Patent Application
20220315934
The invention relates generally to compositions, methods and kits for generating, assessing, improving the activity of and/or identifying compounds that target ribosomes.
The instant application contains a Sequence Listing which has been filed electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jul. 14, 2020, is named 52199_542001WO_SeqLis.txt and is 3.41 MB in size. A tabulated description of sequences presented in the instant Sequence Listing is provided in
Escherichia coli (E. coli) is one of the world's best-characterized organisms. Among many advantages of working with E. coli, it can divide every 20 min in the laboratory under aerobic, nutrient-rich conditions. Pathogenic microbes tend to divide much more slowly—e.g., Syntrophobacter fumaroxidans only doubles in the laboratory every 140 hours (Harmsen et al. Int. J. Syst. Bacteriol. 48: 1383-1388). Working with pathogenic microbes also incurs significant containment costs and carries inherent safety risks.
The extraordinary catalytic capabilities of the ribosome represent a promising avenue for both synthetic biology and for identification of new, ribosome-targeting agents/therapeutics, yet the complexity and essentiality of the ribosome have hindered significant engineering efforts. Despite these limitations, the existence of extensive sequence identity among ribosomal RNAs (rRNAs) from closely related species has enabled limited heterologous rRNA evaluation in engineered E. coli strains via complementation of a genomic ribosome deficiency. However, unsuccessful rRNA complementation has thus far failed to guide the optimization of refractory ribosomes. A need exists for methods and compositions capable of enhancing generation of host cells that harbor heterologous ribosomes and for improving ribosomal activity (and assessment of such activity) in such host cells, for synthetic biology/evolution and ribosome-targeting antibiotic screening purposes, among others.
The current disclosure relates, at least in part, to discovery and generation of an improved system that allows for assessment and evolution/improvement of heterologous ribosome activity within a host cell (optionally, a highly tractable host cell). Specifically, the instant disclosure provides a reporter system that enables monitoring of heterologous ribosome activity in a host cell, via engineering of heterologous rRNA operon sequences and reporter operon sequences. The instant disclosure has further identified that activity of a heterologous rRNA operon can be improved in a host cell by replacing intergenic sequences of the heterologous operon with corresponding host cell intergenic sequences, and that heterologous ribosome activity can be enhanced via introduction of discrete panels of heterologous r-proteins. The instant disclosure has further provided numerous heterologous rRNA-harboring genetic organisms, which enable improved screening approaches for ribosome-targeting agents and also allow for improved synthetic ribosome evolution approaches to be performed upon such cells. The instant disclosure therefore also provides screening approaches for identification of ribosome-targeting antibiotic agents, including, e.g., identification of narrow-spectrum antibiotic agents that preferentially target ribosomes of pathogenic microbes, as compared to commensal microorganisms.
In one aspect, the instant disclosure provides a method for increasing the activity and/or improving the maturation of a non-host cell ribosomal RNA (rRNA) in a host cell, where the non-host cell rRNA is encoded by a nucleic acid sequence harboring both rRNA coding sequences and intergenic sequences, the method involving replacing the intergenic sequences of the nucleic acid sequence harboring both rRNA coding sequences and intergenic sequences with intergenic sequences of the host cell, thereby increasing the activity and/or improving the maturation of the non-host cell rRNA in the host cell.
In one embodiment, the host cell is Escherichia coli. Optionally, the E. coli strain has a genomic deletion for rRNA sequences. Optionally, the E. coli strain carries a counter-selectable plasmid harboring E. coli rRNA sequences. Optionally, the E. coli strain is SQ171.
In certain embodiments, the non-host cell is Mycobacterium tuberculosis, Bifidobacterium longum, Veillonella parvula, Clostridium difficile, Bacillus subtilis, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, Bacteroides thetaiotaomicron, Helicobacter pylori, Desulfovibrio bastinii, Desulfovibrio vulgaris, Rickettsia parkeri, Rhodopseudomonas palustris, Caulobacter crescentus, Mariprofundus ferrooxydans, Ghiorsea bivora, Neisseria gonorrhoeae, Burkholderia cenocepacia, Bordetella pertussis, Alcaligenes faecalis, Acinetobacter baumannii, Pseudomonas aeruginosa, Marinospirillum minutulum, Alteromonas macleodii, Vibrio cholerae, Providencia stuartii, Proteus mirabilis, Serratia marcescens, Edwardsiella tarda, Enterobacter cloacae, Klebsiella oxytoca, Klebsiella pneumoniae, Klebsiella aerogenes, Citrobacter freundii, Salmonella enterica or Shigella spp. (e.g., Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella boydii).
In certain embodiments, the non-host cell is a commensal microbe. Optionally, the commensal microbe is of the phylum Firmicutes, Bacteroidetes, Bifidobacteria, Eubacteria, Ruminococcus, Lactobacillus, Peptococcus, Proteobacteria, Verrumicrobia, Actinobacteria, Fusobacteria or Cyanobacteria, or a combination of phyla thereof.
In another embodiment, the host cell is Bacillus subtilis. Optionally, the B. subtilis strain has a genomic deletion for rRNA sequences. Optionally, the B. subtilis strain carries a counter-selectable plasmid harboring B. subtilis rRNA sequences.
In some embodiments, the non-host cell is Mycobacterium tuberculosis, Bifidobacterium longum, Veillonella parvula, Clostridium difficile, Escherichia coli, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, Bacteroides thetaiotaomicron, Helicobacter pylori, Desulfovibrio bastinii, Desulfovibrio vulgaris, Rickettsia parkeri, Rhodopseudomonas palustris, Caulobacter crescentus, Mariprofundus ferrooxydans, Ghiorsea bivora, Neisseria gonorrhoeae, Burkholderia cenocepacia, Bordetella pertussis, Alcaligenes faecalis, Acinetobacter baumannii, Pseudomonas aeruginosa, Marinospirillum minutulum, Alteromonas macleodii, Vibrio cholerae, Providencia stuartii, Proteus mirabilis, Serratia marcescens, Edwardsiella tarda, Enterobacter cloacae, Klebsiella oxytoca, Klebsiella pneumoniae, Klebsiella aerogenes, Citrobacter freundii, Salmonella enterica or Shigella spp. (e.g., Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella boydii).
In certain embodiments, the non-host cell is Yersinia pestis, Yersinia pseudotuberculosis, Yersinia enterocolitica, Mycobacterium bovis, Mycobacterium avium, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes, Campylobacter jejuni, Bacteroides fragilis, Proteus vulgaris or Haemophilus influenza.
In one embodiment, the nucleic acid sequence having both rRNA coding sequences and intergenic sequences includes non-host cell 165, 23S and 5S rRNA sequences. Optionally, the non-host cell 165, 23S and 5S rRNA sequences are under the control of an inducible promoter. Optionally, the inducible promoter is an aTc-inducible promoter or an IPTG-inducible promoter.
In a related embodiment, the host cell includes a nucleic acid sequence harboring an orthogonal-ribosome binding site (o-RBS) positioned upstream of a reporter sequence. Optionally, the reporter sequence encodes a fluorescent protein. Optionally, the fluorescent protein is a Sirius fluorescent protein, mTagBFP2, a blue fluorescent protein (BFP), Sapphire fluorescent protein, mCerulean, a yellow fluorescent protein (YFP), LSS-mKate2, MiCy, green a fluorescent protein (GFP), mEmerald, Venus, mPapaya, mScarlet-1, mCherry, mRFP, Katushka-9-5, mCarmine, mMaroon1, or E2-Crimson. Optionally, the reporter sequence encodes a chemiluminescent protein. Optionally, the chemiluminescent protein is a luciferase protein. Optionally, the nucleic acid sequence having an o-RBS positioned upstream of a reporter sequence is under the control of an inducible promoter. Optionally, the inducible promoter is an aTc-inducible promoter or an IPTG-inducible promoter. Optionally, the o-RBS reporter sequence is under the control of a PLTet0-1 or a PtetA promoter.
Optionally, the nucleic acid sequence including both rRNA coding sequences and intergenic sequences harbors a non-host cell 16S rRNA sequence that further includes an o-antiRBS sequence. (An exemplary o-antiRBS sequence is 5′-ACCACA-3′ (SEQ ID NO: 406), while a specific example of o-antiRBS-containing sequence, shown in
In certain embodiments, non-host cell rRNA activity is increased to 50% or more of the level of an appropriate host cell rRNA activity control.
In some embodiments, growth of the host cell is improved.
An additional aspect of the instant disclosure provides a nucleic acid sequence having an aTC-inducible promoter and 165, 23S and 5S rRNA coding sequences, where the 16S sequence further harbors an o-antiRBS sequence.
Another aspect of the instant disclosure provides a rRNA reporter system that includes (a) a first nucleic acid sequence harboring an aTC-inducible promoter and 165, 23S and 5S rRNA coding sequences, where the 16S sequence further includes an o-antiRBS sequence; and (b) a second nucleic acid sequence including an o-RBS sequence and a reporter sequence.
In one embodiment, the second nucleic acid sequence includes an inducible promoter. Optionally, the inducible promoter is an IPTG-inducible promoter.
In certain embodiments, the reporter sequence encodes a green fluorescent protein (GFP), a blue fluorescent protein (BFP), a yellow fluorescent protein (YFP), luciferase or a mRFP (e.g., mCherry).
In one embodiment, the aTC-inducible promoter is a PLtetO-1 or a PtetA promoter.
In another embodiment, the rRNA reporter system further includes a third nucleic acid sequence encoding for S20, S16, S1 and/or S15 r-protein(s).
In certain embodiments, the 165, 23S and 5S rRNA coding sequences are non-E. coli sequences. Optionally, the first nucleic acid sequence further includes intergenic sequences. Optionally, the intergenic sequences are E. coli intergenic sequences. Optionally, the rRNA reporter system further includes a third nucleic acid sequence encoding for non-E. coli S20, S16, S1 and/or S15 r-protein(s) of the same organism as the non-E. coli 16S, 23S and 5S rRNA coding sequences.
