Patent Application
20210010015
The present description relates to producing metabolites in a recombinant host cell by metabolic engineering. In particular the invention provides a novel method, a novel recombinant host cell and a novel production system for producing psilocybin and related compounds.
Psilocybin is currently being evaluated (phase II clinical trials) as highly promising drug for medical use for treatment of depression, anxiety and other mental illnesses, such as obsessive-compulsive disorder [1,2].
Psilocybin is nowadays being produced for medical use by multistep chemical organic syntheses [3,4]. Previous methods for psilocybin production are relying on the use of harsh chemicals, resulting in accumulation of toxic waste, and these methods could be inefficient and not environmental friendly. Alternatively, psilocybin can be extracted from natural sources, as it is bio-synthesized in certain species of mushrooms. However, this method relies on supply of the mushrooms, whose production could be inconsistent and difficult to control.
Genes responsible for biosynthesis of psilocybin in basidiomycete mushrooms have been identified and disclosed in a paper by Fricke et al. (2017) [5]. The paper states that genetic manipulation of the basidiomycete genes is not straightforward (p. 12353 left column, first paragraph) and teaches to use in vitro approach for biosynthesis of compounds.
It is an object of the present invention to solve or alleviate at least some of the above problems of prior technology used to produce psilocybin.
According to the first aspect there is provided a recombinant host cell comprising:
According to an aspect of the invention is provided a recombinant host cell comprising:
According to another aspect there is provided a recombinant host cell comprising at least one heterologous polynucleotide encoding PsiD, PsiH, PsiK, and PsiM; wherein the at least one heterologous polynucleotide(s) is/are operably linked to at least one promoter which is capable of directing expression of said heterologous polynucleotide(s) in the host cell.
According to the second aspect there is provided a method for producing metabolites comprising
According to the third aspect there is provided a psilocybin production system comprising:
Different embodiments of the present invention will be illustrated or have been illustrated only in connection with some aspects of the invention. A skilled person appreciates that any embodiment of an aspect of the invention may apply to the same aspect of the invention or to other aspects of the invention.
Psilocybe
cubensis
Saccharomyces
cerevisiae
Psilocybe
cyanescens
Saccharomyces
cerevisiae
Psilocybe
cubensis
Saccharomyces
cerevisiae
Psilocybe
cyanescens
Saccharomyces
cerevisiae
Psilocybe
cubensis
Saccharomyces
cerevisiae
Psilocybe
cyanescens
Saccharomyces
cerevisiae
Psilocybe
cubensis
Saccharomyces
cerevisiae
Psilocybe
cyanescens
Saccharomyces
cerevisiae
Psilocybe
cubensis
Aspergillus
niger
Psilocybe
cyanescens
Aspergillus
niger
Psilocybe
cubensis
Aspergillus
niger
Psilocybe
cyanescens
Aspergillus
niger
Psilocybe
cubensis
Aspergillus
niger
Psilocybe
cyanescens
Aspergillus
niger
Psilocybe
cubensis
Aspergillus
niger
Psilocybe
cyanescens
Aspergillus
niger
Saccharomyces
cerevisiae
Saccharomyces
cerevisiae
Aspergillus
niger
Aspergillus
niger
SEQ ID NO: 1 is a DNA sequence encoding the PsiD enzyme from Psilocybe cubensis with codons suitable for expression in an AT-rich host, such as Saccharomyces cerevisiae
SEQ ID NO: 2 is a DNA sequence encoding the PsiD enzyme from Psilocybe cyanescens with codons suitable for expression in an AT-rich host, such as Saccharomyces cerevisiae
SEQ ID NO: 3 is a DNA sequence encoding the PsiM enzyme from Psilocybe cubensis with codons suitable for expression in an AT-rich host, such as Saccharomyces cerevisiae
SEQ ID NO: 4 is a DNA sequence encoding the PsiM enzyme from Psilocybe cyanescens with codons suitable for expression in an AT-rich host, such as Saccharomyces cerevisiae
SEQ ID NO: 5 is a DNA sequence encoding the PsiH enzyme from Psilocybe cubensis with codons suitable for expression in an AT-rich host, such as Saccharomyces cerevisiae
SEQ ID NO: 6 is a DNA sequence encoding the PsiH enzyme from Psilocybe cyanescens with codons suitable for expression in an AT-rich host, such as Saccharomyces cerevisiae
SEQ ID NO: 7 is a DNA sequence encoding the PsiK enzyme from Psilocybe cubensis with codons suitable for expression in an AT-rich host, such as Saccharomyces cerevisiae
SEQ ID NO: 8 is a DNA sequence encoding the PsiK enzyme from Psilocybe cyanescens with codons suitable for expression in an AT-rich host, such as Saccharomyces cerevisiae
SEQ ID NO: 9 is a DNA sequence encoding the PsiD enzyme from Psilocybe cubensis with codons suitable for expression in a GC-rich host, such as Aspergillus niger
SEQ ID NO: 10 is a DNA sequence encoding the PsiD enzyme from Psilocybe cyanescens with codons suitable for expression in a GC-rich host, such as Aspergillus niger
SEQ ID NO: 11 is a DNA sequence encoding the PsiM enzyme from Psilocybe cubensis with codons suitable for expression in a GC-rich host, such as Aspergillus niger
SEQ ID NO: 12 is a DNA sequence encoding the PsiM enzyme from Psilocybe cyanescens with codons suitable for expression in a GC-rich host, such as Aspergillus niger
SEQ ID NO: 13 is a DNA sequence encoding the PsiH enzyme from Psilocybe cubensis with codons suitable for expression in a GC-rich host, such as Aspergillus niger
SEQ ID NO: 14 is a DNA sequence encoding the PsiH enzyme from Psilocybe cyanescens with codons suitable for expression in a GC-rich host, such as Aspergillus niger
SEQ ID NO: 15 is a DNA sequence encoding the PsiK enzyme from Psilocybe cubensis with codons suitable for expression in a GC-rich host, such as Aspergillus niger
SEQ ID NO: 16 is a DNA sequence encoding the PsiK enzyme from Psilocybe cyanescens with codons suitable for expression in a GC-rich host, such as Aspergillus niger
SEQ ID NO: 17 is a protein sequence of allosterically insensitive mutant of Saccharomyces cerevisiae Aro4 enzyme (Aro4-K229L)
SEQ ID NO: 18 is a protein sequence of allosterically insensitive mutant of Saccharomyces cerevisiae Trp2 enzyme (Trp2-S76L)
SEQ ID NO: 19 is a protein sequence of allosterically insensitive mutant of Aspergillus niger Aro4 enzyme (Aro4-K219L)
SEQ ID NO: 20 is a protein sequence of allosterically insensitive mutant of Aspergillus niger Trp2 enzyme (Trp2-S83L)
SEQ ID NO: 21 is a DNA sequence of synthetic promoter containing two binding sites for Bm3R1-sTF and the core promoter 114cp.
SEQ ID NO: 22 is a DNA sequence of synthetic promoter containing two binding sites for Bm3R1-sTF and the core promoter 201cp
SEQ ID NO: 23 is a DNA sequence of synthetic promoter containing two binding sites for Bm3R1-sTF and the core promoter 533cp
SEQ ID NO: 24 is a DNA sequence of synthetic bidirectional promoter containing eight binding sites for Bm3R1-sTF flanked with core promoters (114cp and 201cp) directing the transcription to opposite directions
SEQ ID NO: 25 is a DNA sequence of the Arabidopsis thaliana MTMC1 core promoter used for the expression of synthetic transcription in tobacco plants.
