunochemistry Technologies, Minn.), LETD-FMK (caspase-8) and AEVD-FMK (caspase-10) were used and transfected cells were analysed. Results are shown as dot plots in
Mock and Oligo 7 transfected cells showed a basal 10% caspase-8 activation. Cells transfected with the polyG rich Oligo 4, however, showed a significant increase in caspase-8 activation reaching approximately 36%. No significant activation of caspase-10 was observed following mock, Oligo 4, or Oligo 7′transfection (data not shown) ruling out the involvement of caspase-10 in the cascade. The observed induction of the cell death pathways by the polyG rich Oligo 4 may therefore be accompanied by caspase activation, more specifically by initiator caspase-8.
The role of mitochondrial depolarization in the death of treated cells was investigated by FACS using the mitochondrial dye JC-1. Representative analyses are shown in
Both Oligo 82 and Oligo 79 induced mitochondrial depolarization to a similar extent as Oligo 1 and Oligo 4, suggesting that these oligonucleotides all share a common pathway of inducing cell death.
Using a NFkB-luciferase reporter plasmid, it was found that Oligo 4 reduced NFkB signalling in HMEC-1 cells when transfected 18 hours prior to evaluation of luciferase activity. This effect was also observed when HMEC-1 cells were stimulated with IL-1 beta and TNFalpha 5 hours prior to the luciferase reading.
Also, ICAM-1 protein expression on the surface of HMEC-1 cells, when induced by IL-1beta for 5 hours, was found to be inhibited by Oligo 4 when transfected into the cells 18 hours prior.
Because NFkB and ICAM-1 are important mediators of inflammatory response and leucocyte migration, this indicates that inter alia, these active oligonucleotides may be of use in clinical disorders in which inflammation is important. Also, Oligo 4 Induced the cell surface expression of FasL relative to the inactive oligonucleotide control (Oligo 7). Because FasL is deregulated in ocular angiogenesis, this indicates potential utility of the oligonucleotides of the invention in the treatment of AMD and diabetic retinopathy.
3. The ODNs of the Invention have Insignificant Cytotoxic Activity on Quiescent Cells
This example demonstrates that cells were most sensitive to the effects of Oligo 1 and Oligo 4 when grown under conditions of exponential growth.
HMEC-1 cells are known to exhibit some degree of contact inhibition and when seeded at 50,000/ well rather than the conventional 4,000/well, they formed a dense multilayer. Oligo 4 had no significant activity under these conditions.
This was shown not to be due to reduced transfection of the oligonucleotide with an Oregon green labelled Oligo 4. By FACS, transfection efficiency was ˜60% at 24 hours with both seeding densities.
A similar inhibition of activity of Oligo 4 due to contact inhibition was observed with two other cell lines, namely murine 3T3 cells and human ARPE-19 cells (human retinal pigmented epithelium).
Specifically, ARPE-19 cells were seeded at “low” and “high” densities of 4,000 and 50,000 cells per well, respectively. In the “high” seeding density wells, the ARPE cells rapidly reached a contact-inhibited quiescent state as determined by the formation of an organised monolayer.
Oligonucleotides bearing the motif disclosed in the invention (eg Oligo 4) had potent activity against the rapidly dividing “active” cells when they were incubated for 48 hours with varying concentrations of oligonucleotide. In contrast, the effect was abolished (at concentrations <0.2 microM) for cells that were quiescent (
Inactive oligonucleotides (eg Oligo 7) did not have appreciable activity in either set of conditions. Similar results were obtained with 3T3 (murine fibroblasts) which also attain contact-inhibited quiescence. This property indicates that cells are more susceptible to the oligonucleotides of the invention under conditions of active proliferation and/or migration. The oligonucleotides may have utility in disorders characterized by abnormal RPE, endothelium and fibroblast proliferation such as angiogenesis, proliferative retinal vitreopathy and scarring, granuloma etc.
The binding protein sensor for Oligo 4 was identified as follows.