Another aspect of the instant disclosure provides a host cell harboring a nucleic acid sequence having non-host cell 16S, 23S and 5S rRNA coding sequences, where the non-host cell is Mycobacterium tuberculosis, Bifidobacterium longum, Veillonella parvula, Clostridium difficile, Bacillus subtilis, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, Bacteroides thetaiotaomicron, Helicobacter pylori, Desulfovibrio bastinii, Desulfovibrio vulgaris, Rickettsia parkeri, Rhodopseudomonas palustris, Caulobacter crescentus, Mariprofundus ferrooxydans, Ghiorsea bivora, Neisseria gonorrhoeae, Burkholderia cenocepacia, Bordetella pertussis, Alcaligenes faecalis, Acinetobacter baumannii, Pseudomonas aeruginosa, Marinospirillum minutulum, Alteromonas macleodii, Vibrio cholerae, Providencia stuartii, Proteus mirabilis, Serratia marcescens, Edwardsiella tarda, Enterobacter cloacae, Klebsiella oxytoca, Klebsiella pneumoniae, Klebsiella aerogenes, Citrobacter freundii or Shigella spp. (e.g., Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella boydii).
A further aspect of the instant disclosure provides a host cell harboring a nucleic acid sequence that includes non-host cell 165, 23S and 5S rRNA coding sequences, where the non-host cell is a commensal microbe. Optionally, the commensal microbe is of one or more of the following phyla: Firmicutes, Bacteroidetes, Bifidobacteria, Eubacteria, Ruminococcus, Lactobacillus, Peptococcus, Proteobacteria, Verrumicrobia, Actinobacteria, Fusobacteria, and Cyanobacteria.
In one embodiment, the nucleic acid sequence having non-host cell 165, 23S and 5S rRNA coding sequences further includes intergenic sequences. Optionally, the intergenic sequences are host cell intergenic sequences.
In another embodiment, the non-host cell 16S rRNA sequence further includes an o-antiRBS sequence.
In an additional embodiment, the host cell further includes a nucleic acid sequence encoding for S20, S16, S1 and/or S15 r-protein(s) of the non-host cell.
In some embodiments, the host cell further includes a nucleic acid sequence harboring an orthogonal-ribosome binding site (o-RBS) positioned upstream of a reporter sequence. Optionally, the nucleic acid sequence harboring an o-RBS positioned upstream of a reporter sequence is under the control of an inducible promoter.
An additional aspect of the instant disclosure provides a method for increasing the activity of a non-host cell ribosomal RNA (rRNA) in a host cell, the method involving introducing a nucleic acid sequence encoding for S20 and/or S16 r-protein(s) of the non-host cell into the host cell, thereby increasing the activity of the non-host cell rRNA in the host cell.
In one embodiment, the method further involves introducing a nucleic acid sequence encoding for S1 and/or S15 r-protein(s) of the non-host cell into the host cell.
In certain embodiments, the host cell is Escherichia coli. Optionally, the non-host cell is Mycobacterium tuberculosis, Bifidobacterium longum, Veillonella parvula, Clostridium difficile, Bacillus subtilis, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, Bacteroides thetaiotaomicron, Helicobacter pylori, Desulfovibrio bastinii, Desulfovibrio vulgaris, Rickettsia parkeri, Rhodopseudomonas palustris, Caulobacter crescentus, Mariprofundus ferrooxydans, Ghiorsea bivora, Neisseria gonorrhoeae, Burkholderia cenocepacia, Bordetella pertussis, Alcaligenes faecalis, Acinetobacter baumannii, Pseudomonas aeruginosa, Marinospirillum minutulum, Alteromonas macleodii, Vibrio cholerae, Providencia stuartii, Proteus mirabilis, Serratia marcescens, Edwardsiella tarda, Enterobacter cloacae, Klebsiella oxytoca, Klebsiella pneumoniae, Klebsiella aerogenes, Citrobacter freundii, Salmonella enterica, Yersinia pestis, Yersinia pseudotuberculosis, Yersinia enterocolitica, Mycobacterium bovis, Mycobacterium avium, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes, Campylobacter jejuni, Bacteroides fragilis, Proteus vulgaris, Haemophilus influenza or Shigella spp. (e.g., Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella boydii).
In some embodiments, the host cell is Bacillus subtilis. Optionally, the non-host cell is Mycobacterium tuberculosis, Bifidobacterium longum, Veillonella parvula, Clostridium difficile, Escherichia coli, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, Bacteroides thetaiotaomicron, Helicobacter pylori, Desulfovibrio bastinii, Desulfovibrio vulgaris, Rickettsia parkeri, Rhodopseudomonas palustris, Caulobacter crescentus, Mariprofundus ferrooxydans, Ghiorsea bivora, Neisseria gonorrhoeae, Burkholderia cenocepacia, Bordetella pertussis, Alcaligenes faecalis, Acinetobacter baumannii, Pseudomonas aeruginosa, Marinospirillum minutulum, Alteromonas macleodii, Vibrio cholerae, Providencia stuartii, Proteus mirabilis, Serratia marcescens, Edwardsiella tarda, Enterobacter cloacae, Klebsiella oxytoca, Klebsiella pneumoniae, Klebsiella aerogenes, Citrobacter freundii, Salmonella enterica, Yersinia pestis, Yersinia pseudotuberculosis, Yersinia enterocolitica, Mycobacterium bovis, Mycobacterium avium, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes, Campylobacter jejuni, Bacteroides fragilis, Proteus vulgaris, Haemophilus influenza or Shigella spp. (e.g., Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella boydii).
In one embodiment, the non-host cell is A. baumannii and the nucleic acid sequence encodes for AbS20 and/or AbS16 r-protein(s).
In another embodiment, the non-host cell is A. macleodii and the nucleic acid sequence encodes for AmS20 and AmS16 r-proteins. Optionally, the nucleic acid sequence further encodes for AmS1 and/or AmS15 r-protein(s).
In an additional embodiment, the non-host cell is V. cholerae or M. minitulum and the nucleic acid sequence encodes for S20, S16, S1 and S15 r-proteins of the non-host cell.
In certain embodiments, the non-host cell is P. aeruginosa and the nucleic acid sequence encodes for PaS16 and PaS20 r-proteins. Optionally, the nucleic acid sequence further encodes for PaS1 and/or PaS15 r-protein(s).
In another embodiment, the non-host cell is A. faecalis, B. cenocepacia, N. gonnorrheae, M. ferrooxydans, or C. crescentus and the nucleic acid sequence encodes for cognate non-host cell S16 and S20 r-proteins.
In some embodiments, the nucleic acid sequence encoding for S20 and/or S16 r-proteins of the non-host cell is under the control of a copy-up variant. Optionally, the copy-up variant is RepA E93K or E93R.
In another embodiment, the host cell further includes an o-RBS reporter construct. Optionally, the reporter of the o-RBS reporter construct is under control of an IPTG-inducible promoter.
In one embodiment, a nucleic acid sequence harboring non-host cell 16S, 23S and 5S rRNA sequences expresses the non-host cell rRNA in the host cell. Optionally, the non-host cell 16S, 23S and 5S rRNA sequences are under the control of an inducible promoter. Optionally, the inducible promoter is an aTc-inducible promoter or an IPTG-inducible promoter. Optionally, the host cell includes a nucleic acid sequence harboring an orthogonal-ribosome binding site (o-RBS) positioned upstream of a reporter sequence. Optionally, the nucleic acid sequence harboring an o-RBS positioned upstream of a reporter sequence is under the control of an inducible promoter. Optionally, the inducible promoter is an aTc-inducible promoter or an IPTG-inducible promoter.
In another embodiment, the nucleic acid sequence having non-host cell 16S, 23S and 5S rRNA sequences includes a non-host cell 16S rRNA sequence further including an o-antiRBS sequence.
In certain embodiments, non-host cell rRNA activity is increased to 50% or more of the level of an appropriate host cell rRNA control.
In some embodiments, growth of the host cell is improved.
In a further aspect, the instant disclosure provides a method for identifying a compound capable of modulating the rRNA activity of a pathogenic microbe in a host cell, where the host cell includes (i) a rRNA reporter system having a first nucleic acid sequence harboring 165, 23S and 5S rRNA coding sequences, where the 16S sequence further includes an o-antiRBS sequence; and (ii) a second nucleic acid sequence having an o-RBS sequence and a reporter sequence, the method involving: (a) contacting the host cell with a test compound; and (b) measuring modulation of the reporter sequence in the presence of the test compound, as compared to an appropriate control, thereby identifying the test compound as a compound capable of modulating the rRNA activity of a pathogenic microbe in the host cell.
In certain embodiments, the appropriate control is the rRNA activity of a commensal microbe. Optionally, the rRNAs of pathogenic and commensal microbes are multiplexed in the host cell.
In one embodiment, the test compound reduces pathogenic microbe rRNA activity.
In another embodiment, the test compound, when administered to the pathogenic microbe, reduces growth of the pathogenic microbe.
In certain embodiments, the test compound is a small molecule.
In some embodiments, the host cell further includes a nucleic acid sequence encoding for S20, S16, S1 and/or S15 r-protein(s) of the pathogenic microbe.
In another embodiment, the first nucleic acid sequence harboring 165, 23S and 5S rRNA coding sequences further includes intergenic sequences. Optionally, the intergenic sequences are host cell intergenic sequences.
In one embodiment, the test compound selectively modulates the rRNA activity of the pathogenic microbe in the host cell, as compared to modulation of rRNA activity of a commensal microbe in the host cell.
In some embodiments, a test compound which preferentially inhibits the rRNA activity of a pathogenic microbe as compared to the rRNA activity of a commensal microbe is selected for administration to a subject having or at risk of having the pathogenic microbe.