The present inventors have surprisingly found that synthesis of psilocybin and related compounds, such as metabolic intermediates of the psilocybin biosynthesis, can be carried out in a recombinant host cell. The inventors found that simply inserting psilocybin biosynthesis pathway genes originating from one species of a mushroom, such as either Psilocybe cubensis or Psilocybe cyanescens, in a host cell is not sufficient for obtaining an efficient production host. The inventors found that a specific combination of the genes from different mushroom species encoding the psilocybin biosynthetic pathway is required for efficient production of psilocybin and related compounds in a recombinant host cell. In addition, without being bound to any theory, it is assumed that the key metabolic substrates and some biosynthesis metabolites can be present in a host cell in amounts that limit production of psilocybin even when the enzymes of the psilocybin pathway were present in the host cell. Thus, preferably either the amount of the metabolites or the regulation of the enzymes responsible for the biosynthesis has to be modified to provide efficient production.
Preferably the host cell, to which the specific psilocybin biosynthesis pathway is engineered, is modified to have elevated L-tryptophan production capacity. Preferably this is achieved by inserting in the host cell genome genetic elements to increase expression of native genes encoding enzymes of the L-tryptophan biosynthetic pathway, and/or by inserting heterologous polynucleotides that encode selected enzymes of the L-tryptophan biosynthetic pathway.
The invention provides an efficient way to produce psilocybin and its intermediates. Because the production is carried out in a recombinant host cell, a production system is provided which can be optimized, tailored, and controlled in a desired manner. The psilocybin produced by the method can be used as such or formulated into a selected formulation. The present invention also provides efficient production of psilocybin and makes it possible to scale up the production method to an industrial scale. Further, the production of heterologous psilocybin in a recombinant host cell host, and use of large scale bioreactors or production systems provides consistent, cheap, and high level of safety production.
In an embodiment the at least one promoter provides production of the heterologous polynucleotides.
In an embodiment the at least one promoter provides constitutive production of the heterologous polynucleotides. Constitutive production is advantageous when it is desirable to express the heterologous polynucleotides without separate induction. Thus, they can be used in a production system which produces said enzymes, and metabolites produced by them, continuously. Constitutive production also helps to produce enzymes required for psilocybin biosynthesis in a concerted way, thereby simplifying production e.g. in a production system.
In an embodiment the at least one heterologous polynucleotide is operably linked to a single promoter, which controls the expression of each of PsiD, PsiH, PsiK, and PsiM.
In an embodiment the single promoter is controlled by a synthetic transcription factor. Synthetic transcription factor can be used to achieve better control of the expressed genes, instead of using natural transcription factors.
In another embodiment the single promoter comprises the SEQ ID NO: 21, 22, 23, and/or 24.
In an embodiment the host cell further comprises at least one further genetic element arranged to increase biosynthetic production of L-tryptophan in the host cell, wherein the further genetic element is operably linked to at least one promoter which is capable of directing expression of said further genetic element in the host cell.
In an embodiment the host cell comprises a modification, which is arranged to increase biosynthetic production of L-tryptophan in the host cell.
In an embodiment the further genetic element encodes at least one enzyme selected from Aro1, Aro2, Aro3, Aro4, Trp1, Trp2, Trp3, Trp4 and Trp5, or a homolog thereof. In another embodiment the homolog is an enzyme having at least 60%, such as 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity with the corresponding sequence of the Saccharomyces cerevisiae enzyme.
In an embodiment the heterologous polynucleotide is a closest homolog of a polynucleotide encoding Aro1, Aro2, Aro3, Aro4, Trp1, Trp2, Trp3, Trp4 or Trp5. The closest homolog has the highest percentage of identical nucleotides with the gene encoding the protein product above; or a gene whose protein product has the highest percentage of identical amino acids with the protein product encoded by the gene.
In an embodiment the further genetic element encodes at least one enzyme selected from Aro1, Aro2, Aro3, Aro4, Trp1, Trp2, Trp3, Trp4 and Trp5, or a homolog thereof. It is expected that an enzyme having high sequence identity inherits more likely properties of the enzyme it is compared with, which is advantageous to improve control and predictability of the metabolite production and biosynthesis regulation in the host cell, in particular in yeast host cells. However, a sequence identity of at least 60% is considered sufficient in the present invention, because the overall sequence conservation in the relevant protein family is rather low.
In a further embodiment the genetic element comprises at least one further heterologous polynucleotide.
In an embodiment the further genetic element encodes at least one of Aro3, Aro4 and Trp2, which is genetically modified to inhibit its allosteric regulation. This is advantageous to increase L-tryptophan production even further.
In an embodiment the host cell comprises at least two further genetic elements that are controlled by a single synthetic transcription factor. This has an advantage of easier control of expression.
In an embodiment the synthetic transcription factor is the same synthetic transcription factor which controls expression of the heterologous polynucleotides encoding PsiD, PsiH, PsiK and/or PsiM. This has an advantage of easier control of expression, and psilocybin production. Further, particularly when the constitutive production of the enzymes is used by using a suitable transcription factor and suitable promoter, production of each enzyme is achieved simultaneously. Thereby, the biosynthetic pathway is reconstructed and fully operational leading to accumulation of psilocybin with simultaneous minimizing of intermediate metabolites accumulation.
In an embodiment the genetic modification comprises at least one of:
a modification of a polynucleotide encoding Trp2 with a S76 mutation, wherein the residue numbering corresponds to that of SEQ ID NO: 18 (S. cerevisiae Trp2), and
a modification of a polynucleotide encoding Aro4 with a K229 mutation, wherein the residue numbering corresponds to that of SEQ ID NO: 17 (S. cerevisiae Aro4).
These mutations are efficient to prevent allosteric regulation, without affecting negatively on the enzyme activity.
The conserved lysine residue corresponding the K229 residue of S. cerevisiae Aro4 is present in homologs of Aro4 enzyme in other hosts, such and A. niger or others (
In an embodiment the further genetic element encodes at least one of:
In an embodiment the recombinant host cells are supplemented with L-tryptophan.
Increased L-tryptophan availability enhance precursor supply and feeds the biosynthetic pathway towards psilocybin production.
In an embodiment L-tryptophan is supplemented by adding L-tryptophan in the growth medium wherein the recombinant host cells are cultivated.
This has an advantage that increased L-tryptophan production does not stress the host cell, because the cell can obtain it from an extracellular source.
In an embodiment in the method the recombinant host cell is the recombinant host cell of an above aspect and L-tryptophan is supplemented by initiating expression of Aro4, Trp2 and Trp3 to enhance production of L-tryptophan.
In an embodiment the method is for producing psilocybin, and psilocybin is recovered in step d.
In an embodiment at least one of the following is recovered in step d: tryptamine, 4-hydroxy-tryptamine, norbaeocystin, baeocystin, psilocybin, and psilocin.
In an embodiment the production of L-tryptophan is enhanced in the recombinant host cell or in the method by inserting in the host cell heterologous polynucleotides capable of enhancing native metabolic flux towards production of L-tryptophan.
