HIGH-THROUGHPUT, DROPLET-BASED SINGLE CELL RNA SEQUENCING

Information

  • Patent Application
  • 20230323336
  • Publication Number
    20230323336
  • Date Filed
    August 11, 2022
    3 years ago
  • Date Published
    October 12, 2023
    2 years ago
Abstract
In one example embodiment, methods of generating a single prokaryotic cell cDNA library include barcoding RNAs from different prokaryotic cells individually, allowing cell identity of each RNA to be retained in a single sequencing library. In one example embodiment, methods include, prior to generating a cDNA library, degrading rRNA and DNA in each cell of a set of fixed and permeabilized cells. In one example embodiment, methods include converting mRNA in each fixed and permeabilized cell into cDNA labeled with a cell-specific first and second barcode combination and a unique molecular identifier (UMI). In one example embodiment, methods include amplifying labeled cDNA and preparing a sequencing library of amplified labeled cDNA. In one example embodiment, a cDNA sequencing library is capable of distinguishing species heterogeneity, strain heterogeneity, genotypic heterogeneity, phenotypic heterogeneity, or a combination thereof, of one or more uncharacterized organisms, an environmental microbiome, an organismal microbiome, or a combination thereof.
Description
TECHNICAL FIELD

The subject matter disclosed herein is generally directed to methods of creating a high-throughput droplet-based single cell RNA sequencing library for microbial cells, such as, for example, bacterial cells.


BACKGROUND

Bacterial heterogeneity has been widely recognized in microbial communities as well as in isogeneic bacterial cultures. Besides genotypic heterogeneity, phenotypic heterogeneity also plays essential roles in bacterial survival, adaptation and evolution. Many technologies have been developed to investigate bacterial heterogeneity, including fluorescence microscopy, flow cytometry and probe-based single-cell approaches. Although these approaches have been successfully applied to single-cell microbiology, they are limited by the numbers of genes that can be studied in an experiment. In addition, genetic manipulations required to make fluorescent reporters are not only time-consuming but they may also introduce artifacts to the original strains.


SUMMARY

In one aspect, the present invention provides for a method of generating a single prokaryotic cell cDNA library, wherein the RNAs from different prokaryotic cells are barcoded individually, allowing the cell identity of each RNA to be retained in a single library, the method comprising: a. degrading ribosomal RNA (rRNA) and genomic DNA (gDNA) in a set of fixed and permeabilized cells; b. labeling each mRNA in the fixed and permeabilized cells, the labeling comprising separating the fixed and permeabilized cells into a plurality of first reaction volumes, reverse transcribing the mRNA into cDNA, and adding a first barcode, a unique molecular identifier (UMI), and a poly-nucleotide tail to each first strand cDNA; c. labeling each cDNA from a same cell in the fixed and permeabilized cells, the labeling comprising separating the fixed and permeabilized cells into separate individual discrete second reaction volumes, conducting a second strand cDNA synthesis, and adding a second barcode unique to that second reaction volume to each second strand cDNA, thus labeling each cDNA with a cell-specific first and second barcode combination and a UMI; and d. amplifying the labeled cDNA and preparing a sequencing library comprising the amplified labeled cDNA.


In one example embodiment, the method further comprising, prior to the degrading step, preparing a set of fixed and permeabilized cells, the preparing comprising: a. fixing each cell of a set of prokaryotic cells; and b. permeabilizing each fixed cell of the set of prokaryotic cells.


In one example embodiment, each first reaction volume comprises a plurality of RT primers, wherein each RT primer comprises (i) a 5′ primer binding sequence (ii) a barcode sequence that is the same for all primers in the same first reaction volume but differs from the barcode sequence of primers in any other first reaction volume, and (iii) a unique molecular identifier (UMI) sequence that is different for each primer in a first reaction volume.


In one example embodiment, the method, each second reaction volume comprises a single bead and a plurality of primers capable of hybridizing to the poly-nucleotide tail, wherein each bead comprises a plurality of capture oligonucleotides attached 5′ to the bead surface, and wherein each capture oligonucleotide comprises (i) a barcode sequence that is the same for all capture oligonucleotides on the same bead but differs from the barcode sequence of capture oligonucleotides on other beads and (ii) a capture sequence that is the same as the 5′ primer binding sequence in each RT primer.


In one example embodiment, the generating second strand cDNA step is accomplished by linear amplification using the primers capable of hybridizing to the poly-nucleotide tail.


In one example embodiment, the second barcode is a bead barcode sequence, and wherein the adding a second barcode step is accomplished by amplifying the second strand cDNA using the capture sequence on the capture oligonucleotides attached to the bead to prime linear amplification.


In one example embodiment, mRNA accounts for more than 5%, more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, or more than 80% of total aligned reads.


In one example embodiment, the mean mRNA UMI per cell is more than 25, more than 35, more than 45, more than 55, or more than 65.


In one example embodiment, each second reaction volume can be loaded with multiple fixed and permeabilized cells.


In one example embodiment, each second reaction volume comprises one, two, three, four, five, or six fixed and permeabilized cells.


In one example embodiment, each second reaction volume is an aqueous in oil droplet.


In one example embodiment, the sequencing library can distinguish species heterogeneity, strain heterogeneity, genotypic heterogeneity and/or phenotypic heterogeneity of the plurality of prokaryotic cells.


In one example embodiment, the sequencing library can distinguish species heterogeneity, strain heterogeneity, genotypic heterogeneity and/or phenotypic heterogeneity of one or more uncharacterized organisms, an environmental microbiome, or an organismal microbiome.


In one example embodiment, the sequencing library can distinguish phenotypic heterogeneity in the response of the plurality of prokaryotic cells to one or more drug treatments.


In one example embodiment, the sequencing library can distinguish phenotypic heterogeneity in the response of the plurality of prokaryotic cells to one or more antibiotic treatments.


In one example embodiment, the set of prokaryotic cells is a biological sample obtained from a subject.


These and other aspects, objects, features, and advantages of the example embodiments will become apparent to those having ordinary skill in the art upon consideration of the following detailed description of example embodiments.





BRIEF DESCRIPTION OF THE DRAWINGS

An understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention may be utilized, in conjunction with the accompanying drawings described herein.



FIGS. 1A-1G – BacDrop: a bacterial droplet-based high throughput scRNA-seq technology. (FIG. 1A) BacDrop workflow. Following cell fixation and permeabilization, rRNA and gDNA is depleted from cells in bulk. Then CB1 and UMIs are added to the 5′ end of cDNA via RT reactions in pools of ~200,000 cells per well in 384-well plates. After round 1 plate barcoding, all cells are pooled and cDNA is polyadenylated at the 3′ end using terminal transferase, followed by droplet generation and round 2 droplet barcoding. The 3′ poly-A tail of cDNA enables second strand synthesis using oligo-dT primers. Round 2 droplet barcoding is achieved via second strand cDNA synthesis and 4 capturing cycles by barcoded primers (on 10x gel beads) in droplets. The successfully captured cDNA contains UMIs, CB1 and CB2, as well as adaptor sequences at both 5′ and 3′ end. Each cell is identified by a combination of CB1 and CB2. (FIG. 1B) rRNA depletion inside fixed and permeabilized cells significantly increases the percentage of total reads that align to mRNA in BacDrop libraries (FIG. 1C) rRNA depletion does not affect mRNA profiles. BacDrop libraries were constructed using samples with or without rRNA depletion, and a linear regression model was fitted to the mRNA counts from each library. (FIG. 1D) Cell fixation and permeabilization does not affect mRNA profiles. Bulk RNA-seq results derived from Trizol-extracted RNA samples versus RNA derived from fixed and permeabilized cells were highly correlated. (FIG. 1E) Single-cell BacDrop results are highly correlated with bulk RNA-seq results when analyzed in bulk mode (without cell barcode extraction). (FIG. 1F) BacDrop has low barcode collision rates in an experiment where 2 million bacterial cells, mixed with K.pneumoniae and P.aeruginosa cells, were loaded into one 10x channel (~6 cells per droplet). About 2.8 % of the cells was assigned to both species. (FIG. 1G) BacDrop was performed on 4 different bacterial species including the gram-negative E.coli, K.pneumoniae, P.aeruginosa, and the gram-positive bacterium E.faecium. Uniform Manifold Approximation and Projection (UMAP) of this mixed population shows the separation of different species, colored by species identity.



FIGS. 2A-2F – Validating BacDrop’s ability to distinguish subpopulations based on distinct responses to different antibiotic treatments. (FIG. 2A), Creation of a BacDrop library containing cells of the same bacterial strain exposed to 4 different conditions. Homogeneous cultures of MGH66 were treated for 30 minutes with antibiotics: meropenem, 2 µg/mL; ciprofloxacin, 2.5 µg/mL; gentamicin, 4 µg/mL; and no antibiotic control. Cells were collected and processed separately until after round 1 plate barcoding. The four samples were then pooled for round 2 droplet barcoding and library construction. (FIG. 2B), Bulk RNA-seq results of cells exposed to the same antibiotic conditions as in a. The abundance for each treated condition and comparison between the treated and untreated cultures are shown as well as significantly up-and down- regulated genes from each treatment (performed in triplicates). (FIG. 2C) UMAP shows that BacDrop results could distinguish distinct responses from different antibiotic treatments when Applicants included ~60,000 cells with ≥ 15 mRNA detected. d-f, Applicants down-sampled 50% (FIG. 2D), 25% (FIG. 2E), and 10% (FIG. 2F) of cells from each sample and repeated the analysis as performed on the ~60,000 cells. As the number of cells included in the analysis decreases, the 4 populations arising from the different treatments becomes less distinct.



FIGS. 3A-3F – BacDrop reveals within population heterogeneity driven largely by mobile genetic elements. (FIGS. 3A, 3B), In a stable, untreated culture of MGH66, a population showing high-level expression of IS903B transposase (MGE, 5.7%; green) and a metabolically stressed population (0.25%; blue) were identified as distinct from the majority subpopulation (~94%; red). Genes expressed at significantly higher levels in these two populations are shown on the dot plot (FIG. 3B). (FIGS. 3C, 3D) Down-sampling of the data from the untreated sample to 20,000 and 10,000 cells, respectively, renders the metabolically stressed population undetectable. (FIGS. 3E, 3F) MGE-driven subpopulations were detected in another K.pneumoniae clinical isolate BIDMC35. UMAP (FIG. 3E) and heatmap (FIG. 3F) shows 4 subpopulations differing from the majority population (Cluster 0; red) of BIDMC35. Clusters 2, 3, and 4 are each driven by the high expression of a different transposase gene. In cluster 1, nearly all of the highly expressed genes belong to a prophage in BIDMC35 genome. Expression levels in all genes in FIG. 3F are normalized to expression in Cluster 0.



FIGS. 4A-4G – BacDrop reveals heterogeneous responses to meropenem exposure. (FIG. 4A) Meropenem treatment induced heterogenous subpopulations, including subpopulations showing the strongest stress response (cluster 5 and 12), undergoing active cell wall/membrane synthesis (cluster 7 and 11), undergoing active DNA replication and cell wall/membrane synthesis (cluster 9), expressing the toxin CspD (cluster 10), and highly expressing the IS903B transposase gene (MGE). (FIG. 4B) Dot plot showing the expression of genes that are significantly different among clusters and the percentage of cells expressing these genes in each cluster. (FIG. 4C) Expression of yhcN (left) and cspD (right) was only detected in their featured subpopulations. (FIG. 4D) In bulk RNA-seq results, the expression of yhcN and cspD was not significantly different in meropenem-treated versus untreated samples (black). In contrast, BacDrop revealed that the expression of yhcN was significantly higher in cluster 5 and 12, and that the expression of cspD was significantly higher in cluster 10 (gray). (FIG. 4E) Flow cytometry of reporter MGH66 strains expressing GFP driven by the promoter of yhcN (MGH66:PyhcN:gfp; left) or cspD (MGH66:PcspD:gfp; right) shows a heterogenous response to meropenem (green) but not to ciprofloxacin (blue) treatment, relative to untreated control (red). (FIG. 4F) MGH66:PcspD:gfp cells were analyzed by FACS at time 0 and 30 minutes after exposure to meropenem (2 µg/mL). After 30 minutes, live cells from GFP-low and GFP-high subpopulations were identified and sorted. (FIG. 4G) GFP-low and GFP-high subpopulations sorted from meropenem-treated MGH66:PcspD:gfp cells differed in their response to meropenem. GFP-low and GFP-high subpopulations were sorted directly into media with no antibiotic or with meropenem (2 µg/mL). Samples were then taken over time and plated on solid agar to enumerate CFU. Persisters only emerged from the GFP-high subpopulation. The limit of detection is indicated by black dashed line. Three asterisks from the treated GFP-low subpopulation indicate either no persister was present or the numbers of persisters were below the limit of detection. Three replicates were performed. The error bars were plotted as standard deviation, and two-tailed Student’s t-test were used for statistical analysis.



FIGS. 5A-5C – rRNA and gDNA depletion are implemented in BacDrop. RNA was extracted from permeabilized cells using proteinase K cell lysis (see methods). (FIG. 5A) no rRNA and gDNA depletion was performed. The three peaks are 16s rRNA (~1000 bp), 23 rRNA (~ 2000 bp), and gDNA (> 4000 bp). (FIG. 5B) only gDNA depletion was performed. (FIG. 5C) both rRNA and gDNA depletion was performed.



FIG. 6 – Scheme of two rounds of cell barcoding (plate barcoding and droplet barcoding) and library construction.



FIG. 7 – BacDrop was validated in multiples species. Unsupervised Cell clustering separate these four species into distinct clusters. Multiple subpopulations of E.faecium were identified, resulted from a small differential expression (Log2 fold change 0.6 – 0.7) of two highly expressed housekeeping genes (ef-tu and ef-g).



FIG. 8 – rRNA depletion efficiency in E.coli, P.aeruginosa, and E.faecium.



FIG. 9 – Cell barcode identification from the sequencing library containing ~ one million cells using the white list function in UMI-Tools. Cells barcodes with ≥10 UMIs per cell were selected for single-cell analysis.



FIG. 10 – Histogram of numbers of mRNA genes detected per cell in ~500,000 MGH66 cells.



FIG. 11 – Unsupervised UAMP clustering of four samples of MGH66, including the untreated, meropenem-treated, ciprofloxacin-treated, and gentamicin-treated samples. UMAP shows that BacDrop results could distinguish distinct responses from different antibiotic treatments when Applicants included ~60,000 cells with ≥ 15 mRNA detected. The ciprofloxacin-treated cells were clustered in cluster 4, and the gentamicin-treated cells were clustered in cluster 6 when 60,000 cells were included in the analysis. As the number of cells included in the analysis decreases, the four populations arising from the different treatments becomes less distinct. The MGE cluster, however, could be identified in all four samples, even when there are only 7,000 cells included in the analysis.



FIGS. 12A-12D – BacDrop results could identify sub-populations when the analysis threshold of minimal number of mRNA genes was set at 10. (FIGS. 12A, 12B) UMAP shows that BacDrop results could distinguish distinct responses from different antibiotic treatments when all ~150,000 cells were included. (FIGS. 12C, 12D) 50% down-sampling from each condition resulted in ~75,000 cells in the analysis. Reducing the numbers of cells in the analysis decreases the resolution of the separation of these four samples.



FIG. 13 – Violin plots of untreated MGH66. Numbers of mRNA genes (left) and mRNA UMIs (right) per cells were plotted. The distribution and mean numbers of mRNA genes or UMIs in three clusters were not significantly different.



FIG. 14 – The MGE subpopulation is present in all 4 samples of MGH66, including the untreated (red), and samples treated with meropenem (green), ciprofloxacin (blue), and gentamicin (purple). The numbers of cells in the MGE-driven clusters were plotted.



FIG. 15 – Violin plots of BIDMC35. Numbers of mRNA genes (left) and mRNA UMIs (right) per cells were plotted. The distribution and mean numbers of mRNA genes or UMIs in five clusters were not significantly different.



FIG. 16 – Killing kinetics of MGH66 treated with antibiotics. At each time points, cells from meropenem treatment (green), Ciprofloxacin treatment (blue), Gentamicin treatment (purple), and the untreated samples were diluted and plated on LB agar plates without antibiotics. CFUs from each condition were normalized to the CFUs of the untreated samples at the same time points to calculate the killing rates for each time points. The experiment was repeated three times and the error bars are plotted as standard deviation.



FIG. 17 – Violin plots of MGH66 treated with meropenem. Numbers of mRNA genes (left) and mRNA UMIs (right) per cells were plotted. The distribution and mean numbers of mRNA genes or UMIs in all clusters were not significantly different, except that most of cells in the MGE cluster had more mRNA genes and UMIs detected, which is caused by multiple copies of the IS903B elements. Due to limitation of the alignment program, Applicants cannot determine if the high-level expression of IS903B elements was caused by specific copies of it or all of the copies existing in the genome.



FIGS. 18A-18B – Live/Dead staining shows that the heterogeneous expression of MGH66:PcspD:gfp was not caused by cell death. (FIG. 18A), At 30 minutes of the meropenem treatment, cells were diluted into propidium iodide staining buffer (106 cells/mL) and incubated at room temperature for 15 min in the dark. The cells were then run through flowcytometry or FACS. The live cells were detected using green fluorescence and dead cells were detected using mCherry red fluorescence. In the GFP-low population, approximately 80% cells are alive, whereas in the GFP-high population, about 94% cells are alive. (FIG. 18B) Sorted cells were immediately diluted and plated on LB agar plates. CFUs were enumerated. This experiment was repeated 3 times. The error bars were plotted as standard deviation. Two-tailed Student’s t-test was used for the statistical testing (p=0.43).



FIG. 19 – Scheme of sequencing data processing.



FIG. 20 – Scheme of library structure.



FIGS. 21A-21D – Validating BacDrop’s ability to distinguish subpopulations based on distinct responses to different antibiotic treatments. (FIG. 21A) UMAP plotted based on the original identity of the 6 samples treated with meropenem (M and its replicate M.2), ciprofloxacin (C and its replicate C.2), and gentamicin (G and its replicate G.2). (FIG. 21B) Unsupervised UMAP showed three clusters with significantly (p < 0.05) higher expression of genes in the SOS-response pathway, heat-shock response, and genes encoding an IS903B transposase (MGE). (FIG. 21C) No strong batch effect was observed between the two biological replicates with the same treatment conditions. 56%-72% of the ciprofloxacin-treated cells were clustered in the SOS-response cluster, and 66%-71% of the gentamicin-treated cells were clustered in the heat-shock response cluster. All 6 samples contained cells highly expressing IS903B (MGE cluster). (FIG. 21D) Expression of a representative gene from each cluster was highlighted on the UMAP.



FIGS. 22A-22B – BacDrop reveals within population heterogeneity driven largely by mobile genetic elements (MGE). (FIGS. 22A, 22B) In an untreated culture of MGH66, a population showing high-level expression of IS903B transposase (MGE, 4.5%; green) was detected.



FIGS. 23A-23H – BacDrop reveals heterogeneous responses to meropenem exposure. (FIG. 23A) Besides the subpopulation highly expressing the IS903B transposase gene (MGE), meropenem treatment induced heterogenous responses, including a stress-response subpopulation, a cell wall synthesis subpopulation, a DNA replication and cell wall synthesis subpopulation, and a cspD-expressing subpopulation. (FIG. 23B) Dot plot showing the expression of genes that are significantly different among clusters and the percentage of cells expressing these genes in each cluster. (FIG. 23C) Validation of subpopulations identified in the meropenem-treated MGH66 using RNA FISH with double marker genes from the “cspD expressing” subpopulation (cspD + rihC) and the “strong stress response” subpopulation (rseB + yidC). A 16s rRNA probe was used as the positive control to show that more than 99% cells were successfully permeabilizated and hybridized. Subpopulations co-expressing double marker genes were identified. (FIG. 23D) Across 20 fields of view, the RNA FISH results showed that ~0.85% cells co-expressed cspD and rihC, and ~12% cells co-expressed rseB + yidC. This result verified the BacDrop result in which ~0.7% cells co-expressed cspD and rihC, and ~8% cells co-expressed rseB + yidC. (FIG. 23E) Flow cytometry of reporter MGH66 strains expressing GFP driven by the promoter of yhcN (MGH66:PyhcN:gfp; left) or cspD (MGH66:PcspD:gfp; right) shows a heterogenous response to meropenem (green) but not to ciprofloxacin (blue) treatment, relative to untreated control (red). (FIG. 23F) MGH66:PcspD:gfp cells were analyzed by FACS at time 0 and 30 minutes after exposure to meropenem (2 µg/mL). After 30 minutes, live cells from GFP-low and GFP-high subpopulations were identified and sorted. (FIG. 23G) GFP-low and GFP-high subpopulations sorted from meropenem-treated MGH66:PcspD:gfp cells differed in their response to meropenem. GFP-low and GFP-high subpopulations were sorted directly into media with no antibiotic or with meropenem (2 µg/mL). Samples were then taken over time and plated on solid agar to enumerate CFU. Persisters only emerged from the GFP-high subpopulation. The limit of detection is indicated by black dashed line. Three asterisks from the treated GFP-low subpopulation indicate either no persister was present or the numbers of persisters were below the limit of detection. (FIG. 23H) Overexpression of cspD in MGH66 increased numbers of persisters but did not affect the susceptibility of meropenem. cspD driven by the arabinose inducible promoter pBAD was transformed into MGH66. Induction of cspD with 1% arabinose did not affect the minimal inhibitory concentration (MIC) of meropenem. When cspD was induced with 1% arabinose and treated with meropenem at 2 µg/mL (purple), a greater number of persisters were formed compared to the culture without arabinose induction under 2 µg/mL meropenem treatment (blue). All experiments in panel c-h were repeated three times. Error bars were plotted as the standard deviation. The Student’s t-test was used for statistical analysis.



FIG. 24 – Development of BacDrop. RNA species and their percentage in a BacDrop library of K.pneumoniae.



FIGS. 25A-25C – BacDrop was validated in multiples species. (FIG. 25A) rRNA depletion efficiency in K.pneumoniae, P.aeruginosa, E.coli, and E.faecium. Due to the capacity of the rRNA depletion kit (10 µg total RNA maximal), the rRNA depletion efficiency is a function of cell numbers. In BacDrop protocol, Applicants used 4 × 107 cell for each rRNA depletion reaction, resulting in a ~80% depletion efficiency. (FIGS. 25B, 25C) Cell lose in the mixed-species experiment is due to different cell recovery rates from centrifugation steps. In this experiment, equal numbers of cells from each species were mixed before round 1 plate barcoding (RT). Due to different cell sizes, these four species had different recovered rates at each centrifugation step (FIG. 25B) at 7,000 g. After PolyA tailing (right before round 2 droplet barcoding), the cells recovered from each species differed significantly (FIG. 25C). Therefore, Applicants recommend users to optimize centrifugation speed for different species. In cases multiplexing is needed, Applicants recommend keep samples separate until round 2 droplet barcoding. Experiments in b-d were repeated three times. Error bars are plotted as standard deviation.



FIGS. 26A-26C – Assessment of the transcriptome coverage of BacDrop libraries. (FIG. 26A) A library containing 10,000 cells of E.coli sequenced at 80,000 reads per cell. Roughly ~4,000 cells were recovered with an average of 90 mRNA genes detected per cell. (FIG. 26B) A library containing 12,000 cells of K.pneumoniae sequenced at 80,000 reads per cell. Roughly ~6,000 cells were recovered with an average of 88 mRNA genes detected per cell. (FIG. 26C) A library containing ~1 million cells of K.pneumoniae sequenced at 5,000 reads per cell. Top 3,000 cells were analyzed with an average of 127 mRNA genes detected per cell. For libraries in a and b, sequencing reads were randomly subsampled to ~40,000, ~20,000, ~4,000 reads per cell, and the analysis was repeated to calculate numbers of mRNA genes detected per cell. For library in c, sequencing reads were randomly subsampled to ~4,000, ~3,000, ~2,000 reads per cell, and the analysis was repeated to calculate numbers of mRNA genes detected per cell.



FIGS. 27A-27D – Assessment of BacDrop’s sensitivity. BacDrop has good sensitivity to distinguish cells based on the expression level of gfp. The expression levels of gfp in three E.coli strains were confirmed using flow cytometry (FIG. 27A) and the mRNA copy numbers of gfp in the sorted population were estimated using RT-qPCR (FIG. 27B). The mRNA copy numbers were 1-5 for the gfp.low strain, 9-30 for the gfp.mid strain, and 30-70 for the gfp.high strain. Roughly 3,300 cells from each strain were mixed to create a heterogeneous population and a BacDrop library was generated. (FIG. 27C) BacDrop results of gfp expression in three strains. (FIG. 27D) Identify of cells and their gfp expression levels.



FIGS. 28A-28C – Analysis of MGH66 experiment including the antibiotic-treated samples and untreated samples. (FIG. 28A) UMAP plotted based on the original identity of these 8 samples. Cells were separated well based on their treatment. (FIG. 28B) Unsupervised UMAP showed three clusters with significantly (p < 0.05) higher expression of genes in the SOS-response pathway, heat-shock response, and genes encoding an IS903B transposase (MGE). (FIG. 28C) No strong batch effect was observed between the two biological replicates with the same treatment conditions. 56%-72% of the ciprofloxacin-treated cells were clustered in the SOS-response cluster, and 66%-71% of the gentamicin-treated cells were clustered in the heat-shock response cluster. All 8 samples contained cells highly expressing IS903B (MGE cluster).



FIG. 29 – Analysis of the untreated samples. UMAP plotted based on the original identity of these two samples (replicate 1 and replicate 2).



FIG. 30 – A large number of cells is beneficial for the detection of small population. Both libraries of Replicate 1 and Replicate 2 were constructed with ~250k untreated MGH66 cells. Applicants sequenced Replicate 1 with ~5,000 reads/cell and Replicate 2 with ~3,000 reads/cell, and recovered ~40k cells and ~10k cells from Replicate 1 and Replicate 2, respectively. In these two libraries, a subpopulation highly expressing maltose transport genes (i.e, lamB) were detected. But this subpopulation was not detected in the library containing only ~3,000 untreated MGH66 cells that were collected at the same condition. The MGE subpopulation was detected in all libraries.



FIGS. 31A-31C – (FIG. 31A) Analysis of the meropenem-treated samples. UMAP plotted based on the original identity of these two samples (replicate 1 and replicate 2). (FIGS. 31B, 31C) FACS sorting coupled with Live/Dead staining to validate the expression of cspD in MGH66: PcspD:gfp strain. At 30 minutes of the meropenem treatment, cells were diluted into propidium iodide staining buffer (106 cells/mL) and incubated at room temperature for 15 min in the dark. Then the cells were run through flowcytometry or subject to FACS sorting. (FIG. 31B) Gating for cells to exclude cell debris. (FIG. 31C) Dead cells were detected using mCherry red fluorescence, and GFP fluorescence of all cells was detected using green fluorescence. Roughly ~15.2% cells are dead in the gated population. The population showing no mCherry fluorescence is live cells. The gating of GFP-low and GFP-high population is shown.



FIG. 32 – Assess potential bias introduced by cell drop-off caused by insufficient sequencing depth. Since many cells were filtered out during the data analysis process due to low numbers of UMI, Applicants assessed the potential bias in RNA-seq results caused by cell drop-off. Applicants used the dataset from the untreated sample of K.pneumoniae MGH66 o calculate the correlation. Analyzed in bulk level, Applicants found the result from top 10k cells correlates well with the top 500k cells (R2=0.82), while the correlation between top 10k cells and traditional bulk RNA-seq has a R2 at 0.61.



FIG. 33 – Genera captured by 16s rRNA DNA sequencing (left) and BacDrop (right). 127 genera were captured using BacDrop, whereas only 58 genera were captured using 16s rRNA DNA sequencing. 54 genera were captured by both methods. Each genera is also labeled with a number.





The figures herein are for illustrative purposes only and are not necessarily drawn to scale.


DETAILED DESCRIPTION OF THE EXAMPLE EMBODIMENTS
General Definitions

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2nd edition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4th edition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F.M. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.): PCR2: A Practical Approach (1995) (M.J. MacPherson, B.D. Hames, and G.R. Taylor eds.): Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.): Antibodies A Laboratory Manual, 2nd edition 2013 (E.A. Greenfield ed.); Animal Cell Culture (1987) (R.I. Freshney, ed.); Benjamin Lewin, Genes IX, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2nd edition (2011).


As used herein, the singular forms “a”, “an”, and “the” include both singular and plural referents unless the context clearly dictates otherwise.


The term “optional” or “optionally” means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.


The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.


The terms “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of +/-10% or less, +/-5% or less, +/-1% or less, and +/-0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.


As used herein, a “biological sample” may contain whole cells and/or live cells and/or cell debris. The biological sample may contain (or be derived from) a “bodily fluid”. The present invention encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof. Biological samples include cell cultures, bodily fluids, cell cultures from bodily fluids. Bodily fluids may be obtained from a mammal organism, for example by puncture, or other collecting or sampling procedures.


The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.


Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment(s). Reference throughout this specification to “one embodiment”, “an embodiment,” “an example embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment,” “in an embodiment,” or “an example embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.


All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference.


Overview

Bacterial heterogeneity has been widely recognized in microbial communities and in isogenic bacterial populations. Besides genotypic heterogeneity, phenotypic heterogeneity also plays essential roles in bacterial survival, adaptation and evolution, often considered to be part of important bet-hedging or division of labor survival strategies1,2. The recent advent of single-cell RNA-seq (scRNA-seq) has fostered numerous important discoveries in mammalian systems, resulting in a transforming appreciation of the heterogeneity in cell types and cell states3,4. However, bacterial scRNA-seq is still underdeveloped due to several challenges5, including difficulties in bacterial lysis, ribosomal RNA (rRNA) contamination, the absence of a polyadenylated tail for messenger RNA (mRNA) capture, and the paucity of mRNA content in a single bacterial cell6. Recently, several bacterial scRNA-seq approaches have been developed, including the plate-based methods7-9, such as microSPLiT, PETRI-seq, and MATQ-seq. However, these plate-based scRNA-seq technologies have to date been limited by the numbers of cells that can be studied in one experiment and the overwhelming dominance of rRNA in the sequencing libraries. Meanwhile, recent probe-based approaches10,11, such as par-seqFISH, have also been described, which differ in their ability to query the entire genome in a completely unbiased way, but with other potential advantages. Par-seqFISH, for example, has the advantage of being able to analyze large numbers of cells while excluding rRNA and providing spatial resolution of a bacterial population; however, prior definition of the genome(s) of interest is required to enable probe design and generation, with a pragmatic limitation to the numbers of genes that can be queried. Additionally, studies using these previously reported methods have mainly focused on between population heterogeneity, with a focus on proof of principle, whereas within population heterogeneity has not been extensively described.


Embodiments disclosed herein provide a droplet-based high throughput bacterial scRNA-seq technology that can be used to investigate millions of single bacterial cells simultaneously (BacDrop). No probe-design and prior knowledge of the genome is required. BacDrop can be used for many species and can be used for microbiome study. The optimized cell permeabilization method allows complete gDNA removal and efficient rRNA depletion. Two rounds of cell barcoding increase the throughput by at least 10 times in each microfluidic channel (e.g., microfluidic channels for forming droplets). The method is high throughput due to a second cell barcoding step performed in droplets. This allows for the analysis of >1,000,000 cells per sample.


The following detailed description is of example embodiments of the presently claimed invention with references to the accompanying drawings. Such description is intended to be illustrative and not limiting with respect to the scope of the present invention. Such embodiments are described in sufficient detail to enable one of ordinary skill in the art to practice the subject invention, and it will be understood that other embodiments may be practiced with some variations without departing from the spirit or scope of the subject invention.


Methods of Generating a Single Prokaryotic Cell cDNA Library

In an aspect, the present disclosure provides methods of generating a single prokaryotic cell cDNA library. In one example embodiment, methods include barcoding RNAs from different prokaryotic cells individually, allowing cell identity of each RNA to be retained in a single sequencing library. In one example embodiment, methods include degrading rRNA and gDNA in fixed and permeabilized cells prior to generation of a cDNA library. In one example embodiment, methods include converting mRNA into cDNA and labeling cDNA with a cell-specific first and second barcode combination and a unique molecular identifier (UMI) in fixed and permeabilized cells. In one example embodiment, methods include amplifying labeled cDNA and preparing a sequencing library of amplified labeled cDNA. In one example embodiment, a cDNA sequencing library is capable of distinguishing species heterogeneity, strain heterogeneity, genotypic heterogeneity, phenotypic heterogeneity, or a combination thereof, of one or more uncharacterized organisms, an environmental microbiome, an organismal microbiome, or a combination thereof. Non-limiting examples of methods are provided herein.


In one example embodiment, methods comprise: degrading rRNA and gDNA in a set of fixed and permeabilized cells; labeling each mRNA in the fixed and permeabilized cells by reverse transcribing the mRNA into cDNA, the labeling adding a first barcode, a unique molecular identifier (UMI), and a poly-nucleotide tail to each first strand cDNA; labeling each cDNA from a same cell in the fixed and permeabilized cells, the labeling comprising separating the fixed and permeabilized cells into separate individual discrete second reaction volumes, conducting a second strand cDNA synthesis, and adding a second barcode unique to that second reaction volume to each second strand cDNA, thus labeling each cDNA with a cell-specific first and second barcode combination and a UMI; and amplifying the labeled cDNA and preparing a sequencing library comprising the amplified labeled cDNA.


Prokaryotic Cell Samples

Samples comprising prokaryotic cells may be analyzed using the single cell sequencing methods described herein. Samples can be prokaryotic cells grown in the lab. The samples can be homogenous cultures. Samples can be microbial cells treated with an agent or perturbation (e.g., antibiotic). Samples can be isolated from a biological source, such as an animal or human subject. Samples can also be isolated from environmental sources such as soil and water. In one example embodiment, a microbiome is analyzed from a subject. Methods of obtaining a sample from a subject can use any method known in the art. In an exemplary embodiment, a sample can be obtained by a swab. In another exemplary embodiment, a sample is obtained during a surgery. Samples may be obtained from the throat, nose, rectum, or vaginal surfaces. Samples obtained may be cultured on media before analysis of single cells.


The methods may be applied to all prokaryotic cells including bacteria and archaea. In one example embodiment, the prokaryotic cells are Gram-negative or Gram-positive. Various combinations of cells may form a set of prokaryotic cells. In one example embodiment, a set of prokaryotic cells includes one or more prokaryotic cell species, one or more strains of the same prokaryotic cell species, one or more phenotypes of the same prokaryotic cell species, one or more phenotypes of the same prokaryotic cell strain, or a combination thereof. In one example embodiment, a set of prokaryotic cells is a biological sample obtained from a subject. In another example embodiment, a set of prokaryotic cells is a biological sample comprising one or more uncharacterized organisms, an environmental microbiome, or an organismal microbiome.


In various examples, the microbial cells can include one or more bacterial species selected from an Acinetobacter species, an Actinobacillus species, an Actinomycetes species, an Actinomyces species, Aerococcus species an Aeromonas species, an Anaplasma species, an Alcaligenes species, a Bacillus species, a Bacteroides species, a Bartonella species, a Bifidobacterium species, a Bordetella species, a Borrelia species, a Brucella species, a Burkholderia species, a Campylobacter species, a Capnocytophaga species, a Chlamydia species, a Citrobacter species, a Coxiella species, a Corynbacterium species, a Clostridium species, an Eikenella species, an Enterobacter species, an Escherichia species, an Enterococcus species, an Ehlichia species, an Epidermophyton species, an Erysipelothrix species, a Eubacterium species, a Francisella species, a Fusobacterium species, a Gardnerella species, a Gemella species, a Haemophilus species, a Helicobacter species, a Kingella species, a Klebsiella species, a Lactobacillus species, a Lactococcus species, a Listeria species, a Leptospira species, a Legionella species, a Leptospira species, Leuconostoc species, a Mannheimia species, a Microsporum species, a Micrococcus species, a Moraxella species, a Morganell species, a Mobiluncus species, a Micrococcus species, Mycobacterium species, a Mycoplasm species, a Nocardia species, a Neisseria species, a Pasteurelaa species, a Pediococcus species, a Peptostreptococcus species, a Pityrosporum species, a Plesiomonas species, a Prevotella species, a Porphyromonas species, a Proteus species, a Providencia species, a Pseudomonas species, a Propionibacteriums species, a Rhodococcus species, a Rickettsia species, a Rhodococcus species, a Serratia species, a Stenotrophomonas species, a Salmonella species, a Serratia species, a Shigella species, a Staphylococcus species, a Streptococcus species, a Spirillum species, a Streptobacillus species, a Treponema species, a Tropheryma species, a Trichophyton species, an Ureaplasma species, a Veillonella species, a Vibrio species, a Yersinia species, and a Xanthomonas species. In another example embodiment, the plurality of microbial cells comprise cells from one or more bacterial species selected from the group consisting of Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Enterococcus faecium.


Degrading Ribosomal RNA (rRNA) and Genomic DNA (gDNA) in a Set of Fixed and Permeabilized Cells

In one example embodiment, a portion, substantially all, or all of the cells of a set of prokaryotic cells are fixed. In one example embodiment, a portion, substantially all, or all of the cells of a set of prokaryotic cells are fixed by crosslinking.


In one example embodiment, a portion, substantially all, or all of the cell wall of each fixed cell of a set of prokaryotic cells are permeabilized. In one example embodiment, a portion, substantially all, or all of the cell wall of each fixed cell of a set of prokaryotic cells are permeabilized by hydrolysis.


Preparing Fixed and Permeabilized Cells

In one example embodiment, preparing a set of fixed and permeabilized cells is performed prior to degrading rRNA and gDNA. In one example embodiment, preparing a set of fixed and permeabilized cells comprises fixing each cell of a set of prokaryotic cells and permeabilizing each fixed cell of the set of prokaryotic cells. The fixing and permeabilizing of cells may be performed in two separate sequential steps, two partially overlapping sequential steps, or a single concurrent step.


In one example embodiment, fixing each cell of a set of prokaryotic cells comprises fixing a portion, substantially all, or all of each cell of a set of prokaryotic cells. Various fixing methods can be used. In one example embodiment, fixing is accomplished by crosslinking. Non-limiting methods of crosslinking are known in the art. Fixation methods can be divided into two groups: additive and denaturing fixation. Additive fixation solutions (also called cross-linking fixations) contain various aldehydes, including formaldehyde, paraformaldehyde, glutaraldehyde, etc., and can create covalent chemical bonds between proteins. This method can preserve the natural structure of proteins, i.e., secondary and tertiary structures. Another group is the denaturing (or precipitating) fixations. These methods can denature proteins by reducing their solubility and/or disrupting the hydrophobic interactions, and thus modify the tertiary structures of proteins as well as inactivate enzymes. Alcohols, such as methanol and ethanol, are commonly used for denaturing fixation. However, alcohols are seldom solely applied since they can induce serious cell shrinkage. Other denaturing chemicals, like acetone and acetic acid, are usually combined with alcohols to enhance the fixation performance. Common fixation solutions include 2.5% glutaraldehyde, 4-10% formalin (formalin is an alternative name for an aqueous solution of formaldehyde), 4% paraformaldehyde, methanol/acetone (1:1), and ethanol/acetic acid (3:1) (see, e.g., Chao Y, Zhang T. Optimization of fixation methods for observation of bacterial cell morphology and surface ultrastructures by atomic force microscopy. Appl Microbiol Biotechnol. 2011;92(2):381-392). In one example embodiment, a set of prokaryotic cells is fixed in a single fixing reaction volume comprising about 10 billion prokaryotic cells or less and/or about 143 million prokaryotic cells/ml or less. In one example embodiment, a set of prokaryotic cells is fixed in a plurality of fixing reaction volumes each comprising about 10 billion prokaryotic cells or less at about 143 million prokaryotic cells/ml or less. In one example embodiment, the fixing step is accomplished by addition of formaldehyde or paraformaldehyde. Fixing of bacteria may employ 4% (wt/vol) paraformaldehyde or formaldehyde, aldehydes that cross-link cellular macromolecules, ultimately creating a mesh type structure within the cell.


In one example embodiment, a permeabilizing step comprises permeabilizing a portion, substantially all, or all of the cell wall and cytoplasmic membrane of each fixed cell of a set of prokaryotic cells. The bacterial cell wall consists of peptidoglycan, an essential protective barrier for bacterial cells that encapsulates the cytoplasmic membrane of both Gram-positive and Gram-negative bacterial cells. Peptidoglycan is a rigid, highly conserved, complex structure of polymeric carbohydrates and amino acids. Various permeabilizing methods can be used. In one example embodiment, permeabilizing is accomplished by hydrolysis. Non-limiting methods of hydrolysis are known in the art. Different classes of permeabilizers include, but are not limited to organic solvents (ethanol), detergents (triton X-100) and enzymes (lysozyme). Lysozyme is a glycoside hydrolase that catalyzes the hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in peptidoglycan, which is the major component of gram-positive bacterial cell wall. Lysozyme attacks peptidoglycans (found in the cell walls of bacteria, especially Gram-positive bacteria). In certain embodiments, the permeabilizing step comprises treatment with ethanol, detergent and/or lysozyme (see, e.g., Rocha R, Almeida C, Azevedo NF (2018) Influence of the fixing/permeabilizing step on peptide nucleic acid fluorescence in situ hybridization (PNA-FISH) for the detection of bacteria. PLoS ONE 13(5): e0196522). Gram-negative and many Gram-positive species may require the use of permeabilizing agents such as enzymes, solvents, detergents or even hydrochloric acid. Id. The choice of the permeabilizing procedure to be employed will depend on the characteristics of the microorganism(s) and their cell envelope composition. In preferred embodiments, a universal permeabilizing step applicable to all or substantially all microorganisms is used that includes treatment with ethanol, detergent and lysozyme (e.g., 50% Ethanol in one step, 0.04% Tween-20 in another step, and lysozyme in another step). In one example embodiment, a set of fixed prokaryotic cells is permeabilized in a single permeabilizing reaction volume comprising about 40 million fixed prokaryotic cells or less and/or about 200,000 fixed prokaryotic cells/µL or less. In another example embodiment, a set of fixed prokaryotic cells is permeabilized in a plurality of permeabilizing reaction volumes each comprising about 40 million fixed prokaryotic cells or less and/or about 200,000 fixed prokaryotic cells/µL or less.


Degrading rRNA and gDNA in Fixed and Permeabilized Cells

Various methods of rRNA and gDNA degradation can be used. In one example embodiment, methods degrade rRNA and gDNA in a set of fixed and permeabilized cells. The permeabilization methods disclosed herein increase access to rRNA and gDNA resulting in increased rRNA and gDNA degradation (e.g., complete gDNA removal and efficient rRNA depletion). Non-limiting methods of removing rRNA and gDNA are known in the art (see, e.g., Giannoukos G., Ciulla D.M., Huang K., Haas B.J., Izard J., Levin J.Z., Livny J., Earl A.M., Gevers D., Ward D.V. et al. Efficient and robust RNA-seq process for cultured bacteria and complex community transcriptomes. Genome Biol. 2012; 13:R23; He S.M., Wurtzel O., Singh K., Froula J.L., Yilmaz S., Tringe S.G., Wang Z., Chen F., Lindquist E.A., Sorek R. et al. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics. Nat. Methods. 2010; 7:U807-U858; Petrova O.E., Garcia-Alcalde F., Zampaloni C., Sauer K. Comparative evaluation of rRNA depletion procedures for the improved analysis of bacterial biofilm and mixed pathogen culture transcriptomes. Sci. Rep. 2017; 7:41114; He S.Izard J, Rivera MC Chapter 3 - Ribosomal RNA removal methods for microbial transcriptomics. Metagenomics for Microbiology. 2015; LondonElsevier39-53; Dunman P.M., Murphy E., Haney S., Palacios D., Tucker-Kellogg G., Wu S., Brown E.L., Zagursky R.J., Shlaes D., Projan S.J. Transcription profiling-based identification of Staphylococcus aureus genes regulated by the agr and/or sarA loci. J. Bacteriol. 2001; 183:7341-7353; Stewart F.J., Ottesen E.A., DeLong E.F. Development and quantitative analyses of a universal rRNA-subtraction protocol for microbial metatranscriptomics. ISMEJ. 2010; 4:896-907; Li S.K., Zhou J.W., Yim A.K.Y., Leung A.K.Y., Tsui S.K.W., Chan T.F., Lau T.C.K. Organism-specific rRNA capture system for application in next-generation sequencing. PLoS One. 2013; 8:e74286; Rey F.E., Faith J.J., Bain J., Muehlbauer M.J., Stevens R.D., Newgard C.B., Gordon J.I. Dissecting the in vivo metabolic potential of two human gut acetogens. J. Biol. Chem. 2010; 285:22082-22090; and Kim I.V., Ross E.J., Dietrich S., Döring K., Alvarado S.A., Kuhn C. Efficient depletion of ribosomal RNA for RNA sequencing in planarians. BMC Genomics. 2019; 20:909.


In one example embodiment, for rRNA degradation, single stranded probes that hybridize specifically to bacterial rRNA are contacted with the cells followed by contacting the cells with RNase H, which degrades the hybridized RNA (see, e.g., NEBNext Bacterial rRNA Depletion Kit, New England Biolabs, Ipswich, MA; Huang Y, Sheth RU, Kaufman A, Wang HH. Scalable and cost-effective ribonuclease-based rRNA depletion for transcriptomics. Nucleic Acids Res. 2020;48(4):e20); and Engelhardt F, Tomasch J, Häussler S. Organism-specific depletion of highly abundant RNA species from bacterial total RNA. Access Microbiol. 2020;2(10):acmi000159).


In another example embodiment, blocking primers specific to rRNA sequences are contacted with the fixed and permeabilized cells to prevent reverse transcription of rRNA (see, e.g., Wangsanuwat, et al., Efficient and cost-effective bacterial mRNA sequencing from low input samples through ribosomal RNA depletion. bioRxiv 2020.06.19.162412; and Wangsanuwat, C., Heom, K.A., Liu, E. et al. Efficient and cost-effective bacterial mRNA sequencing from low input samples through ribosomal RNA depletion. BMC Genomics 21, 717 (2020)).


In another example embodiment, CRISPR is used to deplete rRNA cDNA (i.e., after cDNA synthesis and before sequencing) (see, e.g., Prezza G, Heckel T, Dietrich S, Homberger C, Westermann AJ, Vogel J. Improved bacterial RNA-seq by Cas9-based depletion of ribosomal RNA reads. RNA. 2020;26(8):1069-1078. doi:10.1261/rna.075945.120; and CRISPRclean Pan Bacterial rRNA Depletion Kit, Jumpcode Genomics, San Diego, CA). In certain embodiments, CRISPR depletion is performed after the reverse transcription step. In certain embodiments, CRISPR depletion is performed after sequencing library preparation. In certain embodiments, rRNA is depleted by a method that removes or blocks rRNA before the reverse transcription step and a CRISPR method is used before sequencing to remove remaining rRNA sequences.


In another example embodiment, rRNA cDNA can be removed after the barcoding steps and before sequencing. For example, rRNA depletion can be performed by hybridizing samples to probes antisense to the rRNA cDNA to be depleted, where the antisense probes include a capture moiety that can be captured by a specific binding agent. In some examples, depleting the samples of non-target RNA cDNA comprises using one or more probes that specifically hybridize to the non-target RNA cDNA, wherein the one or more probes comprise a label that facilitates removal of the probe from the sample. In some examples the one or more probes is a plurality of probes, wherein probes in the plurality are selected to tile across the sequence of the non-target RNA cDNA. In some examples, the label comprises biotin. In some examples, the probes are biotinylated antisense probes that deplete ribosomal RNA cDNAs. The probe-RNA cDNA is later bound to streptavidin beads to physically remove the target RNA cDNAs from the solution. Due to the GC-rich sequence of 28S, it is better to use not only biotinylated UTP, but also biotinylated CTP.


Non-limiting methods of removing gDNA are known in the art. In example embodiments, gDNA is removed using DNase treatment. A deoxyribonuclease (DNase) is an enzyme that catalyzes the hydrolytic cleavage of phosphodiester linkages in the DNA backbone, thus degrading DNA. Deoxyribonucleases are one type of nuclease, a generic term for enzymes capable of hydrolyzing phosphodiester bonds that link nucleotides. Some DNases cut, or “cleave”, only residues at the ends of DNA molecules (exodeoxyribonucleases, a type of exonuclease). Others cleave anywhere along the chain (endodeoxyribonucleases, a subset of endonucleases). Some DNases are fairly indiscriminate about the DNA sequence at which they cut, while others, including restriction enzymes, are very sequence-specific. Some cleave only double-stranded DNA; others are specific for single-stranded molecules; and still others are active toward both. In example embodiments, a combination of DNases can be used or a single DNase can be used. In preferred embodiments, DNase I is used to degrade genomic DNA. Deoxyribonuclease I (DNase I) is an endonuclease of the DNase family coded by the human gene DNASE1. DNase I is a nuclease that cleaves DNA preferentially at phosphodiester linkages adjacent to a pyrimidine nucleotide, yielding 5′-phosphate-terminated polynucleotides with a free hydroxyl group on position 3′, on average producing tetranucleotides. DNase I acts on single-stranded DNA, double-stranded DNA, and chromatin.


In an example embodiment, rRNA and gDNA degradation may be performed in two separate sequential steps, two partially overlapping sequential steps, or a single concurrent step.


In one example embodiment, methods selectively degrade rRNA and gDNA over mRNA. In one example embodiment, mRNA in a set of fixed and permeabilized cells is not substantially degraded (e.g., degradation does not result in a detectable change in the mRNA profile).


Methods can be performed to various percent enrichment of mRNA. In one example embodiment, mRNA accounts for more than 5%, more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, or more than 80% of total aligned reads in a cDNA library. In certain aspects, the mean mRNA UMI per cell is more than 25, more than 35, more than 45, more than 55, or more than 65.


In one example embodiment, a set of fixed and permeabilized prokaryotic cells undergoes rRNA and gDNA degradation in a single degradation reaction volume comprising 40 million fixed and permeabilized prokaryotic cells or less and/or 2 million fixed and permeabilized prokaryotic cells/µL or less. In one example embodiment, a set of fixed and permeabilized prokaryotic cells undergoes rRNA and gDNA degradation occurs in a plurality of degradation reaction volumes each comprising 40 million fixed and permeabilized prokaryotic cells or less and/or 2 million fixed and permeabilized prokaryotic cells/µL or less.


Labeling Each mRNA in Fixed and Permeabilized Cells

In example embodiments, after separating the set of fixed and permeabilized prokaryotic cells into a plurality of first reaction volumes, the remaining RNA in each fixed and permeabilized cell is labeled with a first barcode via reverse transcribing RNA into cDNA using primers comprising a first cell barcode. A poly-nucleotide tail (e.g., poly A tail) may then be added to the 3′ end of the cDNA. The poly-nucleotide tailing may be done concurrently with or a separate reaction following the reverse transcription step.


Reverse Transcribing the mRNA Into cDNA

In one example embodiment, reverse transcription of each mRNA into cDNA in the fixed and permeabilized cells adds a first barcode and, optionally, a unique molecular identifier (UMI) to each first strand cDNA in a first reaction volume. In preferred embodiments, a first barcode and a unique molecular identifier (UMI) is added to each first strand cDNA in a first reaction volume. In example embodiments, the first reaction volume can be tubes (such as, microcentrifuge tubes, test tubes, and the like), or wells (such as wells in a plate). In example embodiments, the first reaction volumes are the wells of a microplate, such as a 96 well, a 384 well, or a 1536 well microplate. In an example embodiment, cells are separated into different first reaction volumes, each volume including a reverse transcription primer having the same cell barcode, but different from the barcode in any other volume. In example embodiments, there are at least 96 discrete first reaction volumes, each comprising a different barcode sequence. In example embodiments, there are at least 384 discrete first reaction volumes, each comprising a different barcode sequence. In example embodiments, the set of fixed and permeabilized prokaryotic cells are separated into a plurality of first reaction volumes at about 2 million fixed and permeabilized prokaryotic cells/first reaction volume or less. Thus, after reverse transcription, each of the about 2 million cells in each first reaction volume is labeled with the same first barcode, but the cells from each different first volume have a different first barcode. As described further herein, pooling of the cells and then splitting into second reaction volumes for adding a second cell barcode results in single cells having unique barcodes. RT primers


In one example embodiment, a first reaction volume comprises reverse transcription reagents. In one example embodiment, reverse transcription reagents comprise RT primers. In one example embodiment, RT primers comprise one or more of a 5′ primer binding sequence (PBS), a barcode sequence, and a unique molecular identifier (UMI). In one example embodiment, a barcode sequence is the same for all primers in a same first reaction volume but differs from a barcode sequence of primers in any other first reaction volume. In one example embodiment, a unique molecular identifier (UMI) is different for each primer in a first reaction volume. In one example embodiment, the RT primers include random hexamers for RT priming of all RNAs in the fixed and permeabilized cells. In an example embodiment, each RT primer comprises from 5′ to 3′, a primer binding sequence (PBS), a unique molecular identifier (UMI), a first cell barcode sequence, and a random hexamer for RT priming.


Nucleic Acid Barcode, Barcode, and Unique Molecular Identifier (UMI)

The term “barcode” as used herein refers to a short sequence of nucleotides (for example, DNA or RNA) that is used as an identifier for an associated molecule, such as a target molecule and/or target nucleic acid, or as an identifier of the source of an associated molecule, such as a cell-of-origin. Although it is not necessary to understand the mechanism of an invention, it is believed that the barcode sequence provides a high-quality individual read of a barcode associated with a single cell, such that multiple species can be sequenced together. Barcodes can also allow for identification and/or quantification of individual sequencing-reads.


In one example embodiment barcoding uses an error correcting scheme (T. K. Moon, Error Correction Coding: Mathematical Methods and Algorithms (Wiley, New York, ed. 1, 2005)).


In preferred embodiments, unique molecular identifiers (UMI) are used. The term “unique molecular identifiers” (UMI) as used herein refers to a sequencing linker or a subtype of nucleic acid barcode used in a method that uses molecular tags to detect and quantify unique products (e.g., individual transcripts). A UMI is used to distinguish effects through a single clone from multiple clones. The term “clone” as used herein may refer to a single mRNA or target nucleic acid to be sequenced. The UMI may be used to determine the number of transcripts in each single cell, as each individual transcript will have a different UMI that can be identified even after amplification (See e.g., Islam S. et al., 2014. Nature Methods No: 11, 163-166). In one example embodiment, an UMI is a random sequence of between 4 and 20 base pairs. Not being bound by a theory, the UMI’s are designed such that assignment to the original can take place despite up to 4-7 errors during amplification or sequencing.


Unique molecular identifiers can be used, for example, to normalize samples for variable amplification efficiency. For example, in various embodiments, featuring a solid or semisolid support (for example a bead), to which nucleic acid barcodes (for example a plurality of barcodes sharing the same sequence) are attached, each of the barcodes may be further coupled to a unique molecular identifier, such that every barcode on the particular solid or semisolid support receives a distinct unique molecule identifier. A unique molecular identifier can then be, for example, transferred to a target molecule with the associated barcode, such that the target molecule receives not only a nucleic acid barcode, but also an identifier unique among the identifiers originating from that solid or semisolid support.


A nucleic acid barcode or UMI can have a length of at least, for example, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides, and can be in single- or double-stranded form. Target molecule and/or target nucleic acids can be labeled with multiple nucleic acid barcodes in combinatorial fashion, such as a nucleic acid barcode concatemer. The nucleotide barcode can be a barcode having intervening sequences. For example, a barcode for identifying a single cell may include a first and second cell barcode sequence that are non-contiguous, but together can be used to identify RNA molecules originating from the same cell.


Typically, a nucleic acid barcode is used to identify a target molecule and/or target nucleic acid as being from a particular discrete volume, having a particular physical property (for example, affinity, length, sequence, etc.), or having been subject to certain treatment conditions. Target molecule and/or target nucleic acid can be associated with multiple nucleic acid barcodes to provide information about all of these features (and more). Each member of a given population of UMIs, on the other hand, is typically associated with (for example, covalently bound to or a component of the same molecule as) individual members of a particular set of identical, specific (for example, discreet volume-, physical property-, or treatment condition-specific) nucleic acid barcodes. Thus, for example, each member of a set of origin-specific nucleic acid barcodes, or other nucleic acid identifier or connector oligonucleotide, having identical or matched barcode sequences, may be associated with (for example, covalently bound to or a component of the same molecule as) a distinct or different UMI.


In some embodiments, a nucleic acid identifier (for example, a nucleic acid barcode) may be attached to sequences that allow for amplification and sequencing (for example, SBS3 and P5 elements for Illumina sequencing). In one example embodiment, a nucleic acid barcode can further include a hybridization site for a primer (for example, a single-stranded DNA primer) attached to the end of the barcode. For example, an origin-specific barcode may be a nucleic acid including a barcode and a hybridization site for a specific primer. In particular embodiments, a set of origin-specific barcodes includes a unique primer specific barcode made, for example, using a randomized oligo type NNNNNNNNNNNN.


Target nucleic acids associated origin-specific nucleic acid barcodes (optionally in combination with other nucleic acid barcodes as described herein) can be amplified by methods known in the art, such as polymerase chain reaction (PCR). For example, the nucleic acid barcode can contain universal primer recognition sequences that can be bound by a PCR primer for PCR amplification and subsequent high-throughput sequencing. In one example embodiment, the nucleic acid barcode includes or is linked to sequencing adapters (for example, universal primer recognition sequences) such that the barcode and sequencing adapter elements are both coupled to the target molecule. In particular examples, the sequence of the origin specific barcode is amplified, for example using PCR. In some embodiments, an origin-specific barcode further comprises a sequencing adaptor. In some embodiments, an origin-specific barcode further comprises universal priming sites.


Barcode With Cleavage Sites

In some embodiments, the origin-specific barcode further comprises one or more cleavage sites. In some examples, at least one cleavage site is oriented such that cleavage at that site releases the origin-specific barcode from a substrate, such as a bead, for example a hydrogel bead, to which it is coupled. In some examples, a cleavage site is an enzymatic cleavage site, such an endonuclease site present in a specific nucleic acid sequence. In still other embodiments, a cleavage site is a site of chemical cleavage.


Barcode Adapters

In some embodiments, the target molecule is attached to an origin-specific barcode receiving adapter, such as a nucleic acid. In some examples, the origin-specific barcode receiving adapter comprises an overhang and the origin-specific barcode comprises a sequence capable of hybridizing to the overhang. A barcode receiving adapter is a molecule configured to accept or receive a nucleic acid barcode, such as an origin-specific nucleic acid barcode. For example, a barcode receiving adapter can include a single-stranded nucleic acid sequence (for example, an overhang) capable of hybridizing to a given barcode (for example, an origin-specific barcode), for example, via a sequence complementary to a portion or the entirety of the nucleic acid barcode. In one example embodiment, this portion of the barcode is a standard sequence held constant between individual barcodes. The hybridization couples the barcode receiving adapter to the barcode. In some embodiments, the barcode receiving adapter may be associated with (for example, attached to) a target molecule. As such, the barcode receiving adapter may serve as the means through which an origin-specific barcode is attached to a target molecule. A barcode receiving adapter can be attached to a target molecule according to methods known in the art. For example, a barcode receiving adapter can be attached to a polypeptide target molecule at a cysteine residue (for example, a C-terminal cysteine residue). A barcode receiving adapter can be used to identify a particular condition related to one or more target molecules, such as a cell of origin or a discreet volume of origin. For example, a target molecule can be a cell surface protein expressed by a cell, which receives a cell-specific barcode receiving adapter. The barcode receiving adapter can be conjugated to one or more barcodes as the cell is exposed to one or more conditions, such that the original cell of origin for the target molecule, as well as each condition to which the cell was exposed, can be subsequently determined by identifying the sequence of the barcode receiving adapter/ barcode concatemer.


Other Barcoding Embodiments

Software for DNA barcoding requires integration of a field information management system (FIMS), laboratory information management system (LIMS), sequence analysis tools, workflow tracking to connect field data and laboratory data, database submission tools and pipeline automation for scaling up to eco-system scale projects. Geneious Pro can be used for the sequence analysis components, and the two plugins made freely available through the Moorea Biocode Project, the Biocode LIMS and Genbank Submission plugins handle integration with the FIMS, the LIMS, workflow tracking and database submission.


Adding Poly-Nucleotide Tail Sequence

In one example embodiment, the methods comprise tailing the 3′ end of each first strand cDNA after the reverse transcribing step. In other embodiments, any tail sequence that can be added to the 3′ end of each first strand cDNA can be used and a complementary primer to the tail sequence can be used in second strand synthesis. In an example embodiment, a poly-nucleotide tail is added. In an example embodiment, a poly A, C, T, or G tail is added. In preferred embodiments, a poly-A tail is added. Non-limiting methods of tailing cDNA are known in the art, such as with terminal transferase (TdT). Terminal transferase (TdT) is a template independent polymerase that catalyzes the addition of deoxynucleotides to the 3′ hydroxyl terminus of DNA molecules. Protruding, recessed or blunt-ended double or single-stranded DNA molecules serve as a substrate for TdT. The 58.3 kDa enzyme does not have 5′ or 3′ exonuclease activity. The addition of Co2+ in the reaction makes tailing more efficient. The rate of addition of dNTP’s and thus the length of the tail is a function of the ratio of 3′ DNA ends: dNTP concentration, and also which dNTP is used. In example embodiments, TdT is used to add a poly-A tail. In example embodiments, TdT is used to add a poly-C, -T, or -G tail. In certain embodiments, more than one nucleotide is used to tail the 3′ end, such as by tailing with a first nucleotide, washing out the first nucleotide and a performing an additional TdT reaction with a second nucleotide different from the first.


In one example embodiment, the fixed and permeabilized cells from the plurality of first reaction volumes is pooled into a single tailing reaction volume before adding a tail sequence. In one example embodiment, pooling fixed and permeabilized cells comprises only pooling fixed and permeabilized cells from the same permeabilizing reaction volume into a single tailing reaction volume. In one example embodiment, pooling fixed and permeabilized cells before tailing is optional. In one example embodiment, a set of fixed and permeabilized prokaryotic cells undergoes tailing in a tailing reaction volume comprising 40 million fixed and permeabilized prokaryotic cells and/or 650,000-800,000 fixed and permeabilized prokaryotic cells/µL.


Labeling Each cDNA From the Same Cell With a Unique Barcode

Individual fixed and permeabilized cells comprising the labeled first strand cDNA are then separated into individual discrete volumes where second strand synthesis of cDNA and second round barcoding is conducted in the fixed and permeabilized cells. The second strand cDNA synthesis and second round barcoding results in addition of a second barcode and, optionally, a unique molecular identifier (UMI). For example, the primer sequence including the second barcode can also include a UMI. The second barcode is unique to each individual discrete volume such that all cDNA from the same individual discrete volume receive the same barcode sequence and thus the second barcode in combination with the first barcode can be distinguished as arising from the same individual cell. This is based on the low probability that two cells from the same first reaction volume will be in the same individual discrete second reaction volume.


Individual Discrete Volumes

An “individual discrete volume” is a discrete volume or discrete space, such as a container, receptacle, or other defined volume or space that can be defined by properties that prevent and/or inhibit migration of nucleic acids and reagents necessary to carry out the methods disclosed herein, for example a volume or space defined by physical properties such as walls, for example the walls of a well, tube, or a surface of a droplet, which may be impermeable or semipermeable, or as defined by other means such as chemical, diffusion rate limited, electro-magnetic, or light illumination, or any combination thereof. By “diffusion rate limited” (for example diffusion defined volumes) is meant spaces that are only accessible to certain molecules or reactions because diffusion constraints effectively defining a space or volume as would be the case for two parallel laminar streams where diffusion will limit the migration of a target molecule from one stream to the other. By “chemical” defined volume or space is meant spaces where only certain target molecules can exist because of their chemical or molecular properties, such as size, where for example gel beads may exclude certain species from entering the beads but not others, such as by surface charge, matrix size or other physical property of the bead that can allow selection of species that may enter the interior of the bead. By “electro-magnetically” defined volume or space is meant spaces where the electro-magnetic properties of the target molecules or their supports such as charge or magnetic properties can be used to define certain regions in a space such as capturing magnetic particles within a magnetic field or directly on magnets. By “optically” defined volume is meant any region of space that may be defined by illuminating it with visible, ultraviolet, infrared, or other wavelengths of light such that only target molecules within the defined space or volume may be labeled. One advantage to the used of non-walled, or semipermeable is that some reagents, such as buffers, chemical activators, or other agents maybe passed in through the discrete volume, while other material, such as target molecules, maybe maintained in the discrete volume or space. Typically, a discrete volume will include a fluid medium, (for example, an aqueous solution, an oil, a buffer, and/or a media capable of supporting cell growth) suitable for labeling of the target molecule with the indexable nucleic acid identifier under conditions that permit labeling. Exemplary discrete volumes or spaces useful in the disclosed methods include droplets (for example, microfluidic droplets and/or emulsion droplets), hydrogel beads or other polymer structures (for example poly-ethylene glycol di-acrylate beads or agarose beads), tissue slides (for example, fixed formalin paraffin embedded tissue slides with particular regions, volumes, or spaces defined by chemical, optical, or physical means), microscope slides with regions defined by depositing reagents in ordered arrays or random patterns, tubes (such as, centrifuge tubes, microcentrifuge tubes, test tubes, cuvettes, conical tubes, and the like), bottles (such as glass bottles, plastic bottles, ceramic bottles, Erlenmeyer flasks, scintillation vials and the like), wells (such as wells in a plate), plates, pipettes, or pipette tips among others. In certain example embodiments, the individual discrete volumes are the wells of a microplate. In certain example embodiments, the microplate is a 96 well, a 384 well, or a 1536 well microplate.


In one example embodiment, at least one fixed and permeabilized cell is separated into each second reaction volume. In one example embodiment, at least two or more fixed and permeabilized cells are separated into each second reaction volume. In one example embodiment, at least one, at least two, at least three, at least four, at least five, or at least six fixed and permeabilized cells are separated into each second reaction volume. In one example embodiment, one, two, three, four, five, six, seven, eight, nine, or ten fixed and permeabilized cells are separated into each second reaction volume. In preferred embodiments, about six fixed and permeabilized cells are separated into each second reaction volume (e.g., 5, 6, 7 cells). In one example embodiment, there is a Poisson distribution of numbers of cells in each second reaction volume, but the parameter λ, (the expected rate of occurrences), which is usually 0.1-0.3 in traditional drop-seq and 10x single-cell sequencing, is increased to >1 to 10, or even higher depending on the number of first cell barcodes in the first reaction volume (e.g., 384 first cell barcodes). In probability theory and statistics, the Poisson distribution is a discrete probability distribution that expresses the probability of a given number of events occurring (index k) in a fixed interval of time or space if these events occur with a known constant mean rate λ, (the expected rate of occurrences) and independently of the time since the last event. The average cell number in each second reaction volume is the same as λ. In one example embodiment, the number of cells in the second reaction volume is not limited to 6. In one example embodiment, there are 3-6 cells in the second reaction volume, which have a low barcode collision rate when there are 384 first cell barcodes. Barcode collision rate refers to the rate that two single cells acquire the same first and second cell barcodes. In one example embodiment, there are more than 384 first cell barcodes and there are more than 6 cells on average per second reaction volume. In one example embodiment, each second reaction volume does not comprise a Poisson distribution, such that each second reaction volume receives the same number of cells.


In one example embodiment, second reaction volumes are droplets. In one example embodiment, second reaction volumes are aqueous in oil droplets. In one example embodiment, second reaction volumes are microwells.


In example embodiments, each second reaction volume also includes approximately one or less barcoded bead that is conjugated to a plurality of capture oligonucleotides comprising the second barcode sequence, such that each bead includes a second barcode sequence. The loading of 1 or less bead ensures that single cells are not double barcoded or that each single cell receives the same barcode. The second barcode sequence is the same for all capture oligonucleotides on the same bead, but differ from capture oligonucleotides on any other bead. In other words, all capture oligonucleotides on the bead will share the same barcode, which is unique to that individual bead and distinct from the barcode on any other bead. In one example embodiment, each capture oligonucleotide comprises from 5′ to 3′ a second cell barcode sequence and a capture sequence capable of hybridizing to second strand cDNA and priming linear amplification. In one example embodiment, each bead comprises a plurality of capture oligonucleotides attached 5′ to the bead surface. In one example embodiment, each capture oligonucleotide comprises a barcode sequence that is the same for all capture oligonucleotides on a same bead but differs from the barcode sequence of capture oligonucleotides on other beads. In one example embodiment, each capture oligonucleotide comprises a capture sequence that is the same as a 5′ primer binding sequence in each RT primer. Thus, in one example embodiment, beads are delivered to individual discrete second reaction volumes with fixed and permeabilized prokaryotic cells comprising first strand cDNA (e.g., 1-6 cells). In one example embodiment, the capture oligonucleotides comprise a UMI sequence.


In one example embodiment, the beads are 10X Gel Beads from a Chromium Next GEM Single Cell ATAC Library & Gel Bead Kit (10x Genomics) and the capture oligonucleotides are the (i) partial Illumina Read 1(R1) sequence (22 bp) and (ii) the 16 bp 10x Barcode on the surface of each 10X Gel Bead. The 10x Barcode sequence is unique to each Gel Bead.


The formation of droplets with single beads is used for known methods of single cell sequencing of mammalian cells. Similar or the same microfluidic devices can be used for segregating fixed and permeabilized microbial cells into droplets or microwells. In example embodiments, flow rates and bead concentrations can use standard flow rates and concentrations such that each droplet receives about 1 or no bead. The flow rate for the channel introducing the microbial cells can be the same or adjusted such that each droplet receives about 1 to 6 microbial cells. In an example embodiment, the concentration of microbial cells introduced to the microbial system is used to control for the number of cells in each droplet. Exemplary microfluidic systems for single cell RNA sequencing applicable to the present invention are described and include Macosko et al., 2015, “Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets” Cell 161, 1202-1214; International patent application number PCT/US2015/049178, published as WO2016/040476 on Mar. 17, 2016; Klein et al., 2015, “Droplet Barcoding for Single-Cell Transcriptomics Applied to Embryonic Stem Cells” Cell 161, 1187-1201; International patent application number PCT/US2016/027734, published as WO2016168584A1 on Oct. 20, 2016; Zheng, et al., 2016, “Haplotyping germline and cancer genomes with high-throughput linked-read sequencing” Nature Biotechnology 34, 303-311; Zheng, et al., 2017, “Massively parallel digital transcriptional profiling of single cells” Nat. Commun. 8, 14049 doi: 10.1038/ncomms14049; International patent publication number WO2014210353A2; Zilionis, et al., 2017, “Single-cell barcoding and sequencing using droplet microfluidics” Nat Protoc. Jan;12(1):44-73; Habib et al., 2016, “Div-Seq: Single-nucleus RNA-Seq reveals dynamics of rare adult newborn neurons” Science, Vol. 353, Issue 6302, pp. 925-928; Habib et al., 2017, “Massively parallel single-nucleus RNA-seq with DroNc-seq” Nat Methods. 2017 Oct;14(10):955-958; International patent application number PCT/US2016/059239, published as WO2017164936 on Sep. 28, 2017; International patent application number PCT/US2018/060860, published as WO/2019/094984 on May 16, 2019; International patent application number PCT/US2019/055894, published as WO/2020/077236 on Apr. 16, 2020; and Drokhlyansky, et al., “The enteric nervous system of the human and mouse colon at a single-cell resolution,” bioRxiv 746743.


In an exemplary embodiment, single beads are distributed to microwells and the microbial cells are separated into the microwells (see, e.g., Gierahn et al., “Seq-Well: portable, low-cost RNA sequencing of single cells at high throughput” Nature Methods 14, 395-398 (2017); and Hughes, et al., “Highly Efficient, Massively-Parallel Single-Cell RNA-Seq Reveals Cellular States and Molecular Features of Human Skin Pathology” bioRxiv 689273; doi: doi.org/10.1101/689273). In exemplary embodiments, the microwell can only accommodate a single bead and the dilution of the microbial cells can be used to obtain the desired number of microbial cells per microwell. The microwells may accommodate more than one microbial cell (e.g., about 6).


Conducting Second Strand cDNA Synthesis and Second Barcoding

Second strand cDNA synthesis is accomplished in each discrete second reaction volume by amplification. Non-limiting examples of amplification are known in the art. In one example embodiment, second strand cDNA synthesis is accomplished by linear amplification. Linear amplification generally refers to a method that involve the formation of one or more copies of the complement of only one strand of a nucleic acid or polynucleotide molecule, usually a nucleic acid or polynucleotide analyte. Thus, the primary difference between linear amplification and exponential amplification is that in the latter process, the product serves as substrate for the formation of more product, whereas in the former process the starting sequence is the substrate for the formation of product but the product of the reaction, i.e., the replication of the starting template, is not a substrate for generation of products. In linear amplification the amount of product formed increases as a linear function of time as opposed to exponential amplification where the amount of product formed is an exponential function of time. The methods of the invention generally incorporate single primer isothermal amplification (SPIA). SPIA is an isothermal amplification method described, for example, in U.S. Pat. Nos. 6,692,918, 6,251,639, 6,946,251 and 7,354,717. The primer used in the second strand cDNA synthesis is selected based on its ability to hybridize to the tail sequence added during first strand cDNA synthesis above. Thus, if a specific primer binding the tail sequence was added to the first cDNA strand, the primer selected for second strand cDNA synthesis will be able to hybridize to and prime the second strand synthesis. If a poly-A tail was added during the first strand cDNA synthesis, then a poly-T primer may be used to prime the second strand synthesis. The first strand cDNA includes a primer binding site (PBS) provided by the RT primer above. Second strand synthesis generates a second strand DNA that includes the reverse complement of the PBS. The PBS of the second strand cDNA is now available for hybridization with a sequence including the PBS.


In one example embodiment, the beads provided to each discrete second reaction volume comprise a capture oligonucleotide sequence comprising the primer binding sequence (PBS), thus allowing hybridization to the second strand cDNA for priming linear amplification. In one example embodiment, the second strand cDNA is captured by the capture oligonucleotides on the bead in the second reaction volume and the cDNA is amplified by linear amplification to generate cDNA that includes a first and second cell barcode and a UMI sequence.


In another exemplary embodiment, the beads can include capture oligonucleotides with the reverse complement of the PBS as the capture sequence. In this embodiment, first strand cDNA is directly captured by the capture oligonucleotide and extended by linear amplification to generate barcoded second strand cDNA. This second strand cDNA can be further amplified to generate the cDNA for sequencing.


Preparing a Sequencing Library

In one example embodiment, methods further comprise preparing a sequencing library. In certain aspects, a sequencing library comprises amplified labeled cDNA. In one example embodiment, a single cell cDNA library is prepared. Methods for constructing sequencing libraries are known in the art (see, e.g., Head et al., Library construction for next-generation sequencing: Overviews and challenges. Biotechniques. 2014; 56(2): 61-77; Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K. & Regev, A. Preparation of Single-Cell RNA-Seq Libraries for Next Generation Sequencing. Curr Protoc Mol Biol. 107, 4 22 21-24 22 17, doi:10.1002/0471142727.mb0422s107 (2014). PMCID:4338574). A “library” or “fragment library” may be a collection of nucleic acid molecules derived from one or more nucleic acid samples, in which fragments of nucleic acid have been modified, generally by incorporating terminal adapter sequences comprising one or more primer binding sites and identifiable sequence tags. In certain embodiments, the library members (e.g., genomic DNA, cDNA) may include sequencing adaptors that are compatible with use in, e.g., Illumina’s reversible terminator method, long read nanopore sequencing, Roche’s pyrosequencing method (454), Life Technologies’ sequencing by ligation (the SOLiD platform) or Life Technologies’ Ion Torrent platform. Examples of such methods are described in the following references: Margulies et al (Nature 2005 437: 376-80); Schneider and Dekker (Nat Biotechnol. 2012 Apr 10;30(4):326-8); Ronaghi et al (Analytical Biochemistry 1996 242: 84-9); Shendure et al (Science 2005 309: 1728-32); Imelfort et al (Brief Bioinform. 2009 10:609-18); Fox et al (Methods Mol. Biol. 2009; 553:79-108); Appleby et al (Methods Mol. Biol. 2009; 513:19-39); and Morozova et al (Genomics. 2008 92:255-64), which are incorporated by reference for the general descriptions of the methods and the particular steps of the methods, including all starting products, reagents, and final products for each of the steps.


In one example embodiment, a sequencing library is able to distinguish species heterogeneity, strain heterogeneity, genotypic heterogeneity and/or phenotypic heterogeneity of the plurality of prokaryotic cells. In one example embodiment, a sequencing library is able to distinguish species heterogeneity, strain heterogeneity, genotypic heterogeneity and/or phenotypic heterogeneity of one or more uncharacterized organisms, an environmental microbiome, or an organismal microbiome. In one example embodiment, a sequencing library can distinguish phenotypic heterogeneity in the response of the plurality of prokaryotic cells to one or more drug treatments. In one example embodiment, a sequencing library can distinguish phenotypic heterogeneity in the response of the plurality of prokaryotic cells to one or more antibiotic treatments.


Perturbation and Library Screening

The methods of single prokaryotic cell analysis can be utilized for evaluating environmental stress and/or state, for screening of chemical libraries, and to screen or identify structural, syntenic, genomic, and/or organism and species variations. Aspects of the present disclosure relate to the correlation of an environmental stress or state with the gene expression profile in a sample of cells, for example a culture of cells, can be exposed to an environmental stress, such as but not limited to heat shock, osmolarity, hypoxia, cold, oxidative stress, radiation, starvation, a chemical (for example a therapeutic agent or potential therapeutic agent, such as an antibiotic) and the like. After the stress is applied, a representative sample can be subjected to analysis, for example at various time points, and compared to a control, such as a sample from an organism or cell, for example a cell from an organism, or a standard value.


In some embodiments, the disclosed methods can be used to screen chemical libraries for agents that modulate gene expression profiles, and/or relationships thereof. By exposing prokaryotic cells to different members of the chemical libraries, and performing the methods described herein, different members of a chemical library can be screened for their effect on gene expression profiles, and/or relationships thereof simultaneously in a relatively short amount of time, for example using a high throughput method.


In some embodiments, screening of test agents involves testing a combinatorial library containing a large number of potential modulator compounds. A combinatorial chemical library may be a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical “building blocks” such as reagents. For example, a linear combinatorial chemical library, such as a polypeptide library, is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (for example the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.


Screening for Modulating Agents

A further aspect of the invention relates to a method for identifying an agent capable of modulating one or more phenotypic aspects of a cell or cell population as disclosed herein, comprising: a) applying a candidate agent to the cell or cell population; b) detecting modulation of one or more phenotypic aspects of the cell or cell population by the candidate agent, thereby identifying the agent. The phenotypic aspects of the cell or cell population that is modulated may be a gene signature or biological program specific to a cell type or cell phenotype or phenotype specific to a population of cells (e.g., antibiotic resistance). In one example embodiment, steps can include administering candidate modulating agents to cells, detecting identified cell (sub)populations for changes in signatures, or identifying relative changes in cell (sub) populations which may comprise detecting relative abundance of particular gene signatures.


The term “modulate” broadly denotes a qualitative and/or quantitative alteration, change or variation in that which is being modulated. Where modulation can be assessed quantitatively – for example, where modulation comprises or consists of a change in a quantifiable variable such as a quantifiable property of a cell or where a quantifiable variable provides a suitable surrogate for the modulation – modulation specifically encompasses both increase (e.g., activation) or decrease (e.g., inhibition) in the measured variable. The term encompasses any extent of such modulation, e.g., any extent of such increase or decrease, and may more particularly refer to statistically significant increase or decrease in the measured variable. By means of example, modulation may encompass an increase in the value of the measured variable by at least about 10%, e.g., by at least about 20%, preferably by at least about 30%, e.g., by at least about 40%, more preferably by at least about 50%, e.g., by at least about 75%, even more preferably by at least about 100%, e.g., by at least about 150%, 200%, 250%, 300%, 400% or by at least about 500%, compared to a reference situation without said modulation; or modulation may encompass a decrease or reduction in the value of the measured variable by at least about 10%, e.g., by at least about 20%, by at least about 30%, e.g., by at least about 40%, by at least about 50%, e.g., by at least about 60%, by at least about 70%, e.g., by at least about 80%, by at least about 90%, e.g., by at least about 95%, such as by at least about 96%, 97%, 98%, 99% or even by 100%, compared to a reference situation without said modulation. Preferably, modulation may be specific or selective, hence, one or more desired phenotypic aspects of an immune cell or immune cell population may be modulated without substantially altering other (unintended, undesired) phenotypic aspect(s).


The term “agent” broadly encompasses any condition, substance or agent capable of modulating one or more phenotypic aspects of a cell or cell population as disclosed herein. Such conditions, substances or agents may be of physical, chemical, biochemical and/or biological nature. The term “candidate agent” refers to any condition, substance or agent that is being examined for the ability to modulate one or more phenotypic aspects of a cell or cell population as disclosed herein in a method comprising applying the candidate agent to the cell or cell population (e.g., exposing the cell or cell population to the candidate agent or contacting the cell or cell population with the candidate agent) and observing whether the desired modulation takes place.


Agents may include any potential class of biologically active conditions, substances or agents, such as for instance antibodies, proteins, peptides, nucleic acids, oligonucleotides, small molecules, or combinations thereof, as described herein.


In some embodiments, screening of test agents involves testing a combinatorial library containing a large number of potential modulator compounds. A combinatorial chemical library may be a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical “building blocks” such as reagents. For example, a linear combinatorial chemical library, such as a polypeptide library, is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (for example the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.


In one example embodiment, the present invention provides for gene signature screening. The concept of signature screening was introduced by Stegmaier et al. (Gene expression-based high-throughput screening (GE-HTS) and application to leukemia differentiation. Nature Genet. 36, 257-263 (2004)), who realized that if a gene-expression signature was the proxy for a phenotype of interest, it could be used to find small molecules that effect that phenotype without knowledge of a validated drug target. Prokaryotic cell gene signatures or biological programs may be identified using the present invention. Prokaryotic cell gene signatures or biological programs may be used to screen for drugs that reduce the signature or biological program in cells as described herein. The signature or biological program may be used for GE-HTS. In one example embodiment, pharmacological screens may be used to identify drugs that are selectively toxic to cells having a signature.


Perturb-seq

In one example embodiment, the gene signatures and gene networks are identified by perturbation of target genes within said prokaryotic cells. Methods and tools for genome-scale screening of perturbations in single cells using CRISPR-Cas9 have been described, herein referred to as perturb-seq (see e.g., Dixit et al., “Perturb-Seq: Dissecting Molecular Circuits with Scalable Single-Cell RNA Profiling of Pooled Genetic Screens” 2016, Cell 167, 1853-1866; Adamson et al., “A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response” 2016, Cell 167, 1867–1882; Feldman et al., Lentiviral co-packaging mitigates the effects of intermolecular recombination and multiple integrations in pooled genetic screens, bioRxiv 262121, doi: doi.org/10.1101/262121; Datlinger, et al., 2017, Pooled CRISPR screening with single-cell transcriptome readout. Nature Methods. Vol.14 No.3 DOI: 10.1038/nmeth.4177; Hill et al., On the design of CRISPR-based single cell molecular screens, Nat Methods. 2018 Apr; 15(4): 271-274; Replogle, et al., “Combinatorial single-cell CRISPR screens by direct guide RNA capture and targeted sequencing” Nat Biotechnol (2020). doi.org/10.1038/s41587-020-0470-y; Schraivogel D, Gschwind AR, Milbank JH, et al. “Targeted Perturb-seq enables genome-scale genetic screens in single cells”. Nat Methods. 2020;17(6):629-635; Frangieh CJ, Melms JC, Thakore PI, et al. Multimodal pooled Perturb-CITE-seq screens in patient models define mechanisms of cancer immune evasion. Nat Genet. 2021;53(3):332-341; and International publication serial number WO/2017/075294). The present invention is compatible with perturb-seq, such that prokaryotic genes may be perturbed and the perturbation may be identified and assigned to the gene expression readouts of single cells. In one example embodiment, the perturbation and barcode sequence is expressed from a bacterial promoter and does not require polyadenylated RNAs. In one example embodiment, signature genes may be perturbed in single cells and gene expression analyzed. Not being bound by a theory, networks of genes that are disrupted due to perturbation of a gene may be determined. Understanding the network of genes effected by a perturbation may allow for a gene to be linked to a specific pathway that may be targeted to modulate the signature and treat a disease. Thus, in one example embodiment, perturb-seq is used to discover novel drug targets to allow treatment of specific bacterial infections.


The perturbation methods and tools allow reconstructing of a cellular network or circuit. In one embodiment, the method comprises (1) introducing single-order or combinatorial perturbations to a population of cells, (2) measuring genomic, genetic, proteomic, epigenetic and/or phenotypic differences in single cells and (3) assigning a perturbation(s) to the single cells. Not being bound by a theory, a perturbation may be linked to a phenotypic change, preferably changes in gene or protein expression. In preferred embodiments, measured differences that are relevant to the perturbations are determined by applying a model accounting for co-variates to the measured differences. The model may include the capture rate of measured signals, whether the perturbation actually perturbed the cell (phenotypic impact), the presence of subpopulations of either different cells or cell states, and/or analysis of matched cells without any perturbation. In one example embodiment, the measuring of phenotypic differences and assigning a perturbation to a single cell is determined by performing single prokaryotic cell RNA sequencing as described herein. In one example embodiment, a guide RNA is detected by RNA-seq using a transcript expressed from a vector encoding the guide RNA. The transcript may include a unique barcode specific to the guide RNA. Not being bound by a theory, a guide RNA and guide RNA barcode is expressed from the same vector and the barcode may be detected by RNA-seq. Not being bound by a theory, detection of a guide RNA barcode is more reliable than detecting a guide RNA sequence, reduces the chance of false guide RNA assignment and reduces the sequencing cost associated with executing these screens. Thus, a perturbation may be assigned to a single cell by detection of a guide RNA barcode in the cell. In one example embodiment, a cell barcode is added to the RNA in single cells, such that the RNA may be assigned to a single cell. Generating cell barcodes is described herein for single cell sequencing methods. In one example embodiment, a Unique Molecular Identifier (UMI) is added to each individual transcript. Not being bound by a theory, the UMI allows for determining the capture rate of measured signals or the number of transcripts captured.


In one example embodiment, other CRISPR-based perturbations are readily compatible with Perturb-seq, including alternative editors such as CRISPR/Cpf1. In one example embodiment, Perturb-seq uses Cpf1 as the CRISPR enzyme for introducing perturbations. Not being bound by a theory, Cpf1 does not require Tracr RNA and is a smaller enzyme, thus allowing higher combinatorial perturbations to be tested.


In one embodiment, perturbation is by deletion of regulatory elements. Non-coding elements may be targeted by using pairs of guide RNAs to delete regions of a defined size, and by tiling deletions covering sets of regions in pools.


In one example embodiment, whole genome screens can be used for understanding the phenotypic readout of perturbing potential target genes. In preferred embodiments, perturbations target expressed genes as defined by a gene signature using a focused sgRNA library. Libraries may be focused on expressed genes in specific networks or pathways. In other preferred embodiments, regulatory drivers are perturbed. Applicants can use gene expression profiling data to define the target of interest and perform follow-up single-cell and population RNA-seq analysis.


The invention is further described by the following numbered paragraphs:

  • 1. A method of generating a single microbial cell cDNA library, wherein the RNAs from different microbial cells are barcoded individually, allowing the cell identity of each RNA to be retained in a single library, the method comprising:
    • a. fixing each cell of a plurality of microbial cells within one or more first reaction volumes;
    • b. permeabilizing each fixed cell within one or more second reaction volumes;
    • c. degrading ribosomal RNA (rRNA) in each fixed and permeabilized cell, wherein at least a portion of the rRNA in each cell is degraded;
    • d. degrading DNA in each fixed and permeabilized cell, wherein at least a portion of the DNA in each cell is degraded;
    • e. segregating at least a portion of or all of the fixed and permeabilized cells into separate third reaction volumes, each third reaction volume comprising RT primers, wherein each third reaction volume comprises one or more of the fixed and permeabilized cells, and wherein each RT primer comprises (i) a 5′ primer binding sequence (PBS) (ii) a first barcode sequence that is the same for all primers in the same third reaction volume but differs from the barcode sequence of primers in any other third reaction volume, and (iii) a unique molecular identifier (UMI) sequence that is different for each primer in a third reaction volume;
    • f. reverse transcribing the remaining RNA in each fixed and permeabilized cell using the RT primers to produce labeled individual first strand cDNA;
    • g. adding a common priming sequence to the 3′ end of the first strand cDNA in each fixed and permeabilized cell;
    • h. merging one or more of the fixed and permeabilized cells and a single bead into separate fourth reaction volumes comprising a plurality of primers capable of hybridizing to the common priming sequence added in step (g), wherein each bead comprises a plurality of capture oligonucleotides attached 5′ to the bead surface, each capture oligonucleotide comprising (i) a second barcode sequence that is the same for all capture oligonucleotides on the same bead but differs from the barcode sequence of capture oligonucleotides on other beads and (ii) a capture sequence that is the same as the 5′ primer binding sequence (PBS) in each RT primer;
    • i. hybridizing the primers added at step (h) to the common priming sequence added at the 3′ end of the 1st strand cDNA in the fixed and permeabilized cells in the separate fourth reaction volumes;
    • j. generating 2nd strand cDNA by linear amplification using the primers hybridized to the common priming sequence added at the 3′ end of the 1st strand cDNA;
    • k. generating cDNA comprising the bead barcode sequence by amplifying the 2nd strand cDNA using the capture sequence on the capture oligonucleotides attached to the bead to prime linear amplification; and
    • 1. pooling the cDNA from the separate fourth reaction volumes, whereby a library of cDNA comprising a second barcode, UMI and first barcode is obtained.
  • 2. The method of paragraph 1, wherein 10 billion microbial cells or less are fixed in each of the first reaction volumes.
  • 3. The method of paragraph 1 or 2, wherein 40 million fixed cells or less are permeabilized in each of the second reaction volumes.
  • 4. The method of any of paragraphs 1 to 3, wherein about 1,000 to 1 million fixed and permeabilized cells are segregated into the separate third reaction volumes.
  • 5. The method of paragraph 4, wherein at least 10,000 fixed and permeabilized cells are segregated into the separate third reaction volumes.
  • 6. The method of paragraph 4, wherein at least 30,000 fixed and permeabilized cells are segregated into the separate third reaction volumes comprise.
  • 7. The method of paragraph 4, wherein at least 140,000 fixed and permeabilized cells are segregated into the separate third reaction volumes.
  • 8. The method of any of paragraphs 1 to 7, wherein mRNA accounts for more than 5%, more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, or more than 80% of total aligned reads.
  • 9. The method of any of paragraphs 1 to 8, wherein the mean mRNA UMI per cell is more than 25, more than 35, more than 45, more than 55, or more than 65.
  • 10. The method of any of paragraphs 1 to 9, wherein the fixing step is accomplished by addition of formaldehyde or paraformaldehyde.
  • 11. The method of any of paragraphs 1 to 10, wherein the permeabilizing step comprises treatment with ethanol, detergent and/or lysozyme.
  • 12. The method of any of paragraphs 1 to 11, wherein the degrading rRNA step is accomplished by addition of rRNA selective DNA probes and RNase H.
  • 13. The method of any of paragraphs 1 to 12, wherein the degrading DNA step is accomplished by addition of DNase I.
  • 14. The method of any of paragraphs 1 to 13, wherein the common priming sequence is a poly A sequence, such as SMRT_dT.
  • 15. The method of paragraph 14, wherein the polyA sequence is added by a Terminal Transferase (TdT).
  • 16. The method of any of paragraphs 1 to 15, wherein the method further comprises a lysing step accomplished by heating at about 98° C. for 2 minutes in the fourth reaction volume.
  • 17. The method of any of paragraphs 1 to 16, wherein each third reaction volume is a microwell.
  • 18. The method of any of paragraphs 1 to 17, wherein each fourth reaction volume can be loaded with multiple fixed and permeabilized cells.
  • 19. The method of any of paragraphs 1 to 18, wherein each fourth reaction volume comprises one, two, three, four, five, six, or seven fixed and permeabilized cells.
  • 20. The method of any of paragraphs 1 to 19, wherein each fourth reaction volume is an aqueous in oil droplet.
  • 21. The method of any of paragraphs 1 to 20, wherein the bead material is a hydrogel, polystyrene, methylstyrene, acrylic polymer, paramagnetic material, ceramic, plastic, glass, titanium, latex, sepharose, cellulose, or nylon.
  • 22. The method of paragraph 21, wherein the bead material is methacrylate resin.
  • 23. The method of any of paragraphs 1 to 20, wherein the droplets are formed by a microfluidic device configured for merging microbial cells and beads into aqueous in oil droplets.
  • 24. The method of any of paragraphs 1 to 23, wherein the plurality of microbial cells comprises cells from one or more bacterial species selected from the group consisting of an Acinetobacter species, an Actinobacillus species, an Actinomycetes species, an Actinomyces species, Aerococcus species an Aeromonas species, an Anaplasma species, an Alcaligenes species, a Bacillus species, a Bacteroides species, a Bartonella species, a Bifidobacterium species, a Bordetella species, a Borrelia species, a Brucella species, a Burkholderia species, a Campylobacter species, a Capnocytophaga species, a Chlamydia species, a Citrobacter species, a Coxiella species, a Corynbacterium species, a Clostridium species, an Eikenella species, an Enterobacter species, an Escherichia species, an Enterococcus species, an Ehlichia species, an Epidermophyton species, an Erysipelothrix species, a Eubacterium species, a Francisella species, a Fusobacterium species, a Gardnerella species, a Gemella species, a Haemophilus species, a Helicobacter species, a Kingella species, a Klebsiella species, a Lactobacillus species, a Lactococcus species, a Listeria species, a Leptospira species, a Legionella species, a Leptospira species, Leuconostoc species, a Mannheimia species, a Microsporum species, a Micrococcus species, a Moraxella species, a Morganell species, a Mobiluncus species, a Micrococcus species, Mycobacterium species, a Mycoplasm species, a Nocardia species, a Neisseria species, a Pasteurelaa species, a Pediococcus species, a Peptostreptococcus species, a Pityrosporum species, a Plesiomonas species, a Prevotella species, a Porphyromonas species, a Proteus species, a Providencia species, a Pseudomonas species, a Propionibacteriums species, a Rhodococcus species, a Rickettsia species, a Rhodococcus species, a Serratia species, a Stenotrophomonas species, a Salmonella species, a Serratia species, a Shigella species, a Staphylococcus species, a Streptococcus species, a Spirillum species, a Streptobacillus species, a Treponema species, a Tropheryma species, a Trichophyton species, an Ureaplasma species, a Veillonella species, a Vibrio species, a Yersinia species, and a Xanthomonas species.
  • 25. The method of any of paragraphs 1 to 24, wherein the plurality of microbial cells comprise cells from one or more bacterial species selected from the group consisting of Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Enterococcus faecium.
  • 26. The method of any of paragraphs 1 to 25, wherein the plurality of microbial cells comprise one or more uncharacterized organisms, an environmental microbiome, or an organismal microbiome.
  • 27. The method of any of paragraphs 1 to 26, wherein the method can distinguish species heterogeneity, strain heterogeneity, genotypic heterogeneity and/or phenotypic heterogeneity of the plurality of microbial cells.
  • 28. The method of any of paragraphs 1 to 27, wherein the method can distinguish phenotypic heterogeneity in the response of the plurality of microbial cells to one or more drug treatments.
  • 29. The method of any of paragraphs 1 to 28, wherein the method can distinguish phenotypic heterogeneity in the response of the plurality of microbial cells to one or more antibiotic treatments.
  • 30. The method of any of paragraphs 1 to 29, wherein the plurality of microbial cells is a biological sample obtained from a subject.


Further embodiments are illustrated in the following Examples which are given for illustrative purposes only and are not intended to limit the scope of the invention.


EXAMPLES
Example 1 -BacDrop: Droplet-Based, High Throughput Technology for Bacterial Single-Cell RNA Sequencing (scRNA-Seq)

Heterogeneity plays critical roles in bacterial survival and evolution. While single-cell RNA sequencing (scRNA-seq) has revolutionized the study of cellular heterogeneity in eukaryotic biology and disease, its application to bacteria is still limited due to technical and biological challenges. Here Applicants introduce BacDrop, a bacterial droplet-based high throughput scRNA-seq technology that has overcome many of these challenges. BacDrop has the flexibility to be applied to a range of cell numbers, from thousands to millions, and across both gram-negative and gram- positive bacterial species. It features universal ribosomal RNA depletion and combinatorial barcodes that enable multiplexing. Applicants applied BacDrop to study Klebsiella pneumoniae clinical isolates and to elucidate their critical, heterogenous responses to antibiotic stress. In an unperturbed population previously presumed to be homogenous, Applicants find within population heterogeneity, with subpopulations defined on a genome-wide level, driven largely by expression of mobile genetic elements. In the dynamic setting after antibiotic perturbation, BacDrop revealed transcriptionally distinct subpopulations previously masked by bulk analysis, that are associated with different phenotypic outcomes including decreased antibiotic efficacy and persister formation. BacDrop thus enables the detection of within population heterogeneity and critical transcriptional states that cannot be detected using bulk RNA-seq, especially when performed on large numbers of cells. Importantly, BacDrop can enable new microbiological insights, including characterizations of subpopulations within a larger community such as the microbiome or understanding of heterogenous responses to perturbation such as environmental stress, encounters with a host, residence in a biofilm, or antibiotic exposure.


Here Applicants report the development and application of BacDrop, a droplet-based high throughput bacterial scRNA-seq technology. BacDrop can investigate millions of single bacterial cells simultaneously, without requiring prior knowledge of the genome or probe-design. Due to the paucity of mRNA content in a single bacterial cell and the extremely low fraction of cells in a population that account for phenomena such as persistence or heteroresistance1,6,12,13, a larger number of cells are needed for single-cell analysis to confidently assess differential expression and to identify rare populations, depending on the prevalence of the phenomenon of interest. In addition, if applied to samples with high complexity and diversity, such as microbiota samples that usually contains hundreds of species, large numbers of cells are critical to ensure the capture of enough cells from each species. BacDrop also includes a universal and efficient rRNA-depletion step, reducing sequencing costs by at least ten-fold, thus enabling higher throughput studies. Furthermore, Applicants demonstrated that BacDrop works on a variety of bacterial species, including the gram-negative Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and the gram-positive bacterium Enterococcus faecium.


Applicants applied BacDrop to determine any within population heterogeneity of K.pneumoniae and characterize its responses to antibiotics. K.pneumoniae is a gram-negative pathogen which has become one of the leading threats in the antibiotic resistance crisis, with increasing numbers of strains resistant to carbapenems, the last-resort antibiotic used to treat the most resistant infections14. Under stable and dynamic conditions, with and without antibiotic perturbations, Applicants identified important new features of heterogeneity that has heretofore been masked by bulk analysis in K.pneumoniae clinical isolates. In the absence of antibiotic perturbation, Applicants found within population heterogeneity driven predominantly by mobile genetic elements (MGEs), thus demonstrating novel subpopulation structure in a previously presumed homogenous population. Applicants then measured the transcriptional response of a K.pneumoniae clinical isolate after perturbation with antibiotics and found heterogenous responses on the single-cell level. After antibiotic perturbation, BacDrop revealed transcriptionally distinct subpopulations previously masked by bulk analysis that are associated with different phenotypic outcomes including decreased antibiotic efficacy and persister formation. Specifically, a diverse range of stress responses was induced in different subpopulations rather than inducing a single or uniform response in all cells after specific antibiotic exposure. For example, after treatment by the carbapenem antibiotic meropenem, cspD, a DNA/RNA binding toxin that inhibits DNA replication and induces persister formation15,16, was highly expressed in a subpopulation of K.pneumoniae. Importantly, meropenem had reduced efficacy in this subpopulation, which was enriched for persisters, thereby demonstrating the potential functional importance of these subpopulations. With this demonstration of the power of BacDrop to illuminate heterogeneity both in static bacterial populations and their dynamic responses to perturbations, Applicants propose that BacDrop has the potential to transform Applicants’ understanding of bacterial survival, adaptation, and evolution, with numerous potential applications including the characterization of complex communities.


Results
BacDrop: A Bacterial Droplet-based High Throughput scRNA-seq Technology

Applicants developed BacDrop based on droplet technology, which has the advantage of achieving much higher throughput than plate-based technologies, leveraging the 10x Genomics™ platform, a reliable and commercially available droplet-based platform for scRNA-seq. Two of the unique features of bacteria compared to mammalian cells are the challenge of lysing the bacterial cell wall, which requires harsher lysis conditions, while preserving RNA integrity, and the absence of mRNA polyadenylated tails, thus requiring an alternative approach to isolate mRNA (~5%) from the vastly more abundant rRNA (~95%). To overcome these problems, Applicants adapted a previously reported cell fixation and permeabilization protocol prior to droplet encapsulation to avoid cell lysis7,9, and implemented universal rRNA and genomic DNA (gDNA) depletion steps within the permeabilized, fixed cell using RNase H and DNase I, respectively (FIG. 1A, FIGS. 5A-C).


Droplet-based single cell approaches require Poisson loading at mean droplet occupancy values (λ) far less than 1 to ensure that multiple cells are not encapsulated within a single droplet17 and thus do not share the same barcode. Because of this low occupancy value, Poisson loading limits numbers of cells that can be loaded in each microfluidic channel. To avoid this problem, Applicants utilized a multi-step barcoding strategy wherein cells are uniquely identified using the combination of two barcodes: a “plate barcode” (CB 1) as a pre-indexing step corresponding to one of a possible 384 different barcodes, and a second “droplet barcode” (CB2) that uniquely identifies each droplet, together constituting the cell barcode. A unique molecular identifier (UMI) is also included as part of CB1 to enable identification of unique transcripts via removal of PCR duplicates. This pre-indexing strategy has recently been successfully applied to mammalian droplet-based scRNA-seq18.


The pre-indexing with CB 1 was achieved via reverse transcription (RT) reactions using random hexamer priming in a 384-well plate (plate barcoding), with ~200,000 cells in each well containing one of 384 uniquely barcoded RT primers18 (FIG. 1A, Table 1). Template switching is less efficient for second strand cDNA synthesis from bacterial than mammalian mRNA due to the lack of proper modifications at the 5′ end of bacterial mRNA. Applicants thus used Terminal Transferase (TdT) to append poly-A tails to the 3′ end of cDNA to facilitate second strand cDNA synthesis inside droplets. By pre-indexing,Applicants were able to load each droplet with multiple cells, making Poisson loading unnecessary and increasing the throughput significantly from a λ, of ~0.3 for conventional droplet scRNA-seq experiments to a λ, of >1 for Applicants’ approach with multiple cells in each drop.


For droplet generation and round 2 droplet barcoding (CB2), Applicants utilized the commercially available single-cell kit from 10x Genomics™ (see methods) and loaded 3-6 cells per droplet. After round 2 droplet barcoding, cDNA from each cell was now labeled with a unique cell barcode, a combination of CB1 and CB2. cDNA libraries were then constructed using a protocol modified from the Illumina Nextera XT DNA library construction kit (FIG. 1A, FIG. 6).


Determining the Technical Performance of BacDrop

To characterize the performance of BacDrop, Applicants determined the efficiency of rRNA depletion, preservation of expression profiles despite fixation, correlation of transcriptional profiles generated by droplet library construction with bulk libraries, barcode collision rates, and generalizability to different bacterial species. After rRNA depletion, the fraction of mRNA reads increased from ~5% to 50-90% of the total aligned reads, while preserving mRNA profiles relative to non-depleted samples (R2 = 0.81; FIGS. 1B & 1C; FIG. 24). In addition, Applicants confirmed that mRNA profiles were not affected by cell fixation in bulk experiments (R2 = 0.97; FIG. 1D), and that BacDrop produces transcriptional profiles that are well-correlated with those generated by the traditional bulk RNA-seq method (R2 = 0.91; FIG. 1E).


Applicants confirmed that the two-step barcoding strategy, which was used to enable loading of multiple cells per droplet, resulted in a minimal number of cells labelled with the same barcodes, that is the cell barcode collision rates after two rounds of barcoding. Applicants conducted round 1 plate barcoding using 384 RT primers and round 2 droplet barcoding containing on average 6 cells per droplet, though with a range of cell numbers per droplet, on a mixed population of two distinguishable species, K.pneumoniae and P.aeruginosa. Of 44,140 cells that passed the analysis threshold at the sequencing depth of ~1000 reads per cell, 42,893 cells (97.2%) had >99% of UMIs aligning to a single species, whereas the other 1,247 (2.8%) had > 1% of UMIs aligning to both species (FIG. 1F). The resulting barcode collision rate of 6.6% compares to published methods17,18. Applicants performed all subsequent experiments with a target of <3 cells per droplet, which would yield a library containing maximally a million cells in each 10x channel with an even lower collision rate.


To demonstrate the generalizability of BacDrop to different bacterial species and the ability of BacDrop to differentiate among different species, Applicants applied BacDrop to the gram-negative E.coli, K.pneumoniae, P.aeruginosa, and the gram-positive E.faecium (FIG. 1G, Table 2). Applicants performed cell fixation, permeabilization, rRNA and gDNA depletion, and round 1 plate barcoding separately on individual cultures of these four species, and then mixed all four strains together into a single pool for round 2 droplet barcoding and library construction. Each of these strains were thus labeled with one unique set of CB1 (Table 1), allowing Applicants to track and validate accuracy of species identification in downstream analysis. Applicants used the standard workflow of Seurat 3 for cell clustering and subpopulation identification19. Applicants found that these 4 species were clearly distinguished in the analysis and that the RNase-H based rRNA depletion worked efficiently across all four species (FIG. 1G, FIG. 7, FIG. 8, FIG. 25A). Cells from E.faecium fell into several subpopulations distinguished by differential expression of two highly expressed housekeeping genes (ef-tu and ef-g; log2 fold change ~ 0.6) in E.faecium. Of note, the variation of cell numbers among these four species in the sequenced library was due to cell loss before round 2 droplet barcoding. Specifically, this was due to the loss of a larger fraction of P.aeruginosa cells, which are smaller, during the centrifugation steps (FIGS. 25B, 25C). For future experiments, Applicants only pooled samples right before round 2 droplet barcoding to ensure equal number of cells from each sample are loaded into the 10x channel for cell barcoding and library construction, or use of centrifugation speeds that have been optimized for each species or sample.


Applicants next examined the transcriptome coverage of BacDrop in E.coli and K.pneumoniae. Applicants generated two small libraries containing either ~10,000 cells of E.coli or ~12,000 cells of K.pneumoniae (FIGS. 26A, 26B). Both libraries were sequenced with ~80,000 reads per cell, and Applicants recovered roughly 4,000 or 6,000 cells, containing at least 15 mRNA genes per cell, respectively. Applicants detected the expression of ~70% genes of the E.coli genome and ~80% genes of the K.pneumoniae genome when Applicants analyzed all cells together (Table 8 and 9). At the single-cell level, Applicants detected an average of 90 and 88 mRNA genes per cell, respectively, which is comparable to other reported methods7,9. Applicants also generated a large library from ~1 million K.pneumoniae cells and sequenced with ~5,000 reads per cell. Applicants recovered ~60,000 cells with at least 15 mRNA genes per cell and detected the expression of 96% genes of the whole genome when Applicants analyzed all cells together (Table 10). At the single-cell level Applicants detected an average of 30 mRNA genes per cell across all 60,000 cells. However, from this large library, the top 3,000 high-quality cells had an average of 127 mRNA genes detected per cell (FIG. 26C). Since this large library was only sequenced with ~5,000 reads per cell, Applicants expect to detect a higher number of mRNA genes per cell with increased sequencing depth, as illustrated with the smaller libraries.


Finally, Applicants assessed BacDrop’s sensitivity to distinguish different expression levels of a gene. Applicants created a heterogeneous population containing three E.coli strains constitutively expressing gfp at different levels (Table 2). Applicants used flow cytometry to confirm the differing expression levels of gfp in these strains and estimated the mRNA copy numbers of gfp in each of these strains using RT-qPCR6 (FIGS. 27A, 27B). The estimated mRNA copy numbers per cell were 1-5 for the gfp.low strain, 9-30 for the gfp.mid strain, and 30-70 for the gfp.high strain. Applicants barcoded each strain with a unique set of CB1 and mixed ~3,300 cells from each strain for round 2 droplet barcoding to generate a BacDrop library. Applicants found BacDrop can distinguish cells based on their gfp expression levels. Importantly, the gfp expression levels detected via BacDrop were consistent with the flow cytometry and RT-qPCR results (FIGS. 27C, 27D), suggesting that BacDrop can reliably identify subpopulations with differentially expressed genes.


Together, these results suggest that BacDrop is a robust and reliable technology with sufficient coverage and sensitivity that can be applied across different numbers of cells and species. Applicants thus proceeded to test its capability in revealing biological heterogeneity in a single K.pneumoniae clinical isolate, using these experiments to additionally demonstrate BacDrop’s reproducibility.


Validating BacDrop’s Ability to Identify Subpopulations of a Single Bacterial Isolate

To validate that BacDrop could reproducibly identify subpopulations of cells of the same isolate, Applicants applied BacDrop to the antibiotic-susceptible clinical isolate, K.pneumoniae MGH66 in the absence and presence of antibiotic perturbations (FIG. 2A, Table 2). Applicants split a MGH66 culture (OD600 ~0.2) into 4 identical cultures and treated 3 of them for 30 minutes with 3 antibiotics with different mechanisms of action, including inhibition of cell-wall synthesis (meropenem), DNA synthesis (ciprofloxacin), and protein synthesis (gentamicin), the fourth culture were left untreated (see methods for details). Bulk RNA-seq on the samples collected using the same treatment schemes revealed distinct cellular responses to each antibiotic relative to untreated control. As expected (FIG. 2B), ciprofloxacin induced genes involved in SOS response, e.g., recA., while gentamicin treatment induced a group of heat shock chaperone proteins, e.g., ibpB. In contrast, at 30 minutes, minimal transcriptional responses were observed in bulk from meropenem treatment, under the condition used (OD600 ~ 0.2, meropenem concentration 2 µg/mL), which is consistent with previous observations20 (FIG. 2B).


To validate BacDrop, Applicants applied round 1 plate barcoding to each of these 4 samples separately using one of 4 distinct sets of CB1 (96 different CB1s corresponded to each sample, Table 1). The distinct CB1 set identities allowed Applicants to confirm the original identity of these 4 samples and associate them with the corresponding antibiotic exposure. Applicants then mixed all cells from the different treatments for round 2 droplet barcoding and library construction (FIG. 2A). Each of the replicate libraries contained roughly one million cells. Applicants sequenced Replicate 1 with ~5 billion paired-end reads (~5,000 reads per cell) and Replicate 2 with ~3 billion paired-end reads (~3,000 reads per cell).


To confirm BacDrop’s robustness and reproducibility, Applicants compared the two replicate experiments, each involving 4 samples (3 antibiotic treated and 1 untreated). For the depth of sequencing performed for each experiment, Applicants obtained ~80,000 cells with ≥15 mRNA genes per cell, with an average of ~30 unique mRNA genes detected per cell. No strong batch effect was observed between the replicates. Treatment with the different antibiotics, ciprofloxacin, gentamicin, or meropenem, resulted in cells clustering based on their treatment conditions, (FIGS. 21A-21D). There was some overlap between the meropenem-treated and untreated samples (FIG. 28), consistent with their bulk RNA-seq results (FIG. 2B). Across both replicates, 56%-72% of the ciprofloxacin-treated cells belonged to the SOS-response cluster, while 66%-71% of the gentamicin-treated cells belonged to the heat-shock response cluster, with good reproducibility across the two replicates (FIG. 21B).


Besides the clusters driven by SOS response and heat-shock response, another cluster showed significantly higher expression of a mobile genetic element (MGE), an IS903B transposase (FIGS. 21B-D). This MGE subpopulation was observed in all 8 samples regardless of the treatment, suggesting the presence of this MGE population is a robust, reproducible phenomenon. Together, these experiments confirmed that BacDrop could effectively and reproducibly identify population heterogeneity.


Using UMI-Tools21, Applicants extracted reads from cell barcodes with more than 10 unique molecular identifiers (UMIs) detected (FIG. 9), which constituted ~74% of the total sequencing reads. Applicants then aligned the extracted sequences and quantified numbers of mRNA UMIs and genes in each cell. Applicants found ~350,000 cells containing 1 to 9 mRNA genes, ~90,000 cells containing 10-14 mRNA genes, and ~60,000 cells containing ≥ 15 mRNA genes (FIG. 10). For cells which had the greatest sequencing depth, for example, the top 2000 cells, Applicants obtained a median number of 104 mRNA genes per cell. Applicants analyzed the ~60,000 cells that contained ≥15 mRNA genes, which had a median of ~30 mRNA genes detected, and the result showed a clear distinction among these 4 samples, especially for the ciprofloxacin and gentamicin treated samples (FIG. 2C, FIG. 11), confirming that BacDrop could effectively identify population heterogeneity. As expected, however, the ability to distinguish these samples depended on the numbers of cells analyzed. Applicants down-sampled 50%, 25%, and 10% cells from each sample and repeated the analyses, resulting in a total number of ~30,000, 15,000, and 7,000 cells. As the numbers of cells in the analysis decreased, distinctions between these four samples became less clear (FIGS. 2C - 2F, FIG. 11). When ~30,000 cells were included, the gentamicin treated cells and ciprofloxacin treated cells still stood out as distinct cell clusters, driven by either SOS response genes (ciprofloxacin-treated cells) or heat-shock chaperone proteins (gentamicin-treated cells), whereas the majority of meropenem treated cells clustered with the untreated cells. In contrast, when only ~7,000 cells were included, no clear clustering was observed except for the ciprofloxacin-treated sample from all other cells. Together, these results suggest that higher throughput, even on the order of tens of thousands of cells, facilitates cell classification and subpopulation identification in bacterial scRNA-seq experiments.


Of note, Applicants also performed this same analysis using all cells with ≥10 mRNA genes detected, rather than ≥15. Applicants found equally good clustering of these four samples (FIGS. 12A, 12B) when all ~150,000 cells were included. However, when Applicants down-sampled to ~75,000 cells (50%), the separation of these four samples was not as good (FIGS. 12C & 12D).


BacDrop Reveals Within Population Heterogeneity With Subpopulations Driven Largely by the Expression of Mobile Genetic Elements (MGEs)

Applicants next analyzed the untreated culture of MGH66 at the single cell level to understand if it contained any previously unrecognized within population heterogeneity in transcriptional states. From this untreated condition Applicants recovered ~50,000 cells with at least 15 unique mRNA genes detected in each cell, and Applicants identified two major subpopulations in both replicates using an unsupervised clustering approach (see Methods; FIG. 22A, FIG. 29). While the majority of cells fell into one major homogenous subpopulation, 2,191 cells (~4.5%) fell into the MGE subpopulation driven by IS903B (FIG. 22B), which has 83 copies in MGH66 genome. In an analysis of ~40,000 cells with ≥15 or more unique mRNA genes detected in each cell, Applicants identified three subpopulations (FIG. 2A, FIG. 13) using an unsupervised clustering approach (see methods). While the majority of cells (~92%) fell into one major subpopulation, one smaller population, containing 2,263 cells (5.7%), was distinguished by the high-level expression of a mobile genetic element, an IS903B family transposase, which has 83 copies in MGH66 genome. Due to the limitation of the alignment program, Applicants cannot determine if the high-level expression of IS903B transposase in this subpopulation was caused by specific copies or all of the copies existing in the genome. Nevertheless, the overall expression level of IS903B in this subpopulation was hundreds of times higher than its expression in the rest of the population. Of note, this same MGE subpopulation was observed in the other 3 samples treated with different antibiotics (FIG. 14), suggesting the presence of this MGE population is a robust, reproducible phenomenon.


Previously Applicants had functionally shown that MGH66 and several other K.pneumoniae isolates have high-level transposon insertional mutagenesis activity, which contributes to their high frequencies of carbapenem resistance acquisition22; however, bulk RNA-sequencing had failed to show elevated expression of any transposon genes in these strains. Here, the existence of this subpopulation with high-level transposon activity provides a possible explanation for the strain’s elevated carbapenem-resistance frequencies, with resistance likely emerging from this small subpopulation.