In another aspect, the instant disclosure provides a method for identifying a compound that does not modulate or only weakly modulates (as compared to a pathogenic microbe) the rRNA activity of a commensal microbe in a host cell having (i) a rRNA reporter system harboring a first nucleic acid sequence including 16S, 23S and 5S rRNA coding sequences, where the 16S sequence further includes an o-antiRBS sequence and (ii) a second nucleic acid sequence harboring an o-RBS sequence and a reporter sequence, the method involving: (a) contacting the host cell with a test compound; and (b) measuring modulation of the reporter sequence in the presence of the test compound, as compared to an appropriate control, thereby identifying the test compound as a compound that does not modulate or only weakly modulates (as compared to a pathogenic microbe) the rRNA activity of the commensal microbe in the host cell.
Another aspect of the instant disclosure provides an E. coli cell harboring mutated forms of 23S rRNA genes rrlA, rrlB, rrlC, rrlD, rrlE, rrlG and rrlH.
In embodiments, the E. coli cell further comprises a superfolder GFP (sfGFP) reporter.
In certain embodiments, at least one 23S rRNA gene of E. coli cell genes rrlA, rrlB, rrlC, rrlD, rrlE, rrlG and rrlH harbors an A2058U mutation.
In embodiments, the E. coli cell is erythromycin-resistant.
In some embodiments, the E. coli cell further includes an orthogonal large subunit ribosome and/or an orthogonal small subunit ribosome.
Another aspect of the instant disclosure provides a method for identifying the presence and/or extent of association between an orthogonal SSU and a host cell LSU, the method involving: contacting a host cell of the disclosure having a host cell LSU and harboring a nucleic acid sequence that encodes for an orthogonal SSU capable of being expressed in the host cell, contacting the host cell harboring the orthogonal SSU with erythromycin; and observing the erythromycin sensitivity of the host cell harboring the orthogonal SSU, where: (a) erythromycin sensitivity of the host cell harboring the orthogonal SSU indicates high levels of exchange between the orthogonal SSU and the host cell LSU; and (b) erythromycin resistance of the host cell harboring the orthogonal SSU indicates low levels of exchange between the orthogonal SSU and the host cell LSU (i.e., the orthogonal SSU preferentially associates with the host cell LSU), thereby identifying association between the orthogonal SSU and the host cell LSU.
In one embodiment, the host cell is an E. coli cell.
An additional aspect of the instant disclosure provides a method for enhancing translation in a host cell of an orthogonal nucleic acid harboring a reporter sequence, where the reporter sequence has a 5′ end and a 3′ end, the method involving attaching a sfGFP sequence at the 5′ end of the reporter sequence, thereby enhancing translation of the orthogonal nucleic acid sequence in the host cell.
In one embodiment, the sfGFP sequence includes or is a sequence encoding for SEQ ID NO: 409 (N-MSKGEELFTG-C). Optionally, the sfGFP sequence includes or is SEQ ID NO: 408 (5′-ATGAGCAAAGGTGAAGAACTGTTTACCGGC-3′).
A further aspect of the instant disclosure provides a nucleic acid sequence that includes a first sequence having an o-antiRBS sequence, the first sequence being operably linked to a second sequence that includes a sfGFP sequence having a 5′ and a 3′ end, where the 3′ end of the sfGFP sequence is attached to the 5′ end of a reporter nucleic acid sequence having a 5′ and a 3′ end.
In one embodiment, the reporter nucleic acid sequence encodes a fluorescent protein. Optionally, the fluorescent protein is a Sirius fluorescent protein, mTagBFP2, a blue fluorescent protein (BFP), a Sapphire fluorescent protein, mCerulean, a yellow fluorescent protein (YFP), LSS-mKate2, MiCy, a green fluorescent protein (GFP) (optionally, a superfolder green fluorescent protein (sfGFP)), mEmerald, Venus, mPapaya, mScarlet-1, mCherry, mRFP, Katushka-9-5, mCarmine, mMaroon1, or E2-Crimson.
In another embodiment, the reporter nucleic acid sequence encodes a chemiluminescent protein. Optionally, the chemiluminescent protein is a luciferase protein.
The term “host cell” is used herein to denote any cell, wherein any foreign or exogenous genetic material has been introduced. In its broadest sense, “host cell” is used to denote a cell which has been genetically manipulated. In certain embodiments, “host cell” refers to a microbe, optionally a prokaryotic cell, optionally a tractable prokaryotic cell (e.g., E. coli, B. subtilis, etc.).
As used herein, “heterologous sequence” or “heterologous protein” (e.g., heterologous ribosome) means any sequence or protein other than the one that naturally occurs within a host cell (optionally, in a host cell that has not been genetically modified). In certain embodiments, a heterologous sequence or protein is one for which a corresponding homologous sequence or protein exists within an unmodified host cell.
As used herein, the term “pathogenic microbe” refers to a biological microorganism that is capable of producing an undesirable effect upon a host animal, and includes, for example, without limitation, bacteria, viruses, bacterial spores, molds, mildews, fungi, and the like. This includes all such biological microorganisms, regardless of their origin or of their method of production, and regardless of whether they exist in facilities, in munitions, weapons, or elsewhere. In certain embodiments, the pathogenic microbe of the instant disclosure is a pathogenic bacteria.
As used herein, the term “commensal microbe” refers to a biological microorganism that lives on or in another organism without causing harm. A commensal microbe may refer, without limitation, to bacteria, viruses, fungi, and the like. The term therefore includes all such biological microorganisms, regardless of their origin or of their method of production, and regardless of where they exist. In certain embodiments, the commensal microbe of the instant disclosure is a commensal bacteria.
As used herein, the term “reporter gene” or “reporter nucleic acid” sequence (including “reporter sequence” where reference to a nucleic acid sequence is clear) refers to genes or nucleic acid sequences that enable the detection or measurement of gene expression. Reporter genes and/or reporter nucleic acid sequences may be recombined with regulatory sequences and/or genes of interest, e.g., to report expression, location and/or levels. In some embodiments of the present disclosure, the reporter nucleic acid sequence(s) is a gene encoding a fluorescent or chemiluminescent protein. In some embodiments, a “tag” sequence of the superfolder GFP nucleic acid sequence (“sfGFP” tag nucleic acid sequence is 5′-ATGAGCAAAGGTGAAGAACTGTTTACCGGC-3′ (SEQ ID NO: 408), which encodes for amino acid sequence N-MSKGEELFTG-C(SEQ ID NO: 409)) is employed, as the sfGFP tag sequence was surprisingly identified to enhance the translation of other associated proteins in a host cell.
Unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. “About” can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value.
In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
Unless otherwise clear from context, all numerical values provided herein are modified by the term “about.”
By “control” or “reference” is meant a standard of comparison. In one aspect, as used herein, “changed as compared to a control” sample or subject is understood as having a level that is statistically different than a sample from a normal, untreated, or control sample. Control samples include, for example, cells in culture, one or more laboratory test animals, or one or more human subjects. Methods to select and test control samples are within the ability of those in the art. Determination of statistical significance is within the ability of those skilled in the art, e.g., the number of standard deviations from the mean that constitute a positive result.
The terms “isolated,” “purified,” or “biologically pure” refer to material that is free to varying degrees from components which normally accompany it as found in its native state. “Isolate” denotes a degree of separation from original source or surroundings. “Purify” denotes a degree of separation that is higher than isolation.
By “homologous sequence” is meant a nucleotide sequence that is shared by one or more polynucleotide sequences, such as genes, gene transcripts and/or non-coding polynucleotides. For example, a homologous sequence can be a nucleotide sequence that is shared by two or more genes encoding related but different proteins, such as different members of a gene family, different protein epitopes, different protein isoforms or completely divergent genes, such as a cytokine and its corresponding receptors. A homologous sequence can be a nucleotide sequence that is shared by two or more non-coding polynucleotides, such as noncoding DNA or RNA, regulatory sequences, introns, and sites of transcriptional control or regulation. Homologous sequences can also include conserved sequence regions shared by more than one polynucleotide sequence. Homology does not need to be perfect homology (e.g., 100%), as partially homologous sequences are also contemplated by the instant disclosure (e.g., 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80% etc.). Indeed, design and use of the nucleotide sequences of the instant disclosure contemplates the possibility of using nucleotide sequences that are, e.g., only 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80% etc. homologous to nucleotide sequences recited herein. Indeed, it is contemplated that nucleotide sequences with insertions, deletions, and single point mutations relative to the specific sequences disclosed herein can also be effective, e.g., for use in nucleic acid constructs (and in certain embodiments, in encoded polypeptide sequences) of the instant disclosure. In addition, it is expressly contemplated that nucleotide and/or amino acid sequences with analog substitutions or insertions can also be employed.
Sequence identity may be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or of two amino acid sequences), the sequences are aligned for comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology=# of identical positions/total # of positions×100), optionally penalizing the score for the number of gaps introduced and/or length of gaps introduced.
The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the alignment generated over a certain portion of the sequence aligned having sufficient identity but not over portions having low degree of identity (i.e., a local alignment). A preferred, non-limiting example of a local alignment algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
In another embodiment, a gapped alignment, the alignment is optimized by introducing appropriate gaps, and percent identity is determined over the length of the aligned sequences (i.e., a gapped alignment). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, a global alignment the alignment is optimized by introducing appropriate gaps, and percent identity is determined over the entire length of the sequences aligned. (i.e., a global alignment). A preferred, non-limiting example of a mathematical algorithm utilized for the global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive. Unless specifically stated or obvious from context, as used herein, the terms “a”, “an”, and “the” are understood to be singular or plural.
Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it is understood that the particular value forms another aspect. It is further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. It is also understood that throughout the application, data are provided in a number of different formats and that this data represent endpoints and starting points and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point “15” are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 as well as all intervening decimal values between the aforementioned integers such as, for example, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. With respect to sub-ranges, “nested sub-ranges” that extend from either end point of the range are specifically contemplated. For example, a nested sub-range of an exemplary range of 1 to 50 may comprise 1 to 10, 1 to 20, 1 to 30, and 1 to 40 in one direction, or 50 to 40, 50 to 30, 50 to 20, and 50 to 10 in the other direction.
The transitional term “comprising,” which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. By contrast, the transitional phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. The transitional phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention.