Enhanced L-tryptophan production has an advantage of providing higher intracellular concentration of L-tryptophan, which enhances production of psilocybin as the end product of the biosynthetic pathway.
In an embodiment the production of L-tryptophan is enhanced by inserting in the host cell at least one heterologous polynucleotide encoding allosterically insensitive Aro4 enzyme operably linked to an artificial promoter.
In an embodiment the production of L-tryptophan is enhanced by inserting in the host cell at least one heterologous polynucleotide encoding allosterically insensitive Trp2 enzyme operably linked to an artificial promoter.
In an embodiment the production of L-tryptophan is enhanced by inserting in the host cell at least one heterologous polynucleotide encoding allosterically insensitive Trp2 enzyme, and encoding Trp3 enzyme, operably linked to an artificial promoter.
In an embodiment the production of L-tryptophan is enhanced by inserting in the host cell at least one heterologous polynucleotide encoding allosterically insensitive Aro4 and Trp2 enzyme, and a polynucleotide encoding Trp3 enzyme operably linked to an artificial promoter.
In an embodiment the insertion is by integrating into the genome of the host cell.
In an embodiment the artificial promoter is a promoter activated by a synthetic transcription factor, sTF.
In an embodiment the sTF comprises a polynucleotide encoding:
In an embodiment the sTF is integrated in the genome of the host cell. This can be achieved by transformation with a cassette, which contains the sTF polynucleotide.
In addition to the above mentioned approaches to elevate metabolic flux in the L-tryptophan biosynthesis, other methods can be used either alone or in combinations. Suitable methods include modification of the upstream metabolism increasing provision of pathway's essential precursors and/or cofactors, such as PEP, E4P, L-glutamine (L-Gln as a donor of amino-group in the Trp2/Trp3 reaction). In an embodiment other genes encoding enzymes in the shikimate or L-tryptophan pathways, such as Aro1, Aro2, or Trp5, are overexpressed to drive the metabolic flux towards L-tryptophan.
Further, elimination of certain reactions, such as metabolic branches towards L-tyrosine and L-phenylalanine, or degradation pathway of L-tryptophan, can also be exploited to increase the L-tryptophan levels available for psilocybin biosynthesis. The skilled person is able to achieve said eliminations e.g. by disrupting at least partially genes encoding essential enzymes in said branches of the metabolic pathways, such as Aro7, Aro8, Aro9, or Aro10 in S. cerevisiae or their homologs in other organisms, such as A. niger.
In an embodiment the PsiD belongs to the PLP-independent phosphatidylserine decarboxylase family (E.C. 4.1.1.65). In an embodiment the PsiD of the invention has at least 80% sequence identity with the sequence corresponding to the GenBank accession number ASU62239.1 or the GenBank accession number ASU62242.1, or with the amino acid sequence encoded by polynucleotide SEQ ID NO: 1 or 2 or 9 or 10.
In an embodiment the PsiH is a monooxygenase. In an embodiment the PsiH of the invention has at least 80% sequence identity with the sequence corresponding to the GenBank accession number ASU62246.1 or the GenBank accession number ASU62250.1, or with the amino acid sequence encoded by polynucleotide SEQ ID NO: 5 or 6 or 13 or 14.
In an embodiment the PsiK is a 5-methylthioribose family of small-molecule kinases. In an embodiment the PsiK of the invention has at least 80% sequence identity with the sequence corresponding to the GenBank accession number ASU62237.1 or the GenBank accession number ASU62240.1, or with the amino acid sequence encoded by polynucleotide SEQ ID NO: 7 or 8 or 15 or 16.
In an embodiment the PsiM is a class I methyltransferase. In an embodiment the PsiM of the invention has at least 80% sequence identity with the sequence corresponding to the GenBank accession number ASU62238.1 or the GenBank accession number ASU62241.1, or with the amino acid sequence encoded by polynucleotide SEQ ID NO: 3 or 4 or 11 or 12.
In an embodiment the host cell comprises heterologous polynucleotides encoding PsiD, PsiH, PsiK, and PsiM, which form the whole psilocybin pathway.
In an embodiment the psilocybin pathway (PsiD, PsiH, PsiK, and PsiM) is composed by any combination of the corresponding polynucleotides SEQ ID NO: 1-16.
In a preferred embodiment the psilocybin pathway is composed of PsiD of Psilocybe cubensis origin (encoded by polynucleotide SEQ ID NO: 1 or 9), PsiH of Psilocybe cyanescens origin (encoded by polynucleotide SEQ ID NO: 6 or 14), PsiK of Psilocybe cyanescens origin (encoded by polynucleotide SEQ ID NO: 8 or 16), and PsiM of Psilocybe cubensis origin (encoded by polynucleotide SEQ ID NO: 3 or 11).
In another preferred embodiment the psilocybin pathway is composed of PsiD of Psilocybe cubensis origin (encoded by polynucleotide SEQ ID NO: 1 or 9), PsiH of Psilocybe cyanescens origin (encoded by polynucleotide SEQ ID NO: 6 or 14), PsiK of Psilocybe cubensis origin (encoded by polynucleotide SEQ ID NO: 7 or 15), and PsiM of Psilocybe cyanescens origin (encoded by polynucleotide SEQ ID NO: 4 or 12).
In another preferred embodiment the psilocybin pathway is composed of PsiD of Psilocybe cyanescens origin (encoded by polynucleotide SEQ ID NO: 2 or 10), PsiH of Psilocybe cyanescens origin (encoded by polynucleotide SEQ ID NO: 6 or 14), PsiK of Psilocybe cubensis origin (encoded by polynucleotide SEQ ID NO: 7 or 15), and PsiM of Psilocybe cubensis origin (encoded by polynucleotide SEQ ID NO: 3 or 11).
In an embodiment the Aro4 is a 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase. In an embodiment the Aro4 of the invention contains lysine-to-leucine mutation in position 229 (S. cerevisiae version K229L), or lysine-to-leucine mutation in position 219 (A. niger version K219L), which causes alleviation of feedback-inhibition. Lysine-to-leucine mutations can be implemented to other homologs of Aro4 to generate allosterically insensitive DAHP synthase enzymes in other hosts (
In an embodiment the Trp2 is an anthranilate synthase. In an embodiment the Trp2 of the invention contains serine-to-leucine mutation in position 76 (S. cerevisiae version S76L), or serine-to-leucine mutation in position 83 (A. niger version S83L), which causes alleviation of feedback-inhibition. Serine-to-leucine mutation can be also implemented to other homologs of Trp2 to generate allosterically insensitive anthranilate synthase enzymes in other hosts (
In an embodiment the Trp3 is an indole-3-glycerol-phosphate synthase involved in L-tryptophan biosynthesis. In an embodiment the Trp3 of the invention has at least 80% sequence identity with the sequence corresponding to the GenBank accession number CAA82056.1 or the GenBank accession number OWW28508.1.
In an embodiment the terms PsiD, PsiH, PsiK, and PsiM refer to polypeptides having the corresponding enzyme activity of the relevant enzyme in psilocybin production host, as well as to fusion proteins comprising them. The polypeptides do not necessarily have the exact amino acid sequence of the relevant enzyme, and they may contain mutations, substitutions, additions, deletions and posttranslational modifications that make them chemically and/or functionally different compared to the same enzymes produced in their native host cell.