To examine the robustness of the MGE subpopulation in the datasets and to compare the relative values of deeper sequencing of fewer cells versus more shallow sequencing of more cells, Applicants analyzed the untreated samples in Replicate 1 and Replicate 2 libraries separately, along with a smaller BacDrop library containing ~3,000 cells of MGH66 similarly collected. Applicants sequenced this smaller library more deeply to obtain 80,000 reads per cell with recovery of ~2,000 cells with at least 15 mRNA genes per cell, and collectively an average of 85 mRNA genes detected per cell. Analysis of this smaller library detected the same MGE population identified in the larger cell population, albeit less distinctly (FIG. 30). In contrast, both the replicates of the larger libraries, even when sequenced only to a depth to obtain ~30 mRNA genes per cell, identified an additional small subpopulation (0.25% - 0.36%) featuring high-level expression of maltose transport genes that was not identified in the smaller library, despite its deeper sequencing (FIG. 30). Together, these results show that analyzing larger numbers of cells can help to reveal heterogeneity within a population. They also highlight BacDrop’s versatility and ability to be applied to the study of both large and small cell numbers, depending on the biology of interest.


An even smaller subpopulation comprised of 103 cells (0.25%) showed a distinct metabolic state from the rest of the population (FIGS. 3A & 3B). This group of cells had significant up-regulation of genes involved in the stringent response (i.e., ispH) and starvation response, including genes involved in biofilm formation (lldR), filamentation (damX), and fatty acid degradation (fadB), as well as many nutrient transport genes, including genes involved in maltose transport (malK and lamB), ion transport (fecC), lipoprotein transport (lolB), and the major porin gene ompK36 which plays a role in nutrient uptake. In addition, Applicants found the major efflux pump, tolC, is also significantly up-regulated. These observations indicate that this subpopulation might be undergoing metabolic stress and actively importing nutrients. Of note, this small metabolically stressed population was sufficiently rare that 40,000 cells were required in order to detect it. Down-sampling to 50% or 25% of the total cells rendered this subpopulation undetectable, whereas the larger MGE-driven population could still be detected (FIGS. 3C & 3D). This result suggests that high throughput nature of BacDrop is advantageous for detecting rare populations.


To determine if MGE-driven subpopulations are unique to MGH66, Applicants applied BacDrop to another K. pneumoniae clinical isolate (BIDMC35) (Table 2). BIDMC35 is a carbapenem-resistant isolate in which the carbapenem resistance resulted from a transposon disruption of the major porin gene ompK36 and the transposon-mediated high-level expression of a β-lactamase gene blaOXA-66323. Applicants again observed MGE-driven subpopulations, as in MGH66. Analyzing 9,748 BIDMC35 single cells that passed the analysis threshold at a sequencing depth of ~2000 reads per cell (FIGS. 3E & 3F, FIG. 15), Applicants identified three clusters driven separately by three different transposon genes, including an IS4321 family transposase (Cluster 2, 195 cells, 2%), the insH transposase (cluster 3, 146 cells, 1.5%), and an IS110 family transposase (cluster 4, 133 cells, 1.4%). Due to the presence of multiple copies of each of these transposase genes, Applicants could not resolve whether the high-level expression is caused by expression from a single copy or multiple copies of these transposase genes. Nonetheless, combining reads aligned to all copies of IS4321, insH, or IS110, the expression of each of these three transposase genes in their featured cluster is about 500 times higher than their expression in the rest of the population. Together with the observation in MGH66, it reinforces the finding that variable expression of MGEs may be one of the major drivers of population heterogeneity.


In BIDMC35, besides these MGE-driven subpopulations, Applicants observed another unique subpopulation (190 cells, 2%) driven by the 30- to 320-fold higher expression of a group of prophage genes (FIG. 3F, Table 3), compared to the rest of the populations, indicating that this cluster of cells was likely undergoing spontaneous phage induction. This observation is similar to the phage-induction subpopulation reported in the microSPLiT study9. Additionally, Applicants found the expression of blaOXA-663 is significantly lower in this phage-induction subpopulation (FIG. 3F), possibly caused by spontaneous phage induction.


BacDrop Reveals Heterogeneous Stress Responses to Antibiotic Exposure

Finally, to determine if a perturbed population might have heterogenous transcriptional responses which are being masked by bulk-RNA-seq, Applicants analyzed the single cell responses to different antibiotic exposures from the BacDrop results. Under the conditions in which these samples were generated, the numbers of cells queried, and the level of resolution they were analyzed, Applicants did not detect obvious heterogeneity of response to ciprofloxacin or gentamicin. This is in contrast to what Applicants observed for meropenem treatment.


Applicants had been particularly puzzled by the fact that despite having the same impact on cell killing as ciprofloxacin and gentamicin at 30 minutes (FIG. 16), meropenem treatment only induced minimal transcriptional responses based on bulk RNA-seq analysis, in contrast to the other two antibiotics (FIG. 2B). Applicants thus analyzed the transcriptional response at the single cell level for the meropenem-treated samples and indeed, in addition to the MGE-driven subpopulation, found four interesting subpopulations with distinct molecular responses after meropenem treatment (FIG. 4A; FIGS. 23A and 23B; FIG. 31A). These four subpopulations include: i) a stress response cluster featuring high-level expression of stress response genes such as rseB, yidC, and yhcN; ii) a cell wall/membrane synthesis cluster featuring highly expressed genes involved in cell wall and membrane synthesis, i.e., nlpl and lpxH; iii) a cell wall synthesis and DNA replication cluster featuring highly expressed genes involved in DNA synthesis and cell wall/membrane synthesis such as dnaG and ftsI; and iv) a cspD-expressing cluster characterized by induced expression of cspD15, a DNA-binding toxin that inhibit DNA synthesis and induces the formation of persisters.


One subpopulation consisting of two clusters (clusters 5 and 12, 614 cells, 8%) showed the strongest stress response, compared to the rest of the population. While clusters 5 and 12 shared the same group of highly expressed genes, these genes were more highly expressed in cluster 12 compared to cluster 5. In this subpopulation, Applicants observed 5- to 200-fold higher expression of genes involved in cell envelope damage response (FIG. 4B, Table 4), including the sigma-E factor regulatory gene rseB, an ATP-independent periplasmic protein-refolding chaperone gene spy, and the membrane protein insertase gene yidC. In addition, Applicants also observed 10- to 100-fold higher expression of other stress response genes, including genes involved in a peroxide/acid stress response (yhcN) and cold-shock response (hscA). Interestingly, this subpopulation also showed 8- to 24-fold higher expression of dacC, the gene encoding penicillin-binding protein 6 (PBP6), a target of β-lactams such as meropenem.


In contrast, another subpopulation consisting of cluster 7 and 11 (432 cells, 5.7%) had high level expression of many genes involved in cell wall and membrane synthesis, with cluster 11 having higher expression of these genes compared to cluster 7 (FIG. 4B, Table 4). These genes include lpxH (lipid A biosynthesis), rffG (lipopolysaccharide (LPS) biosynthesis), secY and suhB (membrane protein transport and insertion), and nlpl (peptidoglycan biosynthesis and recycling). These results suggest that these cells may be actively synthesizing cell wall, cell membrane, and other cell surface structures. As β-lactam treatment has been previously reported to induce a futile cycle of cell wall synthesis to deplete peptidoglycan precursors and eventually lyse the cell24, the induction of active cell wall/membrane synthesis observed in this subpopulation may represent the futile cycle of cell wall synthesis.


Another small, unique subpopulation consisting of cluster 9 (80 cells, 1%), features active DNA replication and cell division. Cells in this cluster showed 30- to 50-fold higher expression of genes essential for DNA replication and cell division (FIG. 4B, Table 4), including dnaG (encoding DNA primase) and ftsI (the essential cell division protein PBP3 and a target of 13-lactams). No strong response to cell wall/membrane damage was observed in this subpopulation. Instead, three other stress response factors are highly expressed, including groL, which encodes the heat-shock response chaperone GroEL, fumC, which encodes a backup enzyme in the TCA cycle when the FumA and FumB enzymes are damaged by reactive oxygen species, and ychF, which encodes a redox-regulated ATPase response to oxidative stress.


Finally, cluster 10 (53 cells, 0.7%) had high-level expression of cspD (FIG. 4B, Table 4), which encodes a toxin that inhibits DNA replication and induces the formation of persisters15,16. In addition, rihC, the gene encoding ribonucleoside hydrolase RihC, an enzyme responsive to DNA damage, was also expressed exclusively in cluster 10. Previous studies have shown that the induction of rihC is independent of LexA25, the key transcriptional regulator of the SOS response to DNA damage. Consistent with previous reports, no genes in the SOS response pathway were upregulated in cluster 10, suggesting that cells in cluster 10 may be responding to DNA damage in an SOS-independent way, which might facilitate the formation of persisters (FIG. 4B).


Having identified genes highly expressed in specific subpopulations after meropenem treatment (FIG. 4B, Table 4), Applicants used RNA fluorescence in situ hybridization (FISH) to validate the finding of the “stress response” and “cspD-expressing” subpopulations. Applicants simultaneously probed for two genes highly co-expressed in the “stress response” cluster, rseB and yidC, and confirmed the existence of this cluster (FIGS. 23B and 23C). Similarly, Applicants simultaneously probed for cspD and rihC, two genes highly co-expressed in the “cspD-expressing” cluster to confirm their existence (FIGS. 23B and 23C). The percentage of cells making up each cluster as detected by RNA-FISH and BacDrop were very similar (FIG. 23D).


Applicants also used fluorescence cytometry to validate the expression patterns of genes in the “stress response” and “cspD-expressing” clusters. Applicants engineered MGH66 reporter strains expressing the short-lived green fluorescent protein26 driven by the promoter of yhcN, a “stress response” gene (MGH66:PyhcN:gfp), or cspD (MGH66:PcspD:gfp) (FIGS. 4C, 4D and 4E). Indeed, meropenem, but not ciprofloxacin, induced heterogeneous expression of both yhcN or cspD, consistent with BacDrop results (FIG. 23E). Applicants confirmed that the cells with reduced fluorescence of MGH66:PcspD:gfp (GFP-low) were live and not simply dying using a live-dead stain and plating for colony forming units (FIG. 18; FIGS. 31B and 31C). Interestingly, the GFP-low population actually had lower fluorescence than the untreated population, suggesting that in fact, there may be suppression of cspD expression in this population. Of note, the fractions of cells highly expressing these two genes were greater by flow cytometry than by BacDrop; this would be consistent with the fact that RNA and protein levels are not necessarily well correlated in single cells6, as one copy of mRNA can produce one to hundreds of copies of proteins and mRNA is less stable than protein. Nevertheless, the heterogeneous responses were observed by both methods of measurement.


In summary, under meropenem perturbation, Applicants observed strong heterogeneous responses driven by various stress response pathways that had been previously masked by bulk RNA-seq results. Rather than uniformly turning on a specific stress response pathway in all cells, a diverse range of stress responses appear to be induced in different subpopulations, which could potentially contribute to heterogeneous cell fates such as cell lysis or antibiotic tolerance.


BacDrop Identifies a Subpopulation With Reduced Meropenem Efficacy and Increased Persisters

Given CspD’s reported role in inducing the formation of antibiotic-tolerant persisters in E.coli15,16, Applicants asked whether antibiotic tolerant cells might make up a greater percentage of the GFP-high than the GFP-low subpopulation, with cells in which cspD had been induced surviving preferentially under meropenem treatment. Because CspD plays a role in persister formation rather than maintenance, Applicants anticipated that some cells might induce cspD and thus make high levels of GFP, become antibiotic tolerant, then turn off CspD expression resulting in reduced expression of GFP as the GFP is degraded. Despite this possibility, Applicants nevertheless hypothesized that the GFP-high subpopulation might still be enriched for tolerant cells compared to the GFP-low subpopulation. Applicants performed fluorescence activated cell sorting (FACS) of the MGH66 GFP transcriptional reporter strain (MGH66:PcspD:gfp) coupled with dead-cell stain, after a 30-minute exposure to meropenem. Using flow cytometry coupled with dead-cell stain, after a 30-minute exposure to meropenem, Applicants sorted live cells into the two subpopulations of MGH66: PcspD:gfp (GFP-high and GFP-low) (FIG. 4F; FIG. 23F) directly into liquid media with and without meropenem. Applicants then plated cells from the ensuing 4 samples onto solid agar without antibiotics to enumerate surviving bacteria over time (FIG. 4G; FIG. 23G). Indeed, the GFP-high subpopulation was enriched for meropenem tolerant cells compared to the GFP-low subpopulation, with evidence of a persister population in the GFP-high but not the GFP-low subpopulations (FIG. 4G; FIG. 23G). Consistent with this observation, Applicants also observed ~ 100 times more persister cells in a MGH66 strain over- expressing cspD, though the over-expression of cspD did not reduce antibiotic susceptibility (FIG. 23H). Together, these results confirmed the role that cspD plays in persister formation in a subpopulation of K.penumoniae MGH66.


Discussion

Applicants report a novel bacterial scRNA-seq method, BacDrop, that is robust and reproducible, and leverages droplet-based technology to enable the study of the transcriptional program of both large and smaller numbers of single bacterial cells. Applicants applied BacDrop to study the naturally occurring heterogeneity in a heretofore presumed uniform culture of bacteria and its heterogenous responses to perturbation. Previous genome-wide single cell studies on smaller numbers of cells (hundreds to thousands) have to date focused predominantly on samples with artificially-created heterogeneity, created as mixes of different populations, for method demonstration of between population heterogeneity7-10. Here, Applicants characterized both a stable and a dynamic population of cells derived from the same bacterial isolate, and demonstrated a diversity of states within the stable population and the heterogenous responses in the dynamic population after perturbation with antibiotic. Applicants find that in both cases, the ability to analyze large numbers of cells (thousands to tens of thousands, with the potential to go much higher) enables higher resolution identification of small subpopulations.


BacDrop revealed within population heterogeneity driven predominantly by the expression of MGEs in the presumed uniform cultures of K.pneumoniae. While MGEs drive genetic diversity by their relatively random movement in the genome, Applicants find that the expression levels of individual MGEs are also highly variable within populations of MGH66 and BIDMC35 (FIG. 3 and FIG. 22). Whether this heterogeneity in expression is due to genotypic variation resulting from the movement of genetic elements such as transposon insertions or phase variation, to transcriptional changes in response to stochastic/or local microenvironmental cues, or to epigenetic mechanisms, remains to be understood. However, the consequences of such variation can be significant. Applicants propose that the elevated transposition frequencies found only in a subpopulation of MGH66 likely contribute to the strain’s propensity to become carbapenem resistant, given Applicants’ previous demonstration of the role that high-level transposon mutagenesis plays in carbapenem resistance22. Applicants also identified a very small population of cells (0.25%) in a distinct metabolic state, with signatures of stringent response, nutrient starvation and scavenging, biofilm formation and cell filamentation. The high up-regulation of ispH, a gene involved in antibiotic tolerance and stringent response27, suggests that this group of cells might be undergoing metabolic stress, perhaps maybe even with a potential role in antibiotic tolerance phenotypes.


Meanwhile, in response to a perturbation such as exposure to the important antibiotic meropenem, Applicants observed a wide range of transcriptional responses that are otherwise masked by bulk RNA-seq. Interestingly, a diverse range of stress responses appear to be induced in different subpopulations rather than a single or uniform response occurring in all cells; this subpopulation diversity could potentially contribute to heterogeneous cell fates or phenotypic outcomes, including cell lysis or antibiotic tolerance. It remains to be understood whether this heterogeneous stress response occurring in subpopulations is a general phenomenon in response to stressors or it is specific to certain types of stresses such as meropenem, which may be working in a much more pleiotropic manner than is assumed, thereby eliciting a wide range of stress responses. Meanwhile, Applicants examined one such subpopulation defined by high-level expression of cspD, a gene encoding a toxin that inhibits DNA replication and induces the formation of persisters, but that is not significantly upregulated in bulk RNA-seq results. Using both FISH and flow cytometry, Applicants confirmed that cspD is indeed induced in a subpopulation after meropenem treatment. Moreover, Applicants found a higher survival rate under meropenem treatment in the cspD-induced subpopulation, pointing to its role in antibiotic tolerance within this subpopulation and more generally, to the importance of certain responses in some subpopulations in surviving the lethal effects of antibiotics. Compared to other subpopulations, this cspD-induced subpopulation also showed unique SOS-independent DNA damage response, which could be potentially linked to the induction of cspD.


Applicants have shown that BacDrop can be applied to studies of both large and smaller numbers of cells, depending on the biological question of interest. Importantly, Applicants demonstrated that studying large numbers of cells can more robustly identify population heterogeneity including rare subpopulations even with fewer mRNA genes per cell (FIG. 30). With the ability to characterize large numbers (millions) of cells using BacDrop without requiring any prior knowledge of the genomes of interest, the limitation for understanding the single cell transcriptional programs within complex communities is no longer technical. Instead, one of the major limitations becomes that of sequencing cost, which currently necessitates a compromise between sequencing large numbers of cells and the sequencing depth of individual cells. There is value both in large numbers of cells sequenced less deeply, as well as deep sequencing of lower numbers of individual cells to obtain information on more unique genes. With the rapid development of sequencing technologies and platforms, one can easily imagine that such compromises may no longer be required in the near future.


New computational methods for analysis are also needed. In this study, Applicants analyzed BacDrop data using programs established for mammalian scRNA-seq. More efficient computational pipelines that easily accommodate these much larger cell numbers, and, importantly, are tailored towards bacterial genomes and their genetic architecture will greatly increase the power of BacDrop. This will require parallel efforts to improve annotation of bacterial genomes and to better define operon structure and networks in many different bacterial species, beyond E.coli.


Applicants have developed BacDrop to be a versatile, high-throughput method to characterize the transcriptional programs of bacterial cells in the range from thousands to millions. By doing so, one can reveal both heterogeneity in cell types (species) in a mixed community or cell states in a single strain under stable or dynamic conditions. To demonstrate its utility, Applicants validated BacDrop in four different pathogenic bacterial species. Applicants expect that BacDrop could be easily adapted to more species, including commensal bacterial strains and other environmental species. Applicants thus propose that BacDrop will become a powerful tool for a broad range of studies, including studies focused on elucidating phenotypic heterogeneity, understanding bacterial interactions in microbial communities, dissecting host-pathogen interactions, expanding Applicants’ knowledge of the microbiome beyond genomes and bulk metabolomics, and investigating the emergence of antibiotic resistance, persistence and tolerance.


Materials and Methods
Experimental Methods
Bacterial Strains and Culture

Bacterial strains used in this study are listed in Table 2. K.pneumoniae, E.coli, and P.aeruginosa were cultured in Luria-Bertani (LB) medium or Mueller-Hinton Broth (MHB) with shaking at 37° C.E.faecium was cultured in Todd-Hewitt broth (THB) with shaking at 37° C. For the GFP experiment, E.coli strains expressing gfp driven by different promoters were cultured separately in LB at 37° C. Early exponential growth phase cells (OD600 ~0.2) were collected and fixed immediately. For the antibiotic treatment experiment, K.pneumoniae clinical isolate MGH66 was cultured in MHB at 37° C. until early exponential phase. Then the culture was diluted to OD600 0.05 in MHB. After growing for two doublings (~40 min, OD600 ~0.2), the cultures were split into four equal volume cultures. One culture was left untreated, while the other three were treated with relevant antibiotic at breakpoint concentrations set by the Clinical and Laboratory Standards Institute (CLSI): 2 µg/mL for meropenem, 1 µg/mL for ciprofloxacin and 4 µg/mL for gentamicin. After 30 min, 7 mL of cells were collected from each of these cultures, and immediately proceeded with the cell fixation protocol. For the bulk RNA-seq experiments, samples were collected using the same treatment schemes, and three biological replicates were included in each condition. For the BIDMC35 experiment, BIDMC35 was cultured in LB medium at 37° C. until early exponential phase (OD600 ~0.2). 7 mL cells were then collected and immediately proceed with the cell fixation protocol.


Cell Fixation and Permeabilization

All reagents (Table 5) for cell fixation and permeabilization were kept ice-cold. Up to 10 billion bacterial cells grown at specified conditions were collected by centrifuging at 5525 × g for 10 min at 4° C. The supernatant was removed and cell pellets were resuspended in 7 mL fresh, ice-cold 4% formaldehyde (Sigma, CN 47608) in 1x PBS and incubated with shaking overnight at 4° C. (Digital Platform Rocker Shaker, VWR). Following overnight fixation, cells were centrifuged at 5525 × g for 10 min at 4° C. The supernatant was removed and cells were resuspended in 7 mL PBS-RI (1x PBS supplemented with 0.1 U/µL NxGen RNase inhibitor (Lucigen, CN 30281)). Cells were centrifuged again at 5525 × g for 10 min at 4° C. and pellets were resuspended in 700 µL PBS-RI. Subsequent centrifugations were carried out at 7000 × g for 5 minutes at 4° C. Applicants noticed that some species, e.g., P.aeruginosa, do not pellet very well at this centrifugation speed (FIG. 25B). Thus, Applicants recommend optimizing the centrifugation speed for the specific species of interest. Cells were centrifuged and resuspended in 700 µL50% Ethanol in PBS-RI. Cells were then washed twice with PBS-RI. After the second wash, cells were resuspended in 1 mL100 mM Tris-HCL (pH 7.5) supplemented with 0.1 U/uL NxGen RNase inhibitor. Cells were diluted 100x and quantified using a hemocytometer (VWR, CN 102966).


Applicants found that the number of cells in a permeabilization reaction is critical for achieving sufficient permeabilization. Insufficient permeabilization may result in inefficient rRNA depletion and gDNA removal. For 1 permeabilization reaction, up to 40 million cells were centrifuged and resuspended in 250 µL0.04% Tween-20 in 1x PBS. If more cells are desired, multiple parallel reactions can be set up. Immediately following a 3-minute incubation on ice, 1 mL cold PBS-RI was added, and cells were spun down and resuspended in 200 µL lysozyme mix (100 mM Tris (pH 8.0), 50 mM EDTA pH 8.0, 0.25 U/µL NxGen RNase Inhibitor, 2.5 mg/mL lysozyme). Cells were then incubated at 37° C. for 15 minutes. After the incubation, 1 mL PBS-RI was added and cells were washed twice with 175 µL PBS-RI. After the second wash, cells were resuspended in 150 µL PBS (without RNase inhibitor added) and cell concentrations were measured.


In-cell rRNA Depletion and gDNA Removal

Immediately after cell permeabilization, up to 40 million cells were centrifuged and resuspended in 11 µL nuclease-free H2O. 2 µL NEBNext Bacterial rRNA depletion solution and 2 µL Probe Hybridization Buffer (NEB, CN E7850) were mixed with cells on ice. The hybridization was conducted per the following (lid temperature set to 55° C.): 50° C. for 2 minutes, ramp down to 22° C. at 0.1° C. /second, and hold at 22° C. for 5 minutes. Probe hybridization was immediately followed by RNase H digestion by mixing the probe-hybridized cells with 2 µL RNase H reaction buffer, 2 µL Thermostable RNase H (NEB, CN E7850), and 1 µL nuclease-free H2O, followed by a 30-minute incubation at 50° C. (lid temperature set to 55° C.). The 20 µL reaction was centrifuged and resuspended in 10 µL DNase-RI buffer (1 µL DNase I reaction buffer (Sigma, CN AMPD1), 1 µL DNase I (Sigma, CN AMPD1), 0.025 µL NxGen RNase inhibitor (Lucigen, CN 30281), 8 µL nuclease-free H2O). The reaction was incubated at room temperature for 30 minutes, and the DNase treatment was stopped by adding 1 µL Stop Solution (50 mM EDTA) and incubating at 50° C. for 10 minutes. After the incubation, cells were centrifuged and washed twice with 100 µL PBS-RI. After the second wash, cells were resuspended in 20 µL0.5x PBS supplemented with 1 U/µL SUPERase-In RNase inhibitor and used immediately for in-cell reverse transcription.


In-cell Reverse Transcription, Round 1 Cell Barcoding and Sample Multiplexing

The round 1 plate barcoding and sample multiplexing is achieved via RT reactions in 384- or 96-well plates. 384 RT primers (Table 1) containing UMI sequences and round 1 plate barcodes (CB1) were synthesized at Integrated DNA Technologies at 100 µM concentration. The primers were diluted with ddH2O to a working concentration of 25 µM, and 2.5 µL of each primer was aliquoted into individual wells of the 384- or 96- well plates. The rRNA and gDNA depleted cells was diluted with nuclease-free H2O supplemented with 1 U/µL SUPERase-In RNase inhibitor and added to the plate containing RT primers (1 µL cells per well). Then the cell-primer mix was incubated at 55° C. for 5 minute and immediately put on ice. For each well, the RT master mix, containing 0.25 µL DTT (100 mM), 0.25 µL dNTP (10 mM each), 0.25 µL SUPERase-In, 1 µL RT buffer, 0.25 µL Maxima H Minus reverse transcriptase (Thermo Scientific, CN EP0753), was added and the RT reaction was incubated as follows (set lid temperature to 60° C.): 50° C. for 10 min, 3 cycles of [8° C. for 12 s, 15° C. for 45 s, 20° C. for 45 s, 30° C. for 30 s, 42° C. for 2 min, 50° C. for 3 min], 50° C. for 5 min, hold at 4° C.


In-cell cDNA 3′ poly-A Tailing

After RT, cells were recovered and pooled from 384- or 96- well plate. For multiplexed samples, Applicants prefer to only pool cells from the same sample together, generating individual pools for each sample. This will allow more flexibility to adjust cell numbers of different samples during droplet generation. Then the pooled cells were centrifuged and each pool was resuspended 40 µL nuclease-free H2O supplemented with 1 U/µL SUPERase-In. The poly-A tailing reaction was set up as the following: 38 µL cells, 5 µL 10x terminal transferase buffer, 1 µL dATP (100 mM) (NEB, N0446S), 1 µL SUPERase-In, 5 µL terminal transferase (TdT) (NEB, CN M0315L). The reaction was incubated at 37° C. for 1 hour. Then 10 µL0.2 M EDTA was added to each 50 µL reaction and incubated at room temperature for 10 minutes. Cells were then centrifuged and resuspended in 10 µL nuclease-free H2O supplemented with 1 U/µL SUPERase-In. Cells were diluted and concentrations were quantified.


Droplet Generation

The Chromium Next GEM Chip H (10x Genomics, PN 1000161) and Chromium Next GEM Single Cell ATAC Library & Gel Bead Kit (10x Genomics, PN 1000176) was used for the droplet generation. The unused wells were filled with 70 µL (row 1), 50 µL (row 2), and 40 µL (row 3) 50% glycerol solution. The desired number of cells was diluted to 33.75 µL with nuclease-free H2O supplemented with 1 U/µL SUPERase-In. Right before loading the chip, 33.75 µL cells were mixed with a PCR master mix containing 37.5 µL KAPA HiFi HotStart ReadyMix (Roche, CN KK2602), 2.25 µL second strand synthesis primer SMRT_dT (10 µM) (Table 6), and 1.5 µL Reducing Agent B (10x Genomics, PN 2000087). The chip was loaded with 70 µL PCR-cell mix (row 1), 50 µL Gel Beads (row 2), and 40 µL partitioning oil (row 3), and run on the Chromium system. Approximately 100 µL droplet emulsion was obtained in row 3.


Second Strand cDNA Synthesis and Round 2 Droplet Barcoding in Droplets

To increase thermostability of the droplets, Applicants split each 100-µL emulsion into 4 25-µL reactions into PCR tubes (USA Scientific, CN 1402-4700). In each reaction, 25 µL5% FC-40 oil (RAN Biotechnologies, CN 008-FluoroSurfactant-5wtF) was added to the bottom and 50 µL mineral oil (Sigma, CN M5904) was added on the top. The 2nd strand cDNA synthesis and round 2 cell barcoding was performed as follows: 95° C. for 30 s, 39° C. for 5 min, 65° C. for 10 min; then 4 cycles of [98° C. for 20 s, 62° C. for 15 s, 72° C. for min], 72° C. for 5 min, hold at 4° C. Breaking emulsions and cDNA purification


After the round 2 cell barcoding was finished, the mineral oil and FC-40 oil was removed from the PCR tube, being careful and not to remove the middle layer which contains the emulsion. The emulsion was then combined and broken by adding 125 µL Recovery Agent (10x Genomics, PN 2000087). The tubes were inverted 10 times and centrifuged briefly to ensure that all droplets were broken. 125 µL Recovery Agent/Partitioning Oil (pink) from the bottom of the tube was then removed. cDNA was first purified using Dynabeads. In brief, for each reaction, a mix containing 182 µL cleanup buffer (10x Genomics, PN 2000088), 8 µL Dynabeads MyOne SILANE (10x Genomics, PN 2000048), 5 µL Reducing Agent B, and 5 µL Nuclease-free water was added. After mixing and incubating at room temperature for 10 minutes, samples were placed on a magnetic separator and washed twice with freshly prepared 80% ethanol. After removing ethanol from the second wash, each sample was eluted in 40.5 µL elution buffer that was prepared by mixing 98 µL Buffer EB (Qiagen, CN 19086), 1 µL10% Tween 20 (Teknova, CN T0710), and 1 µL Reducing Agent B. Then 40 µL of the elution was transferred to a fresh PCR tube and subjected to a 0.6x Cleanup with AMPure XP beads (Beckman Coulter, CN A63881). The cDNA was then eluted in 30 µL nuclease-free water.


cDNA Enrichment

Before the cDNA enrichment, a qPCR reaction, containing 1 µL cDNA, 5 µL KAPA HiFi HotStart Ready Mix, 0.3 µL primer P5 (10 µM), 0.3 µL primer SMRT_PCR (10 µM) (Table 6), 2 µL 5x SYBR green (VWR, CN 12001-796), and 1.4 µL nuclease-free water, was set up to determine cycle numbers of the cDNA enrichment in a real-time thermocycler using the following program: 98° C. for 3 min, 30 cycles of [98° C. for 20 s, 67° C. for 20 s, 72° C. for 3 min], 72° C. for 5 min, hold at 4° C. The cycle numbers at which the qPCR reaction reaches early exponential amplification phase was determined as the cycle numbers for cDNA enrichment. For cDNA enrichment, 25 µL of cDNA was mixed with 125 µL KAPA HiFi HotStart Ready Mix, 7.5 µL primer P5 (10 µM), 7.5 µL primer SMRT_PCR (10 µM), and 85 µL nuclease-free water. The cDNA was enriched using the same program as the qPCR reaction, using the cycle numbers determined from the qPCR reaction. The enriched cDNA was purified using 0.6x AMPure XP beads and eluted in 50 µL nuclease-free water.


Illumina Sequencing Library Construction

The Illumina Nextera XT DNA library preparation kit (Illumina, CN FC-131-1096) was used to prepare sequencing libraries with these following modifications: ~ 2 ng enriched cDNA and 4 µL ATM was used for each 50 µL tagmentation reaction. Following tagmentation, 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment. The PCR reaction was removed from the thermocycler and immediately put on ice after 5 cycles of PCR amplification. Then a qPCR reaction, containing 5 µL Nextera XT PCR reaction, 3 µL NPM, 1 µL primer P5 (5 µM), 1 µL Index 1 primer, 3 µL SYBR green, and 2 µL nuclease-free water, was set up to determine the remaining cycle numbers of the library enrichment using the following program: 72° C. for 3 min, 95° C. for 30 s, 25 x [95° C. for 10 s, 55° C. for 30 s, 72° C. for 30 s], 72° C. for 5 min, hold at 10° C. The cycle numbers at which the qPCR reaction reaches one third of the fluorescence saturation was determined as the remaining cycle numbers for library enrichment. Then the remaining 45 µL library enrichment PCR reaction was put back to a thermocycler and amplified using the same program with cycle numbers determined from the qPCR. The libraries were then subjected to a 0.6x cleanup with AMPure XP beads and eluted in 25 µL nuclease-free water.


Illumina Sequencing of BacDrop Libraries

Libraries were diluted to desired concentrations and sequenced on the Illumina NovaSeq 6000 platform with standard sequencing primers, using the following specifications: Read 1: 60 bp; Read 2: 39 bp; Index 1: 8 bp; Index 2: 16 bp. Depending the scale of the experiment and the sequencing depth desired, NovaSeq 6000 SP (Illumina #20027464), S1 (Illumina #20012865), or S2 (Illumina #20012862) reagent kits were used.


Bulk Library Construction

To construct sequencing libraries from bacterial cultures, cell pellets collected from 1 mL early exponential phase cultures were re-suspended in 500 µL TRIzol Reagents (ThermoFisher, CN 15596026) and frozen at -80 C for at least 20 min. Cells were then thawed and mixed with 250 µL of 0.1 mm diameter Zirconia/Silica beads (BioSpec Products), and lysed mechanically via bead-beating for 90 second at 10 m/sec on a FastPrep (MP Bio). After addition of 0.1 mL chloroform, each sample tube was mixed thoroughly by inversion, incubated for 3 minutes at room temperature, and centrifuged at 12,000 xg for 15 minutes at 4° C. The aqueous phase was mixed with an equal volume of 100% ethanol, transferred to a Direct-zol spin column (Zymo Research, CN R2051), and RNA was extracted according the Direct-zol protocol. The sequencing libraries were then generated using the RNAtag-Seq protocol28.


To construct sequencing libraries from fixed cells, or fixed and permeabilized cells, 20 µL cells were pelleted and resuspended 20 µL lysis buffer (50 mM Tris pH 8.0, 200 mM NaCl, 25 mM EDTA pH 8.0) supplemented with 1.6 µL proteinase K (50 mg/mL). Cells were lysed at 55° C. for 1 hour, then RNA was purified using 1.5x AMPure RNAClean XP beads (Beckman Coulter, CN A63987) and eluted in 20 µL nuclease-free water. The sequencing libraries were then generated using the RNAtag-Seq protocol.


Estimation of mRNA Copy Numbers in E. Coli GFP Strains Using RT-qPCR

The estimation of mRNA copy numbers was performed using a protocol modified from a previous study6. In brief, a gfp gBlock fragment was synthesized at Integrated DNA technology. A serial dilution was performed to create gfp dsDNA standards ranging from 1 to 1010 molecules/µL. One µL of the standard was used in a 10 µL qPCR reaction to generate the standard curve. 10 ng RNA from each GFP strain (~66,666 cells with the assumption that there is 0.15 pg RNA per bacterial cell) was converted into cDNA and subjected to qPCR reaction together with the gfp dsDNA standards. GFP mRNA copy numbers were estimated by mapping to the standard curve.


Construction of GFP Reporter Strains and Flow Cytometry

Applicants amplified the promoter region of cspD or yhcN from MGH66 and ligated it into pUA13926 using the BamHI and XhoI sites, resulting in pUA139-PcspD and pUA139-PyhcN. The construct was then transformed into E.coli DH5a and the plasmids were extracted and verified using Sanger sequencing. Electrocompetent cells of MGH66 was made as previously reported22. The extracted plasmids were then transformed into MGH66 via electroporation, generating MGH66: PcspD:gfp and MGH66: PyhcN:gfp.


The cells for flow cytometry were prepared using the same scheme as the meropenem-treated sample for BacDrop. After treating with meropenem at 2 µg/mL for 30 minutes, cells were diluted into PBS at the final concentration of 106 cells/mL and immediately run through flow cytometer. For the flow cytometry including dead-cell staining, 10 µL propidium iodide (1 mg/mL) (Invitrogen, cat# P1304MP) was mixed with 1 mL PBS. Cells after treatment were then diluted in the staining buffer at the final concentration of 106 cells/mL, and incubated in the dark at room temperature for 15 minutes followed by running through flow cytometer. To sort GFP-low and GFP-high populations, cells were run through fluorescence-activated cell sorting (FACS). Applicants sorted ~106 cells into 2 mL LB without or with meropenem (2 µg/mL) from each population. A 50 µL aliquot from cells sorted in LB medium without antibiotics was immediately diluted and plated on LB agar plates without antibiotics. The colony forming unites (CFU) on LB agar plates were enumerated to calculate the survival rates. The rest of the cells was used to measure MICs using the standard microdilution protocol29 or proceeded with the persister assay. For the persister assay, cells were cultured at 37° C. with shaking. At each time points, a 50 µL aliquot was taken, diluted and plated on LB agar plates without antibiotics. Three replicates were performed in each experiment.


RNA Fish

RNA FISH probes were designed using Design Probes tool of DECIPHER32. 3 - 5 probes were designed for each target gene (Table 11). Probes were synthesized at Integrated DNA technologies and labeled with either Cy3 or Alex488 dye at the 5′. Probes of the same gene were pooled together and diluted into 10 µM stocks. Meropenem-treated MGH66 cells were fixed and permeabilized using the same protocol as the cell fixation and permeabilization steps in BacDrop. The hybridization was carried out in 40% hybridization buffer at 50° C. overnight and the following washing steps of washing were performed as described previously33. Cells were imaged using the DeltaVision widefield deconvolution imaging system with a 60x objective. ImageJ was used for image data analysis and cell quantification.


Computational Methods
Processing of Sequencing Data

To build input matrices with gene-barcode information, Applicants created a pipeline that pulls UMI, barcodes 1 and 2 (FIG. 19). In experiments where multiple samples were pooled for droplet barcoding, a demultiplexing step based on CB1 was performed to parse different samples. Threshold of valid cell barcodes, removal invalid cell barcodes, and final count table generation was performed using UMI-tools21 (10.1101/gr.209601.116). Alignments were performed using BWA30 and annotation of bam files were done using FeatureCounts31.


Assess Potential Bias Introduced by Cell Drop-Off Caused by Insufficient Sequencing Depth

Since many cells were filtered out during the data analysis process due to low numbers of UMI, Applicants assessed the potential bias in RNA-seq results caused by cell drop-off. Applicants used the dataset from the untreated sample of K.pneumoniae MGH66 to calculate the correlation (FIG. 32). Analyzed in bulk level, Applicants found the result from top 10k cells correlates well with the top 500k cells (R2=0.82), while the correlation between top 10k cells and traditional bulk RNA-seq has a R2 at 0.61.


Analysis of BacDrop Data

Once the count tables were made, Applicants used the standard workflow of the R package Seurat 319 (Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol. 2018;36(5):411-420; and Stuart T, Butler A, Hoffman P, et al. Comprehensive Integration of Single-Cell Data. Cell. 2019;177(7):1888-1902.e21) (v.3.2.2). Applicants excluded genes that were not expressed in any cells in the dataset, and excluded cells that had fewer than 10 or 15 genes detected and cells that had abnormally high numbers of mRNA detected. For experiments done using MGH66, Applicants identified three genes that showed consistently high-level expression in the majority of cells and in various conditions: WP-004174069.1, WP-004174069.1-2, and WP-002920103.1. Applicants use these three genes as internal controls and removed cells with a normalized expression of any of these three genes that is less than 50. The standard Seurat workflow prior to clustering was used including global normalization, feature selection, and scaling of gene expression. Applicants used the top 2000 highly variable genes as input features for clustering analysis and downstream annotation. The Seurat packages FindNeighbors and FindClusters were used for clustering at a resolution of 0.5. Uniform manifold approximation and projection (UMAP) was utilized for visualization of clustering. For the combined analysis of 4 samples of MGH66 (FIGS. 2C-2F; FIG. 11) and the analysis of 4 species (FIG. 1G; FIG. 7), both supervised and unsupervised cell clustering were performed. For the separate analysis of MGH66 samples and the BIDMC35 experiment, only unsupervised cell clustering was performed. The number of PC used in each analysis is listed in Table 7. For marker identification and annotation of clusters, Seurat’s FindMarkers tool was used with a requirement that the markers were expressed in 25% of the cells present in the dataset. For some rare population detection, the 25% criterion was removed. From the FindMarkers results, Applicants consider genes with log2 fold changes that are greater than 2, and adjusted p-value less than 0.05 as significantly differentiated genes. If a cluster did not contain any genes that pass this threshold, Applicants did not consider this as a significant cluster.


Data Availability

Sequencing data and the processed counting matrix have been deposited to GEO repository (GSE180237).


Example 2 – Microbiome scRNA-seq Methods
Sample Collection

Three to four pellets of fresh murine fecal samples were taken and placed on ice until sample processing. All pellets were homogenized and a portion of the sample was used for DNA extraction and the same amount was used for BacDrop processing (see below for details).


DNA Extraction and Library Preparation for 16S rRNA DNA Sequencing

DNA extraction was performed using the Qiagen DNeasy PowerSoil Pro Kit (HB-2495) according to manufacturer’s instructions and resuspended in 100 uL of Elution Buffer. To make the 16S library, DNA was amplified using primers targeting the V4 region:


Forward:









TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGYCAGCMGCCGCGGT


AA (SEQ ID NO: 1;






Reverse:









GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACNVGGGTWTC


TAAT(SEQ ID NO: 2).






The Illumina 16S Metagenomic Sequencing Library Preparation protocol was followed according to manufacturer’s instructions and the resulting library was loaded onto an Illumina MiSeq.


BacDrop Experimental Processing

The homogenized sample was washed once with 1mL of ice cold 1 × PBS + 4% Formaldehyde. After spin down, the sample was resuspended in 7 ml of ice cold 1 × PBS + 4% Formaldehyde and placed at 4C rotating overnight. The remainder of the protocol follows the standard BacDrop experimental set up.


Data Analysis

Initial data processing with fastp remained the same as previously described for both the BacDrop and 16S libraries. The resulting reads were used as input in the Kraken2 (genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1891-0) taxonomy identification pipeline. The Kraken2 report was analyzed using Pavian (academic.oup.com/bioinformatics/article/36/4/1303/5573755?login=false), and resulting genus comparisons were calculating using the abundances of reads in each genus. The percent was calculated by first normalizing the data from each library by the total number of reads in order to compare across libraries.


Results

Applicants captured 127 genera using BacDrop, whereas only 58 genera were captured using 16s rRNA DNA sequencing (FIG. 33; Tables 12 and 13). 54 genera were captured by both methods.


REFERENCES



  • 1 Ackermann, M. A functional perspective on phenotypic heterogeneity in microorganisms. Nat Rev Microbiol 13, 497-508, doi:10.1038/nrmicro3491 (2015).

  • 2 Davis, K. M. & Isberg, R. R. Defining heterogeneity within bacterial populations via single cell approaches. Bioessays 38, 782-790, doi:10.1002/bies.201500121 (2016).

  • 3 Potter, S. S. Single-cell RNA sequencing for the study of development, physiology and disease. Nat Rev Nephrol 14, 479-492, doi:10.1038/s41581-018-0021-7 (2018).

  • 4 Stuart, T. & Satija, R. Integrative single-cell analysis. Nat Rev Genet 20, 257-272, doi:10.1038/s41576-019-0093-7 (2019).

  • 5 Imdahl, F. & Saliba, A. E. Advances and challenges in single-cell RNA-seq of microbial communities. Curr Opin Microbiol 57, 102-110, doi:10.1016/j.mib.2020.10.001 (2020).

  • 6 Taniguchi, Y. et al. Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells. Science 329, 533-538, doi:10.1126/science.1188308 (2010).

  • 7 Blattman, S. B., Jiang, W., Oikonomou, P. & Tavazoie, S. Prokaryotic single-cell RNA sequencing by in situ combinatorial indexing. Nat Microbiol 5, 1192-1201, doi:10.1038/s41564-020-0729-6 (2020).

  • 8 Imdahl, F., Vafadarnejad, E., Homberger, C., Saliba, A. E. & Vogel, J. Single-cell RNA-sequencing reports growth-condition-specific global transcriptomes of individual bacteria. Nat Microbiol 5, 1202-1206, doi: 10.1038/s41564-020-0774-1 (2020).

  • 9 Kuchina, A. et al. Microbial single-cell RNA sequencing by split-pool barcoding. Science 371, doi:10.1126/science.aba5257 (2021).

  • 10 Dar, D., Dar, N., Cai, L. & Newman, D. K. Spatial transcriptomics of planktonic and sessile bacterial populations at single-cell resolution. Science 373, doi:10.1126/science.abi4882 (2021).

  • 11 McNulty, R. S., Duluxan; Liu, Shichen; Hormoz, Sahand; Rosenthal, Adam Z.. Droplet-based single cell RNA sequencing of bacteria identifies known and previously unseen cellular states. bioRxiv preprint, doi:https://doi.org/10.1101/2021.03.10.434868 (2021).12 Dewachter, L., Fauvart, M. & Michiels, J. Bacterial Heterogeneity and Antibiotic Survival: Understanding and Combatting Persistence and Heteroresistance. Mol Cell 76, 255-267, doi:10.1016/j.molcel.2019.09.028 (2019).

  • 13 Andersson, D. I., Nicoloff, H. & Hjort, K. Mechanisms and clinical relevance of bacterial heteroresistance. Nat Rev Microbiol 17, 479-496, doi:10.1038/s41579-019-0218-1 (2019).

  • 14 Centers for Disease Control and Prevention: Antibiotic Resistance Threats in the United States. doi:https://www.cdc.gov/drugresistance/pdf/threatsreport/2019-ar-threats-report-508.pdf (2019).15 Kim, Y. & Wood, T. K. Toxins Hha and CspD and small RNA regulator Hfq are involved in persister cell formation through MqsR in Escherichia coli. Biochem Biophys Res Commun 391, 209-213, doi:10.1016/j.bbrc.2009.11.033 (2010).

  • 16 Yamanaka, K., Zheng, W., Crooke, E., Wang, Y. H. & Inouye, M. CspD, a novel DNA replication inhibitor induced during the stationary phase in Escherichia coli. Mol Microbiol 39, 1572-1584, doi:10.1046/j.1365-2958.2001.02345.x (2001).

  • 17 Macosko, E. Z. et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell 161, 1202-1214, doi:10.1016/j.cell.2015.05.002 (2015).

  • 18 Datlinger, P. et al. Ultra-high-throughput single-cell RNA sequencing and perturbation screening with combinatorial fluidic indexing. Nat Methods 18, 635-642, doi:10.1038/s41592-021-01153-z (2021).

  • 19 Stuart, T. et al. Comprehensive Integration of Single-Cell Data. Cell 177, 1888-1902 e1821, doi:10.1016/j.cell.2019.05.031 (2019).

  • 20 Bhattacharyya, R. P. et al. Simultaneous detection of genotype and phenotype enables rapid and accurate antibiotic susceptibility determination. Nat Med 25, 1858-1864, doi:10.1038/s41591-019-0650-9 (2019).

  • 21 Smith, T., Heger, A. & Sudbery, I. UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy. Genome Res 27, 491-499, doi:10.1101/gr.209601.116 (2017).

  • 22 Ma, P. et al. Genetic determinants facilitating the evolution of resistance to carbapenem antibiotics. Elife 10, doi:10.7554/eLife.67310 (2021).

  • 23 Ma, P., Laibinis, H. H., Ernst, C. M. & Hung, D. T. Carbapenem Resistance Caused by High-Level Expression of OXA-663 beta-Lactamase in an OmpK36-Deficient Klebsiella pneumoniae Clinical Isolate. Antimicrob Agents Chemother 62, doi:10.1128/AAC.01281-18 (2018).

  • 24 Cho, H., Uehara, T. & Bernhardt, T. G. Beta-lactam antibiotics induce a lethal malfunctioning of the bacterial cell wall synthesis machinery. Cell 159, 1300-1311, doi:10.1016/j.cell.2014.11.017 (2014).

  • 25 Van Dyk, T. K., DeRose, E. J. & Gonye, G. E. LuxArray, a high-density, genomewide transcription analysis of Escherichia coli using bioluminescent reporter strains. J Bacteriol 183, 5496-5505, doi:10.1128/JB.183.19.5496-5505.2001 (2001).

  • 26 Zaslaver, A. et al. A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat Methods 3, 623-628, doi:10.1038/nmeth895 (2006).

  • 27 Harkness, R. E., Kusser, W., Qi, B. J. & Ishiguro, E. E. Genetic mapping of the lytA and lytB loci of Escherichia coli, which are involved in penicillin tolerance and control of the stringent response. Can J Microbiol 38, 975-978, doi:10.1139/m92-156 (1992).

  • 28 Shishkin, A. A. et al. Simultaneous generation of many RNA-seq libraries in a single reaction. Nat Methods 12, 323-325, doi:10.1038/nmeth.3313 (2015).

  • 29 Wiegand, I., Hilpert, K. & Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc 3, 163-175, doi:10.1038/nprot.2007.521 (2008).

  • 30 Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760, doi:10.1093/bioinformatics/btp324 (2009).

  • 31 Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930, doi:10.1093/bioinformatics/btt656 (2014).

  • 32 Wright, E. S., Yilmaz, L. S., Corcoran, A. M., Okten, H. E. & Noguera, D. R. Automated design of probes for rRNA-targeted fluorescence in situ hybridization reveals the advantages of using dual probes for accurate identification. Appl Environ Microbiol 80, 5124-5133, doi:10.1128/AEM.01685-14 (2014).

  • 33 Skinner, S. O., Sepulveda, L. A., Xu, H. & Golding, I. Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization. Nat Protoc 8, 1100-1113, doi:10.1038/nprot.2013.066 (2013).

  • 34 Dar, D. D., Nina; Cai, Long; Newman, K. Dianne. In situ single-cell activities of microbial populations revealed by spatial transcriptomics bioRxiv preprint, doi.org/10.1101/2021.02.24.432792 (2021).



TABLES




TABLE 1








RT Primers


Primer ID
plate_name
plate_ well
CB1 sequence
oligo_seq[5′>3′]




P1_01
BacDrop_RT10X_384_plate1
A01
AAGTGATTAGCAA (SEQ ID NO: 3)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAGTGATTAGCAANNNNNN (SEQ ID NO: 4)


P1_02
BacDrop_RT10X_384_plate1
A02
AGAATCCCCCTAA (SEQ ID NO: 5)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGAATCCCCCTAANNNNNN (SEQ ID NO: 6)


P1_03
BacDrop_RT10X_384_plate1
A03
ACCTGGGAAACTA (SEQ ID NO: 7)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACCTGGGAAACTANNNNNN (SEQ ID NO: 8)


P1_04
BacDrop_RT10X_384_platel
A04
ATACCTCCCAGGA (SEQ ID NO: 9)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATACCTCCCAGGANNNNNN (SEQ ID NO: 10)


P1_05
BacDrop_RT10X_384_platel
A05
AATTTGTGGTATA (SEQ ID NO: 11)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAATTTGTGGTATANNNNNN (SEQ ID NO: 12)


P1_06
BacDrop_RT10X_384_platel
A06
ACCCGAGAGATCA (SEQ ID NO: 13)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACCCGAGAGATCANNNNNN (SEQ ID NO: 14)


P1_07
BacDrop_RT10X_384_platel
A07
AGAGTATAGGGTA (SEQ ID NO: 15)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGAGTATAGGGTANNNNNN (SEQ ID NO: 16)


P1_08
BacDrop_RT10X_384_plate1
A08
ATCTTAATTGAGA (SEQ ID NO: 17)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATCTTAATTGAGANNNNNN (SEQ ID NO: 18)


P1_09
BacDrop_RT10X_384_plate1
A09
AACGTTCTGTCGA (SEQ ID NO: 19)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACACNNNNNNNNAACGTTCTGTCGANNNNNN (SEQ ID NO: 20)


P1_10
BacDrop_RT10X_384_plate1
A10
ACATAATGGCGAA (SEQ ID NO: 21)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACATAATGGCGAANNNNNN (SEQ ID NO: 22)


P1_11
BacDrop_RT10X_384_plate1
A11
AGGCCGGAACATA (SEQ ID NO: 23)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGGCCGGAACATANNNNNN (SEQ ID NO: 24)


P1_12
BacDrop_RT10X_384_plate1
A12
ATCACTTCAAGAA (SEQ ID NO: 25)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATCACTTCAAGAANNNNNN (SEQ ID NO: 26)


P1_13
BacDrop_RT10X_384_plate1
B01
AAGCTGGCCTTCA (SEQ ID NO: 27)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAGCTGGCCTTCANNNNNN (SEQ ID NO: 28)


P1_14
BacDrop_RT10X_384_platel1
B02
ACTGCACATTGGA (SEQ ID NO: 29)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACTGCACATTGGANNNNNN (SEQ ID NO: 30)


P1_15
BacDrop_RT10X_384_plate1
B03
AGGTCCTTCGATA (SEQ ID NO: 31)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGGTCCTTCGATANNNNNN (SEQ ID NO: 32)


P1_16
BacDrop_RT10X_384_plate1
B04
ATTCGCACCCGAA (SEQ ID NO: 33)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATTCGCACCCGAANNNNNN (SEQ ID NO: 34)


P1_17
BacDrop_RT10X_384_plate1
B05
ACCGTAAATTACA (SEQ ID NO: 35)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACCGTAAATTACANNNNNN (SEQ ID NO: 36)


P1_18
BacDrop_RT10X_384_plate1
B06
AGTAGTCGATATA (SEQ ID NO: 37)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGTAGTCGATATANNNNNN (SEQ ID NO: 38)


P1_19
BacDrop_RT10X_384_plate1
B07
ATGTAAGAATCAA (SEQ ID NO: 39)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATGTAAGAATCAANNNNNN (SEQ ID NO: 40)


P1_20
BacDrop_RT10X_384_plate1
B08
AAGGCCCGCCGTA (SEQ ID NO: 41)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAGGCCCGCCGTANNNNNN (SEQ ID NO: 42)


P1_21
BacDrop_RT10X_384_plate1
B09
ACTCCACGCAAGA (SEQ ID NO: 43)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACTCCACGCAAGANNNNNN (SEQ ID NO: 44)


P1_22
BacDrop_RT10X_384_plate1
B10
AGTCTTTGATTAA (SEQ ID NO: 45)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGTCTTTGATTAANNNNNN (SEQ ID NO: 46)


P1_23
BacDrop_RT10X_384_plate1
B11
ATAGAGCCCGCCA (SEQ ID NO: 47)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATAGAGCCCGCCANNNNNN (SEQ ID NO: 48)


P1_24
BacDrop_RT10X_384_plate1
B12
AAGAAATGGAGGA (SEQ ID NO: 49)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAGAAATGGAGGANNNNNN (SEQ ID NO: 50)


P1_25
BacDrop_RT10X_384_plate1
C01
TCAGCGCTGGTTA (SEQ ID NO: 51)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCAGCGCTGGTTANNNNNN (SEQ ID NO: 52)


P1_26
BacDrop_RT10X_384_plate1
C02
TGTTGACGAATAA (SEQ ID NO: 53)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGTTGACGAATAANNNNNN (SEQ ID NO: 54)


P1_27
BacDrop_RT10X_384_plate1
C03
TTGCATCAGCGCA (SEQ ID NO: 55)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTGCATCAGCGCANNNNNN (SEQ ID NO: 56)


P1_28
BacDrop_RT10X_384_plate1
C04
TAGCCATATGAGA (SEQ ID NO: 57)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAGCCATATGAGANNNNNN (SEQ ID NO: 58)


P1_29
BacDrop_RT10X_384_plate1
C05
TCCTGCCCCTGTA (SEQ ID NO: 59)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCCTGCCCCTGTANNNNNN (SEQ ID NO: 60)


P1_30
BacDrop_RT10X_384_plate1
C06
TGGTATAAAACCA (SEQ ID NO: 61)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGGTATAAAACCANNNNNN (SEQ ID NO: 62)


P1_31
BacDrop_RT10X_384_plate1
C07
TTAAAGTCATGCA (SEQ ID NO: 63)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTAAAGTCATGCANNNNNN (SEQ ID NO: 64)


P1_32
BacDrop_RT10X_384_plate1
C08
TAGAACTCAGAAA (SEQ ID NO: 65)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAGAACTCAGAAANNNNNN (SEQ ID NO: 66)


P1_33
BacDrop_RT10X_384_plate1
C09
TCAGCTTAATCGC (SEQ ID NO: 67)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCAGCTTAATCGCNNNNNN (SEQ ID NO: 68)


P1_34
BacDrop_RT10X_384_plate1
C10
TGGCTTAAGAGAC (SEQ ID NO: 69)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGGCTTAAGAGACNNNNNN (SEQ ID NO: 70)


P1_35
BacDrop_RT10X_384_plate1
C11
TTCACCTGTCGGC (SEQ ID NO: 71)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTCACCTGTCGGCNNNNNN (SEQ ID NO: 72)


P1_36
BacDrop_RT10X_384_plate1
C12
TATAGTGATACTC (SEQ ID NO: 73)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATAGTGATACTCNNNNNN (SEQ ID NO: 74)


P1_37
BacDrop_RT10X_384_plate1
D01
TCATCAGCGAACC (SEQ ID NO: 75)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCATCAGCGAACCNNNNNN (SEQ ID NO: 76)


P1_38
BacDrop_RT10X_384_plate1
D02
TGCGCCATGGGAC (SEQ ID NO: 77)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGCGCCATGGGACNNNNNN (SEQ ID NO: 78)


P1_39
BacDrop_RT10X_384_plate1
D03
TTGTTGAACTCCC (SEQ ID NO: 79)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTGTTGAACTCCCNNNNNN (SEQ ID NO: 80)


P1_40
BacDrop_RT10X_384_plate1
D04
TATATACGCAGTC (SEQ ID NO: 81)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATATACGCAGTCNNNNNN (SEQ ID NO: 82)


P1_41
BacDrop_RT10X_384_plate1
D05
TCGCACGACGTAC (SEQ ID NO: 83)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCGCACGACGTACNNNNNN (SEQ ID NO: 84)


P1_42
BacDrop_RT10X_384_plate1
D06
TGGGACAGAAGGC (SEQ ID NO: 85)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGGGACAGAAGGCNNNNNN (SEQ ID NO: 86)


P1_43
BacDrop_RT10X_384_plate1
D07
TTTAACAAGTATC (SEQ ID NO: 87)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTTAACAAGTATCNNNNNN (SEQ ID NO: 88)


P1_44
BacDrop_RT10X_384_plate1
D08
TACTCCTGGGTAC (SEQ ID NO: 89)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTACTCCTGGGTACNNNNNN (SEQ ID NO: 90)


P1_45
BacDrop_RT10X_384_plate1
D09
TCAGAAAACCCCC (SEQ ID NO: 91)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCAGAAAACCCCCNNNNNN (SEQ ID NO: 92)


P1_46
BacDrop_RT10X_384_plate1
D10
TGCACGAGCAGTC (SEQ ID NO: 93)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGCACGAGCAGTCNNNNNN (SEQ ID NO: 94)


P1_47
BacDrop_RT10X_384_plate1
D11
TTATTATGCTTCC (SEQ ID NO: 95)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTATTATGCTTCCNNNNNN (SEQ ID NO: 96)


P1_48
BacDrop_RT10X_384_plate1
D12
TAGCGACTGTATC (SEQ ID NO: 97)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAGCGACTGTATCNNNNNN (SEQ ID NO: 98)


P1_49
BacDrop_RT10X_384_plate1
E01
CCCTTGCGACAGC (SEQ ID NO: 99)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCCTTGCGACAGCNNNNNN (SEQ ID NO: 100)


P1_50
BacDrop_RT10X_384_plate1
E02
CGTTAGATTGCAC (SEQ ID NO: 101)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGTTAGATTGCACNNNNNN (SEQ ID NO: 102)


P1_51
BacDrop_RT10X_384_plate1
E03
CTAAATACCATCC (SEQ ID NO: 103)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTAAATACCATCCNNNNNN (SEQ ID NO: 104)


P1_52
BacDrop_RT10X_384_plate1
E04
CATATTTTTTAGC (SEQ ID NO: 105)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCATATTTTTTAGCNNNNNN (SEQ ID NO: 106)


P1_53
BacDrop_RT10X_384_plate1
E05
CCCCTAAACGCTC (SEQ ID NO: 107)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCCCTAAACGCTCNNNNNN (SEQ ID NO: 108)


P1_54
BacDrop_RT10X_384_plate1
E06
CGATTGTTAGGAC (SEQ ID NO: 109)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGATTGTTAGGACNNNNNN (SEQ ID NO: 110)


P1_55
BacDrop_RT10X_384_plate1
E07
CTACCGAGTCTCC (SEQ ID NO: 111)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTACCGAGTCTCCNNNNNN (SEQ ID NO: 112)


P1_56
BacDrop_RT10X_384_plate1
E08
CAGAACAAATTGC (SEQ ID NO: 113)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAGAACAAATTGCNNNNNN (SEQ ID NO: 114)


P1_57
BacDrop_RT10X_384_plate1
E09
CCTTGATCTCATC (SEQ ID NO: 115)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCTTGATCTCATCNNNNNN (SEQ ID NO: 116)


P1_58
BacDrop_RT10X_384_plate1
E10
CGCCACGCGTTAC (SEQ ID NO: 117)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGCCACGCGTTACNNNNNN (SEQ ID NO: 118)


P1_59
BacDrop_RT10X_384_plate1
E11
CTATAGATACGGC (SEQ ID NO: 119)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTATAGATACGGCNNNNNN (SEQ ID NO: 120)


P1_60
BacDrop_RT10X_384_plate1
E12
CATACCCAGCCAC (SEQ ID NO: 121)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCATACCCAGCCACNNNNNN (SEQ ID NO: 122)


P1_61
BacDrop_RT10X_384_plate1
F01
CCCCGGATGTACC (SEQ ID NO: 123)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCCCGGATGTACCNNNNNN (SEQ ID NO: 124)


P1_62
BacDrop_RT10X_384_plate1
F02
CGATCTCGGCTTC (SEQ ID NO: 125)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGATCTCGGCTTCNNNNNN (SEQ ID NO: 126)


P1_63
BacDrop_RT10X_384_plate1
F03
CTAGCCGCTTTGC (SEQ ID NO: 127)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTAGCCGCTTTGCNNNNNN (SEQ ID NO: 128)


P1_64
BacDrop_RT10X_384_plate1
F04
CCTAAATACAGCC (SEQ ID NO: 129)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCTAAATACAGCCNNNNNN (SEQ ID NO: 130)


P1_65
BacDrop_RT10X_384_plate1
F05
CGGGTTTTACCAG (SEQ ID NO: 131)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGGGTTTTACCAGNNNNNN (SEQ ID NO: 132)


P1_66
BacDrop_RT10X_384_plate1
F06
CATATCCATTGCG (SEQ ID NO: 133)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCATATCCATTGCGNNNNNN (SEQ ID NO: 134)


P1_67
BacDrop_RT10X_384_plate1
F07
CCTCCCGAGAGTG (SEQ ID NO: 135)
TCGTCGG CAGCGTCAGATGTGTATAAGAGACAG N N N N N N N N CCTCCCGAGAGTG N N N N N N (SEQ ID NO: 136)


P1_68
BacDrop_RT10X_384_plate1
F08
CGAATATCTCCGG (SEQ ID NO: 137)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGAATATCTCCGGNNNNNN (SEQ ID NO: 138)


P1_69
BacDrop_RT10X_384_plate1
F09
CTACTAACCCACG (SEQ ID NO: 139)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTACTAACCCACGNNNNNN (SEQ ID NO: 140)


P1_70
BacDrop_RT10X_384_plate1
F10
CAAATGATACAAG (SEQ ID NO: 141)
TCGTCGG CAGCGTCAGATGTGTATAAGAGACAG N N N N N N N N CAAATGATACAAG N N N N N N (SEQ ID NO: 142)


P1_71
BacDrop_RT10X_384_plate1
F11
CCCCCATTATTTG (SEQ ID NO: 143)
TCGTCGG CAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCCCCATTATTTGNNNNNN (SEQ ID NO: 144)


P1_72
BacDrop_RT10X_384_plate1
F12
CGAGTCGCGACGG (SEQ ID NO: 145)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGAGTCGCGACGGNNNNNN (SEQ ID NO: 146)


P1_73
BacDrop_RT10X_384_plate1
G01
GTGGTTGTGGCCG (SEQ ID NO: 147)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGGTTGTGGCCGNNNNNN (SEQ ID NO: 148)


P1_74
BacDrop_RT10X_384_plate1
G02
GATTCAAGGAAAG (SEQ ID NO: 149)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGATTCAAGGAAAGNNNNNN (SEQ ID NO: 150)


P1_75
BacDrop_RT10X_384_plate1
G03
GCCAAGATCTGGG (SEQ ID NO: 151)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCCAAGATCTGGGNNNNNN (SEQ ID NO: 152)


P1_76
BacDrop_RT10X_384_plate1
G04
GATACTGTATCAG (SEQ ID NO: 153)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGATACTGTATCAGNNNNNN (SEQ ID NO: 154)


P1_77
BacDrop_RT10X_384_platel
G05
GCCGATTCGTGCG (SEQ ID NO: 155)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCCGATTCGTGCGNNNNNN (SEQ ID NO: 156)


P1_78
BacDrop_RT10X_384_plate1
G06
GTGACAACGCTGG (SEQ ID NO: 157)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGACAACGCTGGNNNNNN (SEQ ID NO: 158)


P1_79
BacDrop_RT10X_384_plate1
G07
GGGCTGTCTTATG (SEQ ID NO: 159)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGGCTGTCTTATGNNNNNN (SEQ ID NO: 160)


P1_80
BacDrop_RT10X_384_plate1
G08
GACCCTGGCCTGG (SEQ ID NO: 161)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGACCCTGGCCTGGNNNNNN (SEQ ID NO: 162)


P1_81
BacDrop_RT10X_384_plate1
G09
GCGTACGCTTATG (SEQ ID NO: 163)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCGTACGCTTATGNNNNNN (SEQ ID NO: 164)


P1_82
BacDrop_RT10X_384_plate1
G10
GTTGCACTTAATG (SEQ ID NO: 165)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTTGCACTTAATGNNNNNN (SEQ ID NO: 166)


P1_83
BacDrop_RT10X_384_plate1
G11
GGACAAAGAGAAG (SEQ ID NO: 167)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGACAAAGAGAAGNNNNNN (SEQ ID NO: 168)


P1_84
BacDrop_RT10X_384_plate1
G12
GAACCACAGCACG (SEQ ID NO: 169)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAACCACAGCACGNNNNNN (SEQ ID NO: 170)


P1_85
BacDrop_RT10X_384_plate1
H01
GCTTATCTAGAGG (SEQ ID NO: 171)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCTTATCTAGAGGNNNNNN (SEQ ID NO: 172)


P1_86
BacDrop_RT10X_384_plate1
H02
GTAATGTGGTCAG (SEQ ID NO: 173)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTAATGTGGTCAGNNNNNN (SEQ ID NO: 174)


P1_87
BacDrop_RT10X_384_plate1
H03
GGCGCGCGAGCTG (SEQ ID NO: 175)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGCGCGCGAGCTGNNNNNN (SEQ ID NO: 176)


P1_88
BacDrop_RT10X_384_plate1
H04
GTCCATGTGTGTG (SEQ ID NO: 177)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTCCATGTGTGTGNNNNNN (SEQ ID NO: 178)


P1_89
BacDrop_RT10X_384_plate1
H05
GGGAGGAATCCAG (SEQ ID NO: 179)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGGAGGAATCCAGNNNNNN (SEQ ID NO: 180)


P1_90
BacDrop_RT10X_384_plate1
H06
GATCAAAATAGGG (SEQ ID NO: 181)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGATCAAAATAGGGNNNNNN (SEQ ID NO: 182)


P1_91
BacDrop_RT10X_384_plate1
H07
GCAAGACTGCCAG (SEQ ID NO: 183)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCAAGACTGCCAGNNNNNN (SEQ ID NO: 184)


P1_92
BacDrop_RT10X_384_plate1
H08
GTAGGATGGACCG (SEQ ID NO: 185)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTAGGATGGACCGNNNNNN (SEQ ID NO: 186)


P1_93
BacDrop_RT10X_384_plate1
H09
GGATCGGACCTAG (SEQ ID NO: 187)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGATCGGACCTAGNNNNNN (SEQ ID NO: 188)


P1_94
BacDrop_RT10X_384_plate1
H10
GCCCAAAGGAATG (SEQ ID NO: 189)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCCCAAAGGAATGNNNNNN (SEQ ID NO: 190)


P1_95
BacDrop_RT10X_384_plate1
H11
GTACCTAACGCAG (SEQ ID NO: 191)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTACCTAACGCAGNNNNNN (SEQ ID NO: 192)


P1_96
BacDrop_RT10X_384_plate1
H12
GGTCAGGTTCAGG (SEQ ID NO: 193)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGTCAGGTTCAGGNNNNNN (SEQ ID NO: 194)


P2_01
BacDrop_RT10X_384_plate2
A01
AACCTCCAACCCA (SEQ ID NO: 195)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAACCTCCAACCCANNNNNN (SEQ ID NO: 196)


P2_02
BacDrop_RT10X_384_plate2
A02
ACGTTTCAGCCAA (SEQ ID NO: 197)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACGTTTCAGCCAANNNNNN (SEQ ID NO: 198)


P2_03
BacDrop_RT10X_384_plate2
A03
ATAAGGTTAGATA (SEQ ID NO: 199)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATAAGGTTAGATANNNNNN (SEQ ID NO: 200)


P2_04
BacDrop_RT10X_384_plate2
A04
AATATACCAGACA (SEQ ID NO: 201)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAATATACCAGACANNNNNN (SEQ ID NO: 202)


P2_05
BacDrop_RT10X_384_plate2
A05
AGGAGAGACTGTA (SEQ ID NO: 203)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGGAGAGACTGTANNNNNN (SEQ ID NO: 204)


P2_06
BacDrop_RT10X_384_plate2
A06
ACTCATCTTAGCA (SEQ ID NO: 205)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACTCATCTTAGCANNNNNN (SEQ ID NO: 206)


P2_07
BacDrop_RT10X_384_plate2
A07
AAATTTGGCCGTA (SEQ ID NO: 207)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAATTTGGCCGTANNNNNN (SEQ ID NO: 208)


P2_08
BacDrop_RT10X_384_plate2
A08
ATTAAGGAAGTAA (SEQ ID NO: 209)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATTAAGGAAGTAANNNNNN (SEQ ID NO: 210)


P2_09
BacDrop_RT10X_384_plate2
A09
AACCGATCCAGAA (SEQ ID NO: 211)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAACCGATCCAGAANNNNNN (SEQ ID NO: 212)


P2_10
BacDrop_RT10X_384_plate2
A10
ACAACGGGACTGA (SEQ ID NO: 213)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACAACGGGACTGANNNNNN (SEQ ID NO: 214)


P2_11
BacDrop_RT10X_384_plate2
A11
ATCCAGTACAACA (SEQ ID NO: 215)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATCCAGTACAACANNNNNN (SEQ ID NO: 216)


P2_12
BacDrop_RT10X_384_plate2
A12
AGAGGACGATGCA (SEQ ID NO: 217)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGAGGACGATGCANNNNNN (SEQ ID NO: 218)


P2_13
BacDrop_RT10X_384_plate2
B01
AAAGGGTCGCTTA (SEQ ID NO: 219)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAAGGGTCGCTTANNNNNN (SEQ ID NO: 220)


P2_14
BacDrop_RT10X_384_plate2
B02
ACCCATGTAGCAA (SEQ ID NO: 221)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACCCATGTAGCAANNNNNN (SEQ ID NO: 222)


P2_15
BacDrop_RT10X_384_plate2
B03
AGTGAAGTGGACA (SEQ ID NO: 223)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGTGAAGTGGACANNNNNN (SEQ ID NO: 224)


P2_16
BacDrop_RT10X_384_plate2
B04
ATAATAATTACAA (SEQ ID NO: 225)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATAATAATTACAANNNNNN (SEQ ID NO: 226)


P2_17
BacDrop_RT10X_384_plate2
B05
AGCTGTAACGTGA (SEQ ID NO: 227)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGCTGTAACGTGANNNNNN (SEQ ID NO: 228)


P2_18
BacDrop_RT10X_384_plate2
B06
AAAAAGCTGCGTA (SEQ ID NO: 229)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAAAAGCTGCGTANNNNNN (SEQ ID NO: 230)


P2_19
BacDrop_RT10X_384_plate2
B07
ACGCGCAAACAGA (SEQ ID NO: 231)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACGCGCAAACAGANNNNNN (SEQ ID NO: 232)


P2_20
BacDrop_RT10X_384_plate2
B08
ATAATTTTCCCCA (SEQ ID NO: 233)
TCGTCGG CAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATAATTTTCCCCANNNNNN (SEQ ID NO: 234)


P2_21
BacDrop_RT10X_384_plate2
B09
AGGATACTGGTTA (SEQ ID NO: 235)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGGATACTGGTTANNNNNN (SEQ ID NO: 236)


P2_22
BacDrop_RT10X_384_plate2
B10
AAGGGGGAAGCGA (SEQ ID NO: 237)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAGGGGGAAGCGANNNNNN (SEQ ID NO: 238)


P2_23
BacDrop_RT10X_384_plate2
B11
ACAACGCCAAAAA (SEQ ID NO: 239)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACAACGCCAAAAANNNNNN (SEQ ID NO: 240)


P2_24
BacDrop_RT10X_384_plate2
B12
AACGAAGCCTGTA (SEQ ID NO: 241)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAACGAAGCCTGTANNNNNN (SEQ ID NO: 242)


P2_25
BacDrop_RT10X_384_plate2
C01
TTACGTTGCCAGA (SEQ ID NO: 243)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTACGTTGCCAGANNNNNN (SEQ ID NO: 244)


P2_26
BacDrop_RT10X_384_plate2
C02
TAATTAACTTATA (SEQ ID NO: 245)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAATTAACTTATANNNNNN (SEQ ID NO: 246)


P2_27
BacDrop_RT10X_384_plate2
C03
TCTCGGTATGGGA (SEQ ID NO: 247)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCTCGGTATGGGANNNNNN (SEQ ID NO: 248)


P2_28
BacDrop_RT10X_384_plate2
C04
TTCGTGTGAATTA (SEQ ID NO: 249)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTCGTGTGAATTANNNNNN (SEQ ID NO: 250)


P2_29
BacDrop_RT10X_384_plate2
C05
TATAATTAGTTCA (SEQ ID NO: 251)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATAATTAGTTCANNNNNN (SEQ ID NO: 252)


P2_30
BacDrop_RT10X_384_plate2
C06
TGGCTAATTCCTA (SEQ ID NO: 253)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGGCTAATTCCTANNNNNN (SEQ ID NO: 254)


P2_31
BacDrop_RT10X_384_plate2
C07
TAGAAGGTCGTGA (SEQ ID NO: 255)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAGAAGGTCGTGANNNNNN (SEQ ID NO: 256)


P2_32
BacDrop_RT10X_384_plate2
C08
TCGTGAGGGGGTA (SEQ ID NO: 257)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCGTGAGGGGGTANNNNNN (SEQ ID NO: 258)


P2_33
BacDrop_RT10X_384_plate2
C09
TTAGGCTAAAGGC (SEQ ID NO: 259)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTAGGCTAAAGGCNNNNNN (SEQ ID NO: 260)


P2_34
BacDrop_RT10X_384_plate2
C10
TGAAGTGGCTTCC (SEQ ID NO: 261)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGAAGTGGCTTCCNNNNNN (SEQ ID NO: 262)


P2_35
BacDrop_RT10X_384_plate2
C11
TATCGCATAGCGC (SEQ ID NO: 263)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATCGCATAGCGCNNNNNN (SEQ ID NO: 264)


P2_36
BacDrop_RT10X_384_plate2
C12
TCTCCTAAGCTCC (SEQ ID NO: 265)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCTCCTAAGCTCCNNNNNN (SEQ ID NO: 266)


P2_37
BacDrop_RT10X_384_plate2
D01
TAAATCATGATTC (SEQ ID NO: 267)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAAATCATGATTCNNNNNN (SEQ ID NO: 268)


P2_38
BacDrop_RT10X_384_plate2
D02
TCGCATACGGAAC (SEQ ID NO: 269)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCGCATACGGAACNNNNNN (SEQ ID NO: 270)


P2_39
BacDrop_RT10X_384_plate2
D03
TTGCAGCCACAGC (SEQ ID NO: 271)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTGCAGCCACAGCNNNNNN (SEQ ID NO: 272)


P2_40
BacDrop_RT10X_384_plate2
D04
TACCTGGTGCTTC (SEQ ID NO: 273)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTACCTGGTGCTTCNNNNNN (SEQ ID NO: 274)


P2_41
BacDrop_RT10X_384_plate2
D05
TGTTTTCATAAGC (SEQ ID NO: 275)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGTTTTCATAAGCNNNNNN (SEQ ID NO: 276)


P2_42
BacDrop_RT10X_384_plate2
D06
TAAACTGAGATGC (SEQ ID NO: 277)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAAACTGAGATGCNNNNNN (SEQ ID NO: 278)


P2_43
BacDrop_RT10X_384_plate2
D07
TCAGTGCGCTGTC (SEQ ID NO: 279)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCAGTGCGCTGTCNNNNNN (SEQ ID NO: 280)


P2_44
BacDrop_RT10X_384_plate2
D08
TTGAGTGGGCCAC (SEQ ID NO: 281)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTGAGTGGGCCACNNNNNN (SEQ ID NO: 282)


P2_45
BacDrop_RT10X_384_plate2
D09
TATTCTCTCAACC (SEQ ID NO: 283)
TCGTCGG CAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATTCTCTCAACCNNNNNN (SEQ ID NO: 284)


P2_46
BacDrop_RT10X_384_plate2
D10
TCCTCCTTTACGC (SEQ ID NO: 285)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCCTCCTTTACGCNNNNNN (SEQ ID NO: 286)


P2_47
BacDrop_RT10X_384_plate2
D11
TAGAGAACTTTAC (SEQ ID NO: 287)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAGAGAACTTTACNNNNNN (SEQ ID NO: 288)


P2_48
BacDrop_RT10X_384_plate2
D12
TTACTACCAGGTC (SEQ ID NO: 289)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTACTACCAGGTCNNNNNN (SEQ ID NO: 290)


P2_49
BacDrop_RT10X_384_plate2
E01
CATTGCTACATCC (SEQ ID NO: 291)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCATTGCTACATCCNNNNNN (SEQ ID NO: 292)


P2_50
BacDrop_RT10X_384_plate2
E02
CGGAGTCACACGC (SEQ ID NO: 293)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGGAGTCACACGCNNNNNN (SEQ ID NO: 294)


P2_51
BacDrop_RT10X_384_plate2
E03
CCGGTGGAGCTCC (SEQ ID NO: 295)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCGGTGGAGCTCCNNNNNN (SEQ ID NO: 296)


P2_52
BacDrop_RT10X_384_plate2
E04
CTTCGGCCCAATC (SEQ ID NO: 297)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTTCGGCCCAATCNNNNNN (SEQ ID NO: 298)


P2_53
BacDrop_RT10X_384_plate2
E05
CACGAGACACCCC (SEQ ID NO: 299)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCACGAGACACCCCNNNNNN (SEQ ID NO: 300)


P2_54
BacDrop_RT10X_384_plate2
E06
CGTCTAGACAAAC (SEQ ID NO: 301)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGTCTAGACAAACNNNNNN (SEQ ID NO: 302)


P2_55
BacDrop_RT10X_384_plate2
E07
CACCGTACGTTGC (SEQ ID NO: 303)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCACCGTACGTTGCNNNNNN (SEQ ID NO: 304)


P2_56
BacDrop_RT10X_384_plate2
E08
CCTAACCCTCTCC (SEQ ID NO: 305)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCTAACCCTCTCCNNNNNN (SEQ ID NO: 306)


P2_57
BacDrop_RT10X_384_plate2
E09
CTAGATTTAACTC (SEQ ID NO: 307)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTAGATTTAACTCNNNNNN (SEQ ID NO: 308)


P2_58
BacDrop_RT10X_384_plate2
E10
CAGATTAGAGTAC (SEQ ID NO: 309)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAGATTAGAGTACNNNNNN (SEQ ID NO: 310)


P2_59
BacDrop_RT10X_384_plate2
E11
CGGGACGTTTTCC (SEQ ID NO: 311)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGGGACGTTTTCCNNNNNN (SEQ ID NO: 312)


P2_60
BacDrop_RT10X_384_plate2
E12
CTATACCAAGAAC (SEQ ID NO: 313)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTATACCAAGAACNNNNNN (SEQ ID NO: 314)


P2_61
BacDrop_RT10X_384_plate2
F01
CCGGCGAGCCAGC (SEQ ID NO: 315)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCGGCGAGCCAGCNNNNNN (SEQ ID NO: 316)


P2_62
BacDrop_RT10X_384_plate2
F02
CATTTGAAAACGC (SEQ ID NO: 317)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCATTTGAAAACGCNNNNNN (SEQ ID NO: 318)


P2_63
BacDrop_RT10X_384_plate2
F03
CCCCTTTCTGGAC (SEQ ID NO: 319)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCCCTTTCTGGACNNNNNN (SEQ ID NO: 320)


P2_64
BacDrop_RT10X_384_plate2
F04
CTGACTGCAGCGC (SEQ ID NO: 321)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTGACTGCAGCGCNNNNNN (SEQ ID NO: 322)


P2_65
BacDrop_RT10X_384_plate2
F05
CACGATCAAGTTG (SEQ ID NO: 323)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCACGATCAAGTTGNNNNNN (SEQ ID NO: 324)


P2_66
BacDrop_RT10X_384_plate2
F06
CGAAATGCTGACG (SEQ ID NO: 325)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGAAATGCTGACGNNNNNN (SEQ ID NO: 326)


P2_67
BacDrop_RT10X_384_plate2
F07
CGCTACCTGAAGG (SEQ ID NO: 327)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGCTACCTGAAGGNNNNNN (SEQ ID NO: 328)


P2_68
BacDrop_RT10X_384_plate2
F08
CAGGAACTACACG (SEQ ID NO: 329)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAGGAACTACACGNNNNNN (SEQ ID NO: 330)


P2_69
BacDrop_RT10X_384_plate2
F09
CTCGGCCGGTCAG (SEQ ID NO: 331)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTCGGCCGGTCAGNNNNNN (SEQ ID NO: 332)


P2_70
BacDrop_RT10X_384_plate2
F10
CTTTTCCAGCGTG (SEQ ID NO: 333)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTTTTCCAGCGTGNNNNNN (SEQ ID NO: 334)


P2_71
BacDrop_RT10X_384_plate2
F11
CAATCGTAGCCGG (SEQ ID NO: 335)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAATCGTAGCCGGNNNNNN (SEQ ID NO: 336)


P2_72
BacDrop_RT10X_384_plate2
F12
CGTAAACTACGAG (SEQ ID NO: 337)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGTAAACTACGAGNNNNNN (SEQ ID NO: 338)


P2_73
BacDrop_RT10X_384_plate2
G01
GACGAGTATCTGG (SEQ ID NO: 339)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGACGAGTATCTGGNNNNNN (SEQ ID NO: 340)


P2_74
BacDrop_RT10X_384_plate2
G02
GCAAAGGGTGGTG (SEQ ID NO: 341)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCAAAGGGTGGTGNNNNNN (SEQ ID NO: 342)


P2_75
BacDrop_RT10X_384_plate2
G03
GTAGGTGAGAAAG (SEQ ID NO: 343)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTAGGTGAGAAAGNNNNNN (SEQ ID NO: 344)


P2_76
BacDrop_RT10X_384_plate2
G04
GAGCGGATTAGTG (SEQ ID NO: 345)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAGCGGATTAGTGNNNNNN (SEQ ID NO: 346)


P2_77
BacDrop_RT10X_384_plate2
G05
GGTTTGTATGTCG (SEQ ID NO: 347)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGTTTGTATGTCGNNNNNN (SEQ ID NO: 348)


P2_78
BacDrop_RT10X_384_plate2
G06
GAACACATCTGAG (SEQ ID NO: 349)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAACACATCTGAGNNNNNN (SEQ ID NO: 350)


P2_79
BacDrop_RT10X_384_plate2
G07
GCTACCAATGACG (SEQ ID NO: 351)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCTACCAATGACGNNNNNN (SEQ ID NO: 352)


P2_80
BacDrop_RT10X_384_plate2
G08
GTGAGGGCTCGGG (SEQ ID NO: 353)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGAGGGCTCGGGNNNNNN (SEQ ID NO: 354)


P2_81
BacDrop_RT10X_384_plate2
G09
GAAATGTGTCGCG (SEQ ID NO: 355)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAAATGTGTCGCGNNNNNN (SEQ ID NO: 356)


P2_82
BacDrop_RT10X_384_plate2
G10
GGCCCACACCGGG (SEQ ID NO: 357)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGCCCACACCGGGNNNNNN (SEQ ID NO: 358)


P2_83
BacDrop_RT10X_384_plate2
G11
GCCGGTAGCTCCG (SEQ ID NO: 359)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCCGGTAGCTCCGNNNNNN (SEQ ID NO: 360)


P2_84
BacDrop_RT10X_384_plate2
G12
GAAGAATTATGGG (SEQ ID NO: 361)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAAGAATTATGGGNNNNNN (SEQ ID NO: 362)


P2_85
BacDrop_RT10X_384_plate2
H01
GTCTCGTCATATG (SEQ ID NO: 363)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTCTCGTCATATGNNNNNN (SEQ ID NO: 364)


P2_86
BacDrop_RT10X_384_plate2
H02
GGACTTTTGGTCG (SEQ ID NO: 365)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGACTTTTGGTCGNNNNNN (SEQ ID NO: 366)


P2_87
BacDrop_RT10X_384_plate2
H03
GATTTCGTTCCAG (SEQ ID NO: 367)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGATTTCGTTCCAGNNNNNN (SEQ ID NO: 368)


P2_88
BacDrop_RT10X_384_plate2
H04
GTCCCGGAGCCAG (SEQ ID NO: 369)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTCCCGGAGCCAGNNNNNN (SEQ ID NO: 370)


P2_89
BacDrop_RT10X_384_plate2
H05
GGGGGGCCGGACG (SEQ ID NO: 371)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGGGGGCCGGACGNNNNNN (SEQ ID NO: 372)


P2_90
BacDrop_RT10X_384_plate2
H06
GACTACGTTTGGG (SEQ ID NO: 373)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGACTACGTTTGGGNNNNNN (SEQ ID NO: 374)


P2_91
BacDrop_RT10X_384_plate2
H07
GCTTTAATCTAAG (SEQ ID NO: 375)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCTTTAATCTAAGNNNNNN (SEQ ID NO: 376)


P2_92
BacDrop_RT10X_384_plate2
H08
GAGGCAAAAATCG (SEQ ID NO: 377)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAGGCAAAAATCGNNNNNN (SEQ ID NO: 378)


P2_93
BacDrop_RT10X_384_plate2
H09
GTTTGATTCTCGG (SEQ ID NO: 379)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTTTGATTCTCGGNNNNNN (SEQ ID NO: 380)


P2_94
BacDrop_RT10X_384_plate2
H10
GAGGGACATCGAG (SEQ ID NO: 381)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAGGGACATCGAGNNNNNN (SEQ ID NO: 382)


P2_95
BacDrop_RT10X_384_plate2
H11
GGATCCTTACCCG (SEQ ID NO: 383)
TCGTCGG CAGCGTCAGATGTGTATAAGAGACAG NNNNNNNNGGATCCTTACCCG NNNNNN (SEQ ID NO: 384)


P2_96
BacDrop_RT10X_384_plate2
H12
GCGATCCTCGCGG (SEQ ID NO: 385)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCGATCCTCGCGGNNNNNN (SEQ ID NO: 386)


P3_01
BacDrop_RT10X_384_plate3
A01
ATATTGGCACTTA (SEQ ID NO: 387)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATATTGGCACTTANNNNNN (SEQ ID NO: 388)


P3_02
BacDrop_RT10X_384_plate3
A02
AAAAGAATCGCCA (SEQ ID NO: 389)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAAAGAATCGCCANNNNNN (SEQ ID NO: 390)


P3_03
BacDrop_RT10X_384_plate3
A03
AGGAAGCCCATTA (SEQ ID NO: 391)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGGAAGCCCATTANNNNNN (SEQ ID NO: 392)


P3_04
BacDrop_RT10X_384_plate3
A04
ACCCCTTCGCAGA (SEQ ID NO: 393)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACCCCTTCGCAGANNNNNN (SEQ ID NO: 394)


P3_05
BacDrop_RT10X_384_plate3
A05
ATGTCTATTCACA (SEQ ID NO: 395)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATGTCTATTCACANNNNNN (SEQ ID NO: 396)


P3_06
BacDrop_RT10X_384_plate3
A06
AGAACGCTTTGAA (SEQ ID NO: 397)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGAACGCTTTGAANNNNNN (SEQ ID NO: 398)


P3_07
BacDrop_RT10X_384_plate3
A07
AAGGGACCCACCA (SEQ ID NO: 399)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAGGGACCCACCANNNNNN (SEQ ID NO: 400)


P3_08
BacDrop_RT10X_384_plate3
A08
ACACATCGTTTTA (SEQ ID NO: 401)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACACATCGTTTTANNNNNN (SEQ ID NO: 402)


P3_09
BacDrop_RT10X_384_plate3
A09
AATGGTTCTCCGA (SEQ ID NO: 403)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAATGGTTCTCCGANNNNNN (SEQ ID NO: 404)


P3_10
BacDrop_RT10X_384_plate3
A10
ATGCCGCTGAAAA (SEQ ID NO: 405)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATGCCGCTGAAAANNNNNN (SEQ ID NO: 406)


P3_11
BacDrop_RT10X_384_plate3
A11
AAACACTCTAGTA (SEQ ID NO: 407)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAACACTCTAGTANNNNNN (SEQ ID NO: 408)


P3_12
BacDrop_RT10X_384_plate3
A12
ATCCTCGGGGTCA (SEQ ID NO: 409)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATCCTCGGGGTCANNNNNN (SEQ ID NO: 410)


P3_13
BacDrop_RT10X_384_plate3
B01
AAGAATCGCTAGA (SEQ ID NO: 411)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAGAATCGCTAGANNNNNN (SEQ ID NO: 412)


P3_14
BacDrop_RT10X_384_plate3
B02
AGAAGTCAGGTAA (SEQ ID NO: 413)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGAAGTCAGGTAANNNNNN (SEQ ID NO: 414)


P3_15
BacDrop_RT10X_384_plate3
B03
ACGCGGCTCATCA (SEQ ID NO: 415)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACGCGGCTCATCANNNNNN (SEQ ID NO: 416)


P3_16
BacDrop _RT10X _384 _plate3
B04
AAACCCAAATATA (SEQ ID NO: 417)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAACCCAAATATANNNNNN (SEQ ID NO: 418)


P3_17
BacDrop _RT10X _384 _plate3
B05
ATCTCAGAACTGA (SEQ ID NO: 419)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATCTCAGAACTGANNNNNN (SEQ ID NO: 420)


P3_18
BacDrop_RT10X_384_plate3
B06
AGCAATTAGGAGA (SEQ ID NO: 421)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGCAATTAGGAGANNNNNN (SEQ ID NO: 422)


P3_19
BacDrop_RT10X _384 _plate3
B07
AAGTAAACGCGTA (SEQ ID NO: 423)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAGTAAACGCGTANNNNNN (SEQ ID NO: 424)


P3_20
BacDrop_RT10X _384 _plate3
B08
ACATACAGCATGA (SEQ ID NO: 425)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACATACAGCATGANNNNNN (SEQ ID NO: 426)


P3_21
BacDrop_RT10X _384 _plate3
B09
AACGCAGAGAGAA (SEQ ID NO: 427)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAACGCAGAGAGAANNNNNN (SEQ ID NO: 428)


P3_22
BacDrop_RT10X _384 _plate3
B10
ATGACGCGATTTA (SEQ ID NO: 429)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATGACGCGATTTANNNNNN (SEQ ID NO: 430)


P3_23
BacDrop_RT10X_384_plate3
B11
AAACATTCACCAA (SEQ ID NO: 431)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAACATTCACCAANNNNNN (SEQ ID NO: 432)


P3_24
BacDrop _RT10X _384 _plate3
B12
AGGCCTCATATTA (SEQ ID NO: 433)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGGCCTCATATTANNNNNN (SEQ ID NO: 434)


P3_25
BacDrop _RT10X _384 _plate3
C01
TGACGCTCACTGA (SEQ ID NO: 435)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGACGCTCACTGANNNNNN (SEQ ID NO: 436)


P3_26
BacDrop _RT10X _384 _plate3
C02
TCCGGGCGGAGCA (SEQ ID NO: 437)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCCGGGCGGAGCANNNNNN (SEQ ID NO: 438)


P3_27
BacDrop _RT10X _384 _plate3
C03
TTTCCCGTTTAAA (SEQ ID NO: 439)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTTCCCGTTTAAANNNNNN (SEQ ID NO: 440)


P3_28
BacDrop_RT10X _384 _plate3
C04
TGTAACTGAGTGA (SEQ ID NO: 441)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGTAACTGAGTGANNNNNN (SEQ ID NO: 442)


P3_29
BacDrop_RT10X _384 _plate3
C05
TAACCTATGCCTA (SEQ ID NO: 443)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAACCTATGCCTANNNNNN (SEQ ID NO: 444)


P3_30
BacDrop_RT10X _384 _plate3
C06
TCCAAAGAACATA (SEQ ID NO: 445)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCCAAAGAACATANNNNNN (SEQ ID NO: 446)


P3_31
BacDrop_RT10X _384 _plate3
C07
TTCTCGGGTGACA (SEQ ID NO: 447)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTCTCGGGTGACANNNNNN (SEQ ID NO: 448)


P3_32
BacDrop_RT10X _384 _plate3
C08
TGGTGTTGTTTTA (SEQ ID NO: 449)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGGTGTTGTTTTANNNNNN (SEQ ID NO: 450)


P3_33
BacDrop _RT10X _384 _plate3
C09
TAACCCGTAGTAC (SEQ ID NO: 451)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAACCCGTAGTACNNNNNN (SEQ ID NO: 452)


P3_34
BacDrop _RT10X _384 _plate3
C10
TCTGCCTACTAAC (SEQ ID NO: 453)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCTGCCTACTAACNNNNNN (SEQ ID NO: 454)


P3_35
BacDrop _RT10X _384 _plate3
C11
TTCAGTATTTATC (SEQ ID NO: 455)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTCAGTATTTATCNNNNNN (SEQ ID NO: 456)


P3_36
BacDrop _RT10X _384 _plate3
C12
TGCTAGGGAAAAC (SEQ ID NO: 457)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGCTAGGGAAAACNNNNNN (SEQ ID NO: 458)


P3_37
BacDrop _RT10X _384 _plate3
D01
TAGTTACGAGGGC (SEQ ID NO: 459)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAGTTACGAGGGCNNNNNN (SEQ ID NO: 460)


P3_38
BacDrop_RT10X _384 _plate3
D02
TCGACCTAGGTTC (SEQ ID NO: 461)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCGACCTAGGTTCNNNNNN (SEQ ID NO: 462)


P3_39
BacDrop_RT10X _384 _plate3
D03
TGCCTCGATAGGC (SEQ ID NO: 463)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGCCTCGATAGGCNNNNNN (SEQ ID NO: 464)


P3_40
BacDrop_RT10X _384 _plate3
D04
TATTAGTCAAACC (SEQ ID NO: 465)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATTAGTCAAACCNNNNNN (SEQ ID NO: 466)


P3_41
BacDrop_RT10X _384 _plate3
D05
TCTTACTGAACTC (SEQ ID NO: 467)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCTTACTGAACTCNNNNNN (SEQ ID NO: 468)


P3_42
BacDrop_RT10X _384 _plate3
D06
TTCAATTGTGCAC (SEQ ID NO: 469)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTCAATTGTGCACNNNNNN (SEQ ID NO: 470)


P3_43
BacDrop _RT10X _384 _plate3
D07
TGTACATGTCACC (SEQ ID NO: 471)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGTACATGTCACCNNNNNN (SEQ ID NO: 472)


P3_44
BacDrop _RT10X _384 _plate3
D08
TACGTATCATTAC (SEQ ID NO: 473)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTACGTATCATTACNNNNNN (SEQ ID NO: 474)


P3_45
BacDrop _RT10X _384 _plate3
D09
TCATGGACTCTGC (SEQ ID NO: 475)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCATGGACTCTGCNNNNNN (SEQ ID NO: 476)


P3_46
BacDrop _RT10X _384 _plate3
D10
TTCATGCTCCATC (SEQ ID NO: 477)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTCATGCTCCATCNNNNNN (SEQ ID NO: 478)


P3_47
BacDrop _RT10X _384 _plate3
D11
TGCTAACTCTGCC (SEQ ID NO: 479)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGCTAACTCTGCCNNNNNN (SEQ ID NO: 480)


P3_48
BacDrop_RT10X _384 _plate3
D12
TCCCTACTTCAAC (SEQ ID NO: 481)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCCCTACTTCAACNNNNNN (SEQ ID NO: 482)


P3_49
BacDrop_RT10X _384 _plate3
E01
CAGTACTACGCGC (SEQ ID NO: 483)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAGTACTACGCGCNNNNNN (SEQ ID NO: 484)


P3_50
BacDrop_RT10X _384 _plate3
E02
CTCACCGGCTATC (SEQ ID NO: 485)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTCACCGGCTATCNNNNNN (SEQ ID NO: 486)


P3_51
BacDrop_RT10X _384 _plate3
E03
CACTATTTAATAC (SEQ ID NO: 487)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCACTATTTAATACNNNNNN (SEQ ID NO: 488)


P3_52
BacDrop_RT10X_384_plate3
E04
CCGGACTTGCTGC (SEQ ID NO: 489)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCGGACTTGCTGCNNNNNN (SEQ ID NO: 490)


P3_53
BacDrop _RT10X _384 _plate3
E05
CTCACATCTTCCC (SEQ ID NO: 491)
TCGTCGG CAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTCACATCTTCCCNNNNNN (SEQ ID NO: 492)


P3_54
BacDrop _RT10X _384 _plate3
E06
CGACCACCTGTAC (SEQ ID NO: 493)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGACCACCTGTACNNNNNN (SEQ ID NO: 494)


P3_55
BacDrop_RT10X_384_plate3
E07
CATCAATCCCAGC (SEQ ID NO: 495)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCATCAATCCCAGCNNNNNN (SEQ ID NO: 496)


P3_56
BacDrop_RT10X _384 _plate3
E08
CCCAAGCAGGCCC (SEQ ID NO: 497)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCCAAGCAGGCCCNNNNNN (SEQ ID NO: 498)


P3_57
BacDrop_RT10X _384 _plate3
E09
CTGTGCATAGTTC (SEQ ID NO: 499)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTGTGCATAGTTCNNNNNN (SEQ ID NO: 500)


P3_58
BacDrop_RT10X _384 _plate3
E10
CAACGCAGTCCAC (SEQ ID NO: 501)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAACGCAGTCCACNNNNNN (SEQ ID NO: 502)


P3_59
BacDrop_RT10X _384 _plate3
E11
CGCGTTGGTAATC (SEQ ID NO: 503)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGCGTTGGTAATCNNNNNN (SEQ ID NO: 504)


P3_60
BacDrop_RT10X_384_plate3
E12
CCTTCAGTAGGAC (SEQ ID NO: 505)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCTTCAGTAGGACNNNNNN (SEQ ID NO: 506)


P3_61
BacDrop _RT10X _384 _plate3
F01
CTAGCCTTCTGTC (SEQ ID NO: 507)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTAGCCTTCTGTCNNNNNN (SEQ ID NO: 508)


P3_62
BacDrop _RT10X _384 _plate3
F02
CGTCCCACGAAGC (SEQ ID NO: 509)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGTCCCACGAAGCNNNNNN (SEQ ID NO: 510)


P3_63
BacDrop _RT10X _384 _plate3
F03
CTAGTTCCTATTC (SEQ ID NO: 511)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTAGTTCCTATTCNNNNNN (SEQ ID NO: 512)


P3_64
BacDrop _RT10X _384 _plate3
F04
CCCCAACCGGTGC (SEQ ID NO: 513)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCCCAACCGGTGCNNNNNN (SEQ ID NO: 514)


P3_65
BacDrop_RT10X _384 _plate3
F05
CTCTTAAAGATTG (SEQ ID NO: 515)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTCTTAAAGATTGNNNNNN (SEQ ID NO: 516)


P3_66
BacDrop_RT10X _384 _plate3
F06
CGGTCTCCTTGCG (SEQ ID NO: 517)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGGTCTCCTTGCGNNNNNN (SEQ ID NO: 518)


P3_67
BacDrop_RT10X _384 _plate3
F07
CAATGAGCAGAGG (SEQ ID NO: 519)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAATGAGCAGAGGNNNNNN (SEQ ID NO: 520)


P3_68
BacDrop_RT10X _384 _plate3
F08
CCATATTCCCTTG (SEQ ID NO: 521)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCATATTCCCTTGNNNNNN (SEQ ID NO: 522)


P3_69
BacDrop_RT10X _384 _plate3
F09
CTGTTACCCGTAG (SEQ ID NO: 523)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTGTTACCCGTAGNNNNNN (SEQ ID NO: 524)


P3_70
BacDrop _RT10X _384 _plate3
F10
CGATAATTTTCTG (SEQ ID NO: 525)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGATAATTTTCTGNNNNNN (SEQ ID NO: 526)


P3_71
BacDrop _RT10X _384 _plate3
F11
CAACCTTGAGGGG (SEQ ID NO: 527)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAACCTTGAGGGGNNNNNN (SEQ ID NO: 528)


P3_72
BacDrop _RT10X _384 _plate3
F12
CCGATAAAACGCG (SEQ ID NO: 529)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCGATAAAACGCGNNNNNN (SEQ ID NO: 530)


P3_73
BacDrop _RT10X _384 _plate3
G01
GCCTAGAGAGTTG (SEQ ID NO: 531)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCCTAGAGAGTTGNNNNNN (SEQ ID NO: 532)


P3_74
BacDrop _RT10X _384 _plate3
G02
GGTCACCATGGAG (SEQ ID NO: 533)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGTCACCATGGAGNNNNNN (SEQ ID NO: 534)


P3_75
BacDrop_RT10X _384 _plate3
G03
GCTGTGGCCCCGG (SEQ ID NO: 535)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCTGTGGCCCCGGNNNNNN (SEQ ID NO: 536)


P3_76
BacDrop_RT10X _384 _plate3
G04
GTGGGAGGCGAAG (SEQ ID NO: 537)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGGGAGGCGAAGNNNNNN (SEQ ID NO: 538)


P3_77
BacDrop_RT10X _384 _plate3
G05
GGCTGCCGTCACG (SEQ ID NO: 539)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGCTGCCGTCACGNNNNNN (SEQ ID NO: 540)


P3_78
BacDrop_RT10X _384 _plate3
G06
GATCTTCTATGTG (SEQ ID NO: 541)
TCGTCGG CAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGATCTTCTATGTGNNNNNN (SEQ ID NO: 542)


P3_79
BacDrop_RT10X _384 _plate3
G07
GCTACTTGCTCTG (SEQ ID NO: 543)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCTACTTGCTCTGNNNNNN (SEQ ID NO: 544)


P3_80
BacDrop _RT10X _384 _plate3
G08
GTGGGCCTTTAGG (SEQ ID NO: 545)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGGGCCTTTAGGNNNNNN (SEQ ID NO: 546)


P3_81
BacDrop _RT10X _384 _plate3
G09
GGATACACCGGCG (SEQ ID NO: 547)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGATACACCGGCGNNNNNN (SEQ ID NO: 548)


P3_82
BacDrop _RT10X _384 _plate3
G10
GTGCGCTCGGATG (SEQ ID NO: 549)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGCGCTCGGATGNNNNNN (SEQ ID NO: 550)


P3_83
BacDrop _RT10X _384 _plate3
G11
GCACAGGTCAAAG (SEQ ID NO: 551)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCACAGGTCAAAGNNNNNN (SEQ ID NO: 552)


P3_84
BacDrop _RT10X _384 _plate3
G12
GTCTGAGTGCCCG (SEQ ID NO: 553)
TCGTCGG CAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTCTGAGTGCCCGNNNNNN (SEQ ID NO: 554)


P3_85
BacDrop_RT10X _384 _plate3
H01
GGTTGTGTAGCTG (SEQ ID NO: 555)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGTTGTGTAGCTGNNNNNN (SEQ ID NO: 556)


P3_86
BacDrop_RT10X _384 _plate3
H02
GATGCGGGGCGGG (SEQ ID NO: 557)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGATGCGGGGCGGGNNNNNN (SEQ ID NO: 558)


P3_87
BacDrop_RT10X _384 _plate3
H03
GCCGGTGTAAACG (SEQ ID NO: 559)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCCGGTGTAAACGNNNNNN (SEQ ID NO: 560)


P3_88
BacDrop_RT10X _384 _plate3
H04
GTGGCAAGTTCGG (SEQ ID NO: 561)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGGCAAGTTCGGNNNNNN (SEQ ID NO: 562)


P3_89
BacDrop_RT10X_384_plate3
H05
GGTAGAATGAGTG (SEQ ID NO: 563)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGTAGAATGAGTGNNNNNN (SEQ ID NO: 564)


P3_90
BacDrop _RT10X _384 _plate3
H06
GCCCTATGGCCCG (SEQ ID NO: 565)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCCCTATGGCCCGNNNNNN (SEQ ID NO: 566)


P3_91
BacDrop _RT10X _384 _plate3
H07
GTCTATCCTCATG (SEQ ID NO: 567)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTCTATCCTCATGNNNNNN (SEQ ID NO: 568)


P3_92
BacDrop_RT10X_384_plate3
H08
GGAGTGTACTTGG (SEQ ID NO: 569)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGAGTGTACTTGGNNNNNN (SEQ ID NO: 570)


P3_93
BacDrop_RT10X _384 _plate3
H09
GATCGCGAGTACG (SEQ ID NO: 571)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGATCGCGAGTACGNNNNNN (SEQ ID NO: 572)


P3_94
BacDrop_RT10X _384 _plate3
H10
GCGGTCCCAAGTG (SEQ ID NO: 573)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCGGTCCCAAGTGNNNNNN (SEQ ID NO: 574)


P3_95
BacDrop_RT10X _384 _plate3
H11
GTTCTGGGAGAGG (SEQ ID NO: 575)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTTCTGGGAGAGGNNNNNN (SEQ ID NO: 576)


P3_96
BacDrop_RT10X _384 _plate3
H12
GAACTTCGAAAAG (SEQ ID NO: 577)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAACTTCGAAAAGNNNNNN (SEQ ID NO: 578)


P4_01
BacDrop_RT10X_384_plate4
A01
AGCGTCCACACAA (SEQ ID NO: 579)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGCGTCCACACAANNNNNN (SEQ ID NO: 580)


P4_02
BacDrop _RT10X _384 _plate4
A02
ACGAGGTGCCGTA (SEQ ID NO: 581)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACGAGGTGCCGTANNNNNN (SEQ ID NO: 582)


P4_03
BacDrop _RT10X _384 _plate4
A03
ATTTATTAGACGA (SEQ ID NO: 583)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATTTATTAGACGANNNNNN (SEQ ID NO: 584)


P4_04
BacDrop _RT10X _384 _plate4
A04
AGGGCTCCGACAA (SEQ ID NO: 585)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGGGCTCCGACAANNNNNN (SEQ ID NO: 586)


P4_05
BacDrop _RT10X _384 _plate4
A05
AAAGTTTATCAAA (SEQ ID NO: 587)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAAGTTTATCAAANNNNNN (SEQ ID NO: 588)


P4_06
BacDrop_RT10X _384 _plate4
A06
ACACGTGTGCGGA (SEQ ID NO: 589)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACACGTGTGCGGANNNNNN (SEQ ID NO: 590)


P4_07
BacDrop_RT10X _384 _plate4
A07
AACGTCAAGGATA (SEQ ID NO: 591)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAACGTCAAGGATANNNNNN (SEQ ID NO: 592)


P4_08
BacDrop_RT10X _384 _plate4
A08
AGTGACAGCTACA (SEQ ID NO: 593)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGTGACAGCTACANNNNNN (SEQ ID NO: 594)


P4_09
BacDrop_RT10X _384 _plate4
A09
AAGCTTTACATGA (SEQ ID NO: 595)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAGCTTTACATGANNNNNN (SEQ ID NO: 596)


P4_10
BacDrop_RT10X _384 _plate4
A10
ATATGAACAACTA (SEQ ID NO: 597)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATATGAACAACTANNNNNN (SEQ ID NO: 598)


P4_11
BacDrop _RT10X _384 _plate4
A11
AGTAGATCGCTAA (SEQ ID NO: 599)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGTAGATCGCTAANNNNNN (SEQ ID NO: 600)


P4_12
BacDrop _RT10X _384 _plate4
A12
AAAGCGTCTACCA (SEQ ID NO: 601)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAAGCGTCTACCANNNNNN (SEQ ID NO: 602)


P4_13
BacDrop _RT10X _384 _plate4
B01
ACATTTTTGAAGA (SEQ ID NO: 603)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACATTTTTGAAGANNNNNN (SEQ ID NO: 604)


P4_14
BacDrop _RT10X _384 _plate4
B02
ATGTAGCTTACCA (SEQ ID NO: 605)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATGTAGCTTACCANNNNNN (SEQ ID NO: 606)


P4_15
BacDrop _RT10X _384 _plate4
B03
AGTGAGCGGCAAA (SEQ ID NO: 607)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGTGAGCGGCAAANNNNNN (SEQ ID NO: 608)


P4_16
BacDrop_RT10X _384 _plate4
B04
AATGAGCCTGATA (SEQ ID NO: 609)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAATGAGCCTGATANNNNNN (SEQ ID NO: 610)


P4_17
BacDrop_RT10X _384 _plate4
B05
ATCGAAACGAGGA (SEQ ID NO: 611)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATCGAAACGAGGANNNNNN (SEQ ID NO: 612)


P4_18
BacDrop_RT10X _384 _plate4
B06
AGACAGTAGTCCA (SEQ ID NO: 613)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGACAGTAGTCCANNNNNN (SEQ ID NO: 614)


P4_19
BacDrop_RT10X _384 _plate4
B07
ATTTAGCTCGGTA (SEQ ID NO: 615)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATTTAGCTCGGTANNNNNN (SEQ ID NO: 616)


P4_20
BacDrop_RT10X _384 _plate4
B08
AGCTTGAGGACCA (SEQ ID NO: 617)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAGCTTGAGGACCANNNNNN (SEQ ID NO: 618)


P4_21
BacDrop _RT10X _384 _plate4
B09
AACAGACGCCTAA (SEQ ID NO: 619)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAACAGACGCCTAANNNNNN (SEQ ID NO: 620)


P4_22
BacDrop _RT10X _384 _plate4
B10
ATTGGACAGGGCA (SEQ ID NO: 621)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNATTGGACAGGGCANNNNNN (SEQ ID NO: 622)


P4_23
BacDrop _RT10X _384 _plate4
B11
AAAATTCAGTATA (SEQ ID NO: 623)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNAAAATTCAGTATANNNNNN (SEQ ID NO: 624)


P4_24
BacDrop _RT10X _384 _plate4
B12
ACTGTCGAAATAA (SEQ ID NO: 625)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNACTGTCGAAATAANNNNNN (SEQ ID NO: 626)


P4_25
BacDrop _RT10X _384 _plate4
C01
TTGGGTATCAGGA (SEQ ID NO: 627)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTGGGTATCAGGANNNNNN (SEQ ID NO: 628)


P4_26
BacDrop_RT10X _384 _plate4
C02
TGCTATCAGTCTA (SEQ ID NO: 629)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGCTATCAGTCTANNNNNN (SEQ ID NO: 630)


P4_27
BacDrop_RT10X _384 _plate4
C03
TAAGGCGGTAAGA (SEQ ID NO: 631)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTAAGGCGGTAAGANNNNNN (SEQ ID NO: 632)


P4_28
BacDrop_RT10X _384 _plate4
C04
TCGATTGGGTTTA (SEQ ID NO: 633)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCGATTGGGTTTANNNNNN (SEQ ID NO: 634)


P4_29
BacDrop_RT10X _384 _plate4
C05
TTGCCCAGCATAA (SEQ ID NO: 635)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTGCCCAGCATAANNNNNN (SEQ ID NO: 636)


P4_30
BacDrop_RT10X_384_plate4
C06
TGCACTGGGCGCA (SEQ ID NO: 637)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGCACTGGGCGCANNNNNN (SEQ ID NO: 638)


P4_31
BacDrop_RT10X_384_plate4
C07
TATGGGAATAAAA (SEQ ID NO: 639)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATGGGAATAAAANNNNNN (SEQ ID NO: 640)


P4_32
BacDrop_RT10X_384_plate4
C08
TCTACCCGGTTGA (SEQ ID NO: 641)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCTACCCGGTTGANNNNNN (SEQ ID NO: 642)


P4_33
BacDrop_RT10X_384_plate4
C09
TCATCCAGATCAC (SEQ ID NO: 643)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCATCCAGATCACNNNNNN (SEQ ID NO: 644)


P4_34
BacDrop_RT10X_384_plate4
C10
TGAAGCAATTAGC (SEQ ID NO: 645)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGAAGCAATTAGCNNNNNN (SEQ ID NO: 646)


P4_35
BacDrop_RT10X_384_plate4
C11
TATGGCGTCCTTC (SEQ ID NO: 647)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATGGCGTCCTTCNNNNNN (SEQ ID NO: 648)


P4_36
BacDrop_RT10X_384_plate4
C12
TCAATATATTGAC (SEQ ID NO: 649)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCAATATATTGACNNNNNN (SEQ ID NO: 650)


P4_37
BacDrop_RT10X_384_plate4
D01
TTTGGACGACCGC (SEQ ID NO: 651)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTTGGACGACCGCNNNNNN (SEQ ID NO: 652)


P4_38
BacDrop_RT10X_384_plate4
D02
TGATTGACCAAAC (SEQ ID NO: 653)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGATTGACCAAACNNNNNN (SEQ ID NO: 654)


P4_39
BacDrop_RT10X_384_plate4
D03
TCGAACATACCTC (SEQ ID NO: 655)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCGAACATACCTCNNNNNN (SEQ ID NO: 656)


P4_40
BacDrop_RT10X_384_plate4
D04
TTTCATCCAATAC (SEQ ID NO: 657)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTTCATCCAATACNNNNNN (SEQ ID NO: 658)


P4_41
BacDrop_RT10X_384_plate4
D05
TGCGGGAAAGGCC (SEQ ID NO: 659)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGCGGGAAAGGCCNNNNNN (SEQ ID NO: 660)


P4_42
BacDrop_RT10X_384_plate4
D06
TCAGGGATCACTC (SEQ ID NO: 661)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCAGGGATCACTCNNNNNN (SEQ ID NO: 662)


P4_43
BacDrop_RT10X_384_plate4
D07
TGTGTTACTTCCC (SEQ ID NO: 663)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGTGTTACTTCCCNNNNNN (SEQ ID NO: 664)


P4_44
BacDrop_RT10X_384_plate4
D08
TACGGGTGTTGAC (SEQ ID NO: 665)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTACGGGTGTTGACNNNNNN (SEQ ID NO: 666)


P4_45
BacDrop_RT10X_384_plate4
D09
TCCTGATGGTAGC (SEQ ID NO: 667)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTCCTGATGGTAGCNNNNNN (SEQ ID NO: 668)


P4_46
BacDrop_RT10X_384_plate4
D10
TTTCGTGCTTTCC (SEQ ID NO: 669)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTTTCGTGCTTTCCNNNNNN (SEQ ID NO: 670)


P4_47
BacDrop_RT10X_384_plate4
D11
TGACGCGACGATC (SEQ ID NO: 671)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTGACGCGACGATCNNNNNN (SEQ ID NO: 672)


P4_48
BacDrop_RT10X_384_plate4
D12
TATTGTTAACGAC (SEQ ID NO: 673)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATTGTTAACGACNNNNNN (SEQ ID NO: 674)


P4_49
BacDrop_RT10X_384_plate4
E01
CCAAGCGCGTCCC (SEQ ID NO: 675)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCAAGCGCGTCCCNNNNNN (SEQ ID NO: 676)


P4_50
BacDrop_RT10X_384_plate4
E02
CTTATCGTCAAGC (SEQ ID NO: 677)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTTATCGTCAAGCNNNNNN (SEQ ID NO: 678)


P4_51
BacDrop_RT10X_384_plate4
E03
CCTAGAAGTCGAC (SEQ ID NO: 679)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCTAGAAGTCGACNNNNNN (SEQ ID NO: 680)


P4_52
BacDrop_RT10X_384_plate4
E04
CTCGGCATGATCC (SEQ ID NO: 681)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTCGGCATGATCCNNNNNN (SEQ ID NO: 682)


P4_53
BacDrop_RT10X_384_plate4
E05
CGACGGCGCACAC (SEQ ID NO: 683)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGACGGCGCACACNNNNNN (SEQ ID NO: 684)


P4_54
BacDrop_RT10X_384_plate4
E06
CAGACCGTGGACC (SEQ ID NO: 685)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAGACCGTGGACCNNNNNN (SEQ ID NO: 686)


P4_55
BacDrop_RT10X_384_plate4
E07
CCAGGTGACGGCC (SEQ ID NO: 687)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCAGGTGACGGCCNNNNNN (SEQ ID NO: 688)


P4_56
BacDrop_RT10X_384_plate4
E08
CTCGTGTCGGAGC (SEQ ID NO: 689)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTCGTGTCGGAGCNNNNNN (SEQ ID NO: 690)


P4_57
BacDrop_RT10X_384_plate4
E09
CTTTCGTGTAGAC (SEQ ID NO: 691)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAC CT T TCGTGTTAGACNNNNNN (SEQ ID NO: 692)


P4_58
BacDrop_RT10X_384_plate4
E10
CGCCAGTGCTTTC (SEQ ID NO: 693)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGCCAGTGCTTTCNNNNNN (SEQ ID NO: 694)


P4_59
BacDrop_RT10X_384_plate4
E11
CATGTTGCGGGAC (SEQ ID NO: 695)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCATGTTGCGGGACNNNNNN (SEQ ID NO: 696)


P4_60
BacDrop_RT10X_384_plate4
E12
CCGCTTGTATAGC (SEQ ID NO: 697)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCGCTTGTATAGCNNNNNN (SEQ ID NO: 698)


P4_61
BacDrop_RT10X_384_plate4
F01
CTCGTCACTGGCC (SEQ ID NO: 699)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTCGTCACTGGCCNNNNNN (SEQ ID NO: 700)


P4_62
BacDrop_RT10X_384_plate4
F02
CGCTTTTACTGAC (SEQ ID NO: 701)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGCTTTTACTGACNNNNNN (SEQ ID NO: 702)


P4_63
BacDrop_RT10X_384_plate4
F03
CAGCAGGGACGCC (SEQ ID NO: 703)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCAGCAGGGACGCCNNNNNN (SEQ ID NO: 704)


P4_64
BacDrop_RT10X_384_plate4
F04
CCCGCTCGACTAC (SEQ ID NO: 705)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCCGCTCGACTACNNNNNN (SEQ ID NO: 706)


P4_65
BacDrop_RT10X_384_plate4
F05
CTTCTGATTTTGG (SEQ ID NO: 707)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTTCTGATTTTGGNNNNNN (SEQ ID NO: 708)


P4_66
BacDrop_RT10X_384_plate4
F06
CGATGTGCGTGTG (SEQ ID NO: 709)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGATGTGCGTGTGNNNNNN (SEQ ID NO: 710)


P4_67
BacDrop_RT10X_384_plate4
F07
CACCCCGCTCCTG (SEQ ID NO: 711)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCACCCCGCTCCTGNNNNNN (SEQ ID NO: 712)


P4_68
BacDrop_RT10X_384_plate4
F08
CCAGATTGTAACG (SEQ ID NO: 713)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCAGATTGTAACGNNNNNN (SEQ ID NO: 714)


P4_69
BacDrop_RT10X_384_plate4
F09
CTGCTCCACCAAG (SEQ ID NO: 715)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCTGCTCCACCAAGNNNNNN (SEQ ID NO: 716)


P4_70
BacDrop_RT10X_384_plate4
F10
CGCGATATTCGGG (SEQ ID NO: 717)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCGCGATATTCGGGNNNNNN (SEQ ID NO: 718)


P4_71
BacDrop_RT10X_384_plate4
F11
CACAGGGGCAACG (SEQ ID NO: 719)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCACAGGGGCAACGNNNNNN (SEQ ID NO: 720)


P4_72
BacDrop_RT10X_384_plate4
F12
CCTCTGATCCGTG (SEQ ID NO: 721)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNCCTCTGATCCGTGNNNNNN (SEQ ID NO: 722)


P4_73
BacDrop_RT10X_384_plate4
G01
GTCATTGACTTGG (SEQ ID NO: 723)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTCATTGACTTGGNNNNNN (SEQ ID NO: 724)


P4_74
BacDrop_RT10X_384_plate4
G02
GGGAAATCGTACG (SEQ ID NO: 725)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGGAAATCGTACGNNNNNN (SEQ ID NO: 726)


P4_75
BacDrop_RT10X_384_plate4
G03
GAACTTACTGCGG (SEQ ID NO: 727)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAACTTACTGCGGNNNNNN (SEQ ID NO: 728)


P4_76
BacDrop_RT10X_384_plate4
G04
GCGACGGATTAAG (SEQ ID NO: 729)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCGACGGATTAAGNNNNNN (SEQ ID NO: 730)


P4_77
BacDrop_RT10X_384_plate4
G05
GTTGCGATGTCCG (SEQ ID NO: 731)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTTGCGATGTCCGNNNNNN (SEQ ID NO: 732)


P4_78
BacDrop_RT10X_384_plate4
G06
GGGATCGCACAGG (SEQ ID NO: 733)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGGATCGCACAGGNNNNNN (SEQ ID NO: 734)


P4_79
BacDrop_RT10X_384_plate4
G07
GACCAAATTGTAG (SEQ ID NO: 735)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGACCAAATTGTAGNNNNNN (SEQ ID NO: 736)


P4_80
BacDrop_RT10X_384_plate4
G08
GCTGGTCAGTTTG (SEQ ID NO: 737)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCTGGTCAGTTTGNNNNNN (SEQ ID NO: 738)


P4_81
BacDrop_RT10X_384_plate4
G09
GGCCAAGGCGCCG (SEQ ID NO: 739)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGCCAAGGCGCCGNNNNNN (SEQ ID NO: 740)


P4_82
BacDrop_RT10X_384_plate4
G10
GATGTAAGTCTTG (SEQ ID NO: 741)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGATGTAAGTCTTGNNNNNN (SEQ ID NO: 742)


P4_83
BacDrop_RT10X_384_plate4
G11
GGGTGCTCCACAG (SEQ ID NO: 743)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGGTGCTCCACAGNNNNNN (SEQ ID NO: 744)


P4_84
BacDrop_RT10X_384_plate4
G12
GCTGGTAGAGGTG (SEQ ID NO: 745)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCTGGTAGAGGTGNNNNNN (SEQ ID NO: 746)


P4_85
BacDrop_RT10X_384_plate4
H01
GGCAGATTCCAGG (SEQ ID NO: 747)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGCAGATTCCAGGNNNNNN (SEQ ID NO: 748)


P4_86
BacDrop_RT10X_384_plate4
H02
GATGGTTGCAATG (SEQ ID NO: 749)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGATGGTTGCAATGNNNNNN (SEQ ID NO: 750)


P4_87
BacDrop_RT10X_384_plate4
H03
GGCGGGTAGATAG (SEQ ID NO: 751)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGCGGGTAGATAGNNNNNN (SEQ ID NO: 752)


P4_88
BacDrop_RT10X_384_plate4
H04
GCCACTCTTGGGG (SEQ ID NO: 753)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCCACTCTTGGGGNNNNNN (SEQ ID NO: 754)


P4_89
BacDrop_RT10X_384_plate4
H05
GGTGAGGTATGTG (SEQ ID NO: 755)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGTGAGGTATGTGNNNNNN (SEQ ID NO: 756)


P4_90
BacDrop_RT10X_384_plate4
H06
GAACGTTTATACG (SEQ ID NO: 757)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGAACGTTTATACGNNNNNN (SEQ ID NO: 758)


P4_91
BacDrop_RT10X_384_plate4
H07
GGTGCCGCCAGCG (SEQ ID NO: 759)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGTGCCGCCAGCGNNNNNN (SEQ ID NO: 760)


P4_92
BacDrop_RT10X_384_plate4
H08
GCGCGTTACTCAG (SEQ ID NO: 761)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCGCGTTACTCAGNNNNNN (SEQ ID NO: 762)


P4_93
BacDrop_RT10X_384_plate4
H09
GTGATTGATGGAG (SEQ ID NO: 763)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGATTGATGGAGNNNNNN (SEQ ID NO: 764)


P4_94
BacDrop_RT10X_384_plate4
H10
GGTTACGGGCCGG (SEQ ID NO: 765)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGGTTACGGGCCGGNNNNNN (SEQ ID NO: 766)


P4_95
BacDrop_RT10X_384_plate4
H11
GACCAGCATACAG (SEQ ID NO: 767)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGACCAGCATACAGNNNNNN (SEQ ID NO: 768)


P4_96
BacDrop_RT10X_384_plate4
H12
GCGAGTTTAATGG (SEQ ID NO: 769)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGCGAGTTTAATGGNNNNNN (SEQ ID NO: 770)









TABLE 2











Bacterial Strains and plasmids used in this study


Strain Name
Species
Description
MICs of Meropenem (ug/mL)
MICs of Ciprofloxacin (ug/mL)
MICs of Gentamicin (ug/mL)
Reference
Accession no.