Other features and advantages of the disclosure will be apparent from the following description of the preferred embodiments thereof, and from the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All published foreign patents and patent applications cited herein are incorporated herein by reference. All other published references, documents, manuscripts and scientific literature cited herein are incorporated herein by reference. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The following detailed description, given by way of example, but not intended to limit the disclosure solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings, in which:
The present disclosure is directed, at least in part, to discovery of an improved system for monitoring and improving heterologous ribosome activity within a host cell (optionally, within a highly tractable host cell, such as E. coli, B. subtilis, or other), where such assessment is not reliant upon the heterologous ribosome maintaining growth of the host cell. Specifically, the instant disclosure provides a reporter system that enables monitoring of heterologous ribosome activity in a host cell, via engineering of heterologous rRNA operon sequences and reporter operon sequences. Strikingly, for certain heterologous ribosomes, activity of a heterologous rRNA operon can be improved in a host cell by replacing intergenic sequences of the heterologous operon with corresponding host cell intergenic sequences, as well as via introduction of certain heterologous r-proteins (e.g., S20, S16, S1 and/or S15 r-proteins).
Various new heterologous rRNA-harboring genetic organisms have also been provided herein. Such organisms allow for improved screening approaches to identify ribosome-targeting agents, as well as for improved synthetic ribosome evolution. The instant disclosure therefore also provides methods and compositions for identifying ribosome-targeting antibiotic agents, including, e.g., identification of narrow-spectrum antibiotic agents that preferentially target ribosomes of pathogenic microbes, as compared to ribosomes of commensal microbes (in certain embodiments, ribosomal components of pathogenic microbes and commensal microbes can be multiplexed within a common host cell, allowing for direct comparison of, e.g., response to a test compound, between ribosomal components of pathogenic microbes and those of commensal microbes). Such narrow-spectrum antibiotic agents promise clear therapeutic advantages, e.g., where applied to microbes of the gut microbiome, as well as in other scenarios. The compositions, methods and application(s) of the instant disclosure are considered in additional detail below.
The ribosome represents a promising avenue for synthetic biology, but its complexity and essentiality have until now hindered significant engineering efforts. Heterologous ribosomes, comprising rRNAs from divergent organisms, are expected to offer opportunities for enhanced orthogonality or discovery of novel translational functions. Such ribosomes have previously been evaluated in E. coli via complementation of a genomic ribosome deficiency, but this prior art method has failed to guide engineering of refractory ribosomes. In certain aspects, the instant disclosure has implemented orthogonal ribosome binding site (RBS):anti-RBS pairs to quantify the translation of heterologous ribosomes, which has been observed herein to significantly improve the accuracy and throughput of heterologous ribosome analysis. Orthogonal translation has been applied herein to define general requirements for efficient heterologous rRNA processing, and the instant disclosure has discovered that supplementation with a small subset of cognate r-proteins enhanced heterologous ribosome activity for rRNAs derived from organisms with as little as 76.1% 16S rRNA sequence identity to E. coli. In addition, the instant disclosure has identified that moderately divergent heterologous rRNAs can selectively assemble into species-specific ribosomes with limited E. coli subunit association. Cumulatively, certain aspects of the instant disclosure provide a general framework for heterologous ribosome engineering in living cells.
Heterologous ribosomes are canonically produced in E. coli via introduction of ribosomal components derived from extant microbes. Until now, the efficiency of this process has not been high for increasingly divergent microbes, owing to poor ribosome maturation and interaction with host E. coli factors. The instant disclosure has identified defined methods for producing previously intractable heterologous ribosomes in E. coli via (1) processing signal engineering and (2) ribosomal protein complementation, thereby yielding high activity heterologous ribosomes that mimic the natural counterparts.
In particular, non-native ribosomes (i.e., ribosomes from foreign organisms) have been employed herein, and systems for improving heterologous ribosome function in E. coli have been engineered through the following: (1) engineering of specific intergenic sequences to enhance and enable robust ribosomal RNA maturation via interaction with appropriate cellular RNAses, and (2) supplementation with select cognate ribosomal proteins to complement assembly deficiencies of heterologous rRNAs.
In addition to catalyzing the biosynthesis of the complete cellular proteome, the ribosome serves as a hub for signaling events, integrating nutrient availability with growth dynamics and resource allocation (1, 2). In prokaryotes, this functionality is enabled by the concerted action of numerous components: the 16S rRNA and 21 ribosomal proteins (r-proteins) define the small subunit (SSU or 30S), whereas the 23S rRNA, 5S rRNA and 33 r-proteins define the large subunit (LSU or 50S) (3). Extensive efforts towards engineering translation have yielded researcher-dictated, specialized functions in vivo: parallel genetic circuits (4, 71-74), augmented polypeptide diversity using non-canonical amino acids (5), expanded genetic codes incorporating quadruplet codons (6), and linked ribosomal subunits for improved cellular orthogonality (7-9). However, these efforts typically made use of E. coli components, yielding systems that continue to crosstalk with the chassis bacterial cell in unpredictable ways.
Conversely, ribosomal components derived from divergent microorganisms offer enhanced orthogonality as well as the opportunity to discover unique or dedicated ribosomal capabilities, as indicated by naturally occurring subpopulations of prokaryotic ribosomes (10): stress-inducible production of rrsH ribosomes in E. coli modifies the cellular translational program (11), rrnl ribosomes in Vibrio vulnificius selectively translate certain mRNAs (70), and genetically heterogeneous ribosomes are produced at defined stages of the complex Streptomyces coelicolor developmental cycle (12). R-protein complements further specialize ribosomal function, as they are known to vary in the E. coli ribosome under different growth conditions (13), and ribosomes carrying S1 play a role in leaderless mRNA decoding (14). Heterologous ribosomes, synthesized in E. coli using diverse rRNAs and cognate r-proteins, therefore facilitate the discovery or engineering of novel translational capabilities.
Prior investigations of heterologous rRNAs have employed E. coli Δ7 strains lacking all seven chromosomal rRNA operons (e.g., SQ171, KT101, SQZ10, SQ2518) (15-17). These Δ7 strains additionally informed studies on rDNA copy number (18), ribosomal sequence-function relationships (19), factors affecting rRNA processing (20, 21), and rRNA-protein interactions (22). These strains bear a complete genomic rRNA deficiency and are complemented by a counter-selectable rRNA-encoding plasmid, facilitating plasmid exchange with rRNA variants capable of sustaining E. coli survival. Indeed, full-length heterologous rRNA operons derived from species bearing ≥93.2% 16S sequence identity to their E. coli counterparts were found to sustain E. coli Δ7 strain viability (17), whereas 16S sequence fragments bearing ≥80.9% identity were identified to substitute for otherwise wildtype E. coli 16S rRNAs (16). Natural horizontal gene transfer events in the evolutionary record have provided further evidence for heterologous translation with intragenomic 16S identity as low as 88.4% (23-27).
However, past E. coli Δ7 strain complementation assays have proven problematic for systematically evaluating heterologous ribosome function given the myriad roles played by the ribosome in sustaining cell viability, both catalytic and regulatory (28, 29). Specifically, past efforts to engineer heterologous ribosome function have been hampered by the absence of a more quantitative translational assay that reports on a single aspect of ribosome function (as is now disclosed herein). Therefore, guidelines have now been developed herein for evaluating and enhancing the translational activity of heterologous rRNAs in E. coli using a method that reports exclusively on catalytic activity, independent of an rRNA's ability to support cell growth. To achieve this, a library of 34 complete rRNA operons derived from phylogenetically diverse microbes was constructed. Activities of the of 34 complete rRNA operons have been evaluated herein via E. coli Δ7 strain complementation as well as orthogonal translation, which implemented engineered RBS:anti-RBS pairs that exclusively translated researcher-defined reporter transcripts (4, 71-74). Finding a high degree of correlation between the two methods, the orthogonal translation method has been applied herein to guide rRNA processing sequence engineering. The instant disclosure has therefore identified that divergent intergenic sequences exert significant consequences upon heterologous ribosome maturation in E. coli. Furthermore, a small subset of r-proteins were identified that significantly enhanced the activity of refractory heterologous ribosomes possessing as little as 76.1% 16S rRNA sequence identity to E. coli. In addition, it has been identified herein that heterologous 16S rRNAs having intermediate sequence identity preferentially associated with their cognate 23S rRNAs in E. coli. Together, these results have established the herein-disclosed quantitative and extensible method(s) for the engineering of heterologous ribosome activity in vivo, which greatly facilitates the development of diverse ribosomes for synthetic biology applications (including the development of diverse ribosomes with specialized functions). In addition to the process for improving heterologous rRNA maturation and activity, new organisms harboring heterologous rRNAs have also been manufactured and provided herein. Use of such new organisms to streamline identification of new antibiotics, including highly selective/narrow spectrum antibiotics capable of selectively killing targeted pathogenic microbes, is also contemplated.
Herein, microbial phylogenetic relationships have been integrated with orthogonal translation via engineered ribosome binding site (RBS):anti-RBS pairs to quantify heterologous ribosome activity. The findings disclosed herein highlight generally applicable requirements for efficient rRNA processing and cognate r-protein supplementation, which yield functional heterologous ribosomes in E. coli. (and are contemplated to yield functional heterologous ribosomes in other microbes (e.g., B. subtilis) Cumulatively, the instant disclosure also enables further generation of functional heterologous ribosomes possessing new and specialized capabilities for synthetic translation.
rRNAs and r-Proteins
The E. coli ribosome is composed of two large particles, the 30S and the 50S subunits. The 30S subunit consists of a 16S rRNA molecule and 21 small ribosomal proteins (“r-proteins’). The 50S subunit is composed of two ribosomal RNA (rRNA) molecules, 23S and 5S rRNA, and 31 large ribosomal proteins.