A 3′biotinylated analog of Oligo 4 was synthesized:
and tested for cytotoxic activity as described previously. This oligonucleotide had equal activity against HMEC-1 cells.
In a separate experiment, total protein lysates of HMEC-1 cells were prepared in 2 mL MPER extraction buffer (Pierce, Rockford, Ill.). Streptavidin affinity beads were washed twice and resuspended in 2× affinity buffer (10 mM Tris-HCl, 1 mM EDTA, 2M NaCl (pH 7.4) and incubated for 10 minutes with an equal volume of 2 microM Oligo 83. The beads were then washed three times with binding buffer (20 mM HEPES, 100 mM KCl, 0.2 mM EDTA, 0.01% NP-40 and 10% glycerol, pH 7.5) and incubated with the protein lysate for 10 minutes at room temperature. The beads were washed 20 times with binding buffer and non-specific binding proteins eluted with two washes of a 1 microM solution of the non-cytotoxic oligonucleotide (Oligo 7) in binding buffer with alternating buffer washes.
Oligo 4 binding proteins were then eluted with two aliquots of Oligo 4 (1 microM) alternating with binding buffer washes. Aliquots of the Oligo 4 elutions as well as the Oligo 7 washes were concentrated (10000 mwt Centricon, 13800 g, 15 oC, 70 min) and electrophoresed under denaturing conditions on a gradient (4-12%) polyacrylamide gel. The gel was silver stained. Elutions with the inactive Oligo 7 yielded a large number of bands including a predominant band at ˜39 kDa. In contrast, the elution with Oligo 4 produced an intense-staining band at ˜51 kDa as well as 4-6 minor bands. The major band was identified to be eukaryotic elongation factor 1 alpha 1 by mass spectrometric analysis of a trypsin digested sample.
A further correlation for the binding of the active oligonucleotides, as defined in this invention, relative to those with little or no cytotoxic activity was sought. Briefly, beads prepared with Oligo 83 and processed as above with cell proteins were washed as above with Oligo 7. The beads fraction was then split 6 ways. These fractions were then incubated with 0.5 mL solutions of Oligo 4 (active), Oligo 1 (active), Oligo 34 (inactive variant of Oligo 4), Oligo 82 (purine-only active), as well as an additional oligonucleotide:
Oligo 85 is a 27-mer oligonucleotide capable of binding to a nuclear, basic and cancer-specific isoform of eEF1alpha1 (Dapas et al, Eur. J. Biochem, 270: 3251-3262).
Beads eluted with Oligos 4, 1 and 82 all produced a strong 51 kDa band, whereas Oligos 34 and 85 did not. This supports a possible correlation between cytotoxic activity and ability to bind at the Oligo 4 binding site of eEF1alpha1. Although Oligo 85 has been reported to bind to a cancer-specific isoform of this protein, it did not displace Oligo 4 from the affinity beads. This indicates that the binding of Oligo 85 to eEF1alpha1 is either isoform specific or is at a site distinct from that for Oligo 4. This is further supported by the fact that Oligo 85 was found to be inactive in HMEC-1 cells.
The following tests (a) to (e) are used in determining whether oligonucleotides fitting the design rules of the invention have the capacity to induce cell death according to the invention
a) Cytotoxicitv Assay:
b) Assessment of Microscopic Signs of Cell Death:
c) Assessment of Depolarization of Mitochondria
d) Activation of Casoases:
e) Staining with Annexin V:
Although the above mentioned tests (a) to (e) are described using HMEC-1 cells, several other readily cultured cell lines can be used to demonstrate the activity of the oligonucleotides disclosed in this invention. Notably, 3T3 fibroblasts, HEK293, HeLa, PC3 are amongst those in which the activity of the said oligonucleotides is exhibited. In contrast, the oligonucleotides described do not demonstrate cytotoxicity over the 0-200 nM concentration range when transfected into either human colon carcinoma cells HCT-116 and human breast cancer cells MbA-MB-231 using Fugene6 with the previously described conditions.