MGH66

K. pneumoniae

A K. pneumoniae clinical isolate, susceptible to carbapenems, ciprofloxacin, and gentamicin
0.03
0.03
1
Ma et al., eLife, 2021
GCA_00069455 5.1


BIDMC35

K. pneumoniae

A carbapenemresistant K. pneumoniae clinical isolate
>32
>32
0.5
Ma et al., AAC, 2018
GCA_00056722 5.2


UCI38

K. pneumoniae

A K. pneumoniae clinical isolate, susceptible to carbapenems, resistant to ciprofloxacin and gentamicin
0.03
32
2
Ma et al., eLife, 2021
GCA_00056680 5.1


E. coli 10ß

E. coli


E. coli strain from NEB

<0.03
<0.03
<0.03
NEB
GCF_00000886 5.2


PAO1

P. aeruginosa

A P. aeruginosa pathogenic isolate
Not tested
Not tested
Not tested
Stover et al., Nature 2000
GCF_00000676 5.1


EnGen0052-E3346

E. faecium

An E. faecium human commensal isolate
Not tested
Not tested
Not tested
Lebreton et al., Cell, 2017
GCA_00032228 5.1


gfp.low

E. coli


E. coli expressing a GFP reporter driven by the promoter of spy

Not tested
Not tested
Not tested
Zaslaver, A. et al, Nature Method, 2006



gfp.mid

E. coli


E. coli expressing a GFP reporter driven by the promoter of rpoH

Not tested
Not tested
Not tested
Zaslaver, A. et al, Nature Method, 2006



gfp.high

E. coli


E. coli expressing a GFP reporter driven by the promoter of rpsM

Not tested
Not tested
Not tested
Zaslaver, A. et al, Nature Method, 2006



MGH66: PyhcN:gfp

K. pneumoniae

MGH66 expressing a GFP reporter driven by the promoter of yhcN
0.03
0.03
1
This study



MGH66: PcpsD:gfp

K. pneumoniae

MGH66 expressing a GFP reporter driven by the promoter of cspD
0.03
0.03
1
This study



pUA139
plasmid




Zaslaver, A. et al, Nature Method, 2006



pUA139-PyhcN:gfp
plasmid




This study



pUA139-PcspD:gfp
plasmid




This study



MGH66:pBA D: cspD

K. pneumoniae

MGH66 transformed with pBAD:cspD
0.03
Not tested
Not tested
This study










TABLE 3












Prophage predicted in BIDMC35


Candidate ID
SequenceID
Start
End
Length
Category
Score
Closest phage
Gene number




Candidate_34
JCMW02000001.1
2417098
2452250
35153
Active
0.99
Escherichia phage TL-2011b
40


Candidate_86
JCMW02000004.1
10520
88007
77488
Active
0.88
Salmonella phage SSU5
81









TABLE 4













Markers gene identified from significant clusters of the meropenem treated sample


GeneID
Gene product
Pathway
Biological processes
Cluster
p_val
avg_lo g2FC
pct.1
pct.2
p_val_ adj




cds-WP-032430210.1
PBP3
Target of beta-lactams
Target of beta-lactams
9
0.00E+ 00
5.2957
0.712
0.013
0.00E+ 00


cds-WP-032429893.1
PBP6
Target of beta-lactams
Target of beta-lactams
5_12
5.46E-44
3.7036 599
0.257
0.01
1.81E-40


cds-WP-002921264.1
DtpB
Transportation of beta-lactams
Dipeptide/Tripeptide Transport
7_11
0.00E+ 00
6.2815 94
0.619
0.004
0.00E+ 00


cds-WP-002913995.1
SuhB
Membrane protein transport and insertion
Cell wall/membrane synthesis
7_11
4.19E-129
4.4065 98
0.381
0.008
1.39E-125


cds-WP-004151320.1
LpxH
Lipid A biosynthesis
Cell wall/membrane synthesis
7_11
0.00E+ 00
7.6053 74
0.976
0.002
0.00E+ 00


cds-WP-002918241.1
Nlpl
Cell wall synthesis, bind to PBP4 and PBP1A
Cell wall/membrane synthesis
7_11
7.64E-91
3.4877 22
0.833
0.059
2.54E-87


cds-WP-002883303.1
RffG
LPS synthesis
Cell wall/membrane synthesis
7_11
1.80E-110
4.2802 85
0.476
0.015
5.97E-107


cds-WP-004149864.1
DnaG
DNA replication
DNA replication
9
0.00E+ 00
4.4907 15
0.862
0.029
0.00E+ 00


cds-WP-004150295.1
YidC
Membrane damage response
Stress response
5_12
2.48E-103
4.0687 447
1
0.068
8.25E-100


cds-WP-004217130.1
Spy
Membrane damage response
Stress response
5_12
7.00E-102
4.0142 941
0.124
0.007
2.33E-98


cds-WP-002914070.1
RseB
Membrane damage response
Stress response
5_12
6.81E-222
5.1874 707
0.886
0.022
2.26E-218


cds-WP-032428421.1
YhcN
Cytoplasmic acid stress
Stress response
5_12
0.00E+ 00
6.1654 092
0.486
0.003
0.00E+ 00


cds-WP-032429693.1
HscA
Cold shock
Stress response
5_12
1.73E-29
3.2262 902
0.257
0.015
5.75E-26


cds-WP-002903315.1
FumC
Oxidative stress
Stress response
9
0.00E+ 00
5.3042 57
0.262
0.001
0.00E+ 00


cds-WP-002910443.1
YchF
Oxidative stress
Stress response
9
0.00E+ 00
5.2866 79
0.912
0.017
0.00E+ 00


cds-WP-004152420.1
GroES
Stress response
Stress response
9
7.24E-265
4.5107 94
0.588
0.016
2.41E-261


cds-WP-032430200.1
RihC
DNA damage response
Stress response
10
0.00E+ 00
6.1612 2
0.472
0.002
0.00E+ 00


cds-WP-002896516.1
CspD
Persister formation
DNA replication inhibition
10
0.00E+ 00
6.3423 85
0.509
0.001
0.00E+ 00


cds-WP-013815099.1-4
IS903B
Insertion sequence
Mobile genetic elements
4_6_8
0
4.4631 17
0.489
0.017
0









TABLE 5











Reagent lists and cost



Item
Supplier
Supplier
PN/CN

Cost per 1 sample (USD, estimated)
Cost per cell (~1e6 cells/sample; USD, estimated)


A1) Fixation and permeabilization, with rRNA and gDNA depletion












NxGen RNase Inhibitor
Lucigen
Lucigen
30281-2

60
0.00006



Lysozyme
ThermoFisher
ThermoFisher
90082






NEBNext rRNA Depletion Kit
NEB
NEB
E7850X






DNase I
Sigma
Sigma
AMPD1






SUPERase-In RNase inhibitor
ThermoFishe r
ThermoFisher
AM2696

















A2) In-cell reverse transcription, R1 barcoding, and poly-A tailing












Round 1 Barcodes
IDT
IDT


500
0.0005



Maxima H Minus reverse transcriptase
Thermo Scientific
ThermoFisher
EP0753






DTT
??
ProMega
P1171






dNTPs
??
NEB
N0447L






Terminal transferase (TdT)
NEB
NEB
M0315L






dATP
NEB
NEB
N0446S






SUPERase-In RNase inhibitor
ThermoFishe r
ThermoFisher
AM2696

















A3) Droplet generation and R2 barcoding












Chromium Next GEM Chip H
10X Genomics
10X Genomics
1000161

1500
0.0015



Chromium Next GEM Single Cell ATAC Library & Gel Bead Kit
10X Genomics
10X Genomics
1000176






KAPA HiFi HotStart ReadyMix
Roche
Roche
KK2602






5% FC-40 oil
RAN Biotechnolog ies
RAN Biotechnologies
008-FluoroSurf actant-5wtF






SMRT_dT
IDT??
IDT


















A4) cDNA amplification and Illumina library construction












Buffer EB
Qiagen
Qiagen
19086

200
0.0002



Primer P5

IDT







Primer SMRT_PCR

IDT







5X SYBR Green
VWR
VWR
12001-796






Illumina Nextera XT DNA library preparation kit
Illumina
Illumina
FC-131-1096






Primer P5
IDT
IDT







Nextera index 1 primer
Nextera
Illumina
FC-131-2001






AMPure XP beads
Beckman Coulter
Beckman Coulter
A63881

















B) Sequencing












NovaSeq 6000 SP
Illumina
Illumina


3250
0.00325


Total Costs





5510
0.00551









TABLE 6






Other primers used in this study


Primer Name
Sequence
Comments




SMRT_dT
AAGCAGTGGTATCAACGCAGAGTTTTTTTTTTTTTTTVN (SEQ ID NO: 771)
2nd strand synthesis after TdT treatment with dATP


SMRT_PCR
AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO: 772)
used for cDNA amplification


P5
AATGATACGGCGACCACCGAGA (SEQ ID NO: 773)
P5 partial primer, used for cDNA amplification (paired with SMRT_PCR) and for library construction (paired with Nextera index primers N7**)


cspD_F
ACTGGGATCCATGCAGATGGCGGTTTAATCGCAT (SEQ ID NO: 774)
Primers used to amplify the promoter of cspD from MGH66 and ligate into pUA139.


cspD_R
ACTGCTCGAGATGCCAT ACT TCG ACA TCC TTC GT (SEQ ID NO: 775)



YhcN_F
ACTGGGATCCATGCAAGCGTTGTGATGAGAACAT (SEQ ID NO: 776)
Primers used to amplify the promoter of cspD from MGH66 and ligate into pUA139.


YhcN_R
ACTGCTCGAGATGCGAT GTT CAC CTC GTC GAA TC (SEQ ID NO: 777)










TABLE 7










Number of PC used in the analysis


Experiment
Sample_name
Sample_type
Downsample
Number of cells in the analysis
min.Feature
Number of PC




MGH66_combined
MGH66_combined
between population
No
~60k
15
9


MGH66_combined
MGH66_combined
between population
50%
~30k
15
10


MGH66_combined
MGH66_combined
between population
25%
~15k
15
5


MGH66_combined
MGH66_combined
between population
10%
~7k
15
5


MGH66_combined
MGH66_combined
between population
No
~150k
10
10


MGH66_combined
MGH66_combined
between population
50%
~70k
10
10


MGH66
MGH66_untreated
within population
No
~40k
15
5


MGH66
MGH66_untreated
within population
50%
~20k
15
5


MGH66
MGH66_untreated
within population
25%
~10k
15
7


MGH66
MGH66_meropenem
within population
No
~10k
15
5


BIDMC35
BIDMC35
within population
No
~10k
10
10









TABLE 8




Counts table of the E. coli library with 10k cells. Table organized as Geneid, Chr, Start, End, Strand, Length, E. coli_10k; Geneid, Chr, Start, End, Strand, Length, E. coli_10k; etc




cds-WP_001386572.1, NZ_CP025268.1, 190, 255, +, 66, 0; cds-WP_001264707.1, NZ_CP025268.1, 337, 2799, +, 2463, 1181867; cds-WP_000241662.1, NZ_CP025268.1, 2801, 3733, +, 933, 57154; cds-WP_000781074.1, NZ_CP025268.1, 3734, 5020, +, 1287, 102096; cds-WP_000738719.1, NZ_CP025268.1, 5234, 5530, +, 297, 32407; cds-WP_000906197.1, NZ_CP025268.1, 5683, 6459, -, 777, 436; cds-CXP41_RS00035, NZ_CP025268.1, 6529, 7960, -, 1432, 0; cds-WP_000130185.1, NZ_CP025268.1, 8239, 9192, +, 954, 137861; cds-WP_001295414.1, NZ_CP025268.1, 9307, 9894, +, 588, 171445; cds-WP_000528538.1, NZ_CP025268.1, 9929, 10495, -, 567, 246268; cds-WP_101348525.1, NZ_CP025268.1, 10644, 11357, -, 714, 58514; cds-WP_000843565.1, NZ_CP025268.1, 11383, 11787, -, 405, 0; cds-WP_000516135.1, NZ_CP025268.1, 12164, 14080, +, 1917, 2865083; cds-WP_101348526.1, NZ_CP025268.1, 14169, 15299, +, 1131, 1239622; cds-WP_001300563.1, NZ_CP025268.1, 15446, 16558, +, 1113, 135079; cds-WP_000809168.1, NZ_CP025268.1, 16752, 16904, -, 153, 418; cds-WP_000681354.1, NZ_CP025268.1, 17490, 18656, +, 1167, 112; cds-WP_001338226.1, NZ_CP025268.1, 18722, 19621, +, 900, 10211; cds-CXP41_RS24330, NZ_CP025268.1, 19659, 19796, -, 138, 5; cds-CXP41_RS00100, NZ_CP025268.1, 19812, 20509, -, 698, 156287; cds-WP_001274021.1, NZ_CP025268.1, 20816, 21079, -, 264, 43781; cds-WP_001300728.1, NZ_CP025268.1, 21182, 21400, +, 219, 2173; cds-WP_000767329.1, NZ_CP025268.1, 21408, 22349, +, 942, 252327; cds-WP_001286857.1, NZ_CP025268.1, 22392, 25208, +, 2817, 1999037; cds-WP_000083372.1, NZ_CP025268.1, 25208, 25702, +, 495, 290863; cds-WP_000004655.1, NZ_CP025268.1, 25827, 26276, +, 450, 597564; cds-WP_001166395.1, NZ_CP025268.1, 26278, 27228, +, 951, 334110; cds-WP_001239142.1, NZ_CP025268.1, 27294, 28208, +, 915, 33875; cds-WP_000543604.1, NZ_CP025268.1, 28375, 29196, +, 822, 48722; cds-WP_000597260.1, NZ_CP025268.1, 29652, 30800, +, 1149, 263909; cds-WP_001126348.1,


NZ_CP025268.1, 30818, 34039, +, 3222, 299328; cds-WP_000333125.1, NZ_CP025268.1, 34301, 34696, +, 396, 208; cds-WP_000122871.1, NZ_CP025268.1, 34782, 35372, -, 591, 0; cds-WP_001295419.1, NZ_CP025268.1, 35378, 36163, -, 786, 0; cds-WP_001350478.1, NZ_CP025268.1, 36272, 37825, -, 1554, 8947; cds-WP_101348527.1, NZ_CP025268.1, 37899, 39116, -, 1218, 3; cds-WP_000347117.1, NZ_CP025268.1, 39245, 40387, -, 1143, 0; cds-WP_000787103.1, NZ_CP025268.1, 40418, 41932, -, 1515, 0; cds-WP_000692204.1, NZ_CP025268.1, 42404, 43174, +, 771, 0; cds-WP_001091499.1, NZ_CP025268.1, 43189, 44130, +, 942, 0; cds-WP_001287715.1, NZ_CP025268.1, 44181, 45467, +, 1287, 0; cds-WP_000203741.1, NZ_CP025268.1, 45464, 45751, +, 288, 0; cds-WP_001183198.1, NZ_CP025268.1, 45808, 47139, +, 1332, 0; cds-WP_000600725.1, NZ_CP025268.1, 47247, 47777, +, 531, 21; cds-WP_101348528.1, NZ_CP025268.1, 47770, 49632, +, 1863, 0; cds-WP_000624375.1, NZ_CP025268.1, 49824, 50303, +, 480, 2; cds-WP_000257192.1, NZ_CP025268.1, 50381, 51223, -, 843, 88424; cds-WP_000610901.1, NZ_CP025268.1, 51230, 51607, -, 378, 119806; cds-WP_001065381.1, NZ_CP025268.1, 51610, 52431, -, 822, 79948; cds-WP_000241277.1, NZ_CP025268.1, 52428, 53417, -, 990, 784424; cds-WP_000800457.1, NZ_CP025268.1, 53417, 54703, -, 1287, 998930; cds-WP_000746151.1, NZ_CP025268.1, 54756, 57110, -, 2355, 816469; cds-WP_001200579.1, NZ_CP025268.1, 57365, 58180, +, 816, 24699; cds-WP_001393555.1, NZ_CP025268.1, 58475, 59125, +, 651, 39794; cds-WP_001393554.1, NZ_CP025268.1, 59122, 59280, +, 159, 45; cds-CXP41_RS00280, NZ_CP025268.1, 59297, 59475, -, 179, 28; cds-WP_000525176.1, NZ_CP025268.1, 59688, 60347, -, 660, 101855; cds-WP_001117011.1, NZ_CP025268.1, 60359, 63265, -, 2907, 1560983; cds-WP_000035670.1, NZ_CP025268.1, 63430, 65781, -, 2352, 70731; cds-WP_101348529.1, NZ_CP025268.1, 65856, 66551, -, 696, 0; cds-WP_000151748.1, NZ_CP025268.1, 66666, 68168, -, 1503, 87024; cds-WP_000951856.1, NZ_CP025268.1, 68179, 69879, -, 1701, 0; cds-WP_001300811.1, NZ_CP025268.1, 70218, 71096, +, 879, 0; cds-WP_001148390.1, NZ_CP025268.1, 71182, 71946, +, 765, 1319; cds-WP_000916281.1, NZ_CP025268.1, 72060, 72758, -, 699, 4996; cds-WP_000235721.1, NZ_CP025268.1, 72742, 74352, -, 1611, 4943; cds-WP_101348530.1, NZ_CP025268.1, 74328, 75311, -, 984, 105916; cds-WP_001138624.1, NZ_CP025268.1, 75475, 77130, -, 1656, 560025; cds-WP_001248770.1, NZ_CP025268.1, 77219, 77350, +, 132, 0; cds-WP_000637847.1, NZ_CP025268.1, 77452, 78630, +, 1179, 1; cds-WP_000818228.1, NZ_CP025268.1, 78679, 79284, -, 606, 37641; cds-WP_001140652.1, NZ_CP025268.1, 79295, 80695, -, 1401, 12487; cds-WP_000042353.1, NZ_CP025268.1, 80698, 81789, -, 1092, 74683; cds-WP_000082850.1, NZ_CP025268.1, 81789, 83360, -, 1572, 0; cds-WP_001300467.1, NZ_CP025268.1, 83453, 83539, -, 87, 0; cds-WP_001115472.1, NZ_CP025268.1, 84199, 85143, +, 945, 0; cds-WP_120795371.1, NZ_CP025268.1, 85298, 85342, -, 45, 0; cds-WP_001295534.1, NZ_CP025268.1, 85461, 87185, +, 1725, 7; cds-WP_001300383.1, NZ_CP025268.1, 87188, 87679, +, 492, 1; cds-WP_001303787.1, NZ_CP025268.1, 87691, 87777, +, 87, 2; cds-WP_000762401.1, NZ_CP025268.1, 87859, 88863, +, 1005, 214052; cds-WP_001295533.1, NZ_CP025268.1, 89465, 89923, +, 459, 4804; cds-WP_000970479.1, NZ_CP025268.1, 89925, 90866, +, 942, 473538; cds-WP_000625658.1, NZ_CP025268.1, 90863, 91228, +, 366, 221353; cds-WP_000642196.1, NZ_CP025268.1, 91244, 93010, +, 1767, 696601; cds-WP_000775093.1, NZ_CP025268.1, 92997, 94484, +, 1488, 362751; cds-WP_000626685.1, NZ_CP025268.1, 94481, 95839, +, 1359, 719053; cds-WP_101348531.1, NZ_CP025268.1, 95833, 96915, +, 1083, 223379; cds-WP_000796481.1, NZ_CP025268.1, 96918, 98234, +, 1317, 61584; cds-WP_001295532.1, NZ_CP025268.1, 98234, 99478, +, 1245, 240164; cds-WP_000016560.1, NZ_CP025268.1, 99475, 100542, +, 1068, 137396; cds-WP_001096049.1, NZ_CP025268.1, 100596, 102071, +, 1476, 966539; cds-WP_000130056.1, NZ_CP025268.1, 102064, 102984, +, 921, 454721; cds-WP_000075748.1, NZ_CP025268.1, 102986, 103816, +, 831, 72573; cds-WP_101348532.1, NZ_CP025268.1, 103813, 105075, +, 1263, 895413; cds-WP_000462776.1, NZ_CP025268.1, 105136, 106287, +, 1152, 268973; cds-WP_000595482.1, NZ_CP025268.1, 106388, 107305, +, 918, 637582; cds-WP_000014321.1, NZ_CP025268.1, 107536, 108048, +, 513, 183489; cds-WP_000905789.1, NZ_CP025268.1, 108110, 110815, +, 2706, 1485344; cds-WP_000736007.1, NZ_CP025268.1, 110875, 111264, +, 390, 3454; cds-WP_000005042.1, NZ_CP025268.1, 111480, 111677, -, 198, 289; cds-WP_101348533.1, NZ_CP025268.1, 111687, 112430, -, 744, 9140; cds-WP_001269520.1, NZ_CP025268.1, 112430, 113050, -, 621, 18240; cds-WP_120795372.1, NZ_CP025268.1, 113075, 113119, +, 45, 0; cds-WP_001217338.1, NZ_CP025268.1, 113275, 114318, +, 1044, 18118; cds-WP_101348534.1, NZ_CP025268.1, 114353, 115555, -, 1203, 0; cds-WP_001025145.1, NZ_CP025268.1, 115545, 116930, -, 1386, 8357; cds-WP_000360904.1, NZ_CP025268.1, 116940, 117380, -, 441, 0; cds-WP_101348535.1, NZ_CP025268.1, 117583, 118476, -, 894, 0; cds-WP_000923721.1, NZ_CP025268.1, 118564, 119115, +, 552, 35; cds-WP_000172005.1, NZ_CP025268.1, 119112, 119966, +, 855, 10; cds-WP_000969915.1, NZ_CP025268.1, 120009, 121382, -, 1374, 1439; cds-WP_000331776.1, NZ_CP025268.1, 121923, 122687, +, 765, 872024; cds-WP_000003820.1, NZ_CP025268.1, 122848, 125511, +, 2664, 17016091; cds-WP_000963518.1, NZ_CP025268.1, 125526, 127418, +, 1893, 9504704; cds-WP_000102485.1, NZ_CP025268.1, 127743, 129167, +, 1425, 3914037; cds-WP_000784470.1, NZ_CP025268.1, 129238, 131091, -, 1854, 28; cds-WP_001307570.1, NZ_CP025268.1, 131446, 134043, +, 2598, 1131892; cds-WP_000384306.1, NZ_CP025268.1, 134219, 134581, +, 363, 4701; cds-WP_000734287.1, NZ_CP025268.1, 134619, 135413, -, 795, 125317; cds-WP_000818411.1, NZ_CP025268.1, 135429, 136295, -, 867, 147739; cds-WP_001295568.1, NZ_CP025268.1, 136401, 136748, -, 348, 3; cds-WP_101348536.1, NZ_CP025268.1, 136914, 138464, +, 1551, 27; cds-WP_001306211.1, NZ_CP025268.1, 138666, 141056, -, 2391, 592226; cds-WP_000683335.1, NZ_CP025268.1, 141262, 141798, +, 537, 104861; cds-WP_000651599.1, NZ_CP025268.1, 141839, 142501, -, 663, 316787; cds-WP_000150637.1, NZ_CP025268.1, 142610, 143536, +, 927, 82309; cds-WP_000972203.1, NZ_CP025268.1, 143533, 144303, +, 771, 87583; cds-WP_000901987.1, NZ_CP025268.1, 144408, 144848, +, 441, 4980; cds-WP_000277917.1, NZ_CP025268.1, 144912, 146141, +, 1230, 11516; cds-WP_000621515.1, NZ_CP025268.1, 146145, 146525, -, 381, 8; cds-WP_000339954.1, NZ_CP025268.1, 146799, 147701, +, 903, 11178; cds-WP_000905383.1, NZ_CP025268.1, 147775, 148626, -, 852, 52229; cds-WP_000805497.1, NZ_CP025268.1, 148638, 149432, -, 795, 41065; cds-WP_101348537.1, NZ_CP025268.1, 149546, 150784, -, 1239, 0; cds-WP_000553749.1, NZ_CP025268.1, 150834, 151430, -, 597, 0; cds-WP_101348538.1, NZ_CP025268.1, 151457, 152062, -, 606, 0; cds-WP_000598300.1, NZ_CP025268.1, 152074, 152643, -, 570, 0; cds-WP_000151605.1, NZ_CP025268.1, 152660, 155257, -, 2598, 0; cds-WP_000465928.1, NZ_CP025268.1, 155292, 156032, -, 741, 0; cds-WP_000038438.1, NZ_CP025268.1, 156130, 156714, -, 585, 150; cds-WP_000215139.1, NZ_CP025268.1, 157084, 157563, -, 480, 82507; cds-WP_010723084.1, NZ_CP025268.1, 157560, 158957, -, 1398, 812071; cds-WP_000937424.1, NZ_CP025268.1, 159017, 159943, -, 927, 98409; cds-WP_001155227.1, NZ_CP025268.1, 159980, 160435, -, 456, 4116; cds-WP_000396036.1, NZ_CP025268.1, 160613, 161317, -, 705, 28044; cds-WP_001294700.1, NZ_CP025268.1, 161332, 161862, -, 531, 14833; cds-WP_101348539.1, NZ_CP025268.1, 161936, 164365, +, 2430, 46703; cds-WP_000918162.1, NZ_CP025268.1, 164561, 167095, +, 2535, 36024; cds-WP_101348540.1, NZ_CP025268.1, 167315, 169558, +, 2244, 215038; cds-WP_001158931.1, NZ_CP025268.1, 169609, 170406, +, 798, 7752; cds-WP_001310529.1, NZ_CP025268.1, 170406, 171296, +, 891, 12; cds-WP_000044072.1, NZ_CP025268.1, 171293, 173275, +, 1983, 382956; cds-WP_000045315.1, NZ_CP025268.1, 173433, 174713, -, 1281, 151714; cds-WP_211180485.1, NZ_CP025268.1, 174879, 174926, +, 48, 2351; cds-WP_000845394.1, NZ_CP025268.1, 174938, 176359, +, 1422, 465366; cds-WP_120795373.1, NZ_CP025268.1, 176383, 176448, +, 66, 1051; cds-WP_001295564.1, NZ_CP025268.1, 176441, 176785, +, 345, 7116; cds-WP_000964221.1, NZ_CP025268.1, 176832, 177455, -, 624, 144; cds-WP_001129927.1, NZ_CP025268.1, 177493, 178293, -, 801, 15430; cds-WP_000689844.1, NZ_CP025268.1, 178286, 178984, -, 699, 20; cds-WP_000057073.1, NZ_CP025268.1, 179068, 180585, +, 1518, 19959; cds-WP_000753946.1, NZ_CP025268.1, 180715, 182139, +, 1425, 142768; cds-CXP41_RS00845, NZ_CP025268.1, 182294, 183436, +, 1143, 79617; cds-WP_000272188.1, NZ_CP025268.1, 183539, 183925, -, 387, 59; cds-WP_000625631.1, NZ_CP025268.1, 184087, 184899, -, 813, 892; cds-WP_001186650.1, NZ_CP025268.1, 184953, 185777, -, 825, 553; cds-WP_001094586.1, NZ_CP025268.1, 185808, 188480, -, 2673, 296534; cds-WP_001018194.1, NZ_CP025268.1, 188542, 189336, -, 795, 311102; cds-WP_000246882.1, NZ_CP025268.1, 189704, 190429, +, 726, 6151197; cds-WP_000818114.1, NZ_CP025268.1, 190687, 191538, +, 852, 1892216; cds-WP_000224573.1, NZ_CP025268.1, 191685, 192410, +, 726, 1521610; cds-WP_000622418.1, NZ_CP025268.1, 192702, 193259, +, 558, 830799; cds-WP_000811923.1, NZ_CP025268.1, 193351, 194547, +, 1197, 65026; cds-WP_001295562.1, NZ_CP025268.1, 194736, 195494, +, 759, 199767; cds-WP_000922446.1, NZ_CP025268.1, 195507, 196364, +, 858, 648915; cds-WP_001295561.1, NZ_CP025268.1, 196376, 197728, +, 1353, 1295660; cds-WP_101348541.1, NZ_CP025268.1, 197758, 200190, +, 2433, 2246169; cds-WP_000758956.1, NZ_CP025268.1, 200312, 200797, +, 486, 430588; cds-WP_001139279.1, NZ_CP025268.1, 200801, 201826, +, 1026, 726837; cds-WP_000210739.1, NZ_CP025268.1, 201931, 202386, +, 456, 519088; cds-WP_000565966.1, NZ_CP025268.1, 202390, 203178, +, 789, 177761; cds-WP_000139654.1, NZ_CP025268.1, 203178, 204326, +, 1149, 602474; cds-WP_000569430.1, NZ_CP025268.1, 204323, 204919, +, 597, 237509; cds-WP_001294757.1, NZ_CP025268.1, 204956, 208438, +, 3483, 1586443; cds-WP_000055741.1, NZ_CP025268.1, 208451, 209410, +, 960, 809920; cds-WP_001020973.1, NZ_CP025268.1, 209509, 211650, +, 2142, 118208; cds-WP_000901099.1, NZ_CP025268.1, 211707, 212096, +, 390, 226829; cds-WP_000176549.1, NZ_CP025268.1, 212161, 213459, +, 1299, 193; cds-WP_000062312.1, NZ_CP025268.1, 213508, 213768, -, 261, 3; cds-WP_000417058.1, NZ_CP025268.1, 213755, 213955, -, 201, 23; cds-WP_001185290.1, NZ_CP025268.1, 214121, 214666, +, 546, 9668; cds-WP_000635537.1, NZ_CP025268.1, 214663, 215085, +, 423, 89619; cds-WP_000239163.1, NZ_CP025268.1, 215099, 215809, +, 711, 218; cds-WP_001336393.1, NZ_CP025268.1, 216009, 216833, -, 825, 816; cds-WP_001260717.1, NZ_CP025268.1, 216887, 218605, -, 1719, 469255; cds-WP_000094011.1, NZ_CP025268.1, 218717, 219424, -, 708, 74005; cds-WP_001202329.1, NZ_CP025268.1, 219421, 219825, -, 405, 95030; cds-WP_000874226.1, NZ_CP025268.1, 219943, 220758, -, 816, 34349; cds-WP_001294600.1, NZ_CP025268.1, 220798, 221451, -, 654, 17583; cds-WP_000594006.1, NZ_CP025268.1, 221444, 222475, -, 1032, 348221; cds-WP_001140187.1, NZ_CP025268.1, 222663, 223238, +, 576, 12; cds-WP_000997010.1, NZ_CP025268.1, 228997, 229800, +, 804, 211220; cds-WP_000648572.1, NZ_CP025268.1, 229797, 230711, -,915, 134097; cds-WP_001230983.1, NZ_CP025268.1, 230952, 231752, +, 801, 1613; cds-CXP41_RS01095, NZ_CP025268.1, 231783, 232379, +, 597, 0; cds-WP_000644685.1, NZ_CP025268.1, 232427, 233785, -, 1359, 64163; cds-WP_001052715.1, NZ_CP025268.1, 233857, 234612, -, 756, 4484; cds-WP_001326702.1, NZ_CP025268.1, 234646, 235368, +, 723, 1492; cds-WP_000917883.1, NZ_CP025268.1, 235365, 235832, -, 468, 74891; cds-WP_001340895.1, NZ_CP025268.1, 235897, 236628, +, 732, 10; cds-WP_001086141.1, NZ_CP025268.1, 237165, 237950, +, 786, 27; cds-WP_001236645.1, NZ_CP025268.1, 238087, 238566, -, 480, 411; cds-CXP41_RS01145, NZ_CP025268.1, 238576, 238932, -, 357, 0; cds-CXP41_RS01150, NZ_CP025268.1, 238930, 239208, +, 279, 95; cds-WP_001118036.1, NZ_CP025268.1, 239249, 240019, -, 771, 10; cds-WP_001308392.1, NZ_CP025268.1, 240200, 240646, +, 447, 1; cds-WP_000973083.1, NZ_CP025268.1, 240689, 243133, -, 2445, 264; cds-WP_000284050.1, NZ_CP025268.1, 243373, 243951, +, 579, 40658; cds-WP_000333380.1, NZ_CP025268.1, 244157, 244924, +, 768, 57063; cds-WP_001225679.1, NZ_CP025268.1, 244895, 245635, -, 741, 21211; cds-WP_000615983.1,


NZ_CP025268.1, 245791, 246069, -, 279, 0; cds-WP_000729703.1, NZ_CP025268.1, 246072, 246332, -, 261, 0; cds-WP_000056849.1, NZ_CP025268.1, 246542, 247291, +, 750, 0; cds-WP_000006255.1, NZ_CP025268.1, 247466, 247963, +, 498, 93; cds-CXP41_RS01205, NZ_CP025268.1, 248187, 249899, -, 1713, 0; cds-WP_000207552.1, NZ_CP025268.1, 249871, 250656, +, 786, 0; cds-WP_001226164.1, NZ_CP025268.1, 250727, 251782, +, 1056, 0; cds-WP_000554758.1, NZ_CP025268.1, 251834, 252127, +, 294, 571; cds-WP_001263489.1, NZ_CP025268.1, 252130, 252528, +, 399, 863; cds-WP_101348542.1, NZ_CP025268.1, 252538, 252990, +, 453, 33; cds-CXP41_RS01235, NZ_CP025268.1, 253308, 253514, +, 207, 0; cds-CXP41_RS01240, NZ_CP025268.1, 253510, 254031, +, 522, 3437; cds-WP_101348543.1, NZ_CP025268.1, 254088, 255545, -, 1458, 26869; cds-WP_001291990.1, NZ_CP025268.1, 255806, 256264, +, 459, 33035; cds-WP_000189532.1, NZ_CP025268.1, 256356, 257600, +, 1245, 117129; cds-WP_000174689.1, NZ_CP025268.1, 257658, 258059, +, 402, 7439; cds-WP_000749863.1, NZ_CP025268.1, 258098, 259153, -, 1056, 8420; cds-WP_001285288.1, NZ_CP025268.1, 259441, 260544, +, 1104, 191443; cds-WP_094314171.1, NZ_CP025268.1, 260556, 261809, +, 1254, 275458; cds-WP_000854672.1, NZ_CP025268.1, 262381, 262722, -, 342, 5804; cds-WP_000070395.1, NZ_CP025268.1, 262743, 263060, -, 318, 50; cds-WP_000691994.1, NZ_CP025268.1, 263079, 263300, -, 222, 143; cds-WP_000811693.1, NZ_CP025268.1, 263309, 263785, -, 477, 368; cds-WP_000211838.1, NZ_CP025268.1, 263801, 264259, -, 459, 763; cds-WP_000194654.1, NZ_CP025268.1, 264357, 264596, -, 240, 0; cds-WP_001547765.1, NZ_CP025268.1, 264673, 265140, -, 468, 0; cds-WP_000824223.1, NZ_CP025268.1, 265163, 265606, -, 444, 2361; cds-WP_001548158.1, NZ_CP025268.1, 265606, 265833, -, 228, 0; cds-CXP41_RS01330, NZ_CP025268.1, 265829, 266020, -, 192, 0; cds-WP_000197389.1, NZ_CP025268.1, 266237, 267058, -, 822, 0; cds-WP_001065553.1, NZ_CP025268.1, 267150, 268013, -, 864, 0; cds-WP_000770246.1, NZ_CP025268.1, 268342, 269235, -, 894, 832; cds-CXP41_RS01355, NZ_CP025268.1, 269331, 269588, +, 258, 6; cds-WP_001254938.1, NZ_CP025268.1, 269656, 270807, +, 1152, 902; cds-CXP41_RS01365, NZ_CP025268.1, 270817, 271242, +, 426, 50185; cds-CXP41_RS01375, NZ_CP025268.1, 271915, 273006, +, 1092, 72762; cds-WP_000019403.1, NZ_CP025268.1, 273154, 274134, -, 981, 191221; cds-WP_001393629.1, NZ_CP025268.1, 274378, 275781, +, 1404, 0; cds-WP_000081352.1, NZ_CP025268.1, 275768, 276700, +, 933, 2; cds-WP_000192349.1, NZ_CP025268.1, 276809, 277855, -, 1047, 0; cds-CXP41_RS01405, NZ_CP025268.1, 277867, 278214, -, 348, 0; cds-CXP41_RS01410, NZ_CP025268.1, 278231, 278928, -, 698, 21896; cds-CXP41_RS01420, NZ_CP025268.1, 278984, 279157, +, 174, 3; cds-CXP41_RS01425, NZ_CP025268.1, 279167, 279415, -, 249, 0; cds-WP_001030800.1, NZ_CP025268.1, 279438, 279788, -, 351, 0; cds-CXP41_RS01435, NZ_CP025268.1, 279882, 281035, -, 1154, 0; cds-WP_001136613.1, NZ_CP025268.1, 281330, 282238, +, 909, 511; cds-WP_101348544.1, NZ_CP025268.1, 282253, 284220, +, 1968, 1; cds-WP_000192863.1, NZ_CP025268.1, 284447, 285829, +, 1383, 4; cds-WP_101348545.1, NZ_CP025268.1, 285841, 287451, +, 1611, 64081; cds-WP_001121657.1, NZ_CP025268.1, 287456, 288214, -, 759, 11474; cds-WP_001281825.1, NZ_CP025268.1, 288353, 289357, -, 1005, 0; cds-WP_211180486.1, NZ_CP025268.1, 289327, 289422, -, 96, 0; cds-CXP41_RS01470, NZ_CP025268.1, 289481, 289684, +, 204, 0; cds-CXP41_RS01480, NZ_CP025268.1, 289701, 290398, -, 698, 20405; cds-CXP41_RS01490, NZ_CP025268.1, 290453, 291283, +, 831, 715; cds-WP_000860996.1, NZ_CP025268.1, 291374, 292000, -, 627, 0; cds-WP_001214248.1, NZ_CP025268.1, 292272, 292970, -, 699, 1; cds-WP_000072039.1, NZ_CP025268.1, 292997, 293851, -, 855, 0; cds-WP_001272156.1, NZ_CP025268.1, 293970, 294194, -, 225, 0; cds-WP_000224818.1, NZ_CP025268.1, 294191, 294631, -, 441, 78; cds-WP_001407714.1, NZ_CP025268.1, 294748, 296148, -, 1401, 125; cds-CXP41_RS01530, NZ_CP025268.1, 296433, 296771, -, 339, 14; cds-WP_000121359.1, NZ_CP025268.1, 296822, 297778, -, 957, 38; cds-WP_000667026.1, NZ_CP025268.1, 297788, 299986, -, 2199, 0; cds-WP_000643333.1, NZ_CP025268.1, 299983, 300939, -, 957, 0; cds-WP_000070700.1, NZ_CP025268.1, 300936, 301625, -, 690, 0; cds-WP_001019920.1, NZ_CP025268.1, 302043, 302657, +, 615, 1135; cds-WP_001303809.1, NZ_CP025268.1, 302905, 303234, -, 330, 0; cds-WP_001350485.1, NZ_CP025268.1, 303547, 304257, -, 711, 0; cds-WP_001310578.1, NZ_CP025268.1, 304226, 305869, -, 1644, 23; cds-WP_001131096.1, NZ_CP025268.1, 305859, 308384, -, 2526, 1901; cds-WP_000716398.1, NZ_CP025268.1, 308410, 309078, -, 669, 0; cds-WP_000730972.1, NZ_CP025268.1, 309136, 309723, -, 588, 0; cds-WP_001301257.1, NZ_CP025268.1, 309798, 310340, -, 543, 0; cds-WP_001147279.1, NZ_CP025268.1, 311164, 311391, +, 228, 0; cds-WP_000866436.1, NZ_CP025268.1, 311426, 311566, -, 141, 0; cds-WP_000803998.1, NZ_CP025268.1, 311566, 311829, -, 264, 0; cds-WP_000662258.1, NZ_CP025268.1, 312193, 312294, -, 102, 0; cds-CXP41_RS01640, NZ_CP025268.1, 313409, 314284, +, 876, 0; cds-WP_085947771.1, NZ_CP025268.1;NZ_CP025268.1, 314343;314604, 314604;315505, +;+, 1163, 4; cds-CXP41_RS01650, NZ_CP025268.1, 315535, 316188, -, 654, 79341; cds-CXP41_RS24070, NZ_CP025268.1, 316491, 316619, +, 129, 0; cds-WP_001299021.1, NZ_CP025268.1, 316778, 317371, -, 594, 250; cds-WP_000474084.1, NZ_CP025268.1, 317383, 317619, -, 237, 0; cds-WP_001046307.1, NZ_CP025268.1, 317728, 319053, -, 1326, 0; cds-WP_000339594.1, NZ_CP025268.1, 319279, 320133, +, 855, 0; cds-WP_001102108.1, NZ_CP025268.1, 320659, 321378, +, 720, 1; cds-WP_032289499.1, NZ_CP025268.1, 321389, 322816, +, 1428, 20174; cds-WP_000370307.1, NZ_CP025268.1, 322809, 323504, +, 696, 0; cds-WP_001209100.1, NZ_CP025268.1, 323747, 324415, -, 669, 814; cds-WP_001159094.1, NZ_CP025268.1, 324628, 326298, -, 1671, 205497; cds-WP_000089110.1, NZ_CP025268.1, 326312, 327784, -, 1473, 92537; cds-WP_001335745.1, NZ_CP025268.1, 327798, 328385, -, 588, 9761; cds-WP_000131044.1, NZ_CP025268.1, 328514, 330547, +, 2034, 318484; cds-WP_120795374.1, NZ_CP025268.1, 330853, 330927, +, 75, 0; cds-WP_001301264.1, NZ_CP025268.1, 331422, 332510, +, 1089, 20559; cds-WP_001084394.1, NZ_CP025268.1, 332552, 333484, -, 933, 9; cds-WP_001013892.1, NZ_CP025268.1, 333576, 334073, -, 498, 6; cds-WP_000023635.1, NZ_CP025268.1, 334331, 334936, +, 606, 0; cds-CXP41_RS01765, NZ_CP025268.1, 334976, 335839, +, 864, 0; cds-WP_000111836.1, NZ_CP025268.1, 335829, 337376, +, 1548, 0; cds-WP_000083429.1, NZ_CP025268.1, 337376, 338794, +, 1419, 0; cds-WP_001295687.1, NZ_CP025268.1, 338844, 339140, +, 297, 7; cds-WP_000661672.1, NZ_CP025268.1, 339216, 340166, +, 951, 0; cds-WP_000665120.1, NZ_CP025268.1, 340176, 341558, +, 1383, 0; cds-WP_000692754.1, NZ_CP025268.1, 341935, 342984, +, 1050, 151092; cds-WP_001381673.1, NZ_CP025268.1, 343227, 344042, +, 816, 0; cds-WP_000290616.1, NZ_CP025268.1, 344455, 344700, +, 246, 0; cds-WP_000983410.1, NZ_CP025268.1, 344717, 345388, -, 672, 0; cds-WP_000691956.1, NZ_CP025268.1, 345535, 345810, +, 276, 0; cds-WP_000941041.1, NZ_CP025268.1, 345908, 347494, -, 1587, 0; cds-WP_000052206.1, NZ_CP025268.1, 347733, 348623, +, 891, 2; cds-WP_001285927.1, NZ_CP025268.1, 349063, 350232, +, 1170, 0; cds-WP_001275859.1, NZ_CP025268.1, 350266, 351717, +, 1452, 0; cds-WP_000010288.1, NZ_CP025268.1, 351757, 353643, +, 1887, 0; cds-WP_000076233.1, NZ_CP025268.1, 353973, 355232, +, 1260, 125307; cds-WP_001301240.1, NZ_CP025268.1, 355222, 356505, +, 1284, 8118; cds-WP_000952503.1, NZ_CP025268.1, 356842, 357741, -, 900, 0; cds-WP_000658652.1, NZ_CP025268.1, 357850, 358509, +, 660, 2; cds-WP_000616243.1, NZ_CP025268.1, 358540, 359010, +, 471, 0; cds-WP_001301263.1, NZ_CP025268.1, 359016, 360197, +, 1182, 0; cds-WP_001335915.1, NZ_CP025268.1, 360300, 360911, -, 612, 0; cds-WP_000291549.1, NZ_CP025268.1, 360977, 362230, -, 1254, 0; cds-WP_000177906.1, NZ_CP025268.1, 362282, 365356, -, 3075, 2; cds-WP_000805902.1, NZ_CP025268.1, 365479, 366561, -, 1083, 302; cds-WP_001301325.1, NZ_CP025268.1, 366638, 367471, -, 834, 0; cds-WP_001007407.1, NZ_CP025268.1, 367662, 369326, +, 1665, 0; cds-WP_000543457.1, NZ_CP025268.1, 369328, 370272, +, 945, 0; cds-CXP41_RS01915, NZ_CP025268.1, 370290, 371156, +, 867, 0; cds-WP_000160710.1, NZ_CP025268.1, 371166, 371975, +, 810, 0; cds-WP_101348546.1, NZ_CP025268.1, 371972, 372922, +, 951, 0; cds-WP_001013499.1, NZ_CP025268.1, 372919, 373932, +, 1014, 0; cds-WP_000107627.1, NZ_CP025268.1, 374510, 375721, +, 1212, 3; cds-WP_001096705.1, NZ_CP025268.1, 375823, 376362, +, 540, 0; cds-WP_000419081.1, NZ_CP025268.1, 376586, 377419, -, 834, 92829; cds-WP_000842106.1, NZ_CP025268.1, 377513, 378622, -, 1110, 136110; cds-WP_001141271.1, NZ_CP025268.1, 378657, 378932, -, 276, 1176; cds-WP_000596084.1, NZ_CP025268.1, 379120, 379893, -, 774, 0; cds-WP_000012218.1, NZ_CP025268.1, 379895, 380338, -, 444, 467; cds-WP_088895425.1, NZ_CP025268.1;NZ_CP025268.1, 380402;380717, 380717;381630, +;+, 1229, 8565; cds-CXP41_RS01980, NZ_CP025268.1, 381639, 381824, -, 186, 0; cds-WP_101348547.1, NZ_CP025268.1, 381790, 382986, -, 1197, 0; cds-CXP41_RS01990, NZ_CP025268.1, 382996, 383667, -, 672, 0; cds-WP_101348548.1, NZ_CP025268.1, 384283, 385245, +, 963, 0; cds-WP_000939375.1, NZ_CP025268.1, 385258, 386025, +, 768, 0; cds-WP_000114620.1, NZ_CP025268.1, 386022, 386849, +, 828, 0; cds-WP_000004027.1, NZ_CP025268.1, 386846, 387697, +, 852, 8290; cds-WP_001295337.1, NZ_CP025268.1, 387804, 388778, -, 975, 519371; cds-CXP41_RS02030, NZ_CP025268.1, 389302, 390828, +, 1527, 10331; cds-WP_101348549.1, NZ_CP025268.1;NZ_CP025268.1, 390790;391691, 391691;391952, -;-, 1163, 5; cds-CXP41_RS02040, NZ_CP025268.1, 392015, 393469, +, 1455, 243; cds-WP_001295335.1, NZ_CP025268.1, 393557, 394180, +, 624, 0; cds-WP_000830741.1, NZ_CP025268.1, 394181, 395338, -, 1158, 0; cds-WP_001301663.1, NZ_CP025268.1, 395690, 396910, +, 1221, 208421; cds-WP_000092067.1, NZ_CP025268.1, 396923, 398017, +, 1095, 555; cds-WP_000763151.1, NZ_CP025268.1, 398076, 398384, -, 309, 0; cds-WP_001295334.1, NZ_CP025268.1, 398644, 398856, +, 213, 7292; cds-WP_000413677.1, NZ_CP025268.1, 398880, 399974, -, 1095, 138485; cds-WP_001300163.1, NZ_CP025268.1, 400052, 400255, +, 204, 0; cds-CXP41_RS02095, NZ_CP025268.1, 400437, 400696, +, 260, 0; cds-WP_000814403.1, NZ_CP025268.1, 400797, 402212, +, 1416, 0; cds-WP_001295332.1, NZ_CP025268.1, 402331, 402651, +, 321, 0; cds-WP_000484048.1, NZ_CP025268.1, 402753, 403868, +, 1116, 4; cds-WP_001295331.1, NZ_CP025268.1, 403885, 404694, -, 810, 0; cds-WP_000158159.1, NZ_CP025268.1, 404814, 405272, +, 459, 1704; cds-WP_000193393.1, NZ_CP025268.1, 405455, 405979, +, 525, 274152; cds-WP_001142439.1, NZ_CP025268.1, 406029, 406220, +, 192, 136107; cds-WP_001276420.1, NZ_CP025268.1, 406478, 407155, +, 678, 51080; cds-WP_000941942.1, NZ_CP025268.1, 407227, 407511, +, 285, 5361; cds-CXP41_RS02155, NZ_CP025268.1, 407659, 408000, +, 342, 110696; cds-WP_120795376.1, NZ_CP025268.1, 407997, 408080, +, 84, 45022; cds-WP_001298537.1, NZ_CP025268.1, 408158, 409069, -, 912, 364132; cds-WP_001219309.1, NZ_CP025268.1, 409194, 410102, +, 909, 43; cds-WP_001326926.1, NZ_CP025268.1, 410347, 411531, -, 1185, 0; cds-WP_000698951.1, NZ_CP025268.1, 411657, 414803, -, 3147, 20025; cds-WP_001221319.1, NZ_CP025268.1, 414800, 416002, -, 1203, 18989; cds-WP_000113933.1, NZ_CP025268.1, 416192, 416881, +, 690, 19; cds-WP_000893623.1, NZ_CP025268.1, 416939, 418234, +, 1296, 3; cds-WP_000149639.1, NZ_CP025268.1, 418641, 419960, +, 1320, 221773; cds-WP_001295329.1, NZ_CP025268.1, 420036, 421409, +, 1374, 192918; cds-WP_001310597.1, NZ_CP025268.1, 421565, 423382, +, 1818, 70733; cds-WP_001009885.1, NZ_CP025268.1, 423387, 423968, -, 582, 0; cds-WP_001266503.1, NZ_CP025268.1, 424061, 425131, +, 1071, 36189; cds-WP_000667319.1, NZ_CP025268.1, 425187, 426314, +, 1128, 219819; cds-WP_000007629.1, NZ_CP025268.1, 426337, 426669, +, 333, 297141; cds-WP_000934822.1, NZ_CP025268.1, 426697, 428544, +, 1848, 1875237; cds-WP_000046637.1, NZ_CP025268.1, 428555, 429526, +, 972, 467087; cds-WP_000974813.1, NZ_CP025268.1, 429655, 430002, +, 348, 38; cds-WP_001295328.1, NZ_CP025268.1, 430179, 431063, -, 885, 99222; cds-WP _001326929.1, NZ_CP025268.1, 431362, 431901, -, 540, 0; cds-WP_000543535.1, NZ_CP025268.1, 432052, 432501, +, 450, 120; cds-WP_001150457.1, NZ_CP025268.1, 432505, 433608, +, 1104, 581; cds-WP_001021161.1, NZ_CP025268.1, 433697, 434167, +, 471, 251662; cds-WP_000801125.1,


NZ_CP025268.1, 434187, 434606, +, 420, 179709; cds-WP_000742109.1, NZ_CP025268.1, 434684, 435661, +, 978, 191140; cds-WP_000154044.1, NZ_CP025268.1, 435639, 436157, +, 519, 128798; cds-WP_001199800.1, NZ_CP025268.1, 436211, 437185, -, 975, 79281; cds-WP_000006797.1, NZ_CP025268.1, 437365, 439227, -, 1863, 482472; cds-WP_000347217.1, NZ_CP025268.1, 439252, 440151, -, 900, 277058; cds-WP_001124935.1, NZ_CP025268.1, 440151, 440393, -, 243, 9897; cds-WP_000668662.1, NZ_CP025268.1, 440599, 442047, +, 1449, 620556; cds-WP_101348550.1, NZ_CP025268.1, 442101, 442691, -, 591, 26390; cds-WP_000705865.1, NZ_CP025268.1, 442654, 443565, -, 912, 112446; cds-WP_001138904.1, NZ_CP025268.1, 443733, 444224, +, 492, 565; cds-WP_001000963.1, NZ_CP025268.1, 444352, 445716, -, 1365, 2771; cds-WP_000971336.1, NZ_CP025268.1, 445865, 446755, -, 891, 1253013; cds-WP_000019869.1, NZ_CP025268.1, 446767, 447096, -, 330, 457145; cds-WP_000179819.1, NZ_CP025268.1, 447096, 447710, -, 615, 1919279; cds-WP_000467180.1, NZ_CP025268.1, 447700, 449691, -, 1992, 5642384; cds-WP_101348551.1, NZ_CP025268.1, 449713, 450660, -, 948, 2183442; cds-WP_000098429.1, NZ_CP025268.1, 451120, 452595, -, 1476, 316638; cds-WP_001295326.1, NZ_CP025268.1, 452639, 453217, -, 579, 257680; cds-WP_000973448.1, NZ_CP025268.1, 453522, 453839, +, 318, 0; cds-WP_001198386.1, NZ_CP025268.1, 454183, 455481, +, 1299, 1862277; cds-WP_000122253.1, NZ_CP025268.1, 455727, 456350, +, 624, 82332; cds-WP_000130305.1, NZ_CP025268.1, 456476, 457750, +, 1275, 303812; cds-WP_001295325.1, NZ_CP025268.1, 457938, 460292, +, 2355, 601545; cds-WP_001043542.1, NZ_CP025268.1, 460501, 460773, +, 273, 80488; cds-WP_000969372.1, NZ_CP025268.1, 460965, 462836, +, 1872, 1046069; cds-WP_000680312.1, NZ_CP025268.1, 462987, 463358, +, 372, 21257; cds-WP_001194534.1, NZ_CP025268.1, 463452, 463850, +, 399, 0; cds-WP_000817220.1, NZ_CP025268.1, 463902, 464597, -, 696, 647; cds-WP_001238234.1, NZ_CP025268.1, 464662, 466362, -, 1701, 0; cds-WP_001336137.1, NZ_CP025268.1, 466462, 467280, +, 819, 4617; cds-WP_052994949.1, NZ_CP025268.1, 467433, 467891, +, 459, 13994; cds-WP_101348552.1, NZ_CP025268.1, 467921, 469693, +, 1773, 22443; cds-WP_101348553.1, NZ_CP025268.1, 469686, 471467, +, 1782, 155774; cds-WP_000780338.1, NZ_CP025268.1, 471648, 471986, +, 339, 3; cds-WP_000685029.1, NZ_CP025268.1, 472016, 473302, +, 1287, 11102; cds-WP_000075876.1, NZ_CP025268.1, 473351, 474211, -, 861, 1; cds-WP_101348554.1, NZ_CP025268.1, 474429, 475001, +, 573, 13021; cds-WP_000409911.1, NZ_CP025268.1, 475032, 475343, -, 312, 1163; cds-WP_000878140.1, NZ_CP025268.1, 475722, 476075, +, 354, 77593; cds-WP_101348720.1, NZ_CP025268.1, 476117, 477667, -, 1551, 168280; cds-WP_000136192.1, NZ_CP025268.1, 477831, 478301, -, 471, 1585; cds-WP_000102564.1, NZ_CP025268.1, 478417, 478968, -, 552, 62940; cds-WP_001291435.1, NZ_CP025268.1, 479140, 479358, -, 219, 170393; cds-WP_000344800.1, NZ_CP025268.1, 479384, 479758, -, 375, 91333; cds-WP_001132469.1, NZ_CP025268.1, 480304, 483453, -, 3150, 2399433; cds-WP_001295324.1, NZ_CP025268.1, 483476, 484669, -, 1194, 427261; cds-WP_000101737.1, NZ_CP025268.1, 484811, 485458, +, 648, 10946; cds-WP_101348555.1, NZ_CP025268.1, 485586, 488948, +, 3363, 29083; cds-WP_000051153.1, NZ_CP025268.1, 489160, 489321, -, 162, 6; cds-WP_000844874.1, NZ_CP025268.1, 489335, 489862, -, 528, 0; cds-WP_001188905.1, NZ_CP025268.1, 489932, 490309, +, 378, 0; cds-WP_101348556.1, NZ_CP025268.1, 490462, 491013, +, 552, 15010; cds-WP_000122013.1, NZ_CP025268.1, 491142, 493073, +, 1932, 1021894; cds-WP_000467098.1, NZ_CP025268.1, 493126, 493455, +, 330, 212413; cds-WP_001195025.1, NZ_CP025268.1, 493455, 494060, +, 606, 222550; cds-WP_000678201.1, NZ_CP025268.1, 494170, 496044, +, 1875, 319379; cds-WP_001220233.1, NZ_CP025268.1, 496225, 496869, +, 645, 211333; cds-WP_001250103.1, NZ_CP025268.1, 497105, 498067, +, 963, 92; cds-WP_000801813.1, NZ_CP025268.1, 498064, 499023, -, 960, 0; cds-WP_000671574.1, NZ_CP025268.1, 499175, 500479, +, 1305, 221061; cds-WP_000546237.1, NZ_CP025268.1, 500612, 502288, -, 1677, 193789; cds-WP_001251608.1, NZ_CP025268.1, 502526, 503746, -, 1221, 1069; cds-WP_000771748.1, NZ_CP025268.1, 503964, 505616, +, 1653, 79985; cds-WP_000186631.1, NZ_CP025268.1, 505653, 506132, -, 480, 2742; cds-WP_000365173.1, NZ_CP025268.1, 506336, 507130, -, 795, 77021; cds-WP_000806442.1, NZ_CP025268.1, 507268, 507609, +, 342, 17; cds-WP_000083955.1, NZ_CP025268.1, 507925, 510429, -, 2505, 27327; cds-WP_000883034.1, NZ_CP025268.1, 510691, 511623, +, 933, 0; cds-WP_000982172.1, NZ_CP025268.1, 511626, 512918, +, 1293, 52; cds-WP_001026747.1, NZ_CP025268.1, 513043, 513450, +, 408, 1997; cds-WP_000970323.1, NZ_CP025268.1, 513451, 513909, -, 459, 0; cds-WP_000904502.1, NZ_CP025268.1, 513906, 514823, -, 918, 373; cds-WP_001157540.1, NZ_CP025268.1, 514969, 515646, +, 678, 0; cds-WP_001295323.1, NZ_CP025268.1, 515633, 516412, +, 780, 0; cds-WP_001300573.1, NZ_CP025268.1, 516475, 517329, -, 855, 155535; cds-WP_101348557.1, NZ_CP025268.1, 517390, 518199, -, 810, 20690; cds-WP_001295836.1, NZ_CP025268.1, 518189, 518812, -, 624, 0; cds-WP_001110573.1, NZ_CP025268.1, 518783, 519469, +, 687, 0; cds-WP_101348558.1, NZ_CP025268.1, 519466, 521880, +, 2415, 0; cds-WP_000014739.1, NZ_CP025268.1, 522311, 526591, +, 4281, 7556; cds-WP_000877768.1, NZ_CP025268.1, 526631, 526999, +, 369, 0; cds-WP_001300714.1, NZ_CP025268.1, 526999, 527709, +, 711, 0; cds-WP_001320180.1, NZ_CP025268.1, 527690, 527950, +, 261, 0; cds-WP_001297301.1, NZ_CP025268.1, 528007, 528180, +, 174, 0; cds-CXP41_RS02745, NZ_CP025268.1, 528701, 529066, -, 366, 2; cds-WP_001157938.1, NZ_CP025268.1, 529182, 530276, -, 1095, 72936; cds-WP_000460145.1, NZ_CP025268.1, 530345, 531271, -, 927, 0; cds-WP_000776377.1, NZ_CP025268.1, 531501, 531983, +, 483, 0; cds-WP_000141275.1, NZ_CP025268.1, 532061, 532876, +, 816, 34932; cds-WP_001096881.1, NZ_CP025268.1, 532966, 534747, +, 1782, 0; cds-WP_000943544.1, NZ_CP025268.1, 534760, 535536, +, 777, 0; cds-WP_000765839.1, NZ_CP025268.1, 535636, 536514, +, 879, 0; cds-WP_000401100.1, NZ_CP025268.1, 536683, 538137, +, 1455, 246; cds-WP_000006900.1, NZ_CP025268.1, 538197, 539558, +, 1362, 0; cds-WP_001302767.1, NZ_CP025268.1, 539615, 540916, +, 1302, 2423; cds-WP_101348559.1, NZ_CP025268.1, 540938, 542083, +, 1146, 0; cds-WP_000540997.1, NZ_CP025268.1, 542311, 543096, -, 786, 0; cds-WP_101348560.1, NZ_CP025268.1, 543107, 544342, -, 1236, 4; cds-WP_000703900.1, NZ_CP025268.1, 544364, 545413, -, 1050, 0; cds-WP_000580829.1, NZ_CP025268.1, 545730, 547397, +, 1668, 0; cds-WP_000495367.1, NZ_CP025268.1, 547407, 548666, +, 1260, 0; cds-WP_000152519.1, NZ_CP025268.1, 548677, 549492, +, 816, 0; cds-WP_000855379.1, NZ_CP025268.1, 549489, 550382, +, 894, 0; cds-WP_000815571.1, NZ_CP025268.1, 550577, 551644, -, 1068, 103844; cds-WP_001295318.1, NZ_CP025268.1, 551641, 552150, -, 510, 1110; cds-WP_000212247.1, NZ_CP025268.1, 552268, 552990, -, 723, 18664; cds-WP_000255997.1, NZ_CP025268.1, 552993, 553487, -, 495, 164837; cds-WP_000912385.1, NZ_CP025268.1, 553661, 555046, +, 1386, 185111; cds-WP_001143542.1, NZ_CP025268.1, 555082, 555603, -, 522, 31581; cds-WP_000190288.1, NZ_CP025268.1, 555711, 555923, -, 213, 79; cds-WP_000729160.1, NZ_CP025268.1, 555925, 556791, -, 867, 336; cds-WP_000776555.1, NZ_CP025268.1, 557262, 557804, +, 543, 0; cds-WP_000988364.1, NZ_CP025268.1, 558024, 558716, +, 693, 0; cds-WP_001333622.1, NZ_CP025268.1, 558747, 561350, +, 2604, 0; cds-WP_001350487.1, NZ_CP025268.1, 561329, 562369, +, 1041, 0; cds-WP_001255230.1, NZ_CP025268.1, 562380, 562895, +, 516, 0; cds-WP_000805428.1, NZ_CP025268.1, 562898, 563530, -, 633, 0; cds-WP_001350488.1, NZ_CP025268.1, 563865, 565028, -, 1164, 1253; cds-CXP41_RS02925, NZ_CP025268.1, 565148, 565426, -, 279, 0; cds-CXP41_RS02930, NZ_CP025268.1, 565426, 565737, +, 312, 0; cds-CXP41_RS02935, NZ_CP025268.1, 565734, 565823, +, 90, 0; cds-WP_085947771.1-2, NZ_CP025268.1;NZ_CP025268.1, 565892;566153, 566153;567054, +;+, 1163, 6; cds-CXP41_RS02945, NZ_CP025268.1, 567085, 567297, +, 213, 0; cds-WP_001070439.1, NZ_CP025268.1, 567365, 567697, +, 333, 545; cds-WP_001372443.1, NZ_CP025268.1, 567745, 567894, +, 150, 0; cds-WP_000709082.1, NZ_CP025268.1, 567952, 569478, +, 1527, 3; cds-WP_001306955.1, NZ_CP025268.1, 569943, 570494, +, 552, 0; cds-WP_000881075.1, NZ_CP025268.1, 570504, 571301, +, 798, 724; cds-WP_001303586.1, NZ_CP025268.1, 571418, 571519, +, 102, 0; cds-WP_001054340.1, NZ_CP025268.1, 571516, 571971, +, 456, 0; cds-WP_000224915.1, NZ_CP025268.1, 571971, 572141, +, 171, 0; cds-WP_000774486.1, NZ_CP025268.1, 572134, 572424, +, 291, 0; cds-WP_001099712.1, NZ_CP025268.1, 572421, 572783, +, 363, 0; cds-WP_000971055.1, NZ_CP025268.1, 572780, 572920, +, 141, 0; cds-WP_001204791.1, NZ_CP025268.1, 573006, 573389, +, 384, 0; cds-WP_000019403.1-2, NZ_CP025268.1, 573787, 574767, -, 981, 227007; cds-WP_000737282.1, NZ_CP025268.1, 574808, 575875, -, 1068, 221952; cds-WP_000839596.1, NZ_CP025268.1, 576448, 576663, +, 216, 202; cds-WP_001135281.1, NZ_CP025268.1, 576663, 577160, +, 498, 0; cds-WP_001228697.1, NZ_CP025268.1, 577377, 577559, +, 183, 3474; cds-WP_000738500.1, NZ_CP025268.1, 577650, 577943, -, 294, 3921; cds-WP_000079503.1, NZ_CP025268.1, 578234, 578644, -, 411, 0; cds-WP_001031427.1, NZ_CP025268.1, 578930, 579136, +, 207, 7916; cds-WP_001421937.1, NZ_CP025268.1, 579301, 579495, -, 195, 0; cds-WP_000453566.1, NZ_CP025268.1, 579884, 580429, +, 546, 0; cds-CXP41_RS24350, NZ_CP025268.1, 580404, 580712, +, 309, 0; cds-CXP41_RS24355, NZ_CP025268.1, 580710, 581147, +, 438, 0; cds-WP_026089880.1, NZ_CP025268.1, 581201, 581827, -, 627, 0; cds-CXP41_RS03090, NZ_CP025268.1, 581924, 582184, +, 261, 0; cds-WP_000386784.1, NZ_CP025268.1, 582730, 583479, +, 750, 0; cds-WP_001201845.1, NZ_CP025268.1, 583729, 584682, -, 954, 997472; cds-WP_101348561.1, NZ_CP025268.1, 585196, 585957, -, 762, 0; cds-WP_001224604.1, NZ_CP025268.1, 586140, 587030, -, 891, 12; cds-WP_000662357.1, NZ_CP025268.1, 587031, 590003, -, 2973, 143238; cds-WP_000383932.1, NZ_CP025268.1, 589990, 592227, -, 2238, 93; cds-WP_000253839.1, NZ_CP025268.1, 592377, 593819, -, 1443, 27915; cds-WP_000770953.1, NZ_CP025268.1, 593809, 594492, -, 684, 45025; cds-WP_000074234.1, NZ_CP025268.1, 594649, 596022, +, 1374, 0; cds-WP_000709870.1, NZ_CP025268.1, 596180, 596512, +, 333, 0; cds-WP_000717157.1, NZ_CP025268.1, 596528, 597751, +, 1224, 0; cds-WP_000573945.1, NZ_CP025268.1, 597763, 600906, +, 3144, 53049; cds-WP_000786319.1, NZ_CP025268.1, 601008, 602384, +, 1377, 1691; cds-WP_001153148.1, NZ_CP025268.1, 602465, 603712, -, 1248, 117698; cds-WP_000351487.1, NZ_CP025268.1, 603820, 604473, -, 654, 474; cds-WP_000360951.1, NZ_CP025268.1, 604567, 604935, -, 369, 275; cds-WP_000682509.1, NZ_CP025268.1, 605000, 605248, -, 249, 22; cds-WP_001130654.1, NZ_CP025268.1, 605314, 606432, -, 1119, 100888; cds-WP_000956455.1, NZ_CP025268.1, 606885, 607037, +, 153, 0; cds-WP_001300563.1-2, NZ_CP025268.1, 607114, 608226, +, 1113, 95065; cds-WP_001749708.1, NZ_CP025268.1, 608508, 609128, -, 621, 0; cds-WP_001034943.1, NZ_CP025268.1, 609303, 611543, -, 2241, 55; cds-WP_000125843.1, NZ_CP025268.1, 611786, 612988, +, 1203, 4; cds-WP_000885798.1, NZ_CP025268.1, 612991, 613209, +, 219, 0; cds-WP_000077805.1, NZ_CP025268.1, 613206, 617087, +, 3882, 58; cds-WP_000096692.1, NZ_CP025268.1, 617303, 618436, +, 1134, 0; cds-WP_000140647.1, NZ_CP025268.1, 618433, 619248, -, 816, 997; cds-WP_000640988.1, NZ_CP025268.1, 619245, 620237, -, 993, 79105; cds-WP_000016947.1, NZ_CP025268.1, 620234, 621238, -, 1005, 155930; cds-WP_001041786.1, NZ_CP025268.1, 621349, 622599, +, 1251, 406782; cds-WP_001234311.1, NZ_CP025268.1, 622603, 623559, -, 957, 3754; cds-WP_000381303.1, NZ_CP025268.1, 623934, 625109, +, 1176, 1; cds-WP_000026812.1, NZ_CP025268.1, 625119, 626729, +, 1611, 0; cds-WP_001007138.1, NZ_CP025268.1, 626743, 627600, +, 858, 19; cds-WP_000347651.1, NZ_CP025268.1, 627600, 628346, +, 747, 0; cds-WP_000637953.1, NZ_CP025268.1, 628349, 628762, +, 414, 0; cds-WP_101348562.1, NZ_CP025268.1, 628943, 631048, +, 2106, 0; cds-WP_000460431.1, NZ_CP025268.1, 631231, 631428, +, 198, 0; cds-WP_001120441.1, NZ_CP025268.1, 631438, 632526, -, 1089, 0; cds-WP_000183907.1, NZ_CP025268.1, 632635, 633795, +, 1161, 9; cds-WP_000502945.1, NZ_CP025268.1, 633796, 634425, -, 630, 9; cds-WP_000029814.1, NZ_CP025268.1, 634398, 635618, -, 1221, 0; cds-


WP_000002474.1, NZ_CP025268.1, 635765, 636667, -, 903, 0; cds-WP_000913829.1, NZ_CP025268.1, 636876, 637622, -, 747, 0; cds-WP_000052796.1, NZ_CP025268.1, 637994, 638557, +, 564, 264945; cds-WP_000887629.1, NZ_CP025268.1, 638802, 640367, +, 1566, 69361; cds-WP_000278509.1, NZ_CP025268.1, 640488, 640916, -, 429, 0; cds-WP_000646173.1, NZ_CP025268.1, 641137, 642375, +, 1239, 0; cds-WP_000089731.1, NZ_CP025268.1, 642606, 643016, -, 411, 42; cds-WP_000643397.1, NZ_CP025268.1, 643246, 644052, -, 807, 589; cds-WP_000050323.1, NZ_CP025268.1, 644166, 645629, -, 1464, 0; cds-WP_000062457.1, NZ_CP025268.1, 645680, 646558, -, 879, 33515; cds-WP_000550422.1, NZ_CP025268.1, 646533, 647084, -, 552, 0; cds-WP_101348563.1, NZ_CP025268.1, 647088, 648620, -, 1533, 0; cds-WP_000622357.1, NZ_CP025268.1, 648631, 649539, -, 909, 0; cds-WP_000700703.1, NZ_CP025268.1, 649536, 649832, -, 297, 0; cds-WP_000467705.1, NZ_CP025268.1, 649847, 650905, -, 1059, 0; cds-WP_000939767.1, NZ_CP025268.1, 651284, 652942, +, 1659, 0; cds-WP_000126500.1, NZ_CP025268.1, 652911, 653591, +, 681, 4924; cds-WP_000955063.1, NZ_CP025268.1, 653632, 655017, -, 1386, 0; cds-WP_001103094.1, NZ_CP025268.1, 655606, 656166, +, 561, 3; cds-WP_000034825.1, NZ_CP025268.1, 656341, 656550, +, 210, 3339; cds-WP_000939747.1, NZ_CP025268.1, 656604, 656987, -, 384, 9664; cds-CXP41_RS03465, NZ_CP025268.1, 657080, 657867, +, 788, 0; cds-WP_000503931.1, NZ_CP025268.1, 657996, 658199, +, 204, 3; cds-WP_000042632.1, NZ_CP025268.1, 658300, 659265, -, 966, 118663; cds-WP_000378026.1, NZ_CP025268.1, 659474, 660427, -, 954, 2434; cds-WP_101348564.1, NZ_CP025268.1, 660686, 661327, -, 642, 1165; cds-WP_000850550.1, NZ_CP025268.1, 661428, 661691, -, 264, 94; cds-WP_001092082.1, NZ_CP025268.1, 661801, 663012, -, 1212, 410974; cds-WP_001231430.1, NZ_CP025268.1, 663151, 664239, -, 1089, 336757; cds-WP_000131719.1, NZ_CP025268.1, 664250, 665362, -, 1113, 296774; cds-WP_000776191.1, NZ_CP025268.1, 665365, 667266, -, 1902, 1836341; cds-WP_000776104.1, NZ_CP025268.1, 667297, 667764, -, 468, 282734; cds-WP_001161664.1, NZ_CP025268.1, 667768, 668085, -, 318, 170801; cds-WP_001241872.1, NZ_CP025268.1, 668345, 668956, -, 612, 94; cds-WP_000838889.1, NZ_CP025268.1, 668980, 669621, -, 642, 186507; cds-WP_000620535.1, NZ_CP025268.1, 669623, 670654, -, 1032, 211024; cds-WP_001269673.1, NZ_CP025268.1, 670654, 671235, -, 582, 173175; cds-WP_101348565.1, NZ_CP025268.1, 671250, 673832, -, 2583, 2149953; cds-WP_001044880.1, NZ_CP025268.1, 674067, 674549, +, 483, 0; cds-CXP41_RS03565, NZ_CP025268.1, 674619, 675595, -, 977, 0; cds-WP_000367023.1, NZ_CP025268.1, 675759, 676466, +, 708, 0; cds-WP_101348566.1, NZ_CP025268.1, 676463, 677890, +, 1428, 0; cds-WP_001035674.1, NZ_CP025268.1, 677900, 678454, -, 555, 0; cds-WP_101348567.1, NZ_CP025268.1, 678556, 679263, +, 708, 0; cds-WP 001300403.1, NZ_CP025268.1, 679260, 680711, +, 1452, 2; cds-WP 000367875.1, NZ_CP025268.1, 680771, 682441, -, 1671, 0; cds-WP_001207520.1, NZ_CP025268.1, 682525, 683460, -, 936, 1897; cds-WP_000631384.1, NZ_CP025268.1, 683578, 684303, -, 726, 4; cds-WP_000272824.1, NZ_CP025268.1, 684303, 684977, -, 675, 7697; cds-WP_000020941.1, NZ_CP025268.1, 684977, 685717, -, 741, 1140; cds-WP_001177086.1, NZ_CP025268.1, 685887, 686795, -, 909, 412365; cds-WP_000019403.1-3, NZ_CP025268.1, 687045, 688025, -, 981, 165883; cds-WP_000853021.1, NZ_CP025268.1, 688391, 689929, -, 1539, 270915; cds-WP_001278605.1, NZ_CP025268.1, 689954, 690832, -, 879, 606116; cds-WP_000084469.1, NZ_CP025268.1, 690922, 691389, -, 468, 110931; cds-WP_001018040.1, NZ_CP025268.1, 691386, 692426, -, 1041, 271361; cds-WP_000162740.1, NZ_CP025268.1, 692579, 694003, -, 1425, 468465; cds-WP_000184541.1, NZ_CP025268.1, 694149, 695324, +, 1176, 30490; cds-WP_000337077.1, NZ_CP025268.1, 696561, 698225, -, 1665, 2104; cds-WP_000153129.1, NZ_CP025268.1, 698622, 699374, -, 753, 45908; cds-WP_000187594.1, NZ_CP025268.1, 699422, 700642, -, 1221, 134199; cds-WP_000271153.1, NZ_CP025268.1, 700651, 701799, -, 1149, 13807; cds-WP_001237072.1, NZ_CP025268.1, 701859, 702659, -, 801, 0; cds-WP_001023093.1, NZ_CP025268.1, 702992, 704938, +, 1947, 155467; cds-WP_001287154.1, NZ_CP025268.1, 705141, 706805, +, 1665, 945796; cds-WP_001258819.1, NZ_CP025268.1, 707382, 708788, +, 1407, 11508; cds-WP_000733579.1, NZ_CP025268.1, 708838, 709164, +, 327, 1694; cds-WP_000131702.1, NZ_CP025268.1, 709248, 709694, -, 447, 125843; cds-WP_001406816.1, NZ_CP025268.1, 709687, 709773, -, 87, 52385; cds-WP_001018618.1, NZ_CP025268.1, 709983, 710513, -, 531, 592988; cds-WP_101348568.1, NZ_CP025268.1, 710653, 710946, -, 294, 26661; cds-WP_000773288.1, NZ_CP025268.1, 711086, 711850, -, 765, 790; cds-WP_000848387.1, NZ_CP025268.1, 712035, 712580, +, 546, 108189; cds-WP_001297249.1, NZ_CP025268.1, 712606, 714246, +, 1641, 208785; cds-WP_000856353.1, NZ_CP025268.1, 714460, 714954, +, 495, 35278; cds-CXP41 R503795, NZ_CP025268.1, 714995, 715645, -, 651, 0; cds-CXP41_RS03800, NZ_CP025268.1, 715769, 715918, -, 150, 0; cds-WP_000075845.1, NZ_CP025268.1, 715994, 717313, -, 1320, 0; cds-WP_000040195.1, NZ_CP025268.1, 717310, 719508, -, 2199, 3; cds-WP_211180488.1, NZ_CP025268.1, 719766, 719870, -, 105, 0; cds-WP_000186076.1, NZ_CP025268.1, 720104, 720781, -, 678, 0; cds-CXP41_RS03825, NZ_CP025268.1, 720778, 723463, -, 2686, 9; cds-WP_001300431.1, NZ_CP025268.1, 723456, 724028, -, 573, 0; cds-WP_000087939.1, NZ_CP025268.1, 724037, 726085, -, 2049, 549; cds-WP_000741129.1, NZ_CP025268.1, 726108, 727781, -, 1674, 93; cds-WP_001272653.1, NZ_CP025268.1, 727781, 727870, -, 90, 0; cds-WP_000424924.1, NZ_CP025268.1, 728183, 728389, +, 207, 0; cds-WP_000015200.1, NZ_CP025268.1, 728632, 732825, +, 4194, 14025; cds-WP_000873944.1, NZ_CP025268.1, 732825, 733151, +, 327, 0; cds-CXP41_RS03865, NZ_CP025268.1, 733197, 734702, +, 1506, 0; cds-WP_000832338.1, NZ_CP025268.1, 734699, 735268, +, 570, 0; cds-CXP41_RS03875, NZ_CP025268.1, 735494, 735727, +, 234, 0; cds-CXP41_RS03880, NZ_CP025268.1, 735874, 737010, +, 1137, 80; cds-CXP41_RS03885, NZ_CP025268.1, 737141, 737899, +, 759, 0; cds-WP_001053305.1, NZ_CP025268.1, 738050, 738559, +, 510, 0; cds-WP_000207142.1, NZ_CP025268.1, 738556, 739974, +, 1419, 1; cds-WP_001032689.1, NZ_CP025268.1, 740124, 741605, -, 1482, 95222; cds-WP_000798871.1, NZ_CP025268.1, 741876, 742619, +, 744, 24496; cds-WP_001188343.1, NZ_CP025268.1, 742642, 743298, +, 657, 240; cds-WP_000912724.1, NZ_CP025268.1, 743292, 744224, +, 933, 5715; cds-WP_000687112.1, NZ_CP025268.1, 744214, 744948, +, 735, 0; cds-WP_001113989.1, NZ_CP025268.1, 744984, 745775, +, 792, 10705; cds-WP_001336221.1, NZ_CP025268.1, 745772, 746818, -, 1047, 0; cds-WP_001272410.1, NZ_CP025268.1, 746970, 748031, -, 1062, 0; cds-WP_000142799.1, NZ_CP025268.1, 748028, 748756, -, 729, 0; cds-WP_001310647.1, NZ_CP025268.1, 748771, 751227, -, 2457, 0; cds-WP_000472412.1, NZ_CP025268.1, 751278, 751844, -, 567, 0; cds-WP_000785834.1, NZ_CP025268.1, 752234, 753517, -, 1284, 98508; cds-WP_001305582.1, NZ_CP025268.1, 753723, 753830, -, 108, 688; cds-WP_000263347.1, NZ_CP025268.1, 754211, 754615, +, 405, 47351; cds-WP_000254365.1, NZ_CP025268.1, 754609, 754956, +, 348, 17; cds-WP_000775540.1, NZ_CP025268.1, 754956, 756722, +, 1767, 35784; cds-WP_001235254.1, NZ_CP025268.1, 756738, 757454, +, 717, 139338; cds-WP_001181473.1, NZ_CP025268.1, 757755, 760556, +, 2802, 762321; cds-WP_000099823.1, NZ_CP025268.1, 760571, 761788, +, 1218, 228455; cds-WP_001048602.1, NZ_CP025268.1, 762063, 763229, +, 1167, 671; cds-WP_000025458.1, NZ_CP025268.1, 763229, 764098, +, 870, 14684; cds-WP_000509902.1, NZ_CP025268.1, 764202, 764924, -, 723, 0; cds-WP_001054864.1, NZ_CP025268.1, 765093, 767009, +, 1917, 35; cds-WP_000648976.1, NZ_CP025268.1, 767027, 769660, +, 2634, 8; cds-WP_000884361.1, NZ_CP025268.1, 770507, 772075, +, 1569, 1193815; cds-WP_000568275.1, NZ_CP025268.1, 772091, 773230, +, 1140, 1803969; cds-WP_000270282.1, NZ_CP025268.1, 773245, 773358, +, 114, 34634; cds-WP_000034602.1, NZ_CP025268.1, 773358, 773651, +, 294, 114145; cds-WP_001098384.1, NZ_CP025268.1, 773801, 774205, +, 405, 37149; cds-WP_000131314.1, NZ_CP025268.1, 774202, 774894, +, 693, 142109; cds-WP_000090097.1, NZ_CP025268.1, 774898, 775326, +, 429, 106443; cds-WP_000030637.1, NZ_CP025268.1, 775391, 776656, +, 1266, 255216; cds-WP_001295307.1, NZ_CP025268.1, 776789, 778081, +, 1293, 186560; cds-WP_001295306.1, NZ_CP025268.1, 778116, 778637, +, 522, 39438; cds-WP_000097571.1, NZ_CP025268.1, 778647, 779438, +, 792, 327012; cds-WP_000115290.1, NZ_CP025268.1, 781134, 782177, +, 1044, 0; cds-WP_000345410.1, NZ_CP025268.1, 782215, 782934, +, 720, 51009; cds-WP_000951292.1, NZ_CP025268.1, 782931, 783872, -, 942, 1; cds-WP_000784351.1, NZ_CP025268.1, 783986, 784366, -, 381, 27; cds-WP_001109196.1, NZ_CP025268.1, 784682, 785734, +, 1053, 13; cds-WP_001295305.1, NZ_CP025268.1, 785892, 786644, -, 753, 335355; cds-WP_101348569.1, NZ_CP025268.1, 786846, 787895, -, 1050, 19212; cds-WP_000191497.1, NZ_CP025268.1, 787883, 788929, -, 1047, 132; cds-WP_001265438.1, NZ_CP025268.1, 788939, 789955, -, 1017, 38897; cds-WP_000096869.1, NZ_CP025268.1, 790216, 791688, -, 1473, 45779; cds-WP_001147439.1, NZ_CP025268.1, 791756, 792544, -, 789, 1106; cds-WP_000891515.1, NZ_CP025268.1, 792673, 792822, +, 150, 0; cds-WP_000101984.1, NZ_CP025268.1, 792989, 793762, +, 774, 0; cds-WP_000604034.1, NZ_CP025268.1, 793762, 794451, +, 690, 10876; cds-WP_000891692.1, NZ_CP025268.1, 794454, 795512, +, 1059, 1316; cds-WP_001300666.1, NZ_CP025268.1, 795513, 796331, -, 819, 80942; cds-WP_000815435.1, NZ_CP025268.1, 796486, 797481, +, 996, 73; cds-WP_001350493.1, NZ_CP025268.1, 797522, 798475, -, 954, 0; cds-WP_000723652.1, NZ_CP025268.1, 798659, 799711, +, 1053, 0; cds-WP_001036475.1, NZ_CP025268.1, 799787, 801220, +, 1434, 0; cds-WP_000593938.1, NZ_CP025268.1, 801403, 803664, +, 2262, 0; cds-WP_001091569.1, NZ_CP025268.1, 803898, 805181, -, 1284, 88979; cds-WP_000533640.1, NZ_CP025268.1, 805316, 806386, -, 1071, 0; cds-WP_002414258.1, NZ_CP025268.1, 806364, 806582, -, 219, 0; cds-WP_000545733.1, NZ_CP025268.1, 806622, 806789, -, 168, 0; cds-WP_000026224.1, NZ_CP025268.1, 806878, 807159, -, 282, 0; cds-WP_001289873.1, NZ_CP025268.1, 807351, 807899, -, 549, 0; cds-WP_000763367.1, NZ_CP025268.1, 807896, 808117, -, 222, 0; cds-CXP41_RS04275, NZ_CP025268.1, 808216, 808432, -, 217, 0; cds-WP_000548551.1, NZ_CP025268.1, 808509, 808700, -, 192, 0; cds-WP_000149542.1, NZ_CP025268.1, 808673, 808855, -, 183, 0; cds-WP_000186891.1, NZ_CP025268.1, 808852, 809532, -, 681, 0; cds-WP_000100844.1, NZ_CP025268.1, 809529, 810314, -, 786, 0; cds-WP_000995451.1, NZ_CP025268.1, 810320, 810616, -, 297, 0; cds-WP_000372937.1, NZ_CP025268.1, 810691, 810834, -, 144, 0; cds-WP_157825722.1, NZ_CP025268.1, 810803, 810967, -, 165, 0; cds-WP_000065374.1, NZ_CP025268.1, 811040, 811408, -, 369, 0; cds-WP_000213975.1, NZ_CP025268.1, 811591, 811791, -, 201, 0; cds-WP_000281856.1, NZ_CP025268.1, 812058, 812540, +, 483, 0; cds-WP_001564525.1, NZ_CP025268.1, 812541, 812864, -, 324, 0; cds-WP_001245922.1, NZ_CP025268.1, 813329, 813763, -, 435, 0; cds-WP_000788349.1, NZ_CP025268.1, 813779, 814618, -, 840, 0; cds-WP_101348571.1, NZ_CP025268.1, 814731, 815444, -, 714, 0; cds-WP_000088605.1, NZ_CP025268.1, 815706, 816329, +, 624, 0; cds-WP_000027050.1, NZ_CP025268.1, 816414, 817274, +, 861, 0; cds-WP_000118826.1, NZ_CP025268.1, 817488, 818642, +, 1155, 0; cds-WP_000246761.1, NZ_CP025268.1, 818629, 819384, +, 756, 0; cds-WP_000044843.1, NZ_CP025268.1, 819377, 820054, +, 678, 0; cds-WP_000042533.1, NZ_CP025268.1, 820633, 822654, +, 2022, 328; cds-WP_001295302.1, NZ_CP025268.1, 822846, 823754, -, 909, 10; cds-WP_001350494.1, NZ_CP025268.1, 824151, 825140, +, 990, 103496; cds-WP_000084639.1, NZ_CP025268.1, 825162, 825674, +, 513, 6608; cds-WP_000080885.1, NZ_CP025268.1, 825677, 826162, +, 486, 9625; cds-WP_000598619.1, NZ_CP025268.1, 826155, 826400, +, 246, 3094; cds-WP_000852296.1, NZ_CP025268.1, 826402, 826854, +, 453, 44576; cds-WP_000373624.1, NZ_CP025268.1, 826991, 827695, +, 705, 583; cds-WP_000446911.1, NZ_CP025268.1, 827900, 828613, +, 714, 68; cds-WP_000045450.1, NZ_CP025268.1, 828649, 829605, -, 957, 0; cds-WP _000650337.1, NZ_CP025268.1, 829605, 830846, -, 1242, 0; cds-WP_001113348.1, NZ_CP025268.1, 830843, 831604, -, 762, 0; cds-WP_000871982.1, NZ_CP025268.1, 831737, 832147, +, 411, 38; cds-WP_101348572.1, NZ_CP025268.1, 832109, 833215, -, 1107, 290; cds-WP_000070131.1, NZ_CP025268.1,


833226, 834359, -, 1134, 14; cds-WP_000996107.1, NZ_CP025268.1, 834352, 836088, -, 1737, 24026; cds-WP_000976409.1, NZ_CP025268.1, 836081, 837079, -, 999, 8; cds-WP_001296991.1, NZ_CP025268.1, 837079, 837750, -, 672, 0; cds-WP_000007101.1, NZ_CP025268.1, 837979, 839343, +, 1365, 459241; cds-WP_001145126.1, NZ_CP025268.1, 839575, 840057, -, 483, 24; cds-WP_001340191.1, NZ_CP025268.1, 840177, 842327, +, 2151, 550154; cds-WP_000386551.1, NZ_CP025268.1, 842355, 843317, +, 963, 0; cds-WP_000443530.1, NZ_CP025268.1, 843458, 844543, +, 1086, 1; cds-WP_211180490.1, NZ_CP025268.1, 844610, 844669, +, 60, 6; cds-WP_000849301.1, NZ_CP025268.1, 844772, 845032, -, 261, 215; cds-WP_000146343.1, NZ_CP025268.1, 845297, 845563, -, 267, 19; cds-WP_000990177.1, NZ_CP025268.1, 845637, 846314, -, 678, 112175; cds-WP_000430057.1, NZ_CP025268.1, 846356, 848638, -, 2283, 13; cds-WP_000710619.1, NZ_CP025268.1, 848903, 849163, -, 261, 0; cds-WP_001295299.1, NZ_CP025268.1, 849439, 850365, +, 927, 48; cds-WP_001267253.1, NZ_CP025268.1, 850362, 852587, -, 2226, 68; cds-WP_000569083.1, NZ_CP025268.1, 852848, 853570, -, 723, 121985; cds-WP_001159065.1, NZ_CP025268.1, 853567, 854226, -, 660, 20435; cds-WP_000843866.1, NZ_CP025268.1, 854365, 855111, -, 747, 73058; cds-WP_000100800.1, NZ_CP025268.1, 855515, 856018, -, 504, 0; cds-WP_001295297.1, NZ_CP025268.1, 856317, 857204, -, 888, 115; cds-WP_148936914.1, NZ_CP025268.1, 857439, 857504, +, 66, 10483; cds-WP_001295296.1, NZ_CP025268.1, 857557, 858072, +, 516, 321947; cds-WP_001054678.1, NZ_CP025268.1, 858121, 859704, -, 1584, 36526; cds-WP_001001761.1, NZ_CP025268.1, 859976, 860104, -, 129, 13035; cds-WP_000091016.1, NZ_CP025268.1, 860290, 860757, +, 468, 3969; cds-WP_000056457.1, NZ_CP025268.1, 860754, 861872, +, 1119, 54467; cds-WP_001056384.1, NZ_CP025268.1, 861931, 862851, -, 921, 5940; cds-WP_000961458.1, NZ_CP025268.1, 863070, 864662, +, 1593, 208011; cds-WP_000168797.1, NZ_CP025268.1, 864903, 866168, -, 1266, 73; cds-WP_000114272.1, NZ_CP025268.1, 866320, 867135, -, 816, 7921; cds-WP_101348573.1, NZ_CP025268.1, 867281, 869713, -, 2433, 0; cds-WP_001295295.1, NZ_CP025268.1, 869719, 870618, -, 900, 0; cds-WP_001336208.1, NZ_CP025268.1, 870749, 871411, +, 663, 56; cds-WP_000829217.1, NZ_CP025268.1, 871487, 872236, -, 750, 52; cds-WP_000397340.1, NZ_CP025268.1, 872236, 873471, -, 1236, 51680; cds-WP_000513781.1, NZ_CP025268.1, 873675, 874640, +, 966, 11; cds-WP_001301279.1, NZ_CP025268.1, 874627, 876498, +, 1872, 195083; cds-WP_000090140.1, NZ_CP025268.1, 876518, 878056, +, 1539, 43681; cds-WP_000936043.1, NZ_CP025268.1, 878074, 878994, +, 921, 43559; cds-WP_001236051.1, NZ_CP025268.1, 878997, 879908, +, 912, 4; cds-WP_001360263.1, NZ_CP025268.1, 880086, 882434, +, 2349, 112; cds-WP_000086904.1, NZ_CP025268.1, 882442, 883770, +, 1329, 19002; cds-WP_000049367.1, NZ_CP025268.1, 883817, 885142, -, 1326, 50494; cds-WP_000497137.1, NZ_CP025268.1, 885355, 885738, +, 384, 0; cds-WP 000555031.1, NZ_CP025268.1, 885849, 886964, +, 1116, 30; cds-WP_001295292.1, NZ_CP025268.1, 886961, 887587, -, 627, 345; cds-WP_001300708.1, NZ_CP025268.1, 887834, 889036, +, 1203, 36131; cds-WP_000450121.1, NZ_CP025268.1, 889083, 889841, -, 759, 27098; cds-WP_001295291.1, NZ_CP025268.1, 889899, 890495, -, 597, 4396; cds-WP_001180089.1, NZ_CP025268.1, 890780, 892012, +, 1233, 34510; cds-WP_000605480.1, NZ_CP025268.1, 892053, 892337, -, 285, 37095; cds-WP_000023565.1, NZ_CP025268.1, 892423, 893238, -, 816, 74458; cds-WP_000217859.1, NZ_CP025268.1, 893238, 894446, -, 1209, 8253; cds-WP_001295289.1, NZ_CP025268.1, 894530, 895066, +, 537, 0; cds-WP_001024876.1, NZ_CP025268.1, 895241, 896926, -, 1686, 128295; cds-WP_000681108.1, NZ_CP025268.1, 897196, 897573, +, 378, 971; cds-WP_001195240.1, NZ_CP025268.1, 897603, 897860, -, 258, 0; cds-WP 001201560.1, NZ_CP025268.1, 898020, 898307, +, 288, 721; cds-WP_000189159.1, NZ_CP025268.1, 898291, 899013, +, 723, 115708; cds-WP_000684321.1, NZ_CP025268.1, 899074, 899976, +, 903, 173825; cds-WP_000203025.1, NZ_CP025268.1, 900064, 900540, +, 477, 80294; cds-WP_000126072.1, NZ_CP025268.1, 900891, 902003, +, 1113, 43415; cds-WP_000996005.1, NZ_CP025268.1, 902098, 903231, +, 1134, 24197; cds-WP_000105430.1, NZ_CP025268.1, 903241, 904194, +, 954, 0; cds-WP_001061658.1, NZ_CP025268.1, 904191, 905036, +, 846, 0; cds-WP_000389260.1, NZ_CP025268.1, 905096, 905584, +, 489, 5; cds-WP_001149682.1, NZ_CP025268.1, 905625, 906752, +, 1128, 195; cds-WP_001295339.1, NZ_CP025268.1, 906951, 907682, -, 732, 63741; cds-WP_000464491.1, NZ_CP025268.1, 907973, 908641, -, 669, 30919; cds-WP_001001691.1, NZ_CP025268.1, 908641, 909357, -, 717, 101531; cds-WP_000756569.1, NZ_CP025268.1, 909364, 910095, -, 732, 13200; cds-WP_000027205.1, NZ_CP025268.1, 910113, 910841, -, 729, 37369; cds-WP_001270734.1, NZ_CP025268.1, 911059, 911574, -, 516, 178; cds-WP_001160737.1, NZ_CP025268.1, 911700, 912023, +, 324, 12; cds-WP_001252135.1, NZ_CP025268.1, 912020, 912850, +, 831, 11; cds-WP_001338420.1, NZ_CP025268.1, 912847, 913860, -, 1014, 667; cds-WP_001136554.1, NZ_CP025268.1, 913959, 915389, -, 1431, 12119; cds-WP_000566376.1, NZ_CP025268.1, 915400, 916401, -, 1002, 869; cds-WP_000815337.1, NZ_CP025268.1, 916438, 918156, -, 1719, 2; cds-WP_000178677.1, NZ_CP025268.1, 918289, 919257, -, 969, 0; cds-WP_000458809.1, NZ_CP025268.1, 919269, 920921, -, 1653, 0; cds-WP_000491142.1, NZ_CP025268.1, 921065, 921964, -, 900, 100; cds-WP_001298299.1, NZ_CP025268.1, 922459, 923154, -, 696, 35; cds-WP_000599802.1, NZ_CP025268.1, 923580, 925238, +, 1659, 555482; cds-WP_001380339.1, NZ_CP025268.1, 925235, 926191, -, 957, 146922; cds-WP_000746442.1, NZ_CP025268.1, 926342, 927457, +, 1116, 4; cds-WP_000188144.1, NZ_CP025268.1, 927454, 929400, +, 1947, 77152; cds-WP_000410785.1, NZ_CP025268.1, 929473, 929697, -, 225, 6; cds-WP_001406719.1, NZ_CP025268.1, 929847, 929921, +, 75, 0; cds-WP_000520781.1, NZ_CP025268.1, 930020, 930340, +, 321, 0; cds-WP_000934041.1, NZ_CP025268.1, 930371, 932647, +, 2277, 422920; cds-WP_001040187.1, NZ_CP025268.1, 933332, 933550, -, 219, 160435; cds-WP_001241678.1, NZ_CP025268.1, 933835, 934539, -, 705, 32; cds-WP_001202177.1, NZ_CP025268.1, 934581, 936302, -, 1722, 56628; cds-WP_001043598.1, NZ_CP025268.1, 936303, 938069, -, 1767, 46988; cds-WP_000537418.1, NZ_CP025268.1, 938192, 939157, -, 966, 134577; cds-WP_000228473.1, NZ_CP025268.1, 939701, 940195, +, 495, 45903; cds-WP_000076967.1, NZ_CP025268.1, 940330, 944319, +, 3990, 249622; cds-WP_001295343.1, NZ_CP025268.1, 944478, 945089, +, 612, 196847; cds-WP_000067755.1, NZ_CP025268.1, 945100, 946443, +, 1344, 183583; cds-WP_000886683.1, NZ_CP025268.1, 946534, 947826, +, 1293, 250058; cds-WP_000850303.1, NZ_CP025268.1, 948065, 950509, +, 2445, 2162; cds-WP_000213098.1, NZ_CP025268.1, 950520, 951137, +, 618, 1; cds-WP_000534637.1, NZ_CP025268.1, 951139, 952002, +, 864, 0; cds-WP_000165879.1, NZ_CP025268.1, 952037, 952663, -, 627, 0; cds-WP_000109259.1, NZ_CP025268.1, 952977, 954125, +, 1149, 0; cds-WP_000918506.1, NZ_CP025268.1, 954335, 955765, +, 1431, 6; cds-WP_001242684.1, NZ_CP025268.1, 955766, 956674, -, 909, 0; cds-WP_001190363.1, NZ_CP025268.1, 956774, 957364, +, 591, 0; cds-WP_000111043.1, NZ_CP025268.1, 957446, 958186, -, 741, 1374; cds-WP_001292822.1, NZ_CP025268.1, 958378, 960660, -, 2283, 1333550; cds-WP_000642546.1, NZ_CP025268.1, 960715, 961572, -, 858, 25; cds-WP_001295344.1, NZ_CP025268.1, 961978, 963738, -, 1761, 155681; cds-WP_000642849.1, NZ_CP025268.1, 963868, 964560, +, 693, 0; cds-WP_000057138.1, NZ_CP025268.1, 964759, 965847, +, 1089, 203547; cds-WP_000445231.1, NZ_CP025268.1, 965918, 967201, +, 1284, 198564; cds-WP_001350496.1, NZ_CP025268.1, 967370, 968134, +, 765, 0; cds-WP_000125016.1, NZ_CP025268.1, 968307, 968990, +, 684, 121094; cds-WP_000140327.1, NZ_CP025268.1, 969101, 970774, +, 1674, 19851014; cds-WP_000167336.1, NZ_CP025268.1, 970934, 971218, +, 285, 87540; cds-WP_000705764.1, NZ_CP025268.1, 971426, 973690, +, 2265, 92592; cds-WP_000551270.1, NZ_CP025268.1, 973727, 975475, +, 1749, 153829; cds-WP_000570539.1, NZ_CP025268.1, 975472, 976458, +, 987, 27446; cds-WP_000056538.1, NZ_CP025268.1, 976495, 977727, +, 1233, 29682; cds-WP_000350058.1, NZ_CP025268.1, 977779, 977961, +, 183, 13909; cds-WP_000011603.1, NZ_CP025268.1, 977958, 978704, +, 747, 204944; cds-WP_000436922.1, NZ_CP025268.1, 978858, 979751, +, 894, 101396; cds-WP_000899600.1, NZ_CP025268.1, 979728, 980507, -, 780, 0; cds-WP_001298300.1, NZ_CP025268.1, 980643, 981428, +, 786, 58179; cds-WP_001288850.1, NZ_CP025268.1, 981425, 982747, +, 1323, 563258; cds-WP_001295347.1, NZ_CP025268.1, 982728, 983432, +, 705, 499093; cds-WP_000572698.1, NZ_CP025268.1, 983432, 987892, +, 4461, 1463254; cds-WP_000925969.1, NZ_CP025268.1, 988153, 990000, +, 1848, 50; cds-WP_001295932.1, NZ_CP025268.1, 990181, 990729, +, 549, 1369; cds-WP_001109486.1, NZ_CP025268.1, 990756, 991403, +, 648, 129997; cds-WP_000462687.1, NZ_CP025268.1, 991625, 992815, -, 1191, 434944; cds-WP_000977920.1, NZ_CP025268.1, 993000, 994088, -, 1089, 16802; cds-WP_000117881.1, NZ_CP025268.1, 994691, 996091, -, 1401, 621626; cds-WP_001307697.1, NZ_CP025268.1, 996260, 997462, -, 1203, 86598; cds-WP_000193841.1, NZ_CP025268.1, 997728, 1000340, +, 2613, 170974; cds-WP_001090506.1, NZ_CP025268.1, 1000383, 1001150, -, 768, 4; cds-WP_000235203.1, NZ_CP025268.1, 1001147, 1001938, -, 792, 0; cds-WP_000056006.1, NZ_CP025268.1, 1001949, 1003094, -, 1146, 0; cds-WP_001244308.1, NZ_CP025268.1, 1003091, 1004050, -, 960, 0; cds-WP_001263933.1, NZ_CP025268.1, 1004043, 1004618, -, 576, 0; cds-WP_000750293.1, NZ_CP025268.1, 1004974, 1005513, +, 540, 0; cds-WP_001295349.1, NZ_CP025268.1, 1005596, 1006297, +, 702, 0; cds-WP_000286312.1, NZ_CP025268.1, 1006322, 1008922, +, 2601, 6; cds-WP_001165668.1, NZ_CP025268.1, 1008913, 1009983, +, 1071, 0; cds-WP_000730614.1, NZ_CP025268.1, 1009995, 1010537, +, 543, 0; cds-WP_000919497.1, NZ_CP025268.1, 1010545, 1011060, +, 516, 0; cds-WP_001111465.1, NZ_CP025268.1, 1011026, 1011763, +, 738, 0; cds-WP_001295352.1, NZ_CP025268.1, 1011874, 1012884, +, 1011, 4337; cds-CXP41_RS05255, NZ_CP025268.1, 1013058, 1013599, +, 542, 900; cds-WP_000212426.1, NZ_CP025268.1, 1013596, 1014705, -, 1110, 778; cds-WP_001086539.1, NZ_CP025268.1, 1014949, 1017057, +, 2109, 966096; cds-WP_000053099.1, NZ_CP025268.1, 1017069, 1018976, +, 1908, 503501; cds-WP_000333176.1, NZ_CP025268.1, 1019106, 1020359, +, 1254, 136698; cds-WP_000445533.1, NZ_CP025268.1, 1020364, 1022004, +, 1641, 546554; cds-WP_000759120.1, NZ_CP025268.1, 1022001, 1022564, +, 564, 157996; cds-WP_000828648.1, NZ_CP025268.1, 1022820, 1022987, +, 168, 13088; cds-WP_000227927.1, NZ_CP025268.1, 1023057, 1023575, -, 519, 43952; cds-WP_000156518.1, NZ_CP025268.1, 1023644, 1025404, -, 1761, 396922; cds-WP_000877161.1, NZ_CP025268.1, 1025590, 1026042, +, 453, 374; cds-WP_000750416.1, NZ_CP025268.1, 1026118, 1027158, -, 1041, 4387920; cds-WP_000288710.1, NZ_CP025268.1, 1027515, 1028024, -, 510, 10; cds-WP_000839153.1, NZ_CP025268.1, 1028243, 1028872, +, 630, 33881; cds-WP_000875061.1, NZ_CP025268.1, 1028835, 1030997, -, 2163, 5491; cds-WP_001261235.1, NZ_CP025268.1, 1031007, 1031453, -, 447, 3521; cds-WP_001295354.1, NZ_CP025268.1, 1031576, 1033630, +, 2055, 2845; cds-WP_000424181.1, NZ_CP025268.1, 1033662, 1034120, -, 459, 49; cds-WP_000847791.1, NZ_CP025268.1, 1034216, 1034878, -, 663, 0; cds-WP_001301418.1, NZ_CP025268.1, 1035051, 1035464, +, 414, 0; cds-WP_001295356.1, NZ _CP025268.1, 1035509, 1035826, -, 318, 7846; cds-WP_000116297.1, NZ_CP025268.1, 1035884, 1037074, -, 1191, 142701; cds-WP_000048252.1, NZ_CP025268.1, 1037169, 1037447, +, 279, 0; cds-WP_000904442.1, NZ_CP025268.1, 1037444, 1037773, -, 330, 1; cds-WP_000375136.1, NZ_CP025268.1, 1037864, 1038523, -, 660, 10041; cds-WP_001058323.1, NZ_CP025268.1, 1039244, 1040362, +, 1119, 0; cds-WP_000107384.1, NZ_CP025268.1, 1040359, 1042152, +, 1794, 0; cds-WP_001186424.1, NZ_CP025268.1, 1042171, 1042878, +, 708, 32553; cds-WP_000003671.1, NZ_CP025268.1, 1042875, 1043462, +, 588, 81173; cds-WP_000063978.1, NZ_CP025268.1, 1043459, 1043857, +, 399, 0; cds-WP_000004899.1, NZ_CP025268.1, 1043854, 1044711, +, 858, 0; cds-WP_000263582.1, NZ_CP025268.1, 1044845, 1046389, +, 1545, 111; cds-WP_000460803.1, NZ_CP025268.1, 1046401, 1047537, +, 1137, 0; cds-WP_000270305.1, NZ_CP025268.1, 1047550, 1047642, +, 93, 0; cds-WP_001300464.1, NZ_CP025268.1, 1047722, 1049020, +, 1299, 0; cds-WP_000208650.1, NZ_CP025268.1, 1049135, 1051315, -,