Prokaryotic ribosomes are similar across species, but homology of individual ribosomal proteins diverges with phylogenetic distance. rRNAs are relatively few in number and yet play an important role in protein synthesis (Gutell et al., 1985, Prog. Nucleic Acid Res. Mol. Biol. 32:155-216). Ribosome assembly in bacteria is a tightly controlled process. For example, the synthesis of ribosomal components, rRNA and r-proteins, is coordinately regulated to ensure that these molecules are produced in the optimal stoichiometry. Protein-RNA interactions play important regulatory roles at several steps in this process. Synthesis of r-proteins is negatively regulated at the translational level by the binding of repressor r-proteins to specific sites in mRNA. As part of another regulatory step in the ribosome assembly process, certain r-proteins bind to rRNA, to initiate the ordered assembly of the ribosome. Binding of these r-proteins, termed “primary binders,” is required for the subsequent steps of ribosome assembly (Zengel & Lindahl, 1994, Prog. Nuc. Acid Res. Molec. Biol. 47:332-370).
The interaction of ribosomal proteins with RNA influences the synthesis of ribosomal proteins and their assembly into fully functional ribosomes. Ribosomal assembly in E. coli involves the coordinate expression of rRNA and r-proteins. Binding of certain ribosomal proteins to ribosomal RNAs (rRNAs) is necessary for the ordered assembly of fully functional ribosomes. In the course of assembly, a subset of ribosomal proteins, termed primary binding r-proteins, has been identified as binding rRNA directly, and as facilitating the binding of other ribosomal proteins.
rRNA, r-Protein and Construct Sequences
rRNA, r-protein and other rRNA and/or reporter construct sequences of the instant disclosure are presented in the accompanying Sequence Listing, with
rRNA-Deleted Host Strains
It is expressly contemplated that certain compositions and methods of the instant disclosure can employ any appropriate rRNA-deleted host cell. Exemplary rRNA-deleted host cells include, without limitation:
SQ171 is an rrn E. coli strain lacking all seven chromosomal rRNA operons and carrying a single, counter-selectable plasmid bearing the wildtype rrnC operon (50).
KT101 is another example of a rrn E. coli strain lacking all seven chromosomal rRNA operons (rrnA, B, C, D, E, G, H) (21). Growth of KT01 can be complemented by the rrnB operon encoded in rescue plasmid pRB101 (Kitahara et al. PNAS 109: 19220-19225).
Culture and transformation of bacterial cells can be performed by any art-recognized method. E. coli is commonly propagated in rich media, with examples including LB, 2× yeast extract-tryptone (YT), Terrific Broth (TB), and Super Broth (SB).
While early attempts to achieve transformation of E. coli were unsuccessful and it was at one time even believed that E. coli was refractory to transformation, Mandel and Higa (J. Mol. Bio. 53: 159-162 (1970)) found that treatment with CaCl2) allowed E. coli bacteria to take up DNA from bacteriophage k. In 1972, Cohen et al. showed CaCl2)-treated E. coli bacteria were effective recipients for plasmid DNA (Cohen et al., Proc. Natl. Acad. Sci., 69: 2110-2114 (1972)). Since transformation of E. coli is an essential step or cornerstone in many cloning experiments, it is desirable that it be as efficient as possible (Lui and Rashidbaigi, BioTechniques 8: 21-25 (1990)). Hanahan (J. Mol. Biol. 166: 557-580 (1983), herein incorporated by reference) examined factors that affect the efficiency of transformation, and devised a set of conditions for optimal efficiency (expressed as transformants per μg of DNA added) applicable to most E. coli K12 strains. Typically, efficiencies of 107 to 109 transformants/μg can be achieved depending on the strain of E. coli and the method used (Liu & Rashidbaigi, BioTechniques 8: 21-25 (1990), herein incorporated by reference).
Many methods for bacterial transformation are based on the observations of Mandel and Higa (J. Mol. Bio. 53: 159-162 (1970)). Apparently, Mandel and Higa's treatment induces a transient state of “competence” in the recipient bacteria, during which they are able to take up DNAs derived from a variety of sources. Many variations of this basic technique have since been described, often directed toward optimizing the efficiency of transformation of different bacterial strains by plasmids. Bacteria treated according to the original protocol of Mandel and Higa yield 105-106 transformed colonies/μg of supercoiled plasmid DNA. This efficiency can be enhanced 100- to 1000-fold by using improved strains of E. coli (Kushner, In: Genetic Engineering: Proceedings of the International Symposium on Genetic Engineering, Elsevier, Amsterdam, pp. 17-23 (1978); Norgard et al., Gene 3:279-292 (1978); Hanahan, J. Mol. Biol. 166: 557-580 (1983)) combinations of divalent cations ((Kushner, In: Genetic Engineering: Proceedings of the International Symposium on Genetic Engineering, Elsevier, Amsterdam, pp. 17-23 (1978)) for longer periods of time (Dagert and Ehrlich, Gene 6: 23-28 (1979)) and treating the bacteria with DMSO (Kushner, In: Genetic Engineering: Proceedings of the International Symposium on Genetic Engineering, Elsevier, Amsterdam, pp. 17-23 (1978)), reducing agents, and hexamminecobalt chloride (Hanahan (J. Mol. Biol. 166: 557-580 (1983).
A number of procedures exist for the preparation of competent bacteria and the introduction of DNA into those bacteria. A very simple, moderately efficient transformation procedure for use with E. coli involves re-suspending log-phase bacteria in ice-cold 50 mM calcium chloride at about 1010 bacteria/ml and keeping them ice-cold for about 30 min. Plasmid DNA (0.1 mg) is then added to a small aliquot (0.2 ml) of these now competent bacteria, and the incubation on ice continued for a further 30 min, followed by a heat shock of 2 min at 42° C. The bacteria are then usually transferred to nutrient medium and incubated for some time (30 min to 1 hour) to allow phenotypic properties conferred by the plasmid to be expressed, e.g. antibiotic resistance commonly used as a selectable marker for plasmid-containing cells. Protocols for the production of high efficiency competent bacteria have also been described and many of those protocols are based on the protocols described by Hanahan (J. Mol. Biol. 166:557-580 (1983).
Another rapid and simple method for introducing genetic material into bacteria is electoporation (Potter, Anal. Biochem. 174: 361-73 (1988)). This technique is based upon the original observation by Zimmerman et al., J. Membr. Biol. 67: 165-82 (1983), that high-voltage electric pulses can induce cell plasma membranes to fuse. Subsequently, it was found that when subjected to electric shock (typically a brief exposure to a voltage gradient of 4000-16000 V/cm), the bacteria take up exogenous DNA from the suspending solution, apparently through holes momentarily created in the plasma membrane. A proportion of these bacteria become stably transformed and can be selected if a suitable marker gene is carried on the transforming DNA transformed (Newman et al., Mol. Gen. Genetics 197: 195-204 (1982)). With E. coli, electroporation has been found to give plasmid transformation efficiencies of 109-1010/μg DNA (Dower et al., Nucleic Acids Res. 16: 6127-6145 (1988)).
Bacterial cells are also susceptible to transformation by liposomes (Old and Primrose, In Principles of Gene Manipulation: An Introduction to Gene Manipulation, Blackwell Science (1995)). A simple transformation system has been developed which makes use of liposomes prepared from cationic lipid (Old and Primrose, (1995)). Small unilamellar (single bilayer) vesicles are produced. DNA in solution spontaneously and efficiently complexes with these liposomes (in contrast to previously employed liposome encapsidation procedures involving non-ionic lipids). The positively-charged liposomes not only complex with DNA, but also bind to bacteria and are efficient in transforming them, probably by fusion with the cells. The use of liposomes as a transformation or transfection system is called lipofection.
B. subtilis (as well as other microbes) can be grown in culture via art-recognized methods. Transformation of B. subtilis can be achieved via methods including electroporation, protoplast transformation (B. subtilis protoplasts can be transformed but are fragile, with only about 1-10% of protoplasts surviving transformation and becoming regenerated) and use of natural competence, among other methods (see, e.g., Zhang and Zhang. Microb. Biotechnol. 4: 98-105).
Contemplated pathogenic microbes of the instant disclosure include, without limitation, bacteria from the following genera: Bordetella, Borrelia, Brucilla, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Escherichia, Francisella, Haemophilus, Helicobacter, Legionella, Leptospira, Listeria, Mycobacterium, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Staphylococcus, Streptococcus, Treponema, Vibrio and Yersinia.
In certain embodiments, the pathogenic microbe is a bacteria or bacterial combination selected from among the following: Mycobacterium tuberculosis, Bifidobacterium longum, Veillonella parvula, Clostridium difficile, Bacillus subtilis, Escherichia coli, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, Bacteroides thetaiotaomicron, Helicobacter pylori, Desulfovibrio bastinii, Desulfovibrio vulgaris, Rickettsia parkeri, Rhodopseudomonas palustris, Caulobacter crescentus, Mariprofundus ferrooxydans, Ghiorsea bivora, Neisseria gonorrhoeae, Burkholderia cenocepacia, Bordetella pertussis, Alcaligenes faecalis, Acinetobacter baumannii, Pseudomonas aeruginosa, Marinospirillum minutulum, Alteromonas macleodii, Vibrio cholerae, Providencia stuartii, Proteus mirabilis, Serratia marcescens, Edwardsiella tarda, Enterobacter cloacae, Klebsiella oxytoca, Klebsiella pneumoniae, Klebsiella aerogenes, Citrobacter freundii, Salmonella enterica, Yersinia pestis, Yersinia pseudotuberculosis, Yersinia enterocolitica, Mycobacterium bovis, Mycobacterium avium, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes, Campylobacter jejuni, Bacteroides fragilis, Proteus vulgaris, Haemophilus influenza and Shigella spp. (e.g., Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella boydii).
Contemplated commensal microbes of the instant disclosure include, without limitation, microbes of the phyla Firmicutes, Bacteroidetes, Bifidobacteria, Eubacteria, Ruminococcus, Lactobacillus, Peptococcus, Proteobacteria, Verrumicrobia, Actinobacteria, Fusobacteria and/or Cyanobacteria, as well as combinations thereof.