Cytotoxic ODNs can be further evaluated in vivo for inhibition of disease-related angiogenesis according to a number of validated preclinical models. For example, in the area of ocular angiogenesis, a widely-recognized model is the laser-induced Choroidal Neovascularization (CNV) model in rats.
Accordingly, a number of rcs/rdy+ pigmented rats are obtained. Rats are housed in cages at a constant temperature of 22° C, with a 12:1.2 hour light/dark cycle (light on at 0800 hours) and food and water are made available ad libitum. Rats are anaesthetised by intramuscular injection of xylazine (6 mg/kg, Bayer AG, Germany) and ketamine (50 mg/kg, Lambert Company, USA) injection. The. pupils are dilated with 2.5% phenylephrine and 1% Mydriacyl at least 10 minutes before photography and or laser photocoagulation.
Choroidal neovascularisation (CNV) is induced by krypton laser photocoagulation. This is performed using laser irradiation to either the left or alternatively, the right eye of each animal from all treatment groups through a Zeiss slit lamp. A total of 6-11 laser burns are applied to each eye surrounding the optic nerve at the posterior pole at a setting of 100 μm diameter, 0.1 seconds duration and 150 mW intensity.
At a suitable time following laser injury, the oligonucleotides are injected into the affected eyes. The suitable time can be the day following laser induction, or for an assessment against established CNV, the injections can be performed several days or weeks following injury. Intravitreal injections of the oligonucleotides are performed by inserting a 30- or 32-gauge needle into the vitreous at a site 1 mm posterior to the limbus of the eye. Insertion and infusion can be performed and directly viewed through an operating microscope. Care is taken not to injure the lens or the retina. Ideally, the test compounds are placed in the superior and peripheral vitreous cavity. An injection volume of 1 microlitre is appropriate.
Periodically after treatment, the neoangiogenesis is evaluated by either imaging and/or direct sampling (eg histology, immunohistochemistry). In all cases, the assessment of CNV is best performed by a skilled operator blinded to the actual treatment to ensure a lack of bias in the recording of the Information.
An example of a direct imaging method is Colour Fundus Photography (CFP). Again, under anaesthesia as described above, the pupils are dilated with 2.5% phenylephrine and 1% Mydriacyl at least 10 minutes before photography. The rat fundus is then photographed with a small animal fundus camera using the appropriate film.
Alternatively, or preferably in addition to FCP, fluorescein angiography is used to image the vessels and areas of vascular leakage in the retina. This is performed on all of the rats following the intraperitoneal injection of 0.3 to 0.4 ml 10% sodium fluorescein. The retinal vasculature is then photographed using the same camera as used for FCP but with a barrier filter for fluorescein angiography added. Single photographs can be taken at 0.5-1 minute intervals using monochrome Kodak 400 ASA professional film immediately after the administration of sodium fluorescein. The extent of fluorescein leakage is scored by a trained operator or alternatively, by other methods known in the art for measuring leakage. The mean severity scores from each of the time points are compared by ANOVA with a post hoc Fishers LSD analysis and differences considered significant at p<0.05. In addition, the frequency of each lesion score is counted, tabulated and represented graphically.
Rats treated with active oligonucleotides according to the present invention are expected to show a significantly lower severity score than control animals. Alternatively, or in addition, rats can be euthanased at selected time points following treatment (for example 7, 14 and 28 days post injection) with an overdose of sodium pentabarbital. For paraffin sectioning, eyes are enucleated and fixed for 4 hours in 10% neutral buffered saline or 4% paraformaldehyde. After routine processing through graded alcohol, the eyes are embedded in paraffin and sectioned at 5 μm, mounted on sialinated slides and stained with haematoxylin and eosin (H&E) for histopathological examination. A reduction in the number and severity of lesions is expected to be seen with samples treated by active oligonucleotides of the invention.
While the invention has been described in terms of various preferred embodiments, the skilled artisan will appreciate that various modifications, substitutions, omissions and changes may be made without departing from the scope thereof. Accordingly, it is intended that the scope of the present invention be limited by the scope of the following claims, including equivalents thereof.