2181, 21531; cds-WP_000057871.1, NZ_CP025268.1, 1051335, 1051781, -, 447, 0; cds-WP_001295357.1, NZ_CP025268.1, 1051769, 1052908, -, 1140, 0; cds-WP_000742328.1, NZ_CP025268.1, 1052954, 1055050, -, 2097, 0; cds-WP_001038079.1, NZ_CP025268.1, 1055050, 1055796, -, 747, 0; cds-WP_001247610.1, NZ_CP025268.1, 1055793, 1056437, -, 645, 87; cds-WP_001295358.1, NZ_CP025268.1, 1056544, 1056849, -, 306, 0; cds-CXP41_RS05480, NZ_CP025268.1, 1056938, 1057634, +, 697, 135520; cds-WP_000087763.1, NZ_CP025268.1, 1058067, 1058279, -, 213, 7403; cds-WP_000066490.1, NZ_CP025268.1, 1058565, 1058777, +, 213, 108600; cds-WP_071524879.1, NZ_CP025268.1, 1058788, 1058976, +, 189, 41729; cds-WP_001309400.1, NZ _CP025268.1, 1058951, 1059181, +, 231, 28719; cds-WP_001019197.1, NZ _CP025268.1, 1059171, 1059344, +, 174, 44619; cds-WP_000829662.1, NZ_CP025268.1, 1059393, 1060466, -, 1074, 783; cds-WP_001300633.1, NZ_CP025268.1, 1060538, 1063282, -, 2745, 10299; cds-WP_001264933.1, NZ_CP025268.1, 1063365, 1064393, +, 1029, 0; cds-WP_001120125.1, NZ_CP025268.1, 1064366, 1065058, -, 693, 0; cds-WP_001230242.1, NZ_CP025268.1, 1065188, 1066360, +, 1173, 0; cds-WP_001062091.1, NZ_CP025268.1, 1066360, 1068906, +, 2547, 247; cds-WP_000209894.1, NZ_CP025268.1, 1068903, 1069502, +, 600, 5; cds-WP_000024560.1, NZ_CP025268.1, 1069654, 1069959, -, 306, 1; cds-WP 000420621.1, NZ_CP025268.1, 1069959, 1070879, -, 921, 0; cds-WP_000535346.1, NZ_CP025268.1, 1071140, 1072396, +, 1257, 0; cds-WP_001044279.1, NZ_CP025268.1, 1072689, 1073930, +, 1242, 22; cds-WP_001143120.1, NZ_CP025268.1, 1073968, 1074195, -, 228, 0; cds-WP_001151437.1, NZ_CP025268.1, 1074216, 1074812, -, 597, 0; cds-WP_001273658.1, NZ_CP025268.1, 1075185, 1075358, +, 174, 0; cds-WP_001326838.1, NZ_CP025268.1, 1075613, 1076941, -, 1329, 0; cds-WP_001028083.1, NZ_CP025268.1, 1076962, 1077456, -, 495, 0; cds-WP_001001176.1, NZ_CP025268.1, 1077467, 1078057, -, 591, 0; cds-WP_000777653.1, NZ_CP025268.1, 1078067, 1078867, -, 801, 0; cds-WP_001126780.1, NZ_CP025268.1, 1078875, 1079261, -, 387, 0; cds-WP_001393558.1, NZ_CP025268.1, 1079273, 1079965, -, 693, 0; cds-WP_155555868.1, NZ_CP025268.1, 1079965, 1081056, -, 1092, 0; cds-WP_000191701.1, NZ_CP025268.1, 1081344, 1081982, +, 639, 0; cds-WP_001326840.1, NZ _CP025268.1, 1082022, 1085984, -, 3963, 177; cds-WP_000979516.1, NZ _CP025268.1, 1086039, 1086248, +, 210, 0; cds-WP_001018479.1, NZ_CP025268.1, 1086407, 1087915, +, 1509, 18210; cds-CXP41_RS05660, NZ_CP025268.1, 1088458, 1089287, +, 830, 169080; cds-WP_000154398.1, NZ_CP025268.1, 1089345, 1090472, +, 1128, 2961; cds-WP_001199471.1, NZ_CP025268.1, 1090478, 1091749, +, 1272, 24; cds-WP_000533522.1, NZ_CP025268.1, 1092370, 1093158, +, 789, 0; cds-WP_001061095.1, NZ_CP025268.1, 1093208, 1093621, -, 414, 0; cds-WP_000610451.1, NZ_CP025268.1, 1093623, 1094948, -, 1326, 0; cds-WP_000945561.1, NZ_CP025268.1, 1094941, 1096959, -, 2019, 20167; cds-WP_000287458.1, NZ_CP025268.1, 1096968, 1099391, -, 2424, 0; cds-WP_000409873.1, NZ_CP025268.1, 1099978, 1101336, +, 1359, 0; cds-WP_085947771.1-3, NZ_CP025268.1;NZ_CP025268.1, 1101377;1102278, 1102278;1102539, -;-, 1163, 3; cds-CXP41_RS05710, NZ_CP025268.1, 1102607, 1102948, +, 342, 0; cds-WP_000611859.1, NZ _CP025268.1, 1102945, 1103931, +, 987, 0; cds-WP_000351317.1, NZ_CP025268.1, 1104988, 1105926, +, 939, 8; cds-WP_000283667.1, NZ_CP025268.1, 1105981, 1106718, +, 738, 73159; cds-WP_001001921.1, NZ_CP025268.1, 1106742, 1107296, +, 555, 86492; cds-WP _001300785.1, NZ_CP025268.1, 1107398, 1107889, +, 492, 29; cds-WP_001189321.1, NZ_CP025268.1, 1107953, 1108786, -, 834, 58; cds-WP_001264088.1, NZ_CP025268.1, 1108813, 1109229, -, 417, 0; cds-WP_000833288.1, NZ_CP025268.1, 1109254, 1109643, -, 390, 0; cds-WP_000481509.1, NZ_CP025268.1, 1109648, 1110298, -, 651, 0; cds-WP_000791650.1, NZ_CP025268.1, 1111053, 1111508, +, 456, 0; cds-WP_000771437.1, NZ_CP025268.1, 1111549, 1112004, +, 456, 22; cds-WP_001094300.1, NZ_CP025268.1, 1112063, 1112395, +, 333, 9; cds-WP_000489587.1, NZ_CP025268.1, 1112516, 1112827, +, 312, 0; cds-WP_000857405.1, NZ_CP025268.1, 1112922, 1113455, +, 534, 26; cds-WP_001307714.1, NZ_CP025268.1, 1113397, 1114878, +, 1482, 250912; cds-WP_001070375.1, NZ_CP025268.1, 1114886, 1116043, -, 1158, 52; cds-WP_001343212.1, NZ_CP025268.1, 1116437, 1117972, +, 1536, 298536; cds-WP_001295445.1, NZ_CP025268.1, 1117965, 1120508, +, 2544, 2026219; cds-WP_001237205.1, NZ_CP025268.1, 1120681, 1120908, +, 228, 51214; cds-WP_000180056.1, NZ_CP025268.1, 1120909, 1121283, -, 375, 2; cds-WP_000074172.1, NZ_CP025268.1, 1121366, 1122592, -, 1227, 18308; cds-WP_000183364.1, NZ_CP025268.1, 1122764, 1123684, -, 921, 15863; cds-WP_001144615.1, NZ_CP025268.1, 1123909, 1124961, +, 1053, 20849; cds-WP_000749261.1, NZ_CP025268.1, 1125003, 1125578, -, 576, 84476; cds-WP_000011114.1, NZ_CP025268.1, 1125582, 1126148, -, 567, 0; cds-WP_001253418.1, NZ_CP025268.1, 1126409, 1126522, -, 114, 0; cds-WP_000872833.1, NZ_CP025268.1, 1126570, 1127688, -, 1119, 14; cds-WP_000414438.1, NZ_CP025268.1, 1127803, 1128057, -, 255, 0; cds-WP_001217754.1, NZ_CP025268.1, 1128344, 1128589, -, 246, 0; cds-WP_000126534.1, NZ_CP025268.1, 1128663, 1129709, -, 1047, 2289; cds-WP_001295443.1, NZ_CP025268.1, 1129815, 1130375, -, 561, 115; cds-WP_000780912.1, NZ_CP025268.1, 1130509, 1131156, -, 648, 43202; cds-WP_101348576.1, NZ_CP025268.1, 1131220, 1132428, -, 1209, 0; cds-WP_000468186.1, NZ_CP025268.1, 1132664, 1133248, +, 585, 0; cds-WP_000877107.1, NZ_CP025268.1, 1133259, 1133906, +, 648, 1214; cds-WP_000736158.1, NZ_CP025268.1, 1133908, 1134831, +, 924, 72; cds-WP_001050683.1, NZ_CP025268.1, 1134941, 1136476, +, 1536, 29054; cds-WP_000197363.1, NZ_CP025268.1, 1136516, 1136932, -, 417, 223329; cds-WP_000020880.1, NZ_CP025268.1, 1136937, 1137230, -, 294, 76178; cds-WP_000905458.1, NZ_CP025268.1, 1137306, 1137965, -, 660, 6383; cds-WP_000884702.1, NZ_CP025268.1, 1138120, 1138536, +, 417, 47522; cds-WP_001196460.1, NZ_CP025268.1, 1138540, 1138944, +, 405, 146912; cds-WP_000020486.1, NZ_CP025268.1, 1138956, 1139651, +, 696, 1076371; cds-WP_000885873.1, NZ_CP025268.1, 1139676, 1140884, +, 1209, 1124646; cds-WP_000349316.1, NZ_CP025268.1, 1140904, 1141659, +, 756, 277131; cds-WP_000625837.1, NZ_CP025268.1, 1141831, 1142613, +, 783, 526748; cds-WP_001295442.1, NZ_CP025268.1, 1142666, 1143364, +, 699, 101817; cds-WP_000589326.1, NZ_CP025268.1, 1143376, 1144473, +, 1098, 163847; cds-WP_001295441.1, NZ_CP025268.1, 1144473, 1145414, +, 942, 34129; cds-CXP41_RS06000, NZ_CP025268.1, 1145480, 1147122, +, 1643, 469683; cds-WP_001212782.1, NZ_CP025268.1, 1147134, 1148087, +, 954, 220104; cds-WP_000827360.1, NZ_CP025268.1, 1148283, 1151468, -, 3186, 960861; cds-WP_000846343.1, NZ_CP025268.1, 1152041, 1153000, +, 960, 45946; cds-WP_001125202.1, NZ_CP025268.1, 1153112, 1153696, -, 585, 88622; cds-WP_001174481.1, NZ_CP025268.1, 1153895, 1154416, +, 522, 1435619; cds-WP_000290727.1, NZ_CP025268.1, 1154468, 1154641, +, 174, 679039; cds-WP_000197597.1, NZ_CP025268.1, 1154722, 1155792, +, 1071, 1205000; cds-WP_000288132.1, NZ_CP025268.1, 1155860, 1156813, +, 954, 3480344; cds-WP_000191372.1, NZ_CP025268.1, 1156829, 1157758, +, 930, 938806; cds-WP_001008535.1, NZ_CP025268.1, 1157771, 1158505, +, 735, 1538109; cds-WP_000103754.1, NZ_CP025268.1, 1158716, 1158952, +, 237, 996475; cds-WP_101348577.1, NZ_CP025268.1, 1159040, 1160281, +, 1242, 2687278; cds-WP_000478681.1, NZ_CP025268.1, 1160401, 1161210, +, 810, 199189; cds-WP_000756827.1, NZ_CP025268.1, 1161213, 1162235, +, 1023, 205660; cds-WP_001257000.1, NZ_CP025268.1, 1162225, 1162866, +, 642, 105026; cds-WP_001267956.1, NZ_CP025268.1, 1162863, 1163867, +, 1005, 63528; cds-WP_000480245.1, NZ_CP025268.1, 1163878, 1164675, +, 798, 80914; cds-WP_000475719.1, NZ_CP025268.1, 1164970, 1166403, +, 1434, 883967; cds-WP_000953441.1, NZ_CP025268.1, 1166463, 1168652, -, 2190, 197; cds-WP_000807125.1, NZ_CP025268.1, 1168986, 1169345, +, 360, 1315; cds-WP_001225295.1, NZ _CP025268.1, 1169348, 1169725, +, 378, 34; cds-WP_000164439.1, NZ_CP025268.1, 1169739, 1170380, +, 642, 18; cds-WP_001116592.1, NZ_CP025268.1, 1170361, 1171185, +, 825, 1561; cds-WP_000529320.1, NZ_CP025268.1, 1171196, 1172221, +, 1026, 45029; cds-WP_000587933.1, NZ_CP025268.1, 1172244, 1172786, +, 543, 63224; cds-WP_000211045.1, NZ_CP025268.1, 1173186, 1174490, +, 1305, 765029; cds-WP_001043459.1, NZ_CP025268.1, 1174700, 1175239, +, 540, 39204; cds-CXP41_RS06145, NZ_CP025268.1, 1175301, 1175932, -, 632, 1; cds-WP_000800153.1, NZ_CP025268.1, 1176173, 1176430, +, 258, 0; cds-WP_001350500.1, NZ_CP025268.1, 1176512, 1177474, -, 963, 3; cds-WP_001115094.1, NZ_CP025268.1, 1177618, 1181064, -, 3447, 130329; cds-WP_000810253.1, NZ_CP025268.1, 1181192, 1182265, -, 1074, 0; cds-WP_000284714.1, NZ_CP025268.1, 1182527, 1183726, +, 1200, 32890; cds-WP_001033694.1, NZ_CP025268.1, 1183719, 1184420, +, 702, 5; cds-WP_001251348.1, NZ_CP025268.1, 1184420, 1185664, +, 1245, 125905; cds-WP_000291270.1, NZ _CP025268.1, 1185693, 1186604, +, 912, 146433; cds-WP_000952737.1, NZ_CP025268.1, 1186620, 1187459, +, 840, 326778; cds-WP_000713462.1, NZ_CP025268.1, 1187579, 1188367, -, 789, 123643; cds-WP_000076376.1, NZ_CP025268.1, 1188364, 1188825, -, 462, 21043; cds-WP_000759317.1, NZ_CP025268.1, 1188883, 1189929, -, 1047, 648491; cds-WP_000580316.1, NZ_CP025268.1, 1189926, 1190720, -, 795, 417457; cds-WP_ 000799401.1, NZ_CP025268.1, 1190717, 1191574, -, 858, 265718; cds-WP_000531594.1, NZ_CP025268.1, 1191558, 1192694, -, 1137, 601018; cds-WP_000359434.1, NZ_CP025268.1, 1192944, 1194170, +, 1227, 6063; cds-WP_000456506.1, NZ_CP025268.1, 1194219, 1195340, -, 1122, 125915; cds-WP_000735412.1, NZ_CP025268.1, 1195416, 1196876, -, 1461, 152056; cds-WP_001265471.1, NZ_CP025268.1, 1196876, 1197547, -, 672, 41145; cds-WP_000423742.1, NZ_CP025268.1, 1197716, 1199086, -, 1371, 228076; cds-WP_ 001297479.1, NZ_CP025268.1, 1199090, 1199731, -, 642, 220776; cds-WP_001297484.1, NZ_CP025268.1, 1199767, 1200873, -, 1107, 320405; cds-WP_000476093.1, NZ_CP025268.1, 1200927, 1201388, -, 462, 112809; cds-WP_001248691.1, NZ_CP025268.1, 1201398, 1202051, -, 654, 18625; cds-WP_000444484.1, NZ_CP025268.1, 1202223, 1203473, +, 1251, 466826; cds-WP_000241967.1, NZ_CP025268.1, 1203967, 1204632, -, 666, 39487; cds-WP_010723094.1, NZ_CP025268.1, 1204633, 1205337, -, 705, 4; cds-WP_001257372.1, NZ_CP025268.1, 1205795, 1206688, +, 894, 94; cds-CXP41_RS06295, NZ_CP025268.1, 1206779, 1207907, -, 1129, 22; cds-WP_101348578.1, NZ_CP025268.1, 1207888, 1208133, -, 246, 0; cds-WP_011443584.1, NZ_CP025268.1, 1208170, 1208481, -, 312, 4; cds-WP_010723095.1, NZ_CP025268.1, 1208598, 1208939, +, 342, 0; cds-WP_001005353.1, NZ_CP025268.1, 1208877, 1209185, -, 309, 0; cds-WP_000848748.1, NZ_CP025268.1, 1209360, 1210034, -, 675, 25729; cds-WP_000649480.1, NZ_CP025268.1, 1210125, 1210325, +, 201, 0; cds-WP_000515837.1, NZ_CP025268.1, 1210369, 1210926, +, 558, 0; cds-WP_101348579.1, NZ_CP025268.1, 1211102, 1211281, +, 180, 0; cds-WP_000104929.1, NZ_CP025268.1, 1211271, 1212638, +, 1368, 0; cds-WP_000605606.1, NZ_CP025268.1, 1212650, 1212832, +, 183, 0; cds-CXP41_RS06355, NZ_CP025268.1, 1212832, 1213239, +, 408, 0; cds-WP_001350503.1, NZ_CP025268.1, 1213232, 1214023, +, 792, 0; cds-WP_000383574.1, NZ_CP025268.1, 1214014, 1214598, +, 585, 0; cds-WP_000554703.1, NZ_CP025268.1, 1214602, 1215231, +, 630, 0; cds-CXP41_RS06375, NZ_CP025268.1, 1215233, 1215637, +, 405, 0; cds-CXP41_RS06380, NZ_CP025268.1, 1215635, 1216219, -, 585, 0; cds-WP_024184299.1, NZ_CP025268.1, 1216219, 1216713, -, 495, 0; cds-WP_000905001.1, NZ_CP025268.1, 1216785, 1217339, +, 555, 0; cds-WP_000557907.1, NZ_CP025268.1, 1217446, 1218279, +, 834, 0; cds-CXP41_RS06400, NZ_CP025268.1, 1218510, 1218677, +, 168, 0; cds-WP_001295666.1, NZ_CP025268.1, 1218780, 1219103, -, 324, 0; cds-WP_120795380.1, NZ_CP025268.1, 1219360, 1219404, -, 45, 0; cds-WP_032082692.1, NZ_CP025268.1, 1219640, 1219750, -, 111, 0; cds-WP_ 000373101.1, NZ_CP025268.1, 1219803, 1220207, -, 405, 0; cds-WP_000332303.1, NZ_CP025268.1, 1220428, 1221159, -, 732, 4; cds-WP_001299269.1, NZ_CP025268.1, 1221364, 1222575, -, 1212, 79766; cds-WP_000554140.1, NZ_CP025268.1, 1222889, 1223125, +, 237, 0; cds-WP_000858002.1, NZ_CP025268.1, 1223168, 1223440, +, 273, 0; cds-WP_000888772.1, NZ_CP025268.1, 1223469, 1223735, +, 267, 0; cds-WP_001065752.1, NZ_CP025268.1, 1223848, 1224096, +, 249, 0; cds-WP_001246499.1, NZ_CP025268.1, 1224426, 1225949, +, 1524, 161; cds-


WP_001065861.1, NZ_CP025268.1, 1226081, 1226299, +, 219, 1; cds-CXP41_RS24365, NZ_CP025268.1, 1226699, 1229346, +, 2648, 1; cds-WP_000979977.1, NZ_CP025268.1 1229403, 1229738, -, 336, 0; cds-WP_000726974.1, NZ_CP025268.1, 1229742, 1230086, -, 345, 0; cds-WP_000122462.1, NZ_CP025268.1 1230088, 1230261, -, 174, 0; cds-WP_001325005.1, NZ_CP025268.1 1230362, 1230547, +, 186, 70; cds-WP_001131446.1, NZ_CP025268.1, 1230508, 1230627, +, 120, 0; cds-CXP41_RSO6490, NZ_CP025268.1, 1230662, 1231005, +, 344, 0; cds-WP_001185665.1, NZ_CP025268.1 CP025268.1, 1231377, 1231643, -, 267, 336; cds-WP_000101055.1, NZ_CP025268.1 1231647, 1232459, -, 813, 559687; cds-WP_001301105.1, NZ_CP025268.1, 1232483, 1233178, -, 696, 32889; cds-WP_0010568401, NZ_CP025268.1, 1233698, 1234066, +, 369, 0; cds-WP_000695215.1, NZ_CP025268.1, 1234169, 1234570, -, 402, 0; cds-WP_001295992.1, NZ_CP025268.1, 1234812, 1235105, +, 294, 0; cds-WP_101348580.1, NZ_CP025268.1, 1235177, 1235836, +, 660, 3756; cds-WP_001306825.1, NZ_CP025268.1, 1235928, 1236374, +, 447, 1; cds-WP_001336523.1, NZ_CP025268.1, 1236581, 1237492, -, 912, 0; cds-WP_000897378.1, NZ_CP025268.1, 1237865, 1238284, +, 420, 0; cds-WP_000457616.1, NZ_CP025268.1, 1238284, 1239552, +, 1269, 23344; cds-WP_000943459.1, NZ_CP025268.1, 1239598, 1240128, -, 531, 7340; cds-WP_000406391.1, NZ_CP025268.1, 1240274, 1241815, -, 1542, 159507; cds-WP_000234823.1, NZ_CP025268.1, 1242036, 1242755, +, 720, 220; cds-WP_000190854.1, NZ_CP025268.1, 1242807, 1244339, -, 1533, 1431; cds-WP_001266908.1, NZ_CP025268.1, 1244669, 1245967, +, 1299, 290; cds-WP_000197881.1, NZ_CP025268.1, 1245977, 1247047, +, 1071, 3701; cds-WP_000340194.1, NZ_CP025268.1, 1247433, 1249169, -, 1737, 50; cds-WP_000051560.1, NZ_CP025268.1, 1249264, 1250178, -, 915, 8; cds-WP_001301104.1, NZ_CP025268.1, 1250278, 1250889, +, 612, 6999; cds-WP_000020169.1, NZ_CP025268.1, 1250891, 1251625, -, 735, 36475; cds-WP_001310727.1, NZ_CP025268.1, 1251826, 1252080, +, 255, 0; cds-WP_000615067.1, NZ_CP025268.1, 1252258, 1252698, +, 441, 0; cds-WP_000841714.1, NZ_CP025268.1, 1252777, 1254474, -, 1698, 8228; cds-WP_001301101.1, NZ_CP025268.1, 1254794, 1256212, -, 1419, 13484; cds-WP_000059411.1, NZ_CP025268.1, 1256223, 1256855, -, 633, 0; cds-CXP41_RS06650, NZ_CP025268.1, 1256866, 1257937, -, 1072, 0; cds-WP _101348581.1, NZ_CP025268.1, 1258165, 1260084, +, 1920, 1807; cds-WP_001334788.1, NZ_CP025268.1, 1260184, 1263051, -, 2868, 3; cds-WP_000505866.1, NZ_CP025268.1, 1263820, 1264911, -, 1092, 333168; cds-WP_000152933.1, NZ_CP025268.1, 1265028, 1265612, -, 585, 7625; cds-WP_000823885.1, NZ_CP025268.1, 1265890, 1266168, +, 279, 3740; cds-WP_001033352.1, NZ_CP025268.1, 1266223, 1267902, -, 1680, 161138; cds-WP_001298109.1, NZ_CP025268.1, 1268027, 1268974, -, 948, 112829; cds-WP_001260332.1, NZ_CP025268.1, 1269125, 1269976, -, 852, 19540; cds-WP_001130692.1, NZ_CP025268.1, 1269976, 1270599, -, 624, 62029; cds-WP_001299679.1, NZ_CP025268.1, 1270813, 1272069, +, 1257, 9288; cds-WP_000456467.1, NZ_CP025268.1, 1272111, 1272944, +, 834, 99296; cds-WP_000200374.1, NZ_CP025268.1, 1272941, 1273333, +, 393, 217940; cds-WP_001257044.1, NZ_CP025268.1, 1273337, 1274146, +, 810, 419626; cds-WP_000811065.1, NZ_CP025268.1, 1274182, 1275036, +, 855, 47500; cds-WP_000170955.1, NZ_CP025268.1, 1275185, 1275292, -, 108, 3934; cds-WP_000170963.1, NZ_CP025268.1, 1275720, 1275827, -, 108, 550; cds-WP_000170955.1-2, NZ_CP025268.1, 1276255, 1276362, -, 108, 1678; cds-WP_101348582.1, NZ_CP025268.1, 1276766, 1277866, -, 1101, 9660; cds-WP _001146444.1, NZ_CP025268.1, 1278136, 1278366, +, 231, 0; cds-WP_001336325.1, NZ_CP025268.1, 1278524, 1279219, +, 696, 0; cds-WP_001169669.1, NZ_CP025268.1, 1279263, 1279616, -, 354, 0; cds-WP_000086217.1, NZ_CP025268.1, 1279801, 1281195, +, 1395, 1078; cds-WP_000070491.1, NZ_CP025268.1, 1281196, 1281846, -, 651, 274; cds-WP_000918073.1, NZ_CP025268.1, 1281839, 1283635, -, 1797, 87229; cds-WP_000019827.1, NZ_CP025268.1, 1283974, 1285365, +, 1392, 0; cds-WP_000032939.1, NZ_CP025268.1, 1285881, 1289624, +, 3744, 0; cds-WP_000702650.1, NZ_CP025268.1, 1289621, 1291159, +, 1539, 0; cds-WP_000571681.1, NZ_CP025268.1, 1291156, 1291866, +, 711, 0; cds-WP_001160108.1, NZ_CP025268.1, 1291866, 1292543, +, 678, 0; cds-WP_000555857.1, NZ_CP025268.1, 1293799, 1294641, -, 843, 144106; cds-WP_001307143.1, NZ_CP025268.1, 1294691, 1295149, -, 459, 524; cds-WP_001295622.1, NZ_CP025268.1, 1295262, 1296167, +, 906, 1571; cds-WP_000193447.1, NZ_CP025268.1, 1296259, 1297272, +, 1014, 298; cds-WP_000718995.1, NZ _CP025268.1, 1297474, 1298382, +, 909, 242776; cds-WP_001287378.1, NZ_CP025268.1, 1298526, 1298939, -, 414, 189818; cds-WP_000068077.1, NZ_CP025268.1, 1299544, 1300161, +, 618, 1; cds-CXP41_RS06895, NZ_CP025268.1, 1300443, 1301339, -, 897, 101136; cds-WP_000301651.1, NZ_CP025268.1, 1301463, 1304138, -, 2676, 544626; cds-WP_211180492.1, NZ_CP025268.1, 1304531, 1304584, +, 54, 0; cds-WP_000616554.1, NZ_CP025268.1, 1304615, 1305262, +, 648, 1; cds-WP_001211520.1, NZ_CP025268.1, 1305420, 1305716, -, 297, 11217; cds-WP_001393463.1, NZ_CP025268.1, 1306000, 1307631, +, 1632, 2397957; cds-WP_000911112.1, NZ_CP025268.1, 1307717, 1308637, +, 921, 847228; cds-WP_000979661.1, NZ_CP025268.1, 1308652, 1309560, +, 909, 653115; cds-WP_000110948.1, NZ_CP025268.1, 1309572, 1310585, +, 1014, 765740; cds-WP_000994906.1, NZ_CP025268.1 1310582, 1311586, +, 1005, 263125; cds-WP_000366959.1, NZ_CP025268.1 1311639, 1311968, -, 330, 16994; cds-WP_000214516.1, NZ_CP025268.1, 1312003, 1313463, -, 1461, 73962; cds-WP_001309467.1, NZ_CP025268.1, 1313606, 1313779, +, 174, 0; cds-WP_001295624.1, NZ_CP025268.1, 1313834, 1315087, -, 1254, 2; cds-WP_000967595.1, NZ_CP025268.1, 1315387, 1315683, -, 297, 0; cds-WP_001360141.1, NZ_CP025268.1, 1315907, 1316626, +, 720, 101510; cds-WP_000108160.1, NZ_CP025268.1, 1316666, 1317064, -, 399, 26993; cds-WP_000808667.1, NZ_CP025268.1, 1317708, -, 540, 2651; cds-WP_000028545.1, NZ_CP025268.1, 1317738, 1318481, -, 744, 2; cds-CXP41_RS24150, NZ_CP025268.1, 1318509, 1318598, -, 90, 0; cds-WP_000737226.1, NZ_CP025268.1, 1318838, 1319476, +, 639, 0; cds-WP_001079505.1, NZ_CP025268.1,1319536, 1320042, -, 507, 0; cds-WP_001056490.1, NZ_CP025268.1, 1320088, 1320588, -, 501, 147; cds-WP_000807651.1, NZ_CP025268.1, 1320674, 1320853, -, 180, 0; cds-WP_000443067.1, NZ_CP025268.1, 1321234, 1322040, -, 807, 193; cds-WP_000209520.1, NZ_CP025268.1, 1322040, 1323233, -, 1194, 26649; cds-WP_000983871.1, NZ_CP025268.1, 1323245, 1324606, -, 1362, 19; cds-WP_000763511.1, NZ_CP025268.1, 1324607, 1326202, -, 1596, 19; cds-WP_001194582.1, NZ_CP025268.1, 1326202, 1327764, -, 1563, 0; cds-WP_001700591.1, NZ_CP025268.1, 1327856, 1327900, -, 45, 0; cds-WP_001285661.1, NZ_CP025268.1, 1328038, 1328919, +, 882, 4; cds-WP_001295575.1, NZ_CP025268.1, 1328916, 1329536, +, 621, 728; cds-WP_001326916.1, NZ_CP025268.1, 1329564, 1331459, +, 1896, 1109; cds-WP_001291217.1, NZ_CP025268.1, 1331670, 1332545, +, 876, 223441; cds-WP_001278906.1, NZ_CP025268.1, 1332585, 1333175, -, 591, 65112; cds-WP_000559286.1, NZ_CP025268.1, 1333172, 1333930, -, 759, 46; cds-WP_000422045.1, NZ_CP025268.1, 1334150, 1335199, +, 1050, 10878; cds-WP_001031530.1, NZ_CP025268.1, 1335235, 1335486, -, 252, 19; cds-WP_001297122.1, NZ_CP025268.1, 1335866, 1338463, +, 2598, 1375391; cds-WP_000776253.1, NZ_CP025268.1, 1338673, 1339647, +, 975, 2188; cds-WP_001300896.1, NZ_CP025268.1, 1339966, 1340106, +, 141, 0; cds-WP_001297116.1, NZ_CP025268.1, 1340109, 1340276, +, 168, 3; cds-WP_001310756.1, NZ_CP025268.1, 1340390, 1340485, +, 96, 0; cds-WP_000099535.1, NZ_CP025268.1, 1340649, 1343324, +, 2676, 225194; cds-WP_001176295.1, NZ_CP025268.1, 1343388, 1343978, -, 591, 142527; cds-WP_001256538.1, NZ_CP025268.1, 1344148, 1344912, +, 765, 37919; cds-WP_000876286.1, NZ_CP025268.1, 1345061, 1345369, +, 309, 28; cds-WP_000891353.1, NZ_CP025268.1, 1345376, 1346545, +, 1170, 15236; cds-WP_000176270.1, NZ_CP025268.1, 1346739, 1347476, +, 738, 20754; cds-WP_001295580.1, NZ_CP025268.1, 1347476, 1347802, +, 327, 50902; cds-WP_000498253.1, NZ_CP025268.1, 1347928, 1348146, -, 219, 0; cds-WP_001088620.1, NZ_CP025268.1, 1348415, 1349164, -, 750, 16953; cds-WP_001288368.1, NZ_CP025268.1, 1349254, 1349427, -, 174, 63133; cds-WP_211180493.1, NZ_CP025268.1, 1349465, 1349593, +, 129, 32252; cds-WP_000859945.1, NZ_CP025268.1, 1349575, 1351560, -, 1986, 659935; cds-WP_000221855.1, NZ_CP025268.1, 1351614, 1351718, +, 105, 0; cds-WP_000484984.1, NZ_CP025268.1, 1351796, 1353730, -, 1935, 442405; cds-WP_001335988.1, NZ_CP025268.1,1353798, 1354925, -, 1128, 0; cds-WP_000506490.1, NZ_CP025268.1, 1355069, 1355857, -, 789, 177411; cds-WP_000565727.1, NZ_CP025268.1, 1356226, 1356579, -, 354, 1254; cds-WP_000573407.1, NZ_CP025268.1, 1356647, 1357453, -, 807, 10412; cds-WP_001128858.1, NZ_CP025268.1, 1357455, 1358447, -, 993, 2670; cds-WP_101348583.1, NZ_CP025268.1, 1358447, 1359337, -, 891, 54721; cds-WP_000583277.1, NZ_CP025268.1, 1359324, 1360289, -, 966, 540; cds-WP_001250216.1, NZ_CP025268.1, 1360286, 1361929, -, 1644, 68895; cds-WP_001015110.1, NZ_CP025268.1, 1362242, 1362487, -, 246, 2728; cds-WP_000996856.1, NZ_CP025268.1, 1362621, 1364006, -, 1386, 0; cds-WP_120795382.1, NZ_CP025268.1, 1363996, 1364160, -, 165, 0; cds-WP_001296746.1, NZ_CP025268.1, 1364309, 1365727, -, 1419, 5; cds-WP_001300506.1, NZ_CP025268.1, 1365939, 1366703, +, 765, 2995; cds-WP_001278727.1, NZ_CP025268.1, 1366730, 1367287, +, 558, 105443; cds-WP_001009090.1, NZ _CP025268.1, 1367562, 1369049, +, 1488, 0; cds-WP_000134870.1, NZ_CP025268.1, 1369051, 1370331, +, 1281, 0; cds-WP_000069229.1, NZ_CP025268.1, 1370369, 1371634, +, 1266, 0; cds-WP_001301108.1, NZ_CP025268.1, 1371754, 1372731, -, 978, 0; cds-WP_000511025.1, NZ_CP025268.1, 1372898, 1373566, +, 669, 1; cds-WP_001274963.1, NZ _CP025268.1, 1373620, 1373844, +, 225, 0; cds-WP_000907387.1, NZ_CP025268.1, 1373844, 1374203, +, 360, 0; cds-WP_001295585.1, NZ_CP025268.1, 1374212, 1374433, +, 222, 3; cds-WP_000473109.1, NZ_CP025268.1, 1374508, 1374822, +, 315, 0; cds-WP_000810499.1, NZ_CP025268.1, 1375034, 1376713, +, 1680, 7; cds-WP_000597466.1, NZ_CP025268.1, 1376727, 1378019, +, 1293, 0; cds-WP_001080790.1, NZ_CP025268.1, 1378040, 1378921, +, 882, 0; cds-WP_000224659.1, NZ_CP025268.1, 1378908, 1379750, +, 843, 0; cds-WP_000737347.1, NZ_CP025268.1,1379781, 1380833, +, 1053, 0; cds-WP_000690229.1, NZ_CP025268.1, 1380852, 1381640, +, 789, 0; cds-WP_001395397.1, NZ _CP025268.1, 1381650, 1382705, +, 1056, 0; cds-WP_000198036.1, NZ_CP025268.1, 1382702, 1384969, +, 2268, 0; cds-WP_000775794.1, NZ_CP025268.1, 1384966, 1385625, +, 660, 0; cds-CXP41_RS07340, NZ_CP025268.1, 1385639, 1386720, +, 1082, 0; cds-WP_000735257.1, NZ_CP025268.1, 1386765, 1387670, +, 906, 0; cds-WP_000075375.1, NZ_CP025268.1, 1387781, 1388779, -, 999, 0; cds-WP_000825775.1, NZ_CP025268.1, 1388935, 1390332, +, 1398, 1; cds-WP_000138728.1, NZ_CP025268.1, 1390329, 1391390, +, 1062, 2; cds-WP_097766186.1, NZ_CP025268.1, 1391538, 1393079, +, 1542, 228381; cds-WP_000084387.1, NZ_CP025268.1, 1393123, 1393629, -, 507, 157475; cds-CXP41_RS07375, NZ_CP025268.1, 1393748, 1394713, +, 966, 88144; cds-WP_101348584.1, NZ_CP025268.1 CP025268.1, 1394688, 1395416, -, 729, 44; cds-CXP41_RS07385, NZ_CP025268.1, 1395543, 1395680, -, 138, 109685; cds-WP_001300523.1, NZ_CP025268.1, 1395751, 1396671, -, 921, 61005; cds-WP_000817708.1, NZ_CP025268.1, 1396809, 1397708, +, 900, 939700; cds-WP_000683020.1, NZ_CP025268.1, 1398045, 1399658, +, 1614, 21905; cds-WP_000559900.1, NZ_CP025268.1, 1399709, 1400740, -, 1032, 190; cds-WP_000019403.1-4, NZ_CP025268.1, 1400930, 1401910, +, 981, 164925; cds-WP_000605090.1, NZ_CP025268.1, 1402183, 1402440, +, 258, 1854; cds-WP_001262123.1, NZ_CP025268.1, 1402490, 1403440, -, 951, 0; cds-WP_000611911.1, NZ_CP025268.1, 1404344, -, 753, 0; cds-CXP41_RS07430, NZ_CP025268.1, 1404539, 1405055, -, 517, 0; cds-WP_000062973.1, NZ_CP025268.1, 1405066, 1406592, -, 1527, 0; cds-WP_001156451.1, NZ_CP025268.1, 1406629, 1408074, -, 1446, 0; cds-WP_000444929.1, NZ_CP025268.1, 1408074, 1409384, -, 1311, 0; cds-WP_000885458.1, NZ_CP025268.1, 1409560, 1410468, +, 909, 0; cds-WP_001046829.1, NZ_CP025268.1, 1410798, 1411361, +, 564, 0; cds-WP_000628058.1, NZ_CP025268.1, 1411382, 1412614, -, 1233, 0; cds-WP_211180494.1, NZ_CP025268.1, 1412808, 1412855, +, 48, 0; cds-WP_000387388.1,


NZ_CP025268.1, 1412869, 1413852, +, 984, 0; cds-WP_000123737.1, NZ_CP025268.1, 1414330, 1415703, +, 1374, 0; cds-WP_001157406.1, NZ_CP025268.1, 1415832, 1416767, -, 936, 495142; cds-WP _000040852.1, NZ_CP025268.1, 1416819, 1418054, -, 1236, 121497; cds-WP_000079604.1, NZ_CP025268.1, 1418056, 1418271, -, 216, 0; cds-WP_000276809.1, NZ_CP025268.1, 1418350, 1418559, -, 210, 0; cds-WP_001317028.1, NZ_CP025268.1, 1418552, 1418746, -, 195, 0; cds-WP_000166319.1, NZ_CP025268.1, 1418803, 1419612, -, 810, 0; cds-WP_000105143.1, NZ_CP025268.1, 1419605, 1422205, -, 2601, 39; cds-WP_000632297.1, NZ_CP025268.1, 1422307, 1422582, -, 276, 0; cds-WP_001352098.1, NZ_CP025268.1, 1422657, 1422827, -, 171, 0; cds-WP_000560225.1, NZ_CP025268.1, 1422827, 1423048, -, 222, 0; cds-WP_001312793.1, NZ_CP025268.1, 1423490, 1423978, +, 489, 0; cds-WP_001169151.1, NZ_CP025268.1, 1423975, 1424130, -, 156, 5; cds-WP_000948459.1, NZ_CP025268.1, 1424584, 1425060, -, 477, 32423; cds-WP_000712069.1, NZ_CP025268.1, 1425184, 1425480, +, 297, 0; cds-WP_000693797.1, NZ_CP025268.1, 1425503, 1425925, +, 423, 0; cds-WP_000899748.1, NZ_CP025268.1, 1425938, 1426795, +, 858, 105; cds-WP_000788970.1, NZ_CP025268.1, 1426802, 1427548, +, 747, 0; cds-CXP41_RS07585, NZ_CP025268.1, 1427571, 1428023, +, 453, 0; cds-WP_001228696.1, NZ_CP025268.1, 1428219, 1428404, +, 186, 4458; cds-WP_001097895.1, NZ_CP025268.1, 1428601, 1430058, +, 1458, 89; cds-WP_001350510.1, NZ _CP025268.1, 1430196, 1430459, +, 264, 0; cds-WP_000091628.1, NZ_CP025268.1, 1430440, 1430799, +, 360, 0; cds-WP_001755909.1, NZ_CP025268.1, 1430907, 1431107, +, 201, 0; cds-CXP41_RS07620, NZ_CP025268.1, 1431273, 1432205, +, 933, 0; cds-CXP41_RS07625, NZ_CP025268.1, 1432208, 1432423, +, 216, 0; cds-WP_033544729.1, NZ_CP025268.1, 1432565, 1433545, -, 981, 5761; cds-CXP41_RS07640, NZ_CP025268.1, 1433615, 1433803, +, 189, 0; cds-WP_101348721.1, NZ_CP025268.1, 1433868, 1437230, +, 3363, 0; cds-WP_001698950.1, NZ_CP025268.1, 1437230, 1437805, +, 576, 0; cds-WP_000086527.1, NZ_CP025268.1, 1437903, 1438493, -, 591, 2; cds-WP_000836770.1, NZ_CP025268.1, 1438810, 1439043, -, 234, 288321; cds-WP_120795384.1, NZ_CP025268.1, 1439112, 1439225, -, 114, 119559; cds-WP_001157926.1, NZ_CP025268.1, 1439565, 1439738, +, 174, 3; cds-WP 001300461.1, NZ_CP025268.1, 1440004, 1440438, -, 435, 0; cds-WP_000837921.1, NZ_CP025268.1, 1440579, 1441712, -, 1134, 2; cds-WP_000628244.1, NZ_CP025268.1, 1442079, 1445603, -, 3525, 135076; cds-WP_001295715.1, NZ_CP025268.1, 1445877, 1446143, +, 267, 15; cds-WP_001298828.1, NZ_CP025268.1, 1446140, 1446562, -, 423, 7; cds-WP_000762236.1, NZ_CP025268.1, 1446673, 1447662, -, 990, 37307; cds-WP_000900941.1, NZ_CP025268.1, 1447870, 1450509, +, 2640, 263; cds-WP_000698145.1, NZ_CP025268.1, 1450506, 1450691, +, 186, 5665; cds-WP_001300734.1, NZ_CP025268.1, 1450699, 1451025, +, 327, 8510; cds-WP_001067514.1, NZ_CP025268.1, 1451197, 1452102, -, 906, 0; cds-WP_000138615.1, NZ_CP025268.1, 1452338, 1453837, +, 1500, 0; cds-WP_101348587.1, NZ_CP025268.1, 1453895, 1456168, -, 2274, 0; cds-WP_001186469.1, NZ_CP025268.1, 1456416, 1458461, -, 2046, 0; cds-WP_000191077.1, NZ_CP025268.1, 1458746, 1459675, +, 930, 0; cds-WP_000073393.1, NZ_CP025268.1, 1459687, 1459974, +, 288, 0; cds-WP_001072837.1, NZ_CP025268.1, 1459983, 1460729, +, 747, 0; cds-WP_001189201.1, NZ_CP025268.1, 1460744, 1461241, +, 498, 0; cds-WP_000206388.1, NZ_CP025268.1, 1461249, 1462319, +, 1071, 309; cds-WP_001292353.1, NZ_CP025268.1, 1462316, 1463083, +, 768, 0; cds-WP_000969784.1, NZ_CP025268.1, 1463083, 1463871, +, 789, 0; cds-WP_000973360.1, NZ_CP025268.1, 1463873, 1465300, +, 1428, 0; cds-WP_000018413.1, NZ_CP025268.1, 1465290, 1465712, +, 423, 0; cds-WP_001206197.1, NZ_CP025268.1, 1465712, 1466917, +, 1206, 0; cds-WP_000632280.1, NZ_CP025268.1, 1466944, 1468257, +, 1314, 0; cds-WP_000039887.1, NZ_CP025268.1, 1468358, 1469308, +, 951, 0; cds-WP_101348588.1, NZ_CP025268.1, 1469290, 1469880, +, 591, 0; cds-WP_010723099.1, NZ_CP025268.1, 1469984, 1470049, -, 66, 0; cds-CXP41 R507805, NZ_CP025268.1, 1470211, 1472736, +, 2526, 18; cds-WP_088895425.1-2, NZ CP025268.1;NZ CP025268.1, 1472740;1473653, 1473653;1473968, -;-, 1229, 12158; cds-WP_001254932.1, NZ_CP025268.1, 1474177, 1475328, +, 1152, 699; cds-CXP41 R507825, NZ_CP025268.1, 1475335, 1478832, +, 3498, 57179; cds-WP_00OO97801.1, NZ_CP025268.1, 1479040, 1479900, +, 861, 0; cds-WP_000910026.1, NZ_CP025268.1, 1479963, 1482269, +, 2307, 0; cds-WP_000177515.1, NZ _CP025268.1, 1482440, 1483045, +, 606, 0; cds-WP_000890941.1, NZ_CP025268.1, 1483045, 1483941, +, 897, 0; cds-WP_000431845.1, NZ_CP025268.1, 1483957, 1485714, +, 1758, 0; cds-WP_000627368.1, NZ_CP025268.1, 1485704, 1487020, +, 1317, 0; cds-WP_000048950.1, NZ_CP025268.1, 1487074, 1487679, -, 606, 59; cds-WP_000139543.1, NZ_CP025268.1, 1487880, 1491782, +, 3903, 127962; cds-WP_001027942.1, NZ_CP025268.1, 1492054, 1492854, +, 801, 0; cds-WP_000115943.1, NZ_CP025268.1, 1493051, 1494490, +, 1440, 16150; cds-CXP41_RS24180, NZ_CP025268.1, 1494532, 1495532, -, 1001, 18049; cds-WP_101348589.1, NZ_CP025268.1, 1495721, 1496251, +, 531, 66923; cds-WP_000731833.1, NZ_CP025268.1, 1496496, 1496669, +, 174, 12241; cds-WP_211180495.1, NZ_CP025268.1, 1496695, 1496763, +, 69, 646; cds-WP_001320773.1, NZ_CP025268.1, 1496741, 1496890, -, 150, 0; cds-WP_001098559.1, NZ_CP025268.1, 1497289, 1498929, +, 1641, 12972; cds-WP_000414567.1, NZ_CP025268.1, 1498967, 1499890, -, 924, 0; cds-WP_000013789.1, NZ_CP025268.1, 1500107, 1501450, +, 1344, 16; cds-WP_000375961.1, NZ_CP025268.1, 1501675, 1503330, +, 1656, 289281; cds-WP_001296778.1, NZ_CP025268.1, 1503470, 1503694, +, 225, 2; cds-WP_000140873.1, NZ_CP025268.1, 1503757, 1504296, +, 540, 0; cds-WP_001234042.1, NZ_CP025268.1, 1504288, 1505268, -, 981, 0; cds-WP_001301046.1, NZ_CP025268.1, 1505392, 1506384, +, 993, 51145; cds-WP_000586732.1, NZ_CP025268.1, 1506381, 1506974, +, 594, 306313; cds-WP_001261013.1, NZ_CP025268.1, 1507276, 1507944, +, 669, 241; cds-CXP41_RS07970, NZ_CP025268.1, 1507962, 1508468, -, 507, 0; cds-WP_000826416.1, NZ_CP025268.1, 1508476, 1509684, +, 1209, 4; cds-WP_001326689.1, NZ_CP025268.1, 1509724, 1510938, -, 1215, 5472; cds-WP_000429155.1, NZ_CP025268.1, 1510991, 1511527, +, 537, 0; cds-WP_001303492.1, NZ_CP025268.1, 1511600, 1513561, +, 1962, 2660; cds-WP _000494244.1, NZ_CP025268.1, 1513653, 1513883, -, 231, 3; cds-WP_000813794.1, NZ_CP025268.1, 1514105, 1514281, +, 177, 0; cds-WP_001270286.1, NZ_CP025268.1, 1514327, 1514743, +, 417, 0; cds-WP_000760626.1, NZ_CP025268.1, 1514822, 1516228, +, 1407, 375; cds-WP_000047424.1, NZ_CP025268.1, 1516473, 1517618, +, 1146, 0; cds-WP_101348590.1, NZ_CP025268.1, 1517636, 1518649, +, 1014, 0; cds-WP_001251304.1, NZ_CP025268.1, 1518650, 1519591, +, 942, 2; cds-WP_000555458.1, NZ_CP025268.1, 1519581, 1520375, +, 795, 0; cds-WP_001163872.1, NZ_CP025268.1, 1520397, 1521821, +, 1425, 0; cds-WP_001310798.1, NZ_CP025268.1, 1521918, 1522013, -, 96, 0; cds-WP_000061178.1, NZ_CP025268.1, 1522208, 1522381, +, 174, 6487; cds-WP_000018633.1, NZ_CP025268.1, 1522467, 1522700, +, 234, 8; cds-WP_001076535.1, NZ_CP025268.1, 1522701, 1523150, -, 450, 0; cds-WP_001310799.1, NZ_CP025268.1, 1523147, 1523665, -, 519, 0; cds-WP_000531462.1, NZ_CP025268.1, 1523846, 1524883, +, 1038, 0; cds-WP_001300742.1, NZ_CP025268.1, 1525081, 1525746, +, 666, 4983; cds-WP_000689363.1, NZ_CP025268.1, 1525782, 1527884, -, 2103, 315184; cds-WP_000550695.1, NZ_CP025268.1, 1528126, 1529187, +, 1062, 92409; cds-WP_001300590.1, NZ _CP025268.1, 1529300, 1530799, -, 1500, 373; cds-WP_000598857.1, NZ _CP025268.1, 1531066, 1531683, +, 618, 0; cds-WP_000226995.1, NZ_CP025268.1, 1531759, 1531971, +, 213, 0; cds-CXP41_RS08125, NZ_CP025268.1, 1532721, 1534757, +, 2037, 0; cds-WP_101348591.1, NZ_CP025268.1, 1534741, 1535223, +, 483, 2106; cds-WP_120795385.1, NZ_CP025268.1, 1535138, 1535323, -, 186, 4343; cds-CXP41_RS08135, NZ_CP025268.1, 1535405, 1536549, +, 1145, 14342; cds-WP_000421020.1, NZ_CP025268.1, 1536635, 1537771, +, 1137, 598; cds-WP_001120143.1, NZ_CP025268.1, 1537871, 1538104, +, 234, 0; cds-WP_000085899.1, NZ_CP025268.1, 1538101, 1538670, -, 570, 1; cds-WP_000187925.1, NZ_CP025268.1, 1538843, 1539688, +, 846, 5; cds-WP_000804385.1, NZ_CP025268.1, 1539784, 1540677, -, 894, 0; cds-WP_000617115.1, NZ_CP025268.1, 1540756, 1541436, -, 681, 0; cds-WP_001166353.1, NZ_CP025268.1, 1541433, 1542128, -, 696, 0; cds-WP_000702535.1, NZ_CP025268.1, 1542128, 1543672, -, 1545, 0; cds-WP_000040458.1, NZ_CP025268.1, 1543669, 1547409, -, 3741, 390; cds-WP_001207901.1, NZ_CP025268.1, 1547491, 1548879, -, 1389, 49; cds-CXP41_RS08190, NZ_CP025268.1, 1549203, 1550533, -, 1331, 0; cds-WP_000768384.1, NZ_CP025268.1, 1550557, 1550847, -, 291, 0; cds-WP_000198205.1, NZ_CP025268.1, 1551107, 1551988, -, 882, 351; cds-WP_157825723.1, NZ_CP025268.1, 1552220, 1555267, +, 3048, 3253; cds-WP_001240582.1, NZ_CP025268.1, 1555280, 1556164, +, 885, 1702; cds-WP_000045648.1, NZ_CP025268.1, 1556157, 1556810, +, 654, 818; cds-WP_000781370.1, NZ_CP025268.1, 1557217, 1557501, -, 285, 15; cds-WP_000642433.1, NZ_CP025268.1, 1557647, 1558657, -, 1011, 99; cds-WP_000433476.1, NZ_CP025268.1, 1558791, 1560488, -, 1698, 241640; cds-WP_000841554.1, NZ_CP025268.1, 1560645, 1560782, -, 138, 6; cds-WP_000495771.1, NZ_CP025268.1, 1560884, 1561099, -, 216, 0; cds-WP_000152305.1, NZ_CP025268.1, 1561444, 1561875, +, 432, 46254; cds-WP_001285536.1, NZ_CP025268.1, 1561931, 1562857, -, 927, 0; cds-WP_000193547.1, NZ_CP025268.1, 1562850, 1563836, -, 987, 0; cds-WP_000979626.1, NZ_CP025268.1, 1563833, 1564729, -, 897, 192; cds-WP_000145123.1, NZ_CP025268.1, 1564726, 1565748, -, 1023, 35; cds-WP_000830550.1, NZ_CP025268.1, 1565750, 1567300, -, 1551, 0; cds-WP_001285833.1, NZ_CP025268.1, 1567314, 1567895, -, 582, 0; cds-WP_001360132.1, NZ_CP025268.1, 1568153, 1570552, -, 2400, 133; cds-WP_000426292.1, NZ_CP025268.1, 1570577, 1571959, -, 1383, 0; cds-WP_120795386.1, NZ_CP025268.1, 1571997, 1572038, -, 42, 0; cds-WP_000350395.1, NZ_CP025268.1, 1572323, 1573642, -, 1320, 0; cds-WP_000246019.1, NZ_CP025268.1, 1573773, 1575308, -, 1536, 0; cds-WP_000358930.1, NZ_CP025268.1, 1575464, 1576864, -, 1401, 0; cds-WP_001244968.1, NZ_CP025268.1, 1577226, 1580009, -, 2784, 35309; cds-WP_000832437.1, NZ_CP025268.1, 1580066, 1582438, -, 2373, 0; cds-WP_000628576.1, NZ_CP025268.1, 1582476, 1584161, -, 1686, 0; cds-WP_120795387.1, NZ_CP025268.1, 1584364, 1584486, +, 123, 0; cds-WP_001301030.1, NZ_CP025268.1, 1584452, 1585609, -, 1158, 0; cds-WP_001295684.1, NZ_CP025268.1, 1585661, 1587343, -, 1683, 0; cds-WP_000060495.1, NZ_CP025268.1, 1587745, 1588506, -, 762, 0; cds-WP_000543384.1, NZ_CP025268.1, 1588581, 1588778, -, 198, 0; cds-WP 101348593.1, NZ_CP025268.1, 1589026, 1591305, -, 2280, 0; cds-WP_000520676.1, NZ_CP025268.1, 1591639, 1592553, -, 915, 0; cds-WP_000825452.1, NZ_CP025268.1, 1592612, 1593115, -, 504, 0; cds-WP_000876763.1, NZ_CP025268.1, 1593128, 1593658, -, 531, 0; cds-CXP41 R508370, NZ_CP025268.1, 1593672, 1594898, -, 1227, 2; cds-CXP41_RS08375, NZ_CP025268.1, 1595153, 1595361, -, 209, 0; cds-WP_001125439.1, NZ_CP025268.1, 1595673, 1596995, -, 1323, 168; cds-WP_001301023.1, NZ_CP025268.1, 1596995, 1597261, -, 267, 0; cds-CXP41_RS08400, NZ_CP025268.1, 1597484, 1602906, -, 5423, 2; cds-WP_000113108.1, NZ_CP025268.1, 1603437, 1605029, -, 1593, 14; cds-WP_000154342.1, NZ_CP025268.1, 1605108, 1606061, -, 954, 0; cds-WP_001194860.1, NZ_CP025268.1, 1606310, 1607845, +, 1536, 0; cds-WP_000911184.1, NZ_CP025268.1, 1607839, 1608867, +, 1029, 0; cds-WP_001222721.1, NZ_CP025268.1, 1608867, 1609859, +, 993, 0; cds-WP_000172465.1, NZ_CP025268.1, 1609871, 1610893, +, 1023, 0; cds-WP_000774165.1, NZ _CP025268.1, 1610920, 1611795, +, 876, 0; cds-WP_000558527.1, NZ_CP025268.1, 1611819, 1612109, +, 291, 0; cds-WP_001286597.1, NZ_CP025268.1, 1612166, 1612924, +, 759, 13311; cds-WP_001313828.1, NZ_CP025268.1, 1612928, 1613842, -, 915, 4; cds-WP_000854633.1, NZ_CP025268.1, 1614049, 1615500, -, 1452, 3; cds-CXP41 R508470, NZ_CP025268.1, 1615727, 1616713, -, 987, 2845; cds-WP_001191027.1, NZ_CP025268.1, 1616786, 1617145, -, 360, 158; cds-WP_000257409.1, NZ_CP025268.1, 1617145, 1618071, -, 927, 97025; cds-WP_000156615.1, NZ_CP025268.1, 1618135, 1619523, -, 1389, 70382; cds-WP_000366501.1, NZ_CP025268.1, 1619624, 1620505, +, 882, 39851; cds-WP_000258599.1, NZ_CP025268.1, 1620583, 1621698, +, 1116, 0; cds-WP_000210799.1, NZ_CP025268.1, 1621848, 1623038, +, 1191, 4; cds-WP_000885033.1, NZ_CP025268.1,


1623063, 1623728, -, 666, 0; cds-WP_000843414.1, NZ_CP025268.1, 1623940, 1624374, +, 435, 8963; cds-WP_000091199.1, NZ_CP025268.1, 1624394, 1624777, +, 384, 99081; cds-WP_000803657.1, NZ_CP025268.1, 1624809, 1625027, +, 219, 184273; cds-WP_000087187.1, NZ_CP025268.1, 1625058, 1625957, -, 900, 20860; cds-WP_101348595.1, NZ_CP025268.1, 1626152, 1627339, +, 1188, 0; cds-WP_000901367.1, NZ_CP025268.1, 1627466, 1627561, +, 96, 1658; cds-WP_211180496.1, NZ_CP025268.1, 1627561, 1627665, +, 105, 137; cds-WP_000592814.1, NZ_CP025268.1, 1627780, 1628670, -, 891, 11289; cds-CXP41_R508545, NZ_CP025268.1, 1628925, 1629316, -, 392, 0; cds-WP_001024746.1, NZ_CP025268.1, 1629592, 1630110, +, 519, 0; cds-WP_101348596.1, NZ_CP025268.1, 1630154, 1632199, -, 2046, 4167; cds-WP_000636571.1, NZ_CP025268.1, 1632336, 1633082, +, 747, 144; cds-WP_000215549.1, NZ_CP025268.1, 1633171, 1633857, +, 687, 70174; cds-WP_000214712.1, NZ_CP025268.1, 1634034, 1634237, +, 204, 88183; cds-WP_000527743.1, NZ_CP025268.1, 1634272, 1635732, -, 1461, 3; cds-CXP41_RS08580, NZ_CP025268.1, 1635821, 1637188, -, 1368, 0; cds-WP_120795384.1-2, NZ_CP025268.1, 1637709, 1637822, +, 114, 5664; cds-WP_000836768.1, NZ_CP025268.1, 1637891, 1638124, +, 234, 20370; cds-WP_000078177.1, NZ_CP025268.1, 1638441, 1639031, +, 591, 0; cds-WP_000885611.1, NZ_CP025268.1, 1639129, 1639704, -, 576, 0; cds-WP_001027733.1, NZ_CP025268.1, 1639704, 1640666, -, 963, 0; cds-WP_000453612.1, NZ_CP025268.1, 1640617, 1641186, -, 570, 0; cds-WP_001368374.1, NZ_CP025268.1, 1641575, 1641808, +, 234, 0; cds-WP_000373090.1, NZ_CP025268.1, 1641866, 1642276, +, 411, 0; cds-WP_001019606.1, NZ_CP025268.1, 1642428, 1642601, -, 174, 3584; cds-WP_001309517.1, NZ_CP025268.1, 1642773, 1642928, -, 156, 2; cds-WP_120795388.1, NZ_CP025268.1, 1643007, 1643072, -, 66, 0; cds-WP_071524604.1, NZ_CP025268.1, 1643075, 1643263, -, 189, 117; cds-WP_000066495.1, NZ_CP025268.1, 1643274, 1643486, -, 213, 113; cds-WP_001071769.1, NZ_CP025268.1, 1643849, 1644346, -, 498, 0; cds-WP_001092971.1, NZ_CP025268.1, 1644343, 1644876, -, 534, 0; cds-WP_000189916.1, NZ_CP025268.1, 1644873, 1645184, -, 312, 941; cds-WP_000839590.1, NZ_CP025268.1, 1645189, 1645404, -, 216, 0; cds-WP_211180497.1, NZ_CP025268.1, 1645624, 1645794, +, 171, 0; cds-WP_000066484.1, NZ_CP025268.1, 1646158, 1646373, -, 216, 92777; cds-WP_000087756.1, NZ_CP025268.1, 1646674, 1646886, +, 213, 85166; cds-WP_120795389.1, NZ_CP025268.1, 1646941, 1647030, +, 90, 122089; cds-WP_001047135.1, NZ_CP025268.1, 1647308, 1648060, -, 753, 120657; cds-WP_001393597.1, NZ_CP025268.1, 1648074, 1649123, -, 1050, 0; cds-WP_012304870.1, NZ_CP025268.1, 1649125, 1649403, -, 279, 29; cds-WP_000980994.1, NZ_CP025268.1, 1649470, 1649721, -, 252, 0; cds-WP_000813254.1, NZ_CP025268.1, 1649938, 1650093, -, 156, 0; cds-WP_000323025.1, NZ_CP025268.1, 1650165, 1650452, -, 288, 4; cds-WP_000534858.1, NZ_CP025268.1, 1650452, 1650691, -, 240, 44; cds-WP_001326990.1, NZ_CP025268.1, 1650716, 1651021, +, 306, 0; cds-WP_001301033.1, NZ_CP025268.1, 1651224, 1651556, +, 333, 6; cds-WP_011443592.1, NZ_CP025268.1, 1651993, 1652142, -, 150, 0; cds-CXP41_RS08725, NZ_CP025268.1, 1652177, 1652455, -, 279, 0; cds-WP_000920568.1, NZ_CP025268.1, 1652439, 1652669, -, 231, 0; cds-WP_000448564.1, NZ_CP025268.1, 1652753, 1653160, +, 408, 931; cds-WP_000379575.1, NZ_CP025268.1, 1653327, 1653482, +, 156, 0; cds-WP_001171942.1, NZ_CP025268.1, 1653642, 1653860, +, 219, 0; cds-WP_000854559.1, NZ_CP025268.1, 1654428, 1654616, +, 189, 0; cds-WP_001083297.1, NZ_CP025268.1, 1654613, 1654804, +, 192, 0; cds-CXP41_R508770, NZ_CP025268.1, 1654897, 1655664, +, 768, 0; cds-CXP41_RS08775, NZ_CP025268.1, 1655661, 1656356, +, 696, 8; cds-CXP41_RS08780, NZ_CP025268.1, 1656370, 1657527, +, 1158, 0; cds-WP_000836066.1, NZ_CP025268.1, 1657715, 1658734, -, 1020, 0; cds-WP_101348598.1, NZ_CP025268.1, 1658746, 1659960, -, 1215, 0; cds-WP_101348599.1, NZ_CP025268.1, 1660141, 1660491, -, 351, 0; cds-WP_000705211.1, NZ_CP025268.1, 1660626, 1660967, +, 342, 15355; cds-WP_001138581.1, NZ_CP025268.1, 1661002, 1661562, +, 561, 309704; cds-WP_001321287.1, NZ_CP025268.1, 1661565, 1662275, -, 711, 2; cds-WP_001300836.1, NZ_CP025268.1, 1662383, 1662688, +, 306, 751; cds-WP_000041675.1, NZ_CP025268.1, 1662887, 1665313, +, 2427, 1; cds-WP_001340362.1, NZ_CP025268.1, 1665374, 1667797, +, 2424, 105; cds-WP_000213028.1, NZ_CP025268.1, 1667808, 1668425, +, 618, 70932; cds-WP_101348600.1, NZ_CP025268.1, 1668427, 1669281, +, 855, 1; cds-WP_000148710.1, NZ_CP025268.1, 1669324, 1669938, +, 615, 3; cds-WP_071592181.1, NZ_CP025268.1, 1670097, 1671389, +, 1293, 222; cds-WP_000919231.1, NZ_CP025268.1, 1671342, 1672037, -, 696, 0; cds-WP_000225262.1, NZ_CP025268.1, 1672162, 1673382, -, 1221, 22924; cds-WP_001019525.1, NZ_CP025268.1, 1673517, 1674410, -, 894, 0; cds-WP_101348601.1, NZ_CP025268.1, 1674517, 1675770, +, 1254, 5532; cds-WP_001299090.1, NZ_CP025268.1, 1675819, 1675938, -, 120, 0; cds-WP_001340364.1, NZ_CP025268.1, 1676194, 1676502, +, 309, 0; cds-WP_000233093.1, NZ_CP025268.1, 1676595, 1676678, +, 84, 0; cds-WP_001260865.1, NZ_CP025268.1, 1676778, 1677599, +, 822, 0; cds-WP_000046661.1, NZ_CP025268.1, 1677638, 1677967, -, 330, 0; cds-CXP41_RS08905, NZ_CP025268.1, 1677954, 1678320, -, 367, 12800; cds-WP_211180498.1, NZ_CP025268.1, 1678427, 1678528, -, 102, 3399; cds-WP_001118241.1, NZ_CP025268.1, 1678732, 1679766, +, 1035, 250; cds-WP_000014036.1, NZ_CP025268.1, 1679791, 1681179, -, 1389, 233571; cds-WP_001300486.1, NZ_CP025268.1, 1681190, 1682722, -, 1533, 160606; cds-WP_000769303.1, NZ_CP025268.1, 1683246, 1684190, +, 945, 151865; cds-WP_000412379.1, NZ_CP025268.1, 1684376, 1685758, +, 1383, 100133; cds-WP_000520804.1, NZ_CP025268.1, 1685795, 1686517, +, 723, 5350; cds-WP_000524868.1, NZ_CP025268.1, 1686514, 1686849, -, 336, 559; cds-WP_001092508.1, NZ_CP025268.1, 1686978, 1687697, +, 720, 1115; cds-WP_000732512.1, NZ_CP025268.1, 1687701, 1689002, +, 1302, 115904; cds-WP_000135181.1, NZ_CP025268.1, 1689078, 1690007, +, 930, 45; cds-CXP41_RS08970, NZ_CP025268.1, 1690004, 1691406, -, 1403, 295; cds-WP_000066639.1, NZ_CP025268.1, 1691549, 1693195, -, 1647, 33; cds-WP_001170664.1, NZ_CP025268.1, 1693394, 1694569, +, 1176, 23829; cds-WP_001043339.1, NZ_CP025268.1, 1694670, 1696178, +, 1509, 83554; cds-WP_001227023.1, NZ_CP025268.1, 1696404, 1697669, -, 1266, 0; cds-WP_001075849.1, NZ_CP025268.1, 1697708, 1699081, -, 1374, 0; cds-WP_000945878.1, NZ_CP025268.1, 1699078, 1700889, -, 1812, 3; cds-WP_000969092.1, NZ_CP025268.1, 1701279, 1701869, -, 591, 1895; cds-WP_000483353.1, NZ_CP025268.1, 1702090, 1702857, -, 768, 1102; cds-WP_000179510.1, NZ_CP025268.1, 1702969, 1703997, -, 1029, 0; cds-CXP41_RS09020, NZ_CP025268.1, 1704172, 1705765, +, 1594, 1; cds-WP_000459379.1, NZ_CP025268.1, 1705775, 1706947, +, 1173, 4; cds-WP_000567490.1, NZ_CP025268.1, 1707051, 1708052, +, 1002, 14885; cds-WP_001282550.1, NZ_CP025268.1, 1708086, 1709126, -, 1041, 135653; cds-WP_001300888.1, NZ_CP025268.1, 1709369, 1709494, +, 126, 0; cds-WP_000217950.1, NZ_CP025268.1, 1709767, 1709982, +, 216, 0; cds-WP_001310854.1, NZ_CP025268.1, 1710068, 1710508, +, 441, 381; cds-WP_000133193.1, NZ_CP025268.1, 1710585, 1711166, +, 582, 9349; cds-WP_000991805.1, NZ_CP025268.1, 1711166, 1711744, +, 579, 79106; cds-WP_000915778.1, NZ_CP025268.1, 1711737, 1713959, +, 2223, 613504; cds-WP_101348602.1, NZ_CP025268.1, 1713960, 1715018, +, 1059, 466319; cds-WP_000920784.1, NZ_CP025268.1, 1715022, 1715642, +, 621, 84542; cds-WP_001289652.1, NZ_CP025268.1, 1715646, 1716341, +, 696, 111854; cds-WP_001030339.1, NZ_CP025268.1, 1716341, 1716976, +, 636, 34696; cds-WP_000100932.1, NZ_CP025268.1, 1717588, 1719090, +, 1503, 930937; cds-WP_000765749.1, NZ_CP025268.1, 1719196, 1719801, +, 606, 47425; cds-WP_001307229.1, NZ_CP025268.1, 1719845, 1720708, -, 864, 72; cds-WP_001295400.1, NZ_CP025268.1, 1720767, 1722041, -, 1275, 233030; cds-WP_001282319.1, NZ_CP025268.1, 1722170, 1722826, -, 657, 5558; cds-WP_000178044.1, NZ_CP025268.1, 1722885, 1723214, -, 330, 324; cds-WP_101348603.1, NZ_CP025268.1, 1723312, 1724421, -, 1110, 2; cds-WP_000597196.1, NZ_CP025268.1, 1724695, 1725162, +, 468, 36643; cds-WP_001296943.1, NZ_CP025268.1, 1725209, 1725643, -, 435, 78869; cds-WP_000670998.1, NZ_CP025268.1, 1725844, 1726080, +, 237, 117613; cds-WP_001300356.1, NZ_CP025268.1, 1726083, 1726940, +, 858, 18034; cds-WP_000994333.1, NZ_CP025268.1, 1726940, 1728952, +, 2013, 11899; cds-WP_001296937.1, NZ_CP025268.1, 1728953, 1729474, -, 522, 113543; cds-WP_000250656.1, NZ_CP025268.1, 1729555, 1730451, -, 897, 11278; cds-WP_000840481.1, NZ_CP025268.1, 1730500, 1730739, -, 240, 0; cds-WP_001032936.1, NZ_CP025268.1, 1730842, 1731441, +, 600, 273874; cds-WP_000093589.1, NZ_CP025268.1, 1731478, 1732575, +, 1098, 3141; cds-WP_001237796.1, NZ_CP025268.1, 1732656, 1733063, +, 408, 46197; cds-WP_001282283.1, NZ_CP025268.1, 1733166, 1733813, +, 648, 248; cds-WP_001310858.1, NZ_CP025268.1, 1733906, 1738522, +, 4617, 307; cds-WP_000108172.1, NZ_CP025268.1, 1738573, 1738920, -, 348, 278; cds-WP_000101193.1, NZ_CP025268.1, 1739254, 1740069, +, 816, 31; cds-WP_101348604.1, NZ_CP025268.1, 1740197, 1740778, +, 582, 383332; cds-WP_000701040.1, NZ_CP025268.1, 1740940, 1742109, -, 1170, 16; cds-WP_000102278.1, NZ_CP025268.1, 1742275, 1742364, -, 90, 0; cds-WP_000190982.1, NZ_CP025268.1, 1742663, 1743688, +, 1026, 127800; cds-WP_000269501.1, NZ_CP025268.1, 1743685, 1744617, -, 933, 893; cds-WP_001182347.1, NZ_CP025268.1, 1744730, 1745941, +, 1212, 29983; cds-WP_000098896.1, NZ_CP025268.1, 1746232, 1747380, +, 1149, 199430; cds-WP_000493947.1, NZ_CP025268.1, 1747420, 1748061, -, 642, 0; cds-WP_001174940.1, NZ_CP025268.1, 1748276, 1749649, +, 1374, 17667; cds-WP_000534271.1, NZ_CP025268.1, 1749690, 1750946, -, 1257, 243803; cds-WP_000212657.1, NZ_CP025268.1, 1751519, 1751824, +, 306, 78478; cds-WP_000716950.1, NZ_CP025268.1, 1751950, 1753554, +, 1605, 62498; cds-WP_000587525.1, NZ_CP025268.1, 1753566, 1754378, -, 813, 0; cds-WP_001069979.1, NZ_CP025268.1, 1754382, 1755167, -, 786, 330; cds-WP_001310861.1, NZ_CP025268.1, 1755164, 1755832, -, 669, 0; cds-WP_001301419.1, NZ_CP025268.1, 1755896, 1756534, -, 639, 0; cds-WP_001273527.1, NZ_CP025268.1, 1756547, 1758649, -, 2103, 0; cds-WP_001070230.1, NZ_CP025268.1, 1758670, 1759296, -, 627, 14; cds-WP_000528342.1, NZ_CP025268.1, 1759751, 1759960, -, 210, 0; cds-WP_101348605.1, NZ_CP025268.1, 1760517, 1761929, +, 1413, 1554104; cds-WP_000648420.1, NZ_CP025268.1, 1762240, 1762476, +, 237, 3406; cds-CXP41_RS09330, NZ_CP025268.1, 1762540, 1763539, -, 1000, 12314; cds-WP_001196530.1, NZ_CP025268.1, 1763688, 1764104, -, 417, 2; cds-CXP41_RS09340, NZ_CP025268.1, 1764117, 1765338, -, 1222, 306087; cds-WP_101348606.1, NZ_CP025268.1, 1765335, 1766606, -, 1272, 0; cds-WP_000948863.1, NZ_CP025268.1, 1766581, 1767327, -, 747, 2048; cds-CXP41_RS09355, NZ_CP025268.1, 1767337, 1768823, -, 1487, 0; cds-WP_000367160.1, NZ_CP025268.1, 1768832, 1769200, -, 369, 6; cds-WP_001296104.1, NZ_CP025268.1, 1769748, 1769936, -, 189, 0; cds-WP_000637982.1, NZ_CP025268.1, 1770036, 1770446, -, 411, 1993; cds-WP_000613008.1, NZ_CP025268.1, 1770443, 1773499, -, 3057, 43930; cds-WP_101348607.1, NZ_CP025268.1, 1773888, 1775003, +, 1116, 98; cds-WP_001310864.1, NZ_CP025268.1, 1775432, 1775788, +, 357, 0; cds-WP_000795537.1, NZ_CP025268.1, 1775888, 1777102, +, 1215, 0; cds-WP_000081197.1, NZ_CP025268.1, 1777329, 1778594, +, 1266, 0; cds-WP_000383469.1, NZ_CP025268.1, 1778606, 1779472, +, 867, 0; cds-WP_000860201.1, NZ_CP025268.1, 1779503, 1780261, +, 759, 0; cds-WP_000805700.1, NZ_CP025268.1, 1780404, 1781999, +, 1596, 0; cds-WP_000347850.1, NZ_CP025268.1, 1782013, 1783164, +, 1152, 0; cds-WP_000284799.1, NZ_CP025268.1, 1783207, 1784118, -, 912, 0; cds-WP_000692135.1, NZ_CP025268.1, 1784434, 1785198, +, 765, 0; cds-WP_000080722.1, NZ_CP025268.1, 1785218, 1786156, +, 939, 1; cds-WP_001278525.1, NZ_CP025268.1, 1786212, 1787501, +, 1290, 127; cds-WP_000081081.1, NZ_CP025268.1, 1787498, 1787791, +, 294, 0; cds-WP_001336282.1, NZ_CP025268.1, 1787848, 1789494, +, 1647, 0; cds-WP_000069375.1, NZ_CP025268.1, 1789551, 1791929, -, 2379, 15; cds-WP_000368046.1, NZ_CP025268.1, 1792262, 1793095, +, 834, 0; cds-WP_001082229.1, NZ_CP025268.1, 1793252, 1794298, +, 1047, 1819; cds-WP_001270809.1, NZ_CP025268.1, 1794430, 1794621, +, 192, 42; cds-WP_000175703.1, NZ_CP025268.1, 1794625, 1796061, -, 1437, 29900; cds-


WP_001300634.1, NZ_CP025268.1, 1796124, 1796837, -, 714, 73568; cds-WP _001209795.1, NZ_CP025268.1, 1797084, 1797548, -, 465, 1671; cds-WP _000029474.1, NZ_CP025268.1, 1797626, 1798375, -, 750, 1; cds-WP_001154168.1, NZ_CP025268.1, 1798375, 1798926, -, 552, 0; cds-WP_000956528.1, NZ_CP025268.1, 1798989, 1799969, -, 981, 1374; cds-WP _001229265.1, NZ_CP025268.1, 1800070, 1800369, -, 300, 11548; cds-WP _000672380.1, NZ_CP025268.1, 1800374, 1802761, -, 2388, 2320260; cds-WP_000018596.1, NZ_CP025268.1, 1802776, 1803759, -, 984, 652332; cds-WP_001386830.1, NZ_CP025268.1, 1804043, 1804087, -, 45, 0; cds-WP_000124850.1, NZ_CP025268.1, 1804210, 1804566, -, 357, 2136197; cds-WP _001124225.1, NZ_CP025268.1, 1804619, 1804816, -, 198, 1505527; cds-WP_001700733.1, NZ_CP025268.1, 1804913, 1805455, -, 543, 1388071; cds-WP _001144202.1, NZ_CP025268.1, 1805459, 1807387, -, 1929, 2954188; cds-CXP41_RS09565, NZ_CP025268.1, 1807911, 1809810, +, 1900, 510; cds-WP_001142445.1, NZ_CP025268.1, 1809982, 1810089, +, 108, 0; cds-WP_000771391.1, NZ_CP025268.1, 1810142, 1810900, -, 759, 5; cds-WP _000251727.1, NZ_CP025268.1, 1811187, 1812116, +, 930, 15; cds-WP _000146159.1, NZ_CP025268.1, 1812217, 1812507, +, 291, 0; cds-WP_000267650.1, NZ_CP025268.1, 1812613, 1813473, +, 861, 0; cds-WP_000222163.1, NZ_CP025268.1, 1813514, 1814050, -, 537, 10112; cds-WP_000106833.1, NZ_CP025268.1, 1814197, 1814865, +, 669, 1779; cds-WP _001297653.1, NZ_CP025268.1, 1815028, 1815618, +, 591, 6; cds-WP _001010696.1, NZ_CP025268.1, 1815751, 1817142, +, 1392, 1356; cds-WP_001310874.1, NZ_CP025268.1, 1817146, 1817949, -, 804, 12125; cds-WP_001241561.1, NZ_CP025268.1, 1818238, 1818501, -, 264, 0; cds-WP _000077872.1, NZ_CP025268.1, 1818684, 1820945, +, 2262, 2792; cds-WP_000440471.1, NZ_CP025268.1, 1821203, 1821952, -, 750, 0; cds-WP_000078765.1, NZ_CP025268.1, 1821965, 1823317, -, 1353, 0; cds-WP_000983647.1, NZ_CP025268.1, 1823422, 1824264, -, 843, 0; cds-WP _000968919.1, NZ_CP025268.1, 1824272, 1824622, -, 351, 0; cds-WP_000073041.1, NZ_CP025268.1, 1824673, 1826031, -, 1359, 0; cds-WP_000412169.1, NZ_CP025268.1, 1826116, 1826436, -, 321, 24; cds-WP_001039044.1, NZ_CP025268.1, 1826734, 1827072, -, 339, 0; cds-WP_000175026.1, NZ_CP025268.1, 1827274,1828101, +, 828, 7026; cds-WP _000252397.1, NZ_CP025268.1, 1828331, 1829218, +, 888, 251; cds-WP _001300480.1, NZ_CP025268.1, 1829178, 1829753, -, 576, 0; cds-WP_001228984.1, NZ_CP025268.1, 1829956, 1830441, -, 486, 0; cds-WP _000368506.1, NZ_CP025268.1, 1830771, 1831739, -, 969, 0; cds-WP_000994973.1, NZ_CP025268.1, 1831732, 1833075, -, 1344, 0; cds-WP _000177206.1, NZ_CP025268.1, 1833072, 1834550, -, 1479, 14; cds-WP_000989419.1, NZ_CP025268.1, 1834547, 1835581, -, 1035, 0; cds-WP_000081983.1, NZ_CP025268.1, 1835578, 1836798, -, 1221, 0; cds-WP _000673918.1, NZ_CP025268.1, 1837244, 1838050, +, 807, 297444; cds-WP _001300395.1, NZ_CP025268.1, 1838217, 1838927, +, 711, 16101; cds-WP _000939212.1, NZ_CP025268.1, 1838932, 1839609, +, 678, 0; cds-WP_000980098.1, NZ_CP025268.1, 1839624, 1840331, +, 708, 0; cds-WP _000524097.1, NZ_CP025268.1, 1840331, 1840879, +, 549, 0; cds-WP _001215339.1, NZ_CP025268.1, 1840889, 1842055, +, 1167, 0; cds-WP_000224958.1, NZ_CP025268.1, 1842028, 1843563, +, 1536, 0; cds-WP_001300558.1, NZ_CP025268.1, 1843563, 1844216, +, 654, 9; cds-WP _001350515.1, NZ_CP025268.1, 1844283, 1845590, +, 1308, 121; cds-WP _001295484.1, NZ_CP025268.1, 1845599, 1846219, -, 621, 54; cds-WP _000781888.1, NZ_CP025268.1, 1846306, 1846713, +, 408, 0; cds-WP_101348608.1, NZ_CP025268.1, 1846679, 1846951, -, 273, 0; cds-WP _000373021.1, NZ_CP025268.1, 1847187, 1848530, +, 1344, 0; cds-WP _000756910.1, NZ_CP025268.1, 1848647, 1849687, -, 1041, 20241; cds-WP_001235800.1, NZ_CP025268.1, 1849815, 1851776, -, 1962, 276660; cds-WP _001295485.1, NZ_CP025268.1, 1851781, 1852824, -, 1044, 803479; cds-WP _000339283.1, NZ_CP025268.1, 1852941, 1853492, -, 552, 28944; cds-WP _001259810.1, NZ_CP025268.1, 1853653, 1855509, +, 1857, 30; cds-WP_001170162.1, NZ_CP025268.1, 1855675, 1856691, +, 1017, 105360; cds-WP_001135066.1, NZ_CP025268.1, 1856702, 1857343, +, 642, 6; cds-WP _000438807.1, NZ_CP025268.1, 1857436, 1858794, -, 1359, 1000; cds-WP_000719096.1, NZ_CP025268.1, 1858911, 1859669, -, 759, 0; cds-WP _000723710.1, NZ_CP025268.1, 1859806, 1860786, -, 981, 0; cds-WP _000369231.1, NZ_CP025268.1, 1860796, 1861743, -, 948, 589; cds-WP _000878893.1, NZ_CP025268.1, 1861748, 1862584, -, 837, 0; cds-WP_000798110.1, NZ_CP025268.1, 1862605, 1863648, -, 1044, 0; cds-WP _000435292.1, NZ_CP025268.1, 1863665, 1865044, -, 1380, 0; cds-WP_000645221.1, NZ_CP025268.1, 1865071, 1866147, -, 1077, 0; cds-WP _001300415.1, NZ _CP025268.1, 1866517, 1866789, -, 273, 15142; cds-WP _001284618.1, NZ_CP025268.1, 1866831, 1867244, -, 414, 114524; cds-WP_000153502.1, NZ_CP025268.1, 1867586, 1868581, +, 996, 1396973; cds-WP _001335909.1, NZ_CP025268.1, 1868665, 1869549, +, 885, 3646; cds-WP _001186371.1, NZ_CP025268.1, 1869597, 1870451, -, 855, 5318; cds-WP _000163771.1, NZ_CP025268.1, 1870541, 1871287, -, 747, 234387; cds-WP_001019882.1, NZ_CP025268.1, 1871723, 1873657, +, 1935, 8973; cds-CXP41_RS09905, NZ_CP025268.1, 1873770, 1875052, +, 1283, 0; cds-WP _000616433.1, NZ_CP025268.1, 1875199, 1876674, +, 1476, 0; cds-WP_000766132.1, NZ_CP025268.1, 1876855, 1878345, +, 1491, 7; cds-WP_000138043.1, NZ_CP025268.1, 1878388, 1878891, +, 504, 0; cds-WP _000999630.1, NZ_CP025268.1, 1878892, 1878996, -, 105, 0; cds-WP _000460707.1, NZ_CP025268.1, 1879166, 1879612, +, 447, 0; cds-CXP41_RS09935, NZ_CP025268.1, 1879569, 1880389, -, 821, 4955; cds-WP_000128491.1, NZ_CP025268.1, 1880486, 1881667, +, 1182, 2; cds-WP_001326526.1, NZ_CP025268.1, 1881722, 1882069, +, 348, 2; cds-WP _000691930.1, NZ_CP025268.1, 1882091, 1882345, -, 255, 0; cds-WP _001310896.1, NZ_CP025268.1, 1882528, 1883553, +, 1026, 7; cds-WP_001219350.1, NZ_CP025268.1, 1883586, 1883684, +, 99, 2; cds-WP_001386836.1, NZ_CP025268.1, 1883687, 1883761, +, 75, 0; cds-WP_000512153.1, NZ_CP025268.1, 1883820, 1884068, -, 249, 0; cds-WP _000513737.1, NZ_CP025268.1, 1884216, 1884398, -, 183, 0; cds-WP _000939317.1, NZ_CP025268.1, 1884402, 1884761, -, 360, 90; cds-WP _000457206.1, NZ_CP025268.1, 1884934, 1885572, -, 639, 3147; cds-WP_101348722.1, NZ_CP025268.1, 1885699, 1886622, -, 924, 0; cds-WP _000978494.1, NZ_CP025268.1, 1886725, 1887810, +, 1086, 0; cds-CXP41_RS10000, NZ_CP025268.1, 1887965, 1889446, +, 1482, 0; cds-WP_000067822.1, NZ_CP025268.1, 1889478, 1890602, +, 1125, 0; cds-WP_001287026.1, NZ_CP025268.1, 1890658, 1891623, +, 966, 35471; cds-WP_001307844.1, NZ_CP025268.1, 1891677, 1892792, -, 1116, 18232; cds-WP_000758422.1, NZ_CP025268.1, 1892874, 1894559, -, 1686, 82298; cds-WP _000290576.1, NZ_CP025268.1, 1894764, 1895345, -, 582, 53331; cds-WP_001220966.1, NZ_CP025268.1, 1895385, 1896080, -, 696, 41924; cds-WP_000128841.1, NZ_CP025268.1, 1896138, 1898048, -, 1911, 630259; cds-WP _001295493.1, NZ_CP025268.1, 1898180, 1898524, +, 345, 669; cds-WP _001111995.1, NZ_CP025268.1, 1898946, 1899245, +, 300, 0; cds-WP_000457334.1, NZ_CP025268.1, 1899365, 1899544, -, 180, 0; cds-WP_000854958.1, NZ_CP025268.1, 1899618, 1900979, +, 1362, 27; cds-WP_000456715.1, NZ_CP025268.1, 1900983, 1901561, +, 579, 163; cds-WP _000624298.1, NZ_CP025268.1, 1901745, 1903109, +, 1365, 198212; cds-WP_001295494.1, NZ_CP025268.1, 1903240, 1904838, +, 1599, 0; cds-WP _000394983.1, NZ_CP025268.1, 1904842, 1906398, -, 1557, 1; cds-WP _000150543.1, NZ_CP025268.1, 1906861, 1907832, +, 972, 495; cds-WP _000406926.1, NZ_CP025268.1, 1907895, 1908695, +, 801, 68622; cds-WP_000228655.1, NZ_CP025268.1, 1908708, 1909559, +, 852, 1141; cds-WP _000156255.1, NZ_CP025268.1, 1909614, 1910072, +, 459, 3; cds-WP _021542535.1, NZ_CP025268.1, 1910501, 1911067, +, 567, 3087; cds-WP _000010115.1, NZ_CP025268.1, 1911064, 1911873, -, 810, 55; cds-WP_001062678.1, NZ_CP025268.1, 1912039, 1912248, -, 210, 3786; cds-WP_001295496.1, NZ_CP025268.1, 1912261, 1912404, -, 144, 35455; cds-WP _001006866.1, NZ_CP025268.1, 1913074, 1913361, -, 288, 5158; cds-WP _000714550.1, NZ_CP025268.1, 1913436, 1913579, -, 144, 61; cds-WP _001211011.1, NZ_CP025268.1, 1913738, 1913977, +, 240, 4; cds-WP _001262203.1, NZ_CP025268.1, 1914121, 1914912, -, 792, 150427; cds-WP_101348609.1, NZ_CP025268.1, 1915089, 1916462, +, 1374, 5; cds-WP_000984520.1, NZ_CP025268.1, 1916508, 1917389, -, 882, 166532; cds-WP_001055791.1, NZ_CP025268.1, 1917581, 1919629, -, 2049, 682104; cds-WP _000431381.1, NZ_CP025268.1, 1919649, 1920347, -, 699, 518391; cds-WP _001043877.1, NZ_CP025268.1, 1920444, 1920941, -, 498, 98200; cds-WP_001207282.1, NZ_CP025268.1, 1921071, 1922354, +, 1284, 6; cds-WP _001326728.1, NZ_CP025268.1, 1922323, 1924956, +, 2634, 31807; cds-WP_001352260.1, NZ_CP025268.1, 1925037, 1926476, +, 1440, 54423; cds-WP_001295499.1, NZ_CP025268.1, 1926594, 1926830, +, 237, 5615; cds-WP _000457842.1, NZ_CP025268.1, 1926935, 1927126, +, 192, 209; cds-WP _000812724.1, NZ _CP025268.1, 1927127, 1927783, -, 657, 6; cds-WP _000976476.1, NZ_CP025268.1, 1928179, 1928520, -, 342, 3075; cds-WP_000879289.1, NZ_CP025268.1, 1928533, 1929405, -, 873, 8023; cds-WP_000168747.1, NZ_CP025268.1, 1929409, 1929783, -, 375, 6524; cds-WP _000916763.1, NZ_CP025268.1, 1929922, 1930152, +, 231, 345; cds-WP_000011658.1, NZ_CP025268.1, 1930254, 1930910, +, 657, 1; cds-WP _000944256.1, NZ_CP025268.1, 1930934, 1931596, +, 663, 84; cds-WP _000936927.1, NZ_CP025268.1, 1931593, 1933653, -, 2061, 425; cds-WP_000024757.1, NZ_CP025268.1, 1933862, 1934521, -, 660, 427; cds-WP_001350516.1, NZ_CP025268.1, 1934848, 1935204, -, 357, 1093; cds-WP_000257738.1, NZ_CP025268.1, 1935271, 1935561, -, 291, 944; cds-CXP41_RS10265, NZ_CP025268.1, 1935695, 1936874, +, 1180, 0; cds-WP _000800512.1, NZ_CP025268.1, 1936930, 1937571, -, 642, 44831; cds-WP _001069467.1, NZ_CP025268.1, 1937608, 1939419, -, 1812, 73068; cds-WP_000301727.1, NZ_CP025268.1, 1939654, 1941129, -, 1476, 359265; cds-WP _001056706.1, NZ_CP025268.1, 1941467, 1942336, +, 870, 11133; cds-WP_000091148.1, NZ_CP025268.1, 1942464, 1943906, +, 1443, 5242; cds-WP_101348610.1, NZ_CP025268.1, 1944037, 1945008, -, 972, 26215; cds-WP_001184045.1, NZ_CP025268.1, 1945128, 1946450, -, 1323, 179727; cds-WP _001300644.1, NZ_CP025268.1, 1946466, 1947398, -, 933, 151142; cds-WP_101348611.1, NZ_CP025268.1, 1947477, 1948232, +, 756, 25733; cds-WP _000571480.1, NZ_CP025268.1, 1948229, 1949014, +, 786, 81; cds-WP _000568519.1, NZ_CP025268.1, 1949161, 1950171, -, 1011, 1552; cds-WP _000580323.1, NZ_CP025268.1, 1950180, 1950791, -, 612, 3; cds-WP_010723105.1, NZ_CP025268.1, 1950930, 1950995, -, 66, 0; cds-WP_001024932.1, NZ_CP025268.1, 1951066, 1951668, +, 603, 64548; cds-WP_001295503.1, NZ_CP025268.1, 1951670, 1952191, -, 522, 62958; cds-WP_000907248.1, NZ_CP025268.1, 1952226, 1952966, -, 741, 302189; cds-WP_001300367.1, NZ_CP025268.1, 1952995, 1953447, -, 453, 158832; cds-WP _001258678.1, NZ_CP025268.1, 1953565, 1955337, -, 1773, 559912; cds-WP _000891621.1, NZ_CP025268.1, 1955648, 1956214, +, 567, 149; cds-WP_000639274.1, NZ_CP025268.1, 1956211, 1957029, +, 819, 295; cds-WP_000252980.1, NZ_CP025268.1, 1957082, 1957477, +, 396, 1388; cds-WP _000019590.1, NZ_CP025268.1, 1957518, 1958261, +, 744, 88607; cds-WP_000564725.1, NZ_CP025268.1, 1958258, 1959229, +, 972, 44494; cds-WP_000176781.1, NZ_CP025268.1, 1959394, 1961823, -, 2430, 0; cds-WP _001214331.1, NZ_CP025268.1, 1961848, 1962948, -, 1101, 8; cds-WP _001185741.1, NZ_CP025268.1, 1963336, 1964082, -, 747, 305; cds-WP_001326725.1, NZ_CP025268.1, 1964096, 1964662, -, 567, 5; cds-WP_001025322.1, NZ_CP025268.1, 1964878, 1966611, +, 1734, 123037; cds-WP_211180499.1, NZ_CP025268.1, 1966653, 1966697, -, 45, 669; cds-WP_001299676.1, NZ_CP025268.1, 1966788, 1967276, +, 489, 4186; cds-WP _001259583.1, NZ_CP025268.1, 1967396, 1967788, -, 393, 184; cds-WP_000066951.1, NZ_CP025268.1, 1967788, 1969866, -, 2079, 320333; cds-WP_001278954.1, NZ_CP025268.1, 1969859, 1971007, -, 1149, 72; cds-WP_000983609.1, NZ_CP025268.1, 1971209, 1971853, -, 645, 8631; cds-WP_000763867.1, NZ_CP025268.1, 1971864, 1972253, -, 390, 17615; cds-WP _000036361.1, NZ_CP025268.1, 1972268, 1973317, -, 1050, 301052; cds-WP _000204337.1, NZ_CP025268.1, 1973320, 1974180, -, 861, 32114; cds-WP _000483239.1, NZ_CP025268.1, 1974199, 1975800, -, 1602, 314159; cds-WP _001297437.1, NZ_CP025268.1, 1975846, 1977507, -, 1662, 17650; cds-WP_000147302.1, NZ_CP025268.1, 1977652, 1978155, -, 504, 772; cds-


WP_001350517.1, NZ_CP025268.1, 1978176, 1980140, -, 1965, 574532; cds-WP _000795630.1, NZ_CP025268.1, 1980145, 1981071, -, 927, 423235; cds-WP _000906340.1, NZ_CP025268.1, 1981068, 1981955, -, 888, 231158; cds-WP_001291603.1, NZ_CP025268.1, 1982082, 1982660, -, 579, 6608; cds-WP_001295647.1, NZ_CP025268.1, 1982663, 1983013, -, 351, 3220; cds-WP _000122416.1, NZ_CP025268.1, 1983793, 1984221, +, 429, 0; cds-WP_001295646.1, NZ_CP025268.1, 1984228, 1985652, -, 1425, 59; cds-WP_001295645.1, NZ_CP025268.1, 1985627, 1986427, -, 801, 472; cds-WP _000100205.1, NZ_CP025268.1, 1986594, 1987580, -, 987, 50; cds-WP_001187819.1, NZ_CP025268.1, 1987595, 1989109, -, 1515, 0; cds-WP _000548675.1, NZ_CP025268.1, 1989179, 1990168, -, 990, 0; cds-WP _000179469.1, NZ_CP025268.1, 1990965, 1991468, +, 504, 12; cds-WP_000082127.1, NZ_CP025268.1, 1991547, 1991798, -, 252, 1; cds-WP_010723106.1, NZ_CP025268.1, 1991913, 1991999, -, 87, 1; cds-WP_001237869.1, NZ_CP025268.1, 1992262, 1992585, +, 324, 3; cds-WP_000917208.1, NZ_CP025268.1, 1992756, 1993253, +, 498, 47261; cds-WP _000377225.1, NZ_CP025268.1, 1993291, 1993530, -, 240, 0; cds-WP_000797560.1, NZ_CP025268.1, 1993721, 1994932, +, 1212, 33843; cds-WP_000847902.1, NZ_CP025268.1, 1994994, 1995659, -, 666, 46250; cds-WP _001160187.1, NZ_CP025268.1, 1996309, 1996857, -, 549, 0; cds-WP _001283421.1, NZ_CP025268.1, 1996914, 1998746, -, 1833, 244575; cds-WP _000611335.1, NZ_CP025268.1, 1998743, 1999399, -, 657, 16084; cds-WP_000590347.1, NZ_CP025268.1, 1999695, 1999871, +, 177, 23; cds-WP_000106474.1, NZ_CP025268.1, 1999858, 2000082, +, 225, 11; cds-WP_001152715.1, NZ_CP025268.1, 2000150, 2000872, -, 723, 12292; cds-WP _001272991.1, NZ_CP025268.1, 2001102, 2001854, -, 753, 68628; cds-WP _001158220.1, NZ_CP025268.1, 2001851, 2002519, -, 669, 4249; cds-WP _001128215.1, NZ_CP025268.1, 2002534, 2003520, -, 987, 23; cds-WP _001296168.1, NZ_CP025268.1, 2003625, 2004425, -, 801, 39753; cds-WP _001350518.1, NZ_CP025268.1, 2004513, 2005064, -, 552, 252496; cds-WP_001087467.1, NZ_CP025268.1, 2005110, 2005829, -, 720, 179333; cds-WP_000079739.1, NZ_CP025268.1, 2006150, 2007646, -, 1497, 2442576; cds-WP_000146784.1, NZ_CP025268.1, 2007912, 2009318, +, 1407, 248527; cds-WP _000270671.1, NZ_CP025268.1, 2009343, 2009753, +, 411, 45043; cds-WP_001015033.1, NZ_CP025268.1, 2009753, 2010118, +, 366, 5302; cds-WP _001245695.1, NZ_CP025268.1, 2010196, 2011683, +, 1488, 65371; cds-WP _001350519.1, NZ_CP025268.1, 2011717, 2012130, -, 414, 4632; cds-WP _000118897.1, NZ_CP025268.1, 2012317, 2013522, +, 1206, 19861; cds-WP_000790504.1, NZ_CP025268.1, 2013519, 2013752, +, 234, 11; cds-WP_000334583.1, NZ_CP025268.1, 2013861, 2014529, +, 669, 0; cds-WP _000494172.1, NZ_CP025268.1, 2014640, 2015119, +, 480, 19513; cds-WP _001362554.1, NZ_CP025268.1, 2015388, 2015579, -, 192, 1784; cds-CXP41_RS10705, NZ_CP025268.1, 2015589, 2016391, -, 803, 68548; cds-WP_001274299.1, NZ_CP025268.1, 2016740, 2017054, -, 315, 1393; cds-WP _000994427.1, NZ_CP025268.1, 2017269, 2018927, +, 1659, 116023; cds-WP _000067950.1, NZ_CP025268.1, 2018920, 2019915, +, 996, 303259; cds-WP _001282683.1, NZ_CP025268.1, 2019908, 2020594, +, 687, 29965; cds-WP_000213294.1, NZ_CP025268.1, 2020594, 2021967, +, 1374, 511687; cds-WP _000807579.1, NZ_CP025268.1, 2021986, 2022429, +, 444, 90634; cds-WP_000620071.1, NZ_CP025268.1, 2022426, 2023553, +, 1128, 48053; cds-WP_000133106.1, NZ_CP025268.1, 2023658, 2024122, +, 465, 142261; cds-WP_001350520.1, NZ_CP025268.1, 2024127, 2025131, +, 1005, 653829; cds-WP _001282101.1, NZ_CP025268.1, 2025128, 2025541, +, 414, 97349; cds-WP_001302429.1, NZ_CP025268.1, 2025544, 2025909, +, 366, 351875; cds-WP_001253441.1, NZ_CP025268.1, 2025909, 2026646, +, 738, 107785; cds-WP _000187358.1, NZ_CP025268.1, 2026656, 2026925, +, 270, 105328; cds-WP_000942319.1, NZ_CP025268.1, 2026933, 2027718, +, 786, 142296; cds-WP_000104001.1, NZ_CP025268.1, 2028008, 2028631, +, 624, 14; cds-WP _000867217.1, NZ_CP025268.1, 2028675, 2028863, -, 189, 0; cds-WP _000844800.1, NZ_CP025268.1, 2029026, 2029253, +, 228, 5; cds-WP_000491520.1, NZ_CP025268.1, 2029551, 2030366, +, 816, 7; cds-WP _001350521.1, NZ_CP025268.1, 2030363, 2032057, -, 1695, 335800; cds-WP _000009307.1, NZ_CP025268.1, 2032228, 2032410, -, 183, 0; cds-WP_000922686.1, NZ_CP025268.1, 2032489, 2033406, -, 918, 3; cds-CXP41_RS10830, NZ_CP025268.1, 2033579, 2034498, +, 920, 149346; cds-WP _000786005.1, NZ_CP025268.1, 2034487, 2034957, -, 471, 29891; cds-WP _001157239.1, NZ_CP025268.1, 2034938, 2036356, -, 1419, 331913; cds-WP _000365562.1, NZ_CP025268.1, 2036423, 2037118, -, 696, 3629; cds-WP_001313057.1, NZ_CP025268.1, 2037158, 2037523, -, 366, 0; cds-CXP41_RS10855, NZ_CP025268.1, 2038090, 2039282, +, 1193, 26; cds-WP _000218212.1, NZ_CP025268.1, 2039874, 2040725, +, 852, 82; cds-WP _000826792.1, NZ_CP025268.1, 2040833, 2042191, -, 1359, 901; cds-WP_001395354.1, NZ_CP025268.1, 2042191, 2042862, -, 672, 12082; cds-WP_000920120.1, NZ_CP025268.1, 2042995, 2043408, +, 414, 0; cds-WP_000740106.1, NZ_CP025268.1, 2043517, 2044521, +, 1005, 0; cds-WP_001240091.1, NZ_CP025268.1, 2044522, 2045157, +, 636, 0; cds-WP _001007805.1, NZ_CP025268.1, 2045414, 2046064, +, 651, 0; cds-WP_001079074.1, NZ_CP025268.1, 2046407, 2046937, +, 531, 5174; cds-WP_001302302.1, NZ_CP025268.1, 2047690, 2048487, +, 798, 0; cds-WP_157825727.1, NZ_CP025268.1, 2048977, 2056053, +, 7077, 62990; cds-CXP41_RS10930, NZ_CP025268.1, 2056315, 2057367, -, 1053, 0; cds-WP _000378575.1, NZ_CP025268.1, 2057682, 2058998, +, 1317, 19469; cds-WP _001060244.1, NZ_CP025268.1, 2059100, 2060554, +, 1455, 188343; cds-WP _000532923.1, NZ_CP025268.1, 2060897, 2061613, +, 717, 6206; cds-WP_000943916.1, NZ_CP025268.1, 2062242, 2063885, -, 1644, 0; cds-WP_001011008.1, NZ_CP025268.1, 2064003, 2064953, -, 951, 701; cds-WP_001011462.1, NZ_CP025268.1, 2065055, 2065972, -, 918, 0; cds-WP _000986321.1, NZ_CP025268.1, 2066430, 2067365, -, 936, 25096; cds-WP _001166160.1, NZ_CP025268.1, 2067427, 2068506, -, 1080, 29955; cds-WP _001326708.1, NZ_CP025268.1, 2068518, 2069261, -, 744, 353; cds-WP_000973176.1, NZ_CP025268.1, 2069258, 2069803, -, 546, 3832; cds-WP_000019402.1, NZ_CP025268.1, 2070344, 2071324, -, 981, 189892; cds-CXP41_RS11035, NZ_CP025268.1, 2072674, 2072979, +, 306, 7; cds-WP_088895425.1-3, NZ_CP025268.1;NZ_CP025268.1, 2072991;2073904, 2073904;2074219, -;-, 1229, 8621; cds-CXP41_RS11045, NZ_CP025268.1, 2074313, 2074510, +, 198, 0; cds-WP_014639038.1, NZ_CP025268.1, 2074540, 2075250, +, 711, 0; cds-WP_101348613.1, NZ_CP025268.1, 2075578, 2078697, +, 3120, 10516; cds-WP _001350525.1, NZ_CP025268.1, 2078818, 2080350, +, 1533, 44496; cds-WP _000187523.1, NZ_CP025268.1, 2080347, 2080793, +, 447, 0; cds-WP_000692323.1, NZ_CP025268.1, 2080856, 2081077, +, 222, 0; cds-WP _001285584.1, NZ_CP025268.1, 2081151, 2081519, +, 369, 0; cds-WP _000854814.1, NZ_CP025268.1, 2081608, 2081982, +, 375, 0; cds-WP_000988600.1, NZ_CP025268.1, 2081979, 2082173, +, 195, 0; cds-WP _001161660.1, NZ_CP025268.1, 2082186, 2082299, +, 114, 0; cds-CXP41_RS11090, NZ_CP025268.1, 2082588, 2082716, -, 129, 0; cds-WP_001016348.1, NZ_CP025268.1, 2082788, 2082970, +, 183, 0; cds-WP _000450409.1, NZ_CP025268.1, 2083071, 2083400, -, 330, 6805; cds-WP_001200891.1, NZ_CP025268.1, 2083572, 2084630, -, 1059, 6; cds-WP_001105415.1, NZ_CP025268.1, 2084828, 2085301, -, 474, 88974; cds-WP _000830156.1, NZ_CP025268.1, 2085420, 2086586, -, 1167, 10679; cds-WP_000980589.1, NZ_CP025268.1, 2086795, 2088222, +, 1428, 1; cds-WP_000234896.1, NZ_CP025268.1, 2088265, 2088492, -, 228, 162; cds-WP_000492339.1, NZ_CP025268.1, 2088506, 2089564, -, 1059, 6; cds-WP_101348614.1, NZ_CP025268.1, 2089743, 2091101, -, 1359, 372683; cds-WP_010723108.1, NZ_CP025268.1, 2091091, 2091153, -, 63, 1514; cds-WP_000803351.1, NZ_CP025268.1, 2091368, 2092297, -, 930, 229; cds-WP_000754737.1, NZ_CP025268.1, 2092343, 2093167, -, 825, 49299; cds-WP _000767829.1, NZ_CP025268.1, 2093250, 2093504, -, 255, 73730; cds-WP _001259255.1, NZ_CP025268.1, 2093501, 2093752, -, 252, 35696; cds-WP _001364200.1, NZ_CP025268.1, 2094035, 2094085, +, 51, 76; cds-WP_000131782.1, NZ_CP025268.1, 2094231, 2095130, +, 900, 7199; cds-WP _000009594.1, NZ_CP025268.1, 2095136, 2096440, +, 1305, 59; cds-WP_000108941.1, NZ_CP025268.1, 2096437, 2097507, +, 1071, 4059; cds-WP _000080105.1, NZ_CP025268.1, 2097507, 2098574, +, 1068, 46591; cds-WP_001103560.1, NZ_CP025268.1, 2098574, 2099164, +, 591, 72334; cds-WP_000586462.1, NZ_CP025268.1, 2099164, 2099901, +, 738, 603; cds-WP_000880182.1, NZ_CP025268.1, 2099883, 2100659, +, 777, 346209; cds-WP _000954911.1, NZ_CP025268.1, 2100653, 2101264, +, 612, 72119; cds-WP _001393575.1, NZ_CP025268.1, 2101360, 2102340, -, 981, 232026; cds-WP_101348615.1, NZ_CP025268.1, 2102486, 2103652, -, 1167, 25336; cds-WP_000043484.1, NZ_CP025268.1, 2103901, 2105307, -, 1407, 1579997; cds-CXP41_RS11230, NZ_CP025268.1, 2105435, 2105788, -, 354, 18028; cds-WP_000019403.1-5, NZ_CP025268.1, 2105934, 2106914, -, 981, 96838; cds-CXP41_RS11245, NZ_CP025268.1, 2106985, 2107428, -, 444, 56891; cds-WP_101348616.1, NZ_CP025268.1, 2107430, 2108548, -, 1119, 614798; cds-WP _000601187.1, NZ_CP025268.1, 2108533, 2109123, -, 591, 103462; cds-WP_001407542.1, NZ_CP025268.1, 2109104, 2110096, -, 993, 146180; cds-WP_000639866.1, NZ_CP025268.1, 2110099, 2111265, -, 1167, 741782; cds-WP_000272486.1, NZ_CP025268.1, 2111265, 2112368, -, 1104,724072; cds-WP_001393538.1, NZ_CP025268.1, 2112376, 2113623, -, 1248, 659655; cds-WP_001100981.1, NZ_CP025268.1, 2113620, 2114177, -, 558, 278096; cds-WP_000783975.1, NZ_CP025268.1, 2114177, 2115058, -, 882, 692185; cds-WP _001023610.1, NZ_CP025268.1, 2115116, 2116015, -, 900, 1610962; cds-WP _000699460.1, NZ_CP025268.1, 2116015, 2117100, -, 1086, 762907; cds-WP _000183060.1, NZ_CP025268.1, 2117473, 2118366, -, 894, 72839; cds-WP_001116026.1, NZ_CP025268.1, 2118541, 2119935, -, 1395, 0; cds-WP_000862592.1, NZ_CP025268.1, 2119946, 2121166, -, 1221, 5; cds-WP_101348617.1, NZ_CP025268.1, 2121163, 2122443, -, 1281, 0; cds-WP_000058424.1, NZ_CP025268.1, 2122719, 2124197, -, 1479, 0; cds-WP _000183107.1, NZ_CP025268.1, 2124199, 2125593, -, 1395, 0; cds-WP_001350528.1, NZ_CP025268.1, 2125648, 2127018, -, 1371, 0; cds-WP_000079274.1, NZ_CP025268.1, 2127123, 2128559, -, 1437, 0; cds-WP _000699693.1, NZ_CP025268.1, 2128562, 2129785, -, 1224, 0; cds-WP _001393539.1, NZ_CP025268.1, 2129782, 2130261, -, 480, 0; cds-WP _000043654.1, NZ_CP025268.1, 2130264, 2131229, -, 966, 0; cds-WP 000048190.1, NZ_CP025268.1, 2131232, 2132353, -, 1122, 0; cds-WP_001153547.1, NZ_CP025268.1, 2132379, 2132927, -, 549, 0; cds-WP _000927089.1, NZ_CP025268.1, 2132943, 2133689, -, 747, 0; cds-WP_101348618.1, NZ_CP025268.1, 2133700, 2134917, -, 1218, 0; cds-WP_101348619.1, NZ_CP025268.1, 2134892, 2136109, -, 1218, 0; cds-WP_000888740.1, NZ_CP025268.1, 2136106, 2136594, -, 489, 0; cds-WP_000794699.1, NZ_CP025268.1, 2136597, 2137436, -, 840,11803; cds-WP_000137196.1, NZ_CP025268.1, 2137529, 2139691, -, 2163, 8086; cds-WP_000482901.1, NZ_CP025268.1, 2139694, 2140137, -, 444, 0; cds-WP_000978094.1, NZ_CP025268.1, 2140143, 2141282, -, 1140, 0; cds-WP_000454701.1, NZ_CP025268.1, 2141941, 2143524, +, 1584, 10074; cds-WP_001252331.1, NZ_CP025268.1, 2143798, 2145651, -, 1854, 480531; cds-WP_001234768.1, NZ_CP025268.1, 2145673, 2146254, -, 582, 66104; cds-WP _001295424.1, NZ_CP025268.1, 2146346, 2146987, -, 642, 73641; cds-WP_000043761.1, NZ_CP025268.1, 2147305, 2150622, +, 3318, 61; cds-WP _000288420.1, NZ_CP025268.1, 2150731, 2151579, -, 849, 5; cds-WP _000469708.1, NZ_CP025268.1, 2151713, 2153065, +, 1353, 15833; cds-WP_000856081.1, NZ_CP025268.1, 2153078, 2155024, -, 1947, 20565; cds-WP _000722348.1, NZ_CP025268.1, 2155224, 2155685, +, 462, 0; cds-WP_000119090.1, NZ_CP025268.1, 2155750, 2156511, -, 762, 0; cds-WP_000003154.1, NZ_CP025268.1, 2156508, 2157167, -, 660, 0; cds-WP_010723109.1, NZ_CP025268.1, 2157388, 2157447, -, 60, 0; cds-WP _001386899.1, NZ_CP025268.1, 2157720, 2157776, -, 57, 0; cds-WP_000678989.1, NZ_CP025268.1, 2158055, 2159302, +, 1248, 33675; cds-WP_001197875.1, NZ_CP025268.1, 2159302, 2162424, +, 3123, 528; cds-WP_000667481.1, NZ_CP025268.1, 2162425, 2165502, +, 3078, 0; cds-WP _000130850.1, NZ_CP025268.1, 2165503, 2166918, +, 1416, 24; cds-WP _000675150.1, NZ_CP025268.1, 2166915, 2168318, +, 1404, 5; cds-WP _000137877.1, NZ_CP025268.1, 2168315, 2169037, +, 723, 316; cds-WP _001350529.1, NZ_CP025268.1, 2169228, 2169560, +, 333, 0; cds-WP _000476011.1, NZ_CP025268.1, 2169707, 2171068,