Certain embodiments of the instant disclosure expressly contemplate identification of heterologous ribosome-targeting agents, including in certain embodiments agents that are selective for ribosomes of pathogens, optionally as compared to ribosomes of commensal microorganisms. Exemplary forms of such agents include small molecules and macromolecules (e.g., peptides, antibodies, nucleic acids and other biologics). For example, screening of a small molecule drug-repurposing library can be performed to identify agents that selectively inhibit ribosomes derived from pathogenic organisms. Specific examples of expressly contemplated compound libraries include the Pharmakon library (www.msdiscovery.com/pharmakon.html), other Microsource libraries (US Drug collection, NatProd collection or Spectrum collection), Chembridge screening libraries (EXPRESS-Pick Collection Stock or CORE Library Stock; www.chembridge.com/screening_libraries/), HTS, Advanced, and Premium screening libraries from Enamine (enamine.net/hit-finding/compound-collections/screening-collection), among other available libraries.
The instant disclosure also provides kits containing agents of this disclosure for use in the methods of the present disclosure. Kits of the instant disclosure may include one or more containers comprising a nucleic acid construct, organism, or other component of the system(s) described herein.
The instructions generally include information as to use of the components included in the kit. Instructions supplied in the kits of the instant disclosure are typically written instructions on a label or package insert (e.g., a paper sheet included in the kit), but machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk) are also acceptable.
The kits of this disclosure are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like.
Kits may optionally provide additional components such as buffers and interpretive information. Normally, the kit comprises a container and a label or package insert(s) on or associated with the container.
The practice of the present disclosure employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al., 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Sambrook et al., 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Ausubel et al., 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Anand, 1992; Guthrie and Fink, 1991; Harlow and Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Jakoby and Pastan, 1979; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Hogan et al., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986); Westerfield, M., The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio), (4th Ed., Univ. of Oregon Press, Eugene, 2000).
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Reference will now be made in detail to exemplary embodiments of the disclosure. While the disclosure will be described in conjunction with the exemplary embodiments, it will be understood that it is not intended to limit the disclosure to those embodiments. To the contrary, it is intended to cover alternatives, modifications, and equivalents as may be included within the spirit and scope of the disclosure as defined by the appended claims. Standard techniques well known in the art or the techniques specifically described below were utilized.
Unless otherwise noted, all PCRs were performed using Phusion U HotStart DNA Polymerase (Life Technologies). Water was purified using a MilliQ water purification system (MilliporeSigma). Antibiotics (Gold Biotechnology) were used at the following concentrations for plasmid selection: 30 μg mL−1 Kanamycin, 40 μg mL−1 chloramphenicol, 50 μg mL−1 carbenicillin, 100 μg mL−1 spectinomycin. Antibiotics concentrations were one-third the aforementioned for strains bearing three unique plasmids. Unless otherwise noted, all DNA manipulations were performed in NEB Turbo cells (New England Biolabs) or Mach1F cells (Mach1 T1R cells (Thermo Fisher Scientific) mated with F′ episome of the previously described S2060 strain (47)). All fluorescence and luminescence assays were carried out using E. coli S2060 (47).
Chemically competent cells were prepared for cloning and assay strains. A glycerol stock of the appropriate strain was used to start a 2 mL culture of the strain supplemented with the appropriate antibiotics and grown up overnight at 30° C. at 300 RPM. The saturated culture was diluted 1:1000 in 50 mL 2×YT (United States Biological) with appropriate antibiotics and grown to OD=0.3-0.5 in a 370 shaker at 300 RPM. Cells were pelleted in a pre-chilled conical tube (VWR) by centrifugation at 8,000 g for 10 min at 4° C. The supernatant was removed and the cells were resuspended in approximately 20 mL 10% glycerol, then pelleted by centrifugation at 8,000 g for 10 min at 4° C. The supernatant was removed and the cells were resuspended in chilled TSS buffer (2×YT media supplemented with 5% DMSO, 10% PEG2250, 2 mM MgCl2) Cells were flash frozen in liquid N2 at 100 μL aliquots and transferred to −80° C. storage.
Plasmids were constructed using USER cloning, or a combination of USER cloning and overlap extension PCR. In USER cloning, primers are designed to include a deoxyuracil base approximately 10-20 from the 5′ end of the primer; the region between the deoxyuracil base and the 5′ end of the primer is known as the “USER junction” and specifies the homology necessary for plasmid assembly. USER junctions were designed to have a 42° C.<Tm<70° C., minimal secondary structure, and begin with a dA and end with a dT (the latter is replaced with a dU by uracil DNA glycosylase during assembly). PCR products were all gel purified using QIAquick Gel Extraction kit (Qiagen) and eluted to a final volume of 10 μL. Fragments were quantified using a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific). For assembly, PCR products with complementary USER junctions were added in an equimolar ratio (0.1-1 pmol each) in a 10 μl reaction containing 0.75 units DpnI (New England Biolabs), 0.75 units USER (Uracil-Specific Excision Reagent; Endonuclease VIII and Uracil-DNA Glycosylase) enzyme (New England Biolabs), 1 unit of CutSmart Buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg mL−1 BSA at pH 7.9; New England Biolabs). Reactions were incubated at 370 for 20 min, then heated at 80° C. and slowly cooled to 22° C. at 0.1° C./s in a thermocycler.
Inserts of plasmids “A01”, “AO2”, and “S1-S21,” consisting of many small fragments, were cloned using overlap extension PCR. Primers were designed containing ˜15 bp overhangs complementary to the adjoining fragment. Individual fragments were amplified and gel purified as above; then 0.2 picomoles of each fragment was used in a 200 μL PCR reaction to join each fragment together. This fragment was gel purified and USER assembly was used to clone it into the plasmid backbone. Plasmid constructs were heat-shocked into chemically competent NEB Turbo or Mach1f cells: 100 μL 2×KCM (100 mM KCl, 30 mM CaCl2), 50 mM MgCl2 in MilliQ H2O) was added to 100 μl cells alongside plasmid DNA. Cells were incubated on ice for 15 min, heat shocked at 42° C. for 2 min, and placed back on ice for 2 min. Cells were recovered in 1 mL 2×YT media at 37° with shaking at 300 RPM for a minimum of 45 min. Cells were streaked on 2×YT media+1.8% agar plates supplemented with the appropriate antibiotic.
Ribosomal DNA, contiguous r-protein operons and single r-protein ORFs were amplified from bacterial strains or the corresponding gDNA. Direct amplification from bacterial strains required boiling at 95° C. for 10 min in MilliQ water prior to PCR for efficient amplification. In cases where a non-type strain was used, universal primers
were used to amplify a ˜900 bp fragment from the bacterial genome to include a partial 16S element for subcloning and sequencing, allowing for closest sequenced genome determination. For species with high sequence variability between ribosomal operons, a representative operon was chosen based on maximal sequence homology to E. coli.
The erythromycin-resistant strain S4246 was generated using conventional recombineering (76, 77). Briefly, chemically competent S2060 cells were transformed with pKD46 (77) and plated on 2×YT agar plates supplemented with 50 μg mL−1 carbencillin at 30° C. A single colony was picked, grown at 30° C. in 2×YT liquid medium supplemented with 50 μg mL−1 carbencillin and 10 mM arabinose, and made chemically competent when the culture reached the appropriate OD600. Chemically competent S2060/pKD46 cells were transformed with the phosphothiorated recombineering oligonucleotide AB5708 (5′-C*T*C*A*ATGTTCAGTGTCAAGCTATAGTAAAGGTTCACGGGGTCTTACCGTCTTG CCGCG GGTACACTGCATCTTCACAGCGAGTTCAATTT-3′, SEQ ID NO: 403; phosphothirate bonds indicated as *, introduced mutation is bolded) to introduce the rrlA-H A2058U mutation on replichore 2 (76). Following recovery for 3 hours at 30° C., transformed cells were plated on 2×YT agar plates supplemented with 1000 μg mL−1 erythromycin and incubated at 37° C. to cure the resident pKD46 plasmid. Following overnight growth, single colonies were picked into 2×YT liquid medium supplemented with 50 μg mL−1 streptomycin, 10 μg mL−1 tetracycline and 1000 μg mL−1 erythromycin and allowed to grow overnight at 37° C. To assess the degree of rrlA-H mutagenesis, cultures were used as PCR templates using primers AB5710 (5′-GAAATTCCTTGTCGGGTAAGTTCC-3′, SEQ ID NO: 404) and AB5711 (5′-GAACATCAAACATTAAAGGGTGGTATTTC-3′, SEQ ID NO: 405), and the PCR products were treated with the endonuclease HpyCH4III (New England Biolabs) according to the manufacturer's guidelines. Wildtype rrlA-H genotypes show no digestion under these conditions, whereas complete conversion results in complete PCR product digestion. Intermediate (incomplete) digestion indicated in incomplete conversion of all seven genomic alleles. The completely converted strain S4246 was confirmed to be sensitive to the following antibiotics (ensures no resistance crosstalk with plasmid-borne markers): carbenicillin (50 μg mL−1), spectinomycin (100 μg mL−1), chloramphenicol (40 μg mL−1), and kanamycin (30 μg mL−1). The strain was confirmed to be resistant to the following antibiotics: streptomycin (50 μg mL−1), tetracycline (10 μg mL−1), and erythromcyin (1000 μg mL−1).
For orthogonal translation assays, S2060 chemically competent cells were transformed with the E. coli o-rRNA plasmid and the relevant orthogonal reporter plasmid. Transformants were streaked on 2×YT media+1.8% agar supplemented with kanamycin and carbenicillin. Plates were grown in a 37° C. incubator for 16 hours. Colonies were picked into DRM (United States Biological) (48) supplemented with kanamycin, carbenicillin, 1 mM IPTG+/−1000 ng/mL aTc. To assay heterologous o-rRNA function, chemically competent cells carrying the sfGFP reporter plasmid were prepared (52060.sfGFP) and transformed with the appropriate o-rRNA plasmid. E. coli o-rRNA was always transformed alongside experimental o-rRNAs as a positive control. Transformants were streaked out and picked into media as above.