In an embodiment the recombinant host cell is a eukaryotic host cell selected from the group consisting of plant cell, animal cell, or fungal cell.
In a preferred embodiment the recombinant host cell is a recombinant plant cell or a recombinant yeast cell.
In an embodiment is provided a plant or a plant part comprising at least recombinant plant cell of the invention. Preferably the plant is a tobacco plant.
In certain embodiments, the heterologous polynucleotides, e.g. in a form of a construct containing them, may be introduced in the genome of a host cell (e.g., of the plant) in which the polynucleotides are expressed. The polynucleotides as taught herein can be transiently introduced in the cell (e.g., of the plant) in which the polynucleotides as taught herein are expressed, or they can be stably introduced in the genome of the cell (e.g., of the plant) in which the polynucleotides as taught herein are expressed. The polynucleotides can be introduced in the cell with methods known in the art, such as transformation or agroinfiltration. The polynucleotides according to the invention may be inserted into vectors, which may be commercially available, suitable for transforming into plants and suitable for (transiently or stably) expressing of the gene of interest in the transformed cells.
In a preferred embodiment the heterologous polynucleotides are transferred to plant host cells by agroinfiltration for transient expression of the heterologous polynucleotides.
In an embodiment is provided a method for the production of a plant having a capability to produce psilocybin comprising:
The term “plant” as used throughout the specification encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, wherein each of the aforementioned comprise the polynucleotide of interest. In certain embodiments, the term “plant” also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the aforementioned comprises the polynucleotide and construct of interest.
In an embodiment the method comprises introducing the heterologous polynucleotides encoding PsiD, PsiH, PsiK and PsiM in the plant by agroinfiltration by using two Agrobacterium strains, each containing two of said polynucleotides.
In a further embodiment the plant cell is exposed to the Agrobacterium strains sequentially. In another embodiment the plant cell is exposed to a mixture containing both Agrobacterium strains.
The skilled person is able to analyse the amount of metabolite produced by the present method by using a method known in the art. In an embodiment the level of metabolite is analysed as described in Example 3. Preferably the analysis is by methanol extraction and UPLC-MS analysis.
In an embodiment the recombinant host cell is selected from cells of: 1) Fungal microorganisms including filamentous fungi and yeasts, in particular organisms from the following taxa: A) Saccharomycetales, including but not limited to species Saccharomyces cerevisiae, Kluyveromyces lactis, Candida krusei (Pichia kudriavzevii), Pichia pastoris (Komagataella pastoris), Eremothecium gossypii, Kazachstania exigua, Yarrowia lipolytica, and others; Schizosaccharomycetes, such as Schizosaccharomyces pombe; B) Eurotiomycetes, including but not limited to species Aspergillus niger, Aspergillus nidulans, Penicillium chrysogenum, and others; C) Sordariomycetes, including but not limited to species Trichoderma reesei, Myceliophthora thermophila, and others; D) Mucorales, such as Mucor indicus and others. 2) Plant organisms, including flowering plants and green algae, in particular organisms from the following taxa: E) Solanales, including but not limited to species Nicotiana benthamiana, Solanum tuberosum, Lycopersicon esculentum, Capsicum anuum, and others; F) Brassicales, including but not limited to species Arabidopsis thaliana, Brassica napus, and others; G) Poales, including but not limited to species Avena sativa, Secale cereale, Zea mays, Triticum spp., Oryza sativa, Hordeum vulgare, Sorghum bicolor, Saccharum officinarum, and others; H) Fabales including but not limited to species Phaseolus spp., Vigna spp., Glycine max, Pisum sativum, Lens culinaris, Cicer arietinum and others; I) Malpighiales, including but not limited to species Populus sp., and others;
J) Pinales, including but not limited to species Pinus sp., and others; K) Arecales including but not limited to species Elaeis guineensis, Cocos nucifera, and others; L) Chlorophyceae, including but not limited to species Chlamydomonas reinhardtii, and others; M) Trebouxiophyceae, including but not limited to species Chlorella spp., and others. 3) Animal organisms, in particular organisms from the following taxa: N) mammals (Mammalia), including but not limited to species Mus musculus (mouse), Cricetulus griseus (hamster), Homo sapiens (human), and others; 0) insects (Insecta), including but not limited to species Mamestra brassicae, Spodoptera frugiperda, Trichoplusia ni, Drosophila melanogaster, and others.
In an embodiment the heterologous polynucleotides are integrated in the genome of the recombinant host cell.
In an embodiment the integration is by transformation of the DNA into the cell. Transformation of (typically) yeast can be done by a “standard Lithium-acetate protocol”. In case of filamentous fungi (and also yeast), protoplast transformation can be used. The protoplast transformation is described in WO2017144777. There are other ways how to get the DNA into the host: Agrobacterium-facilitated transfection (mainly for plants but also fungi); biolistic; virus-facilitated transfection; or standard chemical transfection of animal cells (other methods listed in wikipedia: https://en.wikipedia.org/wiki/Transfection)
In an embodiment the integration is by integration of the (intracellular) DNA into the genome. Integration of the DNA into specific place (locus) in the genome can be done by the intrinsic cellular mechanism—homologous recombination (or sometimes by non-homologous recombination which however results in random/unspecific integration). The integration into a specific place of the genome can be achieved by homologous recombination providing, in the transformed DNA, flanking sequences identical/homologous to the genomic site of intended integration. The efficiency of the targeted genome integration can be greatly enhanced by using the CRISPR genome editing method that is based on the use of RNA-guided DNA endonucleases. There are several alternative approaches to implement the CRISPR method—there are also a few alternative RNA-guided DNA endonucleases (e.g. Cas9, Cpfl and MAD7) which can be used in the CRISPR method. The RNA-guided DNA endonucleases can be delivered into the cells as plasmid expressing the endonuclease, or directly as a protein. The RNA-guided DNA endonucleases need a target specific guide RNA (gRNA) to generate a double stranded break into the genomic target/locus—the gRNA can be delivered as plasmid expressing the gRNA, or directly as chemically synthesized gRNA.
In an embodiment the heterologous polynucleotides are inside the recombinant host cell in at least one vector or plasmid or linear DNA molecule or DNA cassette.
In an embodiment the recombinant host cell comprises metabolites of the biosynthetic pathway from L-tryptophan to psilocybin.
In an embodiment the host cell is arranged to produce the synthetic transcription factor (sTF) constitutively.
In an embodiment the Psi genes are under the control of the synthetic transcription factor.
In an embodiment the host cell contains the Psi genes arranged in a bi-directional dual gene expression cassette. This allows co-expression of two genes from one genomic locus. In an embodiment the Psi genes are present in said cassettes in pairs PsiH and PsiD, and PsiK and PsiM.
In an embodiment the bi-directional dual gene expression cassette is used where any combination of genes in the bidirectional cassettes can be used.