Anfossi G, Gewirtz A M and Calabretta B. 1989: An oligomer complementary to c-myb-encoded mRNA inhibits proliferation of human myeloid leukemia cell lines. Proc. Natl. Acad. Sci. USA 86: 3379-83.
Benimetskaya L, Berton M, Kolbanovsky A, Benimetsky S. and Stein C A. 1997. Formation of a G-tetrad and higher order structures correlates with biological activity of the RelA (NF-kappaB p 64) “antisense” oligonucleotide. Nucleic Acids Res. 25: 2648-2656.
Burgstaller P, Jenne A and Blind M. 2002. Aptamers and aptazymes: accelerating small molecule drug discovery. Curr. Opin. Drug Discov. Devel. 5: 690-700.
Cotter F E, Johnson P, Hall P, Pocock C, Al Mahdi N, Cowell J K and Morgan G. 1994. Antisense oligonucleotides suppress B-cell lymphoma growth in a SCID-hu mouse model. Oncogene 9: 3049-55.
Dapas et al., 2003, Eur. J. Biochem., 270: 3251-3262.
Ejiri S. I., 2002, Biosci. Biotechnol. Biochem. 66(1), 1-21.
Goeckeritz B E, Flora M, Witherspoon K, Vos Q, Lees A, Dennis G J, Pisetsky D S, Kloinman D M, Snapper C M and Mond J J. 1999. Multivalent cross-linking of membrane Ig sensitizes murine B cells to a broader spectrum of CpG-contgaining oligodeoxynucleotide motifs, including their methylated counterparts, for stimulation of proliferation and Ig secretion. Int. Immunol. 11:1693.
Gursel I, Gursel M, Yamada H, lshii K J, Takeshita F and Klinman D M. 2003. Repetitive elements in mammalian telomeres suppress bacterial DNA-induced immune activation. J. Immunol. 171:1393-1400.
Guvakova M A, Yakubov L A, Vlodavsky I, Tonkinson J L and Stein C A. 1995. Phosphorothioate oligodeoxynucleotides bind to basic fibroblast growth factor, inhibit its binding to cell surface receptors, and remove it from low affinity binding sites on extracellular matrix. J. Biol. Chem. 270: 2620-27.
Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, and Akira S. 2000. A toll-like receptor recognizes bacterial DNA. Nature 408: 740-5.
Jueliger S and Bates P J. 2004. Expression of fluorescent-tagged nucleolin and co-localization with G-rich oligonucleotides in lung cancer cells. Proceedings of the AACR 45.
Khachigian L. et al. 2002, J. Biol. Chem., vol 277, n° 25, pp 22985-22991.
Lenert P, Yi A-K, Krieg A M, Stunz L L and Ashman R F. Inhibitory oligonucleotides block the induction of AP-1 transcription factor by stimulatory CpG oligonucleotides in B cells. 2003. Antisense Nucleic Acid Drug Dev 13: 143-150.
Sun L-Q. et al., 1999, J. Biol. Chem., vol 274, n° 24, pp 17236-17241.
Wu C C N, Lee J, Raz E, Corr M and Carson D A. 2004. Necessity of oligonucleotide aggregation for toll-like receptor 9 activation. J. Biol. Chem. 279: 33071-8
Wyatt J R, Davis P W and Freier S M. 1996. Kinetics of G-quartet-mediated tetramer formation. Biochemistiy 35: 8002-8.
Yaswen P, Stampfer M R, Ghosh K and Cohen J S. 1993. Effects of sequence of thioated oligonucleotides on cultured human mammary epithelial cells. Antisense Res. Dev. 3: 67-77.
Zhang G, et al., 2004, Journal of the National Cancer Institute, Vol. 96, n°9, pp 683-696
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/IB06/02887 | 6/28/2006 | WO | 00 | 12/21/2007 |
| Number | Date | Country | |
|---|---|---|---|
| 60694745 | Jun 2005 | US |