+, 1362, 75524; cds-WP _000468310.1, NZ_CP025268.1, 2171341, 2171559, -, 219, 0; cds-CXP41_RS11525, NZ_CP025268.1, 2171641, 2171853, -, 213, 0; cds-WP _001318299.1, NZ_CP025268.1, 2172028, 2172345, -, 318, 0; cds-WP_000807348.1, NZ_CP025268.1, 2172751, 2173650, +, 900, 0; cds-CXP41_RS11545, NZ_CP025268.1, 2173732, 2174208, -, 477, 0; cds-WP _085947771.1-4, NZ_CP025268.1;NZ_CP025268.1, 2174275;2174536, 2174536;2175437, +;+, 1163, 6; cds-CXP41_RS11555, NZ_CP025268.1, 2175467, 2175766, -, 300, 0; cds-WP_000844219.1, NZ_CP025268.1, 2175872, 2176912, -, 1041, 0; cds-WP _000490679.1, NZ_CP025268.1, 2176960, 2178315, -, 1356, 134433; cds-WP _000823270.1, NZ_CP025268.1, 2178319, 2178603, -, 285, 3865; cds-WP _000182899.1, NZ_CP025268.1, 2178634, 2179086, -, 453, 22; cds-WP _000853883.1, NZ_CP025268.1, 2179096, 2180358, -, 1263, 54874; cds-WP_001307281.1, NZ_CP025268.1, 2180387, 2181241, -, 855, 427067; cds-WP_000129551.1, NZ_CP025268.1, 2181549, 2182601, -, 1053, 0; cds-WP_000858484.1, NZ_CP025268.1, 2182858, 2184135, +, 1278, 27; cds-WP_000846217.1, NZ_CP025268.1, 2184132, 2185136, +, 1005, 2; cds-WP_000012001.1, NZ_CP025268.1, 2185133, 2186098, +, 966, 0; cds-WP_000434038.1, NZ_CP025268.1, 2186072, 2186818, -, 747, 2; cds-WP _001351783.1, NZ_CP025268.1, 2186870, 2187688, -, 819, 0; cds-WP_000822274.1, NZ_CP025268.1, 2187753, 2188553, -, 801, 21751; cds-WP _001195564.1, NZ_CP025268.1, 2188550, 2189338, -, 789, 68376; cds-WP _000019944.1, NZ_CP025268.1, 2189561, 2189833, -, 273, 0; cds-WP_000134636.1, NZ_CP025268.1, 2189954, 2190778, +, 825, 0; cds-WP_000153067.1, NZ_CP025268.1, 2190997, 2191335, +, 339, 5; cds-WP _000405713.1, NZ_CP025268.1, 2191417, 2192451, -, 1035, 0; cds-WP_000945454.1, NZ_CP025268.1, 2192467, 2194947, -, 2481, 9; cds-WP _000677393.1, NZ_CP025268.1, 2194963, 2195637, -, 675, 0; cds-WP_000830456.1, NZ_CP025268.1, 2195717, 2196259, -, 543, 0; cds-WP_001324851.1, NZ_CP025268.1, 2196552, 2196833, -, 282, 16745; cds-WP_001005448.1, NZ_CP025268.1, 2197096, 2198205, -, 1110, 146358; cds-WP _001350533.1, NZ_CP025268.1, 2198337, 2200370, +, 2034, 637547; cds-CXP41_RS24230, NZ_CP025268.1, 2200511, 2204306, +, 3796, 10830; cds-WP _001373533.1, NZ_CP025268.1, 2204316, 2204558, +, 243, 0; cds-WP_101348620.1, NZ_CP025268.1, 2204555, 2207947, +, 3393, 398; cds-WP_000636925.1, NZ_CP025268.1, 2208008, 2208325, +, 318, 0; cds-WP_001350535.1, NZ_CP025268.1, 2208632, 2209720, +, 1089, 0; cds-WP _001294387.1, NZ_CP025268.1, 2209731, 2212010, +, 2280, 0; cds-WP_001333512.1, NZ_CP025268.1, 2212003, 2213139, +, 1137, 0; cds-CXP41_RS11730, NZ_CP025268.1, 2213136, 2215136, +, 2001, 108; cds-WP _001295429.1, NZ_CP025268.1, 2215261, 2215722, +, 462, 9720; cds-WP _000950409.1, NZ_CP025268.1, 2215762, 2216232, -, 471, 9462; cds-WP _000598641.1, NZ_CP025268.1, 2216279, 2216998, -, 720, 4; cds-CXP41_RS11750, NZ_CP025268.1, 2216995, 2218679, -, 1685, 0; cds-WP_001240401.1, NZ_CP025268.1, 2218901, 2219632, +, 732, 0; cds-WP_001216963.1, NZ_CP025268.1, 2219692, 2219799, +, 108, 0; cds-WP _000783123.1, NZ_CP025268.1, 2219780, 2220511, -, 732, 6999; cds-WP_000569315.1, NZ_CP025268.1, 2220516, 2221442, -, 927, 0; cds-WP_000220837.1, NZ_CP025268.1, 2221435, 2222592, -, 1158, 0; cds-WP_001130308.1, NZ_CP025268.1, 2222599, 2223516, -, 918, 41544; cds-WP_069905050.1, NZ_CP025268.1, 2223727, 2226024, -, 2298, 522442; cds-WP _000097403.1, NZ_CP025268.1, 2226220, 2227935, +, 1716, 32203; cds-WP_001319943.1, NZ_CP025268.1, 2227973, 2228905, -, 933, 1082; cds-WP _001295454.1, NZ_CP025268.1, 2229079, 2229666, -, 588, 0; cds-WP _001296821.1, NZ_CP025268.1, 2229836, 2230414, +, 579, 17; cds-WP_000079538.1, NZ_CP025268.1, 2230544, 2231305, -, 762, 0; cds-CXP41_RS11815, NZ_CP025268.1, 2231358, 2232793, -, 1436, 256; cds-WP _000691708.1, NZ_CP025268.1, 2233017, 2233100, +, 84, 0; cds-WP_001264861.1, NZ_CP025268.1, 2233473, 2234420, -, 948, 36; cds-WP _001295452.1, NZ_CP025268.1, 2234659, 2235057, +, 399, 1; cds-WP_000968208.1, NZ_CP025268.1, 2235054, 2235749, +, 696, 5; cds-WP_000553555.1, NZ_CP025268.1, 2235879, 2236763, +, 885, 19; cds-WP_000920064.1, NZ_CP025268.1, 2236913, 2237632, +, 720, 11065; cds-WP _000383096.1, NZ_CP025268.1, 2237635, 2237874, +, 240, 1; cds-WP_001136389.1, NZ_CP025268.1, 2238068, 2239306, +, 1239, 0; cds-WP_000956071.1, NZ_CP025268.1, 2239300, 2240535, +, 1236, 0; cds-WP_001275118.1, NZ_CP025268.1, 2240778, 2241788, -, 1011, 0; cds-WP _000255039.1, NZ_CP025268.1, 2241804, 2243324, -, 1521, 40; cds-WP _001036964.1, NZ_CP025268.1, 2243385, 2244383, -, 999, 0; cds-CXP41_RS11890, NZ_CP025268.1, 2244663, 2245704, -, 1042, 8; cds-WP_000440926.1, NZ_CP025268.1, 2245846, 2247003, -, 1158, 7203; cds-WP _001139613.1, NZ_CP025268.1, 2247020, 2247688, -, 669, 241878; cds-WP_000425438.1, NZ_CP025268.1, 2247946, 2248782, +, 837, 16411; cds-WP_000489247.1, NZ_CP025268.1, 2248814, 2250805, -, 1992, 128422; cds-WP _000253273.1, NZ_CP025268.1, 2251099, 2252568, -, 1470, 74012; cds-WP _000548294.1, NZ_CP025268.1, 2252773, 2253654, -, 882, 14; cds-WP_000182053.1, NZ_CP025268.1, 2253753, 2254802, +, 1050, 171; cds-WP _000873894.1, NZ_CP025268.1, 2254876, 2255733, +, 858, 59013; cds-WP_001065016.1, NZ_CP025268.1, 2255736, 2256824, +, 1089, 24; cds-WP _000382966.1, NZ_CP025268.1, 2256931, 2258181, -, 1251, 647; cds-WP_000415429.1, NZ_CP025268.1, 2258281, 2259222, -, 942, 0; cds-WP_000658575.1, NZ_CP025268.1, 2259352, 2260050, +, 699, 0; cds-WP _000353878.1, NZ_CP025268.1, 2260121, 2261371, -, 1251, 0; cds-WP _001292460.1, NZ_CP025268.1, 2261465, 2262403, -, 939, 0; cds-WP _001208118.1, NZ_CP025268.1, 2262391, 2263332, -, 942, 0; cds-WP_000854447.1, NZ_CP025268.1, 2263755, 2265446, -, 1692, 522789; cds-WP _000091263.1, NZ_CP025268.1, 2265463, 2266401, -, 939, 285075; cds-WP _000487246.1, NZ_CP025268.1, 2266401, 2267531, -, 1131, 75977; cds-WP_000551980.1, NZ_CP025268.1, 2267899, 2269080, +, 1182, 0; cds-WP_000389030.1, NZ_CP025268.1, 2269077, 2269331, -, 255, 0; cds-WP_001136827.1, NZ_CP025268.1, 2269486, 2270058, +, 573, 1098; cds-WP _001091940.1, NZ_CP025268.1, 2270281, 2271747, +, 1467, 225689; cds-WP_000198828.1, NZ_CP025268.1, 2271865, 2272851, +, 987, 44; cds-WP_000594599.1, NZ_CP025268.1, 2272890, 2273603, +, 714, 34818; cds-WP _000241011.1, NZ_CP025268.1, 2274015, 2274581, +, 567, 125896; cds-WP_000470560.1, NZ_CP025268.1, 2274762, 2276318, +, 1557, 96952; cds-WP_000637046.1, NZ_CP025268.1, 2276400, 2278214, +, 1815, 5; cds-WP _000501604.1, NZ_CP025268.1, 2278215, 2279309, +, 1095, 12027; cds-WP_000088923.1, NZ_CP025268.1, 2279309, 2280334, +, 1026, 87543; cds-WP_000194927.1, NZ_CP025268.1, 2280336, 2281925, +, 1590, 123153; cds-WP_000202798.1, NZ_CP025268.1, 2281929, 2282273, -, 345, 19501; cds-WP _000213361.1, NZ_CP025268.1, 2282606, 2283796, -, 1191, 59460; cds-WP _001234850.1, NZ_CP025268.1, 2283824, 2284519, -, 696, 11500; cds-WP_000578061.1, NZ_CP025268.1, 2284668, 2286428, +, 1761, 15; cds-WP _000494183.1, NZ_CP025268.1, 2286553, 2286837, +, 285, 259862; cds-WP _000050793.1, NZ_CP025268.1, 2286976, 2287983, -, 1008, 1016; cds-WP_001135667.1, NZ_CP025268.1, 2288165, 2288392, +, 228, 50009; cds-WP_000256203.1, NZ_CP025268.1, 2288412, 2290172, +, 1761, 936850; cds-CXP41_RS12130, NZ_CP025268.1, 2290426, 2292956, -, 2531, 59713; cds-WP_000019403.1-6, NZ_CP025268.1, 2293100, 2294080, -, 981, 106606; cds-WP_001113639.1, NZ_CP025268.1, 2294535, 2295182, +, 648, 19; cds-WP _001211575.1, NZ_CP025268.1, 2295393, 2296445, -, 1053, 18216; cds-WP _000824439.1, NZ_CP025268.1, 2296442, 2296999, -, 558, 37; cds-WP_000982447.1, NZ_CP025268.1, 2296996, 2298939, -, 1944, 2775; cds-WP _001026418.1, NZ_CP025268.1, 2298936, 2299415, -, 480, 176; cds-WP _000186540.1, NZ_CP025268.1, 2299412, 2299621, -, 210, 0; cds-WP_001295447.1, NZ_CP025268.1, 2299618, 2300355, -, 738, 0; cds-WP_000971730.1, NZ_CP025268.1, 2300397, 2301059, -, 663, 1; cds-WP_000525587.1, NZ_CP025268.1, 2301056, 2301679, -, 624, 18867; cds-WP _000528376.1, NZ_CP025268.1, 2301692, 2302294, -, 603, 3; cds-WP _000835174.1, NZ_CP025268.1, 2302304, 2302753, -, 450, 0; cds-WP _000013515.1, NZ_CP025268.1, 2302750, 2303613, -, 864, 48407; cds-WP _000091291.1, NZ_CP025268.1, 2303600, 2304295, -, 696, 1987; cds-WP_000778061.1, NZ_CP025268.1, 2304302, 2306788, -, 2487, 0; cds-WP_000557378.1, NZ_CP025268.1, 2306785, 2307048, -, 264, 0; cds-WP_000686723.1, NZ_CP025268.1, 2307038, 2307532, -, 495, 0; cds-WP_001310984.1, NZ_CP025268.1, 2307641, 2307805, +, 165, 0; cds-WP _000849209.1, NZ_CP025268.1, 2307940, 2308428, +, 489, 3813; cds-WP _000758077.1, NZ_CP025268.1, 2309143, 2310789, -, 1647, 168934; cds-WP _000422182.1, NZ_CP025268.1, 2311007, 2312650, -, 1644, 461733; cds-WP _000884971.1, NZ_CP025268.1, 2312726, 2313376, -, 651, 0; cds-WP _000710375.1, NZ_CP025268.1, 2313376, 2314440, -, 1065, 382308; cds-WP _000406064.1, NZ_CP025268.1, 2314514, 2315569, -, 1056, 64199; cds-WP_000865568.1, NZ_CP025268.1, 2315681, 2316784, -, 1104, 2637154; cds-WP _001249081.1, NZ_CP025268.1, 2317523, 2320195, +, 2673, 880544; cds-WP _001061917.1, NZ_CP025268.1, 2320212, 2320862, +, 651, 107674; cds-WP_101348621.1, NZ_CP025268.1, 2321062, 2323911, -, 2850,137816; cds-WP_000559125.1, NZ_CP025268.1, 2324078, 2325904, +, 1827, 3; cds-WP_000125282.1, NZ_CP025268.1, 2325901, 2327286, +, 1386, 0; cds-WP _000850540.1, NZ_CP025268.1, 2327482, 2328144, +, 663, 0; cds-WP_000339065.1, NZ_CP025268.1, 2328144, 2328794, +, 651, 0; cds-WP_000580275.1, NZ_CP025268.1, 2328791, 2330113, +, 1323, 0; cds-WP _000786547.1, NZ_CP025268.1, 2330144, 2331328, +, 1185, 0; cds-WP_001225852.1, NZ_CP025268.1, 2331402, 2332178, -, 777, 0; cds-WP _001104549.1, NZ_CP025268.1, 2332183, 2333832, -, 1650, 0; cds-CXP41_RS12345, NZ_CP025268.1, 2333833, 2338347, -, 4515, 2; cds-WP_001295211.1, NZ_CP025268.1, 2338371, 2338994, -,624,0; cds-WP_000012305.1, NZ_CP025268.1, 2338991, 2340679, -, 1689, 6; cds-WP_001281242.1, NZ_CP025268.1, 2340828, 2343455, -, 2628, 1558803; cds-WP _000990765.1, NZ_CP025268.1, 2343602, 2344324, +, 723, 601; cds-WP_001220077.1, NZ_CP025268.1, 2344452, 2348204, -, 3753, 4319; cds-WP_001075164.1, NZ_CP025268.1, 2348900, 2351185, +, 2286, 1963785; cds-WP_211180501.1, NZ_CP025268.1, 2351385, 2351420, -, 36, 228887; cds-WP_000332037.1, NZ_CP025268.1, 2351419, 2352549, +, 1131,980744; cds-WP_000135040.1, NZ_CP025268.1, 2352549, 2352803, +, 255, 99236; cds-WP _000301050.1, NZ_CP025268.1, 2352857, 2353507, -, 651, 20470; cds-CXP41_RS12400, NZ_CP025268.1, 2353686, 2353928, +, 243, 0; cds-WP_000779105.1, NZ_CP025268.1, 2353970, 2355046, -, 1077, 0; cds-WP_000948731.1, NZ_CP025268.1, 2355051, 2356409, -, 1359, 0; cds-WP_000857257.1, NZ_CP025268.1, 2356682, 2358310, +, 1629, 282299; cds-WP _001209927.1, NZ_CP025268.1, 2358300, 2359559, +, 1260, 0; cds-WP_001000379.1, NZ_CP025268.1, 2359556, 2360746, +, 1191, 0; cds-WP_000140592.1, NZ_CP025268.1, 2360939, 2361838, +, 900, 33; cds-CXP41_RS12435, NZ_CP025268.1, 2361839, 2362036, +, 198, 886; cds-WP_088209894.1, NZ_CP025268.1, 2362077, 2362880, -, 804, 0; cds-WP_000100890.1, NZ_CP025268.1, 2362898, 2364187, -, 1290, 0; cds-WP_001319848.1, NZ_CP025268.1, 2364244, 2365449, -, 1206, 0; cds-WP_000894185.1, NZ_CP025268.1, 2365464, 2366246, -, 783, 0; cds-WP_000921621.1, NZ_CP025268.1, 2366466, 2367668, -, 1203, 142; cds-WP_001300392.1, NZ_CP025268.1, 2367768, 2368310, -, 543, 2; cds-WP _001300564.1, NZ_CP025268.1, 2368589, 2369014, +, 426, 0; cds-WP_000879112.1, NZ_CP025268.1, 2369053, 2369655, -, 603, 0; cds-WP _001295286.1, NZ_CP025268.1, 2369963, 2371102, +, 1140, 85081; cds-WP _000461657.1, NZ_CP025268.1, 2371106, 2372074, +, 969, 82; cds-WP_101348623.1, NZ_CP025268.1, 2372074, 2374065, +, 1992, 21; cds-WP_101348624.1, NZ_CP025268.1, 2374050, 2374943, +, 894, 0; cds-WP _000844057.1, NZ_CP025268.1, 2374943, 2376595, +, 1653, 13197; cds-WP _000638031.1, NZ_CP025268.1, 2376592, 2376927, +, 336, 9650; cds-WP_000523880.1, NZ_CP025268.1, 2376927, 2377313, +, 387, 1550; cds-WP_001295285.1, NZ_CP025268.1, 2377307, 2377573, -, 267, 0; cds-WP_000577625.1, NZ_CP025268.1, 2377683, 2379038, -, 1356, 49109; cds-WP_001255628.1, NZ_CP025268.1, 2379035, 2379997, -, 963, 26552; cds-WP_000639996.1, NZ_CP025268.1, 2379997, 2380854, -, 858, 360; cds-WP_000600499.1, NZ_CP025268.1, 2380869, 2381627, -, 759, 2006; cds-WP_001295284.1, NZ_CP025268.1, 2381624, 2383294, -, 1671, 234791; cds-WP _001191419.1, NZ_CP025268.1, 2383383, 2384678, -, 1296, 44341; cds-WP _000070621.1, NZ_CP025268.1, 2384757, 2385062, -, 306, 704; cds-WP_000574091.1, NZ_CP025268.1, 2385117,


2385578, -, 462, 1030; cds-WP _001300687.1, NZ_CP025268.1, 2385643, 2386560, +, 918, 119; cds-WP_001393504.1, NZ_CP025268.1, 2386748, 2387959, +, 1212, 551; cds-WP_001244806.1, NZ_CP025268.1, 2388030, 2389757, -, 1728, 0; cds-WP _000719999.1, NZ_CP025268.1, 2389895, 2390866, +, 972, 0; cds-WP _000525360.1, NZ_CP025268.1, 2390969, 2391472, +, 504, 0; cds-WP _000455114.1, NZ_CP025268.1, 2391745, 2392461, -, 717, 0; cds-WP_000188051.1, NZ_CP025268.1, 2392670, 2393092, +, 423, 0; cds-WP_000767280.1, NZ_CP025268.1, 2393151, 2393999, +, 849, 145549; cds-WP _000156701.1, NZ_CP025268.1, 2394083, 2395540, -, 1458, 403303; cds-WP _000926441.1, NZ_CP025268.1, 2395547, 2397076, -, 1530, 1119696; cds-WP _001056643.1, NZ_CP025268.1, 2397240, 2399081, -, 1842, 870993; cds-WP _000612644.1, NZ_CP025268.1, 2399078, 2399380, -, 303, 78787; cds-WP _000393511.1, NZ_CP025268.1, 2399377, 2399931, -, 555, 717066; cds-WP _000172749.1, NZ_CP025268.1, 2399943, 2400485, -, 543, 524948; cds-WP _000118507.1, NZ_CP025268.1, 2400500, 2401477, -, 978, 356088; cds-WP _000190939.1, NZ_CP025268.1, 2401474, 2404200, -, 2727, 1052505; cds-WP_000789500.1, NZ_CP025268.1, 2404253, 2405590, -, 1338, 795632; cds-WP _000545042.1, NZ_CP025268.1, 2405587, 2406087, -, 501, 238472; cds-WP _000247879.1, NZ_CP025268.1, 2406090, 2407892, -, 1803, 1213256; cds-WP _000386733.1, NZ_CP025268.1, 2407986, 2408648, -, 663, 385483; cds-WP _000062997.1, NZ_CP025268.1, 2408664, 2409107, -, 444, 269829; cds-WP_000622280.1, NZ_CP025268.1, 2409738, 2410676, -, 939, 47; cds-WP_000074527.1, NZ_CP025268.1, 2411596, 2412813, +, 1218, 509011; cds-WP_000813859.1, NZ_CP025268.1, 2412897, 2413496, +, 600, 0; cds-WP_001012899.1, NZ_CP025268.1, 2413555, 2415387, -, 1833, 182569; cds-WP _001203392.1, NZ_CP025268.1, 2415474, 2416124, -, 651, 37325; cds-WP _000426124.1, NZ_CP025268.1, 2416135, 2416629, -, 495, 8055; cds-WP_000106627.1, NZ_CP025268.1, 2416712, 2417167, -, 456, 91; cds-WP_000095707.1, NZ_CP025268.1, 2417505, 2418707, +, 1203, 722010; cds-WP_101348625.1, NZ_CP025268.1, 2418782, 2420926, +, 2145, 2101037; cds-WP_001274493.1, NZ_CP025268.1, 2421116, 2422636, +, 1521, 247146; cds-WP _000437935.1, NZ_CP025268.1, 2422669, 2423211, -, 543, 17927; cds-WP _000772452.1, NZ_CP025268.1, 2423269, 2423820, -, 552, 7903; cds-WP _000042442.1, NZ_CP025268.1, 2423876, 2424520, -, 645, 0; cds-WP_000566471.1, NZ_CP025268.1, 2424656, 2425303, +, 648, 0; cds-WP _000068457.1, NZ_CP025268.1, 2425360, 2425722, +, 363, 1174; cds-WP_001028341.1, NZ_CP025268.1, 2425743, 2426636, +, 894, 0; cds-WP _000156149.1, NZ_CP025268.1, 2426684, 2427574, -, 891, 2555; cds-WP_001293613.1, NZ_CP025268.1, 2427771, 2428544, -, 774, 46659; cds-WP_000569958.1, NZ_CP025268.1, 2428552, 2429268, -, 717, 5905; cds-WP _000965522.1, NZ_CP025268.1, 2429265, 2429951, -, 687, 233; cds-WP_000737621.1, NZ_CP025268.1, 2430041, 2430823, -, 783, 44; cds-WP_000748271.1, NZ_CP025268.1, 2431044, 2431826, -, 783, 125786; cds-WP _000825700.1, NZ_CP025268.1, 2432092, 2432661, -, 570, 24557; cds-WP _000334220.1, NZ_CP025268.1, 2432756, 2434273, -, 1518, 165527; cds-WP _000262111.1, NZ_CP025268.1, 2434310, 2434798, -, 489, 64623; cds-WP _000146992.1, NZ_CP025268.1, 2435057, 2435719, -, 663, 5851; cds-WP_000584546.1, NZ_CP025268.1, 2435709, 2436977, -, 1269, 381005; cds-WP_000118404.1, NZ_CP025268.1, 2437047, 2437961, -, 915, 210550; cds-WP_000364335.1, NZ_CP025268.1, 2438117, 2438776, -, 660, 12788; cds-WP_001283586.1, NZ_CP025268.1, 2438859, 2439671, -, 813, 143221; cds-WP _001289167.1, NZ_CP025268.1, 2439671, 2440684, -, 1014, 264232; cds-WP _000699148.1, NZ_CP025268.1, 2440750, 2441886, -, 1137, 283618; cds-WP_101348626.1, NZ_CP025268.1, 2441985, 2442980, +, 996, 5946; cds-WP _000127781.1, NZ_CP025268.1, 2442977, 2444155, -, 1179, 12888; cds-WP_000817178.1, NZ_CP025268.1, 2444420, 2445640, -, 1221, 2255396; cds-WP _000683799.1, NZ_CP025268.1, 2445799, 2447805, +, 2007, 27905; cds-WP_000559764.1, NZ_CP025268.1, 2447926, 2448204, -, 279, 107; cds-WP_001089222.1, NZ_CP025268.1, 2448238, 2448786, -, 549, 79979; cds-WP_000447361.1, NZ_CP025268.1, 2448786, 2449595, -, 810, 262905; cds-WP _001043825.1, NZ_CP025268.1, 2449595, 2450419, -, 825, 191488; cds-WP_001333535.1, NZ_CP025268.1, 2450423, 2451508, -, 1086, 174988; cds-WP_001300582.1, NZ_CP025268.1, 2451543, 2452475, -, 933, 124918; cds-WP_000730806.1, NZ_CP025268.1, 2452641, 2453192, +, 552, 10218; cds-WP_000698745.1, NZ_CP025268.1, 2453263, 2454084, -, 822, 13901; cds-WP_001043398.1, NZ_CP025268.1, 2454086, 2454625, -, 540, 1; cds-WP _001232541.1, NZ_CP025268.1, 2454622, 2455110, -, 489, 0; cds-WP_001311011.1, NZ_CP025268.1, 2455107, 2455619, -, 513, 0; cds-WP _001281606.1, NZ_CP025268.1, 2455619, 2456371, -, 753, 0; cds-CXP41_RS12915, NZ_CP025268.1, 2456391, 2459036, -, 2646, 19; cds-WP_000033316.1, NZ_CP025268.1, 2459118, 2459681, -, 564, 0; cds-WP _001195819.1, NZ_CP025268.1, 2460362, 2460847, -, 486, 0; cds-WP_000426176.1, NZ_CP025268.1, 2461050, 2463194, -, 2145, 0; cds-WP _000531952.1, NZ_CP025268.1, 2463194, 2464504, -, 1311, 0; cds-WP _001296261.1, NZ_CP025268.1, 2464685, 2464969, -, 285, 303; cds-WP_001295701.1, NZ_CP025268.1, 2465341, 2466681, +, 1341, 246832; cds-WP_000937788.1, NZ_CP025268.1, 2467046, 2468104, +, 1059, 335; cds-WP _000776765.1, NZ_CP025268.1, 2468286, 2469041, -, 756, 746; cds-WP_000368140.1, NZ_CP025268.1, 2469335, 2470267, +, 933, 0; cds-WP _000958671.1, NZ_CP025268.1, 2470579, 2471736, +, 1158, 33243; cds-WP _000915541.1, NZ_CP025268.1, 2471889, 2472251, +, 363, 318; cds-WP _000703651.1, NZ_CP025268.1, 2472248, 2473168, +, 921, 166932; cds-WP_001030215.1, NZ_CP025268.1, 2473165, 2474496, +, 1332, 19807; cds-WP_211180502.1, NZ_CP025268.1, 2474531, 2474677, -, 147, 27; cds-CXP41_RS13005, NZ_CP025268.1, 2474849, 2475139, +, 291, 6; cds-WP_101348627.1, NZ_CP025268.1, 2475111, 2475551, -, 441, 0; cds-WP_011443597.1, NZ_CP025268.1, 2475578, 2476096, -, 519, 0; cds-WP_000066913.1, NZ_CP025268.1, 2476146, 2476421, -, 276, 0; cds-WP_001393497.1, NZ_CP025268.1, 2476421, 2476915, -, 495, 0; cds-CXP41_RS24380, NZ_CP025268.1, 2476912, 2477619, -, 708, 0; cds-WP_000135673.1, NZ_CP025268.1, 2477638, 2478000, +, 363, 0; cds-WP_000081278.1, NZ_CP025268.1, 2478066, 2478890, +, 825, 0; cds-WP _000008183.1, NZ_CP025268.1, 2479018, 2479554, +, 537, 0; cds-WP _001242717.1, NZ_CP025268.1, 2479545, 2479907, +, 363, 901; cds-WP _000206809.1, NZ_CP025268.1, 2479907, 2480212, +, 306, 0; cds-WP_001163428.1, NZ_CP025268.1, 2480344, 2480544, +, 201, 0; cds-WP _001326971.1, NZ_CP025268.1, 2480728, 2481663, -, 936, 0; cds-WP_000556048.1, NZ_CP025268.1, 2481881, 2483218, +, 1338, 0; cds-WP_000426427.1, NZ_CP025268.1, 2483236, 2484564, +, 1329, 528; cds-WP _001018714.1, NZ_CP025268.1, 2484672, 2486210, -, 1539, 0; cds-WP _000435167.1, NZ_CP025268.1, 2486210, 2487373, -, 1164, 0; cds-WP _000991370.1, NZ_CP025268.1, 2487789, 2488403, +, 615, 30494; cds-CXP41_RS13095, NZ_CP025268.1, 2488408, 2492002, +, 3595, 107925; cds-WP_001296867.1, NZ_CP025268.1, 2492058, 2493203, -, 1146, 1; cds-WP_000955028.1, NZ_CP025268.1, 2493277, 2494221, -, 945, 0; cds-WP_001283490.1, NZ_CP025268.1, 2494291, 2495985, -, 1695, 0; cds-WP_000106759.1, NZ_CP025268.1, 2496039, 2497289, -, 1251, 0; cds-WP _000825600.1, NZ_CP025268.1, 2497802, 2498437, -, 636, 12; cds-WP_101348628.1, NZ_CP025268.1, 2498733, 2499008, +, 276, 0; cds-WP_000609275.1, NZ_CP025268.1, 2499085, 2499327, -, 243, 0; cds-WP _000484404.1, NZ_CP025268.1, 2499680, 2500600, +, 921, 33118; cds-WP _010723117.1, NZ_CP025268.1, 2500956, 2501027, +, 72, 0; cds-WP_000785931.1, NZ_CP025268.1, 2501092, 2502330, -, 1239, 294138; cds-WP_000544359.1, NZ_CP025268.1, 2502706, 2504403, +, 1698, 17; cds-WP _001295458.1, NZ_CP025268.1, 2504418, 2505152, +, 735, 11560; cds-WP _000646835.1, NZ_CP025268.1, 2505165, 2506022, +, 858, 24; cds-WP_000955906.1, NZ_CP025268.1, 2506025, 2508520, -, 2496, 0; cds-WP _000366028.1, NZ_CP025268.1, 2508545, 2509582, -, 1038, 0; cds-WP_000173288.1, NZ_CP025268.1, 2509582, 2510667, -, 1086, 0; cds-WP _000985359.1, NZ_CP025268.1, 2510682, 2511929, -, 1248, 0; cds-WP _000038456.1, NZ_CP025268.1, 2511951, 2512277, -, 327, 0; cds-WP_000170346.1, NZ_CP025268.1, 2512496, 2513461, -, 966, 904; cds-WP _000903148.1, NZ_CP025268.1, 2513665, 2514921, +, 1257, 3091; cds-WP _000490072.1, NZ_CP025268.1, 2515036, 2515362, +, 327, 73291; cds-WP _000186369.1, NZ_CP025268.1, 2515503, 2516741, -, 1239, 1900; cds-WP _000376337.1, NZ_CP025268.1, 2517077, 2518279, +, 1203, 96487; cds-WP_001300563.1-3, NZ_CP025268.1, 2518366, 2519478, +, 1113, 87645; cds-WP_0004974001, NZ_CP025268.1, 2519678, 2521867, -, 2190, 131624; cds-WP _000472021.1, NZ_CP025268.1, 2522487, 2522846, +, 360, 1698; cds-WP_000826503.1, NZ_CP025268.1, 2522848, 2523240, +, 393, 52588; cds-WP _000695655.1, NZ_CP025268.1, 2523292, 2524707, -, 1416, 481505; cds-WP_101348629.1, NZ_CP025268.1, 2525628, 2526512, -, 885, 221; cds-WP_000651752.1, NZ_CP025268.1, 2526553, 2526711, -, 159, 0; cds-WP_000020402.1, NZ_CP025268.1, 2526764, 2528020, -, 1257, 0; cds-WP_000084573.1, NZ_CP025268.1, 2528080, 2528913, -, 834, 0; cds-WP_000716421.1, NZ_CP025268.1, 2529162, 2529926, +, 765, 0; cds-WP_001109794.1, NZ_CP025268.1, 2529956, 2530882, -, 927, 0; cds-WP _000765610.1, NZ_CP025268.1, 2530972, 2531970, +, 999, 32; cds-WP _000410201.1, NZ_CP025268.1, 2531967, 2532185, -, 219, 0; cds-WP_000443661.1, NZ_CP025268.1, 2532187, 2534202, -, 2016, 48993; cds-WP_001300494.1, NZ_CP025268.1, 2534273, 2535259, -, 987, 23384; cds-WP_000254839.1, NZ_CP025268.1, 2535489, 2536250, +, 762, 15; cds-WP _000034402.1, NZ_CP025268.1, 2536435, 2537406, +, 972, 130076; cds-WP_000487600.1, NZ_CP025268.1, 2537790, 2538047, +, 258, 251220; cds-WP_000623140.1, NZ_CP025268.1, 2538092, 2539819, +, 1728, 2613075; cds-WP_000522247.1, NZ_CP025268.1, 2539860, 2540369, +, 510, 652770; cds-WP_000096674.1, NZ_CP025268.1, 2540412, 2541263, -, 852,12; cds-WP_000719962.1, NZ_CP025268.1, 2541368, 2541742, +, 375, 815; cds-WP_000745534.1, NZ_CP025268.1, 2541775, 2542509, +, 735, 35406; cds-WP _001336044.1, NZ_CP025268.1, 2542698, 2543609, -, 912, 1333; cds-WP_000021036.1, NZ_CP025268.1, 2543743, 2544840, -, 1098, 22; cds-WP _000852686.1, NZ_CP025268.1, 2544830, 2545705, -, 876, 351; cds-WP_000458406.1, NZ_CP025268.1, 2545705, 2546538, -, 834, 0; cds-WP _000290230.1, NZ_CP025268.1, 2546538, 2547554, -, 1017, 32; cds-WP_000517431.1, NZ_CP025268.1, 2547858, 2548649, -, 792, 6405; cds-WP_000966470.1, NZ_CP025268.1, 2548778, 2549635, -, 858, 15; cds-WP_001159160.1, NZ_CP025268.1, 2549799, 2550695, +, 897, 0; cds-WP_001040483.1, NZ_CP025268.1, 2550699, 2552123, +, 1425, 54231; cds-WP_001327042.1, NZ_CP025268.1, 2552128, 2553432, +, 1305, 140; cds-WP_001350538.1, NZ_CP025268.1, 2553672, 2554571, -, 900, 9; cds-WP _000838944.1, NZ_CP025268.1, 2554667, 2555242, -, 576, 16107; cds-WP _001350539.1, NZ_CP025268.1, 2555303, 2555752, -, 450, 678; cds-WP _000405996.1, NZ_CP025268.1, 2555739, 2556164, -, 426, 4521; cds-WP _000102886.1, NZ_CP025268.1, 2556378, 2557247, +, 870, 1091; cds-WP _000801365.1, NZ_CP025268.1, 2557251, 2558150, +, 900, 184859; cds-WP_000753690.1, NZ_CP025268.1, 2558156, 2559208, -, 1053, 0; cds-WP_000606257.1, NZ_CP025268.1, 2559254, 2559754, -, 501, 0; cds-WP _001111023.1, NZ_CP025268.1, 2559767, 2560426, -, 660, 0; cds-WP_000372316.1, NZ_CP025268.1, 2560436, 2561323, -, 888, 36890; cds-WP_000769961.1, NZ_CP025268.1, 2561344, 2562705, -, 1362, 12645; cds-WP_000047773.1, NZ_CP025268.1, 2562884, 2564092, +, 1209, 24217; cds-WP _000458337.1, NZ_CP025268.1, 2564283, 2564924, +, 642, 1887; cds-WP_010723122.1, NZ_CP025268.1, 2565394, 2565639, +, 246, 0; cds-WP _000683389.1, NZ_CP025268.1, 2565651, 2566019, +, 369, 0; cds-WP _000398186.1, NZ_CP025268.1, 2566137, 2566553, +, 417, 0; cds-WP _000052882.1, NZ_CP025268.1, 2566550, 2567143, +, 594, 0; cds-WP _000770705.1, NZ_CP025268.1, 2567618, 2567995, +, 378, 0; cds-WP_000865921.1, NZ_CP025268.1, 2568006, 2568398, +, 393, 0; cds-WP _010723125.1, NZ_CP025268.1, 2568549, 2569358, +, 810, 8; cds-WP_001097542.1, NZ_CP025268.1, 2569507, 2570910, -, 1404, 0; cds-WP_000512372.1, NZ_CP025268.1, 2570907, 2572133, -, 1227, 1; cds-WP _001326575.1, NZ_CP025268.1, 2572350, 2573537, -, 1188, 0; cds-WP _000929729.1, NZ_CP025268.1, 2573527, 2574363, -, 837, 0; cds-WP _001075716.1, NZ_CP025268.1, 2574374, 2575777, -, 1404, 0; cds-WP_000762196.1, NZ_CP025268.1, 2575789, 2576076, -, 288, 0; cds-WP _000387713.1, NZ_CP025268.1, 2576183, 2576476, -,


294, 0; cds-WP _000582977.1, NZ_CP025268.1, 2576515, 2577531, -, 1017, 0; cds-WP_000651298.1, NZ_CP025268.1, 2577528, 2578331, -, 804, 0; cds-WP_000733906.1, NZ_CP025268.1, 2578328, 2579029, -, 702, 0; cds-WP_000820763.1, NZ_CP025268.1, 2579004, 2579483, -, 480, 0; cds-WP_000356956.1, NZ_CP025268.1, 2579496, 2579831, -, 336, 0; cds-WP_000342644.1, NZ_CP025268.1, 2580124, 2582403, -, 2280, 231; cds-WP_001003709.1, NZ_CP025268.1, 2582692, 2583642, +, 951, 0; cds-WP _000087280.1, NZ_CP025268.1, 2583662, 2585665, +, 2004, 39200; cds-WP _001270542.1, NZ_CP025268.1, 2585760, 2586803, -, 1044, 2185; cds-WP _001300814.1, NZ_CP025268.1, 2586929, 2587504, -, 576, 2; cds-WP _001078880.1, NZ_CP025268.1, 2587572, 2589551, -, 1980, 0; cds-WP_001300881.1, NZ_CP025268.1, 2589757, 2591457, +, 1701, 16492; cds-WP_001273151.1, NZ_CP025268.1, 2591621, 2594734, +, 3114, 116306; cds-WP _001386977.1, NZ_CP025268.1, 2594833, 2594892, -, 60, 3003; cds-WP _000258236.1, NZ_CP025268.1, 2595273, 2595629, +, 357, 173; cds-WP _001277801.1, NZ_CP025268.1, 2595633, 2596760, +, 1128, 12471; cds-WP _000383836.1, NZ_CP025268.1, 2596788, 2596988, +, 201, 425; cds-WP_000679799.1, NZ_CP025268.1, 2597098, 2597796, -, 699, 10436; cds-WP_000829360.1, NZ_CP025268.1, 2597870, 2599885, -, 2016, 67780; cds-WP_001267498.1, NZ_CP025268.1, 2599900, 2600763, -, 864, 68787; cds-WP _001295467.1, NZ_CP025268.1, 2600931, 2601644, -, 714, 17026; cds-WP _001297320.1, NZ_CP025268.1, 2601857, 2602891, -, 1035, 289039; cds-WP_001311023.1, NZ_CP025268.1, 2602908, 2603786, -, 879, 382737; cds-WP_000176187.1, NZ_CP025268.1, 2603932, 2604504, +, 573, 29; cds-CXP41_RS13680, NZ_CP025268.1, 2604504, 2604975, +, 472, 246; cds-WP _001336048.1, NZ_CP025268.1, 2605228, 2605845, +, 618, 254; cds-WP_000339455.1, NZ_CP025268.1, 2605845, 2607863, +, 2019, 1; cds-WP_001311024.1, NZ_CP025268.1, 2607874, 2608821, +, 948, 0; cds-WP _000429104.1, NZ_CP025268.1, 2608838, 2610277, +, 1440, 0; cds-WP _000147987.1, NZ_CP025268.1, 2610289, 2610939, +, 651, 0; cds-WP _000122577.1, NZ_CP025268.1, 2610944, 2612524, +, 1581, 0; cds-WP_001102321.1, NZ_CP025268.1, 2612514, 2614181, +, 1668, 0; cds-WP_000916055.1, NZ_CP025268.1, 2614191, 2614736, +, 546, 0; cds-WP _000075558.1, NZ_CP025268.1, 2614733, 2615491, +, 759, 0; cds-WP_001326580.1, NZ_CP025268.1, 2615484, 2615897, +, 414, 0; cds-WP _001251544.1, NZ_CP025268.1, 2615927, 2617939, +, 2013, 47893; cds-WP_101348630.1, NZ_CP025268.1, 2617961, 2618806, +, 846, 42464; cds-WP_000892044.1, NZ_CP025268.1, 2618844, 2619905, -, 1062, 218445; cds-WP _000489667.1, NZ_CP025268.1, 2620118, 2621581, +, 1464, 89; cds-WP _000166446.1, NZ_CP025268.1, 2621602, 2621961, +, 360, 7; cds-WP _001307333.1, NZ_CP025268.1, 2622099, 2622800, -, 702, 66541; cds-WP _000198328.1, NZ_CP025268.1, 2622895, 2624184, -, 1290, 22452; cds-WP _001295473.1, NZ_CP025268.1, 2624270, 2624896, -, 627, 142515; cds-WP_001336050.1, NZ_CP025268.1, 2625221, 2626258, +, 1038, 32620; cds-WP _001028612.1, NZ_CP025268.1, 2626258, 2626896, +, 639, 25350; cds-WP _000529576.1, NZ_CP025268.1, 2627068, 2629134, +, 2067, 486415; cds-WP _001121363.1, NZ_CP025268.1, 2629139, 2630680, +, 1542, 399875; cds-WP _000772731.1, NZ_CP025268.1, 2630719, 2632962, -, 2244, 106861; cds-WP _000017552.1, NZ_CP025268.1, 2633144, 2633296, -, 153, 0; cds-WP_000076001.1, NZ_CP025268.1, 2633314, 2633505, +, 192, 149; cds-WP_001295476.1, NZ_CP025268.1, 2633816, 2634334, +, 519, 2; cds-WP_000755173.1, NZ_CP025268.1, 2634350, 2634889, +, 540, 219; cds-WP _000138270.1, NZ_CP025268.1, 2634982, 2636559, -, 1578, 1854312; cds-WP _001299507.1, NZ_CP025268.1, 2636628, 2638094, -, 1467, 633481; cds-WP _000937912.1, NZ_CP025268.1, 2638256, 2639626, +, 1371, 115550; cds-WP _001301158.1, NZ_CP025268.1, 2639623, 2639838, -, 216, 48464; cds-WP_101348631.1, NZ_CP025268.1, 2639908, 2641380, -, 1473, 681902; cds-WP_001177052.1, NZ_CP025268.1, 2641498, 2642676, -, 1179, 102626; cds-WP _000409205.1, NZ_CP025268.1, 2642687, 2643307, -, 621, 160236; cds-WP_001107167.1, NZ_CP025268.1, 2643325, 2644599, -, 1275, 1102527; cds-WP _000551807.1, NZ_CP025268.1, 2644710, 2645828, -, 1119, 139521; cds-WP _001090866.1, NZ_CP025268.1, 2645855, 2646868, -, 1014, 117721; cds-WP_000003317.1, NZ_CP025268.1, 2647153, 2648307, -, 1155, 23286; cds-WP _000963837.1, NZ_CP025268.1, 2648457, 2648888, -, 432, 24175; cds-WP_001137675.1, NZ_CP025268.1, 2649037, 2651349, -, 2313, 185542; cds-WP_101348632.1, NZ_CP025268.1, 2651350, 2656311, -, 4962, 70; cds-WP_000108626.1, NZ_CP025268.1, 2656518, 2657363, +, 846, 782; cds-WP _001295479.1, NZ_CP025268.1, 2658181, 2658957, -, 777, 89371; cds-WP_101348633.1, NZ_CP025268.1, 2659099, 2660382, -, 1284, 76601; cds-WP _000523616.1, NZ_CP025268.1, 2660560, 2660760, -, 201, 97472; cds-WP_001124469.1, NZ_CP025268.1, 2660772, 2661107, -, 336, 229194; cds-WP_001196613.1, NZ_CP025268.1, 2661109, 2662959, -, 1851, 107307; cds-WP _000384413.1, NZ_CP025268.1, 2662976, 2663491, -, 516, 574240; cds-WP_000028953.1, NZ_CP025268.1, 2663587, 2663910, -, 324, 141560; cds-WP_000331707.1, NZ_CP025268.1, 2663927, 2664313, -, 387, 57309; cds-WP _001295373.1, NZ_CP025268.1, 2664341, 2665555, -, 1215, 1576250; cds-WP_001241357.1, NZ_CP025268.1, 2665667, 2666155, -, 489, 46328; cds-WP_000940019.1, NZ_CP025268.1, 2666607, 2667347, -, 741, 117591; cds-WP_000553451.1, NZ_CP025268.1, 2667466, 2668269, +, 804, 376167; cds-WP_001297705.1, NZ_CP025268.1, 2668414, 2669268, +, 855, 241865; cds-WP_000982994.1, NZ_CP025268.1, 2669459, 2670739, +, 1281, 7; cds-WP_000244193.1, NZ_CP025268.1, 2670731, 2671870, -, 1140, 701; cds-WP _000423261.1, NZ_CP025268.1, 2672030, 2672920, -, 891, 0; cds-WP_000211172.1, NZ_CP025268.1, 2673056, 2674417, +, 1362, 0; cds-WP_001276072.1, NZ_CP025268.1, 2674414, 2674932, +, 519, 0; cds-WP_001080102.1, NZ_CP025268.1, 2674932, 2675252, +, 321, 0; cds-WP_001281379.1, NZ_CP025268.1, 2675249, 2676061, +, 813, 0; cds-WP _000660788.1, NZ_CP025268.1, 2676071, 2677273, +, 1203, 0; cds-WP_001094726.1, NZ_CP025268.1, 2677370, 2677792, +, 423, 0; cds-WP_000158547.1, NZ_CP025268.1, 2677840, 2678712, -, 873, 0; cds-WP_000700787.1, NZ_CP025268.1, 2678724, 2679818, -, 1095, 3; cds-WP _001276670.1, NZ_CP025268.1, 2679851, 2680849, -, 999, 0; cds-WP _000493470.1, NZ_CP025268.1, 2680874, 2682385, -, 1512, 0; cds-WP_001142427.1, NZ_CP025268.1, 2682408, 2683391, -, 984, 0; cds-WP_001333903.1, NZ_CP025268.1, 2683488, 2686769, -, 3282, 0; cds-WP_001200769.1, NZ_CP025268.1, 2686887, 2688080, +, 1194, 11; cds-WP _000919159.1, NZ_CP025268.1, 2688278, 2689531, -, 1254, 59463; cds-WP_101348634.1, NZ_CP025268.1, 2689859, 2691049, +, 1191, 1; cds-WP_000717694.1, NZ_CP025268.1, 2691094, 2691432, -, 339, 773; cds-WP_001295369.1, NZ_CP025268.1, 2691493, 2692827, -, 1335, 3523; cds-WP _001215861.1, NZ_CP025268.1, 2692817, 2693530, -, 714, 366; cds-WP _001311037.1, NZ_CP025268.1, 2693695, 2695122, -, 1428, 87240; cds-WP_000970102.1, NZ_CP025268.1, 2695680, 2699567, -, 3888, 498552; cds-WP_000734212.1, NZ_CP025268.1, 2699825, 2701381, +, 1557, 24121; cds-WP_001297409.1, NZ_CP025268.1, 2701378, 2701881, -, 504, 5; cds-WP _000190655.1, NZ_CP025268.1, 2701939, 2702574, -, 636, 0; cds-WP_001013779.1, NZ_CP025268.1, 2702783, 2703631, +, 849, 0; cds-WP_001196283.1, NZ_CP025268.1, 2703687, 2703947, +, 261, 17; cds-WP_000128776.1, NZ_CP025268.1, 2704141, 2704221, -, 81, 4590; cds-WP_000986023.1, NZ_CP025268.1, 2704642, 2705022, -, 381, 21681; cds-WP_001297412.1, NZ_CP025268.1, 2705022, 2705753, -, 732, 214727; cds-WP _000399404.1, NZ_CP025268.1, 2705765, 2706493, -, 729, 58386; cds-WP _000020749.1, NZ_CP025268.1, 2706505, 2707410, -, 906, 302898; cds-WP_001068343.1, NZ_CP025268.1, 2707407, 2708087, -, 681, 650608; cds-WP_000002541.1, NZ_CP025268.1, 2708359, 2709333, -, 975, 616421; cds-WP_101348635.1, NZ_CP025268.1, 2709349, 2711148, -, 1800, 636521; cds-WP_000589068.1, NZ_CP025268.1, 2711346, 2711825, -, 480, 308714; cds-WP_000812053.1, NZ_CP025268.1, 2711822, 2712778, -, 957, 1166867; cds-WP _001168459.1, NZ_CP025268.1, 2712778, 2713428, -, 651, 1182023; cds-WP_001295364.1, NZ_CP025268.1, 2713461, 2714036, -, 576, 218293; cds-WP_001303621.1, NZ_CP025268.1, 2714033, 2714188, -, 156, 3; cds-WP _001094491.1, NZ_CP025268.1, 2714444, 2716066, +, 1623, 0; cds-WP _001295363.1, NZ_CP025268.1, 2716051, 2716788, -, 738, 247; cds-WP_101348636.1, NZ_CP025268.1, 2716920, 2718254, +, 1335, 81542; cds-WP_001300638.1, NZ_CP025268.1, 2718463, 2719344, -, 882, 13084; cds-WP _000189207.1, NZ_CP025268.1, 2719447, 2720034, +, 588, 0; cds-WP_000627807.1, NZ_CP025268.1, 2720090, 2720473, -, 384, 0; cds-WP_001262716.1, NZ_CP025268.1, 2720778, 2721467, +, 690,127; cds-WP_000997403.1, NZ_CP025268.1, 2721515, 2722552, -, 1038, 187613; cds-WP_001098726.1, NZ_CP025268.1, 2722759, 2723178, +, 420, 4; cds-WP _001300438.1, NZ_CP025268.1, 2723247, 2723945, +, 699, 7; cds-WP_000083005.1, NZ_CP025268.1, 2723977, 2726637, +, 2661, 40731; cds-WP_211180504.1, NZ_CP025268.1, 2726726, 2726767, +, 42, 3915; cds-WP_000949265.1, NZ_CP025268.1, 2726751, 2728106, +, 1356, 321450; cds-WP_001300818.1, NZ_CP025268.1, 2728152, 2728475, +, 324, 410892; cds-WP_000841103.1, NZ_CP025268.1, 2728472, 2729770, -, 1299, 1009147; cds-WP_001235102.1, NZ_CP025268.1, 2735624, 2738197, -, 2574, 568703; cds-WP _000040169.1, NZ_CP025268.1, 2738327, 2739058, -, 732, 55341; cds-WP _000079100.1, NZ_CP025268.1, 2739055, 2740035, -, 981, 212914; cds-WP_000197686.1, NZ_CP025268.1, 2740170, 2740907, +, 738, 166147; cds-WP_000178456.1, NZ_CP025268.1, 2741178, 2741519, +, 342, 154602; cds-WP_010723158.1, NZ_CP025268.1, 2741623, 2741670, +, 48, 25784; cds-WP_000200120.1, NZ_CP025268.1, 2741769, 2742929, +, 1161, 100613; cds-WP_000225229.1, NZ_CP025268.1, 2742972, 2744093, -, 1122, 7501; cds-WP_001168037.1, NZ_CP025268.1, 2744104, 2745174, -, 1071, 70; cds-WP_000976004.1, NZ_CP025268.1, 2745384, 2745749, +, 366, 0; cds-WP_001212391.1, NZ_CP025268.1, 2745899, 2746417, +, 519, 42; cds-WP_097519179.1, NZ_CP025268.1, 2746407, 2747633, +, 1227, 3853; cds-WP_000589847.1, NZ_CP025268.1, 2747649, 2748131, +, 483, 4254; cds-WP_000065253.1, NZ_CP025268.1, 2748207, 2748554, -, 348, 2311327; cds-WP_000264777.1, NZ_CP025268.1, 2748596, 2749363, -, 768, 6212154; cds-WP_000043335.1, NZ_CP025268.1, 2749394, 2749942, -, 549, 3145360; cds-WP_000256450.1, NZ_CP025268.1, 2749961, 2750209, -, 249, 407517; cds-WP_000460035.1, NZ_CP025268.1, 2750458, 2751819, -, 1362, 340057; cds-WP_001338897.1, NZ_CP025268.1, 2751986, 2752777, +, 792, 81934; cds-WP_010723175.1, NZ_CP025268.1, 2752798, 2754084, +, 1287, 15042; cds-WP_001393454.1, NZ_CP025268.1, 2754139, 2754732, -, 594, 184005; cds-WP_001059169.1, NZ_CP025268.1, 2754855, 2755733, +, 879, 281953; cds-WP _000880910.1, NZ_CP025268.1, 2755819, 2757480, +, 1662, 62592; cds-WP_001203437.1, NZ_CP025268.1, 2757629, 2757970, +, 342, 1832; cds-WP_001117838.1, NZ_CP025268.1, 2758032, 2758322, -, 291, 2; cds-WP _001300750.1, NZ_CP025268.1, 2758312, 2758749, -, 438, 62; cds-WP_000162574.1, NZ_CP025268.1, 2758920, 2759402, +, 483, 5962; cds-WP_000101723.1, NZ_CP025268.1, 2760183, 2761424, +, 1242, 18732; cds-WP_000510827.1, NZ_CP025268.1, 2761668, 2762624, -, 957, 0; cds-WP_001065343.1, NZ_CP025268.1, 2762668, 2762880, +, 213, 2; cds-WP_000481742.1, NZ_CP025268.1, 2763009, 2764418, +, 1410, 0; cds-WP_000220524.1, NZ_CP025268.1, 2764571, 2765197, +, 627, 0; cds-WP_000136402.1, NZ_CP025268.1, 2765375, 2767564, -, 2190, 666; cds-WP_000445380.1, NZ_CP025268.1, 2767561, 2769177, -, 1617, 24098; cds-WP_000502050.1, NZ_CP025268.1, 2769537, 2769800, -, 264, 0; cds-WP_000155570.1, NZ_CP025268.1, 2769941, 2771014, +, 1074, 185682; cds-WP _000461704.1, NZ_CP025268.1, 2771007, 2771378, +, 372, 85742; cds-WP_000787597.1, NZ_CP025268.1, 2771734, 2772597, +, 864, 2146; cds-WP _000197391.1, NZ_CP025268.1, 2772689, 2773510, +, 822, 0; cds-WP _000189409.1, NZ_CP025268.1, 2773726, 2774427, +, 702, 0; cds-WP _001144029.1, NZ_CP025268.1, 2774468, 2774704, +, 237, 0; cds-WP_000824222.1, NZ_CP025268.1, 2774704, 2775147, +, 444, 0; cds-WP_000702495.1, NZ_CP025268.1, 2775171, 2775638, +, 468, 0; cds-WP _000065803.1, NZ_CP025268.1, 2775863, 2776177, -, 315, 0; cds-CXP41_RS14535, NZ_CP025268.1, 2776190, 2777199, -, 1010, 1454; cds-WP_000896263.1, NZ_CP025268.1, 2777341, 2779044, +, 1704, 0; cds-CXP41_RS14545, NZ_CP025268.1, 2779616, 2779839, +, 224, 0; cds-WP_000211841.1, NZ_CP025268.1, 2779942, 2780400, +, 459, 0; cds-WP_001407480.1, NZ_CP025268.1,


2780409, 2780891, +, 483, 0; cds-WP_001395452.1, NZ_CP025268.1, 2780900, 2781100, +, 201, 5; cds-WP_000072690.1, NZ_CP025268.1, 2781138, 2781455, +, 318, 0; cds-WP_001094400.1, NZ_CP025268.1, 2781476, 2781805, +, 330, 0; cds-CXP41_RS14575, NZ_CP025268.1, 2782169, 2786748, -, 4580, 5; cds-WP_001120794.1, NZ_CP025268.1, 2786813, 2786932, -, 120, 0; cds-WP_071524906.1, NZ_CP025268.1, 2787087, 2787305, -, 219, 1657; cds-CXP41_RS24250, NZ_CP025268.1, 2787660, 2789033, -, 1374, 0; cds-CXP41_RS24390, NZ_CP025268.1, 2790419, 2792670, +, 2252, 0; cds-WP_000993126.1, NZ_CP025268.1, 2793006, 2793983, +, 978, 0; cds-WP_000271909.1, NZ_CP025268.1, 2794003, 2795271, +, 1269, 0; cds-WP_000772831.1, NZ_CP025268.1, 2795294, 2796742, +, 1449, 0; cds-WP_001087611.1, NZ_CP025268.1, 2796756, 2798036, +, 1281, 2316; cds-WP_001295173.1, NZ_CP025268.1, 2798274, 2799674, +, 1401, 1; cds-WP_077392725.1, NZ_CP025268.1, 2799695, 2800357, +, 663, 0; cds-WP_000522415.1, NZ_CP025268.1, 2800358, 2800807, -, 450, 0; cds-WP_101348637.1, NZ_CP025268.1, 2800891, 2801049, -, 159, 153; cds-WP_000137280.1, NZ_CP025268.1, 2801232, 2801531, +, 300, 0; cds-WP_001229442.1, NZ_CP025268.1, 2801541, 2802065, +, 525, 1; cds-WP_000115383.1, NZ_CP025268.1, 2802112, 2802516, -, 405, 6; cds-WP_000492656.1, NZ_CP025268.1, 2803185, 2803634, +, 450, 0; cds-WP_000281320.1, NZ_CP025268.1, 2803671, 2804015, -, 345, 0; cds-WP_001295174.1, NZ_CP025268.1, 2804167, 2804496, +, 330, 0; cds-WP_001223227.1, NZ_CP025268.1, 2804744, 2804989, +, 246, 24; cds-WP_000080947.1, NZ_CP025268.1, 2804986, 2805396, +, 411, 0; cds-WP_000246534.1, NZ_CP025268.1, 2805369, 2807513, +, 2145, 5527; cds-WP_000777969.1, NZ_CP025268.1, 2807523, 2808482, +, 960, 60517; cds-WP_000985494.1, NZ_CP025268.1, 2808836, 2810038, +, 1203, 1219492; cds-WP_000774988.1, NZ_CP025268.1, 2810031, 2811095, +, 1065, 496755; cds-WP_001216525.1, NZ_CP025268.1, 2811153, 2812145, +, 993, 371508; cds-CXP41_RS14730, NZ_CP025268.1, 2812337, 2813514, +, 1178, 45693; cds-WP_000445651.1, NZ_CP025268.1, 2813638, 2814375, +, 738, 83038; cds-WP_000119763.1, NZ_CP025268.1, 2814365, 2814700, +, 336, 4170; cds-WP_000378442.1, NZ_CP025268.1, 2814791, 2815321, +, 531, 67664; cds-WP_001326681.1, NZ_CP025268.1, 2815448, 2816620, +, 1173, 470; cds-WP_001295176.1, NZ_CP025268.1, 2816637, 2818175, +, 1539, 560146; cds-WP_001130211.1, NZ_CP025268.1, 2818239, 2818754, -, 516, 1545; cds-WP_000611804.1, NZ_CP025268.1, 2818904, 2820460, -, 1557, 178897; cds-WP_001287454.1, NZ_CP025268.1, 2820533, 2820961, -, 429, 53022; cds-WP_000273290.1, NZ_CP025268.1, 2820958, 2821524, -, 567, 7998; cds-WP_000906486.1, NZ_CP025268.1, 2822982, 2823167, -, 186, 76649; cds-WP_000047184.1, NZ_CP025268.1, 2823402, 2826032, -, 2631, 941092; cds-WP_000140508.1, NZ_CP025268.1, 2826160, 2826660, -, 501, 0; cds-WP_000963143.1, NZ_CP025268.1, 2826729, 2827790, -, 1062, 816627; cds-WP_000132231.1, NZ_CP025268.1, 2827870, 2828367, -, 498, 814; cds-CXP41_RS14830, NZ_CP025268.1, 2828517, 2829596, -, 1080, 104118; cds-WP_000573321.1, NZ_CP025268.1, 2829852, 2830415, +, 564, 0; cds-WP_000148878.1, NZ_CP025268.1, 2830412, 2831371, +, 960, 0; cds-WP_000216194.1, NZ_CP025268.1, 2831382, 2831753, +, 372, 270; cds-WP_001077358.1, NZ_CP025268.1, 2831757, 2832536, +, 780, 0; cds-WP_000252908.1, NZ_CP025268.1, 2832641, 2833000, +, 360, 0; cds-WP_000804550.1, NZ_CP025268.1, 2833067, 2833840, +, 774, 26; cds-WP_001287420.1, NZ_CP025268.1, 2833833, 2834798, +, 966, 6; cds-WP_000010749.1, NZ_CP025268.1, 2834795, 2836309, -, 1515, 72440; cds-WP_000029634.1, NZ_CP025268.1, 2836496, 2837935, +, 1440, 9763; cds-WP_000064752.1, NZ_CP025268.1, 2837932, 2839065, +, 1134, 12052; cds-WP_001107704.1, NZ_CP025268.1, 2839193, 2841445, -, 2253, 28; cds-WP_001078777.1, NZ_CP025268.1, 2841598, 2842125, -, 528, 0; cds-WP_001394680.1, NZ_CP025268.1, 2842274, 2843284, -, 1011, 2; cds-WP_001107828.1, NZ_CP025268.1, 2843544, 2845001, +, 1458, 0; cds-WP_000110363.1, NZ_CP025268.1, 2845010, 2846434, +, 1425, 146496; cds-WP_000132961.1, NZ_CP025268.1, 2846593, 2847063, -, 471,14; cds-WP_001291921.1, NZ_CP025268.1, 2847056, 2847466, -, 411, 0; cds-WP_000067392.1, NZ_CP025268.1, 2847463, 2848230, -, 768, 0; cds-WP_000493781.1, NZ_CP025268.1, 2848230, 2848772, -, 543, 0; cds-WP_001288122.1, NZ_CP025268.1, 2848782, 2850491, -, 1710, 6; cds-WP_000115224.1, NZ_CP025268.1, 2850509, 2851432, -, 924, 0; cds-WP_001274396.1, NZ_CP025268.1, 2851435, 2853261, -, 1827, 0; cds-WP_001079186.1, NZ_CP025268.1, 2853258, 2853869, -, 612, 0; cds-WP_000158056.1, NZ_CP025268.1, 2853994, 2854455, -, 462, 0; cds-WP_001299100.1, NZ_CP025268.1, 2854667, 2855017, +, 351, 0; cds-WP_000337665.1, NZ_CP025268.1, 2855021, 2855893, +, 873, 0; cds-WP_071342902.1, NZ_CP025268.1, 2855884, 2856156, +, 273, 44; cds-WP_001212985.1, NZ_CP025268.1, 2856156, 2857277, +, 1122, 0; cds-WP_001059922.1, NZ_CP025268.1, 2857274, 2858284, +, 1011, 0; cds-CXP41_RS14980, NZ_CP025268.1, 2858358, 2860435, +, 2078, 87; cds-WP_000015497.1, NZ_CP025268.1, 2860472, 2860825, -, 354, 4; cds-WP_000611932.1, NZ_CP025268.1, 2860902, 2861036, -, 135, 0; cds-WP_101348638.1, NZ_CP025268.1, 2861226, 2861600, +, 375, 0; cds-WP_001141337.1, NZ_CP025268.1, 2862069, 2862725, +, 657, 6700; cds-WP_001300386.1, NZ_CP025268.1, 2862775, 2863542, -, 768, 0; cds-WP_000848004.1, NZ_CP025268.1, 2863738, 2864646, +, 909, 0; cds-WP_001393459.1, NZ_CP025268.1, 2864643, 2865809, +, 1167, 0; cds-WP_001278994.1, NZ_CP025268.1, 2865901, 2866539, +, 639, 0; cds-WP_001136934.1, NZ_CP025268.1, 2866544, 2867320, +, 777, 0; cds-WP_000104441.1, NZ_CP025268.1, 2867409, 2868773, +, 1365, 5754; cds-WP_000081588.1, NZ_CP025268.1, 2868867, 2869859, -, 993, 17399; cds-WP_001272592.1, NZ_CP025268.1, 2869922, 2871061, -, 1140, 232423; cds-WP_000254708.1, NZ_CP025268.1, 2871201, 2871827, -, 627, 200532; cds-WP_001295182.1, NZ_CP025268.1, 2871821, 2872582, -, 762, 318959; cds-WP_000568943.1, NZ_CP025268.1, 2872563, 2873612, -, 1050, 9641; cds-WP_001219242.1, NZ_CP025268.1, 2873609, 2874088, -, 480, 536649; cds-WP_000246138.1, NZ_CP025268.1, 2874088, 2874798, -, 711, 620891; cds-WP_000517476.1, NZ_CP025268.1, 2874817, 2875128, -, 312, 149070; cds-WP_001246104.1, NZ_CP025268.1, 2875322, 2875645, -, 324, 5813; cds-WP_001173673.1, NZ_CP025268.1, 2875695, 2876300, -, 606, 2123; cds-WP_001090361.1, NZ_CP025268.1, 2876300, 2877727, -, 1428,9; cds-WP_000372108.1, NZ_CP025268.1, 2877729, 2878637, -, 909, 2; cds-WP_101348639.1, NZ_CP025268.1, 2878889, 2879926, +, 1038, 47120; cds-WP_001381369.1, NZ_CP025268.1, 2880877, 2881161, -, 285, 0; cds-WP_000220066.1, NZ_CP025268.1, 2881163, 2882080, -, 918, 0; cds-WP_000281400.1, NZ_CP025268.1, 2882096, 2882695, -, 600, 0; cds-WP_001334996.1, NZ_CP025268.1, 2882682, 2883356, -, 675, 0; cds-WP_000064450.1, NZ_CP025268.1, 2883359, 2884450, -, 1092, 4; cds-WP_000752800.1, NZ_CP025268.1, 2884463, 2884945, -, 483, 0; cds-WP_001050401.1, NZ_CP025268.1, 2884938, 2886446, -, 1509, 0; cds-WP_000433152.1, NZ_CP025268.1, 2886861, 2889527, -, 2667, 2; cds-WP_000039850.1, NZ_CP025268.1, 2889886, 2890620, -, 735, 5; cds-WP_001290679.1, NZ_CP025268.1, 2890695, 2892407, -, 1713, 0; cds-WP_000211913.1, NZ_CP025268.1, 2892407, 2894206, -, 1800, 21; cds-WP_000108294.1, NZ_CP025268.1, 2894525, 2894887, +, 363, 47464; cds-WP_001301334.1, NZ_CP025268.1, 2894965, 2896236, +, 1272, 165482; cds-WP_101348640.1, NZ_CP025268.1, 2896227, 2896484, +, 258, 51629; cds-WP_001130266.1, NZ_CP025268.1, 2896501, 2897076, +, 576, 50489; cds-WP_001299097.1, NZ_CP025268.1, 2897224, 2898084, -, 861, 6; cds-WP_001299652.1, NZ_CP025268.1, 2898081, 2898860, -, 780, 0; cds-WP_000147666.1, NZ_CP025268.1, 2898838, 2900247, -, 1410, 0; cds-WP_000059307.1, NZ_CP025268.1, 2900269, 2901723, -, 1455, 0; cds-WP_000021334.1, NZ_CP025268.1, 2901793, 2902578, -, 786, 0; cds-WP_001164544.1, NZ_CP025268.1, 2902897, 2904174, +, 1278, 0; cds-WP_000039688.1, NZ_CP025268.1, 2904201, 2905679, +, 1479, 0; cds-WP_001199973.1, NZ_CP025268.1, 2907052, 2907723, -, 672, 43919; cds-WP_001288228.1, NZ_CP025268.1, 2907862, 2908002, +, 141, 0; cds-WP_001268460.1, NZ_CP025268.1, 2908016, 2908888, +, 873, 2; cds-WP_000036723.1, NZ_CP025268.1, 2908948, 2910246, -, 1299, 1828361; cds-WP_000210878.1, NZ_CP025268.1, 2910334, 2911971, -, 1638, 918782; cds-WP_001071648.1, NZ_CP025268.1, 2912199, 2912990, -, 792, 56644; cds-WP_000254738.1, NZ_CP025268.1, 2913061, 2913396, -, 336, 60670; cds-WP_000581937.1, NZ_CP025268.1, 2913396, 2913644, -, 249, 203672; cds-WP_000226815.1, NZ_CP025268.1, 2913722, 2915956, -, 2235, 525863; cds-WP_000046812.1, NZ_CP025268.1, 2916004, 2917305, -, 1302, 7; cds-WP_101348641.1, NZ_CP025268.1, 2917362, 2920118, +, 2757, 251862; cds-WP_000098255.1, NZ_CP025268.1, 2920350, 2921690, -, 1341, 0; cds-WP_000235391.1, NZ_CP025268.1, 2921711, 2923051, -, 1341, 1; cds-WP_000097072.1, NZ_CP025268.1, 2923053, 2924405, -, 1353, 0; cds-WP_000807753.1, NZ_CP025268.1, 2924840, 2925289, -, 450, 77; cds-WP_000890001.1, NZ_CP025268.1, 2925307, 2926089, -, 783, 62; cds-WP_000206990.1, NZ_CP025268.1, 2926089, 2926418, -, 330, 70553; cds-WP_000342431.1, NZ_CP025268.1, 2927040, 2927585, -, 546, 9671; cds-WP_000100421.1, NZ_CP025268.1, 2927653, 2928501, +, 849, 2129; cds-WP_000627995.1, NZ_CP025268.1, 2928613, 2929977, +, 1365, 114465; cds-WP_000450476.1, NZ_CP025268.1, 2930534, 2931823, +, 1290, 1184005; cds-WP_000626422.1, NZ_CP025268.1, 2931881, 2933248, +, 1368, 519042; cds-WP_000268232.1, NZ_CP025268.1, 2933360, 2934115, +, 756, 12278; cds-WP_000013588.1, NZ_CP025268.1, 2934170, 2935318, -, 1149, 16063; cds-WP_000440781.1, NZ_CP025268.1, 2935346, 2935993, -, 648, 0; cds-WP_000528603.1, NZ_CP025268.1, 2936540, 2937856, +, 1317, 0; cds-WP_101348642.1, NZ_CP025268.1, 2937889, 2939664, +, 1776, 1139; cds-WP_101348643.1, NZ_CP025268.1, 2939773, 2941191, +, 1419, 0; cds-WP_000920840.1, NZ_CP025268.1, 2941193, 2941615, +, 423, 3; cds-WP_000642344.1, NZ_CP025268.1, 2941673, 2942404, +, 732, 1375; cds-WP_001045520.1, NZ_CP025268.1, 2942448, 2943548, -, 1101, 62756; cds-WP_000203905.1, NZ_CP025268.1, 2943541, 2943936, -, 396, 14224; cds-WP_000044401.1, NZ_CP025268.1, 2943955, 2944872, -, 918, 23085; cds-WP_000750398.1, NZ_CP025268.1, 2945223, 2945450, -, 228, 2178; cds-WP_001300698.1, NZ_CP025268.1, 2945642, 2946847, +, 1206, 25385; cds-WP_000184261.1, NZ_CP025268.1, 2946847, 2947290, +, 444, 29069; cds-WP_000117728.1, NZ_CP025268.1, 2947341, 2948147, -, 807, 738; cds-WP_000678646.1, NZ_CP025268.1, 2948386, 2949483, -, 1098, 225922; cds-WP_000016907.1, NZ_CP025268.1, 2950062, 2951315, -, 1254, 278483; cds-WP_000237947.1, NZ_CP025268.1, 2951547, 2952878, +, 1332, 50066; cds-WP_000775955.1, NZ_CP025268.1, 2952940, 2954766, -, 1827, 77459; cds-WP_001285993.1, NZ_CP025268.1, 2954766, 2958308, -, 3543, 349202; cds-WP_001138201.1, NZ_CP025268.1, 2958301, 2961189, -, 2889, 923499; cds-WP_000946938.1, NZ_CP025268.1, 2961365, 2964733, -, 3369, 73873; cds-WP_001276460.1, NZ_CP025268.1, 2964746, 2965069, -, 324, 3; cds-WP_001078376.1, NZ_CP025268.1, 2965054, 2965461, -, 408, 0; cds-WP_001144315.1, NZ_CP025268.1, 2965458, 2966021, -, 564, 0; cds-WP_000857051.1, NZ_CP025268.1, 2966012, 2966482, -, 471, 0; cds-WP_000816232.1, NZ_CP025268.1, 2966666, 2967460, -, 795, 207006; cds-WP_000204658.1, NZ_CP025268.1, 2967467, 2968342, -, 876, 61363; cds-WP_000957910.1, NZ_CP025268.1, 2968493, 2970739, -, 2247, 454341; cds-WP_000564489.1, NZ_CP025268.1, 2970752, 2971282, -, 531, 17362; cds-WP 000082201.1, NZ_CP025268.1, 2971967, 2972656, +, 690, 35; cds-WP_000895624.1, NZ_CP025268.1, 2972725, 2973438, +, 714, 49574; cds-WP_000758655.1, NZ_CP025268.1, 2973576, 2973794, +, 219, 68449; cds-WP_001199295.1, NZ_CP025268.1, 2973902, 2974942, +, 1041, 10; cds-WP_000004616.1, NZ_CP025268.1, 2974974, 2976167, -, 1194, 4420; cds-WP_000899054.1, NZ_CP025268.1, 2976160, 2978319, -, 2160, 55420; cds-WP_000201063.1, NZ_CP025268.1, 2978904, 2979935, +, 1032, 54; cds-WP_001120711.1, NZ_CP025268.1, 2979942, 2981204, -, 1263, 48528; cds-WP_101348644.1, NZ_CP025268.1, 2981326, 2982261, +, 936, 0; cds-WP_000848659.1, NZ_CP025268.1, 2982248, 2982940, -, 693, 2546; cds-WP_000256438.1, NZ_CP025268.1, 2983069, 2984487, -, 1419, 204; cds-WP_000603502.1, NZ_CP025268.1, 2984802, 2985563, -, 762, 0; cds-WP_101348645.1, NZ_CP025268.1, 2985593, 2986429, -, 837, 0; cds-WP_000656030.1, NZ_CP025268.1, 2986716, 2987897, -, 1182, 90; cds-WP_000065950.1, NZ_CP025268.1, 2988152, 2989381, +, 1230, 61266;


cds-WP _001336169.1, NZ_CP025268.1, 2989841, 2990473, +, 633, 372; cds-WP_001300710.1, NZ_CP025268.1, 2990807, 2991616, +, 810, 31301; cds-WP _000568339.1, NZ_CP025268.1, 2991609, 2992091, +, 483, 0; cds-WP_000655820.1, NZ_CP025268.1, 2992124, 2992204, -, 81, 0; cds-WP_000350612.1, NZ_CP025268.1, 2992240, 2992665, -, 426, 0; cds-WP _001333802.1, NZ_CP025268.1, 2992859, 2993305, +, 447, 0; cds-WP­_000102780.1, NZ_CP025268.1, 2993573, 2994064, +, 492, 0; cds-WP _000362702.1, NZ_CP025268.1, 2994399, 2995775, +, 1377, 0; cds-WP _000184091.1, NZ_CP025268.1, 2995943, 2996161, +, 219, 85; cds-WP _0013361671, NZ_CP025268.1, 2996244, 2996720, +, 477, 0; cds-CXP41_RS15625, NZ_CP025268.1, 2996765, 2997397, -, 633, 0; cds-WP _000606430.1, NZ_CP025268.1, 2997620, 2998051, -, 432, 0; cds-WP _001372633.1, NZ_CP025268.1, 2998054, 2998275, -, 222, 0; cds-CXP41_RS15645, NZ_CP025268.1, 2998268, 2998666, -, 399, 1562; cds-WP_088895425.1-4, NZ_CP025268.1;NZ_CP025268.1, 2998678;2999591, 2999591;2999906, -;-, 1229, 8180; cds-CXP41_RS15660, NZ_CP025268.1, 2999998, 3001134, -, 1137, 207; cds-WP _001301085.1, NZ_CP025268.1, 3001442, 3002197, -, 756, 0; cds-WP _000388150.1, NZ_CP025268.1, 3002612, 3004909, +, 2298, 1082; cds-WP_000459182.1, NZ_CP025268.1, 3004920, 3005798, +, 879, 0; cds-WP_001016605.1, NZ_CP025268.1, 3005795, 3006274, +, 480, 0; cds-WP_000417791.1, NZ_CP025268.1, 3006314, 3008092, -, 1779, 1; cds-WP _000859787.1, NZ_CP025268.1, 3008571, 3009758, +, 1188, 27; cds-WP _000110493.1, NZ_CP025268.1, 3009816, 3011012, +, 1197, 0; cds-WP_001107125.1, NZ_CP025268.1, 3011070, 3012281, +, 1212, 29; cds-WP_001264442.1, NZ_CP025268.1, 3012334, 3013719, +, 1386, 0; cds-WP_000037992.1, NZ_CP025268.1, 3013767, 3014699, +, 933, 0; cds-WP _001020381.1, NZ_CP025268.1, 3014919, 3016544, -, 1626, 0; cds-WP _001298920.1, NZ_CP025268.1, 3016591, 3017361, -, 771, 0; cds-WP_001272828.1, NZ_CP025268.1, 3017464, 3018042, +, 579, 0; cds-WP_000502395.1, NZ_CP025268.1, 3018364, 3021462, +, 3099, 0; cds-WP_000906252.1, NZ_CP025268.1, 3021465, 3022793, +, 1329, 0; cds-WP _000572462.1, NZ_CP025268.1, 3022844, 3023623, +, 780, 0; cds-WP_000583615.1, NZ_CP025268.1, 3023620, 3026490, +, 2871, 0; cds-WP_001280192.1, NZ_CP025268.1, 3026655, 3028055, +, 1401, 0; cds-WP _001336279.1, NZ_CP025268.1, 3028073, 3029389, +, 1317, 0; cds-WP _000012163.1, NZ_CP025268.1, 3029425, 3030792, +, 1368, 0; cds-WP _000838428.1, NZ_CP025268.1, 3030828, 3031316, -, 489, 22; cds-WP _001350545.1, NZ_CP025268.1, 3031316, 3033235, -, 1920, 0; cds-WP _001295374.1, NZ_CP025268.1, 3033671, 3035119, +, 1449, 49263; cds-WP_001010156.1, NZ_CP025268.1, 3035121, 3035246, +, 126, 0; cds-WP_120795390.1, NZ_CP025268.1, 3035243, 3035314, -, 72, 0; cds-WP _001192820.1, NZ_CP025268.1, 3035369, 3035917, +, 549, 17487; cds-WP _000003071.1, NZ_CP025268.1, 3035961, 3037478, -, 1518, 1378272; cds-WP _001701073.1, NZ_CP025268.1;NZ_CP025268.1, 3037488;3038512, 3038510;3038586, -;-, 1098, 1145535; cds-WP _000813200.1, NZ_CP025268.1, 3038677, 3040410, -, 1734, 216382; cds-WP_000715214.1, NZ_CP025268.1, 3040416, 3041126, -, 711, 93230; cds-WP _000806638.1, NZ_CP025268.1, 3041151, 3042047, -, 897, 11116; cds-WP _001055874.1, NZ_CP025268.1, 3042159, 3042680, +, 522, 54292; cds-WP _000244777.1, NZ_CP025268.1, 3042720, 3043127, -, 408, 71956; cds-WP _000354046.1, NZ_CP025268.1, 3043108, 3043374, -, 267, 101408; cds-WP _000886062.1, NZ_CP025268.1, 3043617, 3044597, +, 981, 28026; cds-WP _000250274.1, NZ_CP025268.1, 3044793, 3045452, -, 660, 94319; cds-WP_001182957.1, NZ_CP025268.1, 3045616, 3045927, -, 312, 3505; cds-WP _001336277.1, NZ_CP025268.1, 3045972, 3047405, +, 1434, 94899; cds-WP _000951964.1, NZ_CP025268.1, 3047462, 3048205, -, 744, 93; cds-WP _000195062.1, NZ_CP025268.1, 3048472, 3051345, -, 2874, 126198; cds-WP_001295377.1, NZ_CP025268.1, 3051464, 3051853, -, 390, 2; cds-WP _000068701.1, NZ_CP025268.1, 3051877, 3052971, -, 1095, 53; cds-WP_120795391.1, NZ_CP025268.1, 3053262, 3053345, +, 84, 0; cds-WP_001192229.1, NZ_CP025268.1, 3053419, 3054621, -, 1203, 611890; cds-WP _000111195.1, NZ_CP025268.1, 3054644, 3055822, -, 1179, 313724; cds-WP _001290136.1, NZ_CP025268.1, 3055819, 3057144, -, 1326, 87198; cds-WP_001295378.1, NZ_CP025268.1, 3057170, 3057748, -, 579, 221023; cds-WP _001276008.1, NZ_CP025268.1, 3057916, 3058245, +, 330, 348186; cds-WP_000192748.1, NZ_CP025268.1, 3058491, 3059093, +, 603, 200842; cds-WP _010723220.1, NZ_CP025268.1, 3059194, 3059253, -, 60, 0; cds-WP_001151604.1, NZ_CP025268.1, 3059482, 3060714, -, 1233, 32; cds-WP _000189743.1, NZ_CP025268.1, 3060970, 3061629, -, 660, 16; cds-WP_000545308.1, NZ_CP025268.1, 3061685, 3061915, -, 231, 0; cds-WP_000828351.1, NZ_CP025268.1, 3062057, 3062950, +, 894, 21890; cds-WP_101348647.1, NZ_CP025268.1, 3063154, 3065298, +, 2145, 0; cds-WP_000606525.1, NZ_CP025268.1, 3065291, 3066286, +, 996, 0; cds-WP_000122080.1, NZ_CP025268.1, 3066297, 3067082, +, 786, 0; cds-WP 000449965.1, NZ_CP025268.1, 3067106, 3068584, +, 1479, 26; cds-WP _000350807.1, NZ_CP025268.1, 3068581, 3069477, -, 897, 1; cds-WP_000669834.1, NZ_CP025268.1, 3069644, 3070384, -, 741, 34709; cds-WP_000493352.1, NZ_CP025268.1, 3070477, 3071112, -, 636, 4; cds-WP _000389818.1, NZ_CP025268.1, 3071251, 3072111, -, 861, 2849; cds-WP _000034372.1, NZ_CP025268.1, 3072469, 3073548, -, 1080, 2054720; cds-WP _000111269.1, NZ_CP025268.1, 3073763, 3074926, -, 1164, 1574310; cds-WP _000218480.1, NZ_CP025268.1, 3074976, 3075995, -, 1020, 63675; cds-WP _000687705.1, NZ_CP025268.1, 3076280, 3076993, -, 714, 1901; cds-WP _000224147.1, NZ_CP025268.1, 3076990, 3077499, -, 510, 24562; cds-WP_000987283.1, NZ_CP025268.1, 3077521, 3078486, -, 966, 0; cds-WP_000853247.1, NZ_CP025268.1, 3078483, 3079760, -, 1278, 7; cds-WP_101348648.1, NZ_CP025268.1, 3079775, 3081163, -, 1389, 0; cds-WP_001239650.1, NZ_CP025268.1, 3081191, 3081634, -, 444, 0; cds-WP _000098614.1, NZ_CP025268.1, 3081948, 3083939, -, 1992, 1740431; cds-WP _001326497.1, NZ_CP025268.1, 3084217, 3084975, +, 759, 171; cds-WP_101348649.1, NZ_CP025268.1, 3085181, 3086101, -, 921, 229307; cds-WP_101348650.1, NZ_CP025268.1, 3086239, 3088215, -, 1977, 237048; cds-WP _001297406.1, NZ_CP025268.1, 3088224, 3088355, -, 132, 23014; cds-WP _001303650.1, NZ_CP025268.1, 3088491, 3088706, +, 216, 14109; cds-WP_001062128.1, NZ_CP025268.1, 3089010, 3090164, +, 1155, 464510; cds-WP_001112301.1, NZ_CP025268.1, 3090588, 3091982, +, 1395, 1; cds-WP_001300769.1, NZ_CP025268.1, 3092059, 3092556, +, 498, 167; cds-WP _000286500.1, NZ_CP025268.1, 3092651, 3093358, +, 708, 6672; cds-WP_001222509.1, NZ_CP025268.1, 3093438, 3094169, +, 732, 51; cds-WP_000593273.1, NZ_CP025268.1, 3094182, 3095132, +, 951, 50440; cds-WP _001053178.1, NZ_CP025268.1, 3095241, 3095804, +, 564, 161205; cds-WP_000017106.1, NZ_CP025268.1, 3095804, 3096220, +, 417, 22817; cds-WP_101348651.1, NZ_CP025268.1, 3096404, 3097384, -, 981, 191; cds-WP _000997795.1, NZ_CP025268.1, 3097402, 3098106, +, 705, 4937; cds-WP_001094831.1, NZ_CP025268.1, 3098124, 3098690, +, 567, 26149; cds-WP-_000994920.1, NZ_CP025268.1, 3098687, 3098977, +, 291, 17694; cds-WP _001174777.1, NZ_CP025268.1, 3098985, 3099578, +, 594, 32239; cds-WP _000239943.1, NZ_CP025268.1, 3099571, 3100707, +, 1137, 35490; cds-WP _000745210.1, NZ_CP025268.1, 3100862, 3101869, -, 1008, 1260; cds-WP _000394140.1, NZ_CP025268.1, 3101986, 3103032, -, 1047, 106075; cds-CXP41_RS16160, NZ_CP025268.1, 3103208, 3103928, -, 721, 97968; cds-WP _001107564.1, NZ_CP025268.1, 3104112, 3104438, -, 327, 6399; cds-WP_000786911.1, NZ_CP025268.1, 3104438, 3105157, -, 720, 20866; cds-WP_001321419.1, NZ_CP025268.1, 3105318, 3106370, +, 1053, 5717; cds-WP _000091700.1, NZ_CP025268.1, 3106398, 3106673, +, 276, 75717; cds-WP_000760323.1, NZ_CP025268.1, 3106738, 3107817, +, 1080, 141876; cds-WP_001049791.1, NZ_CP025268.1, 3108019, 3109275, +, 1257, 44999; cds-WP_001326492.1, NZ_CP025268.1, 3109325, 3111460, -, 2136, 5586; cds-WP_211180506.1, NZ_CP025268.1, 3111622, 3111705, -, 84, 0; cds-WP_000234514.1, NZ_CP025268.1, 3111858, 3112565, +, 708, 0; cds-WP_000942785.1, NZ_CP025268.1, 3112895, 3113431, -, 537, 15511; cds-CXP41_RS16225, NZ_CP025268.1, 3113433, 3114398, -, 966, 12998; cds-WP_000135077.1, NZ_CP025268.1, 3114359, 3115354, -, 996, 7; cds-WP _001324279.1, NZ_CP025268.1, 3115372, 3115782, -, 411, 106; cds-WP_001333829.1, NZ_CP025268.1, 3115848, 3116657, -, 810, 171203; cds-WP_101348652.1, NZ_CP025268.1, 3116855, 3121417, -, 4563, 2305837; cds-WP _000259302.1, NZ_CP025268.1, 3121902, 3123584, -, 1683, 0; cds-WP _000084131.1, NZ_CP025268.1, 3123939, 3126110, -, 2172, 1190; cds-WP _000853256.1, NZ_CP025268.1, 3126132, 3126536, -, 405, 1; cds-WP _001194661.1, NZ_CP025268.1, 3126541, 3127764, -, 1224, 217; cds-WP _000943100.1, NZ_CP025268.1, 3127775, 3128827, -, 1053, 0; cds-WP_000026117.1, NZ_CP025268.1, 3128827, 3130326, -, 1500, 0; cds-WP_001297764.1, NZ_CP025268.1, 3130577, 3131341, +, 765, 53; cds-WP_157825724.1, NZ_CP025268.1, 3131348, 3132484, -, 1137, 590; cds-WP _000019403.1-7, NZ_CP025268.1, 3132519, 3133499, +, 981, 201173; cds-CXP41_RS16300, NZ_CP025268.1, 3133649, 3134713, -, 1065, 25790; cds-WP_000339531.1, NZ_CP025268.1, 3134759, 3135517, -, 759, 0; cds-WP_001076243.1, NZ_CP025268.1, 3135549, 3136262, -, 714, 3; cds-CXP41_RS16315, NZ_CP025268.1, 3136436, 3137116, +, 681, 0; cds-WP_000933250.1, NZ_CP025268.1, 3137176, 3138675, -, 1500, 1; cds-WP_001297309.1, NZ_CP025268.1, 3138967, 3140826, -, 1860, 127; cds-WP _001295515.1, NZ_CP025268.1, 3141031, 3141897, +, 867, 8093; cds-WP_000334896.1, NZ_CP025268.1, 3142020, 3142268, -, 249, 8572; cds-WP_101348654.1, NZ_CP025268.1, 3142281, 3142622, -, 342, 0; cds-WP_000134014.1, NZ_CP025268.1, 3142615, 3143103, -, 489, 3463; cds-WP_001221939.1, NZ_CP025268.1, 3143096, 3143590, -, 495, 8381; cds-WP _000083065.1, NZ_CP025268.1, 3143590, 3145293, -, 1704, 17; cds-WP_000017703.1, NZ_CP025268.1, 3145290, 3146468, -, 1179, 0; cds-WP_001081870.1, NZ_CP025268.1, 3146458, 3147444, -, 987, 651139; cds-WP _000145410.1, NZ_CP025268.1, 3147447, 3148565, -, 1119, 1; cds-WP _001059136.1, NZ_CP025268.1, 3148754, 3149041, -, 288, 0; cds-CXP41_RS16385, NZ_CP025268.1, 3149160, 3150044, -, 885, 0; cds-WP_000262172.1, NZ_CP025268.1, 3150201, 3151241, +, 1041, 47254; cds-WP_000439331.1, NZ_CP025268.1, 3151281, 3151775, -, 495, 40220; cds-WP _000018760.1, NZ_CP025268.1, 3151966, 3152850, +, 885, 0; cds-WP_001240712.1, NZ_CP025268.1, 3153122, 3153547, -, 426, 3204; cds-WP_000527844.1, NZ_CP025268.1, 3153554, 3154288, -, 735, 210587; cds-WP _001301079.1, NZ_CP025268.1, 3154540, 3155727, +, 1188, 9; cds-WP _000268419.1, NZ_CP025268.1, 3155867, 3156526, +, 660, 18221; cds-WP_001407451.1, NZ_CP025268.1, 3156566, 3157465, -, 900, 811; cds-WP_001058802.1, NZ_CP025268.1, 3157659, 3158822, +, 1164, 148863; cds-WP_000013149.1, NZ_CP025268.1, 3158927, 3159754, +, 828, 171641; cds-WP_000691619.1, NZ_CP025268.1, 3159954, 3160880, +, 927, 42699; cds-WP _000848528.1, NZ_CP025268.1, 3160931, 3161188, +, 258, 74533; cds-WP _000095187.1, NZ_CP025268.1, 3161231, 3163450, -, 2220, 179330; cds-WP_101348655.1, NZ_CP025268.1, 3163561, 3164973, -, 1413, 34146; cds-WP_000965722.1, NZ_CP025268.1, 3165048, 3165785, -, 738, 7853; cds-WP _001281881.1, NZ_CP025268.1, 3166019, 3168277, -, 2259, 337489; cds-WP _001295629.1, NZ_CP025268.1, 3168415, 3170022, -, 1608, 0; cds-WP_000650107.1, NZ_CP025268.1, 3170155, 3170550, -, 396, 1614; cds-WP _000415584.1, NZ_CP025268.1, 3170552, 3170848, -, 297, 0; cds-WP_000183505.1, NZ_CP025268.1, 3171053, 3171535, -, 483, 367; cds-WP_000712658.1, NZ_CP025268.1, 3171588, 3171980, -, 393, 0; cds-WP _001221495.1, NZ_CP025268.1, 3172132, 3172791, +, 660, 5; cds-WP_000673402.1, NZ_CP025268.1, 3172788, 3174137, +, 1350, 59650; cds-WP _000917684.1, NZ_CP025268.1, 3174183, 3174515, -, 333, 0; cds-WP _000065430.1, NZ_CP025268.1, 3174834, 3175415, +, 582, 102496; cds-WP_000958598.1, NZ_CP025268.1, 3175446, 3175760, +, 315, 29; cds-WP _000195296.1, NZ_CP025268.1, 3175808, 3177700, -, 1893, 161962; cds-WP_000105733.1, NZ_CP025268.1, 3177729, 3178310, -, 582, 91985; cds-WP_101348656.1, NZ_CP025268.1, 3178310, 3179137, -, 828, 181992; cds-WP_000833393.1, NZ_CP025268.1, 3179162, 3179584, -, 423, 309; cds-WP_000917117.1, NZ_CP025268.1, 3179585, 3180214, -, 630, 1263; cds-WP _000831543.1, NZ_CP025268.1, 3180430, 3181101, +, 672, 98625; cds-WP _000442860.1, NZ_CP025268.1, 3181107, 3182267, +, 1161, 511910; cds-WP_001320780.1, NZ_CP025268.1, 3182305,


3183093, -, 789, 402; cds-WP_101348658.1, NZ_CP025268.1, 3183236, 3184009, +, 774, 51653; cds-WP_000469266.1, NZ_CP025268.1, 3184067, 3184237, -, 171, 281; cds-WP_001076997.1, NZ_CP025268.1, 3184499, 3185152, -, 654, 215838; cds-WP _001295626.1, NZ_CP025268.1, 3185526, 3185816, +, 291, 749; cds-WP _001272145.1, NZ_CP025268.1, 3186100, 3186651, +, 552, 1; cds-WP _088895425.1-5, NZ_CP025268.1;NZ_CP025268.1, 3186873;3187188, 3187188;3188101, +;+, 1229, 14838; cds-WP_101348659.1, NZ_CP025268.1, 3188086, 3190551, +, 2466, 0; cds-WP_001269824.1, NZ_CP025268.1, 3190567, 3191316, +, 750, 2; cds-WP _001269802.1, NZ_CP025268.1, 3191318, 3192382, +, 1065, 568; cds-WP_000350095.1, NZ_CP025268.1, 3192425, 3192625, -, 201, 0; cds-WP _000599926.1, NZ_CP025268.1, 3192894, 3193523, +, 630, 0; cds-WP_001311137.1, NZ_CP025268.1, 3193550, 3195211, +, 1662, 116570; cds-WP _001387081.1, NZ_CP025268.1, 3195452, 3195511, +, 60, 3; cds-WP _010723221.1, NZ_CP025268.1, 3195827, 3195886, +, 60, 8858; cds-WP _000869178.1, NZ_CP025268.1, 3196006, 3197439, -, 1434, 79885; cds-WP_001301081.1, NZ_CP025268.1, 3197487, 3200327, -, 2841, 288553; cds-WP _000046281.1, NZ_CP025268.1, 3200350, 3201651, -, 1302, 79013; cds-WP_001125331.1, NZ_CP025268.1, 3201893, 3202513, +, 621, 77954; cds-WP_000708487.1, NZ_CP025268.1, 3202577, 3203815, +, 1239, 154856; cds-WP _001281927.1, NZ_CP025268.1, 3203996, 3204817, -, 822, 206616; cds-WP _001295541.1, NZ_CP025268.1, 3204907, 3205275, -, 369, 795; cds-WP _001272796.1, NZ_CP025268.1, 3205380, 3205997, +, 618, 19410; cds-WP_000935206.1, NZ_CP025268.1, 3206010, 3206942, -, 933, 0; cds-WP _000986797.1, NZ_CP025268.1, 3207149, 3208060, +, 912, 0; cds-WP _000722957.1, NZ_CP025268.1, 3208057, 3208662, +, 606, 0; cds-WP_000804973.1, NZ_CP025268.1, 3208710, 3210173, +, 1464, 19; cds-WP_001264352.1, NZ_CP025268.1, 3210216, 3211229, -, 1014, 11; cds-WP _001144069.1, NZ_CP025268.1, 3211467, 3211682, +, 216, 73775; cds-WP_000918827.1, NZ_CP025268.1, 3211793, 3213538, +, 1746, 601564; cds-WP_000437376.1, NZ_CP025268.1, 3213733, 3215574, +, 1842, 1711864; cds-WP_000228937.1, NZ_CP025268.1, 3215653, 3216159, -, 507, 10768; cds-WP_001066494.1, NZ_CP025268.1, 3216413, 3217177, -, 765, 41; cds-WP_000018003.1, NZ_CP025268.1, 3217465, 3218088, +, 624, 8524; cds-WP_101348660.1, NZ_CP025268.1, 3218242, 3219762, -, 1521, 74; cds-WP_101348661.1, NZ_CP025268.1, 3220180, 3221559, +, 1380, 0; cds-WP_000450594.1, NZ_CP025268.1, 3221601, 3221933, -, 333, 0; cds-WP_000212475.1, NZ_CP025268.1, 3222152, 3223135, +, 984, 15223; cds-WP_001082856.1, NZ_CP025268.1, 3223319, 3226411, +, 3093, 9137; cds-WP _001219954.1, NZ_CP025268.1, 3226408, 3226857, +, 450, 0; cds-WP_001285432.1, NZ_CP025268.1, 3226920, 3228353, +, 1434, 0; cds-WP_000767652.1, NZ_CP025268.1, 3228487, 3229557, +, 1071, 0; cds-WP_000695487.1, NZ_CP025268.1, 3229574, 3231925, +, 2352, 1; cds-WP_000121433.1, NZ_CP025268.1, 3232351, 3234369, +, 2019, 2; cds-WP_000560266.1, NZ_CP025268.1, 3234414, 3234830, -, 417, 0; cds-WP_000550189.1, NZ_CP025268.1, 3234827, 3235141, -, 315, 118257; cds-WP _000018695.1, NZ_CP025268.1, 3235425, 3236561, -, 1137, 43020; cds-WP _001333820.1, NZ_CP025268.1, 3236646, 3237149, +, 504, 23; cds-WP_000942548.1, NZ_CP025268.1, 3237226, 3237918, +, 693, 0; cds-WP_000617698.1, NZ_CP025268.1, 3237997, 3238983, +, 987, 4; cds-WP _001098806.1, NZ_CP025268.1, 3239265, 3240230, +, 966, 7976; cds-WP_000211655.1, NZ_CP025268.1, 3240629, 3241873, +, 1245, 25200; cds-WP_000128135.1, NZ_CP025268.1, 3241878, 3242429, -, 552, 1; cds-WP_001199390.1, NZ_CP025268.1, 3242512, 3243999, -, 1488, 546; cds-WP_000187442.1, NZ_CP025268.1, 3244014, 3245426, -, 1413, 0; cds-WP_001226465.1, NZ_CP025268.1, 3245909, 3247207, +, 1299, 0; cds-WP_000406488.1, NZ_CP025268.1, 3247337, 3248113, +, 777, 234; cds-WP_211180508.1, NZ_CP025268.1, 3248353, 3248436, +, 84, 3; cds-WP_000422149.1, NZ_CP025268.1, 3248458, 3249120, +, 663, 633; cds-WP 001166760.1, NZ_CP025268.1, 3249124, 3249507, +, 384, 6; cds-WP_001295543.1, NZ_CP025268.1, 3249654, 3250022, +, 369, 7428; cds-WP_000031415.1, NZ_CP025268.1, 3250060, 3250365, +, 306, 7401; cds-WP_000785722.1, NZ_CP025268.1, 3250368, 3250772, +, 405, 0; cds-WP 000096091.1, NZ_CP025268.1, 3250762, 3251061, +, 300, 0; cds-WP 000732240.1, NZ_CP025268.1, 3251247, 3251639, +, 393, 0; cds-WP_000531213.1, NZ_CP025268.1, 3251709, 3252695, +, 987, 0; cds-WP 000384145.1, NZ_CP025268.1, 3252989, 3253354, +, 366, 320; cds-WP_001198807.1, NZ_CP025268.1, 3253596, 3253952, +, 357, 0; cds-WP_001041009.1, NZ_CP025268.1, 3254003, 3254899, -, 897, 120; cds-WP_000633576.1, NZ_CP025268.1, 3255004, 3255705, +, 702, 0; cds-WP_001345966.1, NZ_CP025268.1, 3255728, 3255892, +, 165, 0; cds-WP _000460499.1, NZ_CP025268.1, 3256026, 3257336, -, 1311, 1; cds-WP_000401598.1, NZ_CP025268.1, 3257364, 3258695, -, 1332, 4; cds-WP_000622126.1, NZ_CP025268.1, 3258970, 3260334, -, 1365, 72; cds-WP_000719990.1, NZ_CP025268.1, 3260406, 3260795, -, 390, 0; cds-WP _000861734.1, NZ_CP025268.1, 3260809, 3263103, -, 2295, 27471; cds-WP_001295545.1, NZ_CP025268.1, 3263137, 3264345, -, 1209, 0; cds-WP_000107723.1, NZ_CP025268.1, 3264371, 3265702, -, 1332, 544; cds-WP _000548347.1, NZ_CP025268.1, 3265724, 3266713, -, 990, 1; cds-WP _000104211.1, NZ_CP025268.1, 3266812, 3267750, -, 939, 1; cds-WP_001301311.1, NZ_CP025268.1, 3268065, 3268283, +, 219, 0; cds-WP_000675733.1, NZ_CP025268.1, 3268539, 3269078, +, 540, 0; cds-WP_101348662.1, NZ_CP025268.1, 3269100, 3270287, +, 1188, 17; cds-WP _001300387.1, NZ_CP025268.1, 3271310, 3272455, -, 1146, 0; cds-WP_101348723.1, NZ_CP025268.1, 3272552, 3273442, -, 891, 0; cds-WP_001058209.1, NZ_CP025268.1, 3273472, 3274242, -, 771, 0; cds-WP_000599636.1, NZ_CP025268.1, 3274258, 3275592, -, 1335, 0; cds-WP_001273753.1, NZ_CP025268.1, 3275967, 3277538, +, 1572, 0; cds-WP_001307405.1, NZ_CP025268.1, 3277687, 3278022, +, 336, 7; cds-WP _000347273.1, NZ_CP025268.1, 3278022, 3278486, +, 465, 40203; cds-WP_101348663.1, NZ_CP025268.1, 3278541, 3279350, -, 810, 12875; cds-WP _000681920.1, NZ_CP025268.1, 3279599, 3280879, +, 1281, 503; cds-WP _001336162.1, NZ_CP025268.1, 3280902, 3281375, +, 474, 0; cds-CXP41_RS17120, NZ_CP025268.1, 3281386, 3281757, +, 372, 0; cds-CXP41_RS17125, NZ_CP025268.1, 3281753, 3282310, +, 558, 0; cds-WP _001114869.1, NZ_CP025268.1, 3282661, 3283815, +, 1155, 2; cds-WP _000022766.1, NZ_CP025268.1, 3283828, 3284688, +, 861, 0; cds-WP _000203711.1, NZ_CP025268.1, 3284855, 3285331, +, 477, 0; cds-WP_000544489.1, NZ_CP025268.1, 3285370, 3286173, +, 804, 0; cds-WP_000534347.1, NZ_CP025268.1, 3286163, 3286954, +, 792, 0; cds-WP_001311150.1, NZ_CP025268.1, 3286955, 3287710, +, 756, 0; cds-WP _001045432.1, NZ_CP025268.1, 3288111, 3288695, +, 585, 0; cds-WP _000044775.1, NZ_CP025268.1, 3288775, 3289470, +, 696, 0; cds-WP_001355538.1, NZ_CP025268.1, 3289499, 3292015, +, 2517, 819; cds-WP_000816992.1, NZ_CP025268.1, 3292026, 3293117, +, 1092, 4; cds-WP_000809262.1, NZ_CP025268.1, 3293160, 3294020, -, 861, 97; cds-WP_000249104.1, NZ_CP025268.1, 3294085, 3296121, +, 2037, 82001; cds-WP_000246830.1, NZ_CP025268.1, 3296079, 3296474, +, 396, 185210; cds-WP_001158034.1, NZ_CP025268.1, 3296494, 3297084, +, 591, 13195; cds-WP_000646033.1, NZ_CP025268.1, 3297094, 3297669, +, 576, 40467; cds-WP_101348664.1, NZ_CP025268.1, 3297783, 3298823, -, 1041, 2855; cds-WP _001300423.1, NZ_CP025268.1, 3298896, 3299531, -, 636, 1; cds-WP_000037608.1, NZ_CP025268.1, 3299659, 3300177, +, 519, 3; cds-WP_000449030.1, NZ_CP025268.1, 3300157, 3300600, -, 444, 3; cds-WP_101348665.1, NZ_CP025268.1, 3300651, 3300953, +, 303, 4167; cds-WP_000908554.1, NZ_CP025268.1, 3300940, 3301443, -, 504, 3619; cds-WP _001295552.1, NZ_CP025268.1, 3301437, 3301961, -, 525, 19314; cds-WP_101348666.1, NZ_CP025268.1, 3302170, 3303165, +, 996, 0; cds-WP _001301318.1, NZ_CP025268.1, 3303174, 3304052, +, 879, 0; cds-WP_000130380.1, NZ_CP025268.1, 3304133, 3305140, +, 1008, 2405; cds-WP_000224351.1, NZ_CP025268.1, 3305258, 3306502, -, 1245, 139265; cds-WP_001295553.1, NZ_CP025268.1, 3306656, 3308545, -, 1890, 4688190; cds-WP_010723222.1, NZ_CP025268.1, 3308538, 3308618, -, 81, 200640; cds-WP _000802080.1, NZ_CP025268.1, 3308725, 3309609, -, 885, 1696468; cds-WP _001295554.1, NZ_CP025268.1, 3309717, 3311852, -, 2136, 4195203; cds-WP _000059466.1, NZ_CP025268.1, 3312099, 3312368, -, 270, 354048; cds-WP_000089698.1, NZ_CP025268.1, 3312517, 3313461, -, 945, 1082886; cds-WP _001040205.1, NZ_CP025268.1, 3313461, 3313862, -, 402, 72669; cds-WP _000133044.1, NZ_CP025268.1, 3314026, 3316698, -, 2673, 5975794; cds-WP _001031057.1, NZ_CP025268.1, 3316723, 3318210, -, 1488, 4193086; cds-WP_001300397.1, NZ_CP025268.1, 3318238, 3318690, -, 453, 711148; cds-WP_000207680.1, NZ_CP025268.1, 3319321, 3320664, +, 1344, 16940; cds-WP _001333576.1, NZ_CP025268.1, 3320672, 3322297, -, 1626, 13228; cds-WP_001295556.1, NZ_CP025268.1, 3322857, 3323189, -, 333, 112503; cds-WP _000071134.1, NZ_CP025268.1, 3323417, 3324754, -, 1338, 458764; cds-WP_000764731.1, NZ_CP025268.1, 3324747, 3325595, -, 849, 199698; cds-WP_001107467.1, NZ_CP025268.1, 3325685, 3327619, -, 1935, 2702686; cds-WP_000145975.1, NZ_CP025268.1, 3327719, 3328348, -, 630, 365240; cds-WP_0010544201, NZ_CP025268.1, 3328474, 3328767, +, 294, 28273; cds-WP _001148001.1, NZ_CP025268.1, 3328923, 3329399, -, 477, 39130; cds-WP_101348667.1, NZ_CP025268.1, 3329647, 3331044, +, 1398, 93391; cds-WP_000673575.1, NZ_CP025268.1, 3331267, 3332439, -, 1173, 556725; cds-WP 000813037.1, NZ_CP025268.1, 3332455, 3333420, -, 966, 183054; cds-WP_000940595.1, NZ_CP025268.1, 3333547, 3333804, -, 258, 756856; cds-WP_000271401.1, NZ_CP025268.1, 3333825, 3334136, -, 312, 844174; cds-WP_001047336.1, NZ_CP025268.1, 3334395, 3335366, +, 972, 8338; cds-WP _000445413.1, NZ_CP025268.1, 3335594, 3335872, +, 279, 2; cds-WP_000357259.1, NZ_CP025268.1, 3335920, 3337179, -, 1260, 70923; cds-WP_000429656.1, NZ_CP025268.1, 3337234, 3337488, -, 255, 30991; cds-WP_000004488.1, NZ_CP025268.1, 3337648, 3337941, -, 294, 94319; cds-WP_000476487.1, NZ_CP025268.1, 3337941, 3338576, -, 636, 302948; cds-WP_001296448.1, NZ_CP025268.1, 3338595, 3339146, -, 552, 204326; cds-WP _000925795.1, NZ_CP025268.1, 3339151, 3339933, -, 783, 368525; cds-WP _000438245.1, NZ_CP025268.1, 3339941, 3340750, -, 810, 608281; cds-WP_101348668.1, NZ_CP025268.1, 3340960, 3341937, +, 978, 65150; cds-WP_001295557.1, NZ_CP025268.1, 3341951, 3342937, +, 987, 22866; cds-WP _000030005.1, NZ_CP025268.1, 3342958, 3343524, +, 567, 36025; cds-WP _000030537.1, NZ_CP025268.1, 3343521, 3344096, +, 576, 142399; cds-WP_000669785.1, NZ_CP025268.1, 3344065, 3344622, +, 558, 302570; cds-WP_000224099.1, NZ_CP025268.1, 3344629, 3345354, +, 726, 299169; cds-WP _000809057.1, NZ_CP025268.1, 3345402, 3346835, +, 1434, 1320026; cds-WP_001176599.1, NZ_CP025268.1, 3346858, 3347145, +, 288, 171334; cds-WP _000183676.1, NZ_CP025268.1, 3347263, 3347754, +, 492, 275166; cds-WP_000243741.1, NZ_CP025268.1, 3347800, 3348654, +, 855, 440506; cds-WP_000216791.1, NZ_CP025268.1, 3348651, 3348923, +, 273, 261; cds-WP_000620405.1, NZ_CP025268.1, 3349137, 3349769, +, 633, 22089; cds-WP_000047091.1, NZ_CP025268.1, 3349766, 3350494, -, 729, 229183; cds-WP _001300411.1, NZ_CP025268.1, 3350491, 3351144, -, 654, 47032; cds-WP _000809774.1, NZ_CP025268.1, 3351374, 3353710, -, 2337, 138444; cds-WP _001299745.1, NZ_CP025268.1, 3353806, 3354735, -, 930, 0; cds-WP_001300352.1, NZ_CP025268.1, 3355410, 3359870, +, 4461, 48671; cds-WP_000081674.1, NZ_CP025268.1, 3359883, 3361301, +, 1419, 5; cds-WP_000465371.1, NZ_CP025268.1, 3361861, 3362625, +, 765, 0; cds-WP_001311157.1, NZ_CP025268.1, 3362797, 3363471, +, 675, 0; cds-WP _000914994.1, NZ_CP025268.1, 3363492, 3365873, +, 2382, 346; cds-CXP41_RS17555, NZ_CP025268.1, 3365870, 3366238, +, 369, 235; cds-WP_000019403.1-8, NZ_CP025268.1, 3366387, 3367367, -, 981, 136247; cds-CXP41_RS17565, NZ_CP025268.1, 3367435, 3367614, +, 180, 237; cds-WP_101348669.1, NZ_CP025268.1, 3367611, 3368327, +, 717, 0; cds-WP _000445111.1, NZ_CP025268.1, 3368512, 3369639, +,1128,166; cds-WP_000979882.1, NZ_CP025268.1, 3369699, 3370163, -, 465, 0; cds-WP_000209011.1, NZ_CP025268.1, 3370160, 3371035, -, 876, 0; cds-WP_000054239.1, NZ_CP025268.1, 3371032, 3371721, -, 690, 0; cds-WP_000108454.1, NZ_CP025268.1, 3371769, 3373259, -, 1491, 0; cds-WP _000224714.1, NZ_CP025268.1, 3373368, 3374261, -, 894, 0; cds-WP_000523845.1, NZ_CP025268.1, 3374383, 3375174, -, 792, 2272; cds-WP_000467018.1, NZ_CP025268.1, 3375554, 3376921,