In an embodiment the use of standard expression cassettes (one promoter—one gene) is used, where these cassettes:
In an embodiment expression of the bi-directional dual gene expression cassette is regulated by at least one sTF-specific binding site between the outwards oriented core promoters and the polynucleotide sequences encoding Psi genes. Preferably more than one, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 binding sites are provided. The production level of the heterologous protein encoded by the polynucleotide sequence can be controlled by the number of binding sites: fewer binding sites provide lower expression level and thus lower production, whereas a higher amount of binding sites provides higher expression level and thus higher production. The skilled person is able to select an appropriate number of binding sites to provide a suitable balance in the expression level of the heterologous proteins, which provides successful production of psilocybin or its biosynthetic intermediates.
In an embodiment the host cell contains the heterologous polynucleotides inserted in its genome in cassettes comprising at the least transcription factor and the Psi genes, and optionally L-Trp genes.
In an embodiment the host cell is genetically modified to overproduce chorismate at levels higher than the wild type host cell in the same culturing conditions. This provides a higher availability of chorismate for the L-tryptophan biosynthetic pathway, and results in higher psilocybin production.
In an embodiment the enhanced chorismate production is provided by genetically modifying at last one of the genes encoding Aro4 and/or Aro3 enzyme to prevent allosteric regulation of said enzyme. In an embodiment the genetic modification provides K229 mutation in the Aro4 enzyme. In a preferred embodiment the genetic modification provides K229L mutation in the Aro4 enzyme. In another embodiment the genetic modification provides other mutation or mutations in Aro4 or Aro3 enzymes preventing allosteric inhibition. Each of these mutations is particularly useful because they allow removing allosteric regulation of the enzyme in a single amino acid mutation or in combination of amino acid mutations.
In an embodiment the host cell is arranged to have enhanced metabolic activity in the shikimate pathway. This is advantageous in providing enhanced production of chorismate, which may be used in synthesis of further aromatic metabolites, such as L-tryptophan.
In an embodiment the host cell produces elevated amounts of Aro1 and Aro2 enzymes. In an embodiment the host cell comprises heterologous polynucleotides encoding Aro1 and/or Aro2.
In an embodiment the host cell is genetically modified to produce Trp2 and Trp3. In a preferred embodiment the host cell is genetically engineered to overexpress Trp2 and/or Trp3. Overexpression of these genes drives the metabolic flux towards L-tryptophan.
In a preferred embodiment the gene encoding Trp2 is genetically modified to prevent allosteric regulation of Trp2. In an embodiment the genetic modification provides S76 mutation in the Trp2 enzyme. In a more preferred embodiment the genetic modification provides S76L mutation in the Trp2 enzyme. This mutation is particularly useful because it allows removing allosteric regulation of the enzyme in a single amino acid mutation, and drives the metabolic flux even more efficiently towards L-tryptophan.
In an embodiment the host cell comprises genes encoding Trp4, Trp1, Trp3, Trp5 and Trp2. In another embodiment the host cells contains heterologous polynucleotide encoding Trp1 and Trp3 in a fusion protein.
In an embodiment the host cell comprises heterologous polynucleotides encoding Aro4, Trp2 and Trp3. In a preferred embodiment the polynucleotides encoding Aro4 and Trp2 are genetically modified to prevent allosteric regulation of said enzymes. Preferably said genetic modification comprises at least K229 mutation in Aro4 and S76 mutation in Trp2, wherein the numbering corresponds to the SEQ ID NOs: 17 and 18, respectively. More preferably said genetic modification comprises at least K229L mutation in Aro4 and S76L mutation in Trp2, wherein the numbering corresponds to the SEQ ID NOs: 17 and 18, respectively.
Even more preferably said mutation is a non-conservative mutation, most preferably a mutation into L residue.
In an embodiment the method and the production system is an industrial scale method and an industrial scale production system.
In an embodiment the heterologous polynucleotides are under control of the same transcription factor of transcription factors.
In an embodiment the heterologous polynucleotides of the psilocybin pathway are under control of the same transcription factor or transcription factors, and the heterologous polynucleotides responsible for the enhanced L-tryptophan production are under control of a different transcription factor or factors. In an embodiment the transcription factor or transcription factors provide constitutive production of the transcription factor. In another embodiment the production of the transcription factor is triggered by an effector molecule.
The recombinant host cell can be used to produce psilocybin and to carry the heterologous polynucleotides required for synthesis of psilocybin from L-tryptophan. The recombinant host cell is useful also in optimization of L-tryptophan and/or psilocybin production. For example, a host cell can be selected, which facilitates purification and formulation of psilocybin produced in the host cell.
The polypeptide encoded by the heterologous polynucleotide may have structural or functional properties that differentiate it from a native polypeptide having the same or similar amino acid sequence. For example, a host cell can be selected for production, which provides the produced recombinant polypeptide with post-translational modifications, a lack thereof, or localization to facilitate production and/or formulation.
In an embodiment in the method the recombinant host cells are supplemented with L-tryptophan. This has an advantage of enhanced production of psilocybin and its synthesis intermediates.
In an embodiment in the method at least two metabolites are recovered.
In one embodiment of the invention the heterologous polynucleotide encodes an enzyme having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to the PsiD amino acid sequence encoded by polynucleotide SEQ ID NO: 1 or 2 or 9 or 10.
In one embodiment of the invention the heterologous polynucleotide encodes an enzyme having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to the PsiH amino acid sequence encoded by polynucleotide SEQ ID NO: 5 or 6 or 13 or 14.
In one embodiment of the invention the heterologous polynucleotide encodes an enzyme having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to the PsiK amino acid sequence encoded by polynucleotide SEQ ID NO: 7 or 8 or 15 or 16.
In one embodiment of the invention the heterologous polynucleotide encodes an enzyme having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to the PsiM amino acid sequence encoded by polynucleotide SEQ ID NO: 3 or 4 or 11 or 12.
In one embodiment of the invention the heterologous polynucleotide encodes an enzyme having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to ARO4, SEQ ID NO: 17 or 19.
In one embodiment of the invention the heterologous polynucleotide encodes an enzyme having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to TRP2, SEQ ID NO: 18 or 20.
In one embodiment of the invention the heterologous polynucleotide encodes an enzyme having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to TRP3 amino acid sequence deposited in the GenBank under accession number CAA82056.1 or the GenBank accession number OWW28508.1.
In an embodiment the heterologous polynucleotide does not have 100% sequence identity with any one of PsiD, PsiH, PsiK, PsiM, ARO4, TRP2 and/or TRP3 at nucleotide sequence level or amino acid sequence level.
In another embodiment of the invention the heterologous polynucleotide encodes an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to at least one of the sequences of PsiD, PsiH, PsiK, PsiM, ARO4, TRP2 and TRP3.
In an embodiment the heterologous polynucleotide encodes an active fragment of any of the enzymes encoded by the Psi genes, and/or the enzymes encoded by the L-Trp genes.
An advantage of a certain sequence identity or similarity as defined above is that the an enzyme having said sequence identity can comprise modification, in view of the original sequence, which improves controlling production of psilocybin, or improves production yield or simplifies the production process.
In an embodiment the production system of the third aspect is configured to carry out the method of the second aspect. Thus, the production system can be advantageously used to produce metabolites, including psilocybin.
In an embodiment the production unit is a fermenter. Preferably the present recombinant host cell is provided inside the reactor tank of the fermenter.
In an embodiment the production unit comprises at least one fluid inlet and at least one fluid outlet, each fluid inlet and fluid outlet being in fluid connection with at least one vessel.