To assay r-protein effects on heterologous o-rRNA function, 52060.sfGFP chemically competent cells were co-transformed with the appropriate o-rRNA plasmid and r-protein plasmid. As a positive control, E. coli o-rRNA was transformed alongside an mCherry expression plasmid. In the absence of r-protein supplementation, heterologous o-rRNAs were transformed with mCherry to maintain consistent growth rates and antibiotic selection markers. Transformants were streaked on 2×YT media+1.8% agar supplemented with kanamycin, carbenicillin, chloramphenicol, and 200 mM glucose and picked into DRM supplemented with kanamycin, carbenicillin, chloramphenicol, 1 mM IPTG, 1000 ng/mL aTc, +/−10 mM arabinose.
To quantify fluorescence output, 150 μl each culture was aliquoted into a 96-well black wall, clear bottom plate (Costar). OD600 and the appropriate excitation and emission wavelengths were used for fluorescence measurements (
Chemically competent SQ171 (49, 50) cells were transformed with heterologous rRNAs as described above and recovered for up to 7 h in 2×YT in a 37° C. shaker. The recovery culture was centrifuged at 10,000 RCF for 2 min, then the pellet was resuspended in 100 μL MilliQ water. The resuspended cells were diluted serially in seven, 10-fold increments to yield eight total samples (undiluted, 101, 102, 101, 104, 105, 106, and 107 fold diluted). To determine the efficiencies of EP transformation and counter-selectable plasmid curing, 3 μl of diluted cells were plated on 1.8% agar-2×YT plates (United States Biological) supplemented with spectinomycin (100 μg mL−1) and carbenicillin (50 μg mL−1), with or without 5% sucrose (Millipore Sigma). For picking single colonies, the remaining undiluted cells were plated on 1.8% agar-2×YT plates (United States Biological) containing spectinomycin (100 μg mL−1), carbenicillin (50 μg mL−1) and 5% sucrose. All plates were grown for 16-120 hours in a 37° C. incubator.
Colonies transformed with the appropriate EP and surviving sucrose selection were picked and grown in DRM containing spectinomycin (100 μg mL−1), carbenicillin (50 μg mL−1), and 5% sucrose. Following growth of the EP-carrying strains for up to 3 days, cultures were glycerol stocked. Overnight cultures were started from these glycerol stocks in DRM containing spectinomycin (100 μg mL−1), carbenicillin (50 μg mL−1), and 5% sucrose. Following overnight growth, cultures were diluted 100-fold into fresh DRM containing spectinomycin (100 μg mL−1) and carbenicillin (50 μg mL−1). From the diluted cultures, 200 μl of each culture was transferred to a 96-well black wall, clear bottom plate (Costar), topped with 20 μL of mineral oil, and the OD600 was measured every 5 min over 15 h. Separately, 400 μL of each diluted culture was supplemented with kanamycin (30 μg mL−1) and grown in a 37° C. shaker at 900 RPM. Colonies that survived selection in kanamycin were excluded from final analysis, as survival in kanamycin indicates persistence of the resident pCSacB plasmid (which carries a KanR resistance cassette) The doubling time of each culture was calculated using the Growthcurver package (51) in Rstudio.
To calculate sequence identities, 16S sequences of all rRNAs used in the study were aligned using Clustal Omega with default settings (43). The phylogenetic tree (
To analyze sequence similarities of r-proteins, refseq proteomes of relevant species were downloaded and a local BLAST database was created from these proteomes. E. coli SSU r-protein sequences were queried against the database using local blastp with default parameters using the BLOSUM62 similarity matrix. Hits were filtered to those annotated with “30S,” “SSU,” or “ribosomal protein.”
The data that support the findings of this study are available within the paper and its supplementary information files. Plasmid names are provided for reference in
SQ171 is an E. coli strain lacking all seven chromosomal rRNA operons and carrying a single, counter-selectable plasmid bearing the wildtype rrnC operon (17, 30). To investigate the ability of heterologous rRNAs to support SQ171 cell survival, episomally-encoded rRNA operons were introduced into the strain followed by sucrose counterselection of the resident E. coli rrnC plasmid using the B. subtilis sacB cassette (
This strategy was validated using a number of increasingly divergent heterologous rRNA operons: Salmonella enterica (97.0% 16S rRNA sequence identity to E. coli), Alteromonas macleodii (85.9%), Pseudomonas aeruginosa (85.2%), and Acinetobacter baumannii (84.3%). Heterologous rRNA derived from S. enterica robustly supported SQ171 strain growth, while rRNA derived from A. macleodii and P. aeruginosa supported growth with a moderate defect (
SQ171 complementation provides information about the capacity of a heterologous rRNA to translate the E. coli proteome of >4000 proteins (31), as well as the fulfillment of extracatalytic roles, including integrating environmental cues to modulate translation (29) and initiating the stringent response to cellular stressors (28). Furthermore, hibernation factors that regulate translation in gammaproteobacteria (e.g., E. coli) under unfavorable conditions are often not found in other proteobacterial classes (28), which indicates that phylogenetically distant rRNAs are unable to support SQ171 survival due to regulatory constraints rather than enzymatic ones, further confounding interpretation of strain survival. Finally, it was observed herein that SQ171 complementation pipelines required up to 5 days to observe colonies for strains relying on highly divergent rRNAs, where transformed colonies were laboriously counter-screened due to the high escape frequency of SacB-dependent negative selection (
To overcome these technical limitations, an assay was developed herein that delivered a single, quantifiable, translational output orthogonal to native ribosomal machinery and therefore also independent of cell viability. Previously described orthogonal ribosome-mRNA pairs were leveraged, in which the antiRBS of the 16S rRNA was engineered to exclusively translate a researcher-defined transcript bearing a complementary RBS (4, 8, 71-74). This yielded an orthogonal pool of ribosomes (o-ribosomes) in vivo, the functions of which were monitored and quantified via reporter expression (superfolder GFP; sfGFP (34)) independently of cellular survival (
With a robust reporter system now in hand, the o-antiRBS was engineered into all 21 heterologous rRNAs capable of complementing SQ171 viability, alongside an additional 13 phylogenetically more divergent rRNAs (
The observed relationship between heterologous orthogonal translation activity and phylogenetic distance from E. coli indicated that certain elements encoded within the rRNA operon might have sufficiently diverged to restrict efficient ribosome assembly in E. coli. Analysis of per-base conservation (35) across the complete rRNA operons showed significantly higher conservation scores within the ribosomal genes (16S, 23S, and 5S rRNAs), as compared to intergenic elements (
To assess the impact of putative rRNA processing on heterologous ribosome function in E. coli, the native intergenic sequences of each of the 34 o-rRNAs were substituted with their corresponding E. coli sequences (
Highly divergent rRNAs (<80% 16S rRNA sequence identity to E. coli) failed to translate the orthogonal sfGFP transcript despite replacement of their intergenic sequences, indicating that the formation of functional heterologous ribosomes required supplementation with additional factors. As ribosomal proteins (r-proteins) are known to co-diverge alongside their cognate rRNA (38, 39, 40), it was hypothesized herein that E. coli r-proteins might only be capable of binding to and forming heterologous ribosomes with rRNAs sufficiently homologous to E. coli. Complementing highly divergent rRNAs with cognate r-proteins might therefore be expected to improve heterologous ribosome activity.
In prokaryotes, the majority of r-proteins are typically arranged on five operons (α, β, s10, spc, str). R-proteins encoded within these five operons account for ˜60% (12/21 SSU and 18/33 LSU in E. coli) of the full r-protein repertoire (31) with the remaining ˜40% distributed throughout the genome (
When tested alongside A. baumannii o-rRNA, only AbAO1 (comprising mostly SSU r-proteins) significantly improved sfGFP expression (
It is notable that excessive protein overexpression alongside orthogonal translation circuits has pleiotropic consequences on apparent translational activity. Using mCherry as a surrogate for cognate r-protein overexpression alongside o-rRNA-dependent sfGFP production, a characteristic isocost line was observed that described the production of two proteins under the constraints of a restricted metabolic budget (
This analysis was extended to A. macleodii o-rRNA bearing the E. coli intergenic sequences (17% activity vs. E. coli o-rRNA). Again it was found that only AmAO1 significantly improved sfGFP expression (
The interface between rRNA and r-proteins is subject to extensive coevolution and divergence between related organisms (38-40). Accordingly, overlap between SSU r-protein complements that improved A. baumannii and A. macleodii o-rRNA activity indicated that the same r-proteins might improve the function of o-rRNAs derived from a variety of species. Indeed, the identified r-protein combinations improved activities of increasingly distant o-rRNAs: P. aeruginosa, V. cholerae, Marinospirillum minutulum, A. faecalis, B. cenocepacia, Neisseria gonorrhoeae, M. ferrooxydans, and Caulobacter crescentus (
Notably, this complete set of four r-proteins (S20, S16, S1 and S15) was not necessary for the observed improvement in activity for all evaluated o-rRNAs (
To determine r-proteins necessary to complement more divergent o-rRNAs, the instantly disclosed operon-based complementation approach was extended to rRNAs derived from B. cenocepacia (betaproteobacteria; 81.5% 16S rRNA sequence ID to E. coli), Rickettsia parkeri (alphaproteobacteria; 76.8%), and Enterococcus faecalis (bacilli; 76.1%). However, a significant increase in orthogonal translation activity upon r-protein operon induction (
To validate the functional relevance of these helices, variants of the E. coli o-rRNA were constructed in which these helices were replaced with their cognate E. faecalis helices, with the discovery that orthogonal translation was abrogated in only 2 instances (transplantation of helices h9/h10 and h26,
The analysis of the instant disclosure provided guidelines to improve refractory heterologous ribosome function; however, exclusive identification of SSU r-proteins suggested that cognate heterologous LSUs were poorly active in E. coli. It was hypothesized that either E. coli LSUs interacted with heterologous SSUs to enable orthogonal translation, or, that because many heterologous rRNAs supported SQ171 strain survival, cognate heterologous LSUs were sufficiently active (
To assess the degree of association between E. coli LSUs and heterologous SSUs, an erythromycin-dependent reporter was developed to distinguish between genome- (E. coli; erythromycin-resistant) and episome-derived (heterologous; erythromycin-sensitive) LSUs. The erythromycin-resistant strain S4246 was developed, wherein all seven genomic 23S genes (rrlA-H) of 52060 cells were mutated (A2058U) (75) to mitigate macrolide binding in the ribosomal exit tunnel (
Next, the ErmC leader peptide, ermCL, was introduced ahead of the orthogonal sfGFP reporter, ensuring that reporter translation would be abrogated via erythromycin- and ermCL-dependent translational stalling (78) (
Reporter plasmid pAB140j8 was specifically employed, having the following nucleic acid sequence:
To validate this sensor, the erythromycin sensitivity of an episome-derived E. coli orthogonal ribosome encoding or lacking the identical A2058U mutation was assessed. A recently described stapled E. coli ribosome (d2d8) (7) that preferentially uses a covalently linked 23S rRNA, with or without the identical mutation was used as a control. Using this sensor/strain combination, it was observed that A2058U-LSUs showed no appreciable change in orthogonal translation upon erythromycin dosing (
This analysis was next extended to a set of 20 functional heterologous ribosomes. For heterologous ribosomes with high 16S sequence identity to E. coli (≥99.2%), a dramatic reduction in both sfGFP translation and cell viability was observed (
To reduce association between heterologous and E. coli ribosomal subunits, the above rRNA stapling approach (7) was extended to the same 20 heterologous ribosomes, wherein the staple was extensible to rRNAs with high sequence identity (>99.2% 16S) to E. coli (
Thus, a library of 34 heterologous ribosomes derived from species across a broad phylogenetic range has been constructed herein and expressed in E. coli. The functionality of each of these ribosomes has been evaluated using both Δ7 strain complementation and orthogonal translation, with a high degree of correlation observed between the two assays. Remarkably, replacement of intergenic sequences with those of E. coli, as well as supplementation with only a small subset of r-proteins (S20, S16, S1, S15), significantly improved expression from orthogonal heterologous rRNAs. While o-rRNAs with high sequence identity (up to 96.2% 16S rRNA sequence identity to E. coli) natively translated superfolder GFP (sfGFP) at robust levels, substitution of intergenic sequences allowed for o-rRNAs as divergent as P. mirabilis (92.9%) to translate the orthogonal transcript at levels similar to the E. coli o-rRNA. Supplementation with r-proteins S20 and S16 allowed for similarly robust levels of translation from o-rRNA derived from A. baumannii (84.3%). More remarkably, using a more extensive set of r-proteins, heterologous translation from o-rRNAs as diverged as E. faecalis (76.1%) was achieved in the instant E. coli system. Further, an erythromycin-dependent reporter system was developed, which demonstrated that a subset of heterologous SSUs preferentially associated with their cognate LSUs.