+, 1368, 19275; cds-WP_000366129.1, NZ_CP025268.1, 3376964, 3377461, -, 498, 508575; cds-WP _000257293.1, NZ_CP025268.1, 3377467, 3378105, -, 639, 319459; cds-WP_000829818.1, NZ_CP025268.1, 3378500, 3378892, -, 393, 3193737; cds-WP _000847559.1, NZ_CP025268.1, 3378908, 3379336, -, 429, 2213122; cds-WP _001192332.1, NZ_CP025268.1, 3379555, 3380682, -, 1128, 29; cds-WP _001295270.1, NZ_CP025268.1, 3380876, 3381274, +, 399, 391; cds-WP _001295271.1, NZ_CP025268.1, 3381428, 3382795, +, 1368, 34946; cds-WP _000497723.1, NZ_CP025268.1, 3382885, 3383952, +, 1068, 90; cds-WP _001295272.1, NZ_CP025268.1, 3384015, 3384953, -, 939, 103868; cds-WP_001257846.1, NZ_CP025268.1, 3385388, 3385858, +, 471, 3823; cds-WP_000695690.1, NZ_CP025268.1, 3386223, 3386486, +, 264, 44265; cds-WP _001029013.1, NZ_CP025268.1, 3386542, 3386814, -, 273, 130769; cds-WP_000510991.1, NZ_CP025268.1, 3386906, 3388873, -, 1968, 97206; cds-WP _000854021.1, NZ_CP025268.1, 3388879, 3389811, -, 933, 0; cds-WP _000051841.1, NZ_CP025268.1, 3389819, 3390022, -, 204, 0; cds-WP _000440317.1, NZ_CP025268.1, 3390205, 3391134, +, 930, 220847; cds-WP_000055909.1, NZ_CP025268.1, 3391268, 3392713, -, 1446, 352552; cds-WP _001253618.1, NZ_CP025268.1, 3393143, 3396943, -, 3801, 549076; cds-WP _000123197.1, NZ_CP025268.1, 3397011, 3398480, -, 1470, 814142; cds-WP_000203105.1, NZ_CP025268.1, 3398470, 3399063, -, 594, 726515; cds-WP_000179409.1, NZ_CP025268.1, 3399072, 3399560, -, 489, 644355; cds-WP_000802511.1, NZ_CP025268.1, 3399560, 3400663, -, 1104, 389329; cds-WP_000913396.1, NZ_CP025268.1, 3400729, 3401772, -, 1044, 184553; cds-WP_001241469.1, NZ_CP025268.1, 3402077, 3404017, -, 1941, 41068; cds-WP_001148481.1, NZ_CP025268.1, 3404169, 3405143, +, 975, 14; cds-WP _000354622.1, NZ_CP025268.1, 3406121, 3406591, +, 471, 581733; cds-WP _000884639.1, NZ_CP025268.1, 3406602, 3407951, +, 1350, 1852492; cds-WP _000381173.1, NZ_CP025268.1, 3408060, 3408302, +, 243, 7175; cds-WP_001175728.1, NZ_CP025268.1, 3408292, 3409743, +, 1452, 230973; cds-WP_001145827.1, NZ_CP025268.1, 3409755, 3410636, +, 882, 178703; cds-WP_101348670.1, NZ_CP025268.1, 3410965, 3411930, +, 966, 1685262; cds-WP_000462905.1, NZ_CP025268.1, 3411956, 3412252, +, 297, 922298; cds-WP_001258895.1, NZ_CP025268.1, 3412338, 3413222, +, 885, 124269; cds-WP_001295275.1, NZ_CP025268.1, 3413306, 3413485, +, 180, 0; cds-WP _001129518.1, NZ_CP025268.1, 3413488, 3414150, -, 663, 0; cds-WP_000160334.1, NZ_CP025268.1, 3414549, 3415706, +, 1158, 0; cds-WP_001273238.1, NZ_CP025268.1, 3415718, 3418822, +, 3105, 22620; cds-WP_000825639.1, NZ_CP025268.1, 3419075, 3419296, +, 222, 0; cds-CXP41_RS17845, NZ_CP025268.1, 3419727, 3420751, +, 1025, 0; cds-WP _000019655.1, NZ_CP025268.1, 3420819, 3422000, +, 1182, 9; cds-WP_001300681.1, NZ_CP025268.1, 3422010, 3423113, +, 1104, 0; cds-WP_000078349.1, NZ_CP025268.1, 3423121, 3423879, +, 759, 11746; cds-WP _001286216.1, NZ_CP025268.1, 3429921, 3430475, +, 555, 75088; cds-WP _001070563.1, NZ_CP025268.1, 3430451, 3430708, -, 258, 19687; cds-WP_000451243.1, NZ_CP025268.1, 3430705, 3431523, -, 819, 7970; cds-WP_001301412.1, NZ_CP025268.1, 3431528, 3432100, -, 573, 8; cds-WP_001129722.1, NZ_CP025268.1, 3432105, 3432647, -, 543, 54922; cds-WP_000460680.1, NZ_CP025268.1, 3432676, 3433149, -, 474, 3080; cds-CXP41_RS17930, NZ_CP025268.1, 3433121, 3434246, -, 1126, 1826; cds-WP_074523692.1, NZ_CP025268.1, 3434376, 3434885, +, 510, 50646; cds-WP_101348671.1, NZ_CP025268.1, 3434900, 3435847, +, 948, 95755; cds-WP _000744778.1, NZ_CP025268.1, 3435893, 3437182, +, 1290, 492436; cds-WP _000691382.1, NZ_CP025268.1, 3437204, 3438580, +, 1377, 294961; cds-WP _000022442.1, NZ_CP025268.1, 3438710, 3439120, +, 411, 73587; cds-WP _000092696.1, NZ_CP025268.1, 3439117, 3439335, -, 219, 7276; cds-WP_000285607.1, NZ_CP025268.1, 3439391, 3439816, -, 426, 45643; cds-WP _000266486.1, NZ_CP025268.1, 3439827, 3440195, -, 369, 29066; cds-WP_001216368.1, NZ_CP025268.1, 3440302, 3440685, -, 384, 4815238; cds-WP_101348672.1, NZ_CP025268.1, 3440726, 3441715, -, 990, 21425773; cds-WP _000135224.1, NZ_CP025268.1, 3441741, 3442361, -, 621, 14335744; cds-WP _001029684.1, NZ_CP025268.1, 3442395, 3442784, -, 390, 6788459; cds-WP _000090775.1, NZ_CP025268.1, 3442801, 3443157, -, 357, 5624737; cds-WP _000868187.1, NZ_CP025268.1, 3443304, 3443420, -, 117, 1443665; cds-WP _001118861.1, NZ_CP025268.1, 3443452, 3444783, -, 1332, 27160434; cds-WP_001238914.1, NZ_CP025268.1, 3444791, 3445225, -, 435, 8105130; cds-WP_001140433.1, NZ_CP025268.1, 3445229, 3445408, -, 180, 5500590; cds-WP _000940121.1, NZ_CP025268.1, 3445412, 3445915, -, 504, 11853099; cds-WP_000358960.1, NZ_CP025268.1, 3445930, 3446283, -, 354, 9707218; cds-WP_000091945.1, NZ_CP025268.1, 3446293, 3446826, -, 534, 12462326; cds-WP _000062611.1, NZ_CP025268.1, 3446839, 3447231, -, 393, 6629373; cds-WP _001118930.1, NZ_CP025268.1, 3447265, 3447570, -, 306, 13871607; cds-WP _001096200.1, NZ_CP025268.1, 3447585, 3448124, -, 540, 14583055; cds-WP_000729185.1, NZ_CP025268.1, 3448139, 3448453, -, 315, 5440817; cds-WP _000613955.1, NZ_CP025268.1, 3448464, 3448835, -, 372, 3169150; cds-WP_000130100.1, NZ_CP025268.1, 3449000, 3449254, -, 255, 4010266; cds-WP _000644741.1, NZ_CP025268.1, 3449254, 3449445, -, 192, 3152131; cds-WP_000941212.1, NZ_CP025268.1, 3449445, 3449855, -, 411, 6449844; cds-WP _000529945.1, NZ_CP025268.1, 3449868, 3450569, -, 702, 7460363; cds-WP _000447529.1, NZ_CP025268.1, 3450587, 3450919, -, 333, 5778702; cds-WP _001138117.1, NZ_CP025268.1, 3450934, 3451212, -, 279, 6067094; cds-WP _000301864.1, NZ_CP025268.1, 3451229, 3452050, -, 822, 19182687; cds-WP_000617544.1, NZ_CP025268.1, 3452068, 3452370, -, 303, 4241425; cds-WP _000424395.1, NZ_CP025268.1, 3452367, 3452972, -, 606, 9972905; cds-WP_000579833.1, NZ_CP025268.1, 3452983, 3453612, -, 630, 8424155; cds-WP _001181004.1, NZ_CP025268.1, 3453645, 3453956, -, 312, 3967454; cds-WP_000461450.1, NZ_CP025268.1, 3454194, 3454613, -, 420, 0; cds-WP_000107576.1, NZ_CP025268.1, 3454615, 3456084, -, 1470, 5537; cds-WP_001142708.1, NZ_CP025268.1, 3456264, 3457079, +, 816, 0; cds-WP_101348673.1, NZ_CP025268.1, 3457063, 3459015, +, 1953, 0; cds-WP_001219894.1, NZ_CP025268.1, 3459025, 3460506, +, 1482, 11; cds-WP_001109573.1, NZ_CP025268.1, 3460503, 3461699, +, 1197, 103374; cds-WP_001202874.1, NZ_CP025268.1, 3461709, 3462146, +, 438, 0; cds-WP _001076046.1, NZ_CP025268.1, 3462154, 3462663, +, 510, 0; cds-WP_001041743.1, NZ_CP025268.1, 3462660, 3463037, +, 378, 0; cds-WP_000610634.1, NZ_CP025268.1, 3463030, 3463617, +, 588, 0; cds-WP_001058522.1, NZ_CP025268.1, 3463610, 3464593, +, 984, 0; cds-WP _001115238.1, NZ_CP025268.1, 3464608, 3465771, +, 1164, 7; cds-WP _001295161.1, NZ_CP025268.1, 3465768, 3466229, +, 462, 20; cds-WP_000178154.1, NZ_CP025268.1, 3466229, 3466906, +, 678, 245; cds-WP_101348674.1, NZ_CP025268.1, 3466935, 3467411, -, 477, 6809; cds-WP_000289085.1, NZ_CP025268.1, 3467483, 3467677, -, 195, 280; cds-WP_000773156.1, NZ_CP025268.1, 3467846, 3470539, -, 2694, 79667; cds-WP_000031783.1, NZ_CP025268.1, 3470831, 3472015, -, 1185, 19540468; cds-WP_000124700.1, NZ_CP025268.1, 3472086, 3474200, -, 2115, 44071846; cds-CXP41_RS18215, NZ_CP025268.1, 3474300, 3474767, -, 468, 7283746; cds-WP _000246815.1, NZ_CP025268.1, 3474864, 3475238, -, 375, 3561247; cds-WP _000903373.1, NZ_CP025268.1, 3475364, 3475651, -, 288, 21291; cds-WP _000820714.1, NZ_CP025268.1, 3475659, 3476018, -, 360, 3051; cds-WP _001209680.1, NZ_CP025268.1, 3476018, 3476404, -, 387, 4; cds-WP_000091466.1, NZ_CP025268.1, 3476404, 3477126, -, 723, 416398; cds-WP_000838250.1, NZ_CP025268.1, 3477293, 3478105, -, 813, 122690; cds-WP _001153615.1, NZ_CP025268.1, 3478326, 3478544, +, 219, 13749; cds-WP_000861334.1, NZ_CP025268.1, 3478593, 3479183, -, 591, 231338; cds-WP _001007730.1, NZ_CP025268.1, 3479278, 3479478, -, 201, 62097; cds-WP _000399147.1, NZ_CP025268.1, 3479488, 3481293, -, 1806, 46756; cds-WP _001297514.1, NZ_CP025268.1, 3481293, 3481844, -, 552, 13; cds-WP_101348675.1, NZ_CP025268.1, 3481975, 3483888, +, 1914, 99350; cds-WP _000057356.1, NZ_CP025268.1, 3483888, 3484910, +, 1023, 8870; cds-WP _000907085.1, NZ_CP025268.1, 3484904, 3485122, +, 219, 0; cds-WP _001274680.1, NZ_CP025268.1, 3485176, 3486045, +, 870, 20992; cds-WP_001148908.1, NZ_CP025268.1, 3486100, 3486504, -, 405, 0; cds-WP_000242755.1, NZ_CP025268.1, 3486806, 3487438, +, 633, 64107; cds-WP _001295162.1, NZ_CP025268.1, 3487489, 3489579, +, 2091, 142787; cds-WP_000963792.1, NZ_CP025268.1, 3489646, 3490866, -, 1221, 155720; cds-WP_000601847.1, NZ_CP025268.1, 3490952, 3491515, -, 564, 0; cds-WP _001280641.1, NZ_CP025268.1, 3491547, 3492149, -, 603, 27; cds-WP_000736862.1, NZ_CP025268.1, 3492139, 3492306, -, 168, 7465; cds-WP _000477225.1, NZ_CP025268.1, 3492411, 3492983, -, 573, 6139; cds-WP_000185247.1, NZ_CP025268.1, 3493254, 3494435, +, 1182, 9486; cds-WP_000049208.1, NZ_CP025268.1, 3494697, 3497240, +, 2544, 82176; cds-WP_000084764.1, NZ_CP025268.1, 3497237, 3497563, +, 327, 0; cds-WP_000493556.1, NZ_CP025268.1, 3497689, 3498495, +, 807, 0; cds-WP _000349855.1, NZ_CP025268.1, 3498514, 3499887, +, 1374, 492; cds-WP_001031834.1, NZ_CP025268.1, 3500134, 3500301, +, 168, 0; cds-WP _001311175.1, NZ_CP025268.1, 3500545, 3501933, +, 1389, 0; cds-WP_001295163.1, NZ_CP025268.1, 3501954, 3502976, +, 1023, 0; cds-WP_000847837.1, NZ_CP025268.1, 3503026, 3503856, +, 831, 0; cds-WP _000853353.1, NZ_CP025268.1, 3503853, 3504638, +, 786, 0; cds-WP _001276847.1, NZ_CP025268.1, 3504738, 3505469, +, 732, 43; cds-WP _000847144.1, NZ_CP025268.1, 3505621, 3506706, -, 1086, 2; cds-WP_000366857.1, NZ_CP025268.1, 3506718, 3508022, -, 1305, 0; cds-WP _000719728.1, NZ_CP025268.1, 3508034, 3508387, -, 354, 2; cds-CXP41_RS18420, NZ_CP025268.1, 3508398, 3509275, -, 878, 0; cds-WP_000090644.1, NZ_CP025268.1, 3509272, 3510498, -, 1227, 0; cds-WP_000497334.1, NZ_CP025268.1, 3510498, 3511661, -, 1164, 0; cds-WP_001295165.1, NZ_CP025268.1, 3511745, 3512107, -, 363, 0; cds-CXP41_RS18440, NZ_CP025268.1, 3512124, 3513030, -, 907, 3004; cds-WP _000165552.1, NZ_CP025268.1, 3513320, 3514324, -, 1005, 553136; cds-WP_001031729.1, NZ_CP025268.1, 3514317, 3515075, -, 759, 54147; cds-WP _000816280.1, NZ_CP025268.1, 3515068, 3515745, -, 678, 116283; cds-WP_101348676.1, NZ_CP025268.1, 3515763, 3516599, -, 837, 216262; cds-WP _000343215.1, NZ_CP025268.1, 3516706, 3517992, -, 1287, 788500; cds-WP_000439848.1, NZ_CP025268.1, 3518084, 3519172, -, 1089, 1098492; cds-WP_000818618.1, NZ_CP025268.1, 3519229, 3519750, -, 522, 90342; cds-WP _000815987.1, NZ_CP025268.1, 3520151, 3521389, -, 1239, 0; cds-WP_001264141.1, NZ_CP025268.1, 3521301, 3521705, -, 405, 0; cds-WP _001055759.1, NZ_CP025268.1, 3521695, 3522135, -, 441, 0; cds-WP _001069315.1, NZ_CP025268.1, 3522119, 3522658, -, 540, 0; cds-WP _001295166.1, NZ_CP025268.1, 3522658, 3523437, -, 780, 0; cds-WP _001336003.1, NZ_CP025268.1, 3523557, 3526109, +, 2553, 487247; cds-WP_000045744.1, NZ_CP025268.1, 3526275, 3526835, -, 561, 27543; cds-WP _000104533.1, NZ_CP025268.1, 3527155, 3529290, +, 2136, 245141; cds-WP _001295168.1, NZ_CP025268.1, 3529355, 3530023, +, 669, 56167; cds-WP_000660483.1, NZ_CP025268.1, 3530034, 3530435, +, 402, 71781; cds-WP_001135574.1, NZ_CP025268.1, 3530460, 3531338, +, 879, 668594; cds-WP _101348677.1, NZ_CP025268.1, 3531401, 3533125, -, 1725, 774; cds-WP _001265681.1, NZ_CP025268.1, 3533504, 3535126, +, 1623, 357011; cds-WP_101348678.1, NZ_CP025268.1, 3535202, 3536554, -, 1353, 109182; cds-WP_001157751.1, NZ_CP025268.1, 3536551, 3537270, -, 720, 41496; cds-WP _000856737.1, NZ_CP025268.1, 3537498, 3537974, +, 477, 5817; cds-WP _000980727.1, NZ_CP025268.1, 3538071, 3540392, +, 2322, 188770; cds-WP _001200455.1, NZ_CP025268.1, 3540849, 3541076, +, 228, 0; cds-WP _000737039.1, NZ_CP025268.1, 3541093, 3543414, +, 2322, 133782; cds-WP _000157586.1, NZ_CP025268.1, 3543414, 3543650, +, 237, 7435; cds-WP _000039062.1, NZ_CP025268.1, 3543853, 3544731, +, 879, 145662; cds-WP _001060070.1, NZ_CP025268.1, 3544760, 3545530, -, 771, 7479; cds-WP_001333371.1, NZ_CP025268.1, 3545568, 3546251, +, 684, 7797; cds-WP_000619389.1, NZ_CP025268.1, 3546310, 3546885, +, 576, 94524; cds-WP_001131758.1, NZ_CP025268.1, 3547245, 3548561, +, 1317, 38; cds-WP _000444342.1, NZ_CP025268.1, 3548672, 3550756, -, 2085, 3; cds-WP_000081909.1, NZ_CP025268.1, 3550766, 3553159, -, 2394, 354136; cds-WP _000906961.1, NZ_CP025268.1, 3553771, 3556476, +, 2706, 583570; cds-WP_101348679.1, NZ_CP025268.1, 3556519, 3557535, -,


1017, 2; cds-WP_001105504.1, NZ_CP025268.1, 3557539, 3558765, -, 1227, 0; cds-WP_001232948.1, NZ_CP025268.1, 3558954, 3560552, +, 1599, 1577; cds-WP _000815099.1, NZ_CP025268.1, 3560534, 3561292, -, 759, 267995; cds-WP_000928723.1, NZ_CP025268.1, 3561309, 3562139, -, 831, 173819; cds-WP _000371928.1, NZ_CP025268.1, 3562184, 3562510, -, 327, 873; cds-WP _000448136.1, NZ_CP025268.1, 3562700, 3564205, +, 1506, 184133; cds-CXP41_RS18680, NZ_CP025268.1, 3564474, 3564695, -, 222, 3; cds-WP_000993449.1, NZ_CP025268.1, 3564821, 3567268, -, 2448, 26; cds-WP _001197646.1, NZ_CP025268.1, 3567287, 3568720, -, 1434, 59; cds-WP _000253975.1, NZ_CP025268.1, 3568720, 3570015, -, 1296, 69711; cds-WP_000192523.1, NZ_CP025268.1, 3570033, 3572006, -, 1974, 32245; cds-WP_001283723.1, NZ_CP025268.1, 3572003, 3574189, -, 2187, 561341; cds-WP_211180509.1, NZ_CP025268.1, 3574347, 3574388, -, 42, 772; cds-WP_000799956.1, NZ_CP025268.1, 3574462, 3575565, -, 1104, 27065; cds-WP _001002544.1, NZ_CP025268.1, 3575758, 3576351, +, 594, 3539; cds-WP _000210111.1, NZ_CP025268.1, 3576408, 3577748, -, 1341, 1; cds-WP _000108330.1, NZ_CP025268.1, 3577752, 3578279, -, 528, 23300; cds-WP_000730252.1, NZ_CP025268.1, 3578418, 3579413, -, 996, 10304; cds-WP_000639811.1, NZ_CP025268.1, 3579637, 3580332, -, 696, 4602; cds-WP_000236293.1, NZ_CP025268.1, 3580455, 3581492, -, 1038, 339; cds-WP_001295206.1, NZ_CP025268.1, 3581825, 3582313, +, 489, 0; cds-WP_000065894.1, NZ_CP025268.1, 3582550, 3583728, +, 1179, 4011; cds-WP_000988497.1, NZ_CP025268.1, 3583725, 3584141, +, 417, 0; cds-CXP41_RS18765, NZ_CP025268.1, 3584170, 3584867, +, 698, 154869; cds-WP_001307436.1, NZ_CP025268.1, 3585091, 3585246, +, 156, 0; cds-WP_000634159.1, NZ_CP025268.1, 3585446, 3585730, +, 285, 0; cds-WP_000595082.1, NZ_CP025268.1, 3585768, 3587510, -, 1743, 0; cds-WP_101348680.1, NZ_CP025268.1, 3587630, 3588070, +, 441, 22; cds-WP_000073623.1, NZ_CP025268.1, 3588057, 3588800, -, 744, 468; cds-WP_000907792.1, NZ_CP025268.1, 3588797, 3589867, -, 1071, 66; cds-WP_101348681.1, NZ_CP025268.1, 3589869, 3590714, -, 846, 0; cds-WP_000099289.1, NZ_CP025268.1, 3590711, 3591598, -, 888, 0; cds-WP_000803190.1, NZ_CP025268.1, 3591696, 3593012, -, 1317, 1; cds-WP_000416891.1, NZ_CP025268.1, 3593411, 3594124, -, 714, 94799; cds-WP_000082101.1, NZ_CP025268.1, 3594126, 3594893, -, 768, 0; cds-WP_000803813.1, NZ_CP025268.1, 3594890, 3596167, -, 1278, 0; cds-WP_001295111.1, NZ_CP025268.1, 3596164, 3597090, -, 927, 1; cds-WP_000827696.1, NZ_CP025268.1, 3597138, 3598247, -, 1110, 33; cds-WP _000778768.1, NZ_CP025268.1, 3598671, 3599054, +, 384, 52; cds-WP_083586216.1, NZ_CP025268.1, 3599203, 3600345, -, 1143, 25947; cds-WP _000130217.1, NZ_CP025268.1, 3600616, 3601470, -, 855, 786295; cds-WP _001042003.1, NZ_CP025268.1, 3601715, 3602773, -, 1059, 81533; cds-WP _000617723.1, NZ_CP025268.1, 3602766, 3603434, -, 669, 31761; cds-WP_001040654.1, NZ_CP025268.1, 3603437, 3604930, -, 1494, 620350; cds-WP _000743193.1, NZ_CP025268.1, 3605080, 3605676, +, 597, 59019; cds-WP_001311191.1, NZ_CP025268.1, 3605666, 3605935, +, 270, 73316; cds-WP_000042895.1, NZ_CP025268.1, 3605938, 3606297, -, 360, 4; cds-WP _000964718.1, NZ_CP025268.1, 3606438, 3607064, +, 627, 14; cds-WP _000106551.1, NZ_CP025268.1, 3607138, 3609336, +, 2199, 415371; cds-WP _000130621.1, NZ_CP025268.1, 3609438, 3609683, -, 246, 9533; cds-WP _001100469.1, NZ_CP025268.1, 3609904, 3610569, +, 666, 3676; cds-WP _001245295.1, NZ_CP025268.1, 3610642, 3611199, +, 558, 568; cds-WP _001300943.1, NZ_CP025268.1, 3611203, 3612420, -, 1218, 348444; cds-WP_001300885.1, NZ_CP025268.1, 3612552, 3613601, +, 1050, 8; cds-WP_000285774.1, NZ_CP025268.1, 3613656, 3614243, +, 588, 9463; cds-WP _000953361.1, NZ_CP025268.1, 3614354, 3615928, +, 1575, 150060; cds-WP _000947068.1, NZ_CP025268.1, 3615928, 3616872, +, 945, 0; cds-WP _001008963.1, NZ_CP025268.1, 3616869, 3617702, +, 834, 0; cds-WP _001136229.1, NZ_CP025268.1, 3617702, 3618466, +, 765, 0; cds-WP _000173631.1, NZ_CP025268.1, 3618463, 3619269, +, 807, 0; cds-WP_001190062.1, NZ_CP025268.1, 3619275, 3619676, +, 402, 12; cds-WP _000015298.1, NZ_CP025268.1, 3619879, 3624114, +, 4236, 48; cds-WP _001271686.1, NZ_CP025268.1, 3624086, 3624469, +, 384, 904; cds-CXP41_RS18970, NZ_CP025268.1, 3624574, 3624924, +, 351, 1775; cds-WP _000420980.1, NZ_CP025268.1, 3625065, 3626201, +, 1137, 3903; cds-WP_001216257.1, NZ_CP025268.1, 3626366, 3627490, -, 1125, 620; cds-WP _000149156.1, NZ_CP025268.1, 3627490, 3630225, -, 2736, 223744; cds-WP _000361477.1, NZ_CP025268.1, 3630222, 3631289, -, 1068, 29; cds-WP_001296785.1, NZ_CP025268.1, 3631352, 3631465, -, 114, 9; cds-WP _001393583.1, NZ_CP025268.1, 3631655, 3633277, -, 1623, 0; cds-CXP41_RS19000, NZ_CP025268.1, 3633539, 3635145, -, 1607, 0; cds-WP_001028905.1, NZ_CP025268.1, 3635528, 3636580, +, 1053, 40894; cds-WP _000439170.1, NZ_CP025268.1, 3636895, 3638097, -, 1203, 14019; cds-WP _000902780.1, NZ_CP025268.1, 3638329, 3639828, +, 1500, 712468; cds-WP_000626187.1, NZ_CP025268.1, 3640072, 3640407, -, 336, 21411; cds-WP _000323571.1, NZ_CP025268.1, 3640798, 3641232, +, 435, 38644; cds-WP_211180511.1, NZ_CP025268.1, 3641299, 3641373, -, 75, 0; cds-WP_001098652.1, NZ_CP025268.1, 3641549, 3643018, +, 1470, 9271; cds-WP_000686620.1, NZ_CP025268.1, 3643067, 3643819, -, 753, 8680; cds-WP _001298719.1, NZ_CP025268.1, 3643827, 3645869, -, 2043, 165422; cds-WP_001300574.1, NZ_CP025268.1, 3646072, 3646914, +, 843, 158485; cds-WP_000160816.1, NZ_CP025268.1, 3646986, 3648338, +, 1353, 427736; cds-WP_001295215.1, NZ_CP025268.1, 3648392, 3648475, -, 84, 0; cds-WP _000008957.1, NZ_CP025268.1, 3649215, 3649568, +, 354, 0; cds-WP_000922639.1, NZ_CP025268.1, 3649622, 3650911, +, 1290, 9126; cds-WP_000065769.1, NZ_CP025268.1, 3650924, 3651349, +, 426, 0; cds-CXP41_RS19090, NZ_CP025268.1, 3651978, 3652724, +, 747, 51; cds-WP_000019403.1-9, NZ_CP025268.1, 3652869, 3653849, -, 981, 112221; cds-CXP41_RS19100, NZ_CP025268.1, 3653915, 3654293, +, 379, 91; cds-WP_001350553.1, NZ_CP025268.1, 3654648, 3655214, +, 567, 2; cds-WP _000478619.1, NZ_CP025268.1, 3655370, 3655900, +, 531, 0; cds-WP _001296814.1, NZ_CP025268.1, 3655942, 3656589, -, 648, 0; cds-WP_001298717.1, NZ_CP025268.1, 3656653, 3656979, -, 327, 0; cds-WP _000756550.1, NZ_CP025268.1, 3657095, 3657427, -, 333, 0; cds-WP_000965672.1, NZ_CP025268.1, 3657682, 3658254, +, 573, 0; cds-WP_000576690.1, NZ_CP025268.1, 3659053, 3659580, +, 528, 0; cds-WP _001205329.1, NZ_CP025268.1, 3659581, 3659859, -, 279, 0; cds-WP _001081984.1, NZ_CP025268.1, 3659919, 3661076, +, 1158, 0; cds-WP_000024872.1, NZ_CP025268.1, 3661101, 3664214, +, 3114, 25; cds-CXP41_RS19165, NZ_CP025268.1, 3664577, 3665306, -, 730, 22; cds-WP _001191059.1, NZ_CP025268.1, 3665674, 3666498, -, 825, 13; cds-WP_000372240.1, NZ_CP025268.1, 3666868, 3668268, -, 1401, 1; cds-WP _000784827.1, NZ_CP025268.1, 3668479, 3669876, -, 1398, 0; cds-WP _000934216.1, NZ_CP025268.1, 3670280, 3671929, +, 1650, 7; cds-WP_001167676.1, NZ_CP025268.1, 3671980, 3672582, -, 603, 88; cds-WP _000357790.1, NZ_CP025268.1, 3673102, 3674001, +, 900, 0; cds-WP _000191237.1, NZ_CP025268.1, 3674050, 3675063, +, 1014, 2293; cds-WP _001149003.1, NZ_CP025268.1, 3675474, 3676796, +, 1323, 18288; cds-WP_001296794.1, NZ_CP025268.1, 3676978, 3679038, -, 2061, 378923; cds-WP _001295219.1, NZ_CP025268.1, 3679108, 3679875, -, 768, 18291; cds-WP_000037562.1, NZ_CP025268.1, 3680107, 3681036, +, 930, 259499; cds-WP_001163141.1, NZ_CP025268.1, 3681132, 3682628, -, 1497, 456221; cds-WP _000858214.1, NZ_CP025268.1, 3682849, 3684135, -, 1287, 95537; cds-WP _001266293.1, NZ_CP025268.1, 3684318, 3686306, -, 1989, 17842; cds-WP_001225124.1, NZ_CP025268.1, 3686388, 3689861, -, 3474, 0; cds-WP _001311203.1, NZ_CP025268.1, 3689843, 3690949, -, 1107, 324636; cds-WP _001407405.1, NZ_CP025268.1, 3690956, 3693295, -, 2340, 581387; cds-WP_101348682.1, NZ_CP025268.1, 3693306, 3695924, -, 2619, 0; cds-CXP41_RS19270, NZ_CP025268.1, 3695921, 3696673, -, 753, 87665; cds-WP_001063318.1, NZ_CP025268.1, 3696685, 3696873, -, 189, 208; cds-WP _001204931.1, NZ_CP025268.1, 3697146, 3698717, +, 1572, 19967; cds-WP_000988308.1, NZ_CP025268.1, 3698714, 3698905, +, 192, 19; cds-WP _000191622.1, NZ_CP025268.1, 3698902, 3700581, +, 1680, 372; cds-WP _000141634.1, NZ_CP025268.1, 3700668, 3700775, -, 108, 0; cds-WP_001295225.1, NZ_CP025268.1, 3701251, 3702522, +, 1272, 48354; cds-WP_000107012.1, NZ_CP025268.1, 3702552, 3703556, -, 1005, 0; cds-WP_001196486.1, NZ_CP025268.1, 3703553, 3704536, -, 984, 506; cds-WP_000084677.1, NZ_CP025268.1, 3704547, 3705449, -, 903, 56398; cds-WP _000938855.1, NZ_CP025268.1, 3705459, 3706478, -, 1020, 15949; cds-WP _001222883.1, NZ_CP025268.1, 3706786, 3708393, -, 1608, 21819; cds-CXP41_RS19355, NZ_CP025268.1, 3709472, 3711164, -, 1693, 137260; cds-WP _000189019.1, NZ_CP025268.1, 3711488, 3712696, -, 1209, 0; cds-WP _001299523.1, NZ_CP025268.1, 3712925, 3713623, -, 699, 28036; cds-WP_000438957.1, NZ_CP025268.1, 3713781, 3714344, +, 564, 60178; cds-WP _000617473.1, NZ_CP025268.1, 3714341, 3714781, +, 441, 462; cds-WP _000013950.1, NZ_CP025268.1, 3714750, 3717083, -, 2334, 8010; cds-WP _000747625.1, NZ_CP025268.1, 3717236, 3717895, +, 660, 9381; cds-WP_000805038.1, NZ_CP025268.1, 3717999, 3718973, +, 975, 8121; cds-WP _000190516.1, NZ_CP025268.1, 3719023, 3719733, -, 711, 140496; cds-WP _000455798.1, NZ_CP025268.1, 3720167, 3720457, +, 291, 0; cds-WP_000014594.1, NZ_CP025268.1, 3720738, 3720950, +, 213, 530883; cds-WP_211180513.1, NZ_CP025268.1, 3721089, 3721160, +, 72, 780; cds-WP _001135732.1, NZ_CP025268.1, 3721137, 3721289, -, 153, 5775; cds-WP _085947770.1, NZ_CP025268.1;NZ_CP025268.1, 3721369;3721849, 3721849;3722738, +;+, 1370, 99448; cds-WP_001291772.1, NZ_CP025268.1, 3723017, 3725086, -, 2070, 1777903; cds-WP_001168560.1, NZ_CP025268.1, 3725096, 3726007, -, 912, 106820; cds-WP _000980107.1, NZ_CP025268.1, 3726102, 3726401, -, 300, 0; cds-WP_001182650.1, NZ_CP025268.1, 3726576, 3727571, +, 996, 0; cds-WP _001296808.1, NZ_CP025268.1, 3727613, 3728050, -, 438, 0; cds-WP _001295228.1, NZ_CP025268.1, 3728096, 3728437, -, 342, 0; cds-CXP41_RS19455, NZ_CP025268.1, 3728606, 3730062, -, 1457, 0; cds-WP _001149591.1, NZ_CP025268.1, 3730134, 3731456, -, 1323, 0; cds-WP_101348684.1, NZ_CP025268.1, 3731822, 3732814, +, 993, 0; cds-WP_101348685.1, NZ_CP025268.1, 3732892, 3734433, +, 1542, 0; cds-WP _000045978.1, NZ_CP025268.1, 3734411, 3735592, +, 1182, 0; cds-WP _000494484.1, NZ_CP025268.1, 3735670, 3736848, +, 1179, 24833; cds-WP _001297957.1, NZ_CP025268.1, 3737045, 3737869, -, 825, 231322; cds-WP_000761225.1, NZ_CP025268.1, 3738189, 3740219, +, 2031, 171185; cds-WP_000144363.1, NZ_CP025268.1, 3740397, 3741650, +, 1254, 8752; cds-WP _001300918.1, NZ_CP025268.1, 3741801, 3742274, -, 474, 4; cds-WP _000514240.1, NZ_CP025268.1, 3742376, 3743224, -, 849, 6; cds-WP_000053415.1, NZ_CP025268.1, 3743406, 3744554, +, 1149, 350138; cds-WP_000869037.1, NZ_CP025268.1, 3744655, 3745653, +, 999, 0; cds-WP _000576079.1, NZ_CP025268.1, 3745665, 3746132, +, 468, 0; cds-WP _000721664.1, NZ_CP025268.1, 3746250, 3746723, +, 474, 0; cds-WP_000279599.1, NZ_CP025268.1, 3746726, 3748003, +, 1278, 370; cds-WP _000776887.1, NZ_CP025268.1, 3748016, 3749002, +, 987, 0; cds-WP _000196054.1, NZ_CP025268.1, 3749006, 3750502, +, 1497, 0; cds-WP _000089481.1, NZ_CP025268.1, 3750499, 3751161, +, 663, 0; cds-WP_001350555.1, NZ_CP025268.1, 3751154, 3752014, +, 861, 0; cds-WP_101348686.1, NZ_CP025268.1, 3752008, 3752703, +, 696, 0; cds-CXP41_RS24405, NZ_CP025268.1, 3752735, 3752836, -, 102, 0; cds-CXP41_RS19560, NZ_CP025268.1, 3752840, 3753028, +, 189, 0; cds-WP _000906819.1, NZ_CP025268.1, 3753050, 3753790, -, 741, 0; cds-WP_000164036.1, NZ_CP025268.1, 3753914, 3754888, +, 975, 0; cds-WP_000364884.1, NZ_CP025268.1, 3754885, 3756021, -, 1137, 0; cds-WP_000478195.1, NZ_CP025268.1, 3756027, 3756350, -, 324, 408; cds-WP_001066080.1, NZ_CP025268.1, 3756533, 3756676, +, 144, 0; cds-WP_000183980.1, NZ_CP025268.1, 3756895, 3758433, -, 1539, 712; cds-WP_000741518.1, NZ_CP025268.1, 3758598, 3759749, -, 1152, 0; cds-WP_000582468.1, NZ_CP025268.1, 3759939, 3761783, -, 1845, 127680; cds-WP _000206275.1, NZ_CP025268.1, 3761780, 3763171, -, 1392, 94584; cds-WP_101348687.1, NZ_CP025268.1, 3763269, 3763877, -, 609, 3628; cds-WP_000015300.1, NZ_CP025268.1, 3764105, 3768238, +, 4134, 60; cds-WP_000072850.1, NZ_CP025268.1, 3768259, 3769101, +, 843, 128; cds-CXP41_RS24295, NZ_CP025268.1, 3769129, 3770087, +, 959, 5; cds-WP_000642478.1, NZ_CP025268.1, 3770099, 3770560, +, 462, 0; cds-


WP_001326561.1, NZ_CP025268.1, 3771267, 3771602, +, 336, 0; cds-WP_000364939.1, NZ_CP025268.1, 3772165, 3773301, -, 1137, 0; cds-WP_000479624.1, NZ_CP025268.1, 3773304, 3773666, -, 363, 0; cds-WP_101348688.1, NZ_CP025268.1, 3774203, 3776116, +, 1914, 67758; cds-WP_000645439.1, NZ_CP025268.1, 3776346, 3777494, +, 1149, 4850; cds-WP_000228269.1, NZ_CP025268.1, 3777494, 3778081, +, 588, 52547; cds-WP_000517100.1, NZ_CP025268.1, 3778093, 3778302, -, 210, 21564; cds-WP _000665680.1, NZ_CP025268.1, 3778587, 3778949, +, 363, 5103; cds-WP_001295233.1, NZ_CP025268.1, 3779321, 3780976, +, 1656, 2932; cds-WP_000636500.1, NZ_CP025268.1, 3780976, 3781752, +, 777, 2; cds-WP_000586962.1, NZ_CP025268.1, 3781749, 3782939, +, 1191, 0; cds-WP _000932347.1, NZ_CP025268.1, 3783137, 3783610, +, 474, 32261; cds-WP_001277561.1, NZ_CP025268.1, 3783663, 3784484, -, 822, 219629; cds-WP_001076194.1, NZ_CP025268.1, 3784564, 3785583, -, 1020, 372722; cds-WP _000003377.1, NZ_CP025268.1, 3785583, 3786050, -, 468, 403389; cds-WP_000024392.1, NZ_CP025268.1, 3786113, 3786364, -, 252, 386813; cds-WP _001156181.1, NZ_CP025268.1, 3786506, 3786937, -, 432, 223624; cds-WP_001350558.1, NZ_CP025268.1, 3787182, 3788726, +, 1545, 248455; cds-WP_001214147.1, NZ_CP025268.1, 3788736, 3790019, +, 1284, 212648; cds-WP_101348689.1, NZ_CP025268.1, 3790023, 3790982, +, 960, 1332; cds-WP_101348690.1, NZ_CP025268.1, 3790969, 3792003, -, 1035, 26; cds-WP _000646007.1, NZ_CP025268.1, 3792242, 3793267, -, 1026, 21437; cds-WP_001213834.1, NZ_CP025268.1, 3793277, 3794473, -, 1197, 20561; cds-WP_000842820.1, NZ_CP025268.1, 3794748, 3795605, -, 858, 926; cds-WP_000587764.1, NZ_CP025268.1, 3795909, 3796841, +, 933, 389746; cds-WP_000699219.1, NZ_CP025268.1, 3796851, 3797897, +, 1047, 80152; cds-WP_001264584.1, NZ_CP025268.1, 3797901, 3798860, +, 960, 304626; cds-WP_001395405.1, NZ_CP025268.1, 3798870, 3800129, +, 1260, 142366; cds-WP _001236433.1, NZ_CP025268.1, 3800161, 3801234, -, 1074, 37840; cds-WP_000790279.1, NZ_CP025268.1, 3801267, 3802118, -, 852, 131193; cds-WP_000615254.1, NZ_CP025268.1, 3802189, 3802887, -, 699, 33444; cds-WP_000376841.1, NZ_CP025268.1, 3802905, 3803921, -, 1017, 114374; cds-WP_001188013.1, NZ_CP025268.1, 3803961, 3804980, -, 1020, 16033; cds-WP_000683964.1, NZ_CP025268.1, 3804980, 3806059, -, 1080, 42794; cds-WP_000158225.1, NZ_CP025268.1, 3806103, 3807038, -, 936, 41950; cds-WP _000229840.1, NZ_CP025268.1, 3807075, 3807872, -, 798, 43529; cds-WP_000634283.1, NZ_CP025268.1, 3807865, 3808989, -, 1125, 168272; cds-WP_001350560.1, NZ_CP025268.1, 3808986, 3810056, -, 1071, 10833; cds-WP_000891564.1, NZ_CP025268.1, 3810462, 3811739, +, 1278, 186522; cds-WP_001171866.1, NZ_CP025268.1, 3811747, 3812226, +, 480, 1810; cds-WP_001114543.1, NZ_CP025268.1, 3812265, 3813074, -, 810, 11585; cds-WP_001051798.1, NZ_CP025268.1, 3813172, 3813339, -, 168, 44298; cds-WP _000091955.1, NZ_CP025268.1, 3813360, 3813596, -, 237, 208948; cds-WP_001350561.1, NZ_CP025268.1, 3813813, 3814481, -, 669, 19016; cds-WP_000050139.1, NZ_CP025268.1, 3814653, 3815873, +, 1221, 1583; cds-WP_000976073.1, NZ_CP025268.1, 3815851, 3816309, +, 459, 4711; cds-WP_000818601.1, NZ_CP025268.1, 3816416, 3817012, +, 597, 189030; cds-WP_000806177.1, NZ_CP025268.1, 3817049, 3817690, -, 642, 1; cds-CXP41_RS19895, NZ_CP025268.1, 3817757, 3818472, -, 716, 5364; cds-WP_000621340.1, NZ_CP025268.1, 3818599, 3819462, +, 864, 16906; cds-WP_001350563.1, NZ_CP025268.1, 3819683, 3820507, +, 825, 3956; cds-WP _000924289.1, NZ_CP025268.1, 3820797, 3821414, +, 618, 2016; cds-WP _000870036.1, NZ_CP025268.1, 3821411, 3823093, -, 1683, 0; cds-WP_001295237.1, NZ_CP025268.1, 3823351, 3823974, +, 624, 490712; cds-WP _000135058.1, NZ_CP025268.1, 3824029, 3824304, +, 276, 172550; cds-WP _000280488.1, NZ_CP025268.1, 3824323, 3826431, +, 2109, 2010454; cds-WP _001070177.1, NZ_CP025268.1, 3826438, 3827127, +, 690, 173338; cds-WP_000678419.1, NZ_CP025268.1, 3827133, 3829214, +, 2082, 761330; cds-WP_000468833.1, NZ_CP025268.1, 3829383, 3830588, -, 1206, 34023; cds-WP _001295238.1, NZ_CP025268.1, 3830868, 3832259, +, 1392, 315899; cds-WP _001300954.1, NZ_CP025268.1, 3832380, 3834089, +, 1710, 13; cds-WP_000702898.1, NZ_CP025268.1, 3834142, 3836460, -, 2319, 3; cds-WP_000834439.1, NZ_CP025268.1, 3836470, 3837852, -, 1383, 11; cds-WP_001172878.1, NZ_CP025268.1, 3838876, 3840060, +, 1185, 1686; cds-WP _000535961.1, NZ_CP025268.1, 3840171, 3841094, +, 924, 9630; cds-WP _000779426.1, NZ_CP025268.1, 3841098, 3841916, -, 819, 16966; cds-WP_000805509.1, NZ_CP025268.1, 3842138, 3842431, +, 294, 17; cds-WP_001288549.1, NZ_CP025268.1, 3842472, 3843662, -, 1191, 124758; cds-WP _001295241.1, NZ_CP025268.1, 3843873, 3844325, -, 453, 0; cds-WP_001403836.1, NZ_CP025268.1, 3844378, 3845712, -, 1335, 0; cds-WP_001065718.1, NZ_CP025268.1, 3845887, 3847653, +,1767,1395; cds-WP_000879194.1, NZ_CP025268.1, 3847699, 3849090, -, 1392, 0; cds-WP_000936566.1, NZ_CP025268.1, 3849228, 3850547, -, 1320, 557; cds-CXP41_RS20045, NZ_CP025268.1, 3850557, 3852058, -, 1502, 217; cds-WP_000633668.1, NZ_CP025268.1, 3852058, 3852648, -, 591, 96732; cds-WP_001181706.1, NZ_CP025268.1, 3852724, 3853014, -, 291, 1608; cds-WP _000168475.1, NZ_CP025268.1, 3853018, 3854706, -, 1689, 631; cds-WP _001300753.1, NZ_CP025268.1, 3854812, 3854910, -, 99, 105; cds-WP_001054909.1, NZ_CP025268.1, 3855475, 3855564, +, 90, 0; cds-WP_211180519.1, NZ_CP025268.1, 3855688, 3855762, -, 75, 0; cds-WP _000828746.1, NZ_CP025268.1, 3855844, 3857028, +, 1185, 49; cds-WP _000148061.1, NZ_CP025268.1, 3857036, 3857533, -, 498, 32; cds-WP _074557320.1, NZ_CP025268.1, 3857530, 3857892, -, 363, 9; cds-WP_000703959.1, NZ_CP025268.1, 3857882, 3858229, -, 348, 0; cds-WP_000511289.1, NZ_CP025268.1, 3858337, 3858786, +, 450, 2; cds-WP _000828527.1, NZ_CP025268.1, 3858833, 3860326, -, 1494, 0; cds-WP _001087145.1, NZ_CP025268.1, 3860323, 3862038, -, 1716, 0; cds-WP _001013540.1, NZ_CP025268.1, 3862205, 3863098, +, 894, 0; cds-CXP41_RS20135, NZ_CP025268.1, 3863095, 3863909, -, 815, 0; cds-CXP41_RS20140, NZ_CP025268.1, 3863909, 3865521, -, 1613, 5; cds-WP_001300779.1, NZ_CP025268.1, 3865817, 3866533, +, 717, 0; cds-WP_001279752.1, NZ_CP025268.1, 3866530, 3868191, -, 1662, 2753; cds-WP_001243431.1, NZ_CP025268.1, 3868387, 3868815, -, 429, 35; cds-WP_001243437.1, NZ_CP025268.1, 3868927, 3869340, -, 414, 16367; cds-WP _000620888.1, NZ_CP025268.1, 3869646, 3869978, +, 333, 82; cds-WP _001336371.1, NZ_CP025268.1, 3869980, 3871194, -, 1215, 3; cds-WP _001340434.1, NZ_CP025268.1, 3871295, 3872359, +, 1065, 0; cds-WP _000253455.1, NZ_CP025268.1, 3872356, 3873693, -, 1338, 1951; cds-WP _000705001.1, NZ_CP025268.1, 3873768, 3874916, -, 1149, 766; cds-WP _001198722.1, NZ_CP025268.1, 3874913, 3875530, -, 618, 0; cds-WP _000127091.1, NZ_CP025268.1, 3875514, 3876392, -, 879, 0; cds-WP_000174305.1, NZ_CP025268.1, 3876389, 3877078, -, 690, 0; cds-WP_000772934.1, NZ_CP025268.1, 3877356, 3878012, +, 657, 82; cds-WP _000985549.1, NZ_CP025268.1, 3878058, 3878870, -, 813, 112987; cds-WP _000522208.1, NZ_CP025268.1, 3878985, 3879383, -, 399, 1; cds-WP _000072067.1, NZ_CP025268.1, 3879623, 3882037, -, 2415, 563499; cds-WP _000060112.1, NZ_CP025268.1, 3882066, 3883139, -, 1074, 435621; cds-WP _000673464.1, NZ_CP025268.1, 3883139, 3884239, -, 1101, 245630; cds-WP _000059111.1, NZ_CP025268.1, 3884244, 3885647, -, 1404, 155359; cds-WP_120795392.1, NZ_CP025268.1, 3885944, 3886024, +, 81, 0; cds-WP_000831330.1, NZ_CP025268.1, 3886254, 3886394, +, 141, 89214; cds-WP _000239730.1, NZ_CP025268.1, 3886411, 3886770, +, 360, 511738; cds-WP _001307474.1, NZ_CP025268.1, 3886734, 3886991, +, 258, 714363; cds-WP _000378250.1, NZ_CP025268.1, 3886994, 3888640, +, 1647, 3228559; cds-WP _001282346.1, NZ_CP025268.1, 3888746, 3890110, +, 1365, 225559; cds-WP _001364348.1, NZ_CP025268.1, 3890353, 3890427, +, 75, 0; cds-WP_001295247.1, NZ_CP025268.1, 3890648, 3892063, +, 1416, 0; cds-WP_000131925.1, NZ_CP025268.1, 3892154, 3893401, +, 1248, 0; cds-WP_101348691.1, NZ_CP025268.1, 3893533, 3894708, +, 1176, 23464; cds-WP _001311238.1, NZ_CP025268.1, 3894683, 3895642, +, 960, 47438; cds-WP _001296581.1, NZ_CP025268.1, 3895799, 3896548, +, 750, 99465; cds-WP _001291268.1, NZ_CP025268.1, 3896570, 3897136, +, 567, 29417; cds-WP_000019348.1, NZ_CP025268.1, 3897190, 3898527, -, 1338, 644268; cds-CXP41_RS20310, NZ_CP025268.1, 3898692, 3899358, +, 667, 0; cds-WP_000116777.1, NZ_CP025268.1, 3899425, 3899892, +, 468, 1; cds-WP_000193072.1, NZ_CP025268.1, 3899941, 3900528, +, 588, 0; cds-WP _000766900.1, NZ_CP025268.1, 3900590, 3901312, -, 723, 0; cds-WP_001336377.1, NZ_CP025268.1, 3901327, 3902496, -, 1170, 0; cds-WP_000489881.1, NZ_CP025268.1, 3902523, 3904139, -, 1617, 0; cds-WP_000643228.1, NZ_CP025268.1, 3904208, 3905620, -, 1413, 0; cds-WP _000137296.1, NZ_CP025268.1, 3905639, 3907516, -, 1878, 280602; cds-WP _001295251.1, NZ_CP025268.1, 3907650, 3908486, -, 837, 0; cds-WP_000377786.1, NZ_CP025268.1, 3908772, 3909497, -, 726, 205679; cds-WP _000063125.1, NZ_CP025268.1, 3909512, 3910285, -, 774, 239107; cds-WP _001251998.1, NZ_CP025268.1, 3910468, 3911358, -, 891, 168777; cds-WP _000741620.1, NZ_CP025268.1, 3911358, 3912317, -, 960, 49866; cds-WP_000867146.1, NZ_CP025268.1, 3912404, 3913444, -, 1041, 1616; cds-WP _047397264.1, NZ_CP025268.1, 3913758, 3915587, -, 1830, 3647621; cds-WP _000933736.1, NZ_CP025268.1, 3915749, 3917119, -, 1371, 1025329; cds-WP _001251965.1, NZ_CP025268.1, 3917472, 3917891, -, 420, 576702; cds-WP _000190506.1, NZ_CP025268.1, 3917912, 3919294, -, 1383, 2956632; cds-WP_000896498.1, NZ_CP025268.1, 3919321, 3920184, -, 864, 4171310; cds-WP _001176745.1, NZ_CP025268.1, 3920235, 3921776, -, 1542, 4640035; cds-WP_001288587.1, NZ_CP025268.1, 3921789, 3922322, -, 534, 1048830; cds-WP _001052219.1, NZ_CP025268.1, 3922337, 3922807, -, 471, 2185721; cds-WP_000429386.1, NZ_CP025268.1, 3922869, 3923108, -, 240, 537530; cds-WP_000135625.1, NZ_CP025268.1, 3923155, 3923970, -, 816, 2075845; cds-WP _000116695.1, NZ_CP025268.1, 3923979, 3924359, -, 381, 246809; cds-WP _000932839.1, NZ_CP025268.1, 3924976, 3925599, -, 624, 40092; cds-WP_000499788.1, NZ_CP025268.1, 3925663, 3927552, -, 1890, 1333383; cds-WP _000763724.1, NZ_CP025268.1, 3927931, 3928374, -, 444, 153344; cds-WP_000432970.1, NZ_CP025268.1, 3928464, 3928922, -, 459, 0; cds-WP_000845104.1, NZ_CP025268.1, 3929074, 3930066, +, 993, 6360; cds-WP _000956642.1, NZ_CP025268.1, 3930071, 3931522, -, 1452, 1905; cds-WP _001299914.1, NZ_CP025268.1, 3931516, 3933012, -, 1497, 0; cds-WP_000102319.1, NZ_CP025268.1, 3933235, 3935103, +, 1869, 24613; cds-WP_001301979.1, NZ_CP025268.1, 3935270, 3935689, +, 420, 18; cds-WP _000387770.1, NZ_CP025268.1, 3935697, 3937202, +, 1506, 185324; cds-WP _000211858.1, NZ_CP025268.1, 3937207, 3938172, +, 966, 90371; cds-WP_001056271.1, NZ_CP025268.1, 3938197, 3939087, +, 891, 149749; cds-WP _001300603.1, NZ_CP025268.1, 3939213, 3940142, +, 930, 155374; cds-WP _000224470.1, NZ_CP025268.1, 3940146, 3941138, +, 993, 264441; cds-WP_101348692.1, NZ_CP025268.1, 3941104, 3942531, -, 1428, 5063; cds-WP _001131164.1, NZ_CP025268.1, 3942554, 3943246, -, 693, 276; cds-WP _000379245.1, NZ_CP025268.1, 3949047, 3949886, -, 840, 76707; cds-WP_000841001.1, NZ_CP025268.1, 3950005, 3950343, +, 339, 98628; cds-WP_000058964.1, NZ_CP025268.1, 3950368, 3951888, -, 1521, 191247; cds-WP_001311244.1, NZ_CP025268.1, 3952241, 3952339, +, 99, 1; cds-WP _001387183.1, NZ_CP025268.1, 3952426, 3952476, +, 51, 5; cds-CXP41_RS20575, NZ_CP025268.1, 3952479, 3954123, +, 1645, 35755; cds-WP _000983255.1, NZ_CP025268.1, 3954120, 3954383, +, 264, 46571; cds-WP _000208520.1, NZ_CP025268.1, 3954403, 3955332, +, 930, 586; cds-WP_001127399.1, NZ_CP025268.1, 3955397, 3957247, +, 1851, 6; cds-WP_000785596.1, NZ_CP025268.1, 3957250, 3958794, +, 1545, 9; cds-WP _000365791.1, NZ_CP025268.1, 3958846, 3959739, -, 894, 5; cds-WP _000024939.1, NZ_CP025268.1, 3959889, 3961364, +, 1476, 136198; cds-WP _001140251.1, NZ_CP025268.1, 3961451, 3961732, -, 282, 1933; cds-CXP41_RS20615, NZ_CP025268.1, 3961931, 3962379, -, 449, 0; cds-WP_101348693.1, NZ_CP025268.1, 3962596, 3964617, +, 2022, 57897; cds-WP_101348694.1, NZ_CP025268.1, 3964664, 3966148, -, 1485, 1326354; cds-WP _000047499.1, NZ_CP025268.1, 3966284, 3967549, -, 1266, 444515; cds-WP _001280776.1, NZ_CP025268.1, 3967680, 3968009, +, 330, 82772; cds-WP _001295255.1, NZ_CP025268.1, 3968150, 3968251, +, 102, 99997; cds-WP_001054527.1, NZ_CP025268.1, 3968336, 3969595, +, 1260, 3609513; cds-WP_001050960.1, NZ_CP025268.1, 3969835, 3970938, +, 1104,


459326; cds-WP_101348695.1, NZ_CP025268.1, 3970950, 3972014, +, 1065, 881019; cds-WP _001340422.1, NZ_CP025268.1, 3972053, 3973183, +, 1131, 190405; cds-WP_000006621.1, NZ_CP025268.1, 3973180, 3974442, +, 1263, 461537; cds-WP _001226601.1, NZ_CP025268.1, 3974442, 3975509, +, 1068, 802708; cds-WP _000676056.1, NZ_CP025268.1, 3975528, 3976409, +, 882, 1592; cds-WP_001145183.1, NZ_CP025268.1, 3976387, 3977061, +, 675, 59260; cds-WP _000612043.1, NZ_CP025268.1, 3977066, 3978196, +, 1131, 511768; cds-WP_101348696.1, NZ_CP025268.1, 3978198, 3979448, +, 1251, 62950; cds-WP_000217234.1, NZ_CP025268.1, 3979445, 3980524, +, 1080, 242435; cds-WP _000055129.1, NZ_CP025268.1, 3980521, 3981873, +, 1353, 8305; cds-WP _001064040.1, NZ_CP025268.1, 3981876, 3982616, +, 741, 1; cds-CXP41_RS20720, NZ_CP025268.1, 3982807, 3984194, +, 1388, 124912; cds-WP _000941517.1, NZ_CP025268.1, 3984880, 3986115, +, 1236, 234957; cds-WP _000395863.1, NZ_CP025268.1, 3986274, 3987929, -, 1656, 1830; cds-WP _000921791.1, NZ_CP025268.1, 3988608, 3989804, -, 1197, 40427; cds-WP _000138997.1, NZ_CP025268.1, 3989807, 3990988, -, 1182, 298164; cds-WP _000026046.1, NZ_CP025268.1, 3991010, 3991750, -, 741, 135080; cds-WP _001338644.1, NZ_CP025268.1, 3991747, 3992688, -, 942, 48; cds-WP_101348697.1, NZ_CP025268.1, 3993075, 3995621, +, 2547, 1121125; cds-WP_000999947.1, NZ_CP025268.1, 3995661, 3995981, -, 321, 0; cds-WP_000799889.1, NZ_CP025268.1, 3996444, 3996647, +, 204, 461; cds-WP _001160654.1, NZ_CP025268.1, 3996684, 3997508, +, 825, 95123; cds-WP_000812796.1, NZ_CP025268.1, 3997505, 3998212, +, 708, 54573; cds-WP_000130691.1, NZ_CP025268.1, 3998209, 3999105, +, 897, 350117; cds-WP _001213584.1, NZ_CP025268.1, 3999105, 3999821, +, 717, 9434; cds-WP _000383406.1, NZ_CP025268.1, 3999905, 4002067, +, 2163, 104358; cds-WP_000951133.1, NZ_CP025268.1, 4002214, 4002978, -, 765, 268; cds-WP_211180520.1, NZ_CP025268.1, 4003140, 4003196, +, 57, 69288; cds-WP _000947159.1, NZ_CP025268.1, 4003348, 4004298, +, 951, 159779; cds-WP_000032581.1, NZ_CP025268.1, 4004341, 4004721, -, 381, 15; cds-WP_000955197.1, NZ_CP025268.1, 4004735, 4005151, -, 417, 0; cds-WP _000339104.1, NZ_CP025268.1, 4005210, 4006100, -, 891, 104828; cds-WP _001277142.1, NZ_CP025268.1, 4006152, 4006619, -, 468, 0; cds-WP_001259700.1, NZ_CP025268.1, 4006784, 4007653, +, 870, 86202; cds-WP _000035581.1, NZ_CP025268.1, 4007786, 4009615, +, 1830, 214996; cds-WP_000928824.1, NZ_CP025268.1, 4009679, 4010299, +, 621, 21520; cds-WP _000171710.1, NZ_CP025268.1, 4010361, 4010981, -, 621, 27806; cds-WP_000487654.1, NZ_CP025268.1, 4011092, 4012114, +, 1023, 49; cds-WP_000285362.1, NZ_CP025268.1, 4012122, 4012922, +, 801, 1017; cds-WP _001196238.1, NZ_CP025268.1, 4012998, 4013897, +, 900, 297; cds-WP _000573621.1, NZ_CP025268.1, 4013785, 4014738, -, 954, 0; cds-WP _000153907.1, NZ_CP025268.1, 4014975, 4017236, +, 2262, 33; cds-WP_001336442.1, NZ_CP025268.1, 4017276, 4018091, -, 816, 1; cds-WP_000045177.1, NZ_CP025268.1, 4018353, 4019114, +, 762, 3285; cds-WP _000347714.1, NZ_CP025268.1, 4019255, 4020682, +, 1428, 76900; cds-WP_000227958.1, NZ_CP025268.1, 4020777, 4021532, +, 756, 164300; cds-WP_001295259.1, NZ_CP025268.1, 4021546, 4022151, +, 606, 585342; cds-WP _000187530.1, NZ_CP025268.1, 4022148, 4023788, +, 1641, 708483; cds-WP_001295260.1, NZ_CP025268.1, 4023867, 4024136, +, 270, 19144; cds-WP_000459594.1, NZ_CP025268.1, 4024140, 4024655, +, 516, 508380; cds-WP_000109943.1, NZ_CP025268.1, 4024658, 4025434, +, 777, 47609; cds-WP _000459630.1, NZ_CP025268.1, 4025476, 4026258, +, 783, 8270; cds-WP_001192396.1, NZ_CP025268.1, 4026255, 4026743, -, 489, 16696; cds-WP_000339804.1, NZ_CP025268.1, 4026910, 4028403, +, 1494, 205198; cds-WP_000209826.1, NZ_CP025268.1, 4028449, 4029150, +, 702, 186952; cds-WP _000438725.1, NZ_CP025268.1, 4029531, 4030694, -, 1164, 227494; cds-WP_000965936.1, NZ_CP025268.1, 4030704, 4032893, -, 2190, 1831; cds-WP _000444561.1, NZ_CP025268.1, 4033083, 4034414, +, 1332, 219173; cds-WP _001308167.1, NZ_CP025268.1, 4034414, 4035028, +, 615, 74896; cds-WP _000545677.1, NZ_CP025268.1, 4035067, 4036518, +, 1452, 233528; cds-WP_000853959.1, NZ_CP025268.1, 4036530, 4037075, +, 546, 11744; cds-WP _000907622.1, NZ_CP025268.1, 4042828, 4043355, -, 528, 4; cds-WP_001052181.1, NZ_CP025268.1, 4043337, 4043921, -, 585, 4718; cds-WP_001295263.1, NZ_CP025268.1, 4043991, 4044260, +, 270, 17; cds-WP_001065497.1, NZ_CP025268.1, 4044337, 4045323, +, 987, 53485; cds-WP _000725337.1, NZ_CP025268.1, 4045340, 4045966, +, 627, 69008; cds-WP _001333507.1, NZ_CP025268.1, 4046121, 4047551, +, 1431, 1235; cds-WP _001311257.1, NZ_CP025268.1, 4047592, 4048524, -, 933, 404; cds-WP _000250006.1, NZ_CP025268.1, 4048888, 4051674, +, 2787, 94328; cds-WP _000183349.1, NZ_CP025268.1, 4052055, 4052687, -, 633, 36449; cds-WP_001295266.1, NZ_CP025268.1, 4053269, 4053778, +, 510, 18; cds-WP_000116090.1, NZ_CP025268.1, 4053967, 4055340, +, 1374, 50126; cds-WP _000893994.1, NZ_CP025268.1, 4055569, 4055679, -, 111, 5276; cds-WP_001188777.1, NZ_CP025268.1, 4055791, 4057200, -, 1410, 289713; cds-WP_000190577.1, NZ_CP025268.1, 4057212, 4058261, -, 1050, 46250; cds-WP_001271717.1, NZ_CP025268.1, 4058547, 4059956, -, 1410, 985980; cds-WP _000570668.1, NZ_CP025268.1, 4060329, 4062152, +, 1824, 2320178; cds-WP_000829798.1, NZ_CP025268.1, 4062369, 4063079, +, 711, 0; cds-WP _000256396.1, NZ_CP025268.1, 4063087, 4064067, +, 981, 0; cds-WP _000956313.1, NZ_CP025268.1, 4064169, 4065434, +, 1266, 0; cds-WP_000723465.1, NZ_CP025268.1, 4065525, 4066217, -, 693, 0; cds-WP_001295267.1, NZ_CP025268.1, 4066285, 4067688, -, 1404, 0; cds-WP _000018380.1, NZ_CP025268.1, 4067731, 4069116, -, 1386, 0; cds-WP_000380843.1, NZ_CP025268.1, 4069162, 4071198, -, 2037, 1107; cds-WP _001295268.1, NZ_CP025268.1, 4071397, 4072299, -, 903, 0; cds-WP _000870916.1, NZ_CP025268.1, 4072437, 4073678, -, 1242, 0; cds-WP _001046453.1, NZ_CP025268.1, 4073695, 4074573, -, 879, 2538; cds-WP_000718893.1, NZ_CP025268.1, 4074597, 4075493, -, 897, 0; cds-WP _000621656.1, NZ_CP025268.1, 4075661, 4076557, +, 897, 134; cds-WP _000059678.1, NZ_CP025268.1, 4076591, 4077376, +, 786, 4529; cds-WP_001295269.1, NZ_CP025268.1, 4077475, 4078074, +, 600,1; cds-WP_000920762.1, NZ_CP025268.1, 4078068, 4078940, +, 873, 8726; cds-WP _000560983.1, NZ_CP025268.1, 4078937, 4079374, +, 438, 3257; cds-WP_001297068.1, NZ_CP025268.1, 4079419, 4080360, +, 942, 71516; cds-WP_001295676.1, NZ_CP025268.1, 4081213, 4081431, +, 219, 0; cds-WP_001086388.1, NZ_CP025268.1, 4081649, 4081891, +, 243, 0; cds-WP_000027703.1, NZ_CP025268.1, 4082221, 4083150, -, 930, 322886; cds-WP_000829013.1, NZ_CP025268.1, 4083147, 4083782, -, 636, 166370; cds-WP_000331377.1, NZ_CP025268.1, 4083779, 4084681, -, 903, 1152679; cds-WP _010723259.1, NZ_CP025268.1, 4084694, 4087744, -, 3051, 6889307; cds-WP _000753617.1, NZ_CP025268.1, 4087938, 4088771, +, 834, 66; cds-WP_001295677.1, NZ_CP025268.1, 4088924, 4089979, +, 1056, 1; cds-WP_000931299.1, NZ_CP025268.1, 4090029, 4091777, -, 1749, 0; cds-WP_001019484.1, NZ_CP025268.1, 4091777, 4092847, -, 1071, 0; cds-WP _000446023.1, NZ_CP025268.1, 4092837, 4094288, -, 1452, 0; cds-WP _000729595.1, NZ_CP025268.1, 4094299, 4094745, -, 447, 0; cds-WP_000619493.1, NZ_CP025268.1, 4095046, 4095360, -, 315, 0; cds-WP _001179745.1, NZ_CP025268.1, 4095370, 4096194, -, 825, 0; cds-WP_001311268.1, NZ_CP025268.1, 4096645, 4097904, -, 1260, 213; cds-WP _000144073.1, NZ_CP025268.1, 4097901, 4099370, -, 1470, 0; cds-WP _000217137.1, NZ_CP025268.1, 4099658, 4100494, +, 837, 0; cds-WP_001336056.1, NZ_CP025268.1, 4100568, 4101416, +, 849, 2; cds-WP_000063526.1, NZ_CP025268.1, 4101413, 4102447, -, 1035, 1; cds-WP _000122641.1, NZ_CP025268.1, 4102732, 4103352, +, 621, 44783; cds-WP _001166063.1, NZ_CP025268.1, 4103612, 4104595, +, 984, 256; cds-WP _001270260.1, NZ_CP025268.1, 4104744, 4105418, +, 675, 32455; cds-WP _000580417.1, NZ_CP025268.1, 4105524, 4106897, -, 1374, 231365; cds-WP _001033722.1, NZ_CP025268.1, 4106894, 4107592, -, 699, 64674; cds-WP_001223800.1, NZ_CP025268.1, 4107742, 4108242, +, 501, 62564; cds-WP_001076742.1, NZ_CP025268.1, 4108391, 4109293, +, 903, 3; cds-WP _000591795.1, NZ_CP025268.1, 4109474, 4110436, +, 963, 157830; cds-WP _001045689.1, NZ_CP025268.1, 4110756, 4111745, +, 990, 5; cds-WP_001326656.1, NZ_CP025268.1, 4111852, 4112607, +, 756, 277; cds-WP_001216325.1, NZ_CP025268.1, 4112662, 4113429, -, 768, 16296; cds-WP_000802216.1, NZ_CP025268.1, 4113537, 4114136, -, 600, 0; cds-WP_000155257.1, NZ_CP025268.1, 4114237, 4114677, +, 441, 0; cds-WP_000655989.1, NZ_CP025268.1, 4114889, 4115188, +, 300, 158; cds-WP _000323556.1, NZ_CP025268.1, 4115215, 4115643, +, 429, 118532; cds-WP_000796332.1, NZ_CP025268.1, 4115648, 4116394, -, 747, 9; cds-WP_001250644.1, NZ_CP025268.1, 4116491, 4117501, -, 1011, 52444; cds-WP_101348698.1, NZ_CP025268.1, 4117636, 4119144, -, 1509, 77; cds-WP_000084268.1, NZ_CP025268.1, 4119167, 4120012, -, 846, 6133; cds-WP _001296623.1, NZ_CP025268.1, 4120437, 4120682, +, 246, 1648; cds-WP_000872908.1, NZ_CP025268.1, 4120767, 4121252, -, 486, 76969; cds-WP_000139496.1, NZ_CP025268.1, 4121345, 4122271, -, 927, 59632; cds-WP _001293341.1, NZ_CP025268.1, 4122338, 4123669, -, 1332, 937425; cds-WP_000208242.1, NZ_CP025268.1, 4123679, 4124209, -, 531, 289081; cds-WP_000068828.1, NZ_CP025268.1, 4124302, 4125261, -, 960, 175443; cds-WP_000644904.1, NZ_CP025268.1, 4125353, 4126378, -, 1026, 100086; cds-WP _001301269.1, NZ_CP025268.1, 4126534, 4128732, -, 2199, 764921; cds-WP _000710769.1, NZ_CP025268.1, 4128935, 4129147, +, 213, 60050; cds-WP _000797353.1, NZ_CP025268.1, 4129208, 4129816, -, 609, 48; cds-WP_000852812.1, NZ_CP025268.1, 4130000, 4130317, -, 318, 586; cds-WP _001295694.1, NZ_CP025268.1, 4130594, 4131754, +, 1161, 1; cds-WP_000110772.1, NZ_CP025268.1, 4131757, 4134189, +, 2433, 242835; cds-WP_000007523.1, NZ_CP025268.1, 4134538, 4135428, +, 891, 48; cds-WP _001295695.1, NZ_CP025268.1, 4135757, 4137937, +, 2181, 17216; cds-WP _001271242.1, NZ_CP025268.1, 4138030, 4138935, +, 906, 0; cds-WP_000647891.1, NZ_CP025268.1, 4138962, 4139579, -, 618, 0; cds-WP_000374004.1, NZ_CP025268.1, 4139854, 4140957, -, 1104, 0; cds-WP_000424840.1, NZ_CP025268.1, 4140968, 4141630, -, 663, 0; cds-WP_001174077.1, NZ_CP025268.1, 4141642, 4144143, -, 2502, 0; cds-WP_001004446.1, NZ_CP025268.1, 4144452, 4145531, +, 1080, 0; cds-WP_000161265.1, NZ_CP025268.1, 4145546, 4145866, +, 321, 0; cds-WP_000184811.1, NZ_CP025268.1, 4145917, 4148214, +, 2298, 44; cds-WP_000204105.1, NZ_CP025268.1, 4148180, 4149058, +, 879, 0; cds-WP_000323846.1, NZ_CP025268.1, 4149060, 4149401, +, 342, 0; cds-WP_101348699.1, NZ_CP025268.1, 4149388, 4150239, -, 852, 5; cds-WP_101348700.1, NZ_CP025268.1, 4150454, 4152187, -, 1734, 272899; cds-WP _001005586.1, NZ_CP025268.1, 4152369, 4155020, -, 2652, 85224; cds-WP _001298964.1, NZ_CP025268.1, 4155618, 4156769, -, 1152, 16687; cds-WP _000935370.1, NZ_CP025268.1, 4156923, 4157927, +, 1005, 8810; cds-WP_001302318.1, NZ_CP025268.1, 4157935, 4158711, +, 777, 17214; cds-WP_001230087.1, NZ_CP025268.1, 4158772, 4160145, +, 1374, 1; cds-WP_101348701.1, NZ_CP025268.1, 4160412, 4161329, +, 918, 16; cds-WP _001120810.1, NZ_CP025268.1, 4161312, 4162712, -, 1401, 2241; cds-WP _001309117.1, NZ_CP025268.1, 4163043, 4163693, +, 651, 42079; cds-WP_000806411.1, NZ_CP025268.1, 4163693, 4164052, +, 360, 27441; cds-WP_000187022.1, NZ_CP025268.1, 4164092, 4165192, -, 1101, 445044; cds-WP_000591359.1, NZ_CP025268.1, 4165561, 4167405, +, 1845, 106792; cds-WP_000201820.1, NZ_CP025268.1, 4167350, 4168207, +, 858, 6285; cds-WP_001016699.1, NZ_CP025268.1, 4173979, 4175007, +, 1029, 7481; cds-WP _000654630.1, NZ_CP025268.1, 4175004, 4175969, +, 966, 40101; cds-WP_000023081.1, NZ_CP025268.1, 4175998, 4176948, -, 951, 165948; cds-WP _000031784.1, NZ_CP025268.1, 4177866, 4179050, +, 1185, 9189359; cds-WP _001275702.1, NZ_CP025268.1, 4179280, 4179663, +, 384, 644556; cds-WP _001287516.1, NZ_CP025268.1, 4179665, 4180210, +, 546, 157940; cds-WP _001085926.1, NZ_CP025268.1, 4180369, 4180797, +, 429, 3020157; cds-WP _001096684.1, NZ_CP025268.1, 4180801, 4181505, +, 705, 10979757; cds-WP_001207201.1, NZ_CP025268.1, 4181918, 4182415, +, 498, 16356929; cds-WP _000028878.1, NZ_CP025268.1, 4182482, 4182847, +, 366, 7794591; cds-WP _000263098.1, NZ_CP025268.1, 4183167, 4187195, +, 4029, 17562917; cds-WP _000653944.1, NZ_CP025268.1, 4187272, 4191495, +, 4224, 18484796; cds-WP _001307500.1, NZ_CP025268.1,


4191708, 4192247, +, 540, 18627; cds-WP_000847447.1, NZ_CP025268.1, 4192657, 4193790, -, 1134, 135825; cds-WP_000944104.1, NZ_CP025268.1, 4193787, 4194557, -, 771, 43844; cds-WP_001166226.1, NZ_CP025268.1, 4194559, 4194759, -, 201, 0; cds-WP_000999737.1, NZ_CP025268.1, 4194743, 4195498, -, 756, 0; cds-WP_000284615.1, NZ_CP025268.1, 4195491, 4196126, -, 636, 0; cds-WP_001276926.1, NZ_CP025268.1, 4196126, 4198021, -, 1896, 198; cds-WP_000934302.1, NZ_CP025268.1, 4198254, 4198730, -, 477, 42; cds-WP_000373940.1, NZ_CP025268.1, 4198825, 4199598, +, 774, 44; cds-WP_000137657.1, NZ_CP025268.1, 4199638, 4200702, +, 1065, 13411; cds-WP_000362388.1, NZ_CP025268.1, 4200712, 4201383, +, 672, 68; cds-WP_000940106.1, NZ_CP025268.1, 4201426, 4202016, +, 591, 45282; cds-CXP41_RS21775, NZ_CP025268.1, 4202203, 4202475, +, 273, 20672; cds-WP_001084037.1, NZ_CP025268.1, 4202488, 4203183, +, 696, 20186; cds-WP_000828222.1, NZ_CP025268.1, 4203185, 4203610, -, 426, 7125; cds-WP_001211892.1, NZ_CP025268.1, 4203848, 4205245, +, 1398, 0; cds-WP_000148503.1, NZ_CP025268.1, 4205242, 4206567, +, 1326, 0; cds-WP_000866800.1, NZ_CP025268.1, 4206564, 4207853, -, 1290, 34; cds-WP_001187559.1, NZ_CP025268.1, 4207865, 4209454, -, 1590, 204981; cds-WP_001326558.1, NZ_CP025268.1, 4215156, 4215539, +, 384, 35837; cds-WP_000237004.1, NZ_CP025268.1, 4215602, 4216045, -, 444, 322093; cds-WP_001122779.1, NZ_CP025268.1, 4216202, 4217131, +, 930, 4100; cds-WP_000138905.1, NZ_CP025268.1, 4217400, 4219001, +, 1602, 35509; cds-WP_000857856.1, NZ_CP025268.1, 4219031, 4220335, +, 1305, 227; cds-WP_101348702.1, NZ_CP025268.1, 4220518, 4222254, +, 1737, 10; cds-WP_000632913.1, NZ_CP025268.1, 4222223, 4224409, -, 2187, 310; cds-WP_000226403.1, NZ_CP025268.1, 4224726, 4225550, -, 825, 1484; cds-WP_000096011.1, NZ_CP025268.1, 4225750, 4229433, +, 3684, 247; cds-WP_000956830.1, NZ_CP025268.1, 4229653, 4231284, +, 1632, 4817; cds-WP_000421763.1, NZ_CP025268.1, 4231375, 4232064, -, 690, 0; cds-WP_000936377.1, NZ_CP025268.1, 4232276, 4233148, +, 873, 815; cds-WP_001207634.1, NZ_CP025268.1, 4233281, 4233553, -, 273, 41; cds-WP_097756446.1, NZ_CP025268.1, 4233806, 4235155, -, 1350, 25878; cds-WP_000789986.1, NZ_CP025268.1, 4235680, 4237329, +, 1650, 746326; cds-WP_000757333.1, NZ_CP025268.1, 4237828, 4238070, +, 243, 0; cds-WP_001295278.1, NZ_CP025268.1, 4238184, 4238822, +, 639, 0; cds-WP_000595558.1, NZ_CP025268.1, 4238819, 4239556, +, 738, 0; cds-WP_000745776.1, NZ_CP025268.1, 4239556, 4241652, +, 2097, 0; cds-WP_001295279.1, NZ_CP025268.1, 4241699, 4241977, -, 279, 0; cds-WP_000202902.1, NZ_CP025268.1, 4242247, 4242657, +, 411, 0; cds-WP_001097274.1, NZ_CP025268.1, 4242701, 4244176, -, 1476, 0; cds-WP_001252058.1, NZ_CP025268.1, 4244548, 4245438, -, 891, 1; cds-WP_001297290.1, NZ_CP025268.1, 4245453, 4246997, -, 1545, 9; cds-WP_000695387.1, NZ_CP025268.1, 4247151, 4248341, -, 1191, 0; cds-WP_000179165.1, NZ_CP025268.1, 4248706, 4249821, +, 1116, 0; cds-WP_000973663.1, NZ_CP025268.1, 4249893, 4251233, +, 1341, 0; cds-WP_001326641.1, NZ_CP025268.1, 4251476, 4252396, +, 921, 3; cds-CXP41_RS22000, NZ_CP025268.1, 4252625, 4254205, +, 1581, 0; cds-WP_001326644.1, NZ_CP025268.1, 4254428, 4254925, +, 498, 3712; cds-WP_000455227.1, NZ_CP025268.1, 4254938, 4255810, +, 873, 18599; cds-WP_000017354.1, NZ_CP025268.1, 4255965, 4258388, -, 2424, 284739; cds-WP_000002907.1, NZ_CP025268.1, 4258559, 4258927, +, 369, 12636; cds-WP_000646078.1, NZ_CP025268.1, 4259037, 4259645, +, 609, 39652; cds-WP_001326646.1, NZ_CP025268.1, 4259718, 4261043, +, 1326, 147627; cds-WP_001030593.1, NZ_CP025268.1, 4261159, 4261368, +, 210, 10005; cds-WP_001295691.1, NZ_CP025268.1, 4261410, 4261925, -, 516, 10811; cds-CXP41_RS22055, NZ_CP025268.1, 4262243, 4263228, +, 986, 0; cds-WP_001298868.1, NZ_CP025268.1, 4263591, 4264628, +, 1038, 143325; cds-WP_000891404.1, NZ_CP025268.1, 4264762, 4265004, +, 243, 2339; cds-WP_000235508.1, NZ_CP025268.1, 4265170, 4266153, -, 984, 1429; cds-WP_000918363.1, NZ_CP025268.1, 4266236, 4267651, +, 1416, 301052; cds-WP_001147328.1, NZ_CP025268.1, 4267704, 4268783, +, 1080, 164949; cds-WP_000486985.1, NZ_CP025268.1, 4269036, 4270229, +, 1194, 3; cds-WP_001321562.1, NZ_CP025268.1, 4270732, 4270935, -, 204, 0; cds-WP_001226928.1, NZ_CP025268.1, 4271337, 4272050, +, 714, 0; cds-WP_000270375.1, NZ_CP025268.1, 4272161, 4272577, +, 417, 0; cds-WP_000155657.1, NZ_CP025268.1, 4272581, 4272937, +, 357, 0; cds-WP_000357740.1, NZ_CP025268.1, 4272972, 4275794, -, 2823, 317749; cds-WP_000168305.1, NZ_CP025268.1, 4276048, 4276584, +, 537, 41203; cds-WP_001295689.1, NZ_CP025268.1, 4276683, 4276964, -, 282, 8811; cds-WP_000019548.1, NZ_CP025268.1, 4277394, 4278980, +, 1587, 8; cds-WP_000019358.1, NZ_CP025268.1, 4278983, 4279306, -, 324, 2; cds-WP_000412428.1, NZ_CP025268.1, 4279392, 4279856, +, 465, 0; cds-WP_000106882.1, NZ_CP025268.1, 4280402, 4281751, +, 1350, 43933; cds-WP_000402210.1, NZ_CP025268.1, 4281903, 4283552, +, 1650, 15006; cds-WP_001270094.1, NZ_CP025268.1, 4283706, 4284998, -, 1293, 0; cds-WP_000832573.1, NZ_CP025268.1, 4285176, 4286825, -, 1650, 0; cds-WP_001014565.1, NZ_CP025268.1, 4286822, 4287136, -, 315, 0; cds-WP_000078239.1, NZ_CP025268.1, 4287336, 4289294, -, 1959, 618; cds-WP_000196875.1, NZ_CP025268.1, 4289687, 4291123, +, 1437, 0; cds-WP_001295391.1, NZ_CP025268.1, 4291168, 4291734, +, 567, 0; cds-WP_000220281.1, NZ_CP025268.1, 4291731, 4292402, +, 672, 0; cds-WP_000195171.1, NZ_CP025268.1, 4292399, 4293355, +, 957, 0; cds-WP_071524917.1, NZ_CP025268.1, 4293375, 4295093, +, 1719, 0; cds-WP_001032531.1, NZ_CP025268.1, 4295086, 4295469, +, 384, 0; cds-WP_000812896.1, NZ_CP025268.1, 4295466, 4296062, +, 597, 0; cds-WP_000789592.1, NZ_CP025268.1, 4296404, 4297717, +, 1314, 1316; cds-WP_000719886.1, NZ_CP025268.1, 4298361, 4299050, -, 690, 50184; cds-WP_101348703.1, NZ_CP025268.1, 4299144, 4301291, -, 2148, 0; cds-WP_000610601.1, NZ_CP025268.1, 4301489, 4302955, -, 1467, 0; cds-WP_101348704.1, NZ_CP025268.1, 4302952, 4305003, -, 2052, 0; cds-WP_000446378.1, NZ_CP025268.1, 4305003, 4306034, -, 1032, 0; cds-WP_001295389.1, NZ_CP025268.1, 4306053, 4306328, -, 276, 0; cds-WP_001066019.1, NZ_CP025268.1, 4306537, 4308522, -, 1986, 0; cds-WP_001171687.1, NZ_CP025268.1, 4308795, 4309724, -, 930, 0; cds-WP_001311314.1, NZ_CP025268.1, 4309708, 4310403, -, 696, 0; cds-WP_000507106.1, NZ_CP025268.1, 4310414, 4311394, -, 981, 0; cds-WP_000235257.1, NZ_CP025268.1, 4311373, 4312905, -, 1533, 0; cds-WP_001046187.1, NZ_CP025268.1, 4313032, 4313967, -, 936, 0; cds-WP_000083216.1, NZ_CP025268.1, 4314026, 4314916, -, 891, 0; cds-WP_000716794.1, NZ_CP025268.1, 4315275, 4315724, +, 450, 0; cds-WP_000819746.1, NZ_CP025268.1, 4315793, 4316122, +, 330, 0; cds-WP_000059908.1, NZ_CP025268.1, 4316269, 4317027, -, 759, 1; cds-WP_001110490.1, NZ_CP025268.1, 4317029, 4317463, -, 435, 0; cds-WP_000971886.1, NZ_CP025268.1, 4317450, 4318007, -, 558, 0; cds-WP_000586325.1, NZ_CP025268.1, 4318007, 4319143, -, 1137, 0; cds-WP_101348705.1, NZ_CP025268.1, 4319140, 4319820, -, 681, 0; cds-WP_001075514.1, NZ_CP025268.1, 4319931, 4320689, -, 759, 1; cds-WP_000002303.1, NZ_CP025268.1, 4320686, 4321531, -, 846, 0; cds-WP_001295388.1, NZ_CP025268.1, 4321524, 4322588, -, 1065, 0; cds-WP_000171628.1, NZ_CP025268.1, 4322588, 4323172, -, 585, 0; cds-WP_000542790.1, NZ_CP025268.1, 4323169, 4323621, -, 453, 0; cds-WP_001295387.1, NZ_CP025268.1, 4323622, 4324347, -, 726, 0; cds-CXP41_RS22375, NZ_CP025268.1, 4324368, 4325155, -, 788, 0; cds-WP_000992002.1, NZ_CP025268.1, 4325261, 4326277, -, 1017, 0; cds-WP_101348706.1, NZ_CP025268.1, 4326302, 4327090, -, 789, 0; cds-WP_001131339.1, NZ_CP025268.1, 4327223, 4327666, -, 444, 0; cds-WP_001300891.1, NZ_CP025268.1, 4328324, 4328659, -, 336, 1305; cds-WP_000288603.1, NZ_CP025268.1, 4329060, 4331288, +, 2229, 112300; cds-CXP41_RS22410, NZ_CP025268.1, 4331285, 4332164, +, 880, 5897; cds-WP_101348707.1, NZ_CP025268.1, 4332428, 4333930, +, 1503, 895790; cds-WP_000797657.1, NZ_CP025268.1, 4334042, 4334131, +, 90, 33076; cds-WP_001051092.1, NZ_CP025268.1, 4334107, 4335207, -, 1101, 101474; cds-WP_000697926.1, NZ_CP025268.1, 4335208, 4335876, -, 669, 7; cds-WP_000919792.1, NZ_CP025268.1, 4335873, 4337516, -, 1644, 0; cds-WP_000093154.1, NZ_CP025268.1, 4337620, 4338957, -, 1338, 0; cds-WP_001217060.1, NZ_CP025268.1, 4339094, 4339855, -, 762, 0; cds-WP_001381593.1, NZ_CP025268.1, 4340180, 4342447, -, 2268, 11197; cds-WP_001090758.1, NZ_CP025268.1, 4342646, 4343554, -, 909, 0; cds-WP_000986601.1, NZ_CP025268.1, 4343837, 4345192, +, 1356, 14; cds-WP_000028111.1, NZ_CP025268.1, 4345295, 4346716, +, 1422, 0; cds-WP_000198773.1, NZ_CP025268.1, 4346855, 4347484, -, 630, 0; cds-WP_101348708.1, NZ_CP025268.1, 4347606, 4349252, -, 1647, 5; cds-WP_000899522.1, NZ_CP025268.1, 4349330, 4350670, -, 1341, 0; cds-WP_000611288.1, NZ_CP025268.1, 4351241, 4351960, -, 720, 3; cds-WP_001216477.1, NZ_CP025268.1, 4351957, 4353588, -, 1632, 257482; cds-WP_000371704.1, NZ_CP025268.1, 4353769, 4353999, +, 231, 0; cds-WP_000405651.1, NZ_CP025268.1, 4354011, 4354283, +, 273, 151; cds-WP_000398619.1, NZ_CP025268.1, 4354510, 4354806, +, 297, 528; cds-WP_001173343.1, NZ_CP025268.1, 4354834, 4355007, +, 174, 305; cds-WP_001295074.1, NZ_CP025268.1, 4355126, 4356643, -, 1518, 524813; cds-WP_000856829.1, NZ_CP025268.1, 4356880, 4358337, -, 1458, 0; cds-WP_001295383.1, NZ_CP025268.1, 4358396, 4360543, -, 2148, 0; cds-WP_000092909.1, NZ_CP025268.1, 4360623, 4361957, -, 1335, 0; cds-WP_001187173.1, NZ_CP025268.1, 4362322, 4363860, -, 1539, 9375; cds-WP_001188520.1, NZ_CP025268.1, 4364659, 4365234, -, 576, 293; cds-WP_000068922.1, NZ_CP025268.1, 4365271, 4366968, -, 1698, 103; cds-WP_000883400.1, NZ_CP025268.1, 4366944, 4367282, -, 339, 359; cds-WP_000961959.1, NZ_CP025268.1, 4367398, 4368699, -, 1302, 49108; cds-WP_000069437.1, NZ_CP025268.1, 4368817, 4370253, -, 1437, 214; cds-WP_001267448.1, NZ_CP025268.1, 4370590, 4371066, +, 477, 0; cds-WP_000015837.1, NZ_CP025268.1, 4371082, 4372338, -, 1257, 46581; cds-WP_001026276.1, NZ_CP025268.1, 4372614, 4372907, +, 294, 74515; cds-WP_000729117.1, NZ_CP025268.1, 4372951, 4374597, +, 1647, 3333904; cds-WP_000558209.1, NZ_CP025268.1, 4374735, 4375088, +, 354, 0; cds-WP_001008040.1, NZ_CP025268.1, 4375291, 4376160, -, 870, 0; cds-WP_000940549.1, NZ_CP025268.1, 4376555, 4377583, -, 1029, 13765; cds-WP_000257278.1, NZ_CP025268.1, 4377625, 4378191, +, 567, 88357; cds-WP_000977757.1, NZ_CP025268.1, 4378243, 4378368, +, 126, 104613; cds-WP_000239596.1, NZ_CP025268.1, 4378479, 4378625, +, 147, 15126; cds-WP_000118482.1, NZ_CP025268.1, 4378801, 4379118, +, 318, 1233; cds-WP_001238378.1, NZ_CP025268.1, 4379115, 4379648, -, 534, 8; cds-WP_001336292.1, NZ_CP025268.1, 4379737, 4380870, -, 1134, 4266; cds-WP_000609663.1, NZ_CP025268.1, 4380933, 4381292, -, 360, 0; cds-WP_000208757.1, NZ_CP025268.1, 4381303, 4381698, -, 396, 0; cds-WP_000829498.1, NZ_CP025268.1, 4381709, 4382443, -, 735, 33; cds-WP_001192973.1, NZ_CP025268.1, 4382436, 4384244, -, 1809, 23; cds-WP_000004771.1, NZ_CP025268.1, 4384569, 4385546, +, 978, 80834; cds-WP_001336293.1, NZ_CP025268.1, 4385765, 4387267, +, 1503, 61256; cds-WP_000342867.1, NZ_CP025268.1, 4387319, 4387633, +, 315, 217210; cds-WP_001276180.1, NZ_CP025268.1, 4387630, 4387944, +, 315, 106616; cds-WP_001236847.1, NZ_CP025268.1, 4387973, 4391296, -, 3324, 118085; cds-WP_101348709.1, NZ_CP025268.1, 4391318, 4392286, -, 969, 1049361; cds-WP_000041964.1, NZ_CP025268.1, 4392383, 4393435, -, 1053, 383511; cds-WP_001295188.1, NZ_CP025268.1, 4393530, 4394075, +, 546, 86883; cds-WP_010723271.1, NZ_CP025268.1, 4394818, 4394871, +, 54, 178; cds-WP_001294219.1, NZ_CP025268.1, 4394854, 4395993, -, 1140, 70338; cds-WP_001295189.1, NZ_CP025268.1, 4395992, 4397539, +, 1548, 6; cds-WP_000981977.1, NZ_CP025268.1, 4397511, 4397972, +, 462, 0; cds-WP_000990333.1, NZ_CP025268.1, 4397991, 4399328, +, 1338, 288778; cds-WP_001122505.1, NZ_CP025268.1, 4399338, 4401185, +, 1848, 39527; cds-WP_001280345.1, NZ_CP025268.1, 4401178, 4402128, +, 951, 210169; cds-WP_001051883.1, NZ_CP025268.1, 4402214, 4402522, +, 309, 90721; cds-WP_000460362.1, NZ_CP025268.1, 4402598, 4403878, +, 1281, 902688; cds-WP_000312488.1, NZ_CP025268.1, 4403964, 4405223, +, 1260, 762357; cds-WP_001232412.1, NZ_CP025268.1, 4405226, 4406230, +, 1005, 660285; cds-WP_001089295.1, NZ_CP025268.1, 4406312, 4406509, +, 198, 11;


cds-WP_000527955.1, NZ_CP025268.1, 4406613, 4407911, +, 1299, 512206; cds-WP_001177639.1, NZ_CP025268.1, 4408116, 4408541, +, 426, 97852; cds-WP_000076332.1, NZ_CP025268.1, 4408580, 4411021, +, 2442, 482130; cds-WP_001293282.1, NZ_CP025268.1, 4411201, 4411932, +, 732, 18166; cds-WP_000220128.1, NZ_CP025268.1, 4412059, 4412460, +, 402, 24388; cds-WP_000511955.1, NZ_CP025268.1, 4412479, 4413177, +, 699, 0; cds-WP_000012550.1, NZ_CP025268.1, 4413228, 4413887, +, 660, 0; cds-WP_000547760.1, NZ_CP025268.1, 4413905, 4414303, +, 399, 0; cds-WP_000101658.1, NZ_CP025268.1, 4414313, 4414951, +, 639, 0; cds-WP_000943959.1, NZ_CP025268.1, 4414954, 4416117, +, 1164, 0; cds-WP_001350567.1, NZ_CP025268.1, 4416201, 4417826, +, 1626, 1; cds-WP_000811566.1, NZ_CP025268.1, 4417943, 4418218, -, 276, 0; cds-WP_000254633.1, NZ_CP025268.1, 4418367, 4418696, -, 330, 3572; cds-WP_000569707.1, NZ_CP025268.1, 4418878, 4419627, +, 750, 0; cds-WP_000133631.1, NZ_CP025268.1, 4419624, 4420379, -, 756, 2973; cds-WP_001295191.1, NZ_CP025268.1, 4420487, 4421551, -, 1065, 0; cds-WP_001350568.1, NZ_CP025268.1, 4421906, 4423303, +, 1398, 0; cds-WP_000218362.1, NZ_CP025268.1, 4423319, 4423624, +, 306, 0; cds-WP_000776517.1, NZ_CP025268.1, 4423634, 4424098, +, 465, 0; cds-WP_101348710.1, NZ_CP025268.1, 4424112, 4424762, +, 651, 0; cds-WP_000949502.1, NZ_CP025268.1, 4424772, 4425626, +, 855, 0; cds-WP_001170847.1, NZ_CP025268.1, 4425626, 4426312, +, 687, 0; cds-CXP41_RS22905, NZ_CP025268.1, 4426442, 4426716, -, 275, 0; cds-WP_001216676.1, NZ_CP025268.1, 4427043, 4427438, +, 396, 2428846; cds-WP_001315977.1, NZ_CP025268.1, 4427445, 4427759, +, 315, 4722802; cds-WP_000135199.1, NZ_CP025268.1, 4427764, 4427991, +, 228, 4344849; cds-WP_001196062.1, NZ_CP025268.1, 4428033, 4428482, +, 450, 2251752; cds-WP_000174714.1, NZ_CP025268.1, 4428553, 4429347, -, 795, 166290; cds-CXP41_RS22940, NZ_CP025268.1, 4429619, 4430020, +, 402, 0; cds-WP_001119478.1, NZ_CP025268.1, 4430004, 4430642, -, 639, 7; cds-WP_000211225.1, NZ_CP025268.1, 4430860, 4431480, +, 621, 938; cds-WP_000228346.1, NZ_CP025268.1, 4431789, 4433201, +, 1413, 8988; cds-WP_000331456.1, NZ_CP025268.1, 4433246, 4433908, -, 663, 4; cds-WP_001350569.1, NZ_CP025268.1, 4434016, 4434981, -, 966, 2; cds-WP_000560561.1, NZ_CP025268.1, 4435089, 4435949, -, 861, 25; cds-WP_000084622.1, NZ_CP025268.1, 4436038, 4436418, +, 381, 2; cds-WP_000589431.1, NZ_CP025268.1, 4436547, 4438490, -, 1944, 39160; cds-WP_000886919.1, NZ_CP025268.1, 4438680, 4439420, +, 741, 0; cds-WP_000937655.1, NZ_CP025268.1, 4439632, 4440570, +, 939, 69; cds-WP_000175279.1, NZ_CP025268.1, 4440633, 4441187, -, 555, 0; cds-WP_000689228.1, NZ_CP025268.1, 4441512, 4441718, +, 207, 2170; cds-WP_000935036.1, NZ_CP025268.1, 4441797, 4443140, -, 1344, 1492; cds-WP_101348711.1, NZ_CP025268.1, 4443463, 4444101, -, 639, 0; cds-WP_001269327.1, NZ_CP025268.1, 4444307, 4446040, +, 1734, 65055; cds-CXP41_RS23035, NZ_CP025268.1, 4446037, 4449815, +, 3779, 270027; cds-WP_001219160.1, NZ_CP025268.1, 4449818, 4450159, +, 342, 3488; cds-WP_001223208.1, NZ_CP025268.1, 4450371, 4450622, +, 252, 1164; cds-WP_000239577.1, NZ_CP025268.1, 4450616, 4450966, +, 351, 91; cds-WP_000055075.1, NZ_CP025268.1, 4451046, 4451576, -, 531, 62382; cds-WP_000265913.1, NZ_CP025268.1, 4451886, 4452842, +, 957, 68213; cds-WP_000205805.1, NZ_CP025268.1, 4452982, 4454484, +, 1503, 22; cds-WP_001313531.1, NZ_CP025268.1, 4454498, 4455520, +, 1023, 68; cds-WP_000596014.1, NZ_CP025268.1, 4455507, 4456502, +, 996, 5; cds-WP_000853753.1, NZ_CP025268.1, 4456535, 4457533, -, 999, 56; cds-WP_001219813.1, NZ_CP025268.1, 4457709, 4459082, +, 1374, 121451; cds-WP_000166270.1, NZ_CP025268.1, 4459238, 4459789, -, 552, 26242; cds-WP_001162171.1, NZ_CP025268.1, 4459883, 4461235, +, 1353, 646940; cds-WP_023649327.1, NZ_CP025268.1, 4461414, 4461779, +, 366, 596; cds-WP_001106233.1, NZ_CP025268.1, 4461824, 4462288, -, 465, 1; cds-WP_000187778.1, NZ_CP025268.1, 4462446, 4464584, -, 2139, 46173; cds-WP_001336303.1, NZ_CP025268.1, 4464978, 4466633, -, 1656, 141016; cds-WP_001407733.1, NZ_CP025268.1, 4466683, 4468104, -, 1422, 1; cds-WP_001181307.1, NZ_CP025268.1, 4468223, 4469170, -, 948, 78; cds-WP_001387276.1, NZ_CP025268.1, 4469355, 4469408, +, 54, 9463; cds-WP_000471889.1, NZ_CP025268.1, 4469549, 4472245, +, 2697, 1200541; cds-WP_000047539.1, NZ_CP025268.1, 4472451, 4472837, -, 387, 706; cds-WP_000148581.1, NZ_CP025268.1, 4472910, 4473371, -, 462, 129; cds-WP_000013046.1, NZ_CP025268.1, 4473384, 4474319, -, 936, 599; cds-WP_001296693.1, NZ_CP025268.1, 4474323, 4474457, -, 135, 0; cds-WP_000230281.1, NZ_CP025268.1, 4474738, 4475133, -, 396, 3272; cds-WP_000500727.1, NZ_CP025268.1, 4475264, 4475977, -, 714, 0; cds-CXP41_RS23175, NZ_CP025268.1, 4476058, 4476642, +, 585, 2; cds-WP_000583469.1, NZ_CP025268.1, 4476787, 4477239, +, 453, 30; cds-CXP41_RS23185, NZ_CP025268.1, 4477362, 4479177, +, 1816, 45; cds-WP_000012931.1, NZ_CP025268.1, 4479233, 4480237, -, 1005, 30; cds-WP_000002953.1, NZ_CP025268.1, 4480399, 4480815, +, 417, 15127; cds-WP_001059402.1, NZ_CP025268.1, 4480960, 4481463, -, 504, 40697; cds-WP_000079634.1, NZ_CP025268.1, 4481656, 4482852, +, 1197, 25632; cds-WP_000416392.1, NZ_CP025268.1, 4482908, 4485763, -, 2856, 1759757; cds-WP_000786400.1, NZ_CP025268.1, 4485763, 4486206, -, 444, 127753; cds-WP_000397144.1, NZ_CP025268.1, 4486366, 4487877, -, 1512, 216254; cds-WP_211180521.1, NZ_CP025268.1, 4488031, 4488081, +, 51, 194; cds-WP_000584114.1, NZ_CP025268.1, 4488144, 4489244, +, 1101, 10626; cds-WP_001295681.1, NZ_CP025268.1, 4489244, 4490326, +, 1083, 74728; cds-WP_001294573.1, NZ_CP025268.1, 4490487, 4491989, -, 1503, 1872; cds-WP_001309159.1, NZ_CP025268.1, 4492056, 4493054, -, 999, 16681; cds-WP_001128335.1, NZ_CP025268.1, 4493121, 4494440, -, 1320,6236; cds-WP_000998695.1, NZ_CP025268.1, 4494502, 4495266, -, 765, 0; cds-WP_001197411.1, NZ_CP025268.1, 4495290, 4496321, -, 1032, 0; cds-WP_000896738.1, NZ_CP025268.1, 4496538, 4497101, +, 564, 0; cds-WP_001309160.1, NZ_CP025268.1, 4497105, 4498124, -, 1020, 0; cds-CXP41_RS23280, NZ_CP025268.1, 4498590, 4499855, +, 1266, 109719; cds-WP_088895425.1-6, NZ_CP025268.1;NZ_CP025268.1, 4500187;4500502, 4500502;4501415, +;+, 1229, 52084; cds-CXP41_RS23290, NZ_CP025268.1, 4501508, 4502688, -, 1181, 21330; cds-CXP41_RS23305, NZ_CP025268.1, 4503275, 4503504, +, 230, 0; cds-WP_000483767.1, NZ_CP025268.1, 4504018, 4505364, -, 1347, 0; cds-WP_000179691.1, NZ_CP025268.1, 4505973, 4507190, +, 1218, 0; cds-WP_000611568.1, NZ_CP025268.1, 4507202, 4508320, +, 1119, 10; cds-WP_000594405.1, NZ_CP025268.1, 4508363, 4508488, +, 126, 0; cds-WP_000254999.1, NZ_CP025268.1, 4508541, 4508798, -, 258, 0; cds-CXP41_RS24310, NZ_CP025268.1, 4508788, 4509024, +, 237, 0; cds-CXP41_RS23345, NZ_CP025268.1, 4509112, 4509369, +, 258, 1; cds-WP_001254932.1-2, NZ_CP025268.1, 4509381, 4510532, -, 1152, 666; cds-CXP41_RS23355, NZ_CP025268.1, 4510597, 4510857, -, 261, 2; cds-CXP41_RS23360, NZ_CP025268.1, 4510924, 4511708, +, 785, 3; cds-WP_000177057.1, NZ_CP025268.1, 4511791, 4512048, +, 258, 0; cds-CXP41_RS23370, NZ_CP025268.1, 4512605, 4513372, -, 768, 15980; cds-WP_000684852.1, NZ_CP025268.1, 4513373, 4514329, -, 957, 127807; cds-WP_000125187.1, NZ_CP025268.1, 4514326, 4515324, -, 999, 4; cds-WP_000879155.1, NZ_CP025268.1, 4515321, 4516223, -, 903, 15316; cds-WP_101348713.1, NZ_CP025268.1, 4516268, 4518592, -, 2325, 47408; cds-WP_001068910.1, NZ_CP025268.1, 4518679, 4519632, -, 954, 126240; cds-WP_001283626.1, NZ_CP025268.1, 4519629, 4520150, -, 522, 10099; cds-WP_211180522.1, NZ_CP025268.1, 4520287, 4520355, +, 69, 0; cds-CXP41_RS23410, NZ_CP025268.1, 4520442, 4521139, +, 698, 40454; cds-WP_000373366.1, NZ_CP025268.1, 4521253, 4522239, -, 987, 2171; cds-WP_001128363.1, NZ_CP025268.1, 4522586, 4523935, -, 1350, 5; cds-WP_000116326.1, NZ_CP025268.1, 4524042, 4526009, -, 1968, 668; cds-WP_000714563.1, NZ_CP025268.1, 4526020, 4526925, -, 906, 0; cds-WP_000251798.1, NZ_CP025268.1, 4526930, 4527718, -, 789, 0; cds-WP_000082780.1, NZ_CP025268.1, 4528021, 4528803, -, 783, 0; cds-WP_000600622.1, NZ_CP025268.1, 4528820, 4529452, -, 633, 0; cds-WP_101348714.1, NZ_CP025268.1, 4529464, 4529895, -, 432, 0; cds-WP_000118626.1, NZ_CP025268.1, 4530026, 4530832, -, 807, 43725; cds-WP_000460843.1, NZ_CP025268.1, 4530845, 4532158, -, 1314, 1; cds-WP_000722973.1, NZ_CP025268.1, 4532170, 4532448, -, 279, 0; cds-WP_000010829.1, NZ_CP025268.1, 4532445, 4533566, -, 1122, 0; cds-CXP41_RS24410, NZ_CP025268.1, 4533811, 4533927, -, 117, 0; cds-CXP41_RS23480, NZ_CP025268.1, 4533965, 4534183, -, 219, 0; cds-WP_000354251.1, NZ_CP025268.1, 4534352, 4535098, -, 747, 0; cds-WP_001309181.1, NZ_CP025268.1, 4535154, 4535699, -, 546, 0; cds-WP_001054376.1, NZ_CP025268.1, 4535711, 4535968, -, 258, 0; cds-CXP41_RS23505, NZ_CP025268.1, 4536345, 4536590, -, 246, 0; cds-CXP41_RS23515, NZ_CP025268.1, 4536706, 4537946, +, 1241, 0; cds-WP_000991438.1, NZ_CP025268.1, 4538529, 4539509, -, 981, 0; cds-WP_001309184.1, NZ_CP025268.1, 4539574, 4540680, -, 1107, 0; cds-WP_001295734.1, NZ_CP025268.1, 4540700, 4541416, -, 717, 0; cds-WP_032162589.1, NZ_CP025268.1, 4542907, 4543473, +, 567, 10952; cds-WP_000044711.1, NZ_CP025268.1, 4543951, 4544547, +, 597, 1; cds-WP_000695564.1, NZ_CP025268.1, 4545029, 4545577, +, 549, 0; cds-WP_000824114.1, NZ_CP025268.1, 4545642, 4546181, +, 540, 0; cds-WP_000066547.1, NZ_CP025268.1, 4546218, 4546943, +, 726, 0; cds-WP_000121005.1, NZ_CP025268.1, 4547010, 4549646, +, 2637, 9; cds-WP_001244827.1, NZ_CP025268.1, 4549656, 4550186, +, 531, 0; cds-WP_000870592.1, NZ_CP025268.1, 4550199, 4550702, +, 504, 0; cds-WP_000832247.1, NZ_CP025268.1, 4550722, 4551624, +, 903, 0; cds-WP_000558251.1, NZ_CP025268.1, 4551867, 4553210, -, 1344, 0; cds-WP_000438562.1, NZ_CP025268.1, 4553550, 4554734, +, 1185, 354234; cds-WP_000208205.1, NZ_CP025268.1, 4554815, 4556275, +, 1461, 395; cds-WP_000833679.1, NZ_CP025268.1, 4556490, 4557263, +, 774, 2; cds-WP_000062552.1, NZ_CP025268.1, 4557404, 4558234, -, 831, 0; cds-WP_120795393.1, NZ_CP025268.1, 4558827, 4558910, +, 84, 0; cds-WP_001309187.1, NZ_CP025268.1, 4558907, 4559299, +, 393, 6868; cds-WP_000340740.1, NZ_CP025268.1, 4559292, 4560203, -, 912, 5871; cds-WP_000568432.1, NZ_CP025268.1, 4560268, 4561440, -, 1173, 33; cds-WP_000211971.1, NZ_CP025268.1, 4561453, 4561914, -, 462, 0; cds-WP_001295597.1, NZ_CP025268.1, 4561911, 4562594, -, 684, 45090; cds-WP_001151855.1, NZ_CP025268.1, 4562844, 4563398, +, 555, 0; cds-WP_001141220.1, NZ_CP025268.1, 4563411, 4564589, -, 1179, 0; cds-WP_001350572.1, NZ_CP025268.1, 4564657, 4565517, -, 861, 0; cds-WP_000657675.1, NZ_CP025268.1, 4565582, 4565839, -, 258, 0; cds-WP_000331745.1, NZ_CP025268.1, 4565836, 4566603, -, 768, 0; cds-WP_101348716.1, NZ_CP025268.1, 4566613, 4567764, -, 1152, 0; cds-WP_001037419.1, NZ_CP025268.1, 4567880, 4569160, -, 1281, 16424; cds-WP_001137036.1, NZ_CP025268.1, 4569201, 4570433, -, 1233, 30213; cds-CXP41_RS24325, NZ_CP025268.1, 4570912, 4571832, +, 921, 0; cds-WP_000199300.1, NZ_CP025268.1, 4572076, 4573488, -, 1413, 55426; cds-WP_000394280.1, NZ_CP025268.1, 4573665, 4573829, +, 165, 0; cds-CXP41_RS23730, NZ_CP025268.1, 4574328, 4575836, +, 1509, 8144; cds-CXP41_RS23735, NZ_CP025268.1, 4575833, 4578769, +, 2937, 22335; cds-WP_000437621.1, NZ_CP025268.1, 4578826, 4579872, -, 1047, 47608; cds-WP_000443951.1, NZ_CP025268.1, 4579872, 4581251, -, 1380, 124702; cds-WP_000132601.1, NZ_CP025268.1, 4581413, 4581754, -, 342, 0; cds-WP_001272447.1, NZ_CP025268.1, 4581982, 4583376, -, 1395, 61694; cds-WP_001063204.1, NZ_CP025268.1, 4583373, 4584962, -, 1590, 548219; cds-WP_000981388.1, NZ_CP025268.1, 4585163, 4588675, -, 3513, 30496; cds-WP_000217931.1, NZ_CP025268.1, 4588863, 4589777, +, 915, 13; cds-WP_001312515.1, NZ_CP025268.1, 4589823, 4590779, -, 957, 388; cds-WP_000467859.1, NZ_CP025268.1, 4590790, 4590993, -, 204, 169; cds-WP_001299714.1, NZ_CP025268.1, 4591043, 4593193, -, 2151, 200203; cds-WP_000919536.1, NZ_CP025268.1, 4593571, 4595226, +, 1656, 207925; cds-WP_000410113.1, NZ_CP025268.1, 4595275, 4596636, -, 1362, 540260; cds-WP_000091570.1, NZ_CP025268.1, 4596851, 4597765, -, 915, 0; cds-WP_000106030.1, NZ_CP025268.1, 4597904, 4598926, +, 1023, 249; cds-WP_001292679.1, NZ_CP025268.1, 4599064, 4601355, -, 2292, 448880; cds-WP_001308243.1, NZ_CP025268.1, 4601609, 4602103, -, 495, 6173; cds-WP_000799911.1, NZ_CP025268.1, 4602152, 4602889, -, 738, 70; cds-WP_000098818.1,


NZ_CP025268.1, 4602892, 4603431, -, 540, 26; cds-WP_000538191.1, NZ_CP025268.1, 4603538, 4604011, -, 474, 0; cds-WP_001338213.1, NZ_CP025268.1, 4604002, 4604772, -771, 0; cds-WP_000936635.1, NZ_CP025268.1, 4605391, 4606116, +, 726, 0; cds-WP_101348717.1, NZ_CP025268.1, 4606074, 4606751, +, 678, 10596; cds-WP_000331618.1, NZ_CP025268.1, 4606789, 4607577, -, 789, 7845; cds-WP_001393508.1, NZ_CP025268.1, 4607718, 4607954, +, 237, 70402; cds-WP_001272330.1, NZ_CP025268.1, 4608584, 4609615, -, 1032, 60867; cds-WP_000204012.1, NZ_CP025268.1, 4609718, 4610131, +, 414, 9474; cds-WP_001092461.1, NZ_CP025268.1, 4610100, 4610546, +, 447, 3952; cds-WP_000870710.1, NZ_CP025268.1, 4610561, 4611238, +, 678, 123988; cds-WP_000175940.1, NZ_CP025268.1, 4611330, 4612919, +, 1590, 494020; cds-WP_001295748.1, NZ_CP025268.1, 4613312, 4613917, +, 606, 28; cds-WP_000490275.1, NZ_CP025268.1, 4614044, 4614205, +, 162, 8; cds-WP_001299799.1, NZ_CP025268.1, 4614327, 4615400, +, 1074, 7; cds-WP_000563040.1, NZ_CP025268.1, 4615397, 4616176, +, 780, 0; cds-WP_001088415.1, NZ_CP025268.1, 4616596, 4617459, -, 864, 0; cds-WP_001143253.1, NZ_CP025268.1, 4617431, 4618981, -, 1551, 6; cds-WP_001298497.1, NZ_CP025268.1, 4619239, 4620018, +, 780, 22; cds-WP_101348718.1, NZ_CP025268.1, 4620145, 4621458, +, 1314, 283472; cds-WP_101348719.1, NZ_CP025268.1, 4621510, 4622733, +, 1224, 395661; cds-WP_000224877.1, NZ_CP025268.1, 4622790, 4623509, +, 720, 663269; cds-WP_001293115.1, NZ_CP025268.1, 4623676, 4625007, +, 1332, 249081; cds-WP_000105884.1, NZ_CP025268.1, 4625008, 4626024, -, 1017, 194; cds-WP_000124615.1, NZ_CP025268.1, 4626052, 4626696, -, 645, 21710; cds-WP_001132955.1, NZ_CP025268.1, 4626802, 4627770, +, 969, 16; cds-WP_001029687.1, NZ_CP025268.1, 4627819, 4629201, +, 1383, 20693; cds-WP_000093814.1, NZ_CP025268.1, 4629222, 4630454, +, 1233, 193503; cds-WP_000007444.1, NZ_CP025268.1, 4630488, 4630655, +, 168, 45; cds-WP_000046749.1, NZ_CP025268.1, 4630762, 4632429, -, 1668, 731111; cds-WP_000409451.1, NZ_CP025268.1, 4632640, 4634577, +, 1938, 25666; cds-WP_000068679.1, NZ_CP025268.1, 4634667, 4634993, +, 327, 3406; cds-WP_001338221.1, NZ_CP025268.1, 4635140, 4635652, -, 513, 457; cds-WP_000942344.1, NZ_CP025268.1, 4635704, 4636351, +, 648, 46735; cds-WP_000371666.1, NZ_CP025268.1, 4636348, 4637217, -, 870, 35267; cds-WP_000875487.1, NZ_CP025268.1, 4637428, 4637901, +, 474, 123; cds-WP_001188654.1, NZ_CP025268.1, 4637914, 4638603, +, 690, 3; cds-WP_001219577.1, NZ_CP025268.1, 4638603, 4640027, +, 1425, 44533; cds-WP_000920294.1, NZ_CP025268.1, 4640085, 4641437, +, 1353, 177380; cds-WP_001194358.1, NZ_CP025268.1, 4641497, 4642213, -, 717, 204297; cds-WP_001303782.1, NZ_CP025268.1, 4642309, 4642449, +, 141, 895; cds-WP_001223132.1, NZ_CP025268.1, 4642849, 4643535, +, 687, 17;