In an embodiment the production unit comprises temperature controlling means for lowering and raising temperature of the production unit.
In an embodiment the control unit is configured to monitor and control cultivation of the recombinant host cells such that constitutive production of recombinant enzymes is achieved.
In an embodiment the control unit is configured to control operation of the temperature controlling means and the at least one fluid inlet and at least one fluid outlet.
As evidenced by the Examples, the recombinant host cell according to the invention allows production of psilocybin and its intermediates in a recombinant host cell. The inventors tested several heterologous polynucleotides and their variants and found that not all of them produce sufficient yields, or have the required stability or activity, which allows them to be taken into use in industrial production. Thus, the invention described above defines a limited set of host cells that can be used in production of psilocybin and its intermediates. The host cell of the present invention is particularly suitable for production in a yeast host cell or a filamentous fungus host cell.
A common structural element shared by the host cells of the invention is the combination of the heterologous polynucleotides encoding PsiD, PsiH, PsiK, and PsiM. These structural elements are characteristic for the host cell of the invention.
The term “Psi genes” refers to the genes encoding PsiD, PsiH, PsiK, and PsiM.
The term “Psi enzymes” refers to the enzymes PsiD, PsiH, PsiK, and PsiM.
The term “L-Trp genes” refers to the genes encoding Aro1, Aro2, Aro3, Aro4, Trp1, Trp2, Trp3, Trp4, and Trp5.
As used herein, “isolated” and “recovered” mean a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing or decreasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; one or multiple copies of a gene; and use of an alternative promoter to the promoter naturally associated with the gene). In an embodiment a polypeptide, enzyme, polynucleotide, host cell, a metabolite or composition of the invention is isolated.
As used herein, the term “comprising” includes the broader meanings of “including”, “containing”, and “comprehending”, as well as the narrower expressions “consisting of” and “consisting only of”.
The term “substantially” when used together with a numerical parameter means an approximation of said parameter. In other words the exact mathematical value of the parameter is not in this case critical, but a certain degree of approximation is allowable and the parameter still achieves its purpose in a sufficient degree. Depending on the case, in an embodiment the term substantially allows 15%, 10% or 5% variation in the value of the parameter. In another embodiment the allowable variation is 3%, 2% or 1%.
In an embodiment the meaning of all numerical values and parameters disclosed herein include the meaning of the substantially same value as the exact mathematical value.
As used herein, “fragment” means a protein or a polynucleotide having one or more amino acids or nucleotides deleted. In the context of DNA, a fragment includes both single stranded and double stranded DNA of any length. A fragment may be an active fragment, which has the biological function, such as enzyme activity or regulatory activity, of the protein or the polynucleotide. A fragment may also be an inactive fragment, i.e. it does not have one or more biological effects of the native protein or polynucleotide.
As used herein, a “peptide” and a “polypeptide” are amino acid sequences including a plurality of consecutive polymerized amino acid residues. For purpose of this invention, peptides are molecules including up to 20 amino acid residues, and polypeptides include more than 20 amino acid residues. The peptide or polypeptide may include modified amino acid residues, naturally occurring amino acid residues not encoded by a codon, and non-naturally occurring amino acid residues. As used herein, a “protein” may refer to a peptide or a polypeptide of any size. A protein may be an enzyme, a protein, an antibody, a membrane protein, a peptide hormone, regulator, or any other protein.
The term “polynucleotide” denotes a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5′ to the 3′ end. Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules.
As used herein, “modification”, “modified”, and similar terms in the context of polynucleotides refer to modification in a coding or a non-coding region of the polynucleotide, such as a regulatory sequence, 5′ untranslated region, 3′ untranslated region, up-regulating genetic element, down-regulating genetic element, enhancer, suppressor, promoter, exon, or intron region. The modification may in some embodiments be only structural, having no effect on the biological effect, action or function of the polynucleotide. In other embodiments the modification is a structural modification, which provides a change in the biological effect, action or function of the polynucleotide. Such a modification may enhance, suppress or change the biological function of the polynucleotide. In an embodiment the polynucleotide is codon optimised for a host cell.
As used herein, “identity” means the percentage of exact matches of nucleotide or amino acid residues between two aligned sequences over the number of positions where there are residues present in both sequences. When one sequence has a residue with no corresponding residue in the other sequence, the alignment program allows a gap in the alignment, and that position is not counted in the denominator of the identity calculation. In an embodiment identity is a value determined with the Pairwise Sequence Alignment tool EMBOSS Needle at the EMBL-EBI websites (https://www.ebi.ac.uk/Tools/psa/emboss needle/, https://www.ebi.ac.uk/Tools/psa/emboss needle/nucleotide.html). In an embodiment identity is a value determined with the Multiple Sequence Alignment tool Clustal Omega at the EMBL-EBI website (https://www.ebi.ac.uk/Tools/msa/clustalo/).
As used herein, “a genetic element” means any functional polynucleotide sequence. In an embodiment a genetic element is a gene. In another embodiment a genetic element is a polynucleotide encoding an enzyme or protein, and at least one regulatory sequence such as a promoter. In another embodiment a genetic element is a polynucleotide encoding a modified enzyme or a protein and at least one regulatory sequence such as a promoter. The polynucleotide may be a heterologous polynucleotide.
As used herein the term “allosteric regulation” is the regulation of an enzyme by binding an effector molecule, such as a metabolite, at a site other than the enzyme's active site. In an embodiment the effector molecule is a metabolite downstream of the metabolic pathway.
As used herein, “host cell” means any cell type that is susceptible to transformation, transfection, transduction, mating, crossing or the like with a nucleic acid construct or expression vector comprising a polynucleotide. The term “host cell” encompasses any progeny that is not identical due to mutations that occur during replication.
A “recombinant cell” or “recombinant host cell” refers to a cell or host cell that has been genetically modified or altered to comprise a nucleic acid sequence which is not native to said cell or host cell. In an embodiment the genetic modification comprises integrating the polynucleotide in the genome of the host cell. In another embodiment the polynucleotide is exogenous in the host cell.
As used herein, “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. In an embodiment the conservative amino acids in the present description refer to the amino acids within following groupings: Hydrophobic (F W Y H K M IL V A G C); Aromatic (F W Y H); Aliphatic (I L V); Polar (W Y H K R E D C S T N Q); Charged (H K R E D); Positively charged (H K R); Negatively charged (E D); Small (V C A G S P T N D); Tiny (A G S). Thus, a conservative substitution occurs when an amino acid is substituted with an amino acid in the same group.
In an embodiment the substitution is a substitution, or a structural change caused by genetic modification, affecting at least one amino acid residue. In a further embodiment the at least amino acid is Ala or Leu, preferably Leu.
As used herein, a “non-conservative amino acid substitution” is one in which an amino acid is substituted with an amino acid in a different group as defined above. The non-conservative substitution may result into a change of an amino acid to another amino acid with different biochemical properties, such as charge, hydrophobicity and/or size. In an embodiment the non-conservative substitution changes at least one property of the variant, such as stability, glycosylation pattern, folding, structure, activity, allosteric regulation or affinity.
In an embodiment any specific mutation or genetic modification described herein, such as S76L or K229L, is carried out in an alternative embodiment by using a non-conservative amino acid substitution.