Collectively, the instant disclosure has established orthogonal translation as a viable alternative to Δ7 complementation for evaluating the function of heterologous rRNAs and has provided generalizable strategies for enhancing heterologous rRNA function. Notably, of the four r-proteins found to be broadly important for o-rRNA function, only two (S1 and S16) have been found to be essential for viability in E. coli via gene knockout (45, 46), which indicates that essentiality cannot serve as a predictor of crucial factors enhancing o-rRNA function. It was therefore sought herein to determine whether rules for predicting r-proteins necessary for complementing heterologous o-rRNAs could be derived. Using sequence similarities of heterologous SSU r-proteins to their E. coli homologues, it was discovered that r-proteins empirically found to be crucial for complementation (S20, S16, and S15) tended to be those with the lowest sequence similarity (
It is therefore contemplated herein that heterologous rRNAs—specifically those of relevance to human health—can be expressed in E. coli for the high-throughput discovery of ribosome-targeting antibiotics. In particular, in certain embodiments, screening can be performed in the heterologous rRNA and/or r-protein systems that are disclosed herein, to identify antibiotics that are selective to ribosomes of pathogens, while doing less or no damage to ribosomes of commensal micro-organisms. Optionally, such screening assays can be multiplexed, thereby allowing for direct comparisons to be made between ribosomes of pathogenic microbes and ribosomes of non-pathogenic microbes (e.g., ribosomes of commensal microbes). More broadly, the strategies described herein can be used in the development of increasingly divergent ribosomes that limit interaction with host cells, yielding more orthogonal components for engineered variations of the central dogma. Finally, the heterologous ribosomes described infra are contemplated to serve as alternative starting points for the discovery and evolution of novel translational properties. Through the use of such diverse ribosomes, synthetic biologists can now take advantage of and likely repurpose the myriad functionalities for which bacteria have evolved their ribosomes.
Expressly contemplated applications of the compositions and methods of the instant disclosure therefore include, without limitation, the following:
(1) Scalable, and potentially multiplexed, discovery of molecules that selectively inhibit ribosomes of pathogenic bacteria, optionally in direct comparison to ribosomes of commensal bacteria: In an exemplary application, an orthogonal, heterologous ribosome is measured via a single reporter in E. coli. Combinations of pathogenic ribosomes and reporters are mixed in 96-well plate format. Combinations of commensal ribosomes and reporters are also optionally mixed in the same or parallel 96-well plate format. Test compound is added to each well. Relative decrease of reporter activity in a single well is considered a “hit” (putative specific inhibitor of bacterial translation), where a molecule that hits pathogenic ribosomes while having fewer or no hits to commensal ribosomes is considered a pathogen-selective “hit” as compared to commensal strains. Such a platform obviates inefficiencies traditionally associated with antimicrobial small-molecule screens (i.e., variable bacterial growth conditions, biohazard concerns).
(2) Prediction of resistance alleles (optionally to newly discovered small molecules): predicted resistance alleles can be introduced via PCR onto the rRNA of a heterologous ribosome. As for (1) above, test compounds can be screened against mutated ribosomes.
(3) Engineered heterologous ribosomes for enhanced bioproduction capabilities: heterologous ribosomes putatively share fewer resources with the E. coli host cell than native ribosomes. Heterologous orthogonal ribosomes may be directed towards the production of biomolecules for industry or pharmaceuticals.
Certain aspects of the instant disclosure contemplate use of the exemplary sequences presented in Tables 2-4 below.
A. baumannn 16S
V. cholerae 16S
P. aeruginosa 16S
S. marcescens 16S
S. enterica 16S
N. gonohhhoeae 16S
A. baumannn 23S
V. cholerae 23S
P. aeruginosa 23S
S. marcescens 23S
S. enterica 23S
N. gonorrhoeae 23S
A. baumannn 5S
V. cholerae 5S
P. aeruginosa 5S
S. marcescens 5S
S. enterica 5S
N. gonorrhoeae 5S
N. gonorrhoeae
N. gonorrhoeae
N. gonorrhoeae
N. gonorrhoeae
N. gonorrhoeae
N. gonorrhoeae
N. gonorrhoeae
N. gonorrhoeae
B. pertussis
B. pertussis
B. pertussis
B. pertussis
B. pertussis
B. pertussis
B. pertussis
B. pertussis
A. faecalis
A. faecalis
A. faecalis
A. faecalis
A. faecalis
A. faecalis
A. faecalis
A. faecalis
V. cholerae
V. cholerae
V. cholerae
V. cholerae
V. cholerae
V. cholerae
V. cholerae
V. cholerae
A. baumannii
A. baumannii
A. baumannii
A. baumannii
A. bauniannii
A. bauniannii
A. bauniannii
P. aeruginosa
P. aeruginosa
P. aeruginosa
P. aeruginosa
P. aeruginosa
P. aeruginosa
P. aeruginosa
P. aeruginosa
It is contemplated that variant or mutant forms of the sequences presented herein can also be employed in making and using nucleotide and/or protein constructs of the disclosure. Accordingly, the exemplary sequences presented herein can be modified to contain one, two, three, four, five or more variant residues, as compared to those disclosed herein, and still remain within the scope of the contemplated disclosure. Similarly, it is contemplated that a sequence at least 80% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 98% identical or at least 99% identical to one or more of the specific sequences recited herein can be employed in the compositions and methods of the instant disclosure.
All patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the disclosure pertains. All references cited in this disclosure are incorporated by reference to the same extent as if each reference had been incorporated by reference in its entirety individually.
One skilled in the art would readily appreciate that the present disclosure is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The methods and compositions described herein as presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the disclosure. Changes therein and other uses will occur to those skilled in the art, which are encompassed within the spirit of the disclosure, are defined by the scope of the claims.
In addition, where features or aspects of the disclosure are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group or other group.
The use of the terms “a” and “an” and “the” and similar referents in the context of describing the disclosure (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.
All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the disclosure.
Embodiments of this disclosure are described herein, including the best mode known to the inventors for carrying out the disclosed invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the instant description.
The disclosure illustratively described herein suitably can be practiced in the absence of any element or elements, limitation or limitations that are not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising”, “consisting essentially of”, and “consisting of” may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present disclosure provides preferred embodiments, optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this disclosure as defined by the description and the appended claims.
It will be readily apparent to one skilled in the art that varying substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention. Thus, such additional embodiments are within the scope of the present disclosure and the following claims. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the disclosure to be practiced otherwise than as specifically described herein. Accordingly, this disclosure includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the disclosure unless otherwise indicated herein or otherwise clearly contradicted by context. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Such equivalents are intended to be encompassed by the following claims.
This application claims the benefit of U.S. Provisional Application No. 62/873,957, filed Jul. 14, 2019, entitled “Heterologous Ribosome Generation, Assessment and Compositions Thereof,” and to U.S. Provisional Application No. 62/924,472, filed Oct. 22, 2019, also entitled “Heterologous Ribosome Generation, Assessment and Compositions Thereof.” The entire contents of the aforementioned applications are incorporated herein by reference.
This invention was made with government support under Grant No. OD024590 awarded by the National Institutes of Health and under Grant No. NNH17ZDA001N-EXO awarded by the National Aeronautics and Space Administration. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2020/041905 | 7/14/2020 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 62873957 | Jul 2019 | US | |
| 62924472 | Oct 2019 | US |