TABLE 9




Counts table of the small (12k) K. pneumoniae library when analyzed in bulk. Table organized as Geneid, Chr, Start, End, Strand, Length, K.pneumoniae_small; Geneid, Chr, Start, End, Strand, Length, K.pneumoniae_small; etc




cds-AF52_RS22895, NZ_KK737546.1, 1, 1202, +, 1202, 4; cds-AF52_RS22890, NZ_KK737546.1, 1257, 1415, -, 159, 212; cds-AF52_RS26590, NZ_KK737546.1, 6165, 6338, -, 174, 717; cds-AF52_RS26600, NZ_KK737546.1, 8440, 8543, -, 104, 173; cds-AF52_RS0122900, NZ_KK737546.1, 8577, 10166, -, 1590, 0; cds-WP_014228879.1, NZ_KK737546.1, 10308, 10652, -, 345, 0; cds-WP_032429382.1, NZ_KK737546.1, 10695, 10889, -, 195, 0; cds-AF52_RS0122905, NZ_KK737546.1, 11334, 11537, +, 204, 10; cds-AF52_RS26610, NZ_KK737546.1, 11581, 11765, +, 185, 208; cds-AF52_RS22870, NZ_KK737546.1, 12344, 12603, +, 260, 1028; cds-WP_040234937.1, NZ_KK737546.1, 13181, 13495, +, 315, 81216; cds-WP_032429384.1, NZ_KK737546.1, 13777, 14166, -, 390, 5608; cds-WP_072001558.1, NZ_KK737546.1, 14276, 14503, +, 228, 1137; cds-WP_032429385.1, NZ_KK737546.1, 14506, 15060, +, 555, 0; cds-WP_072001559.1, NZ_KK737546.1, 15105, 16124, +, 1020, 0; cds-WP_032429698.1, NZ_KK737546.1, 16117, 16581, +, 465, 2; cds-WP_032429386.1, NZ_KK737546.1, 16595, 17035, +, 441, 0; cds-WP_013815099.1, NZ_KK737546.1, 17339, 18307, -, 969, 1975; cds-WP_004147997.1, NZ_KK737546.1, 18343, 18546, -, 204, 14; cds-WP_139042930.1, NZ_KK737546.1, 19315, 19434, -, 120, 3; cds-WP_016160648.1, NZ_KK737546.1, 20352, 20567, +, 216, 0; cds-WP_032429387.1, NZ_KK737546.1, 20567, 21064, +, 498, 0; cds-WP_016160650.1, NZ_KK737546.1, 21061, 21411, +, 351, 0; cds-WP_050484272.1, NZ_KK737546.1, 22361, 22786, +, 426, 38; cds-WP_013815099.1-2, NZ_KK737546.1, 22812, 23780, -, 969, 7706; cds-WP_023289182.1, NZ_KK737546.1, 23903, 24127, -, 225, 997; cds-WP_162924227.1, NZ_KK737546.1, 24306, 24470, +, 165, 0; cds-AF52_RS24930, NZ_KK737546.1, 24454, 24816, +, 363, 0; cds-WP_023289183.1, NZ_KK737546.1, 24768, 25091, +, 324, 0; cds-WP_023289184.1, NZ_KK737546.1, 25088, 25519, +, 432, 0; cds-WP_012542168.1, NZ_KK737546.1, 25767, 26201, +, 435, 0; cds-WP_021462603.1, NZ_KK737546.1, 26201, 27922, +, 1722, 0; cds-WP_017898992.1, NZ_KK737546.1, 27916, 28095, +, 180, 4; cds-WP_012542166.1, NZ_KK737546.1, 28095, 29354, +, 1260, 0; cds-WP_032429388.1, NZ_KK737546.1, 29391, 30311, +, 921, 0; cds-WP_032429389.1, NZ_KK737546.1, 30389, 31675, +, 1287, 0; cds-WP_014907814.1, NZ_KK737546.1, 31734, 31994, +, 261, 0; cds-WP_020317538.1, NZ_KK737546.1, 31975, 32292, +, 318, 0; cds-WP_014228910.1, NZ_KK737546.1, 32289, 32627, +, 339, 0; cds-WP_032429390.1, NZ_KK737546.1, 32608, 32997, +, 390, 0; cds-WP_017898997.1, NZ_KK737546.1, 32994, 33395, +, 402, 0; cds-WP_014228913.1, NZ_KK737546.1, 33427, 33888, +, 462, 19; cds-WP_014228914.1, NZ_KK737546.1, 33946, 34311, +, 366, 0; cds-WP_032429392.1, NZ_KK737546.1, 34544, 37879, +, 3336, 0; cds-WP_014228916.1, NZ_KK737546.1, 37879, 38217, +, 339, 0; cds-WP_032429393.1, NZ_KK737546.1, 38214, 38969, +, 756, 0; cds-WP_023317958.1, NZ_KK737546.1, 38971, 39681, +, 711, 0; cds-WP_032429394.1, NZ_KK737546.1, 39714, 40061, +, 348, 0; cds-WP_023159867.1, NZ_KK737546.1, 40113, 40706, +, 594, 0; cds-AF52_RS0122945, NZ_KK737546.1, 40769, 53314, +, 12546, 79; cds-WP_032429396.1, NZ_KK737546.1, 53376, 54872, +, 1497, 5; cds-WP_004892953.1, NZ_KK737546.1, 55027, 55179, +,153,188; cds-WP_023279886.1, NZ_KK737546.1, 55452, 56165, -, 714, 0; cds-WP_004190914.1, NZ_KK737546.1, 56162, 56554, -, 393, 0; cds-WP_004150797.1, NZ_KK737546.1, 56547, 56870, -, 324, 0; cds-AF52_RS0122950, NZ_KK737546.1, 56993, 57166, -, 174, 3; cds-WP_004140530.1, NZ_KK737546.1, 57320, 57547, -, 228, 2; cds-WP_021462619.1, NZ_KK737546.1, 57660, 58853, -, 1194, 0; cds-WP_004150795.1, NZ_KK737546.1, 59476, 59661, +, 186, 0; cds-WP_004148027.1, NZ_KK737546.1, 59752, 60246, +, 495, 0; cds-WP_004140514.1, NZ_KK737546.1, 60273, 60779, +, 507, 0; cds-WP_013815099.1-3, NZ_KK737546.1, 60849, 61817, +, 969, 6093; cds-WP_032429398.1, NZ_KK737546.1, 61874, 62749, +, 876, 19; cds-WP_004140511.1, NZ_KK737546.1, 62805, 64211, +, 1407, 3; cds-WP_004183659.1, NZ_KK737546.1, 64208, 65218, +, 1011, 87; cds-WP_004140506.1, NZ_KK737546.1, 65334, 65531, -, 198, 0; cds-WP_004183660.1, NZ_KK737546.1, 66098, 66730, +, 633, 11; cds-WP_004140501.1, NZ_KK737546.1, 66770, 66949, +, 180, 0; cds-WP_004150790.1, NZ_KK737546.1, 67347, 68033, +, 687, 34940; cds-WP_004150789.1, NZ_KK737546.1, 68146, 68310, -, 165, 39; cds-WP_004140497.1, NZ_KK737546.1, 68344, 69852, -, 1509, 0; cds-WP_021313530.1, NZ_KK737546.1, 69973, 70863, +, 891, 1; cds-WP_004213090.1, NZ_KK737546.1, 70870, 72654, -, 1785, 10587; cds-WP_004140494.1, NZ_KK737546.1, 72728, 73936, -, 1209, 37; cds-WP_004179363.1, NZ_KK737546.1, 74239, 75282, +, 1044, 22; cds-WP_004148038.1, NZ_KK737546.1, 75944, 76858, +, 915, 545; cds-WP_004150783.1, NZ_KK737546.1, 76948, 77586, +, 639, 16; cds-WP_004140489.1, NZ_KK737546.1, 77717, 77980, +, 264, 1132; cds-WP_004140488.1, NZ_KK737546.1, 78039, 78164, -, 126, 828; cds-WP_004213093.1, NZ_KK737546.1, 78282, 78356, -, 75, 1; cds-WP_004150782.1, NZ_KK737546.1, 78356, 78457, -, 102, 28; cds-WP_004176549.1, NZ_KK737546.1, 78515, 79528, -, 1014, 1112; cds-WP_004176548.1, NZ_KK737546.1, 79829, 80068, +, 240, 8031; cds-WP_014343000.1, NZ_KK737546.1, 80058, 80396, -, 339, 3; cds-WP_020802835.1, NZ_KK737546.1, 80401, 80910, -, 510, 3; cds-WP_021441569.1, NZ_KK737546.1, 81056, 81748, +, 693, 1811; cds-WP_020324105.1, NZ_KK737546.1, 81780, 82955, -, 1176, 3850; cds-WP_004140469.1, NZ_KK737546.1, 83063, 83857, +, 795, 3; cds-WP_002901080.1, NZ_KK737546.1, 83841, 84287, -, 447, 2; cds-WP_002901088.1, NZ_KK737546.1, 84404, 84904, -, 501, 8; cds-WP_072271772.1, NZ_KK737546.1, 85151, 86287, +, 1137, 0; cds-WP_002901096.1, NZ_KK737546.1, 86458, 86700, -, 243, 1; cds-WP_002901192.1, NZ_KK737546.1, 86971, 87390, +, 420, 0; cds-WP_004152360.1, NZ_KK737546.1, 87393, 88658, +, 1266, 0; cds-WP_021441571.1, NZ_KK737546.1, 88665, 89570, -, 906, 3272; cds-WP_004176542.1, NZ_KK737546.1, 89737, 90486, +, 750, 0; cds-WP_021441573.1, NZ_KK737546.1, 90483, 91700, -, 1218, 0; cds-WP_004179386.1, NZ_KK737546.1, 91876, 92757, +, 882, 23; cds-WP_004220356.1, NZ_KK737546.1, 92828, 92947, -, 120, 342; cds-WP_016946410.1, NZ_KK737546.1, 93015, 93326, +, 312, 0; cds-WP_032428825.1, NZ_KK737546.1, 93618, 94166, +, 549, 0; cds-WP_124053788.1, NZ_KK737546.1, 94180, 94551, +, 372, 0; cds-WP_004140429.1, NZ_KK737546.1, 94548, 95831, -, 1284, 20; cds-WP_002901234.1, NZ_KK737546.1, 95917, 97851, -, 1935, 4403; cds-WP_002901236.1, NZ_KK737546.1, 98268, 99014, +, 747, 59720; cds-WP_072143276.1, NZ_KK737546.1, 99145, 99960, +, 816, 12129; cds-WP_002901240.1, NZ_KK737546.1, 100017, 100901, -, 885, 124773; cds-WP_002901243.1, NZ_KK737546.1, 100976, 101971, -, 996, 484985; cds-WP_002901246.1, NZ_KK737546.1, 102310, 102723, +, 414, 8523; cds-WP_002901249.1, NZ_KK737546.1, 102767, 103045, +, 279, 483; cds-WP_002901254.1, NZ_KK737546.1, 103140, 103484, -, 345, 2002; cds-WP_002901255.1, NZ_KK737546.1, 103645, 104898, -, 1254, 11894; cds-WP_004140413.1, NZ_KK737546.1, 105070, 105711, -, 642, 24509; cds-WP_004176535.1, NZ_KK737546.1, 105721, 106740, -, 1020, 140153; cds-WP_004140411.1, NZ_KK737546.1, 106879, 108732, -, 1854, 532; cds-WP_004176531.1, NZ_KK737546.1, 108898, 109449, +, 552, 19; cds-WP_002901387.1, NZ_KK737546.1, 110185, 110931, -, 747, 11261; cds-WP_004176528.1, NZ_KK737546.1, 111157, 112200, +, 1044, 112; cds-WP_032428827.1, NZ_KK737546.1, 112205, 114151, +, 1947, 13156; cds-WP_004140406.1, NZ_KK737546.1, 114331, 115311, +, 981, 26; cds-WP_004176526.1, NZ_KK737546.1, 115355, 116698, -, 1344, 461; cds-WP_004183673.1, NZ_KK737546.1, 116881, 117291, -, 411, 74; cds-WP_002901398.1, NZ_KK737546.1, 117378, 118001, +, 624, 0; cds-WP_032429402.1, NZ_KK737546.1, 118053, 119360, -, 1308, 115; cds-WP_032428829.1, NZ_KK737546.1, 119454, 120086, -, 633, 0; cds-WP_004892845.1, NZ_KK737546.1, 120086, 121621, -, 1536, 0; cds-WP_004224226.1, NZ_KK737546.1, 121594, 122772, -, 1179, 0; cds-WP_004176519.1, NZ_KK737546.1, 122775, 123335, -, 561, 0; cds-WP_004151923.1, NZ_KK737546.1, 123332, 124042, -, 711, 0; cds-WP_021441584.1, NZ_KK737546.1, 124029, 124685, -, 657, 2; cds-WP_002901486.1, NZ_KK737546.1, 124899, 125705, -, 807, 13016; cds-WP_002901489.1, NZ_KK737546.1, 126144,127364, +, 1221, 19157; cds-WP_032429405.1, NZ_KK737546.1, 127361, 128395, +, 1035, 13524; cds-WP_004151922.1, NZ_KK737546.1, 128392, 129870, +, 1479, 34155;


cds-WP_004892826.1, NZ_KK737546.1, 129867, 131192, +, 1326, 717; cds-WP_021441588.1, NZ_KK737546.1, 131202, 132167, +, 966, 21; cds-WP_004217130.1, NZ_KK737546.1, 132511, 132996, +, 486, 32034; cds-WP_004176514.1, NZ_KK737546.1, 133084, 133947, -, 864, 0; cds-WP_032429406.1, NZ_KK737546.1, 134048, 134875, -, 828, 13161; cds-WP_002901544.1, NZ_KK737546.1, 135158, 135496, +, 339, 654; cds-WP_013815099.1-4, NZ_KK737546.1, 135868, 136836, +, 969, 7626; cds-WP_050484274.1, NZ_KK737546.1, 136880, 137161, +, 282, 10; cds-WP_014907779.1, NZ_KK737546.1, 137181, 137297, +, 117, 0; cds-WP_004148091.1, NZ_KK737546.1, 137309, 138667, +, 1359, 0; cds-WP_004183683.1, NZ_KK737546.1, 138721, 139068, +, 348, 0; cds-WP_002901552.1, NZ_KK737546.1, 139096, 139920, +, 825, 19; cds-WP_032429409.1, NZ_KK737546.1, 140031, 141377, +, 1347, 7628; cds-WP_004179430.1, NZ_KK737546.1, 141390, 142148, +, 759, 9; cds-WP_002901554.1, NZ_KK737546.1, 142206, 144464, -, 2259, 7358; cds-WP_004140343.1, NZ_KK737546.1, 144577, 144909, +, 333, 0; cds-WP_032429412.1, NZ_KK737546.1, 144969, 146360, -, 1392, 127; cds-WP_002901611.1, NZ_KK737546.1, 146496, 147086, -, 591, 0; cds-WP_004176511.1, NZ_KK737546.1, 147178, 147939, -, 762, 648; cds-WP_004140335.1, NZ_KK737546.1, 148089, 148757, -, 669, 7; cds-WP_002901627.1, NZ_KK737546.1, 148946, 149482, +, 537, 372; cds-WP_002901629.1, NZ_KK737546.1, 149512, 149910, -, 399, 13; cds-AF52_RS0123015, NZ_KK737546.1, 150010, 152194, -, 2185, 0; cds-WP_002901631.1, NZ_KK737546.1, 152466, 153005, -, 540, 15; cds-WP_002901632.1, NZ_KK737546.1, 153060, 153803, -, 744, 8777; cds-WP_032429413.1, NZ_KK737546.1, 153829, 154242, -, 414, 437; cds-WP_002901634.1, NZ_KK737546.1, 154512, 155150, +, 639, 0; cds-WP_032429414.1, NZ_KK737546.1, 155235, 155912, -, 678, 13723; cds-WP_032429415.1, NZ_KK737546.1, 155961, 158246, -, 2286, 0; cds-WP_021441592.1, NZ_KK737546.1, 158556, 159263, -, 708, 2; cds-WP_004151911.1, NZ_KK737546.1, 159382, 159582, +, 201, 0; cds-WP_032429416.1, NZ_KK737546.1, 159691, 160638, -, 948, 0; cds-WP_021441594.1, NZ_KK737546.1, 160713, 161171, +, 459, 0; cds-WP_004183698.1, NZ_KK737546.1, 161214, 162122, -, 909, 30; cds-WP_004210755.1, NZ_KK737546.1, 162251, 163561, +, 1311, 0; cds-WP_002901724.1, NZ_KK737546.1, 163576, 164664, +, 1089, 6; cds-WP_004179454.1, NZ_KK737546.1, 164667, 165926, +, 1260, 0; cds-WP_021441596.1, NZ_KK737546.1, 166145, 166954, -, 810, 2; cds-WP_032423750.1, NZ_KK737546.1, 166954, 168147, -, 1194, 23066; cds-WP_032429417.1, NZ_KK737546.1, 168157, 169515, -, 1359, 255; cds-WP_021441599.1, NZ_KK737546.1, 169519, 171114, -, 1596, 0; cds-WP_004176488.1, NZ_KK737546.1, 171114, 172676, -, 1563, 1034; cds-WP_002901735.1, NZ_KK737546.1, 172965, 173828, +, 864, 203; cds-WP_002901738.1, NZ_KK737546.1, 173845, 174465, +, 621, 3597; cds-WP_021441600.1, NZ_KK737546.1, 174487, 175395, -, 909, 0; cds-WP_004176482.1, NZ_KK737546.1, 175507, 176403, +, 897, 0; cds-WP_002901746.1, NZ_KK737546.1, 176685, 177587, +, 903, 991; cds-WP_002901749.1, NZ_KK737546.1, 177648, 178238, -, 591, 270; cds-WP_032429418.1, NZ_KK737546.1, 178235, 178996, -, 762, 21659; cds-WP_004148112.1, NZ_KK737546.1, 178991, 179206, +, 216, 1; cds-WP_002901758.1, NZ_KK737546.1, 179251, 180297, +, 1047, 13728; cds-WP_002901761.1, NZ_KK737546.1, 180345, 180596, -, 252, 54; cds-WP _002901763.1, NZ_KK737546.1, 181003, 183600, +, 2598, 87342; cds-WP_002901772.1, NZ_KK737546.1, 183946, 184920, +, 975, 17094; cds-WP_002901776.1, NZ_KK737546.1, 185166, 185333, +, 168, 5049; cds-WP_032429420.1, NZ_KK737546.1, 185722, 188400, +, 2679, 8958; cds-WP_032429421.1, NZ_KK737546.1, 188448, 189050, -, 603, 64; cds-WP_002901779.1, NZ_KK737546.1, 189214, 189981, +, 768, 855; cds-WP_002901780.1, NZ_KK737546.1, 190117, 190425, +, 309, 216; cds-WP_002901781.1, NZ_KK737546.1, 190432, 191601, +, 1170, 17; cds-WP_014907762.1, NZ_KK737546.1, 191793, 192530, +, 738, 2; cds-WP_004210732.1, NZ_KK737546.1, 192530, 192856, +, 327, 0; cds-WP_002901783.1, NZ_KK737546.1, 192988, 193206, -, 219, 87; cds-WP_002901785.1, NZ_KK737546.1, 193482, 194231, -, 750, 54; cds-WP_002901786.1, NZ_KK737546.1, 194303, 194482, -, 180, 615; cds-WP_002901787.1, NZ_KK737546.1, 194641, 196575, -, 1935, 27359; cds-WP_032421254.1, NZ_KK737546.1, 196657, 197814, -, 1158, 2; cds-WP_004140277.1, NZ_KK737546.1, 198005, 198793, -, 789, 51406; cds-WP_014907760.1, NZ_KK737546.1, 198992, 199534, -, 543, 15124; cds-WP_004151902.1, NZ_KK737546.1, 199782, 201161, +, 1380,8909; cds-WP_004140269.1, NZ_KK737546.1, 201206, 202015, -, 810, 4254; cds-WP_004140266.1, NZ_KK737546.1, 202017, 203009, -, 993, 83222; cds-WP_004151901.1, NZ_KK737546.1, 203009, 203899, -, 891, 3160; cds-WP_032429422.1, NZ_KK737546.1, 204046, 205263, +, 1218, 0; cds-WP_004892750.1, NZ_KK737546.1, 205484, 205723, -, 240, 0; cds-WP_016831904.1, NZ_KK737546.1, 205731, 206039, -, 309, 0; cds-WP_108918811.1, NZ_KK737546.1, 206036, 206677, -, 642, 0; cds-WP_016831906.1, NZ_KK737546.1, 206689, 206910, -, 222, 0; cds-WP_032426563.1, NZ_KK737546.1, 206907, 207434, -, 528, 0; cds-WP_008807811.1, NZ_KK737546.1, 207463, 208086, -, 624, 14; cds-WP_032429423.1, NZ_KK737546.1, 208083, 208829, -, 747, 0; cds-WP_008807813.1, NZ_KK737546.1, 208846, 209130, -, 285, 0; cds-WP_008807814.1, NZ_KK737546.1, 209211, 209417, -, 207, 1; cds-WP_161477215.1, NZ_KK737546.1, 209410, 209568, -, 159, 165; cds-WP_004223168.1, NZ_KK737546.1, 209854, 210057, +, 204, 1; cds-WP_008807815.1, NZ_KK737546.1, 210087, 210734, -, 648, 44865; cds-WP_008807816.1, NZ_KK737546.1, 210731, 211165, -, 435, 15398; cds-WP_024622727.1, NZ_KK737546.1, 211385, 212074, -, 690, 910; cds-WP_004178811.1, NZ_KK737546.1, 212179, 212412, +, 234, 0; cds-WP_004141720.1, NZ_KK737546.1, 212452, 212772, +, 321, 8; cds-WP_004151298.1, NZ_KK737546.1, 212859, 213005, +, 147, 0; cds-WP_073545955.1, NZ_KK737546.1, 213046, 213897, +, 852, 1; cds-WP_075209545.1, NZ_KK737546.1, 213902, 215317, +, 1416, 10; cds-WP_032429424.1, NZ_KK737546.1, 215317, 215619, +, 303, 0; cds-AF52_RS21920, NZ_KK737546.1, 215616, 215912, +, 297, 0; cds-WP_032429425.1, NZ_KK737546.1, 216035, 216298, +, 264, 0; cds-AF52_RS25000, NZ_KK737546.1, 216450, 216854, +, 405, 0; cds-WP_023286281.1, NZ_KK737546.1, 217078, 217299, +, 222, 0; cds-WP_032429427.1, NZ_KK737546.1, 217303, 218010, +, 708, 13; cds-WP_016831923.1, NZ_KK737546.1, 218000, 218224, +, 225, 0; cds-WP_032429428.1, NZ_KK737546.1, 218299, 218811, +, 513, 7; cds-WP_032429704.1, NZ_KK737546.1, 218879, 219136, +, 258, 3; cds-WP_032429429.1, NZ_KK737546.1, 219243, 219839, +, 597, 16; cds-WP_004146340.1, NZ_KK737546.1, 220048, 220338, +, 291, 3; cds-WP_004177081.1, NZ_KK737546.1, 220335, 220697, +, 363, 0; cds-WP_023279926.1, NZ_KK737546.1, 220694, 220834, +, 141, 0; cds-WP_032429430.1, NZ_KK737546.1, 220831, 221520, +, 690, 0; cds-WP_024940884.1, NZ_KK737546.1, 222173, 222472, +, 300, 0; cds-WP_008807831.1, NZ_KK737546.1, 222469, 223008, +, 540, 11023; cds-WP_004190674.1, NZ_KK737546.1, 223005, 223349, +, 345, 0; cds-WP_032429431.1, NZ_KK737546.1, 223346, 223621, +, 276, 0; cds-WP_004218558.1, NZ_KK737546.1, 224580, 224825, +, 246, 98; cds-WP_013815099.1-5, NZ_KK737546.1, 225397, 226365, -, 969, 6184; cds-WP_032429432.1, NZ_KK737546.1, 226754, 227758, +, 1005, 57; cds-WP_004190663.1, NZ_KK737546.1, 227736, 229043, +, 1308, 2027; cds-AF52_RS21820, NZ_KK737546.1, 229043, 229582, +, 540, 3806; cds-WP_170965341.1, NZ_KK737546.1, 229616, 229810, +, 195, 331; cds-AF52_RS26695, NZ_KK737546.1, 231136, 231250, +, 115, 163; cds-WP_187079184.1, NZ_KK737546.1, 231498, 232175, +, 678, 41493; cds-WP_032429434.1, NZ_KK737546.1, 232159, 233271, +, 1113, 15197; cds-WP_032429435.1, NZ_KK737546.1, 233356, 234141, +, 786, 28; cds-WP_032429436.1, NZ_KK737546.1, 234152, 235105, +, 954, 152229; cds-WP_142689607.1, NZ_KK737546.1, 235114, 235386, +, 273, 14109; cds-WP_004217348.1, NZ_KK737546.1, 235427, 235822, +, 396, 2460; cds-WP_004190649.1, NZ_KK737546.1, 235824, 236078, +, 255, 31591; cds-WP_004217344.1, NZ_KK737546.1, 236307, 236690, +, 384, 0; cds-WP_008807839.1, NZ_KK737546.1, 236692, 237243, +, 552, 0; cds-WP_004190640.1, NZ_KK737546.1, 237240, 237632, +, 393, 0; cds-WP_004217341.1, NZ_KK737546.1, 237656, 238828, +, 1173, 225738; cds-WP_004226994.1, NZ_KK737546.1, 238882, 239364, +, 483, 0; cds-WP_074185736.1, NZ_KK737546.1, 239502, 239696, +, 195, 0; cds-WP_032429437.1, NZ_KK737546.1, 240136, 240315, +, 180, 10065; cds-WP_032417044.1, NZ_KK737546.1, 240325, 240810, +, 486, 48355; cds-AF52_RS21755, NZ_KK737546.1, 240849, 241094, -, 246, 17803; cds-WP_013815099.1-6, NZ_KK737546.1, 241160, 242128, -, 969, 9202; cds-WP_032429438.1, NZ_KK737546.1, 242146, 242397, -, 252, 0; cds-WP_077254381.1, NZ_KK737546.1, 242561, 242902, +, 342, 4; cds-AF52_RS21745, NZ_KK737546.1, 243004, 244416, +, 1413, 6993; cds-WP_013815099.1-7, NZ_KK737546.1, 244471, 245439, -, 969, 4011; cds-AF52_RS21735, NZ_KK737546.1, 245474, 246952, +, 1479, 85; cds-WP_032429439.1, NZ_KK737546.1, 246952, 247425, +, 474, 0; cds-WP_032429440.1, NZ_KK737546.1, 247412, 247894, +, 483, 0; cds-WP_032429442.1, NZ_KK737546.1, 247904, 248284, +, 381, 0; cds-AF52_RS21715, NZ_KK737546.1, 248281, 251259, +, 2979, 50; cds-WP_013815099.1-8, NZ_KK737546.1, 251293, 252261, +, 969, 3512; cds-AF52_RS0123075, NZ_KK737546.1, 252965, 253330, -, 366, 0; cds-WP_032429443.1, NZ_KK737546.1, 253422, 253970, +, 549, 0; cds-WP_004179627.1, NZ_KK737546.1, 255020, 255439, +, 420, 430; cds-AF52_RS0123080, NZ_KK737546.1, 255441, 256706, +, 1266, 2; cds-WP_032429444.1, NZ_KK737546.1, 256748, 257389, +, 642, 93; cds-WP_016831214.1, NZ_KK737546.1, 257382, 258056, -, 675, 1; cds-WP_002901816.1, NZ_KK737546.1, 258261, 259226, -, 966, 26785; cds-WP_004140258.1, NZ_KK737546.1, 259223, 260866, -, 1644,8092; cds-WP_021441607.1, NZ_KK737546.1, 261200, 262108, -, 909, 0; cds-WP_019705465.1, NZ_KK737546.1, 262216, 263046, +, 831, 0; cds-WP_032429447.1, NZ_KK737546.1, 263025, 265334, -, 2310, 2422; cds-WP_002901900.1, NZ_KK737546.1, 265506, 266675, +, 1170, 0; cds-WP_021441611.1, NZ_KK737546.1, 266701, 268092, +, 1392, 34; cds-WP_004148137.1, NZ_KK737546.1, 268083, 269072, -, 990, 2; cds-WP_002901908.1, NZ_KK737546.1, 269225, 269893, +, 669, 10356; cds-WP_002901911.1, NZ_KK737546.1, 269949, 270173, +, 225, 35994; cds-WP_002901913.1, NZ_KK737546.1, 270173, 270532, +, 360, 15; cds-WP_002901915.1, NZ_KK737546.1, 270561, 270779, +, 219, 784; cds-WP_002901917.1, NZ_KK737546.1, 270882, 272279, +, 1398, 67; cds-WP_004140239.1, NZ_KK737546.1, 272276, 273337, +, 1062, 3; cds-WP_004888583.1, NZ_KK737546.1, 273427, 274326, -, 900, 12; cds-WP_002901977.1, NZ_KK737546.1, 274440, 275753, +, 1314, 0; cds-WP_002901979.1, NZ_KK737546.1, 275926, 277467, +, 1542, 91; cds-WP_032428836.1, NZ_KK737546.1, 277569, 278621, +, 1053, 671; cds-WP_004152131.1, NZ_KK737546.1, 278692, 279198, -, 507, 9283; cds-WP_032429452.1, NZ_KK737546.1, 279301, 280266, +, 966, 53; cds-WP_004152134.1, NZ_KK737546.1, 280263, 280970, -, 708, 3; cds-WP_004148146.1, NZ_KK737546.1, 281043, 281159, +, 117, 97; cds-WP_004176446.1, NZ_KK737546.1, 281156, 282772, +, 1617, 12506; cds-WP_021441615.1, NZ_KK737546.1, 282873, 283259, -, 387, 1048; cds-WP_004190572.1, NZ_KK737546.1, 283490, 284323, +, 834, 357; cds-WP_004152138.1, NZ_KK737546.1, 284448, 285332, -, 885, 6; cds-WP_004190569.1, NZ_KK737546.1, 285505, 286641, +, 1137, 0; cds-WP_023287551.1, NZ_KK737546.1, 286714, 287916, +, 1203, 0; cds-WP_004152141.1, NZ_KK737546.1, 287995, 288864, +, 870, 30762; cds-AF52_RS21545, NZ_KK737546.1, 289095, 289340, +, 246, 1; cds-WP_072001575.1, NZ_KK737546.1, 289412, 289558, -, 147, 17; cds-WP_013815099.1-9, NZ_KK737546.1, 289602, 290570, -, 969, 3218; cds-WP_187079185.1, NZ_KK737546.1, 290586, 291959, +, 1374, 0; cds-WP_002902422.1, NZ_KK737546.1, 292005, 292940, -, 936, 2545; cds-WP_004140161.1, NZ_KK737546.1, 293174, 293608, -, 435, 82; cds-WP_002902432.1, NZ_KK737546.1, 293690, 293902, -, 213, 0; cds-WP_004176397.1, NZ_KK737546.1, 294046, 295170, -, 1125, 0; cds-WP_021313170.1, NZ_KK737546.1, 295527, 299054, -, 3528, 28151; cds-WP_004140155.1, NZ_KK737546.1, 299417, 299680, +, 264, 0; cds-WP_032429459.1, NZ_KK737546.1, 299726, 300166, -, 441, 1; cds-WP_002902515.1, NZ_KK737546.1, 300289, 301278, -, 990, 62821; cds-WP_002902516.1, NZ_KK737546.1, 301426, 301926, -, 501, 0; cds-WP_023279029.1, NZ_KK737546.1, 302133, 304772, +, 2640, 182; cds-WP_004140145.1, NZ_KK737546.1, 304769, 304954, +, 186, 29; cds-WP_002902522.1, NZ_KK737546.1, 304962, 305285, +, 324, 1; cds-WP_004140140.1,


NZ_KK737546.1, 305286, 306188, -, 903, 143; cds-WP_032429462.1, NZ_KK737546.1, 306424, 307923, +, 1500, 22; cds-WP_032429463.1, NZ_KK737546.1, 308048, 308938, +, 891, 179; cds-WP_021440033.1, NZ_KK737546.1, 308982, 309965, +, 984, 34; cds-WP_021440034.1, NZ_KK737546.1, 309968, 312235, -, 2268, 8251; cds-WP _032429464.1, NZ_KK737546.1, 312712, 314757, -, 2046, 59991; cds-WP_032428268.1, NZ_KK737546.1, 315044, 315973, +, 930, 168104; cds-WP_032429465.1, NZ_KK737546.1, 315985, 316272, +, 288, 85592; cds-WP_020324632.1, NZ_KK737546.1, 316280, 317035, +, 756, 50114; cds-WP_021440037.1, NZ_KK737546.1, 317047, 317544, +, 498, 92127; cds-WP_002902772.1, NZ_KK737546.1, 317552, 318622, +, 1071, 80402; cds-WP_032429468.1, NZ_KK737546.1, 318619, 319386, +, 768, 6208; cds-WP_004140117.1, NZ_KK737546.1, 319389, 320177, +, 789, 11398; cds-WP_021440038.1, NZ_KK737546.1, 320178, 321602, +, 1425, 26687; cds-WP_002902876.1, NZ_KK737546.1, 321592, 322014, +, 423, 8960; cds-WP_014907683.1, NZ_KK737546.1, 322014, 323219, +, 1206, 3868; cds-WP_002902877.1, NZ_KK737546.1, 323246, 324562, +, 1317, 4263; cds-WP_004194367.1, NZ_KK737546.1, 324682, 325608, +, 927, 33362; cds-WP_002902883.1, NZ_KK737546.1, 325618, 326214, +, 597, 0; cds-WP_024940864.1, NZ_KK737546.1, 326223, 326633, +, 411, 1; cds-WP_002902889.1, NZ_KK737546.1, 326670, 327275, -, 606, 9233; cds-WP_032429470.1, NZ_KK737546.1, 327480, 331382, +, 3903, 7550; cds-WP_020324670.1, NZ_KK737546.1, 331443, 332117, -, 675, 39; cds-WP_021440039.1, NZ_KK737546.1, 332118, 333497, -, 1380, 64086; cds-WP_002902965.1, NZ_KK737546.1, 333494, 334579, -, 1086, 37323; cds-WP_002902967.1, NZ_KK737546.1, 334608, 336260, -, 1653, 648; cds-WP_002902969.1, NZ_KK737546.1, 336260, 336691, -, 432, 6; cds-WP_002902971.1, NZ_KK737546.1, 336799, 337746, -, 948, 0; cds-WP_032429472.1, NZ_KK737546.1, 337847, 338845, +, 999, 2963; cds-WP_004151574.1, NZ_KK737546.1, 339001, 340275, -, 1275, 678112; cds-WP_004224524.1, NZ_KK737546.1, 340488, 340634, -, 147, 6898; cds-WP_020802294.1, NZ_KK737546.1, 340804, 342009, +, 1206, 128906; cds-WP_004140076.1, NZ_KK737546.1, 342028, 343050, +, 1023, 61699; cds-WP_004183870.1, NZ_KK737546.1, 343041, 344507, +, 1467, 64759; cds-WP_004190366.1, NZ_KK737546.1, 344529, 345869, +, 1341, 14107; cds-WP_004176358.1, NZ_KK737546.1, 345880, 346875, +, 996, 3046; cds-WP_016947259.1, NZ_KK737546.1, 346885, 348315, +, 1431, 36098; cds-WP_021440044.1, NZ_KK737546.1, 348524, 349849, -, 1326, 348; cds-WP_020316474.1, NZ_KK737546.1, 350230, 351030, +, 801, 1; cds-WP_004140057.1, NZ_KK737546.1, 351092, 351229, -, 138, 2; cds-WP_004151568.1, NZ_KK737546.1, 351228, 352667, +, 1440, 79; cds-WP_002903227.1, NZ_KK737546.1, 352716, 353714, -, 999, 1803; cds-WP_002903230.1, NZ_KK737546.1, 353997, 354155, +, 159, 1; cds-WP_004224558.1, NZ_KK737546.1, 354190, 354582, -, 393, 0; cds-WP_002903233.1, NZ_KK737546.1, 354833, 355066, -, 234, 475; cds-WP_021440045.1, NZ_KK737546.1, 355063, 356271, -, 1209, 0; cds-WP_004179665.1, NZ_KK737546.1, 356375, 356728, -, 354, 0; cds-WP_004179667.1, NZ_KK737546.1, 356965, 357444, +, 480, 0; cds-WP_004151566.1, NZ_KK737546.1, 357514, 357717, -, 204, 0; cds-WP_032429476.1, NZ_KK737546.1, 358029, 359057, +, 1029, 0; cds-WP_032429478.1, NZ_KK737546.1, 359071, 360243, -, 1173, 18504; cds-WP_021440047.1, NZ_KK737546.1, 360295, 361887, -, 1593, 12134; cds-WP_021440048.1, NZ_KK737546.1, 362060, 363088, +, 1029, 850; cds-WP_004190339.1, NZ_KK737546.1, 363128, 364687, -, 1560, 33208; cds-WP_032429480.1, NZ_KK737546.1, 364774, 365952, -, 1179, 46643; cds-WP_032429482.1, NZ_KK737546.1, 366154, 367800, +, 1647, 376679; cds-WP_002903315.1, NZ_KK737546.1, 368140, 369540, +, 1401, 2457; cds-WP_021440051.1, NZ_KK737546.1, 369530, 370462, -, 933, 14; cds-WP_021440052.1, NZ_KK737546.1, 370538, 371839, -, 1302, 51278; cds-WP_032429484.1, NZ_KK737546.1, 372095, 372457, -, 363, 1307; cds-WP_002903377.1, NZ_KK737546.1, 372700, 373419, -, 720, 51; cds-WP_002903379.1, NZ_KK737546.1, 373548, 373883, +, 336, 53; cds-WP_004179681.1, NZ_KK737546.1, 373880, 374602, -, 723, 66; cds-WP_004183892.1, NZ_KK737546.1, 374639, 376021, -, 1383, 1; cds-WP_002903384.1, NZ_KK737546.1, 376199, 377149, -, 951, 39992; cds-WP_004140012.1, NZ_KK737546.1, 377146, 377328, -, 183, 347; cds-WP_032422490.1, NZ_KK737546.1, 377671, 379200, +, 1530, 30984; cds-WP_002903386.1, NZ_KK737546.1, 379211, 380599, +, 1389, 49553; cds-WP_004887037.1, NZ_KK737546.1, 380748, 380936, +, 189, 2; cds-WP _002903391.1, NZ_KK737546.1, 381046, 381996, -, 951, 28733; cds-WP_002903394.1, NZ_KK737546.1, 382135, 382887, -, 753, 23533; cds-WP_004224598.1, NZ_KK737546.1, 383082, 383597, -, 516, 0; cds-WP_002903398.1, NZ_KK737546.1, 383890, 384048, +, 159, 0; cds-AF52_RS21120, NZ_KK737546.1, 384081, 384533, -, 453, 0; cds-WP_023343160.1, NZ_KK737546.1, 384656, 384919, -, 264, 0; cds-WP_032429712.1, NZ_KK737546.1, 384927, 385493, -, 567, 0; cds-WP_072001561.1, NZ_KK737546.1, 385495, 386064, -, 570, 0; cds-WP_032429489.1, NZ_KK737546.1, 386061, 386354, -, 294, 0; cds-AF52_RS0123125, NZ_KK737546.1, 386354, 386536, -, 183, 0; cds-WP_032429490.1, NZ_KK737546.1, 386715, 386915, -, 201,0; cds-WP_032429491.1, NZ_KK737546.1, 386912, 387394, -, 483, 0; cds-AF52_RS26290, NZ_KK737546.1, 387508, 387846, -, 339, 0; cds-WP_032429493.1, NZ_KK737546.1, 388073, 388858, -, 786, 0; cds-WP_023343167.1, NZ_KK737546.1, 388851, 389051, -, 201, 0; cds-WP_032429494.1, NZ_KK737546.1, 389051, 389578, -, 528, 0; cds-WP_032429495.1, NZ_KK737546.1, 389714, 390544, -, 831, 8; cds-WP_032429496.1, NZ_KK737546.1, 390597, 390968, -, 372, 0; cds-WP_187079182.1, NZ_KK737546.1, 391972, 392158, +, 187, 209; cds-AF52_RS26730, NZ_KK737546.1, 393389, 393527, +, 139, 3720; cds-WP_032429497.1, NZ_KK737546.1, 393786, 394019, -, 234, 1; cds-WP_032429029.1, NZ_KK737546.1, 394208, 394867, -, 660, 16047; cds-WP_023343174.1, NZ_KK737546.1, 394955, 395155, +, 201, 0; cds-WP_032429498.1, NZ_KK737546.1, 395200, 395751, +, 552, 1395; cds-WP_023322342.1, NZ_KK737546.1, 395924, 396103, +, 180, 0; cds-AF52_RS21035, NZ_KK737546.1, 396093, 396482, +, 390, 0; cds-WP_013815099.1-10, NZ_KK737546.1, 396540, 397508, -, 969, 2680; cds-AF52_RS21025, NZ_KK737546.1, 397537, 398793, -, 1257, 318; cds-WP_004143402.1, NZ_KK737546.1, 399073, 399846, -, 774, 3; cds-WP_023301931.1, NZ_KK737546.1, 399893, 401398, -, 1506, 28629; cds-WP_021440130.1, NZ_KK737546.1, 401452, 402201, -, 750, 755; cds-WP_021440129.1, NZ_KK737546.1, 402565, 403365, +, 801, 33; cds-AF52_RS21000, NZ_KK737546.1, 403475, 404163, +, 689, 0; cds-WP_032429499.1, NZ_KK737546.1, 404175, 405119, +, 945, 0; cds-WP_004143414.1, NZ_KK737546.1, 405156, 406490, +, 1335, 8; cds-WP_004176179.1, NZ_KK737546.1, 406492, 406881, +, 390, 0; cds-WP_021440127.1, NZ_KK737546.1, 407130, 408686, +, 1557, 23; cds-WP_021440126.1, NZ_KK737546.1, 408683, 410275, +, 1593, 23; cds-WP_004190119.1, NZ_KK737546.1, 410287, 411021, +, 735, 8; cds-WP_004148393.1, NZ_KK737546.1, 411033, 412223, +, 1191, 18; cds-WP_004143425.1, NZ_KK737546.1, 412359, 413696, +, 1338, 116; cds-WP_004148392.1, NZ_KK737546.1, 413710, 414588, +, 879, 6; cds-WP_004176181.1, NZ_KK737546.1, 414665, 416035, +, 1371, 2760; cds-WP_021440125.1, NZ_KK737546.1, 416049, 417224, +, 1176, 2; cds-WP_002904834.1, NZ_KK737546.1, 417221, 418378, +, 1158, 11; cds-WP_002904832.1, NZ_KK737546.1, 418461, 419336, -, 876, 0; cds-WP_021440123.1, NZ_KK737546.1, 419448, 420332, -, 885, 1; cds-WP_002904827.1, NZ_KK737546.1, 420444, 421187, +, 744, 6; cds-WP_002904825.1, NZ_KK737546.1, 421193, 421891, -, 699, 4623; cds-WP_032417116.1, NZ_KK737546.1, 422159, 423691, +, 1533, 13; cds-WP_021440120.1, NZ_KK737546.1, 423703, 425031, +, 1329, 1; cds-WP_032417115.1, NZ_KK737546.1, 425777, 427222, +, 1446, 250262; cds-WP_021440118.1, NZ_KK737546.1, 427212, 427655, +, 444, 93061; cds-WP_002904816.1, NZ_KK737546.1, 428072, 428311, +, 240, 0; cds-WP_009308870.1, NZ_KK737546.1, 428336, 428476, +, 141, 125; cds-WP_004148380.1, NZ_KK737546.1, 428664, 429599, +, 936, 1; cds-WP_004143447.1, NZ_KK737546.1, 429633, 431288, -, 1656, 40727; cds-WP_002904810.1, NZ_KK737546.1, 431585, 431833, +, 249, 168; cds-WP_002904808.1, NZ_KK737546.1, 432123, 432341, +, 219, 9; cds-WP_004179825.1, NZ_KK737546.1, 432322, 433104, +, 783, 7507; cds-WP_004176193.1, NZ_KK737546.1, 433331, 433618, -, 288, 0; cds-WP_004143457.1, NZ_KK737546.1, 434062, 434625, +, 564, 0; cds-WP_004176194.1, NZ_KK737546.1, 434703, 435398, +, 696, 0; cds-WP_016831617.1, NZ_KK737546.1, 435414, 437915, +, 2502, 0; cds-WP_004176196.1, NZ_KK737546.1, 437903, 438907, +, 1005, 8; cds-WP_002904794.1, NZ_KK737546.1, 439049, 440341, +, 1293, 2071; cds-WP_004176197.1, NZ_KK737546.1, 440358, 441680, -, 1323, 1; cds-WP_032417111.1, NZ_KK737546.1, 441680, 441946, -, 267, 6; cds-WP_002904788.1, NZ_KK737546.1, 442211, 442537, -, 327, 0; cds-WP_002904787.1, NZ_KK737546.1, 442534, 443034, -, 501, 670; cds-WP_032429500.1, NZ_KK737546.1, 443012, 444391, -, 1380, 2; cds-WP_002904783.1, NZ_KK737546.1, 444737, 445891, +, 1155, 7184; cds-WP_032429501.1, NZ_KK737546.1, 445872, 446795, -, 924, 5978; cds-WP_021440114.1, NZ_KK737546.1, 446921, 447958, +, 1038, 92; cds-WP_032429502.1, NZ_KK737546.1, 447970, 448953, +, 984, 0; cds-WP_014907616.1, NZ_KK737546.1, 448930, 450168, -, 1239, 21; cds-WP_032429503.1, NZ_KK737546.1, 450274, 451218, +, 945, 8; cds-WP_032429504.1, NZ_KK737546.1, 451228, 451983, -, 756, 0; cds-WP_002904646.1, NZ_KK737546.1, 452160, 452471, -, 312, 0; cds-WP_002904643.1, NZ_KK737546.1, 452493, 452756, -, 264, 51; cds-WP_004176215.1, NZ_KK737546.1, 453039, 454067, +, 1029, 0; cds-WP_002904638.1, NZ_KK737546.1, 454091, 454897, +, 807, 2; cds-WP_021440110.1, NZ_KK737546.1, 454894, 455685, +, 792, 0; cds-WP_021440109.1, NZ_KK737546.1, 455682, 456341, +, 660, 819; cds-WP_021440108.1, NZ_KK737546.1, 456352, 457425, -, 1074, 5; cds-WP_004143508.1, NZ_KK737546.1, 457500, 458345, +, 846, 0; cds-WP_032417109.1, NZ_KK737546.1, 458342, 459499, -, 1158, 15325; cds-WP_032417108.1, NZ_KK737546.1, 459707, 460129, +, 423, 189; cds-WP_004176220.1, NZ_KK737546.1, 460285, 461472, +, 1188, 16; cds-WP_002904624.1, NZ_KK737546.1, 461701, 461991, +, 291, 8; cds-WP_004176221.1, NZ_KK737546.1, 462200, 462961, +, 762, 0; cds-WP_004143517.1, NZ_KK737546.1, 463122, 463442, +, 321, 0; cds-WP_032429505.1, NZ_KK737546.1, 463433, 463813, +, 381, 0; cds-WP_021440101.1, NZ_KK737546.1, 464024, 464470, -, 447, 24; cds-WP_004183995.1, NZ_KK737546.1, 464724, 466175, -, 1452, 43391; cds-WP_021440100.1, NZ_KK737546.1, 466289, 466819, -, 531, 15; cds-WP_004148352.1, NZ_KK737546.1, 466897, 468321, -, 1425, 7443; cds-WP_004190206.1, NZ_KK737546.1, 468436, 468804, -, 369, 0; cds-AF52_RS0123140, NZ_KK737546.1, 468804, 469730, -, 927, 58; cds-WP_021440098.1, NZ_KK737546.1, 469811, 471199, -, 1389, 0; cds-WP_002904495.1, NZ_KK737546.1, 471301, 472179, +, 879, 0; cds-WP_009308907.1, NZ_KK737546.1, 472133, 472615, -, 483, 0; cds-WP_021440097.1, NZ_KK737546.1, 472760, 473704, +, 945, 115; cds-WP_002904489.1, NZ_KK737546.1, 473719, 474480, -, 762, 31; cds-WP_016532445.1, NZ_KK737546.1, 474482, 475468, -, 987, 58; cds-WP_032429506.1, NZ_KK737546.1, 475461, 476696, -, 1236, 0; cds-WP_004179774.1, NZ_KK737546.1, 476871, 478019, +, 1149, 404; cds-WP_021440094.1, NZ_KK737546.1, 478034, 478918, +, 885, 14029; cds-WP_021440093.1, NZ_KK737546.1, 479004, 479954, +, 951, 18; cds-WP_004179768.1, NZ_KK737546.1, 480018, 481337, +, 1320, 4; cds-WP_004179766.1, NZ_KK737546.1, 481383, 482177, -, 795, 28; cds-WP_002904407.1, NZ_KK737546.1, 482379, 483578, +, 1200, 0; cds-WP_002904403.1, NZ_KK737546.1, 483647, 484315, -, 669, 25; cds-WP_004217987.1, NZ_KK737546.1, 484359, 484487, -, 129, 45; cds-WP_013815099.1-11, NZ_KK737546.1, 484550, 485518, -, 969, 7632; cds-WP_032429507.1, NZ_KK737546.1, 485643, 486077, +, 435, 2; cds-WP_002904397.1, NZ_KK737546.1, 486098, 486472, +, 375, 1262; cds-WP_002904394.1, NZ_KK737546.1, 486513, 486731, +, 219, 0; cds-WP_004143566.1, NZ_KK737546.1, 486780, 487679, -, 900, 0; cds-WP_021440091.1, NZ_KK737546.1, 487875, 489071, +, 1197, 0; cds-WP_002904389.1, NZ_KK737546.1, 489201, 489683, +, 483, 0; cds-WP_004176246.1, NZ_KK737546.1, 489719, 490417, -, 699, 5; cds-WP_004148342.1, NZ_KK737546.1, 490427, 491224, -, 798, 0; cds-WP_032429508.1, NZ_KK737546.1, 491224, 492297, -, 1074, 0; cds-WP_015958384.1, NZ_KK737546.1, 492297, 493871, -, 1575, 0; cds-WP_032429509.1, NZ_KK737546.1, 493933, 495204, -, 1272, 0; cds-WP_004148338.1, NZ_KK737546.1, 495376, 496479, -, 1104, 0; cds-


WP_004183961.1, NZ_KK737546.1, 496628, 497026, -, 399, 0; cds-WP_029602386.1, NZ_KK737546.1, 497094, 498191, +, 1098, 37; cds-WP_004205985.1, NZ_KK737546.1, 498160, 498375, +, 216, 2; cds-WP_021440087.1, NZ_KK737546.1, 498428, 498868, -, 441, 95; cds-WP_004183956.1, NZ_KK737546.1, 499122, 500186, -, 1065, 0; cds-WP_021440086.1, NZ_KK737546.1, 500383, 503490, +, 3108, 517; cds-WP_032429510.1, NZ_KK737546.1, 503545, 504810, +, 1266, 995; cds-WP_021440085.1, NZ_KK737546.1, 504841, 505929, -, 1089, 22; cds-WP_004176262.1, NZ_KK737546.1, 506016, 506276, -, 261, 1159; cds-WP_021440083.1, NZ_KK737546.1, 506568, 507434, +, 867, 1034; cds-WP_002210513.1, NZ_KK737546.1, 507455, 508216, -, 762, 1737; cds-AF52_RS0123150, NZ_KK737546.1, 508478, 509380, +, 903, 0; cds-WP_004224682.1, NZ_KK737546.1, 509392, 510657, +, 1266, 0; cds-WP_002210516.1, NZ_KK737546.1, 510650, 511270, +, 621, 0; cds-WP_004176276.1, NZ_KK737546.1, 511275, 512057, +, 783, 4; cds-WP_013815099.1-12, NZ_KK737546.1, 512157, 513125, -, 969, 10989; cds-AF52_RS0123155, NZ_KK737546.1, 513181, 514545, +, 1365, 2; cds-WP_021440081.1, NZ_KK737546.1, 514572, 515498, -, 927, 0; cds-AF52_RS0123160, NZ_KK737546.1, 515809, 516421, +, 613, 0; cds-WP_004195995.1, NZ_KK737546.1, 516452, 516571, -, 120, 0; cds-WP_004143607.1, NZ_KK737546.1, 516972, 518189, +, 1218, 8647; cds-WP_032429511.1, NZ_KK737546.1, 518210, 518722, -, 513, 1; cds-WP_004183942.1, NZ_KK737546.1, 518888, 519361, -, 474, 20; cds-WP_004173721.1, NZ_KK737546.1, 519807, 519941, -, 135, 19; cds-WP_020316505.1, NZ_KK737546.1, 520183, 520305, +, 123, 0; cds-WP_013815099.1-13, NZ_KK737546.1, 520461, 521429, +, 969, 13000; cds-WP_032429512.1, NZ_KK737546.1, 521466, 522074, +, 609, 11; cds-WP_004143611.1, NZ_KK737546.1, 522071, 522193, -, 123, 0; cds-WP_004219446.1, NZ_KK737546.1, 522248, 522376, -, 129, 0; cds-WP_004176282.1, NZ_KK737546.1, 522548, 523222, +, 675, 67; cds-WP_015958377.1, NZ_KK737546.1, 523273, 524115, -, 843, 106; cds-WP_002903735.1, NZ_KK737546.1, 524143, 524529, +, 387, 62; cds-WP_032417100.1, NZ_KK737546.1, 524607, 526652, -, 2046, 327; cds-WP_032429513.1, NZ_KK737546.1, 526783, 527532, +, 750, 123659; cds-WP_002903730.1, NZ_KK737546.1, 527624, 528310, +, 687, 40595; cds-WP_004183938.1, NZ_KK737546.1, 528363, 528794, -, 432, 1; cds-WP_032429514.1, NZ_KK737546.1, 529059, 530522, -, 1464, 80; cds-WP_032429515.1, NZ_KK737546.1, 530776, 532059, -, 1284, 0; cds-WP_072143281.1, NZ_KK737546.1, 532173, 532535, -, 363, 62; cds-WP_002903720.1, NZ_KK737546.1, 532644, 532985, +, 342, 4975; cds-WP_002903719.1, NZ_KK737546.1, 533064, 533624, +, 561, 14243; cds-WP_032428279.1, NZ_KK737546.1, 533618, 534328, -, 711, 44801; cds-WP_002903714.1, NZ_KK737546.1, 534430, 534699, +, 270, 195; cds-WP_032429516.1, NZ_KK737546.1, 534850, 537285, +, 2436, 0; cds-WP_004152235.1, NZ_KK737546.1, 537296, 537913, +, 618, 4; cds-WP_002903710.1, NZ_KK737546.1, 537915, 538772, +, 858, 0; cds-WP_004209765.1, NZ_KK737546.1, 538814, 539422, +, 609, 0; cds-WP_021440073.1, NZ_KK737546.1, 539556, 540851, +, 1296, 2; cds-WP_032428278.1, NZ_KK737546.1, 540804, 541499, -, 696, 784; cds-WP_002903701.1, NZ_KK737546.1, 541627, 542847, -, 1221, 56; cds-WP_002903700.1, NZ_KK737546.1, 542971, 543873, -, 903, 2; cds-WP_002903698.1, NZ_KK737546.1, 544004, 545254, +, 1251, 743; cds-WP_029884324.1, NZ_KK737546.1, 545594, 547081, +, 1488, 5264; cds-WP_002903693.1, NZ_KK737546.1, 547246, 547665, +, 420, 963; cds-WP_013815099.1-14, NZ_KK737546.1, 548708, 549676, -, 969, 7238; cds-WP_050484275.1, NZ_KK737546.1, 549709, 550482, +, 774, 2; cds-WP_004224649.1, NZ_KK737546.1, 550496, 550612, +, 117, 17; cds-WP_032429518.1, NZ_KK737546.1, 550656, 550985, -, 330, 47641; cds-WP_002903681.1, NZ_KK737546.1, 550972, 551334, -, 363, 54050; cds-WP_002903679.1, NZ_KK737546.1, 551777, 552811, +, 1035, 586; cds-WP_004176297.1, NZ_KK737546.1, 553036, 554691, +, 1656, 0; cds-WP_009486289.1, NZ_KK737546.1, 554691, 555533, +, 843, 0; cds-WP_032428276.1, NZ_KK737546.1, 555551, 555850, +, 300, 0; cds-WP_004143105.1, NZ_KK737546.1, 555843, 556676, +, 834, 0; cds-WP_032429519.1, NZ_KK737546.1, 556676, 557476, +, 801, 0; cds-WP_004148291.1, NZ_KK737546.1, 557613, 558572, +, 960, 0; cds-WP_004152239.1, NZ_KK737546.1, 558576, 559193, +, 618, 2; cds-WP_021440066.1, NZ_KK737546.1, 559193, 560095, +, 903, 0; cds-WP_002903632.1, NZ_KK737546.1, 560085, 561011, -, 927, 1390; cds-AF52_RS20250, NZ_KK737546.1, 561169, 562206, -, 1038, 32; cds-AF52_RS20245, NZ_KK737546.1, 562264, 562518, -, 255, 1282; cds-WP_032429520.1, NZ_KK737546.1, 563260, 563512, -, 253, 352; cds-AF52_RS20235, NZ_KK737546.1, 563544, 564125, -, 582, 0; cds-WP_032428274.1, NZ_KK737546.1, 564433, 565356, -, 924, 1879; cds-WP_016529947.1, NZ_KK737546.1, 565520, 565876, -, 357, 0; cds-WP_032429521.1, NZ_KK737546.1, 566032, 567648, +, 1617, 118; cds-WP_004176303.1, NZ_KK737546.1, 567645, 568364, +, 720, 17; cds-WP_020803870.1, NZ_KK737546.1, 568345, 569295, -, 951, 3; cds-WP_004152245.1, NZ_KK737546.1, 569363, 572140, -, 2778, 3; cds-WP_004148278.1, NZ_KK737546.1, 572782, 574293, +, 1512, 0; cds-WP_004152246.1, NZ_KK737546.1, 574348, 576000, +, 1653, 371; cds-WP_032417097.1, NZ_KK737546.1, 576164, 577780, +, 1617, 0; cds-WP_004143067.1, NZ_KK737546.1, 578370, 578759, -, 390, 0; cds-WP_004151556.1, NZ_KK737546.1, 578752, 579516, -, 765, 219; cds-WP_032429522.1, NZ_KK737546.1, 579506, 580858, -, 1353, 35; cds-WP_009308944.1, NZ_KK737546.1, 580868, 582070, -, 1203, 5; cds-WP_032429523.1, NZ_KK737546.1, 582081, 582737, -, 657, 1; cds-WP_002903522.1, NZ_KK737546.1, 582748, 583434, -, 687, 0; cds-WP_004151560.1, NZ_KK737546.1, 583604, 584410, +, 807, 82; cds-WP_032429524.1, NZ_KK737546.1, 584407, 584970, -, 564, 130; cds-WP_002903460.1, NZ_KK737546.1, 585072, 585980, -, 909, 6451; cds-WP_021440059.1, NZ_KK737546.1, 586147, 587457, +, 1311, 5911; cds-WP_020805029.1, NZ_KK737546.1, 587457, 588902, +, 1446, 61502; cds-WP_017879817.1, NZ_KK737546.1, 589022, 590140, +, 1119, 10011; cds-WP_072001564.1, NZ_KK737546.1, 590269, 591363, +, 1095, 31890; cds-WP_072001565.1, NZ_KK737546.1, 591373, 592209, +, 837, 3953; cds-WP_021314545.1, NZ_KK737546.1, 592340, 592711, -, 372, 0; cds-WP_032429525.1, NZ_KK737546.1, 593013, 593564, -, 552, 0; cds-AF52_RS27770, NZ_KK737546.1, 593656, 594012, +, 357, 0; cds-WP_013815099.1-15, NZ_KK737546.1, 596036, 597004, -, 969, 4381; cds-AF52_RS25145, NZ_KK737546.1, 597030, 597290, +, 261, 401; cds-WP_004150800.1, NZ_KK737546.1, 597408, 598658, -, 1251, 472179; cds-WP_004150801.1, NZ_KK737546.1, 598899, 599549, +, 651, 2850; cds-WP_021313538.1, NZ_KK737546.1, 599566, 600024, +, 459, 2; cds-WP_004150803.1, NZ_KK737546.1, 600081, 601187, +, 1107, 14708; cds-WP_004140557.1, NZ_KK737546.1, 601242, 601883, +, 642, 4172; cds-WP_004176557.1, NZ_KK737546.1, 601887, 603257, +, 1371, 44995; cds-WP_004213084.1, NZ_KK737546.1, 603312, 603674, -, 363, 32; cds-WP_004183655.1, NZ_KK737546.1, 603758, 604564, -, 807, 5; cds-WP_004150807.1, NZ_KK737546.1, 604848, 605519, +, 672, 365; cds-WP_004147969.1, NZ_KK737546.1, 605519, 606985, +, 1467, 37800; cds-WP_004176560.1, NZ_KK737546.1, 607071, 608192, +, 1122, 9355; cds-WP_004150810.1, NZ_KK737546.1, 608332, 609564, -, 1233, 0; cds-WP_004150811.1, NZ_KK737546.1, 609823, 610959, +, 1137, 12764; cds-WP_004150812.1, NZ_KK737546.1, 610943, 611800, +, 858, 21; cds-WP_004150813.1, NZ_KK737546.1, 611797, 612582, +, 786, 133; cds-WP_004140590.1, NZ_KK737546.1, 612579, 613625, +, 1047, 7168; cds-WP_032429526.1, NZ_KK737546.1, 613672, 615396, -, 1725, 6; cds-WP_032429527.1, NZ_KK737546.1, 615393, 617021, -, 1629, 9; cds-WP_032429528.1, NZ_KK737546.1, 617259, 619262, -, 2004, 231923; cds-WP_009484250.1, NZ_KK737546.1, 619282, 620235, -, 954, 1; cds-AF52_RS0123220, NZ_KK737546.1, 620263, 620421, -, 159, 4; cds-AF52_RS0123225, NZ_KK737546.1, 620476, 621173, +, 698, 14702; cds-WP_032429529.1, NZ_KK737546.1, 621229, 622248, -, 1020, 0; cds-AF52_RS25155, NZ_KK737546.1, 622341, 622724, -, 384, 10; cds-WP_013815099.1-16, NZ_KK737546.1, 622777, 623745, -, 969, 5558; cds-AF52_RS19995, NZ_KK737546.1, 623776, 625125, -, 1350, 8; cds-WP_004179336.1, NZ_KK737546.1, 625161, 626168, -, 1008, 31393; cds-WP_004211823.1, NZ_KK737546.1, 626411, 627205, +, 795, 16; cds-WP_004140612.1, NZ_KK737546.1, 627241, 628203, +, 963, 562; cds-WP_032429531.1, NZ_KK737546.1, 628228, 628572, -, 345, 3355; cds-WP_004179333.1, NZ_KK737546.1, 628663, 629493, -, 831, 28351; cds-WP_004140619.1, NZ_KK737546.1, 629508, 630419, -, 912, 24908; cds-WP_002900801.1, NZ_KK737546.1, 630468, 631712, -, 1245, 1362; cds-WP_002900798.1, NZ_KK737546.1, 631712, 632413, -, 702, 857; cds-WP_004176566.1, NZ_KK737546.1, 632406, 633605, -, 1200, 2190; cds-WP_004140630.1, NZ_KK737546.1, 633739, 633870, -, 132, 0; cds-WP_016946615.1, NZ_KK737546.1, 633910, 637356, +, 3447, 926; cds-WP_023159039.1, NZ_KK737546.1, 637514, 638479, +, 966, 14631; cds-WP_002900788.1, NZ_KK737546.1, 638608, 638865, -, 258, 4; cds-WP_004147941.1, NZ_KK737546.1, 638963, 639118, +, 156, 49; cds-WP_004140640.1, NZ_KK737546.1, 639115, 639750, +, 636, 41379; cds-WP_004140642.1, NZ_KK737546.1, 639803, 639925, -, 123, 2542; cds-WP_004150817.1, NZ_KK737546.1, 639994, 642183, +, 2190, 370603; cds-WP_002900781.1, NZ_KK737546.1, 642241, 642780, -, 540, 1; cds-WP_002900778.1, NZ_KK737546.1, 642975, 644279, -, 1305, 11; cds-WP_002900775.1, NZ_KK737546.1, 644525, 645067, -, 543, 11783; cds-WP_004147935.1, NZ_KK737546.1, 645103, 646113, -, 1011, 12064; cds-WP_023286229.1, NZ_KK737546.1, 646137, 646964, -, 828, 3747; cds-WP_014342994.1, NZ_KK737546.1, 646945, 647583, -, 639, 3200; cds-WP_002900683.1, NZ_KK737546.1, 647605, 647979, -, 375, 224; cds-WP_002900681.1, NZ_KK737546.1, 647984, 648340, -, 357, 1492; cds-WP_002900680.1, NZ_KK737546.1, 648602, 650035, -, 1434, 128248; cds-WP_009484238.1, NZ_KK737546.1, 650332, 651126, -, 795, 165; cds-WP_021441547.1, NZ_KK737546.1, 651137, 652141, -, 1005, 21061; cds-WP_002900674.1, NZ_KK737546.1, 652138, 652779, -, 642, 26; cds-WP_002900671.1, NZ_KK737546.1, 652769, 653791, -, 1023, 34; cds-WP_002900669.1, NZ_KK737546.1, 653793, 654602, -, 810, 52; cds-WP_032428777.1, NZ_KK737546.1, 654728, 655969, -, 1242, 245600; cds-WP_000103754.1, NZ_KK737546.1, 656059, 656295, -, 237, 173314; cds-WP_002899294.1, NZ_KK737546.1, 656506, 657240, -, 735, 71714; cds-WP_009308402.1, NZ_KK737546.1, 657253, 658182, -, 930, 138442; cds-WP_002899288.1, NZ_KK737546.1, 658198, 659151, -, 954, 62400; cds-WP_004140697.1, NZ_KK737546.1, 659205, 660365, -, 1161, 208019; cds-WP_000290724.1, NZ_KK737546.1, 660506, 660679, -, 174, 392185; cds-WP_002899276.1, NZ_KK737546.1, 660696, 661217, -, 522, 912516; cds-WP_004183641.1, NZ_KK737546.1, 661359, 661943, +, 585, 1; cds-WP_002899271.1, NZ_KK737546.1, 661981, 662934, -, 954, 39; cds-AF52_RS19800, NZ_KK737546.1, 663634, 666601, +, 2968, 267479; cds-WP_014342992.1, NZ_KK737546.1, 666598, 666849, +, 252, 83; cds-WP_004218670.1, NZ_KK737546.1, 666888, 667916, -, 1029, 281; cds-WP_004176581.1, NZ_KK737546.1, 667933, 669147, +, 1215, 2942; cds-WP_002899104.1, NZ_KK737546.1, 669202, 670737, -, 1536, 167525; cds-WP_004140718.1, NZ_KK737546.1, 670849, 671760, -, 912, 5805; cds-WP_004179323.1, NZ_KK737546.1, 671776, 672429, -, 654, 6021; cds-WP_002899099.1, NZ_KK737546.1, 672439, 673023, -, 585, 2071; cds-WP_002899096.1, NZ_KK737546.1, 673253, 674461, +, 1209, 733; cds-WP_004150824.1, NZ_KK737546.1, 674575, 675135, +, 561, 645; cds-WP_032428773.1, NZ_KK737546.1, 675261, 676307, +, 1047, 60431; cds-WP_002898994.1, NZ_KK737546.1, 676380, 676631, +, 252,1169; cds-WP_002898992.1, NZ_KK737546.1, 676934, 677188, +, 255, 7060; cds-WP_014907855.1, NZ_KK737546.1, 677314, 678432, +, 1119, 4660; cds-WP_002898988.1, NZ_KK737546.1, 678504, 678617, +, 114, 4133; cds-WP_032429533.1, NZ_KK737546.1, 678603, 679667, -, 1065, 8100; cds-WP_004140735.1, NZ_KK737546.1, 679873, 680793, +, 921, 77; cds-WP_002898984.1, NZ_KK737546.1, 680965, 682191, +, 1227, 0; cds-WP_002898981.1, NZ_KK737546.1, 682283, 682669, +, 387, 1; cds-WP_002898978.1, NZ_KK737546.1, 682670, 682897, -, 228, 0; cds-WP_002898967.1, NZ_KK737546.1, 682964, 685492, -, 2529, 101042; cds-WP_004183630.1, NZ_KK737546.1, 685485, 687038, -, 1554, 263280; cds-WP_021441537.1, NZ_KK737546.1, 687290, 688450, +, 1161, 5293; cds-WP_004179313.1, NZ_KK737546.1, 688485, 689078, -, 594, 13; cds-WP_021441536.1, NZ_KK737546.1, 689145, 689672, -, 528, 5; cds-WP_004191006.1, NZ_KK737546.1, 689822, 690304, -, 483, 8; cds-WP_004140758.1, NZ_KK737546.1, 690408, 690962, -, 555,


8083; cds-WP_004140764.1, NZ_KK737546.1, 690985, 691722, -, 738, 11609; cds-WP_032429534.1, NZ_KK737546.1, 691811, 692749, -, 939, 798; cds-WP_020804646.1, NZ_KK737546.1, 693463, 694368, -, 906, 0; cds-WP_032428769.1, NZ_KK737546.1, 694483, 695343, +, 861, 2; cds-WP_002898927.1, NZ_KK737546.1, 695362, 696039, +, 678, 42; cds-WP_013815099.1-17, NZ_KK737546.1, 696673, 697641, +, 969, 5470; cds-AF52_RS0123255, NZ_KK737546.1, 697961, 698214, +, 254, 0; cds-WP_148673676.1, NZ_KK737546.1, 698298, 699011, +, 714, 23; cds-WP_072001576.1, NZ_KK737546.1, 699534, 699737, -, 204, 70; cds-WP_020806188.1, NZ_KK737546.1, 699763, 700743, +, 981, 4501; cds-WP_002906471.1, NZ_KK737546.1, 701021, 701311, -, 291, 0; cds-AF52_RS0123260, NZ_KK737546.1, 701331, 702492, -, 1162, 0; cds-WP_187079186.1, NZ_KK737546.1, 702608, 703498, +, 891, 288; cds-WP_032429537.1, NZ_KK737546.1, 703493, 704992, -, 1500, 959; cds-WP_021440209.1, NZ_KK737546.1, 705116, 705691, +, 576, 183; cds-WP_004151231.1, NZ_KK737546.1, 705866, 707248, +, 1383, 0; cds-WP_021440211.1, NZ_KK737546.1, 707363, 711103, +, 3741, 1; cds-WP_004148517.1, NZ_KK737546.1, 711100, 712644, +, 1545, 20; cds-WP_002906547.1, NZ_KK737546.1, 712644, 713339, +, 696, 0; cds-WP_004180107.1, NZ_KK737546.1, 713336, 714016, +, 681, 0; cds-WP_032429538.1, NZ_KK737546.1, 714449, 715294, -, 846, 535; cds-WP_021440213.1, NZ_KK737546.1, 715371, 717026, -, 1656, 0; cds-WP_004189830.1, NZ_KK737546.1, 717084, 718052, -, 969, 0; cds-WP_004189827.1, NZ_KK737546.1, 718049, 718753, -, 705, 49; cds-WP_004151228.1, NZ_KK737546.1, 718965, 719546, +, 582, 933; cds-WP_021440214.1, NZ_KK737546.1, 719670, 719897, -, 228, 1552; cds-WP_021440215.1, NZ_KK737546.1, 719968, 720585, -, 618, 1; cds-WP_014343117.1, NZ_KK737546.1, 720663, 721514, -, 852, 0; cds-WP_002906697.1, NZ_KK737546.1, 721553, 722332, -, 780, 0; cds-WP_021440216.1, NZ_KK737546.1, 722316, 723242, -, 927, 0; cds-WP_021440217.1, NZ_KK737546.1, 723252, 723761, -, 510, 0; cds-WP_032429539.1, NZ_KK737546.1, 723773, 724705, -, 933, 2; cds-WP_032429540.1, NZ_KK737546.1, 724723, 726036, -, 1314, 0; cds-WP_032429541.1, NZ_KK737546.1, 726061, 727182, -, 1122, 0; cds-WP_004898544.1, NZ_KK737546.1, 727172, 728179, -, 1008, 0; cds-WP_004180132.1, NZ_KK737546.1, 728271, 728822, -, 552, 0; cds-WP_021440220.1, NZ_KK737546.1, 729096, 729983, +, 888, 65; cds-WP_002906778.1, NZ_KK737546.1, 730173, 731627, +, 1455, 311; cds-WP_002906779.1, NZ_KK737546.1, 731678, 731899, -, 222, 2945; cds-WP_032429542.1, NZ_KK737546.1, 732068, 733129, -, 1062, 74507; cds-WP_032429543.1, NZ_KK737546.1, 733388, 735493, +, 2106, 28020; cds-AF52_RS0123265, NZ_KK737546.1, 735691, 737396, +, 1706, 1; cds-WP_002906788.1, NZ_KK737546.1, 737494, 737793, -, 300, 9; cds-WP_032428300.1, NZ_KK737546.1, 737883, 738113, -, 231, 0; cds-WP_021440225.1, NZ_KK737546.1, 738075, 739010, +, 936, 122; cds-WP_002906792.1, NZ_KK737546.1, 739074, 740111, -, 1038, 6067; cds-WP_002906794.1, NZ_KK737546.1, 740177, 740758, -, 582, 5343; cds-WP_002906796.1, NZ_KK737546.1, 740921, 741439, +, 519, 350; cds-WP_004180135.1, NZ_KK737546.1, 741436, 741885, +, 450, 5; cds-WP_002906801.1, NZ_KK737546.1, 741894, 742127, -, 234, 34; cds-WP_009484786.1, NZ_KK737546.1, 742144, 743742, -, 1599, 29548; cds-WP_021440226.1, NZ_KK737546.1, 744012, 745445, +, 1434, 3569; cds-WP_004200090.1, NZ_KK737546.1, 745459, 746208, -, 750, 3; cds-AF52_RS25200, NZ_KK737546.1, 746297, 746392, -, 96, 0; cds-WP_013815099.1-18, NZ_KK737546.1, 746451, 747419, -, 969, 2343; cds-AF52_RS0123285, NZ_KK737546.1, 747453, 747536, -, 84, 0; cds-WP_002906891.1, NZ_KK737546.1, 747732, 747824, +, 93, 0; cds-AF52_RS0123290, NZ_KK737546.1, 747881, 748849, +, 969,11731; cds-WP_002906893.1, NZ_KK737546.1, 748942, 749193, -, 252, 106; cds-WP_004189776.1, NZ_KK737546.1, 749331, 749528, -, 198, 0; cds-WP_004175940.1, NZ_KK737546.1, 749677, 749799, +, 123, 0; cds-WP_004175939.1, NZ_KK737546.1, 750140, 751567, -, 1428, 14; cds-WP_004143773.1, NZ_KK737546.1, 751590, 752396, -, 807, 0; cds-WP_032429544.1, NZ_KK737546.1, 752386, 753315, -, 930, 0; cds-WP_004151215.1, NZ_KK737546.1, 753317, 754330, -, 1014, 0; cds-AF52_RS0123305, NZ_KK737546.1, 754347, 755492, -, 1146, 0; cds-WP_032429724.1, NZ_KK737546.1, 755797, 757209, -, 1413, 9231; cds-WP_032429545.1, NZ_KK737546.1, 757897, 759294, +, 1398, 893; cds-WP_020802114.1, NZ_KK737546.1, 759294, 760304, +, 1011, 0; cds-WP_004180143.1, NZ_KK737546.1, 760304, 760429, +, 126, 0; cds-WP_187079190.1, NZ_KK737546.1, 760525, 760692, +, 168, 110; cds-WP_013815099.1-19, NZ_KK737546.1, 760738, 761706, -, 969, 7026; cds-WP_077254734.1, NZ_KK737546.1, 761708, 761899, -, 192, 0; cds-WP_004143781.1, NZ_KK737546.1, 762045, 762275, +, 231, 3064; cds-WP_032429546.1, NZ_KK737546.1, 762288, 764249, -, 1962, 3765; cds-WP_020806151.1, NZ_KK737546.1, 764283, 764450, +, 168, 3041; cds-WP_002907473.1, NZ_KK737546.1, 764461, 765030, -, 570, 14207; cds-WP_032428296.1, NZ_KK737546.1, 765216, 766382, +, 1167, 2; cds-WP_004151213.1, NZ_KK737546.1, 766359, 767228, -, 870, 906; cds-WP_004151212.1, NZ_KK737546.1, 767409, 768305, +, 897, 0; cds-WP_002907480.1, NZ_KK737546.1, 768352, 769020, -, 669, 318; cds-WP_021440235.1, NZ_KK737546.1, 769281, 769877, -, 597, 23; cds-WP_002907483.1, NZ_KK737546.1, 769874, 770878, -, 1005, 0; cds-WP_004891515.1, NZ_KK737546.1, 770990, 771970, +, 981, 319; cds-WP_002907487.1, NZ_KK737546.1, 771956, 772534, -, 579, 173477; cds-WP_002907489.1, NZ_KK737546.1, 772588, 774243, -, 1656, 68573; cds-WP_032428297.1, NZ_KK737546.1, 774681, 775769, +, 1089, 1; cds-WP_021440237.1, NZ_KK737546.1, 775816, 777321, -, 1506, 14; cds-WP_002907549.1, NZ_KK737546.1, 777363, 778706, -, 1344, 1301; cds-WP_021440238.1, NZ_KK737546.1, 778946, 779686, +, 741, 6; cds-WP_004143799.1, NZ_KK737546.1, 779683, 780303, +, 621, 1; cds-WP_004143800.1, NZ_KK737546.1, 780481, 781404, +, 924, 144820; cds-WP_021440239.1, NZ_KK737546.1, 781704, 784076, +, 2373, 48464; cds-WP_004143804.1, NZ_KK737546.1, 784146, 785264, -, 1119, 61539; cds-WP_002907563.1, NZ_KK737546.1, 785289, 785564, -, 276, 0; cds-WP_002907640.1, NZ_KK737546.1, 785669, 786196, -, 528, 405; cds-WP_004143806.1, NZ_KK737546.1, 786456, 786818, +, 363, 71; cds-WP_002907644.1, NZ_KK737546.1, 786828, 787013, -, 186, 586; cds-WP_032429547.1, NZ_KK737546.1, 787257, 787721, -, 465, 3680; cds-WP_032428298.1, NZ_KK737546.1, 787915, 789069, +, 1155, 82694; cds-WP_004151209.1, NZ_KK737546.1, 789227, 790228, +, 1002, 49322; cds-WP_021440243.1, NZ_KK737546.1, 790264, 791304, -, 1041, 1172; cds-WP_004227851.1, NZ_KK737546.1, 791495, 791632, +, 138, 175; cds-WP_021440244.1, NZ_KK737546.1, 791748, 793118, +, 1371, 1057; cds-WP_002907652.1, NZ_KK737546.1, 793335, 793550, +, 216, 2160; cds-WP_002907654.1, NZ_KK737546.1, 793626, 794066, +, 441, 10604; cds-WP_002907658.1, NZ_KK737546.1, 794145, 794726, +, 582, 7960; cds-WP_004143816.1, NZ_KK737546.1, 794726, 795304, +, 579, 13489; cds-AF52_RS19200, NZ_KK737546.1, 795297, 797532, +, 2236, 687; cds-WP_002907730.1, NZ_KK737546.1, 797533, 798585, +, 1053, 4572; cds-WP_002907731.1, NZ_KK737546.1, 798596, 799216, +, 621, 996; cds-WP_002907733.1, NZ_KK737546.1, 799219, 799917, +, 699, 13708; cds-WP_032429549.1, NZ_KK737546.1, 799919, 800554, +, 636, 9239; cds-WP_004151206.1, NZ_KK737546.1, 801162, 802667, +, 1506, 157144; cds-WP_021440245.1, NZ_KK737546.1, 802778, 803383, +, 606, 27555; cds-WP_032428303.1, NZ_KK737546.1, 803426, 804286, -, 861, 4333; cds-WP_032429550.1, NZ_KK737546.1, 804348, 805622, -, 1275, 27416; cds-WP_032428304.1, NZ_KK737546.1, 805747, 806403, -, 657, 3050; cds-WP_032428306.1, NZ_KK737546.1, 806461, 806784, -, 324, 292; cds-WP_004143831.1, NZ_KK737546.1, 806877, 808001, -, 1125, 73; cds-WP_002907749.1, NZ_KK737546.1, 808269, 808736, +, 468, 2665; cds-AF52_RS19130, NZ_KK737546.1, 808959, 810134, +, 1176, 95; cds-WP_013815099.1-20, NZ_KK737546.1, 810186, 811154, -, 969, 3472; cds-AF52_RS25210, NZ_KK737546.1, 811180, 811386, +, 207, 17; cds-WP_004143833.1, NZ_KK737546.1, 811420, 811860, -, 441, 21496; cds-WP_002907752.1, NZ_KK737546.1, 812033, 812269, +, 237, 132; cds-WP_004143835.1, NZ_KK737546.1, 812280, 813176, +, 897, 11038; cds-WP_002907754.1, NZ_KK737546.1, 813176, 815200, +, 2025, 9935; cds-WP_032429551.1, NZ_KK737546.1, 815193, 815711, -, 519, 13894; cds-WP_021440254.1, NZ_KK737546.1, 815781, 816677, -, 897, 35155; cds-WP_004189722.1, NZ_KK737546.1, 816726, 816968, -, 243, 0; cds-WP_004175857.1, NZ_KK737546.1, 817108, 817707, +, 600, 15; cds-WP_002907763.1, NZ_KK737546.1, 817761, 818858, +, 1098, 1438; cds-WP_013815099.1-21, NZ_KK737546.1, 818914, 819882, +, 969, 4572; cds-WP_002907764.1, NZ_KK737546.1, 820003, 820410, +, 408, 3; cds-WP_002907766.1, NZ_KK737546.1, 820548, 821195, +, 648, 108; cds-WP_032429552.1, NZ_KK737546.1, 821243, 821590, -, 348, 620; cds-WP_004151204.1, NZ_KK737546.1, 821931, 822803, +, 873, 14654; cds-WP_004200127.1, NZ_KK737546.1, 822758, 823243, -, 486, 354; cds-WP_002907771.1, NZ_KK737546.1, 823713, 824294, +, 582, 53581; cds-WP_002907773.1, NZ_KK737546.1, 824356, 825522, -, 1167, 3314; cds-WP_004152976.1, NZ_KK737546.1, 825690, 825779, -, 90, 210; cds-WP_002907778.1, NZ_KK737546.1, 826075, 827100, +, 1026, 74; cds-WP_004180170.1, NZ_KK737546.1, 827027, 828031, -, 1005, 4; cds-WP_002907785.1, NZ_KK737546.1, 828144, 829325, +, 1182, 2384; cds-WP_032429553.1, NZ_KK737546.1, 829618, 830766, +, 1149, 16424; cds-WP_021440257.1, NZ_KK737546.1, 830803, 831438, -, 636, 2685; cds-WP_032429554.1, NZ_KK737546.1, 831668, 833041, +, 1374, 4164; cds-WP_004180172.1, NZ_KK737546.1, 833217, 833453, +, 237, 0; cds-AF52_RS0123325, NZ_KK737546.1, 833594, 834171, -, 578, 247; cds-AF52_RS25220, NZ_KK737546.1, 835237, 835697, -, 461, 0; cds-WP_032428308.1, NZ_KK737546.1, 836525, 837277, -, 753, 17; cds-WP_004180175.1, NZ_KK737546.1, 837376, 838302, +, 927, 0; cds-WP_002907799.1, NZ_KK737546.1, 838299, 839183, -, 885, 16; cds-WP_021440259.1, NZ_KK737546.1, 839340, 839855, +, 516, 0; cds-WP_004184289.1, NZ_KK737546.1, 839863, 840699, +, 837, 10423; cds-WP_002907802.1, NZ_KK737546.1, 840787, 840936, -, 150, 627; cds-WP_004143863.1, NZ_KK737546.1, 841338, 841772, +, 435, 0; cds-WP_021440261.1, NZ_KK737546.1, 841818, 842534, +, 717, 3; cds-WP_002907807.1, NZ_KK737546.1, 842619, 842828, +, 210, 0; cds-WP_002907811.1, NZ_KK737546.1, 843141, 843776, -, 636, 10736; cds-WP_002907812.1, NZ_KK737546.1, 844026, 844655, +, 630, 11671; cds-WP_004189677.1, NZ_KK737546.1, 844660, 845430, -, 771, 0; cds-WP_004175834.1, NZ_KK737546.1, 845522, 845905, +, 384, 1; cds-WP_004175829.1, NZ_KK737546.1, 845937, 846620, +, 684, 9; cds-WP_032428309.1, NZ_KK737546.1, 846965, 848668, +, 1704, 5; cds-WP_004175825.1, NZ_KK737546.1, 848712, 849671, +, 960, 0; cds-WP_016197619.1, NZ_KK737546.1, 849668, 850618, +, 951, 0; cds-WP_021440263.1, NZ_KK737546.1, 850615, 851595, +, 981, 0; cds-WP_021440264.1, NZ_KK737546.1, 851592, 852563, +, 972, 0; cds-WP_002907918.1, NZ_KK737546.1, 852929, 853456, +, 528, 8187; cds-WP_032429555.1, NZ_KK737546.1, 853574, 854062, +, 489, 73231; cds-AF52_RS25225, NZ_KK737546.1, 854099, 854194, -, 96, 4; cds-AF52_RS0123345, NZ_KK737546.1, 854208, 855739, -, 1532, 3; cds-WP_021440267.1, NZ_KK737546.1, 855856, 856773, +, 918, 5; cds-WP_021440268.1, NZ_KK737546.1, 856847, 857836, -, 990, 0; cds-WP_032429556.1, NZ_KK737546.1, 857857, 859275, -, 1419, 5; cds-WP_032428310.1, NZ_KK737546.1, 859287, 860276, -, 990, 116; cds-WP_021440271.1, NZ_KK737546.1, 860571, 861470, -, 900, 609; cds-WP_032428312.1, NZ_KK737546.1, 861678, 862646, +, 969, 0; cds-WP_021440273.1, NZ_KK737546.1, 862658, 863941, +, 1284, 0; cds-WP_002908128.1, NZ_KK737546.1, 863931, 864410, +, 480, 0; cds-WP_021440274.1, NZ_KK737546.1, 864407, 865288, +, 882, 0; cds-WP_002908130.1, NZ_KK737546.1, 865288, 866271, +, 984, 2; cds-WP_032429558.1, NZ_KK737546.1, 866268, 867098, +, 831, 0; cds-WP_002908134.1, NZ_KK737546.1, 867100, 867915, +, 816, 0; cds-WP_032429559.1, NZ_KK737546.1, 867942, 869363, +, 1422, 1; cds-WP_026005880.1, NZ_KK737546.1, 869443, 869691, +, 249, 0; cds-WP_004145368.1, NZ_KK737546.1, 869857, 870765, -, 909, 78716; cds-WP_002908189.1, NZ_KK737546.1, 871055, 871195, +, 141, 170; cds-WP_004189584.1, NZ_KK737546.1, 871242, 872132, -, 891, 0; cds-WP_004175762.1, NZ_KK737546.1, 872273, 872980, +, 708, 0; cds-WP_021440277.1, NZ_KK737546.1, 872982, 873638, +, 657, 0; cds-WP_032429560.1, NZ_KK737546.1, 873648, 874829, +, 1182, 7; cds-WP_004891326.1, NZ_KK737546.1, 874841, 875764, +, 924, 5; cds-WP_032428313.1, NZ_KK737546.1, 875812, 877203, +, 1392, 0; cds-WP_002908202.1,


NZ_KK737546.1, 877227, 877997, +, 771, 0; cds-WP_004145376.1, NZ_KK737546.1, 878017, 878889, -, 873, 0; cds-WP_002908205.1, NZ_KK737546.1, 878996, 879775, +, 780, 0; cds-WP_004200174.1, NZ_KK737546.1, 879785, 881464, +, 1680, 0; cds-WP_004151179.1, NZ_KK737546.1, 881488, 882258, +, 771, 904; cds-WP_013815099.1-22, NZ_KK737546.1, 883311, 884279, -, 969, 6246; cds-AF52_RS0123360, NZ_KK737546.1, 884312, 884632, +, 321, 618; cds-WP_032428316.1, NZ_KK737546.1, 885134, 885976, -, 843, 0; cds-WP_014599186.1, NZ_KK737546.1, 885973, 886419, -, 447, 0; cds-WP_002908216.1, NZ_KK737546.1, 886431, 886985, -, 555, 144; cds-WP_021440283.1, NZ_KK737546.1, 886982, 888934, -, 1953, 4307; cds-WP_021440284.1, NZ_KK737546.1, 888931, 889389, -, 459, 0; cds-WP_021440285.1, NZ_KK737546.1, 889373, 889603, -, 231, 0; cds-WP_004189553.1, NZ_KK737546.1, 889600, 890337, -, 738, 291; cds-WP_032428317.1, NZ_KK737546.1, 890387, 891046, -, 660, 0; cds-WP_004151165.1, NZ_KK737546.1, 891043, 891666, -, 624, 0; cds-WP_182920176.1, NZ_KK737546.1, 891750, 893090, -, 1341, 45; cds-WP_002908285.1, NZ_KK737546.1, 893101, 894885, -, 1785, 0; cds-WP_004217200.1, NZ_KK737546.1, 894888, 895643, -, 756, 1; cds-WP_002908289.1, NZ_KK737546.1, 896145, 896516, +, 372, 98; cds-WP_002908292.1, NZ_KK737546.1, 896524, 897594, -, 1071, 49; cds-WP_002908294.1, NZ_KK737546.1, 897587, 899356, -, 1770, 8800; cds-WP_002908297.1, NZ_KK737546.1, 899430, 900518, -, 1089, 108729; cds-WP_021313976.1, NZ_KK737546.1, 900821, 901900, +, 1080, 4684; cds-WP_021440289.1, NZ_KK737546.1, 902147, 904297, +, 2151, 17; cds-WP_014343153.1, NZ_KK737546.1, 904340, 904501, -, 162, 0; cds-AF52_RS18635, NZ_KK737546.1, 904465, 905497, -, 1033, 55; cds-WP_004148650.1, NZ_KK737546.1, 905793, 906992, +, 1200, 2; cds-WP_004175720.1, NZ_KK737546.1, 907108, 907542, +, 435, 58; cds-WP_032428318.1, NZ_KK737546.1, 908108, 909340, +, 1233, 0; cds-WP_002908370.1, NZ_KK737546.1, 909377, 909769, +, 393, 0; cds-WP_021440293.1, NZ_KK737546.1, 909898, 910485, -, 588, 0; cds-WP_002908374.1, NZ_KK737546.1, 910785, 911507, -, 723, 35; cds-WP_032429562.1, NZ_KK737546.1, 911494, 912258, -, 765, 16; cds-WP_032428319.1, NZ_KK737546.1, 912322, 913089, -, 768, 1568; cds-WP_002908378.1, NZ_KK737546.1, 913182, 914084, -, 903, 0; cds-WP_004148675.1, NZ_KK737546.1, 914081, 915058, -, 978, 3; cds-WP_021440296.1, NZ_KK737546.1, 915048, 916100, -, 1053, 17; cds-WP_004213478.1, NZ_KK737546.1, 916097, 917122, -, 1026, 0; cds-WP_002908416.1, NZ_KK737546.1, 917119, 917940, -, 822, 3; cds-WP_004891261.1, NZ_KK737546.1, 918446, 920518, +, 2073, 0; cds-WP_004175711.1, NZ_KK737546.1, 920627, 921400, -, 774, 0; cds-WP_004148681.1, NZ_KK737546.1, 921394, 922389, -, 996, 0; cds-WP_032429563.1, NZ_KK737546.1, 922370, 923407, -, 1038, 0; cds-WP_002908454.1, NZ_KK737546.1, 923404, 924366, -, 963, 0; cds-WP_032429564.1, NZ_KK737546.1, 924372, 925523, -, 1152, 0; cds-WP_016947511.1, NZ_KK737546.1, 925520, 926605, -, 1086, 3; cds-WP_032429565.1, NZ_KK737546.1, 926750, 927643, -, 894, 0; cds-WP_002908526.1, NZ_KK737546.1, 927750, 928352, +, 603, 0; cds-WP_021440299.1, NZ_KK737546.1, 928358, 929938, +, 1581, 1; cds-WP_021440300.1, NZ_KK737546.1, 929951, 930676, -, 726, 34; cds-AF52_RS0123375, NZ_KK737546.1, 930779, 931975, -, 1197, 0; cds-WP_004180340.1, NZ_KK737546.1, 932051, 933067, -, 1017, 14; cds-WP_021440302.1, NZ_KK737546.1, 933064, 934014, -, 951, 0; cds-WP_032429566.1, NZ_KK737546.1, 934007, 934813, -, 807, 1; cds-WP_004175683.1, NZ_KK737546.1, 934824, 935690, -, 867, 0; cds-WP_021440303.1, NZ_KK737546.1, 935708, 936652, -, 945, 0; cds-WP_024622675.1, NZ_KK737546.1, 936654, 938318, -, 1665, 0; cds-WP_004184404.1, NZ_KK737546.1, 938496, 939308, +, 813, 1; cds-WP_016530930.1, NZ_KK737546.1, 939400, 940458, +, 1059, 287; cds-WP_004151840.1, NZ_KK737546.1, 940448, 941455, +, 1008, 8; cds-WP_004151841.1, NZ_KK737546.1, 941452, 942201, +, 750, 0; cds-WP_014907413.1, NZ_KK737546.1, 942185, 942928, -, 744, 8; cds-WP_004175664.1, NZ_KK737546.1, 942985, 943821, -, 837, 393; cds-WP_004148701.1, NZ_KK737546.1, 943837, 945159, -, 1323, 2; cds-WP_032429567.1, NZ_KK737546.1, 945231, 947084, -, 1854, 3; cds-WP_002908844.1, NZ_KK737546.1, 947211, 947849, +, 639, 17574; cds-WP_004180357.1, NZ_KK737546.1, 947867, 948079, -, 213, 4001; cds-WP_014907411.1, NZ_KK737546.1, 948069, 948227, -, 159, 18; cds-WP_004217210.1, NZ_KK737546.1, 948316, 948447, -, 132, 1; cds-WP_002908859.1, NZ_KK737546.1, 948585, 949997, +, 1413, 102382; cds-WP_032429569.1, NZ_KK737546.1, 950310, 950546, +, 237, 179271; cds-WP_004143241.1, NZ_KK737546.1, 950608, 951594, -, 987, 6420; cds-WP_002908865.1, NZ_KK737546.1, 951694, 952110, -, 417, 0; cds-WP_002908867.1, NZ_KK737546.1, 952122, 953342, -, 1221, 0; cds-AF52_RS18405, NZ_KK737546.1, 953339, 954046, -, 708, 0; cds-WP_013815099.1-23, NZ_KK737546.1, 954079, 955047, +, 969, 5830; cds-AF52_RS18395, NZ_KK737546.1, 955104, 955679, -, 576, 92; cds-WP_002908876.1, NZ_KK737546.1, 955654, 956400, -, 747, 2; cds-WP_002908877.1, NZ_KK737546.1, 956417, 957904, -, 1488, 4136; cds-WP_004143232.1, NZ_KK737546.1, 957907, 958284, -, 378, 914; cds-WP_002908880.1, NZ_KK737546.1, 958767, 958964, -, 198, 922; cds-WP_014343173.1, NZ_KK737546.1, 958963, 959100, +, 138, 346; cds-WP_004143228.1, NZ_KK737546.1, 959201, 959596, +, 396, 0; cds-WP_002908882.1, NZ_KK737546.1, 959593, 960225, +, 633, 2; cds-WP_004151846.1, NZ_KK737546.1, 960480, 961664, +, 1185, 195; cds-WP_021440309.1, NZ_KK737546.1, 961720, 964812, -, 3093, 0; cds-WP_032429570.1, NZ_KK737546.1, 964809, 965918, -, 1110, 0; cds-WP_020805192.1, NZ_KK737546.1, 965993, 966529, -, 537, 3; cds-WP_021440311.1, NZ_KK737546.1, 966703, 967698, -, 996, 1; cds-WP_004175653.1, NZ_KK737546.1, 967795, 968706, +, 912, 3; cds-WP_004180366.1, NZ_KK737546.1, 968865, 969863, +, 999, 27; cds-WP_002908998.1, NZ_KK737546.1, 969863, 970900, +, 1038, 9390; cds-WP_004212506.1, NZ_KK737546.1, 970900, 971661, +, 762, 19798; cds-WP_182920187.1, NZ_KK737546.1, 971718, 972905, +, 1188, 283; cds-WP_002909005.1, NZ_KK737546.1, 972988, 974019, -, 1032, 21; cds-WP_002909008.1, NZ_KK737546.1, 974043, 975023, -, 981, 1958; cds-WP_004212509.1, NZ_KK737546.1, 975593, 975913, +, 321, 305; cds-WP_002909014.1, NZ_KK737546.1, 976011, 976259, -, 249, 818; cds-WP_002909015.1, NZ_KK737546.1, 976464, 976874, -, 411, 161; cds-WP_004175614.1, NZ_KK737546.1, 976871, 979927, -, 3057, 9433; cds-WP_004148729.1, NZ_KK737546.1, 980146, 981258, +, 1113, 6612; cds-WP_002909055.1, NZ_KK737546.1, 981641, 984019, -, 2379, 329014; cds-WP_009484225.1, NZ_KK737546.1, 984095, 984214, +, 120, 1; cds-WP_002909061.1, NZ_KK737546.1, 984359, 985192, +, 834, 5697; cds-WP_021440317.1, NZ_KK737546.1, 985347, 986393, +, 1047, 10058; cds-WP_002909070.1, NZ_KK737546.1, 986501, 986728, +, 228, 862; cds-WP_021440318.1, NZ_KK737546.1, 986758, 988200, -, 1443, 15428; cds-WP_002909082.1, NZ_KK737546.1, 988314, 988778, -, 465, 1604; cds-WP_020803964.1, NZ_KK737546.1, 988860, 989609, -, 750, 139; cds-WP_004180371.1, NZ_KK737546.1, 989609, 990160, -, 552, 2; cds-WP_002909085.1, NZ_KK737546.1, 990397, 991197, +, 801, 15879; cds-WP_004151850.1, NZ_KK737546.1, 991234, 992220, -, 987, 1; cds-WP_014907393.1, NZ_KK737546.1, 992342, 993775, -, 1434, 1; cds-WP_002909089.1, NZ_KK737546.1, 994056, 994970, +, 915, 85800; cds-WP_020802655.1, NZ_KK737546.1, 995020, 996273, +, 1254, 427; cds-WP_021440321.1, NZ_KK737546.1, 996270, 996623, +, 354, 541; cds-WP_002909098.1, NZ_KK737546.1, 996676, 996975, -, 300, 631; cds-WP_015958605.1, NZ_KK737546.1, 996980, 999367, -, 2388, 80582; cds-WP_002909105.1, NZ_KK737546.1, 999383, 1000366, -, 984, 26282; cds-WP_001386830.1, NZ_KK737546.1, 1000505, 1000549, -, 45, 0; cds-WP_000124850.1, NZ_KK737546.1, 1000673, 1001029, -, 357, 652392; cds-WP_001124225.1, NZ_KK737546.1, 1001080, 1001277, -, 198, 475630; cds-WP_004189469.1, NZ_KK737546.1, 1001370, 1001912, -, 543, 464925; cds-WP_032429575.1, NZ_KK737546.1, 1001916, 1003844, -, 1929, 745117; cds-WP_002910028.1, NZ_KK737546.1, 1004276, 1004509, -, 234, 45; cds-WP_002910030.1, NZ_KK737546.1, 1004781, 1005539, -, 759, 78; cds-WP_032429576.1, NZ_KK737546.1, 1005896, 1006828, +, 933, 3; cds-WP_004184572.1, NZ_KK737546.1, 1006923, 1007207, +, 285, 5; cds-WP_032429577.1, NZ_KK737546.1, 1007313, 1008185, +, 873, 5703; cds-WP_014343181.1, NZ_KK737546.1, 1008229, 1009017, -, 789, 141; cds-WP_002910042.1, NZ_KK737546.1, 1009186, 1009482, +, 297, 1552; cds-WP_032103891.1, NZ_KK737546.1, 1009595, 1009735, +, 141, 5; cds-WP_072271743.1, NZ_KK737546.1, 1010163, 1010810, +, 648, 0; cds-WP_004194006.1, NZ_KK737546.1, 1011313, 1011486, -, 174, 3; cds-WP_002910077.1, NZ_KK737546.1, 1011630, 1013090, +, 1461, 464; cds-WP_002910079.1, NZ_KK737546.1, 1013125, 1013454, +, 330, 724; cds-WP_002910080.1, NZ_KK737546.1, 1013517, 1014344, -, 828, 15; cds-WP_002910083.1, NZ_KK737546.1, 1014400, 1015404, -, 1005, 2134; cds-WP_004151853.1, NZ_KK737546.1, 1015401, 1016414, -, 1014,501; cds-WP_004145396.1, NZ_KK737546.1, 1016426, 1017334, -, 909, 6871; cds-WP_002910089.1, NZ_KK737546.1, 1017349, 1018269, -, 921, 8395; cds-WP_004148754.1, NZ_KK737546.1, 1018355, 1019989, -, 1635, 238670; cds-WP_002910095.1, NZ_KK737546.1, 1020727, 1021374, -, 648, 0; cds-WP_004145398.1, NZ_KK737546.1, 1021558, 1021773, -, 216, 0; cds-WP_002910097.1, NZ_KK737546.1, 1021851, 1024526, +, 2676, 228481; cds-WP_002910100.1, NZ_KK737546.1, 1024674, 1025291, -, 618, 212; cds-WP_004145401.1, NZ_KK737546.1, 1025299, 1025430, +, 132, 0; cds-WP_002910103.1, NZ_KK737546.1, 1025853, 1026260, +, 408, 19552; cds-WP_002910105.1, NZ_KK737546.1, 1026382, 1027284, -, 903, 333596; cds-WP_002910107.1, NZ_KK737546.1, 1027482, 1028495, -, 1014, 3568; cds-WP_002910108.1, NZ_KK737546.1, 1028585, 1029487, -, 903, 41826; cds-WP_032429578.1, NZ_KK737546.1, 1029600, 1030058, +, 459, 14422; cds-WP_004151854.1, NZ_KK737546.1, 1030101, 1030943, +, 843, 16212; cds-WP_032428322.1, NZ_KK737546.1, 1031951, 1032394, -, 444, 4; cds-WP_021440328.1, NZ_KK737546.1, 1032502, 1033398, +, 897, 317; cds-WP_032429579.1, NZ_KK737546.1, 1033395, 1034072, -, 678, 4; cds-WP_002910191.1, NZ_KK737546.1, 1034072, 1034782, -, 711, 0; cds-WP_019705142.1, NZ_KK737546.1, 1034779, 1036314, -, 1536, 176; cds-WP_004180382.1, NZ_KK737546.1, 1036311, 1040054, -, 3744, 3006; cds-WP_032428329.1, NZ_KK737546.1, 1040221, 1040334, -, 114, 0; cds-WP_032428323.1, NZ_KK737546.1, 1040460, 1041848, -, 1389, 7608; cds-WP_004175566.1, NZ_KK737546.1, 1042160, 1043938, +, 1779, 18; cds-WP_002910198.1, NZ_KK737546.1, 1043949, 1044599, +, 651, 2312; cds-WP_002910201.1, NZ_KK737546.1, 1044596, 1045978, -, 1383, 605; cds-WP_004175564.1, NZ_KK737546.1, 1046130, 1048730, -, 2601, 0; cds-WP_021440334.1, NZ_KK737546.1, 1048730, 1052797, -, 4068, 0; cds-WP_004145418.1, NZ_KK737546.1, 1052808, 1053596, -, 789, 0; cds-WP_004152255.1, NZ_KK737546.1, 1053606, 1054490, -, 885, 0; cds-WP_032429580.1, NZ_KK737546.1, 1054492, 1055748, -, 1257, 0; cds-WP_021440335.1, NZ_KK737546.1, 1055991, 1057172, -, 1182, 0; cds-WP_002910380.1, NZ_KK737546.1, 1057240, 1057593, +, 354, 63; cds-WP_002910387.1, NZ_KK737546.1, 1057831,1058073, +, 243, 18906; cds-WP_004152258.1, NZ_KK737546.1, 1058291, 1058971, -, 681, 10; cds-WP_002910389.1, NZ_KK737546.1, 1059108, 1059338, -, 231, 6; cds-WP_002910392.1, NZ_KK737546.1, 1059602, 1060702, +, 1101, 18136; cds-WP_002910393.1, NZ_KK737546.1, 1060789, 1061643, -, 855, 69718; cds-WP_032429581.1, NZ_KK737546.1, 1061683, 1062495, -, 813, 12634; cds-WP_004145428.1, NZ_KK737546.1, 1062499, 1062891, -, 393, 528; cds-WP_004898979.1, NZ_KK737546.1, 1062891, 1063739, -, 849, 13; cds-WP_002910403.1, NZ_KK737546.1, 1063739, 1064821, -, 1083, 29470; cds-WP_002910404.1, NZ_KK737546.1, 1064864, 1066120, -, 1257, 12209; cds-WP_002910405.1, NZ_KK737546.1, 1066391, 1067002, +, 612, 2632; cds-WP_004898981.1, NZ_KK737546.1, 1067002, 1067850, +, 849, 67817; cds-WP_002910407.1, NZ_KK737546.1, 1068034, 1068981, +, 948, 311505; cds-WP_004200291.1, NZ_KK737546.1, 1069106, 1070785, +, 1680, 1016; cds-WP_004175547.1, NZ_KK737546.1, 1070786, 1071832, -, 1047, 2; cds-WP_002910437.1, NZ_KK737546.1, 1072054, 1072329, -, 276, 11436; cds-WP_004180389.1, NZ_KK737546.1, 1072602, 1073186, +, 585, 29868; cds-WP_002910443.1, NZ_KK737546.1, 1073304, 1074395, +, 1092, 146825; cds-WP_004145442.1, NZ_KK737546.1, 1074477, 1074806, -, 330, 19; cds-WP_002910453.1, NZ_KK737546.1, 1074890, 1075804, -, 915, 9778; cds-WP_032429582.1, NZ_KK737546.1, 1075936, 1077351, -, 1416, 8; cds-WP_004175538.1, NZ_KK737546.1, 1077371,


1077814, -, 444, 6217; cds-WP_004175532.1, NZ_KK737546.1, 1077817, 1078353, -, 537, 0; cds-WP _021440342.1, NZ_KK737546.1, 1078334, 1079350, -, 1017, 0; cds-AF52_RS17835, NZ_KK737546.1, 1079380, 1081143, -, 1764, 0; cds-WP_171991785.1, NZ_KK737546.1, 1081277, 1084693, -, 3417, 69; cds-WP_004899005.1, NZ_KK737546.1, 1084708, 1085919, -, 1212, 3; cds-WP _004899008.1, NZ_KK737546.1, 1085924, 1086181, -, 258, 0; cds-WP _013815099.1-24, NZ_KK737546.1, 1086223, 1087191, +, 969, 4297; cds-WP_071603213.1, NZ_KK737546.1, 1087273, 1088052, -, 780, 0; cds-AF52_RS25250, NZ_KK737546.1, 1088184, 1089413, -, 1230, 0; cds-AF52_RS26885, NZ_KK737546.1, 1089482, 1089616, +, 135, 61; cds-WP_187079183.1, NZ_KK737546.1, 1089947, 1090528, -, 582, 13; cds-AF52_RS0123460, NZ_KK737546.1, 1090628, 1090912, -, 285, 4597; cds-AF52_RS26890, NZ_KK737546.1, 1095758, 1095891, -, 134, 838; cds-AF52_RS25260, NZ_KK737546.1, 1096147, 1096341, +, 195, 2; cds-WP _050484277.1, NZ_KK737546.1, 1096700, 1097497, -, 798, 25; cds-AF52_RS26910, NZ_KK737546.1, 1101418, 1101547, -, 130, 63; cds-WP _024622687.1, NZ_KK737546.1, 1101978, 1103318, +, 1341, 0; cds-WP_032429587.1, NZ_KK737546.1, 1103315, 1103968, +, 654, 0; cds-WP_032429588.1, NZ_KK737546.1, 1103972, 1105669, +, 1698, 0; cds-AF52_RS27855, NZ_KK737546.1, 1105856, 1105980, +, 125, 0; cds-AF52_RS17780, NZ_KK737546.1, 1106131, 1108194, +, 2064, 10; cds-WP _013815099.1-25, NZ_KK737546.1, 1108246, 1109214, -, 969, 3267; cds-WP_050484282.1, NZ_KK737546.1, 1109194, 1110111, +, 918, 5511; cds-WP _032429589.1, NZ_KK737546.1, 1110157, 1110477, -, 321, 59; cds-WP _032429590.1, NZ_KK737546.1, 1110545, 1110808, -, 264, 0; cds-WP_032429591.1, NZ_KK737546.1, 1110819, 1111511, -, 693, 0; cds-WP_032429592.1, NZ_KK737546.1, 1111564, 1113084, -, 1521, 77; cds-WP _032429593.1, NZ_KK737546.1, 1113085, 1114761, -, 1677, 0; cds-WP _032429594.1, NZ_KK737546.1, 1114766, 1115335, -, 570, 0; cds-WP _032429596.1, NZ_KK737546.1, 1115340, 1115555, -, 216, 0; cds-WP_087749278.1, NZ_KK737546.1, 1115890, 1116027, -, 138, 0; cds-WP_032429598.1, NZ_KK737546.1, 1116030, 1116497, -, 468, 3; cds-WP_020804048.1, NZ_KK737546.1, 1116494, 1117024, -, 531, 4; cds-WP _004151282.1, NZ_KK737546.1, 1117027, 1117275, -, 249, 0; cds-WP _032429600.1, NZ _KK737546.1, 1118641, 1118994, -, 354, 7973; cds-WP _004884209.1, NZ_KK737546.1, 1119587, 1120087, -, 501, 0; cds-WP _032429601.1, NZ _KK737546.1, 1120084, 1120224, -, 141, 0; cds-WP _032429603.1, NZ_KK737546.1, 1120221, 1120583, -, 363, 0; cds-WP_004141687.1, NZ_KK737546.1, 1120580, 1120870, -, 291, 0; cds-WP _032429604.1, NZ_KK737546.1, 1120863, 1121033, -, 171, 0; cds-WP_032429606.1, NZ_KK737546.1, 1121014, 1121481, -, 468, 0; cds-WP_032429607.1, NZ_KK737546.1, 1121740, 1121937, -, 198, 0; cds-WP_032429608.1, NZ_KK737546.1, 1121930, 1122235, -, 306, 0; cds-WP_077254738.1, NZ_KK737546.1, 1122226, 1122615, -, 390, 1; cds-AF52_RS25290, NZ_KK737546.1, 1122697, 1122954, -, 258, 0; cds-WP_001096658.1, NZ_KK737546.1, 1123182, 1123418, -, 237, 0; cds-WP_032429609.1, NZ_KK737546.1, 1123418, 1123792, -, 375, 0; cds-WP_050484278.1, NZ_KK737546.1, 1123792, 1124439, -, 648, 0; cds-WP _032429610.1, NZ_KK737546.1, 1124546, 1124806, -, 261, 0; cds-WP _032429612.1, NZ_KK737546.1, 1124803, 1125198, -, 396, 0; cds-AF52_RS0123495, NZ_KK737546.1, 1125195, 1125496, -, 302, 7; cds-WP_187079187.1, NZ_KK737546.1, 1125496, 1126911, -, 1416, 1; cds-WP_187079188.1, NZ_KK737546.1, 1126916, 1127767, -, 852, 0; cds-WP_004151298.1-2, NZ_KK737546.1, 1127808, 1127954, -, 147, 0; cds-WP _004141720.1-2, NZ_KK737546.1, 1128041, 1128361, -, 321, 4168; cds-WP _023284762.1, NZ_KK737546.1, 1128411, 1128626, -, 216, 1642; cds-WP _019704102.1, NZ_KK737546.1, 1128726, 1129358, +, 633, 234; cds-WP_074440723.1, NZ_KK737546.1, 1129864, 1129989, +, 126, 454; cds-WP_072001571.1, NZ_KK737546.1, 1129982, 1130188, +, 207, 1; cds-WP_032429616.1, NZ_KK737546.1, 1130270, 1130554, +, 285, 11; cds-AF52_RS27875, NZ_KK737546.1, 1130566, 1130764, +, 199, 0; cds-WP_014342891.1, NZ_KK737546.1, 1130734, 1131069, +, 336, 0; cds-WP _032429617.1, NZ_KK737546.1, 1131066, 1131689, +, 624, 1; cds-WP_032429618.1, NZ_KK737546.1, 1131686, 1132114, +, 429, 1407; cds-WP_032429619.1, NZ_KK737546.1, 1132111, 1132767, +, 657, 2; cds-WP _032429620.1, NZ_KK737546.1, 1132764, 1133933, +, 1170, 0; cds-WP_032429621.1, NZ_KK737546.1, 1134147, 1134491, +, 345, 0; cds-WP _072001572.1, NZ_KK737546.1, 1134484, 1134678, +, 195, 0; cds-WP_032429622.1, NZ_KK737546.1, 1134675, 1134866, +, 192, 0; cds-WP_032429623.1, NZ_KK737546.1, 1134863, 1135081, +, 219, 0; cds-WP_019725112.1, NZ_KK737546.1, 1135085, 1135327, +, 243, 0; cds-WP_032429624.1, NZ_KK737546.1, 1135375, 1136637, +, 1263, 1418; cds-AF52_RS0123510, NZ_KK737546.1, 1136676, 1136903, +, 228, 0; cds-WP _004145468.1, NZ_KK737546.1, 1136878, 1137687, -, 810, 0; cds-WP_004175494.1, NZ_KK737546.1, 1137699, 1138994, -, 1296, 750; cds-WP _032429625.1, NZ_KK737546.1, 1139298, 1140224, -, 927, 5673; cds-WP _002910717.1, NZ_KK737546.1, 1140323, 1140799, +, 477, 9689; cds-WP_004148802.1, NZ_KK737546.1, 1140849, 1142492, -, 1644, 605742; cds-WP _002910720.1, NZ_KK737546.1, 1142776, 1143669, +, 894, 327; cds-WP _004175491.1, NZ_KK737546.1, 1143675, 1144394, -, 720, 0; cds-WP _004148803.1, NZ_KK737546.1, 1144391, 1145266, -, 876, 0; cds-WP_004148804.1, NZ_KK737546.1, 1145263, 1146549, -, 1287, 0; cds-WP_004175489.1, NZ_KK737546.1, 1146559, 1147473, -, 915, 0; cds-WP_004189329.1, NZ_KK737546.1, 1147583, 1148641, -, 1059, 0; cds-WP _004225356.1, NZ_KK737546.1, 1148931, 1149077, +, 147, 0; cds-WP_024622740.1, NZ_KK737546.1, 1149129, 1151423, -, 2295, 3; cds-WP_021440352.1, NZ_KK737546.1, 1151452, 1152660, -, 1209, 0; cds-WP_004145486.1, NZ_KK737546.1, 1152688, 1154019, -, 1332, 84; cds-WP_004211070.1, NZ_KK737546.1, 1154045, 1155034, -, 990, 0; cds-WP_002910764.1, NZ_KK737546.1, 1155128, 1156069, -, 942, 0; cds-WP _004148810.1, NZ_KK737546.1, 1156246, 1156389, +, 144, 0; cds-WP_004145488.1, NZ_KK737546.1, 1156687, 1156809, +, 123, 0; cds-WP _024622741.1, NZ_KK737546.1, 1156847, 1157647, -, 801, 0; cds-WP _032425076.1, NZ_KK737546.1, 1157640, 1158626, -, 987, 0; cds-WP _002910830.1, NZ_KK737546.1, 1159065, 1159811, -, 747, 14; cds-WP _008804319.1, NZ_KK737546.1, 1159828, 1160643, -, 816, 0; cds-WP_004184646.1, NZ_KK737546.1, 1160640, 1161569, -, 930, 0; cds-WP _004211064.1, NZ_KK737546.1, 1161563, 1163002, -, 1440, 0; cds-AF52_RS26335, NZ_KK737546.1, 1163005, 1163203, -, 199, 0; cds-WP _004175476.1, NZ_KK737546.1, 1163388, 1165133, +, 1746, 440; cds-WP_023328505.1, NZ_KK737546.1, 1165384, 1167504, +, 2121, 2019; cds-WP_002910846.1, NZ_KK737546.1, 1167546, 1168157, -, 612, 7558; cds-WP_002910883.1, NZ_KK737546.1, 1168333, 1169247, +, 915, 10; cds-WP _002910885.1, NZ _KK737546.1, 1169340, 1171073, +, 1734, 12694; cds-WP_002910887.1, NZ_KK737546.1, 1171090, 1172160, -, 1071, 43034; cds-WP _004175465.1, NZ_KK737546.1, 1172170, 1173468, -, 1299, 139371; cds-WP _032409324.1, NZ_KK737546.1, 1173567, 1173713, -, 147, 0; cds-WP_032429737.1, NZ_KK737546.1, 1173790, 1175322, +, 1533, 46909; cds-WP_002910890.1, NZ_KK737546.1, 1175397, 1176116, -, 720, 10350; cds-WP_004151442.1, NZ_KK737546.1, 1176365, 1177915, +, 1551, 24920; cds-WP_002910894.1, NZ _KK737546.1, 1178044, 1178574, +, 531, 2129; cds-WP_002910895.1, NZ _KK737546.1, 1178725, 1179069, +, 345, 0; cds-WP_021440363.1, NZ_KK737546.1, 1179076, 1179522, -, 447, 19; cds-WP _004180422.1, NZ_KK737546.1, 1179617, 1180276, -, 660, 5801; cds-WP _002910898.1, NZ_KK737546.1, 1180293, 1180574, -, 282, 28813; cds-WP_004180423.1, NZ_KK737546.1, 1180701, 1181399, +, 699, 36220; cds-WP_002910900.1, NZ_KK737546.1, 1181423, 1182235, +, 813, 287591; cds-WP _002910902.1, NZ_KK737546.1, 1182239, 1182508, +, 270, 186844; cds-WP_187079189.1, NZ_KK737546.1, 1182586, 1183701, -, 1116, 1986; cds-WP _002910904.1, NZ_KK737546.1, 1183783, 1185468, -, 1686, 14793; cds-WP_002910905.1, NZ _KK737546.1, 1185674, 1186255, -, 582, 15720; cds-WP _004151443.1, NZ_KK737546.1, 1186294, 1186989, -, 696, 14787; cds-WP_004175456.1, NZ_KK737546.1, 1187135, 1189045, -, 1911, 20175; cds-WP_002910910.1, NZ_KK737546.1, 1189176, 1189520, +, 345, 19090; cds-WP_004145519.1, NZ_KK737546.1, 1189521, 1189706, -, 186, 2372; cds-WP_004145520.1, NZ_KK737546.1, 1189795, 1191150, +, 1356, 6621; cds-WP_004180429.1, NZ_KK737546.1, 1191154, 1191732, +, 579, 12; cds-WP_004151445.1, NZ_KK737546.1, 1191895, 1193259, +, 1365, 51226; cds-WP _024622747.1, NZ_KK737546.1, 1193442, 1195025, +, 1584, 8543; cds-WP_004145524.1, NZ_KK737546.1, 1195059, 1196618, -, 1560, 56105; cds-WP_002910917.1, NZ_KK737546.1, 1197065, 1198036, +, 972, 174726; cds-WP _002910918.1, NZ _KK737546.1, 1198093, 1198893, +, 801, 286296; cds-WP_004145526.1, NZ _KK737546.1, 1198906, 1199757, +, 852, 161413; cds-WP_002910920.1, NZ _KK737546.1, 1199820, 1200278, +, 459, 19088; cds-WP _009484665.1, NZ_KK737546.1, 1200697, 1201263, +, 567, 1178; cds-WP _002910922.1, NZ_KK737546.1, 1201267, 1202061, -, 795, 1; cds-WP_002910924.1, NZ_KK737546.1, 1202123, 1203871, -, 1749, 0; cds-WP_001062678.1, NZ_KK737546.1, 1204059, 1204268, -, 210, 67103; cds-WP _071526670.1, NZ_KK737546.1, 1204351, 1204425, -, 75, 23353; cds-WP_002911374.1, NZ_KK737546.1, 1205016, 1205306, -, 291, 340; cds-WP _002911375.1, NZ_KK737546.1, 1205381, 1205524, -, 144, 191; cds-WP_004145533.1, NZ_KK737546.1, 1205684, 1205923, +, 240, 28223; cds-WP _002911378.1, NZ_KK737546.1, 1205980, 1206771, -, 792, 25836; cds-WP_072200054.1, NZ_KK737546.1, 1206898, 1208319, +, 1422, 1375; cds-WP _002911381.1, NZ_KK737546.1, 1208385, 1209269, -, 885, 274443; cds-WP _004145536.1, NZ_KK737546.1, 1209505, 1211553, -, 2049, 169503; cds-WP_002911385.1, NZ_KK737546.1, 1211573, 1212250, -, 678, 31752; cds-WP_002911386.1, NZ_KK737546.1, 1212348, 1212845, -, 498, 12488; cds-WP_002911387.1, NZ_KK737546.1, 1212978, 1214261, +, 1284, 40762; cds-WP _002911388.1, NZ_KK737546.1, 1214230, 1216863, +, 2634, 160357; cds-WP_032429627.1, NZ_KK737546.1, 1216988, 1218421, +, 1434, 1382; cds-WP _002911393.1, NZ_KK737546.1, 1218537, 1218776, +, 240, 699; cds-WP _002911395.1, NZ _KK737546.1, 1218874, 1219065, +, 192, 0; cds-WP_009484457.1, NZ_KK737546.1, 1219062, 1219715, -, 654, 357; cds-WP _014907334.1, NZ _KK737546.1, 1219872, 1220840, +, 969, 21380; cds-WP _002911398.1, NZ_KK737546.1, 1220945, 1221088, +, 144, 1; cds-WP _002911404.1, NZ_KK737546.1, 1221724, 1222062, -, 339, 13509; cds-WP_032429628.1, NZ_KK737546.1, 1222079, 1222948, -, 870, 873; cds-WP_004151448.1, NZ_KK737546.1, 1222952, 1223326, -, 375, 2692; cds-WP _002911406.1, NZ_KK737546.1, 1223439, 1223669, +, 231, 3481; cds-WP_002911407.1, NZ_KK737546.1, 1223748, 1224407, +, 660, 13413; cds-WP _004151449.1, NZ_KK737546.1, 1224411, 1226471, -, 2061, 17014; cds-WP_004180434.1, NZ_KK737546.1, 1226592, 1227251, -, 660, 26; cds-WP_004184662.1, NZ_KK737546.1, 1227391, 1227738, -, 348, 686; cds-WP_002911418.1, NZ_KK737546.1, 1227883, 1229061, +, 1179, 2243; cds-WP_002911423.1, NZ_KK737546.1, 1229119, 1229760, -, 642, 17355; cds-WP _002911425.1, NZ _KK737546.1, 1229799, 1231610, -, 1812, 16249; cds-WP _002911427.1, NZ _KK737546.1, 1231833, 1233308, -, 1476, 198694; cds-WP _004145554.1, NZ_KK737546.1, 1233319, 1233468, -, 150, 3425; cds-WP_004145555.1, NZ_KK737546.1, 1233628, 1234533, +, 906, 91081; cds-WP_002911440.1, NZ_KK737546.1, 1234659, 1236101, +, 1443, 265884; cds-WP_032429629.1, NZ_KK737546.1, 1236142, 1237116, -, 975, 7717; cds-WP_004148858.1, NZ_KK737546.1, 1237234, 1238553, -, 1320, 46997; cds-WP _004180437.1, NZ_KK737546.1, 1238569, 1239513, -, 945, 32337; cds-WP _002911449.1, NZ_KK737546.1, 1239592, 1240344, +, 753, 7489; cds-WP_004212745.1, NZ_KK737546.1, 1240344, 1241129, +, 786, 1; cds-WP _004148860.1, NZ_KK737546.1, 1241193, 1242203, -, 1011, 466; cds-WP_002911454.1, NZ_KK737546.1, 1242212, 1242823, -, 612, 284; cds-WP_002911456.1, NZ_KK737546.1, 1242903, 1243424, -, 522, 152; cds-WP_002911459.1, NZ_KK737546.1, 1243459, 1244199, -, 741, 25191; cds-WP _002911477.1, NZ_KK737546.1, 1244227, 1244670, -, 444, 5540; cds-WP_002911479.1, NZ_KK737546.1, 1244672, 1246459, -, 1788, 175527; cds-WP_004145564.1, NZ_KK737546.1, 1246727, 1247293, +, 567, 7154; cds-WP _009307531.1, NZ_KK737546.1, 1247290, 1248108, +, 819, 7934; cds-WP _002911484.1, NZ_KK737546.1, 1248161, 1248556, +, 396, 1463; cds-WP_004175417.1, NZ_KK737546.1, 1248596, 1249339, +, 744, 12261; cds-WP _032429630.1, NZ_KK737546.1, 1249336, 1250340, +, 1005, 1599; cds-WP _032429631.1,