As used herein, “expression” includes any step involved in the production of a polypeptide in a host cell including, but not limited to, transcription, translation, post-translational modification, and secretion. Expression may be followed by harvesting, i.e. recovering, the host cells or the expressed product, or a product produced by the activity of the expressed product.
The term “expression vector” denotes a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription. Such additional segments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, carrier and the like. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both. The expression vector may be any expression vector that is conveniently subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which the vector is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
The term “recombinant produced” or “recombinantly produced” used herein in connection with production of a polypeptide or metabolite is defined according to the standard definition in the art.
The term “operably linked”, when referring to DNA segments or genetic elements, denotes that the segments or genetic elements are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in the promoter and proceeds through the coding segment to the terminator.
The term “promoter” denotes a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5′ non-coding regions of genes. In an embodiment at least one promoter of the recombinant polypeptide or an enzyme used to increase production of L-tryptophan is under control of a synthetic promoter disclosed in WO2017144777.
The term “secretory signal sequence” denotes a DNA sequence that encodes a polypeptide (a “secretory peptide”) that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a host cell in which it is produced. The secretory signal sequence can be native or it can be replaced with secretory signal sequence or carrier sequence from another source. Depending on the host cell, the larger peptide may be cleaved to remove the secretory peptide during transit through the secretory pathway. In an embodiment the heterologous polynucleotides comprise secretory signal sequences for transport into extracellular space.
“Enzyme activity” as used herein refers to the enzymatic activity of a polypeptide.
The amino acid sequence encoded by the heterologous polynucleotide may be connected to another functionality of a fusion protein via a linker sequence.
Fusion proteins can be engineered to modify properties or production of the recombinant polypeptides. In an embodiment the recombinant polypeptides are connected to each other with a linker.
By the term “linker” or “spacer” is meant a polypeptide comprising at least two amino acids which may be present between the domains of a multidomain protein, or between different domains of a fusion protein.
The following examples are provided to illustrate various aspects of the present invention. They are not intended to limit the invention, which is defined by the accompanying claims.
The expression cassette for the sTF (
The Sc-sTF-background-strain was modified further by integration of the 2BS_ARO4_K229L cassette (
The Sc-sTF-background-strain was also modified by integration of the 2BS_TRP2_S76L cassette (
The Sc_T2M strain was further modified by integration of the 2BS_TRP3 cassette (
The Sc_T2M_T3 strain was modified further by integration of the 2BS_ARO4_K229L cassette (
The correct and single copy integrations were confirmed by qPCR, where the qPCR signal of each integrated cassette (present), and replaced genomic region (absent), was compared to a qPCR signal of a unique native sequence in each strain.
The production of L-tryptophan was determined in the Sc-sTF-background-, Sc_A4M, Sc_T2M_T3, and Sc_A4M_T2M_T3 strains. It was found that intracellular concentration of L-tryptophan was increased, particularly in the Sc_T2M_T3 and Sc_A4M_T2M_T3 strains (
The expression cassette for the sTF (
The An-sTF-background-strain is modified further by integration of the 2BS_ARO4_K219L cassette (analogous to 2BS_ARO4_K229L cassette in
The An-sTF-background-strain is also modified by integration of the 2BS_TRP2_S83L cassette (analogous to 2BS_TRP2_S76L cassette in
The correct and single copy integrations is confirmed by qPCR, where the qPCR signal of each integrated cassette (present), and replaced genomic region (absent), is compared to a qPCR signal of a unique native sequence in each strain.
The PsiH-PsiD expression cassettes (
All combinations of the PsiH-PsiD+PsiK-PsiM cassette pairs were integrated into the genome of the yeast strain Sc_A4M generated in Example 1, which resulted in 16 unique psilocybin-producing yeast strains (Table 2). Each PsiH-PsiD cassette was integrated into the leu2-3_112 locus, and each PsiK-PsiM cassette was integrated into the his3Δ1 locus of the strain.
The 16 psilocybin-strains were tested for production of psilocybin. The cultivations were performed in liquid media at 30° C. in 4 ml of YPD (20 g/L bacto peptone, 10 g/L yeast extract, and 40 g/L D-glucose) for 24 hours. The cells were separated from the medium by centrifugation, and the cell pellets as well as the supernatants (media) were analyzed.
The cell pellets samples were homogenized with 1 ml of methanol (100%) by using zirconium-grinding beads with a Retsch mixer mill MM400 homogenizer at 20 Hz for 2 min and subjected to ultrasonication for 15 min. The methanolic suspension was centrifuged at 10000 rpm for 5 min. The liquid phase was transferred to another tube and the cell pellet was re-extracted with 1 ml of methanol. The combined methanolic extract was evaporated to dryness at 40° C. under a gentle stream of nitrogen and reconstituted in 0.2 ml of mobile phase (0.1% formic acid in 20% acetonitrile).
The media samples were freeze-dried and diluted in 0.3 ml of mobile phase (0.1% Formic Acid in 20% Acetonitrile). All samples were filtered (PALL GHP Acrodisc 13 mm syringe filters with polypropylene membrane) to a fresh vials. A 2-microliter volume was subjected to the LC-MS analysis to detect psilocybin and related metabolites.
Analysis was performed on an Acquity UHPLC system, Waters (Milford, Mass., USA) and Waters Synapt G2-S MS system Waters (Milford, Mass., USA). Chromatography was performed using an ACQUITY UPLC BEH HSS T3, 1.8 μm 2.1×100 mm, (Waters), kept at 30° C. The experiment was carried out at a flow rate of 0.4 ml/min with mobile phase A (0.1% formic acid in water) and B (acetonitrile). The gradient elution started at 5% B and maintained at 5% B for 0.4 min, then increased to 19% B within 5 min, after this directly returned to initial percentage and maintained for 2 min. Mass spectrometry was carried out using electrospray ionization (ESI) in positive polarity. The capillary voltage was 3.0 kV, cone voltage 30 kV, source temperature 150° C. and desolvation temperature 500° C. The cone and desolvation gas flow were set at 150 L/h (nitrogen) and 1000 L/h (nitrogen), respectively, collision gas was 0.15 mL/min.
The analysis was performed with L-tryptophan as an analytical standard, and the concentration of other metabolites was estimated based on the L-tryptophan standard curve. The identity of the metabolites were confirmed by matching the calculated molecular masses with the mass spectrometry signals. Psilocybin was detected only in the cell pellet extracts (Table 2), but not in the culture supernatants. Based on this preliminary test, three strains with the highest psilocybin content were selected for further analysis. These strains containing the psilocybin pathway versions #6, #8, and #9 (Table 2), were grown in 25 ml of YPD and/or SCD medium (6.7 g/L of yeast nitrogen base (Becton, Dickinson and Company), synthetic complete amino acid mixture, 40 g/L D-glucose) for 5 days, and 4 ml culture samples were collected each day. The preparation of the cell pellet and culture media samples for the UPLC-MS analysis was performed as above. Psilocybin, psilocin, L-tryptophan and tryptamine (all Sigma-Aldrich) were used as quantification standards (
The analysis revealed that psilocybin is predominantly retained in the cells, thus further analysis was focused on intracellular metabolites accumulation. The psilocybin pathway versions #6 and #9 were selected for the tests in other S. cerevisiae strains, and implemented into the following strains: Sc-sTF-background, Sc_T2M_T3, and Sc_A4M_T2M_T3 strains. The strain were transformed with the corresponding versions of the PsiH-PsiD and PsiK-PsiM cassettes. The PsiH-PsiD cassette was integrated into the leu2-3_112 locus, and the PsiK-PsiM cassette was integrated into the his3Δ1 locus of each strains.
The strains were cultivated either in the YPD medium for 4 days (samples analyzed from days 3 and 4), or in the SCD medium for 2 days (samples analyzed from days 1 and 2). The UPLC-MS results for the intracellular content of the metabolites in strains with the psilocybin pathway version #6 are shown in
The methanol extraction of the psilocybin and related compounds from the cells seemed to be an efficient and simple way to obtain relatively pure compounds (
Similar to example 3, the PsiH-PsiD expression cassettes (
All (16) combinations of the PsiH-PsiD+PsiK-PsiM cassette pairs are integrated into the genome of the A. niger strains (An-sTF-background-strain, An_A4M, An_T2M) generated in Example 2, which results in 48 unique psilocybin-producing A. niger strains. Each PsiH-PsiD cassette is integrated into the gaaA locus (JGI protein ID: 1158309), and each PsiK-PsiM cassette is integrated into the gaaC locus (JGI protein ID: 1158310) of the strain.
The A. niger psilocybin-strains are tested for the production of psilocybin. The cultivations are performed in liquid media at 28° C. in 20 ml of YPDG medium (20 g/L bacto peptone, 10 g/L yeast extract, 20 g/L D-glucose, and 30 g/L gelatine) for 48 hours. The mycelia are separated from the medium by filtration, and 500 mg of mycelium (wet weight) as well as the supernatants (media) are analyzed. The extraction and the LC-MS analysis is performed according to example 3.
The expression cassette for the sTF (
Two PsiH-PsiD expression cassettes (
Four Agrobacterium tumefaciens strains (EHA105 background) were constructed each carrying plasmid with one expression cassette: 1) Agrobacterium-strain-1 with the PsiH-PsiD-sTF cassette, were the PsiH was of Psilocybe cyanescens origin and the PsiD was of Psilocybe cubensis origin; 2) Agrobacterium-strain-2 with the PsiH-PsiD-sTF cassette, were the PsiH was of Psilocybe cyanescens origin and the PsiD was of Psilocybe cyanescens origin; 3) Agrobacterium-strain-3 with the PsiK-PsiM-sTF cassette, were the PsiM was of Psilocybe cubensis origin and the PsiK was of Psilocybe cyanescens origin; 4) Agrobacterium-strain-4 with the PsiK-PsiM-sTF cassette, were the PsiM was of Psilocybe cubensis origin and the PsiK was of Psilocybe cubensis origin;
In the initial experiment (
The methanol extraction and the UPLC-MS analysis was performed as described in Example 3. Psilocybin, psilocin, L-tryptophan and tryptamine (all Sigma-Aldrich) were used as quantification standards (
In the second experiment (
CCACTATAAAAGGCTTGGGAACCCCTCGTTCTGTCTTACCTTCTATCATCTTACCAAATCCACTCC
TCTTCCTTCATACATCAATCTTACCAATCAACTACCTCTACAACTCCAATACACTTAATTAAA
ATG
CCCTGACTCCCTTCCTCCAAGTTCTATCTAACCAGCCATCCTACACTCTACATATCCACACCAATC
TACTACAATTATTAATTAAA
ATG
AGGCAGCACATATATAAGATGCTTCGTCCCCTCCCATCGAGTCCTTCTTTTCTCTCTCTCATCAAT
CACTCTACTTCCTACTCTACCTTAAACTCTTCACTACTTCATACGATTAACA
ATG
CAT
TTTAATTAAGTGTATTGGAGTTGTAGAGGTAGTTGATTGGTAAGATTGATGTATGAAGGA
AGAGGAGTGGATTTGGTAAGATGATAGAAGGTAAGACAGAACGAGGGGTTCCCAAGCCTTTT
ATAGTGGGATATTTGGCCACTTGATAAGGTGATCAGGCACTGCAGGGCATATGGCCACAGTTT
GGGGTATATAAAGCACCCTGACTCCCTTCCTCCAAGTTCTATCTAACCAGCCATCCTACACTCTA
CATATCCACACCAATCTACTACAATTATTAATTAAA
ATG
CCAAAATTGTAATTTACCGAGAATTGTAAATTTACCTGAAAACCCTACGCTATAGTTTCGACTAT
AAATACCAAACTTAGGACCTCACTTCAGAATCCCCTCGTCGCTGCGTCTCTCTCCCGCAACCTTC
GATTTTCGTTTATTCGCATCCATCGGAGAGAGAAAACAATCAATTAATTAAA
ATG
P. cubensis
P. cubensis
P. cubensis
P. cubensis
P. cubensis
P. cubensis
P. cubensis
P. cyanescens
P. cubensis
P. cubensis
P. cyanescens
P. cyanescens
P. cubensis
P. cubensis
P. cyanescens
P. cubensis
P. cubensis
P. cyanescens
P. cubensis
P. cubensis
P. cubensis
P. cyanescens
P. cubensis
P. cyanescens
P. cubensis
P. cyanescens
P. cyanescens
P. cyanescens
P. cubensis
P. cyanescens
P. cyanescens
P. cubensis
P. cyanescens
P. cyanescens
P. cubensis
P. cubensis
P. cyanescens
P. cyanescens
P. cubensis
P. cyanescens
P. cyanescens
P. cyanescens
P. cyanescens
P. cyanescens
P. cyanescens
P. cyanescens
P. cyanescens
P. cubensis
P. cyanescens
P. cubensis
P. cubensis
P. cubensis
P. cyanescens
P. cubensis
P. cubensis
P. cyanescens
P. cyanescens
P. cubensis
P. cyanescens
P. cyanescens
P. cyanescens
P. cubensis
P. cyanescens
P. cubensis
The foregoing description has provided, by way of non-limiting examples of particular implementations and embodiments of the invention, a full and informative description of the best mode presently contemplated by the inventors for carrying out the invention. It is, however, clear to a person skilled in the art that the invention is not restricted to details of the embodiments presented above, but that it can be implemented in other embodiments using equivalent means without deviating from the characteristics of the invention.
Furthermore, some of the features of the above-disclosed aspects and embodiments of this invention may be used to advantage without the corresponding use of other features. As such, the foregoing description should be considered as merely illustrative of the principles of the present invention, and not in limitation thereof. Hence, the scope of the invention is only restricted by the appended patent claims.
In an embodiment at least one component of the compositions or chemical products of the invention has a different chemical, structural or physical characteristic compared to the corresponding natural component from which the at least one component is derived from. In an embodiment said characteristic is at least one of uniform size, homogeneous dispersion, different isoform, different codon degeneracy, different post-translational modification, different methylation, different tertiary or quaternary structure, different enzyme activity, different affinity, different binding activity, and different immunogenicity.
Neuropsychopharmacol 24: 342-356.
| Number | Date | Country | Kind |
|---|---|---|---|
| 20185254 | Mar 2018 | FI | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/FI2019/050199 | 3/11/2019 | WO | 00 |