NZ _KK737546.1, 1250422, 1251165, -, 744, 3287; cds-WP _015958659.1, NZ_KK737546.1, 1251242, 1251811, -, 570, 0; cds-WP _004151452.1, NZ _KK737546.1, 1252047, 1253780, +, 1734, 56470; cds-WP _002911497.1, NZ_KK737546.1, 1253842, 1254981, -, 1140, 167; cds-WP _021440394.1, NZ_KK737546.1, 1254986, 1256569, -, 1584, 0; cds-WP_002911500.1, NZ_KK737546.1, 1256923, 1257351, +, 429, 3; cds-WP _004175414.1, NZ_KK737546.1, 1257375, 1258799, -, 1425, 20; cds-WP _002911505.1, NZ_KK737546.1, 1258774, 1259562, -, 789, 2; cds-WP _002911507.1, NZ_KK737546.1, 1259724, 1260704, -, 981, 0; cds-WP_004184670.1, NZ_KK737546.1, 1260719, 1262233, -, 1515, 1; cds-WP_009484443.1, NZ_KK737546.1, 1262296, 1263276, -, 981, 0; cds-WP_160540596.1, NZ_KK737546.1, 1263638, 1263736, +, 99, 0; cds-WP _004175413.1, NZ_KK737546.1, 1264168, 1264677, +, 510, 2; cds-WP_004148869.1, NZ_KK737546.1, 1264748, 1264906, -, 159, 4; cds-WP_002911522.1, NZ_KK737546.1, 1264972, 1266483, +, 1512, 353; cds-WP_002911524.1, NZ_KK737546.1, 1266521, 1266772, -, 252, 164; cds-WP _021440395.1, NZ_KK737546.1, 1266923, 1268344, +, 1422, 6088; cds-WP _021440396.1, NZ_KK737546.1, 1268394, 1269032, -, 639, 0; cds-AF52_RS0123570, NZ_KK737546.1, 1269204, 1269384, +, 181, 0; cds-WP _004141101.1, NZ_KK737546.1, 1269442, 1269939, +, 498, 25074; cds-WP_024622766.1, NZ_KK737546.1, 1269975, 1270214, -, 240, 0; cds-WP_004151453.1, NZ_KK737546.1, 1270406, 1271617, +, 1212,5022; cds-WP _004141106.1, NZ_KK737546.1, 1271642, 1272310, -, 669, 2070; cds-WP _004180444.1, NZ_KK737546.1, 1272409, 1273290, -, 882, 16; cds-WP_002911537.1, NZ_KK737546.1, 1273958, 1274506, -, 549, 6841; cds-WP _002911538.1, NZ_KK737546.1, 1274564, 1276396, -, 1833, 43594; cds-WP _002911539.1, NZ_KK737546.1, 1276393, 1277049, -, 657, 9402; cds-WP_002911541.1, NZ_KK737546.1, 1277511, 1277735, +, 225, 162; cds-WP _032429632.1, NZ_KK737546.1, 1277803, 1278525, -, 723, 20744; cds-WP _024622767.1, NZ_KK737546.1, 1278843, 1279595, -, 753, 507; cds-WP_002911547.1, NZ_KK737546.1, 1279592, 1280260, -, 669, 80; cds-WP_021313403.1, NZ_KK737546.1, 1280276, 1281262, -, 987, 2162; cds-WP _004141135.1, NZ_KK737546.1, 1281358, 1282158, -, 801, 4051; cds-WP_004899206.1, NZ_KK737546.1, 1282359, 1283846, +, 1488, 91; cds-WP_004189223.1, NZ_KK737546.1, 1283888, 1284322, -, 435, 551; cds-WP_004180447.1, NZ_KK737546.1, 1284695, 1285318, +, 624, 6195; cds-WP _002911586.1, NZ_KK737546.1, 1285351, 1285542, -, 192, 7584; cds-WP _002911589.1, NZ_KK737546.1, 1285676, 1285897, +, 222, 0; cds-WP _013815099.1-26, NZ_KK737546.1, 1286063, 1287031, -, 969, 5522; cds-AF52_RS25350, NZ_KK737546.1, 1287063, 1287197, -, 135, 0; cds-WP _004184683.1, NZ_KK737546.1, 1287375, 1288286, +, 912, 44; cds-WP_024622769.1, NZ_KK737546.1, 1288261, 1288755, -, 495, 830; cds-WP_004153246.1, NZ_KK737546.1, 1288736, 1290136, -, 1401, 287; cds-WP _002911594.1, NZ_KK737546.1, 1290213, 1290920, -, 708, 195; cds-WP_004151461.1, NZ_KK737546.1, 1290963, 1291244, -, 282, 4; cds-WP _002911596.1, NZ_KK737546.1, 1291783, 1292928, +, 1146, 8269; cds-WP _004227143.1, NZ_KK737546.1, 1293381, 1294181, +, 801, 3769; cds-WP_009484428.1, NZ_KK737546.1, 1294767, 1295462, +, 696, 23; cds-WP_016946077.1, NZ_KK737546.1, 1295493, 1295690, +, 198, 99; cds-WP_022631352.1, NZ_KK737546.1, 1295840, 1296781, -, 942, 2807; cds-WP_004175385.1, NZ_KK737546.1, 1296860, 1297810, -, 951, 0; cds-WP _002911729.1, NZ_KK737546.1, 1297917, 1298834, -, 918, 0; cds-WP _004148971.1, NZ_KK737546.1, 1299334, 1300968, -, 1635, 173; cds-WP_022631351.1, NZ_KK737546.1, 1301560, 1302264, +, 705, 7162; cds-WP _004151466.1, NZ_KK737546.1, 1302261, 1303238, +, 978, 2230; cds-WP _004184763.1, NZ_KK737546.1, 1303359, 1304291, +, 933, 39119; cds-WP_032429633.1, NZ_KK737546.1, 1304202, 1305824, -, 1623, 0; cds-WP _004141189.1, NZ_KK737546.1, 1306097, 1306342, +, 246, 0; cds-WP _004148975.1, NZ_KK737546.1, 1306472, 1307926, +, 1455, 73771; cds-WP _004151469.1, NZ_KK737546.1, 1308292, 1309728, -, 1437, 2; cds-AF52_RS25355, NZ_KK737546.1, 1310050, 1310136, -, 87, 0; cds-WP_022631349.1, NZ_KK737546.1, 1310278, 1311381, +, 1104, 2; cds-WP _002911798.1, NZ_KK737546.1, 1311378, 1312349, -, 972, 570; cds-WP _004180471.1, NZ_KK737546.1, 1312556, 1313392, -, 837, 158; cds-WP_016532101.1, NZ_KK737546.1, 1313585, 1314160, -, 576, 0; cds-WP_022631348.1, NZ_KK737546.1, 1314292, 1315206, +, 915, 15; cds-WP _002911862.1, NZ_KK737546.1, 1315212, 1315547, -, 336, 0; cds-WP _002911866.1, NZ_KK737546.1, 1315554, 1315886, -, 333, 0; cds-WP_004144110.1, NZ_KK737546.1, 1315984, 1316112, +, 129, 0; cds-WP_016831855.1, NZ _KK737546.1, 1316109, 1318019, -, 1911, 19452; cds-WP_014907250.1, NZ_KK737546.1, 1318030, 1318491, -, 462, 1618; cds-WP_022631347.1, NZ_KK737546.1, 1318835, 1320154, +,1320,0; cds-WP_022631346.1, NZ_KK737546.1, 1320201, 1320941, +, 741, 0; cds-WP_032429739.1, NZ_KK737546.1, 1320901, 1321857, -, 957, 71; cds-WP_004175282.1, NZ_KK737546.1, 1321973, 1322362, +, 390, 572; cds-WP_002911879.1, NZ_KK737546.1, 1322384, 1323115, -, 732, 1; cds-WP _004200363.1, NZ_KK737546.1, 1323314, 1324423, +, 1110, 12582; cds-WP _004200364.1, NZ_KK737546.1, 1324466, 1325533, -, 1068, 11; cds-WP_021440419.1, NZ_KK737546.1, 1325561, 1326301, -, 741, 27; cds-WP_002911883.1, NZ_KK737546.1, 1326616, 1326939, -, 324, 777; cds-WP _032429634.1, NZ_KK737546.1, 1327107, 1328165, -, 1059, 513; cds-WP_021440421.1, NZ_KK737546.1, 1328264, 1328737, -, 474, 2019; cds-WP_004153104.1, NZ_KK737546.1, 1328913, 1330076, -, 1164, 519; cds-WP _032429635.1, NZ_KK737546.1, 1330257, 1331681, +, 1425, 72414; cds-WP _002912106.1, NZ _KK737546.1, 1331905, 1334007, -, 2103, 26; cds-WP_002912109.1, NZ_KK737546.1, 1334247, 1334558, +, 312, 10; cds-WP_004148994.1, NZ_KK737546.1, 1334740, 1336098, -, 1359, 10485; cds-WP _096335043.1, NZ_KK737546.1, 1336088, 1336150, -, 63, 1126; cds-WP _004175276.1, NZ_KK737546.1, 1336388, 1337278, -, 891, 32; cds-WP_004152513.1, NZ_KK737546.1, 1337317, 1338141, -, 825, 209; cds-WP_004899375.1, NZ_KK737546.1, 1338318, 1338368, +, 51, 0; cds-WP _002912152.1, NZ_KK737546.1, 1338514, 1339413, +, 900, 89; cds-WP _009307478.1, NZ_KK737546.1, 1339453, 1340757, +, 1305, 122; cds-WP _032429636.1, NZ _KK737546.1, 1340754, 1341815, +, 1062, 1060; cds-WP_004144133.1, NZ_KK737546.1, 1341812, 1342879, +, 1068, 87; cds-WP _002912227.1, NZ_KK737546.1, 1342879, 1343469, +, 591, 2; cds-WP _004175272.1, NZ_KK737546.1, 1343469, 1344206, +, 738, 11; cds-WP _004180497.1, NZ_KK737546.1, 1344188, 1344964, +, 777, 10733; cds-WP_032429637.1, NZ_KK737546.1, 1344958, 1345557, +, 600, 5907; cds-WP _004198893.1, NZ_KK737546.1, 1345750, 1346127, +, 378, 1926; cds-AF52_RS25360, NZ_KK737546.1, 1346124, 1346378, +, 255, 15; cds-AF52_RS16545, NZ_KK737546.1, 1351106, 1351364, +, 259, 1332; cds-AF52_RS16540, NZ_KK737546.1, 1351435, 1352232, +, 798, 160; cds-AF52_RS27905, NZ_KK737546.1, 1352265, 1352369, +, 105, 218; cds-AF52_RS0123600, NZ_KK737546.1, 1352352, 1353032, +, 681, 241; cds-AF52_RS0123605, NZ_KK737546.1, 1353102, 1353650, -, 549, 6014; cds-WP_013815099.1-27, NZ_KK737546.1, 1353685, 1354653, +, 969, 9667; cds-AF52_RS25365, NZ_KK737546.1, 1354708, 1355376, -, 669, 6059; cds-WP _072269281.1, NZ_KK737546.1, 1355472, 1356614, -, 1143, 15027; cds-WP_032429639.1, NZ_KK737546.1, 1356615, 1357508, -, 894, 172517; cds-WP_004890861.1, NZ_KK737546.1, 1357505, 1358659, -, 1155, 85872; cds-WP _004214006.1, NZ_KK737546.1, 1358675, 1360570, -, 1896, 183455; cds-WP _004175264.1, NZ_KK737546.1, 1360586, 1361326, -, 741, 32281; cds-WP_002912373.1, NZ_KK737546.1, 1361326, 1362093, -, 768, 20095; cds-WP _013815099.1-28, NZ_KK737546.1, 1362205, 1363173, +, 969, 6289; cds-WP _032429640.1, NZ _KK737546.1, 1364205, 1365209, +, 1005, 22305; cds-AF52_RS26960, NZ_KK737546.1, 1368345, 1368481, +, 137, 226; cds-AF52_RS26965, NZ_KK737546.1, 1368526, 1368645, -, 120, 56; cds-WP_032429643.1, NZ _KK737546.1, 1368690, 1368818, +, 129, 1; cds-WP _032429644.1, NZ_KK737546.1, 1369241, 1370407, -, 1167, 56381; cds-WP _004899416.1, NZ_KK737546.1, 1370571, 1371941, -, 1371, 110659; cds-WP _004180506.1, NZ_KK737546.1, 1371964, 1373379, -, 1416, 159418; cds-WP_020802781.1, NZ_KK737546.1, 1373607, 1375013, -, 1407, 1166312; cds-WP _013815099.1-29, NZ_KK737546.1, 1375211, 1376179, -, 969, 5890; cds-WP_020802783.1, NZ_KK737546.1, 1376246, 1377643, -, 1398, 1234; cds-WP_032429645.1, NZ_KK737546.1, 1377862, 1378497, -, 636, 0; cds-AF52_RS26980, NZ_KK737546.1, 1381542, 1381660, -, 119, 4226; cds-WP _072001573.1, NZ_KK737546.1, 1381682, 1382065, -, 384, 9545; cds-WP _032429646.1, NZ_KK737546.1, 1382073, 1383821, -, 1749, 61917; cds-WP_020801666.1, NZ_KK737546.1, 1383842, 1384609, -, 768, 67463; cds-WP_020801633.1, NZ_KK737546.1, 1384619, 1385788, -, 1170, 94805; cds-WP_032429647.1, NZ_KK737546.1, 1385800, 1386888, -, 1089, 28447; cds-WP_032429746.1, NZ_KK737546.1, 1386888, 1388180, -, 1293, 3765; cds-WP_020801632.1, NZ_KK737546.1, 1388137, 1389291, -, 1155, 5530; cds-WP _020801659.1, NZ_KK737546.1, 1389302, 1390468, -, 1167, 124241; cds-WP_020801642.1, NZ_KK737546.1, 1390472, 1391422, -, 951, 61904; cds-WP_013815099.1-30, NZ_KK737546.1, 1391484, 1392452, +, 969, 20438; cds-WP _032429648.1, NZ_KK737546.1, 1392641, 1394812, -, 2172, 137210; cds-WP_072001574.1, NZ_KK737546.1, 1394831, 1395262, -, 432, 64498; cds-WP _020801619.1, NZ_KK737546.1, 1395269, 1396402, -, 1134, 180323; cds-WP_032429649.1, NZ_KK737546.1, 1396548, 1397981, -, 1434, 72155; cds-WP_032429650.1, NZ_KK737546.1, 1398272, 1398394, +, 123, 12; cds-WP _020806188.1-2, NZ_KK737546.1, 1398736, 1399716, -, 981, 6892; cds-WP _004184823.1, NZ_KK737546.1, 1400141, 1400770, -, 630, 1286; cds-WP_001741945.1, NZ_KK737546.1, 1401163, 1402053, -, 891, 41417; cds-WP _004151147.1, NZ_KK737546.1, 1402818, 1404401, +, 1584, 2; cds-WP _032412678.1, NZ_KK737546.1, 1404896, 1406743, -, 1848, 423; cds-WP _004151145.1, NZ_KK737546.1, 1406774, 1407355, -, 582, 21854; cds-WP_002912442.1, NZ_KK737546.1, 1407446, 1408087, -, 642, 66543; cds-WP_032429651.1, NZ_KK737546.1, 1408202, 1409050, -, 849, 7; cds-WP_032429652.1, NZ_KK737546.1, 1409188, 1410540, +, 1353, 6; cds-WP _032429747.1, NZ_KK737546.1, 1410830, 1412686, +, 1857, 26756; cds-WP_032429653.1, NZ_KK737546.1, 1412701, 1413402, +, 702, 16176; cds-WP _032409828.1, NZ_KK737546.1, 1413640, 1413780, +, 141, 0; cds-WP_004899454.1, NZ_KK737546.1, 1413896, 1414507, +, 612, 3; cds-WP _004149053.1, NZ _KK737546.1, 1414781, 1416055, -, 1275, 0; cds-WP _032429654.1, NZ_KK737546.1, 1416356, 1417594, +, 1239, 8; cds-WP _004149055.1, NZ _KK737546.1, 1417594, 1420716, +, 3123, 6029; cds-WP _032429655.1, NZ_KK737546.1, 1420717, 1423794, +, 3078, 55; cds-WP_032429656.1, NZ_KK737546.1, 1423796, 1425211, +, 1416, 0; cds-WP_004149058.1, NZ_KK737546.1, 1425208, 1426686, +, 1479, 946; cds-WP _004175198.1, NZ_KK737546.1, 1426683, 1427405, +, 723, 582; cds-WP _004144192.1, NZ _KK737546.1, 1427724, 1429085, +, 1362, 418; cds-WP_004151134.1, NZ _KK737546.1, 1429328, 1430224, +, 897,1; cds-WP_032429657.1, NZ_KK737546.1, 1430465, 1431238, -, 774, 11; cds-WP _032429748.1, NZ_KK737546.1, 1431249, 1432112, -, 864, 3; cds-WP _004200464.1, NZ_KK737546.1, 1432084, 1432989, -, 906, 10; cds-WP _004149062.1, NZ_KK737546.1, 1432986, 1434023, -, 1038, 15; cds-WP_004180553.1, NZ_KK737546.1, 1434020, 1435642, -, 1623, 17; cds-WP_002912648.1, NZ_KK737546.1, 1435762, 1436916, -, 1155, 8; cds-WP _032429658.1, NZ_KK737546.1, 1437214, 1437876, -, 663, 0; cds-WP _016529109.1, NZ_KK737546.1, 1437925, 1439202, -, 1278, 68; cds-WP_032429659.1, NZ_KK737546.1, 1439273, 1440736, -, 1464, 0; cds-WP _004144197.1, NZ_KK737546.1, 1440746, 1442113, -, 1368, 1; cds-WP_004144198.1, NZ_KK737546.1, 1442320,1443261, +, 942, 32; cds-WP_032429660.1, NZ_KK737546.1, 1443284, 1444285, -, 1002, 5121; cds-WP_004180592.1, NZ_KK737546.1, 1444540, 1445289, +, 750, 0; cds-WP_023285368.1, NZ_KK737546.1, 1445316, 1446923, +, 1608, 33832; cds-WP _004175116.1, NZ_KK737546.1, 1447005, 1448288, +, 1284, 1333; cds-WP _002912704.1, NZ_KK737546.1, 1448347, 1449399, -, 1053, 97; cds-WP _002912707.1, NZ_KK737546.1, 1449547, 1450347, -, 801, 4869; cds-WP _004151131.1, NZ_KK737546.1, 1450344, 1451117, -, 774, 21; cds-WP _009307427.1, NZ_KK737546.1, 1451435, 1451857, +, 423, 112; cds-WP _004175111.1, NZ_KK737546.1, 1451854, 1452768, -, 915, 29; cds-WP_009307426.1, NZ_KK737546.1, 1452889, 1454700, +, 1812, 865; cds-WP _009307425.1, NZ_KK737546.1, 1454703, 1456046, +, 1344, 0; cds-WP _004149074.1,


NZ_KK737546.1, 1456036, 1456935, -, 900, 10; cds-WP_002912749.1, NZ_KK737546.1, 1457119, 1457436, +, 318, 1513; cds-WP _072269284.1, NZ_KK737546.1, 1457408, 1457872, +, 465, 14; cds-WP_032429661.1, NZ_KK737546.1, 1457869, 1458978, -, 1110, 10057; cds-WP_002912753.1, NZ_KK737546.1, 1459132, 1461165, +, 2034, 89294; cds-WP_002912756.1, NZ_KK737546.1, 1461280, 1461750, -, 471, 59724; cds-WP _004144215.1, NZ_KK737546.1, 1461798, 1462517, -, 720, 25949; cds-WP _002912760.1, NZ_KK737546.1, 1462511, 1464199, -, 1689, 16763; cds-WP _002912762.1, NZ_KK737546.1, 1464429, 1464542, +, 114, 0; cds-WP _022631308.1, NZ_KK737546.1, 1464517, 1465254, -, 738, 1070; cds-WP_022631307.1, NZ_KK737546.1, 1465238, 1466185, -, 948, 0; cds-WP _023285369.1, NZ_KK737546.1, 1466178, 1467335, -, 1158, 4677; cds-WP_002912823.1, NZ_KK737546.1, 1467343, 1468260, -, 918, 6378; cds-WP_009307419.1, NZ_KK737546.1, 1468397, 1470694, -, 2298, 44745; cds-WP _002912827.1, NZ_KK737546.1, 1470889, 1472634, +, 1746, 65919; cds-WP_002912829.1, NZ_KK737546.1, 1472720, 1473274, +, 555, 4864; cds-WP _004180615.1, NZ_KK737546.1, 1473497, 1474447, -, 951, 39564; cds-WP _002912831.1, NZ_KK737546.1, 1474636, 1475223, -, 588, 0; cds-WP_009307418.1, NZ_KK737546.1, 1475378, 1475947, +, 570, 4; cds-WP_032429662.1, NZ_KK737546.1, 1475981, 1477420, -, 1440, 55701; cds-WP _022631304.1, NZ_KK737546.1, 1477692, 1479086, -, 1395, 28384; cds-WP _032429663.1, NZ_KK737546.1, 1479102, 1480964, -, 1863, 11212; cds-WP _002912842.1, NZ_KK737546.1, 1481107, 1481940, -, 834, 510; cds-WP _004175080.1, NZ_KK737546.1, 1482096, 1483460, -, 1365, 0; cds-WP _002912862.1, NZ_KK737546.1, 1483817, 1484749, -, 933, 75; cds-WP _002912865.1, NZ_KK737546.1, 1485107, 1485505, +, 399, 2; cds-WP_002912867.1, NZ_KK737546.1, 1485502, 1486197, +, 696, 0; cds-WP_002912869.1, NZ_KK737546.1, 1486325, 1487209, +, 885, 7; cds-WP_004211527.1, NZ_KK737546.1, 1487485,1488201, +, 717, 38479; cds-WP_002912871.1, NZ_KK737546.1, 1488272, 1489282, -, 1011, 191511; cds-WP_004175074.1, NZ_KK737546.1, 1489298, 1490818, -, 1521, 314069; cds-WP_002912878.1, NZ_KK737546.1, 1490937, 1491935, -, 999, 392077; cds-WP_002912919.1, NZ_KK737546.1, 1492232, 1493254, -, 1023, 79683; cds-WP_021440476.1, NZ_KK737546.1, 1493410, 1494567, -, 1158, 19830; cds-WP _002912924.1, NZ_KK737546.1, 1494583, 1495251, -, 669, 79155; cds-WP _004151123.1, NZ_KK737546.1, 1495612, 1496445, +, 834, 8906; cds-WP _032429664.1, NZ_KK737546.1, 1496516, 1498489, -, 1974, 40906; cds-WP_002912929.1, NZ_KK737546.1, 1498988, 1500457, -, 1470, 40399; cds-WP_002912932.1, NZ_KK737546.1, 1500636, 1501502, -, 867, 0; cds-WP_002912935.1, NZ_KK737546.1, 1501768, 1502817, +, 1050, 0; cds-WP_002912937.1, NZ_KK737546.1, 1502890, 1503744, +, 855, 120; cds-WP _021440480.1, NZ_KK737546.1, 1503795, 1505489, -, 1695, 28918; cds-WP _002912941.1, NZ_KK737546.1, 1505506, 1506444, -, 939, 21507; cds-WP _032428355.1, NZ_KK737546.1, 1506445, 1507575, -, 1131, 96; cds-WP _032429665.1, NZ_KK737546.1, 1507911, 1509092, +, 1182, 1276; cds-WP_004175066.1, NZ_KK737546.1, 1509132, 1509386, -, 255, 1742; cds-WP _002912951.1, NZ_KK737546.1, 1509534, 1510106, +, 573, 66985; cds-WP_002912952.1, NZ_KK737546.1, 1510177, 1511367, -, 1191, 23093; cds-WP_004200498.1, NZ_KK737546.1, 1511575, 1513041, +, 1467, 1950; cds-WP_021463904.1, NZ_KK737546.1, 1513162, 1514139, +, 978, 1; cds-WP _072269286.1, NZ_KK737546.1, 1514177, 1514890, +, 714, 21510; cds-WP_002912967.1, NZ_KK737546.1, 1515317, 1515886, +, 570, 50408; cds-WP_021440487.1, NZ _KK737546.1, 1516075, 1517637, +, 1563, 181352; cds-WP _032429666.1, NZ_KK737546.1, 1517706, 1519511, +, 1806, 49; cds-WP_004200501.1, NZ_KK737546.1, 1519521, 1520615, +, 1095, 126; cds-WP _004149131.1, NZ_KK737546.1, 1520615, 1521640, +, 1026, 7; cds-WP _004151118.1, NZ_KK737546.1, 1521642, 1523231, +, 1590, 256; cds-WP _002912974.1, NZ_KK737546.1, 1523235, 1523579, -, 345, 2413; cds-WP_002912975.1, NZ_KK737546.1, 1523911, 1525107, -, 1197, 186; cds-WP _002912977.1, NZ_KK737546.1, 1525104, 1525823, -, 720, 1807; cds-WP _004144263.1, NZ_KK737546.1, 1525971, 1527728, +, 1758, 730; cds-WP_002912979.1, NZ_KK737546.1, 1527865, 1528149, +, 285, 18731; cds-WP _004189004.1, NZ_KK737546.1, 1528208, 1529095, -, 888, 27; cds-AF52_RS0123640, NZ_KK737546.1, 1529200, 1530485, +, 1286, 0; cds-WP_024622810.1, NZ_KK737546.1, 1530504, 1531100, -, 597, 0; cds-WP_002912986.1, NZ_KK737546.1, 1531183, 1531944, +, 762, 485; cds-WP _004144267.1, NZ_KK737546.1, 1531964, 1532971, -, 1008, 17838; cds-WP _004195346.1, NZ_KK737546.1, 1533158, 1533385, +, 228, 120; cds-WP_002912990.1, NZ_KK737546.1, 1533404, 1535164, +, 1761, 18829; cds-WP _032429667.1, NZ_KK737546.1, 1535502, 1536611, +, 1110, 5020; cds-WP _032428356.1, NZ_KK737546.1, 1536786, 1537277, +, 492, 200878; cds-WP _002912994.1, NZ_KK737546.1, 1537344, 1538978, -, 1635, 14569; cds-AF52_RS0123645, NZ_KK737546.1, 1539025, 1539722, -, 698, 16586; cds-WP_020324457.1, NZ_KK737546.1, 1540115, 1541275, +, 1161, 5570; cds-WP_002912996.1, NZ_KK737546.1, 1541238, 1542674, -, 1437, 9666; cds-WP_004184919.1, NZ_KK737546.1, 1542823, 1544466, -, 1644, 45; cds-WP_016530253.1, NZ_KK737546.1, 1544541, 1545194, -, 654, 0; cds-WP_021440495.1, NZ_KK737546.1, 1545194, 1546258, -, 1065, 2339; cds-WP _032429668.1, NZ_KK737546.1, 1546332, 1547384, -, 1053, 1072; cds-WP_032429669.1, NZ_KK737546.1, 1547488, 1548582, -, 1095, 2203612; cds-WP_002913006.1, NZ_KK737546.1, 1549354, 1552011, +, 2658, 30889; cds-WP _002913007.1, NZ_KK737546.1, 1552027, 1552677, +, 651, 16362; cds-WP_032429670.1, NZ_KK737546.1, 1552723, 1555563, -, 2841, 139781; cds-WP _032429671.1, NZ_KK737546.1, 1555695, 1558328, -, 2634, 143101; cds-WP _002913014.1, NZ_KK737546.1, 1558475, 1559203, +, 729, 703; cds-WP _002913016.1, NZ_KK737546.1, 1559548, 1561833, +, 2286, 63733; cds-WP _004140835.1, NZ_KK737546.1, 1561935, 1563065, +, 1131, 153478; cds-WP _002913017.1, NZ_KK737546.1, 1563065, 1563319, +, 255, 22768; cds-WP _032429672.1, NZ_KK737546.1, 1563783, 1564853, -, 1071, 755865; cds-WP_002913019.1, NZ_KK737546.1, 1564863, 1566209, -, 1347, 553531; cds-WP _004214634.1, NZ_KK737546.1, 1566481, 1568103, +, 1623, 0; cds-WP _015958752.1, NZ_KK737546.1, 1568093, 1569352, +, 1260, 0; cds-WP_004184966.1, NZ_KK737546.1, 1569349, 1570527, +, 1179, 115; cds-WP_032428357.1, NZ_KK737546.1, 1570549, 1571352, -, 804, 9; cds-WP_002913045.1, NZ_KK737546.1, 1571367, 1572656, -, 1290, 0; cds-WP_004175029.1, NZ_KK737546.1, 1572699, 1573904, -, 1206, 0; cds-WP_002913046.1, NZ_KK737546.1, 1573915, 1574700, -, 786, 0; cds-WP _004184973.1, NZ_KK737546.1, 1574905, 1576101, -, 1197, 46070; cds-WP _019705497.1, NZ_KK737546.1, 1576204, 1576746, -, 543, 11351; cds-WP _024622815.1, NZ_KK737546.1, 1577021, 1577962, -, 942, 221; cds-WP _032429673.1, NZ_KK737546.1, 1578100, 1578525, +, 426, 0; cds-WP _021440500.1, NZ_KK737546.1, 1578581, 1579957, -, 1377, 3735; cds-WP _021440501.1, NZ_KK737546.1, 1579954, 1580919, -, 966, 47415; cds-WP_002913098.1, NZ_KK737546.1, 1580919, 1581776, -, 858, 3254; cds-WP _021440502.1, NZ_KK737546.1, 1581791, 1582549, -, 759, 118; cds-WP _002913103.1, NZ_KK737546.1, 1582546, 1584216, -, 1671, 21; cds-WP_021440503.1, NZ_KK737546.1, 1584299, 1585588, -, 1290, 6; cds-WP_004184987.1, NZ_KK737546.1, 1585724, 1586185, -, 462, 7699; cds-WP_004214593.1, NZ_KK737546.1, 1586243, 1587163, +, 921, 14; cds-WP _004151107.1, NZ_KK737546.1, 1587218, 1588675, -, 1458, 64799; cds-WP_032429674.1, NZ_KK737546.1, 1588682, 1590211, -, 1530, 326802; cds-WP _032429675.1, NZ_KK737546.1, 1590381, 1592222, -, 1842, 205426; cds-WP _002913148.1, NZ_KK737546.1, 1592219, 1592521, -, 303, 36962; cds-WP_002913150.1, NZ_KK737546.1, 1592518, 1593072, -, 555, 146159; cds-WP_002913152.1, NZ_KK737546.1, 1593084, 1593626, -, 543, 245938; cds-WP_002913156.1, NZ_KK737546.1, 1593641, 1594618, -, 978, 117528; cds-WP_023285394.1, NZ_KK737546.1, 1594615, 1597341, -, 2727, 317211; cds-WP_002913158.1, NZ_KK737546.1, 1597374, 1598711, -, 1338, 487311; cds-WP _002913160.1, NZ_KK737546.1, 1598708, 1599208, -, 501, 62403; cds-WP _002913162.1, NZ_KK737546.1, 1599211, 1601019, -, 1809, 806231; cds-WP_002913178.1, NZ_KK737546.1, 1601106, 1601780, -, 675, 297635; cds-WP_002913181.1, NZ_KK737546.1, 1601796, 1602242, -, 447, 58633; cds-WP_021440508.1, NZ _KK737546.1, 1602894, 1603820, -, 927, 8949; cds-WP_002913185.1, NZ_KK737546.1, 1604693, 1605910, +, 1218, 108565; cds-WP_002913188.1, NZ_KK737546.1, 1605992, 1606591, +, 600, 92061; cds-WP _032428358.1, NZ_KK737546.1, 1606636, 1608468, -, 1833, 42684; cds-WP _019705510.1, NZ_KK737546.1, 1608545, 1609204, -, 660, 9838; cds-WP _002913193.1, NZ_KK737546.1, 1609216, 1609710, -, 495, 3368; cds-WP _002913194.1, NZ_KK737546.1, 1609798, 1610253, -, 456, 43; cds-WP_002913195.1, NZ_KK737546.1, 1610591, 1611793, +, 1203, 484395; cds-WP_002913196.1, NZ_KK737546.1, 1611994, 1614141, +, 2148, 530303; cds-WP_032429676.1, NZ_KK737546.1, 1614234, 1614785, -, 552, 24658; cds-WP _004174991.1, NZ_KK737546.1, 1614843, 1615394, -, 552, 33259; cds-WP _004180746.1, NZ_KK737546.1, 1615457, 1616095, -, 639, 13236; cds-WP_004174988.1, NZ_KK737546.1, 1616276, 1616905, +, 630, 0; cds-WP _002913200.1, NZ_KK737546.1, 1616971, 1617333, +, 363, 3161; cds-WP _002913203.1, NZ_KK737546.1, 1617352, 1618245, +, 894, 6884; cds-WP_004217247.1, NZ_KK737546.1, 1618225, 1618341, -, 117, 0; cds-WP_032429677.1, NZ_KK737546.1, 1618461, 1618988, +, 528, 72; cds-WP_002913206.1, NZ_KK737546.1, 1618994, 1619767, -, 774, 1628; cds-WP_002913207.1, NZ_KK737546.1, 1619775, 1620491, -, 717, 64192; cds-WP_002913208.1, NZ_KK737546.1, 1620488, 1621174, -, 687, 7410; cds-WP _002913209.1, NZ_KK737546.1, 1621239, 1622021, -, 783, 89476; cds-WP _002913210.1, NZ_KK737546.1, 1622289, 1623071, -, 783, 68617; cds-WP_004140952.1, NZ_KK737546.1, 1623117, 1623278, +, 162, 10154; cds-WP _014599227.1, NZ_KK737546.1, 1623359, 1623928, -, 570, 3; cds-WP_032429678.1, NZ_KK737546.1, 1624064, 1625581, -, 1518, 49321; cds-WP _002913214.1, NZ_KK737546.1, 1625615, 1626103, -, 489, 3500; cds-WP _004151102.1, NZ_KK737546.1, 1626320, 1627009, -, 690, 882; cds-WP _021440515.1, NZ_KK737546.1, 1626999, 1628267, -, 1269, 19796; cds-WP_002913220.1, NZ_KK737546.1, 1628343, 1629263, -, 921, 118618; cds-WP _002913221.1, NZ_KK737546.1, 1629449, 1630108, -, 660, 10420; cds-WP _002913226.1, NZ_KK737546.1, 1630135, 1630947, -, 813, 5197; cds-WP_002913227.1, NZ_KK737546.1, 1630947, 1631960, -, 1014, 4666; cds-WP _021440517.1, NZ_KK737546.1, 1632024, 1633160, -, 1137, 11171; cds-WP_032429679.1, NZ_KK737546.1, 1633271, 1634248, +, 978, 23; cds-WP_004149211.1, NZ_KK737546.1, 1634335, 1635510, -, 1176, 911; cds-WP_002913291.1, NZ_KK737546.1, 1635720, 1636940, -, 1221, 3400; cds-WP_032429751.1, NZ_KK737546.1, 1637099, 1639087, +, 1989, 8680; cds-WP _002913338.1, NZ_KK737546.1, 1639149, 1639430, -, 282, 10017; cds-WP_032429680.1, NZ_KK737546.1, 1639462, 1640010, -, 549, 5430; cds-WP _002913340.1, NZ_KK737546.1, 1640010, 1640819, -, 810, 80; cds-WP _004174960.1, NZ_KK737546.1, 1640819, 1641643, -, 825, 18; cds-WP _002913342.1, NZ_KK737546.1, 1641646, 1642731, -, 1086, 36471; cds-WP_002913346.1, NZ_KK737546.1, 1642773, 1643705, -, 933, 52979; cds-WP_002913348.1, NZ_KK737546.1, 1643873, 1644424, +, 552, 1083; cds-WP _002913355.1, NZ_KK737546.1, 1644445, 1644930, -, 486, 2104; cds-WP_032429681.1, NZ_KK737546.1, 1645140, 1647284, -, 2145, 164589; cds-WP_002913358.1, NZ_KK737546.1, 1647284, 1648594, -, 1311, 70928; cds-WP _002913359.1, NZ_KK737546.1, 1648754, 1649038, -, 285, 10291; cds-WP _002913360.1, NZ_KK737546.1, 1649412, 1650734, +, 1323, 77710; cds-WP_002913362.1, NZ_KK737546.1, 1650796, 1651557, -, 762, 77524; cds-WP_004149224.1, NZ_KK737546.1, 1651847, 1652776, +, 930, 91; cds-WP _004174945.1, NZ_KK737546.1, 1653189, 1653671, +, 483, 6096; cds-WP _032428359.1, NZ_KK737546.1, 1654039, 1654920, +, 882, 11; cds-WP_021440524.1, NZ_KK737546.1, 1654930, 1655838, -, 909, 4203; cds-WP _009486224.1, NZ_KK737546.1, 1655971, 1656429, +, 459, 1; cds-WP _023282888.1, NZ_KK737546.1, 1656426, 1657622, +, 1197, 0; cds-WP_099119320.1, NZ_KK737546.1, 1657961, 1658032, +, 72, 1596; cds-WP _002913372.1, NZ_KK737546.1, 1658103, 1659317, -, 1215, 7969; cds-WP _004188912.1, NZ _KK737546.1, 1659406, 1659591, +, 186, 0; cds-WP _004153200.1, NZ_KK737546.1, 1659588, 1659701, -, 114, 3; cds-WP_004149230.1, NZ_KK737546.1, 1659700, 1661397, +,


1698, 4577; cds-WP_002913374.1, NZ_KK737546.1, 1661409, 1662146, +, 738, 10752; cds-WP_002913377.1, NZ_KK737546.1, 1662200, 1663165, -, 966, 61693; cds-WP_004154521.1, NZ_KK737546.1, 1663429, 1664664, +, 1236, 1; cds-WP _032428368.1, NZ_KK737546.1, 1664661, 1666322, -, 1662, 0; cds-WP _002913417.1, NZ_KK737546.1, 1666503, 1667495, +, 993, 75567; cds-WP_002913419.1, NZ_KK737546.1, 1667626, 1667985, +, 360, 268; cds-WP_002913421.1, NZ_KK737546.1, 1668043, 1669284, -, 1242, 537; cds-WP _002913423.1, NZ_KK737546.1, 1669631, 1670833, +, 1203, 3018; cds-WP_032429682.1, NZ_KK737546.1, 1670882, 1673053, -, 2172, 2954; cds-WP _002913434.1, NZ_KK737546.1, 1673558, 1673911, +, 354, 0; cds-WP_002913435.1, NZ_KK737546.1, 1673915, 1674307, +, 393, 36; cds-WP_004145598.1, NZ_KK737546.1, 1674359, 1675777, -, 1419, 214245; cds-WP _021440528.1, NZ_KK737546.1, 1676741, 1677667, -, 927, 322; cds-WP_021440529.1, NZ_KK737546.1, 1677756, 1678754, +, 999, 26509; cds-WP_002913440.1, NZ_KK737546.1, 1678751, 1678969, -, 219, 2152; cds-WP_004180820.1, NZ_KK737546.1, 1678971, 1680986, -, 2016, 8953; cds-WP _004180822.1, NZ_KK737546.1, 1681056, 1682117, -, 1062, 45813; cds-WP_004174922.1, NZ_KK737546.1, 1682348, 1683109, +, 762, 1262; cds-WP_002913498.1, NZ_KK737546.1, 1683286, 1684257, +, 972, 11840; cds-WP _002913505.1, NZ_KK737546.1, 1684638, 1684895, +, 258, 73258; cds-WP _021440531.1, NZ_KK737546.1, 1684940, 1686667, +, 1728, 283276; cds-WP_000522253.1, NZ_KK737546.1, 1686710, 1687219, +, 510, 63933; cds-WP_004890526.1, NZ_KK737546.1, 1687261, 1687500, -, 240, 1; cds-WP _004890524.1, NZ_KK737546.1, 1687497, 1688363, -, 867, 4612; cds-WP_004174915.1, NZ_KK737546.1, 1688446, 1689744, +, 1299, 22; cds-WP _004890521.1, NZ_KK737546.1, 1689885, 1690280, +, 396, 0; cds-WP _004890515.1, NZ_KK737546.1, 1690277, 1691188, -, 912, 317; cds-WP _002913623.1, NZ_KK737546.1, 1691307, 1692401, -, 1095, 16795; cds-WP_004890510.1, NZ_KK737546.1, 1692391, 1693266, -, 876, 4; cds-WP _002913626.1, NZ_KK737546.1, 1693266, 1694099, -, 834, 0; cds-WP _032429684.1, NZ_KK737546.1, 1694099, 1695121, -, 1023, 9; cds-AF52_RS25445, NZ_KK737546.1, 1695322, 1695665, +, 344, 12; cds-WP _020803947.1, NZ_KK737546.1, 1695761, 1696660, -, 900, 7135; cds-WP_002913630.1, NZ_KK737546.1, 1696755, 1697330, -, 576, 2569; cds-WP _002913635.1, NZ_KK737546.1, 1697392, 1697841, -, 450, 4; cds-WP_002913637.1, NZ_KK737546.1, 1697828,1698253, -, 426, 34; cds-WP_002913639.1, NZ_KK737546.1, 1698465, 1699337, +, 873, 189715; cds-WP_032429685.1, NZ_KK737546.1, 1699337, 1700236, +, 900, 3320; cds-WP_002913642.1, NZ_KK737546.1, 1700280, 1701332, -, 1053, 6; cds-WP_032428360.1, NZ_KK737546.1, 1701378, 1701863, -, 486, 0; cds-WP_004174905.1, NZ_KK737546.1, 1701875, 1702534, -, 660, 2; cds-WP_021440537.1, NZ_KK737546.1, 1702544, 1703443, -, 900, 0; cds-WP _032429686.1, NZ_KK737546.1, 1703464, 1704825, -, 1362, 28; cds-WP_021440539.1, NZ_KK737546.1, 1704837, 1706240, -, 1404, 0; cds-WP _004149260.1, NZ_KK737546.1, 1706237, 1707469, -, 1233, 0; cds-WP_032429687.1, NZ_KK737546.1, 1707669, 1708856, -, 1188, 0; cds-WP_004180842.1, NZ_KK737546.1, 1708846, 1709685, -, 840, 0; cds-WP_004152003.1, NZ_KK737546.1, 1709695, 1711098, -, 1404, 0; cds-WP_002913719.1, NZ_KK737546.1, 1711110, 1711397, -, 288, 0; cds-WP _000387720.1, NZ_KK737546.1, 1711526, 1711816, -, 291, 0; cds-WP _021440542.1, NZ_KK737546.1, 1711855, 1712871, -, 1017, 0; cds-WP _004180847.1, NZ_KK737546.1, 1712861, 1713667, -, 807, 0; cds-WP _002913725.1, NZ_KK737546.1, 1713664, 1714353, -, 690, 0; cds-WP_021440543.1, NZ_KK737546.1, 1714331, 1714810, -, 480, 0; cds-WP _002913729.1, NZ_KK737546.1, 1714823, 1715158, -, 336, 1; cds-WP _004185057.1, NZ_KK737546.1, 1715377, 1717656, -, 2280, 132791; cds-WP_002913732.1, NZ_KK737546.1, 1717951, 1718907, +, 957, 10089; cds-WP _004149269.1, NZ _KK737546.1, 1718924, 1720918, +, 1995, 1443; cds-WP _009309515.1, NZ_KK737546.1, 1720908, 1721954, -, 1047, 2; cds-WP _002913754.1, NZ_KK737546.1, 1722018, 1722614, -, 597, 107; cds-WP _032429689.1, NZ_KK737546.1, 1722673, 1724655, -, 1983, 2; cds-WP_004185072.1, NZ_KK737546.1, 1725028, 1728141, +, 3114, 251; cds-WP_100181659.1, NZ_KK737546.1, 1728269, 1728328, -, 60, 3196; cds-WP _002913764.1, NZ_KK737546.1, 1728694, 1729047, +, 354, 696; cds-WP_021440546.1, NZ_KK737546.1, 1729051, 1730178, +, 1128, 49002; cds-WP_002913768.1, NZ_KK737546.1, 1730205, 1730408, +, 204, 117194; cds-WP _002913770.1, NZ_KK737546.1, 1730457, 1731152, -, 696, 51; cds-WP _021440547.1, NZ_KK737546.1, 1731229, 1733232, -, 2004, 477; cds-WP _032429690.1, NZ_KK737546.1, 1733242, 1734117, -, 876, 5403; cds-WP _002913801.1, NZ_KK737546.1, 1734237, 1734950, -, 714, 33855; cds-WP_004149279.1, NZ_KK737546.1, 1735167, 1736201, -, 1035, 18092; cds-WP_002913803.1, NZ_KK737546.1, 1736218, 1737096, -, 879, 192853; cds-WP_002913804.1, NZ_KK737546.1, 1737250, 1737816, +, 567, 27370; cds-WP_002913805.1, NZ_KK737546.1, 1737820, 1738290, +, 471, 60443; cds-WP _002913806.1, NZ_KK737546.1, 1738352, 1739413, -, 1062, 11650; cds-WP _004221267.1, NZ_KK737546.1, 1739468, 1739584, -, 117, 6; cds-WP _002913807.1, NZ_KK737546.1, 1739636, 1741099, +, 1464, 59189; cds-WP_002913810.1, NZ_KK737546.1, 1741109, 1741468, +, 360, 89; cds-WP _023301620.1, NZ_KK737546.1, 1741596, 1742519, +, 924, 86; cds-WP_020947395.1, NZ_KK737546.1, 1742516, 1743217, -, 702, 47914; cds-WP_002913824.1, NZ_KK737546.1, 1743316, 1744602, -, 1287, 18337; cds-WP_002913827.1, NZ_KK737546.1, 1744698, 1745324, -, 627, 17491; cds-WP_021440551.1, NZ_KK737546.1, 1745542, 1746975, -, 1434, 63201; cds-WP_021440552.1, NZ_KK737546.1, 1746985, 1747878, -, 894, 1032; cds-WP _004149288.1, NZ_KK737546.1, 1748142, 1749179, +, 1038, 883; cds-WP _004145656.1, NZ_KK737546.1, 1749176, 1749817, +, 642, 20; cds-WP_002913838.1, NZ_KK737546.1, 1749998, 1752058, +, 2061, 134090; cds-WP _002913839.1, NZ_KK737546.1, 1752062, 1753594, +, 1533, 98283; cds-WP _032429691.1, NZ_KK737546.1, 1753648, 1755876, -, 2229, 15088; cds-WP_004174861.1, NZ_KK737546.1, 1756247, 1756420, +, 174, 58; cds-WP_004221278.1, NZ_KK737546.1, 1756517, 1757428, -, 912, 8; cds-WP _021440556.1, NZ_KK737546.1, 1757502, 1758734, +, 1233, 0; cds-WP _021440557.1, NZ_KK737546.1, 1759028, 1760206, +, 1179, 0; cds-WP_009309501.1, NZ_KK737546.1, 1760190, 1762058, +, 1869, 3; cds-WP_004151979.1, NZ_KK737546.1, 1762153, 1763730, -, 1578, 64132; cds-WP _004151980.1, NZ_KK737546.1, 1763798, 1765264, -, 1467, 9536; cds-WP _015958798.1, NZ_KK737546.1, 1765423, 1766814, +, 1392, 21156; cds-WP _004144303.1, NZ_KK737546.1, 1766798, 1767016, -, 219, 74; cds-WP _021313079.1, NZ_KK737546.1, 1767066, 1768145, -, 1080, 17; cds-WP_020317242.1, NZ_KK737546.1, 1768329, 1768808, -, 480, 0; cds-WP_032418518.1, NZ_KK737546.1, 1769030, 1769722, -, 693, 2; cds-WP_004144309.1, NZ_KK737546.1, 1770089, 1771567, -, 1479,6638; cds-WP_002913889.1, NZ_KK737546.1, 1771681,1772859, -, 1179, 144090; cds-WP_002913890.1, NZ_KK737546.1, 1772870, 1773490, -, 621, 83909; cds-WP_004149335.1, NZ_KK737546.1, 1773525, 1774799, -, 1275, 62983; cds-WP _002913892.1, NZ_KK737546.1, 1774891, 1776012, -, 1122, 12687; cds-WP_004149336.1, NZ_KK737546.1, 1776039, 1777034, -, 996, 14143; cds-WP_002913894.1, NZ_KK737546.1, 1777311, 1778477, -, 1167, 7248; cds-WP_004144312.1, NZ_KK737546.1, 1778961, 1779392, -, 432, 214962; cds-WP_004890414.1, NZ_KK737546.1, 1779553, 1781877, -, 2325, 31; cds-WP_021440561.1, NZ_KK737546.1, 1781878, 1786827, -, 4950, 132278; cds-WP_002913950.1, NZ_KK737546.1, 1787033, 1787890, +, 858, 26269; cds-WP _032429692.1, NZ_KK737546.1, 1788117, 1788959, +, 843, 19; cds-WP_021440563.1, NZ_KK737546.1, 1789030, 1789806, -, 777, 12820; cds-WP_002913953.1, NZ_KK737546.1, 1789905, 1791191, -, 1287, 61183; cds-WP _002913954.1, NZ_KK737546.1, 1791262, 1791462, -, 201, 55548; cds-WP _002913956.1, NZ_KK737546.1, 1791464, 1791799, -, 336, 45297; cds-WP_032429693.1, NZ_KK737546.1, 1791801, 1793651, -, 1851, 93323; cds-WP_004174835.1, NZ_KK737546.1, 1793667, 1794182, -, 516, 48685; cds-WP _002913979.1, NZ_KK737546.1, 1794257, 1794580, -, 324, 15296; cds-WP _002913991.1, NZ_KK737546.1, 1794598, 1794984, -, 387, 3136; cds-WP_002913992.1, NZ_KK737546.1, 1795011, 1796225, -, 1215, 73703; cds-WP_002913993.1, NZ_KK737546.1, 1796404, 1796895, -, 492, 46; cds-WP _004185116.1, NZ_KK737546.1, 1797130, 1797864, -, 735, 5547; cds-WP_002913995.1, NZ_KK737546.1, 1797985, 1798788, +, 804, 17345; cds-WP_021440564.1, NZ_KK737546.1, 1798835, 1799671, -, 837, 0; cds-WP_021440565.1, NZ_KK737546.1, 1799771, 1800751, -, 981, 0; cds-WP _023301580.1, NZ_KK737546.1, 1800742, 1801380, -, 639, 9638; cds-WP_002914002.1, NZ_KK737546.1, 1801505, 1802782, +, 1278, 1407; cds-WP_004144329.1, NZ_KK737546.1, 1802779, 1803915, -, 1137, 442; cds-WP _021440567.1, NZ_KK737546.1, 1803998, 1804831, -, 834, 0; cds-WP _002914018.1, NZ_KK737546.1, 1804831, 1806267, -, 1437, 3; cds-WP _015958809.1, NZ_KK737546.1, 1806337, 1809612, -, 3276, 5; cds-WP_004214134.1, NZ_KK737546.1, 1809725, 1810921, +, 1197, 1378; cds-WP_002914024.1, NZ_KK737546.1, 1810995, 1811417, +, 423, 1035; cds-WP_002914027.1, NZ_KK737546.1, 1811473, 1812726, -, 1254, 504254; cds-WP _004185137.1, NZ_KK737546.1, 1813052, 1814242, +, 1191, 7423; cds-WP _002914032.1, NZ_KK737546.1, 1814317, 1814655, -, 339, 448; cds-WP_004149357.1, NZ_KK737546.1, 1814721, 1816058, -, 1338, 7260; cds-WP _002914033.1, NZ_KK737546.1, 1816045, 1816731, -, 687, 9857; cds-WP _004888415.1, NZ_KK737546.1, 1816761, 1818182, -, 1422, 3293; cds-WP _004185139.1, NZ_KK737546.1, 1818773, 1822660, -, 3888, 23278; cds-WP_004144346.1, NZ_KK737546.1, 1822836, 1824452, +, 1617, 4497; cds-WP_071603195.1, NZ_KK737546.1, 1824449, 1824991, -, 543, 10; cds-WP _004180922.1, NZ _KK737546.1, 1825021, 1825656, -, 636, 1; cds-WP_004144349.1, NZ _KK737546.1, 1825870, 1826718, +, 849, 281; cds-WP _004888420.1, NZ _KK737546.1, 1826775, 1827035, +, 261, 4442; cds-WP_004144351.1, NZ_KK737546.1, 1827048, 1827428, -, 381, 26874; cds-WP _004888422.1, NZ_KK737546.1, 1827428, 1828159, -, 732, 28083; cds-WP_002914062.1, NZ_KK737546.1, 1828171, 1828908, -, 738, 18679; cds-WP _002914063.1, NZ_KK737546.1, 1828920, 1829825, -, 906, 44735; cds-WP _002914065.1, NZ_KK737546.1, 1829822, 1830502, -, 681, 5145; cds-WP_002914067.1, NZ_KK737546.1, 1830752, 1831726, -, 975, 90827; cds-WP _002914069.1, NZ_KK737546.1, 1831742, 1833541, -, 1800, 91992; cds-WP_004144354.1, NZ _KK737546.1, 1833727, 1834206, -, 480, 12007; cds-WP _002914070.1, NZ_KK737546.1, 1834203, 1835159, -, 957, 47371; cds-WP_002914072.1, NZ_KK737546.1, 1835159, 1835809, -, 651, 172503; cds-WP _002914074.1, NZ_KK737546.1, 1835842, 1836417, -, 576, 148341; cds-WP_121980491.1, NZ _KK737546.1, 1836414, 1836509, -, 96, 43; cds-WP _004144357.1, NZ _KK737546.1, 1836838, 1838457, +, 1620, 720; cds-WP_002914079.1, NZ_KK737546.1, 1838442, 1839179, -, 738, 5; cds-WP_002914082.1, NZ_KK737546.1, 1839311, 1840642, +, 1332, 1965; cds-WP_002914084.1, NZ_KK737546.1, 1840688, 1841071, -, 384, 1; cds-WP _002914088.1, NZ_KK737546.1, 1841384, 1842073, +, 690, 1098; cds-WP _002914089.1, NZ_KK737546.1, 1842131, 1843216, -, 1086, 218; cds-WP_002914091.1, NZ_KK737546.1, 1843420, 1843845, +, 426, 266; cds-WP _002914092.1, NZ_KK737546.1, 1843915, 1844613, +, 699, 23528; cds-WP _004149373.1, NZ_KK737546.1, 1844648, 1847299, +, 2652, 147388; cds-WP_002914094.1, NZ_KK737546.1, 1847420, 1848775, +, 1356, 39916; cds-WP _004888435.1, NZ_KK737546.1, 1848817, 1849140, +, 324, 1023; cds-WP _004144368.1, NZ_KK737546.1, 1849144, 1850442, -, 1299, 34790; cds-AF52_RS14425, NZ_KK737547.1, 98, 328, -, 231, 0; cds-WP_002890376.1, NZ_KK737547.1, 349, 636, -, 288, 0; cds-AF52_RS0123765, NZ_KK737547.1, 642, 842, -, 201, 25; cds-AF52_RS27035, NZ_KK737547.1, 876, 1049, +, 174, 232; cds-AF52_RS14415, NZ_KK737547.1, 4070, 4221, +, 152, 209; cds-AF52_RS14410, NZ_KK737547.1, 4277, 4528, -, 252, 14; cds-WP _002890386.1, NZ_KK737547.1, 4875, 5477, -, 603, 47035; cds-AF52_RS14400, NZ_KK737547.1, 5700, 5873, -, 174, 318; cds-AF52_RS27040, NZ_KK737547.1, 7013, 7174, -, 162, 291; cds-WP _032429763.1, NZ_KK737547.1, 7192, 7758, -, 567, 0; cds-WP _032429764.1, NZ_KK737547.1, 7833, 7949, +, 117, 0; cds-WP _002890390.1, NZ_KK737547.1, 8014, 9078, +, 1065, 9958; cds-WP_002890395.1, NZ_KK737547.1, 9187, 10314, +, 1128, 211181; cds-WP_002890398.1, NZ_KK737547.1, 10337, 10669, +, 333, 74802; cds-WP_002890400.1, NZ_KK737547.1, 10696, 12543, +, 1848, 122457; cds-WP_002890403.1, NZ_KK737547.1,


12554, 13525, +, 972, 23908; cds-WP _002890404.1, NZ_KK737547.1, 13662, 14027, +, 366, 0; cds-WP _004144646.1, NZ_KK737547.1, 14052, 14747, +, 696, 2; cds-WP_002890412.1, NZ_KK737547.1, 14802, 15686, -, 885, 234877; cds-WP _002890414.1, NZ _KK737547.1, 15985, 16524, -, 540, 4; cds-WP _002890417.1, NZ_KK737547.1, 16672, 17121, +, 450, 129; cds-WP _004144650.1, NZ_KK737547.1, 17125, 18228, +, 1104, 2089; cds-WP_001021161.1, NZ_KK737547.1, 18316, 18786, +, 471, 18355; cds-WP_002891356.1, NZ_KK737547.1, 18806, 19225, +, 420, 57928; cds-WP_004177267.1, NZ_KK737547.1, 19297, 20268, +, 972, 29559; cds-WP_004177266.1, NZ_KK737547.1, 20261, 20764, +, 504, 177; cds-WP _004191727.1, NZ_KK737547.1, 20810, 21784, -, 975, 2; cds-WP_004144655.1, NZ_KK737547.1, 21845, 23707, -, 1863, 1926; cds-WP_004144656.1, NZ_KK737547.1, 23726, 24625, -, 900, 31216; cds-WP _032429766.1, NZ_KK737547.1, 24626, 24868, -, 243, 10082; cds-WP _004151340.1, NZ_KK737547.1, 25050, 26498, +, 1449, 2250; cds-WP_032429768.1, NZ_KK737547.1, 26565, 27041, -, 477, 855; cds-WP_002891460.1, NZ_KK737547.1, 27092, 27685, -, 594, 0; cds-WP_002891462.1, NZ_KK737547.1, 27648, 28559, -, 912, 3737; cds-WP_002891465.1, NZ_KK737547.1, 28751, 29242, +, 492, 40395; cds-WP _004144660.1, NZ_KK737547.1, 29286, 30650, -, 1365, 1650; cds-WP_004177261.1, NZ_KK737547.1, 30810, 31988, -, 1179, 5116; cds-WP _002891473.1, NZ_KK737547.1, 32320, 33684, -, 1365, 3; cds-WP_002891476.1, NZ_KK737547.1, 33695, 34513, -, 819, 0; cds-WP_032103307.1, NZ_KK737547.1, 34588, 36267, -, 1680, 0; cds-WP _002891541.1, NZ_KK737547.1, 36278, 36598, -, 321, 0; cds-WP_032429771.1, NZ_KK737547.1, 36612, 38288, -, 1677, 19192; cds-WP _032419345.1, NZ_KK737547.1, 38285, 39106, -, 822, 0; cds-WP _002891624.1, NZ_KK737547.1, 39259, 40017, +, 759,158; cds-WP_004178748.1, NZ_KK737547.1, 40057, 40389, -, 333, 8; cds-WP_002891629.1, NZ_KK737547.1, 40639, 41526, -, 888, 300094; cds-WP_002891634.1, NZ_KK737547.1, 41538, 41867, -, 330, 236106; cds-WP_002891635.1, NZ_KK737547.1, 41867, 42478, -, 612, 347651; cds-WP _032424651.1, NZ_KK737547.1, 42468, 44459, -, 1992, 1820420; cds-WP_002891641.1, NZ_KK737547.1, 44479, 45423, -, 945, 987323; cds-WP_032429776.1, NZ_KK737547.1, 45903, 47378, -, 1476, 13639; cds-WP_002891647.1, NZ_KK737547.1, 47422, 48000, -, 579, 8225; cds-WP _032429779.1, NZ_KK737547.1, 48303, 48620, +, 318, 3804; cds-WP _004147333.1, NZ_KK737547.1, 48966, 50264, +, 1299, 387426; cds-WP _002891804.1, NZ_KK737547.1, 50574, 51197, +, 624, 17980; cds-WP_002891807.1, NZ_KK737547.1, 51448, 52722, +, 1275, 95680; cds-WP _004151336.1, NZ_KK737547.1, 52906, 55260, +, 2355, 220166; cds-WP_002444653.1, NZ_KK737547.1, 55470, 55742, +, 273, 53188; cds-WP _004177252.1, NZ_KK737547.1, 55957, 57831, +, 1875, 231193; cds-WP _004144680.1, NZ_KK737547.1, 57980, 58348, +, 369, 0; cds-WP _002891860.1, NZ_KK737547.1, 58460, 58861, +, 402, 2473; cds-WP_002891863.1, NZ_KK737547.1, 58973, 59674, -, 702, 27590; cds-WP_032429782.1, NZ_KK737547.1, 59741, 61441, -, 1701, 207; cds-WP _004151335.1, NZ_KK737547.1, 61569, 62387, +, 819, 5; cds-WP _002891871.1, NZ_KK737547.1, 62432, 63484, -, 1053, 2885; cds-WP_002891873.1, NZ_KK737547.1, 63600, 64058, +, 459, 5239; cds-WP_032429784.1, NZ_KK737547.1, 64102, 65874, +, 1773, 71; cds-WP _032429785.1, NZ_KK737547.1, 65867, 67645, +, 1779, 112; cds-WP_002891893.1, NZ_KK737547.1, 67889, 68227, +, 339, 0; cds-WP _004152876.1, NZ_KK737547.1, 68261, 69547, +, 1287, 833; cds-WP_020804789.1, NZ_KK737547.1, 69602, 70465, -, 864, 7203; cds-WP_002891903.1, NZ_KK737547.1, 70682, 71173, +, 492, 38; cds-WP _004142687.1, NZ_KK737547.1, 71211, 71522, -, 312, 3963; cds-WP _004178755.1, NZ_KK737547.1, 71590, 71997, -, 408, 165; cds-WP_013815099.1-31, NZ_KK737547.1, 72608, 73576, -, 969, 6354; cds-WP _004147373.1, NZ_KK737547.1, 74028, 77174, -, 3147, 345479; cds-WP_004177236.1, NZ_KK737547.1, 77197, 78390, -, 1194, 402111; cds-WP_002892080.1, NZ_KK737547.1, 78533, 79183, +, 651, 10375; cds-WP _032429786.1, NZ_KK737547.1, 79313, 82660, +, 3348, 128850; cds-WP _032429788.1, NZ_KK737547.1, 82696, 83595, -, 900, 33; cds-WP_002892136.1, NZ_KK737547.1, 83663, 83836, -, 174, 4; cds-WP_002892142.1, NZ_KK737547.1, 83849, 84376, -, 528, 0; cds-WP _002892144.1, NZ_KK737547.1, 84446, 84823, +, 378, 12; cds-WP _002892145.1, NZ_KK737547.1, 84974, 85525, +, 552, 638; cds-WP _032429789.1, NZ_KK737547.1, 85618, 87525, +, 1908, 6661; cds-WP_002892173.1, NZ_KK737547.1, 87583, 87915, +, 333, 1252; cds-WP_002892177.1, NZ_KK737547.1, 87915, 88520, +, 606, 344; cds-WP_002892181.1, NZ_KK737547.1, 88632, 90506, +, 1875, 54764; cds-WP_032423667.1, NZ_KK737547.1, 90729, 91373, +, 645, 96701; cds-WP _002892189.1, NZ_KK737547.1, 91502, 92464, +, 963, 46356; cds-WP_002892192.1, NZ_KK737547.1, 92528, 93832, +, 1305, 6766; cds-WP_002892195.1, NZ_KK737547.1, 93868, 95544, -, 1677, 7495; cds-WP_004147385.1, NZ_KK737547.1, 95770, 96990, -, 1221, 1; cds-WP _002892203.1, NZ_KK737547.1, 97260, 98912, +, 1653, 6957; cds-WP _002892205.1, NZ_KK737547.1, 99018, 99497, -, 480, 172; cds-WP_004151327.1, NZ_KK737547.1, 99700, 100494, -, 795, 8944; cds-WP_004893800.1, NZ_KK737547.1, 100626, 103127, -, 2502, 7294; cds-WP_002892208.1, NZ_KK737547.1, 103234, 103644, +, 411, 985; cds-WP _004893797.1, NZ_KK737547.1, 103641, 104099, -, 459, 0; cds-WP _002892258.1, NZ_KK737547.1, 104096, 105013, -, 918, 2274; cds-WP _004893793.1, NZ_KK737547.1, 105154, 105831, +, 678, 3232; cds-WP_004893788.1, NZ_KK737547.1, 105818, 106600, +, 783, 5594; cds-WP_002892263.1, NZ_KK737547.1, 106708, 107562, -, 855, 88484; cds-WP_009484702.1, NZ_KK737547.1, 107621, 108430, -, 810, 42; cds-WP _004196998.1, NZ_KK737547.1, 108420, 109043, -, 624, 4; cds-WP _032429794.1, NZ_KK737547.1, 109014, 109700, +, 687, 0; cds-WP_032429796.1, NZ_KK737547.1, 109697, 112111, +, 2415, 21631; cds-WP_004219504.1, NZ_KK737547.1, 112088, 112201, -, 114, 0; cds-WP _004142997.1, NZ_KK737547.1, 112293, 113438, +, 1146, 2; cds-WP _004151323.1, NZ_KK737547.1, 113546, 114622, -, 1077, 1; cds-WP_032429798.1, NZ_KK737547.1, 114734, 115801, -, 1068, 5352; cds-WP_004151322.1, NZ_KK737547.1, 115798, 116307, -, 510, 2357; cds-WP _032429801.1, NZ_KK737547.1, 116404, 116742, -, 339, 0; cds-WP _004151320.1, NZ_KK737547.1, 116850, 117572, -, 723, 369; cds-WP_004151319.1, NZ_KK737547.1, 117576, 118070, -, 495, 13418; cds-WP _004143010.1, NZ_KK737547.1, 118246, 119631, +, 1386, 18722; cds-WP_004143016.1, NZ_KK737547.1, 119677, 119889, -, 213, 0; cds-WP_004143017.1, NZ_KK737547.1, 119891, 120757, -, 867, 8315; cds-WP_013815099.1-32, NZ_KK737547.1, 121337, 122305, +, 969, 4154; cds-AF52_RS25480, NZ_KK737547.1, 122362, 122511, +, 150, 58; cds-WP _002893005.1, NZ_KK737547.1, 122529, 123590, +, 1062, 0; cds-AF52_RS13845, NZ_KK737547.1, 123655, 124524, +, 870, 0; cds-WP_013815099.1-33, NZ_KK737547.1, 124555, 125523, +, 969, 6426; cds-AF52_RS27075, NZ_KK737547.1, 125582, 125707, +, 126, 57; cds-AF52_RS13835, NZ_KK737547.1, 125760, 126170, -, 411, 0; cds-AF52_RS27080, NZ_KK737547.1, 127801, 127981, -, 181, 266; cds-AF52_RS13830, NZ_KK737547.1, 128015, 130339, -, 2325, 92; cds-WP _021441375.1, NZ_KK737547.1, 130436, 131470, -, 1035, 86; cds-WP_004151823.1, NZ_KK737547.1, 132136, 133002, -, 867, 47; cds-WP_004223482.1, NZ_KK737547.1, 133111, 134538, +, 1428, 0; cds-WP _004142570.1, NZ_KK737547.1, 134609, 135853, +, 1245, 6623; cds-WP _004176981.1, NZ_KK737547.1, 135857, 136837, -, 981, 1932; cds-WP _004183289.1, NZ_KK737547.1, 137086, 137502, +, 417, 0; cds-WP_016946855.1, NZ_KK737547.1, 137522, 138673, -, 1152, 15335; cds-WP _032429809.1, NZ_KK737547.1, 138675, 139697, -, 1023, 2; cds-WP _021441372.1, NZ_KK737547.1, 139714, 140919, -, 1206, 2; cds-WP _021441371.1, NZ_KK737547.1, 141107, 142483, -, 1377, 1; cds-WP_032428635.1, NZ_KK737547.1, 142591, 144789, -, 2199, 0; cds-WP_032428633.1, NZ_KK737547.1, 144849, 145931, -, 1083, 0; cds-WP _032428631.1, NZ_KK737547.1, 146327, 147811, -, 1485, 0; cds-WP _004176990.1, NZ_KK737547.1, 147970, 149271, +, 1302, 22; cds-WP _002892824.1, NZ_KK737547.1, 149285, 149650, +, 366, 0; cds-WP_021441367.1, NZ_KK737547.1, 150030, 151529, +, 1500, 0; cds-WP_021441366.1, NZ_KK737547.1, 151507, 152049, +, 543, 15081; cds-WP _004178885.1, NZ_KK737547.1, 152067, 152429, -, 363, 39328; cds-WP _004178884.1, NZ_KK737547.1, 152430, 152732, -, 303, 27508; cds-WP _021441365.1, NZ _KK737547.1, 152816, 153931, -, 1116, 26574; cds-WP _004183273.1, NZ_KK737547.1, 153948, 155120, -, 1173, 2676; cds-WP _002892774.1, NZ_KK737547.1, 155238, 155921, -, 684, 13926; cds-WP_009308086.1, NZ_KK737547.1, 156346, 157533, +, 1188, 7; cds-WP_004223434.1, NZ_KK737547.1, 157578, 159311, +, 1734, 0; cds-WP _004183270.1, NZ_KK737547.1, 159399, 160175, +, 777, 0; cds-WP _032429971.1, NZ_KK737547.1, 160201, 160935, +, 735, 172; cds-WP _013815099.1-34, NZ_KK737547.1, 160961, 161929, -, 969, 4801; cds-AF52_RS13690, NZ_KK737547.1, 161961, 162431, -, 471, 0; cds-WP_021441356.1, NZ_KK737547.1, 162670, 163593, +, 924, 0; cds-WP _004147437.1, NZ_KK737547.1, 163758, 165275, +, 1518,0; cds-WP_021441355.1, NZ_KK737547.1, 165380, 166750, +, 1371,0; cds-WP_021441354.1, NZ_KK737547.1, 166750, 168150, +, 1401, 0; cds-WP_187079191.1, NZ_KK737547.1, 168174, 169184, +, 1011, 0; cds-WP_004177009.1, NZ_KK737547.1, 169200, 169841, -, 642, 0; cds-WP _004152946.1, NZ_KK737547.1, 170025, 171047, -, 1023, 0; cds-WP_004142660.1, NZ_KK737547.1, 171067, 172551, -, 1485, 0; cds-WP_002892597.1, NZ_KK737547.1, 172584, 173507, -, 924, 0; cds-WP_004191476.1, NZ_KK737547.1, 173937, 174956, -, 1020, 0; cds-AF52_RS13635, NZ_KK737547.1, 175058, 176062, +, 1005, 0; cds-WP_004147428.1, NZ_KK737547.1, 176984, 178015, -, 1032, 0; cds-WP_004191478.1, NZ_KK737547.1, 178025, 179197, -, 1173, 0; cds-WP _004215104.1, NZ_KK737547.1, 179194, 180114, -, 921, 0; cds-WP_187079192.1, NZ_KK737547.1, 180220, 181188, -, 969, 3812; cds-AF52_RS0123810, NZ_KK737547.1, 181222, 181695, +, 474, 641; cds-WP _032429814.1, NZ_KK737547.1, 181760, 183334, -, 1575, 208; cds-WP _002892402.1, NZ_KK737547.1, 183628, 183900, -, 273, 11736; cds-WP _002892400.1, NZ_KK737547.1, 184001, 184921, -, 921, 131199; cds-WP _032429816.1, NZ_KK737547.1, 185432, 186298, +, 867, 2387; cds-WP _032428620.1, NZ_KK737547.1, 186371, 187675, -, 1305, 0; cds-WP_004142684.1, NZ_KK737547.1, 187721, 187861, -, 141, 0; cds-WP _002892370.1, NZ_KK737547.1, 188186, 188356, +, 171, 0; cds-AF52_RS27950, NZ_KK737547.1, 188435, 188512, -, 78, 0; cds-WP _013815099.1-35, NZ _KK737547.1, 188546, 189514, +, 969, 8529; cds-AF52_RS13575, NZ_KK737547.1, 189571, 190284, -, 714, 1; cds-WP_004183295.1, NZ_KK737547.1, 190287, 191030, -, 744, 0; cds-WP_004176974.1, NZ_KK737547.1, 191045, 191515, -, 471, 0; cds-WP _002893017.1, NZ_KK737547.1, 191508, 191942, -, 435, 0; cds-WP _004178896.1, NZ_KK737547.1, 192190, 192843, -, 654, 136; cds-WP _004142557.1, NZ_KK737547.1, 192963, 193331, -, 369, 3837; cds-WP _014599061.1, NZ_KK737547.1, 193331, 193912, -, 582, 741; cds-WP_171991789.1, NZ_KK737547.1, 194092, 195207, +, 1116, 13; cds-WP_002893035.1, NZ_KK737547.1, 195238, 195579, +, 342, 340; cds-WP_002893037.1, NZ_KK737547.1, 195597, 195845, -, 249, 261; cds-WP_032428645.1, NZ_KK737547.1, 196348, 199071, +, 2724, 7; cds-WP_021441380.1, NZ_KK737547.1, 199124, 200203, +, 1080, 0; cds-WP_032429823.1, NZ_KK737547.1, 200217, 203309, +, 3093, 0; cds-WP _004176956.1, NZ_KK737547.1, 203658, 204377, -, 720, 5966; cds-WP _004178906.1, NZ_KK737547.1, 204425, 205540, -, 1116, 3; cds-WP _021441381.1, NZ_KK737547.1, 205867, 207534, +, 1668, 0; cds-WP _004178910.1, NZ_KK737547.1, 207553, 208506, +, 954, 0; cds-WP_008805546.1, NZ_KK737547.1, 208509, 209402, +, 894, 0; cds-WP _004223507.1, NZ_KK737547.1, 209406, 210443, +, 1038, 0; cds-WP_021441382.1, NZ_KK737547.1, 210433, 211443, +, 1011, 4; cds-WP _021441383.1, NZ_KK737547.1, 211541, 212809, +, 1269, 0; cds-WP _032428650.1, NZ_KK737547.1, 212913, 213821, -, 909, 0; cds-WP_032429824.1, NZ_KK737547.1, 213946, 215280, +, 1335, 0; cds-WP _004176948.1, NZ_KK737547.1, 215277, 216740, -, 1464, 0; cds-WP_004176946.1, NZ_KK737547.1, 216982, 217833, +, 852, 0; cds-WP _002893187.1, NZ_KK737547.1, 217881, 218522, +, 642, 6; cds-WP _002893189.1, NZ_KK737547.1, 218537, 219202, +, 666, 0; cds-WP_004151676.1, NZ_KK737547.1, 219195, 219956, +, 762, 0; cds-WP _032428652.1, NZ_KK737547.1, 220010, 220774, -, 765, 0; cds-WP _004183313.1, NZ_KK737547.1, 220955, 222292, +, 1338, 0; cds-WP_104443363.1, NZ_KK737547.1, 222667, 222822, -, 156, 0; cds-WP_077254746.1, NZ_KK737547.1, 223649, 223759, -, 111, 22; cds-WP_013815099.1-


36, NZ_KK737547.1, 223803, 224771, -, 969, 6537; cds-WP _022615459.1, NZ_KK737547.1, 225071, 226066, -, 996, 2917; cds-WP _009483809.1, NZ_KK737547.1, 226423, 227127, -, 705, 119; cds-WP_021441389.1, NZ_KK737547.1, 227114, 227950, -, 837, 3; cds-WP_032429827.1, NZ_KK737547.1, 227943, 228776, -, 834, 117; cds-WP _021441390.1, NZ_KK737547.1, 228776, 229798, -, 1023, 13; cds-WP_009308119.1, NZ_KK737547.1, 229918, 231486, -, 1569, 1509; cds-WP _002893466.1, NZ_KK737547.1, 231692, 232387, +, 696, 9; cds-WP _032429829.1, NZ_KK737547.1, 232508, 234172, -, 1665, 31397; cds-WP _004147503.1, NZ_KK737547.1, 234186, 235658, -, 1473, 8505; cds-WP _004151671.1, NZ_KK737547.1, 235672, 236259, -, 588, 13; cds-WP_004142478.1, NZ_KK737547.1, 236388, 238421, +, 2034, 31; cds-WP_071603220.1, NZ_KK737547.1, 238467, 238994, -, 528, 132; cds-WP_021441392.1, NZ_KK737547.1, 239138, 240394, +, 1257, 13; cds-WP _021441393.1, NZ_KK737547.1, 240391, 241284, -, 894, 1; cds-WP _004183326.1, NZ_KK737547.1, 241539, 242144, +, 606, 788; cds-WP_021441395.1, NZ_KK737547.1, 242203, 243702, -, 1500, 476511; cds-WP_032428654.1, NZ_KK737547.1, 243717, 245135, -, 1419, 846558; cds-WP _004893550.1, NZ_KK737547.1, 245170, 246120, -, 951, 363393; cds-WP _004893549.1, NZ_KK737547.1, 246113, 246943, -, 831, 589397; cds-WP_032429976.1, NZ_KK737547.1, 247255, 248205, +, 951, 1003; cds-WP_021441398.1, NZ_KK737547.1, 248202, 249164, -, 963, 15051; cds-WP _004885708.1, NZ_KK737547.1, 249320, 250408, -, 1089, 360871; cds-WP_032429833.1, NZ_KK737547.1, 250410, 251936, -, 1527, 1320731; cds-WP_032428655.1, NZ_KK737547.1, 251936, 252544, -, 609, 600641; cds-WP _021441401.1, NZ_KK737547.1, 252555, 253496, -, 942, 396104; cds-WP_021441402.1, NZ_KK737547.1, 253614, 254273, -, 660, 14316; cds-WP _021441403.1, NZ_KK737547.1, 254340, 256568, -, 2229, 48187; cds-WP_004147519.1, NZ_KK737547.1, 256828, 258036, +, 1209, 548; cds-WP_004176919.1, NZ_KK737547.1, 258064, 258267, +, 204, 145; cds-WP_021441404.1, NZ_KK737547.1, 258278, 262159, +, 3882, 1762; cds-WP_002893737.1, NZ_KK737547.1, 262224, 263018, -, 795, 17; cds-WP _004147521.1, NZ_KK737547.1, 263015, 264007, -, 993, 2; cds-WP _032429835.1, NZ_KK737547.1, 264004, 265011, -, 1008, 14; cds-WP_032429836.1, NZ_KK737547.1, 265124, 266365, +, 1242, 0; cds-WP _004147526.1, NZ_KK737547.1, 266628, 267587, -, 960, 35; cds-WP_032429837.1, NZ_KK737547.1, 267776, 268951, +, 1176, 2973; cds-WP _004147529.1, NZ_KK737547.1, 268961, 270568, +, 1608, 1667; cds-WP_020324582.1, NZ_KK737547.1, 270582, 271433, +, 852, 16; cds-WP _024622880.1, NZ_KK737547.1, 271442, 272188, +, 747, 3; cds-WP_002893892.1, NZ_KK737547.1, 272189, 272602, +, 414, 1; cds-WP_021441407.1, NZ_KK737547.1, 272959, 275064, +, 2106, 69280; cds-WP _002893903.1, NZ_KK737547.1, 275169, 275366, +, 198, 32419; cds-WP _004178982.1, NZ_KK737547.1, 275363, 275767, -, 405, 32; cds-WP _021441408.1, NZ_KK737547.1, 275742, 276044, -, 303, 59; cds-WP_021464368.1, NZ_KK737547.1, 276228, 276971, -, 744, 5; cds-WP _032429838.1, NZ_KK737547.1, 277029, 278117, -, 1089, 0; cds-WP _020801584.1, NZ_KK737547.1, 278281, 279783, +, 1503, 0; cds-WP _002894035.1, NZ_KK737547.1, 279780, 280778, +, 999, 0; cds-WP_002894036.1, NZ_KK737547.1, 280799, 281863, +, 1065, 1; cds-WP _004178989.1, NZ_KK737547.1, 281965, 283206, +, 1242, 5699; cds-WP_004210859.1, NZ_KK737547.1, 283420, 284619, -, 1200, 9; cds-WP _004183373.1, NZ_KK737547.1, 284721, 285749, +, 1029, 0; cds-WP_032429839.1, NZ_KK737547.1, 285810, 287078, -, 1269, 0; cds-WP _032429841.1, NZ_KK737547.1, 287104, 288462, -, 1359, 13; cds-WP_004151655.1, NZ_KK737547.1, 288573, 289382, -, 810, 1; cds-WP_072157843.1, NZ_KK737547.1, 289504, 290454, -, 951,108; cds-WP_032429842.1, NZ_KK737547.1, 290600, 291838, -, 1239, 0; cds-WP _002894159.1, NZ_KK737547.1, 291835, 293070, -, 1236, 1; cds-WP_032429843.1, NZ_KK737547.1, 293067, 294329, -, 1263, 0; cds-WP_002894164.1, NZ_KK737547.1, 294781, 295389, +, 609, 1474; cds-WP _032429844.1, NZ_KK737547.1, 295402, 296898, +, 1497, 0; cds-WP_032429847.1, NZ_KK737547.1, 296895, 297923, +, 1029, 1; cds-WP_032429849.1, NZ_KK737547.1, 297966, 298907, -, 942, 1; cds-WP_004223619.1, NZ_KK737547.1, 298919, 299923, -, 1005, 0; cds-WP_004147555.1, NZ_KK737547.1, 299920, 300909, -, 990, 0; cds-WP_021441413.1, NZ_KK737547.1, 300906, 302408, -, 1503, 0; cds-WP_032429851.1, NZ_KK737547.1, 302453, 303433, -, 981, 0; cds-WP_032429853.1, NZ_KK737547.1, 303842, 306151, +, 2310, 0; cds-WP_002894357.1, NZ_KK737547.1, 306259, 306801, -, 543, 0; cds-WP _004142397.1, NZ_KK737547.1, 306798, 307487, -, 690, 47; cds-WP_020802207.1, NZ_KK737547.1, 307629, 308774, +, 1146, 1; cds-WP_004212613.1, NZ_KK737547.1, 308775, 309401, -, 627, 4; cds-WP_002894369.1, NZ_KK737547.1, 309386, 310609, -, 1224, 31; cds-WP _004147565.1, NZ_KK737547.1, 310720, 311652, -, 933, 0; cds-WP_002894375.1, NZ_KK737547.1, 311833, 312582, -, 750, 251; cds-WP_002894394.1, NZ_KK737547.1, 312994, 313557, +, 564, 125584; cds-WP_004183398.1, NZ_KK737547.1, 313745, 315310, +, 1566, 7867; cds-WP_002894401.1, NZ_KK737547.1, 315387, 315815, -, 429, 1147; cds-WP_002894404.1, NZ_KK737547.1, 316002, 316412, -, 411, 135; cds-WP_032429854.1, NZ_KK737547.1, 316591, 317388, -, 798, 11; cds-WP _004142371.1, NZ_KK737547.1, 317481, 318854, -, 1374, 7007; cds-WP_072143258.1, NZ_KK737547.1, 319136, 319711, +, 576, 10535; cds-WP_002439184.1, NZ_KK737547.1, 319906, 320115, +, 210, 73246; cds-WP_002894459.1, NZ_KK737547.1, 320183, 320566, -, 384, 166; cds-WP _002894461.1, NZ_KK737547.1, 320656, 321444, +, 789, 22; cds-WP_002894464.1, NZ_KK737547.1, 321687, 321893, +, 207, 2267; cds-WP_002894467.1, NZ_KK737547.1, 322084, 323049, -, 966, 45573; cds-WP_020803604.1, NZ_KK737547.1, 323230, 324189, -, 960, 81; cds-WP_002894472.1, NZ_KK737547.1, 324320, 324964, -, 645, 2502; cds-WP _002894474.1, NZ_KK737547.1, 325069, 325332, -, 264, 652; cds-WP _002894539.1, NZ_KK737547.1, 325445, 326644, -, 1200, 38637; cds-WP _004147579.1, NZ_KK737547.1, 326783, 327931, -, 1149, 7282; cds-WP_002894613.1, NZ_KK737547.1, 327943, 329055, -, 1113, 79; cds-WP _002894617.1, NZ_KK737547.1, 329055, 330956, -, 1902, 31380; cds-WP_002894620.1, NZ_KK737547.1, 330984, 331451, -, 468, 4607; cds-WP_002894623.1, NZ_KK737547.1, 331455, 331772, -, 318, 31; cds-WP _004151650.1, NZ_KK737547.1, 331995, 332624, -, 630, 279; cds-WP_004176879.1, NZ_KK737547.1, 332697, 333347, -, 651, 4285; cds-WP_032429857.1, NZ_KK737547.1, 333340, 334371, -, 1032, 105419; cds-WP _002894693.1, NZ_KK737547.1, 334371, 334961, -, 591, 5794; cds-WP _004147581.1, NZ_KK737547.1, 334976, 337558, -, 2583, 490179; cds-WP _032429977.1, NZ_KK737547.1, 337785, 338267, +, 483, 14; cds-WP_032429859.1, NZ_KK737547.1, 338313, 340106, -, 1794, 1581; cds-WP_032429860.1, NZ_KK737547.1, 340172, 341842, -, 1671, 977; cds-WP _002894706.1, NZ_KK737547.1, 342216, 342941, -, 726, 195; cds-WP _002894707.1, NZ_KK737547.1, 342941, 343615, -, 675, 628; cds-WP_002894709.1, NZ_KK737547.1, 343615, 344355, -, 741, 18338; cds-WP_002894712.1, NZ_KK737547.1, 344520, 345431, -, 912, 106501; cds-WP _032429861.1, NZ_KK737547.1, 345786, 347324, -, 1539, 23153; cds-WP_004197606.1, NZ_KK737547.1, 347450, 348328, -, 879, 39738; cds-WP_002894722.1, NZ_KK737547.1, 348476, 348949, -, 474, 1225; cds-WP_004176871.1, NZ_KK737547.1, 348946, 349992, -, 1047, 19147; cds-WP_002894730.1, NZ_KK737547.1, 350146, 351570, -, 1425, 44165; cds-WP _032429863.1, NZ_KK737547.1, 351750, 352925, +, 1176, 44; cds-WP_002894734.1, NZ_KK737547.1, 354033, 355697, -, 1665, 89732; cds-WP_002894738.1, NZ_KK737547.1, 355976, 356728, -, 753, 100847; cds-WP _002894742.1, NZ_KK737547.1, 356845, 358065, -, 1221, 9800; cds-WP_002894747.1, NZ_KK737547.1, 358074, 359222, -, 1149, 18951; cds-WP _002894749.1, NZ_KK737547.1, 359336, 360136, -, 801, 5998; cds-WP_032429865.1, NZ_KK737547.1, 360451, 362418, +, 1968, 4992; cds-WP_002894753.1, NZ_KK737547.1, 362597, 364264, +, 1668, 341659; cds-WP_004142270.1, NZ_KK737547.1, 364318, 364626, -, 309, 6; cds-WP _004152230.1, NZ_KK737547.1, 364699, 366102, +, 1404, 38; cds-WP_002894759.1, NZ_KK737547.1, 366150, 366482, +, 333, 2053; cds-WP_166686314.1, NZ_KK737547.1, 366534, 366977, -, 444, 549; cds-WP _002894761.1, NZ_KK737547.1, 367099, 367551, -, 453, 122525; cds-WP_002894765.1, NZ_KK737547.1, 367843, 368373, -, 531, 5353; cds-WP_002894767.1, NZ_KK737547.1, 368525, 368818, -, 294, 619; cds-WP_004152229.1, NZ_KK737547.1, 368952, 369725, -, 774, 22310; cds-WP _002894771.1, NZ_KK737547.1, 369909, 370457, +, 549, 59722; cds-WP _002894773.1, NZ_KK737547.1, 370490, 372130, +, 1641, 330165; cds-WP_004179052.1, NZ_KK737547.1, 372185, 372622, +, 438, 1239; cds-WP _002894776.1, NZ_KK737547.1, 372604, 373281, -, 678, 220; cds-WP _021441429.1, NZ_KK737547.1, 373278, 375965, -, 2688, 0; cds-WP _032429868.1, NZ_KK737547.1, 375966, 376541, -, 576, 16; cds-WP_021441430.1, NZ_KK737547.1, 376552, 378600, -, 2049, 0; cds-WP_004152226.1, NZ_KK737547.1, 378621, 380300, -, 1680, 0; cds-WP _020323459.1, NZ_KK737547.1, 380300, 380389, -, 90, 34; cds-WP _004142243.1, NZ_KK737547.1, 380696, 380905, +, 210, 0; cds-WP_032429869.1, NZ_KK737547.1, 381089, 382531, +, 1443, 7; cds-WP_004893379.1, NZ_KK737547.1, 382503, 383981, -, 1479, 0; cds-WP_002894919.1, NZ_KK737547.1, 384249, 384992, +, 744, 109; cds-WP _004176857.1, NZ_KK737547.1, 385007, 385663, +, 657, 19; cds-WP_004183433.1, NZ_KK737547.1, 385657, 386589, +, 933, 2036; cds-WP _004183435.1, NZ_KK737547.1, 386579, 387322, +, 744, 59; cds-WP _002894928.1, NZ_KK737547.1, 387404, 388129, +, 726, 4; cds-WP_004176855.1, NZ_KK737547.1, 388126, 389121, +, 996, 9714; cds-WP_004183438.1, NZ_KK737547.1, 389131, 389775, +, 645, 0; cds-WP_002894935.1, NZ_KK737547.1, 389791, 390582, +, 792, 48; cds-WP_004183439.1, NZ_KK737547.1, 390673, 391956, -, 1284, 1291721; cds-WP _004142216.1, NZ_KK737547.1, 392597, 393001, +, 405, 284571; cds-WP_002894949.1, NZ_KK737547.1, 392995, 393342, +, 348, 360445; cds-WP_004179067.1, NZ_KK737547.1, 393342, 395108, +, 1767, 1476851; cds-WP _002894954.1, NZ_KK737547.1, 395124, 395840, +, 717, 610782; cds-WP_012068464.1, NZ_KK737547.1, 396222, 399029, +, 2808, 2953128; cds-WP _004142209.1, NZ_KK737547.1, 399044, 400270, +, 1227, 547398; cds-WP _002895039.1, NZ_KK737547.1, 400374, 401540, +, 1167, 929955; cds-WP _002895043.1, NZ_KK737547.1, 401540, 402409, +, 870, 195922; cds-WP_002895047.1, NZ_KK737547.1, 403234, 404802, +, 1569, 137318; cds-WP _002895049.1, NZ_KK737547.1, 404818, 405957, +, 1140, 148537; cds-WP _002895051.1, NZ_KK737547.1, 405973, 406089, +, 117, 624; cds-WP_002895053.1, NZ_KK737547.1, 406089, 406379, +, 291, 46; cds-WP_002895056.1, NZ_KK737547.1, 406529, 406933, +, 405, 39927; cds-WP_004152221.1, NZ_KK737547.1, 406930, 407622, +, 693, 40909; cds-WP_002895061.1, NZ_KK737547.1, 407626, 408054, +, 429, 82; cds-WP _004179068.1, NZ_KK737547.1, 408154, 409479, +, 1326, 53812; cds-WP _032429872.1, NZ_KK737547.1, 409609, 410901, +, 1293, 253984; cds-WP _002895068.1, NZ_KK737547.1, 410936, 411460, +, 525, 370269; cds-WP _002895071.1, NZ_KK737547.1, 411470, 412264, +, 795, 261964; cds-WP_032409073.1, NZ_KK737547.1, 413744, 413893, -, 150, 0; cds-WP_002895074.1, NZ_KK737547.1, 413963, 415006, +, 1044, 95; cds-WP _004151689.1, NZ_KK737547.1, 415042, 415761, +, 720, 64; cds-WP_004147641.1, NZ_KK737547.1, 415758, 416702, -, 945, 48; cds-WP_002895084.1, NZ_KK737547.1, 416820, 417185, -, 366, 3; cds-WP_002895086.1, NZ_KK737547.1, 417500, 418552, +, 1053, 1639; cds-WP_002895089.1, NZ_KK737547.1, 418626, 419378, -, 753, 380666; cds-WP _023302155.1, NZ_KK737547.1, 419670, 420713, -, 1044, 2147; cds-WP _004179071.1, NZ_KK737547.1, 420707, 421855, -, 1149, 41273; cds-WP_004142166.1, NZ_KK737547.1, 421858, 422904, -, 1047, 27105; cds-WP _002895150.1, NZ_KK737547.1, 422914, 423930, -, 1017, 56353; cds-WP _032428718.1, NZ_KK737547.1, 424140, 425612, -, 1473, 62; cds-WP _032429873.1, NZ_KK737547.1, 425680, 426468, -, 789, 20; cds-WP_002895156.1, NZ_KK737547.1, 426621, 426770, +, 150, 1; cds-WP_032428721.1, NZ_KK737547.1, 426913, 427686, +, 774, 2825; cds-WP_002895159.1, NZ_KK737547.1, 427686, 428375, +, 690, 1166; cds-WP _004176832.1, NZ_KK737547.1, 428378, 429436, +, 1059, 166; cds-WP _002895164.1, NZ_KK737547.1, 429437, 430255, -, 819, 994; cds-WP_002895166.1, NZ_KK737547.1, 430484, 431479, +, 996, 203; cds-WP _002895168.1, NZ_KK737547.1, 431589, 431855, -, 267, 34169; cds-WP _004147654.1, NZ_KK737547.1, 431907, 432212, -, 306, 26147; cds-WP _004151693.1, NZ_KK737547.1, 432339, 432584, -, 246, 23955; cds-WP_004176831.1, NZ_KK737547.1, 432913, 434124, +, 1212, 98976;


cds-WP _032429874.1, NZ_KK737547.1, 434280, 435014, +, 735, 8465; cds-WP_004151695.1, NZ_KK737547.1, 435056, 435610, -, 555, 31; cds-WP_002895280.1, NZ_KK737547.1, 435692, 435904, -, 213, 231; cds-WP_032428722.1, NZ_KK737547.1, 436289, 436435, +, 147, 0; cds-WP _002895283.1, NZ_KK737547.1, 436640, 437146, +, 507, 0; cds-WP_072271782.1, NZ_KK737547.1, 437163, 438086, -, 924, 10; cds-AF52_RS0123875, NZ_KK737547.1, 438125, 441190, -, 3066, 1832; cds-WP_032429876.1, NZ_KK737547.1, 441191, 442276, -, 1086, 2; cds-WP _021441450.1, NZ_KK737547.1, 442810, 443241, +, 432, 0; cds-WP_020316497.1, NZ_KK737547.1, 443293, 445980, +, 2688, 11; cds-WP_004142122.1, NZ_KK737547.1, 446254, 447537, -, 1284, 18975; cds-WP_004182478.1, NZ_KK737547.1, 447692, 449011, +, 1320, 15524; cds-WP _021441452.1, NZ_KK737547.1, 449008, 449964, +, 957, 33665; cds-WP _002895358.1, NZ_KK737547.1, 450026, 450751, +, 726, 65001; cds-AF52_RS27965, NZ_KK737547.1, 450894, 451647, +, 754, 52370; cds-WP_160333877.1, NZ_KK737547.1, 451644, 452582, +, 939, 102950; cds-WP_032428723.1, NZ_KK737547.1, 452579, 454105, +, 1527, 34190; cds-WP_004147672.1, NZ_KK737547.1, 454204, 455586, +, 1383, 13159; cds-WP_002895575.1, NZ_KK737547.1, 456305, 456781, -, 477, 705; cds-WP_004223758.1, NZ_KK737547.1, 456852, 458141, -, 1290, 47; cds-WP _032429877.1, NZ_KK737547.1, 458355, 459395, +, 1041, 947; cds-WP_004183475.1, NZ_KK737547.1, 459392, 460549, +, 1158, 0; cds-WP_032429878.1, NZ_KK737547.1, 460533, 461288, +, 756, 588; cds-WP _002895648.1, NZ_KK737547.1, 461281, 462003, +, 723, 2; cds-WP_004152853.1, NZ_KK737547.1, 461945, 462667, -, 723, 911; cds-WP _002895652.1, NZ_KK737547.1, 462754, 462966, -, 213, 1; cds-WP _004147678.1, NZ_KK737547.1, 463378, 465399, +, 2022, 256; cds-WP_032429879.1, NZ_KK737547.1, 465648, 466745, -, 1098, 137; cds-WP _002895659.1, NZ_KK737547.1, 466749, 467420, -, 672, 5; cds-WP _021441454.1, NZ_KK737547.1, 467420, 469060, -, 1641, 11; cds-WP_004142092.1, NZ_KK737547.1, 469165, 470070, -, 906, 3155; cds-WP_002895665.1, NZ_KK737547.1, 470405, 471394, +, 990, 11156; cds-WP_021441455.1, NZ_KK737547.1, 471418, 471930, +, 513, 13630; cds-WP _002895670.1, NZ_KK737547.1, 471934, 472422, +, 489, 2; cds-WP_002895672.1, NZ_KK737547.1, 472415, 472663, +, 249, 3; cds-WP _002895674.1, NZ_KK737547.1, 472665, 473117, +, 453, 987; cds-WP _004142079.1, NZ_KK737547.1, 473163, 473867, +, 705, 1041; cds-WP_032429880.1, NZ_KK737547.1, 474048, 475013, -, 966, 4; cds-WP_032429882.1, NZ_KK737547.1, 475010, 476254, -, 1245, 3; cds-WP_004179098.1, NZ_KK737547.1, 476251, 477012, -, 762, 7; cds-WP_004176793.1, NZ_KK737547.1, 477144, 477581, +, 438, 4287; cds-WP_004142068.1, NZ_KK737547.1, 477642, 478748, -, 1107, 9424; cds-WP_004212202.1, NZ_KK737547.1, 478878, 480011, -, 1134, 81; cds-WP_032429883.1, NZ_KK737547.1, 480001, 481740, -, 1740, 0; cds-WP _002895745.1, NZ_KK737547.1, 481733, 482728, -, 996, 25; cds-WP_002895746.1, NZ_KK737547.1, 482728, 483387, -, 660, 0; cds-WP_004223785.1, NZ_KK737547.1, 483461, 484384, -, 924, 19456; cds-WP_004142057.1, NZ_KK737547.1, 484376, 484513, +, 138, 0; cds-WP _019705008.1, NZ_KK737547.1, 484801, 486132, +, 1332, 0; cds-AF52_RS27125, NZ_KK737547.1, 486247, 486348, -, 102, 157; cds-WP_032429885.1, NZ_KK737547.1, 488364, 488701, -, 338, 275; cds-WP_002895750.1, NZ_KK737547.1, 488735, 489484, +, 750, 0; cds-WP_002895753.1, NZ_KK737547.1, 489498, 490343, +, 846, 4; cds-WP_002895757.1, NZ_KK737547.1, 490343, 491335, +, 993, 0; cds-WP_032429886.1, NZ_KK737547.1, 491550, 492905, +, 1356, 121; cds-WP_004147693.1, NZ_KK737547.1, 493093, 495249, +, 2157, 48468; cds-WP_004179105.1, NZ_KK737547.1, 495279, 496247, +, 969, 1179; cds-WP _004176772.1, NZ_KK737547.1, 496357, 496617, -, 261, 646; cds-WP_032428726.1, NZ_KK737547.1, 496903, 497169, -, 267, 0; cds-WP_004183485.1, NZ_KK737547.1, 497190, 497450, -, 261, 2; cds-WP _016529094.1, NZ_KK737547.1, 497590, 498204, -, 615, 896; cds-WP_021441457.1, NZ_KK737547.1, 498301, 499215, +, 915, 16; cds-WP _021441458.1, NZ_KK737547.1, 499218, 501413, -, 2196, 5919; cds-WP_004142040.1, NZ_KK737547.1, 501525, 502247, -, 723, 21863; cds-WP_002895837.1, NZ_KK737547.1, 502244, 502903, -, 660, 48047; cds-WP_002895839.1, NZ_KK737547.1, 503029, 503775, -, 747, 258478; cds-WP_002895841.1, NZ_KK737547.1, 504184, 504687, -, 504, 484; cds-WP_002895842.1, NZ_KK737547.1, 504925, 505812, -, 888, 0; cds-WP _002895845.1, NZ_KK737547.1, 506164, 506676, +, 513, 27120; cds-WP_021441460.1, NZ_KK737547.1, 506767, 508347, -, 1581, 79450; cds-WP _002895851.1, NZ_KK737547.1, 508616, 508741, -, 126, 2386; cds-WP _004176765.1, NZ_KK737547.1, 508927, 509400, +, 474, 12; cds-WP _021441462.1, NZ_KK737547.1, 509397, 510509, +, 1113, 55; cds-WP _004176762.1, NZ_KK737547.1, 510679, 512055, +, 1377, 2653; cds-WP_004151705.1, NZ_KK737547.1, 512124, 512840, +, 717, 1294; cds-WP _002895871.1, NZ_KK737547.1, 512986, 513900, -, 915, 80712; cds-WP _002895874.1, NZ_KK737547.1, 514101, 514886, -, 786, 431; cds-WP _002895876.1, NZ_KK737547.1, 515065, 516657, +, 1593, 11422; cds-WP _021441465.1, NZ_KK737547.1, 517192, 519555, -, 2364, 2; cds-WP _004183491.1, NZ_KK737547.1, 519571, 520872, -, 1302, 0; cds-WP _004219745.1, NZ_KK737547.1, 521115, 522245, +, 1131, 835; cds-WP_004176744.1, NZ_KK737547.1, 522242, 523507, -, 1266, 11; cds-WP _004212174.1, NZ_KK737547.1, 523647, 524462, -, 816, 5868; cds-WP _032429888.1, NZ_KK737547.1, 524639, 527071, -, 2433, 1; cds-WP_004183492.1, NZ_KK737547.1, 527076, 527975, -, 900, 0; cds-WP_004141998.1, NZ_KK737547.1, 528130, 528885, -, 756, 27; cds-WP _032429890.1, NZ_KK737547.1, 528885, 530120, -, 1236, 30; cds-WP _004147725.1, NZ_KK737547.1, 530356, 531297, +, 942, 237; cds-WP _004151710.1, NZ_KK737547.1, 531315, 533174, +, 1860, 479; cds-WP _012068490.1, NZ_KK737547.1, 533207, 534748, +, 1542, 7331; cds-WP _002892997.1, NZ_KK737547.1, 534795, 535715, +, 921, 9715; cds-WP _004147729.1, NZ_KK737547.1, 535717, 536628, +, 912, 4202; cds-WP _032429891.1, NZ_KK737547.1, 537149, 538474, -, 1326, 206050; cds-WP _004176729.1, NZ_KK737547.1, 538707, 539948, -, 1242, 61870; cds-WP_004151712.1, NZ_KK737547.1, 540327, 540710, +, 384, 22377; cds-WP_029884283.1, NZ_KK737547.1, 540826, 541935, +, 1110, 982; cds-WP_004176727.1, NZ_KK737547.1, 541938, 542564, -, 627, 3717; cds-AF52_RS27135, NZ_KK737547.1, 542764, 542887, -, 124, 309; cds-WP_171290763.1, NZ_KK737547.1, 551069, 551268, -, 200, 532; cds-WP_179139609.1, NZ_KK737547.1, 552619, 552832, +, 214, 441; cds-AF52_RS11970, NZ_KK737547.1, 559347, 559565, +, 219, 735; cds-WP _032428727.1, NZ_KK737547.1, 559740, 559868, +, 129, 13; cds-WP_032429893.1, NZ_KK737547.1, 560520, 561722, +, 1203, 37496; cds-WP_004151717.1, NZ_KK737547.1, 561761, 562519, -, 759, 7828; cds-WP _004141974.1, NZ_KK737547.1, 562621, 563214, -, 594, 24; cds-WP_004141972.1, NZ_KK737547.1, 563542, 564774, +, 1233, 526; cds-WP _004141971.1, NZ_KK737547.1, 564812, 565624, -, 813, 162; cds-WP_004151719.1, NZ_KK737547.1, 565624, 566826, -, 1203, 1445; cds-WP _032429895.1, NZ_KK737547.1, 566909, 567472, +, 564, 5; cds-WP _032429979.1, NZ_KK737547.1, 567650, 569335, -, 1686, 51; cds-WP _002896351.1, NZ_KK737547.1, 569602, 569985, +, 384, 449; cds-WP_002896352.1, NZ_KK737547.1, 569992, 570255, -, 264, 4074; cds-WP_004179132.1, NZ_KK737547.1, 570458, 570745, +, 288, 3587; cds-WP_004179133.1, NZ_KK737547.1, 570729, 571451, +, 723, 2; cds-WP_002896363.1, NZ_KK737547.1, 571566, 572468, +, 903, 352; cds-WP_002896365.1, NZ_KK737547.1, 572557, 573036, +, 480, 10803; cds-WP _002896368.1, NZ_KK737547.1, 573385, 574497, +, 1113, 10251; cds-WP_002896370.1, NZ_KK737547.1, 574661, 575794, +, 1134, 13124; cds-WP _002896371.1, NZ_KK737547.1, 575805, 576758, +, 954, 34; cds-WP _002896372.1, NZ_KK737547.1, 576755, 577600, +, 846, 2; cds-WP_002896376.1, NZ_KK737547.1, 577658, 578146, +, 489, 2; cds-WP _004147758.1, NZ_KK737547.1, 578188, 579315, +, 1128, 3930; cds-WP _002896380.1, NZ_KK737547.1, 579394, 580110, +, 717, 4893; cds-WP_002896382.1, NZ_KK737547.1, 580107, 581579, +, 1473, 4; cds-WP _002896384.1, NZ_KK737547.1, 581666, 582397, -, 732, 1440; cds-WP_004141917.1, NZ_KK737547.1, 582581, 583249, -, 669, 35209; cds-WP_002896386.1, NZ_KK737547.1, 583249, 583965, -, 717, 17979; cds-WP_002896390.1, NZ_KK737547.1, 583972, 584703, -, 732, 788; cds-WP_002896392.1, NZ_KK737547.1, 584724, 585452, -, 729, 215; cds-WP _002896394.1, NZ_KK737547.1, 585679, 586194, -, 516, 1240; cds-AF52_RS11825, NZ_KK737547.1, 587073, 587345, +, 273, 142; cds-WP_013815099.1-37, NZ_KK737547.1, 587378, 588346, +, 969, 3269; cds-AF52_RS11815, NZ_KK737547.1, 588400, 589278, +, 879, 93; cds-WP_032429899.1, NZ_KK737547.1, 589310, 590140, +, 831, 23377; cds-WP _002896399.1, NZ_KK737547.1, 590137, 591150, -, 1014, 9698; cds-WP_004209682.1, NZ_KK737547.1, 591238, 592680, -, 1443, 39330; cds-WP_032429901.1, NZ_KK737547.1, 592691, 593692, -, 1002, 37375; cds-WP_004176700.1, NZ_KK737547.1, 593731, 595449, -, 1719, 25; cds-WP _002896408.1, NZ_KK737547.1, 595601, 596035, +, 435, 0; cds-WP _004147771.1, NZ_KK737547.1, 596247, 597215, -, 969, 0; cds-WP_004176696.1, NZ_KK737547.1, 597226, 598878, -, 1653, 1; cds-AF52_RS11770, NZ_KK737547.1, 599022, 599681, -, 660, 0; cds-WP_013815099.1-38, NZ_KK737547.1, 599738, 600706, -, 969, 4863; cds-AF52_RS11760, NZ_KK737547.1, 600739, 600987, -, 249, 167; cds-WP _032429902.1, NZ_KK737547.1, 601103, 601798, -, 696, 9; cds-WP_013815099.1-39, NZ_KK737547.1, 602061, 603029, -, 969, 4723; cds-WP_032429903.1, NZ_KK737547.1, 603283, 604941, +, 1659, 3658; cds-WP _002896440.1, NZ_KK737547.1, 605088, 606203, +, 1116, 50; cds-WP_032429904.1, NZ_KK737547.1, 606200, 608140, +, 1941, 5; cds-WP _002896516.1, NZ_KK737547.1, 608217, 608438, -, 222, 14357; cds-WP_002896520.1, NZ_KK737547.1, 608764, 609081, +, 318, 160863; cds-WP _002896522.1, NZ_KK737547.1, 609112, 611391, +, 2280, 228557; cds-WP_001040187.1, NZ_KK737547.1, 611511, 611729, -, 219, 19295; cds-WP _002898014.1, NZ_KK737547.1, 612083, 612784, -, 702, 15541; cds-WP_004224003.1, NZ_KK737547.1, 612829, 614550, -, 1722, 2306; cds-WP_032429906.1, NZ_KK737547.1, 614551, 616317, -, 1767,9299; cds-WP_002898019.1, NZ_KK737547.1, 616432, 617400, -, 969, 24905; cds-WP_000228469.1, NZ_KK737547.1, 617933, 618427, +, 495, 5107; cds-AF52_RS0123915, NZ_KK737547.1, 618563, 622808, +, 4246, 66886; cds-WP_002898132.1, NZ_KK737547.1, 622931, 623542, +, 612, 311; cds-WP_004179165.1, NZ_KK737547.1, 623551, 624894, +, 1344, 7408; cds-WP _002898139.1, NZ_KK737547.1, 624985, 626277, +, 1293, 117868; cds-WP_004147794.1, NZ_KK737547.1, 626478, 628916, +, 2439, 0; cds-WP_004150845.1, NZ_KK737547.1, 628927, 629544, +, 618, 0; cds-WP_004150844.1, NZ_KK737547.1, 629546, 630409, +, 864, 0; cds-WP_032429909.1, NZ_KK737547.1, 630684, 631832, +, 1149, 6384; cds-WP _002898145.1, NZ_KK737547.1, 631995, 632735, -, 741, 3; cds-WP_002898148.1, NZ_KK737547.1, 632927, 635209, -, 2283, 189377; cds-WP_032429911.1, NZ_KK737547.1, 635261, 636118, -, 858, 5352; cds-WP_004150842.1, NZ_KK737547.1, 636504, 638264, -, 1761, 15462; cds-WP_002898152.1, NZ_KK737547.1, 638380, 639072, +, 693, 3940; cds-WP _004176687.1, NZ_KK737547.1, 639261, 640349, +, 1089, 560; cds-WP_002898157.1, NZ_KK737547.1, 640423, 641706, +, 1284, 23; cds-WP_002898160.1, NZ_KK737547.1, 641881, 642564, +, 684, 73377; cds-WP_002898162.1, NZ_KK737547.1, 642698, 644371, +, 1674, 2929632; cds-WP _002898165.1, NZ_KK737547.1, 644523, 644810, +, 288, 23616; cds-WP_032411196.1, NZ_KK737547.1, 645016, 647280, +, 2265, 0; cds-WP_004201387.1, NZ_KK737547.1, 647317, 649065, +, 1749, 12139; cds-WP_016946992.1, NZ_KK737547.1, 649062, 650042, +, 981, 13; cds-WP_032429912.1, NZ_KK737547.1, 650097, 651326, +, 1230, 100; cds-WP _002898177.1, NZ_KK737547.1, 651390, 651572, +, 183, 8666; cds-WP_032429914.1, NZ_KK737547.1, 651569, 652315, +, 747, 41024; cds-WP _002898182.1, NZ_KK737547.1, 652453, 653346, +, 894, 0; cds-WP_004141786.1, NZ_KK737547.1, 653323, 654102, -, 780, 2; cds-WP _002898187.1, NZ_KK737547.1, 654224, 655024, +, 801, 10735; cds-WP_032429915.1, NZ_KK737547.1, 655021, 656343, +, 1323, 16514; cds-WP_004150840.1, NZ_KK737547.1, 656324, 657028, +, 705, 216; cds-WP_004176682.1, NZ_KK737547.1, 657028, 661476, +, 4449, 216607; cds-WP _002898195.1, NZ_KK737547.1, 661677, 663467, +, 1791, 1112; cds-WP _002898198.1, NZ_KK737547.1, 663770, 664321, +, 552, 195539; cds-WP _002898200.1, NZ_KK737547.1, 664335, 664982, +, 648, 392; cds-WP _002898202.1, NZ_KK737547.1, 665051, 666241, -, 1191, 62998; cds-WP_004141771.1, NZ_KK737547.1, 666429, 667508, -, 1080, 106019; cds-


WP_032429917.1, NZ_KK737547.1, 668100, 669500, -, 1401, 126913; cds-AF52_RS11510, NZ_KK737547.1, 669581, 670140, -, 560, 1; cds-WP _013815099.1-40, NZ_KK737547.1, 670203, 671171, -, 969, 5124; cds-WP_004179185.1, NZ_KK737547.1, 671515, 672726, +, 1212, 1; cds-WP_023286202.1, NZ_KK737547.1, 672849, 674138, +, 1290, 0; cds-WP_032429918.1, NZ_KK737547.1, 674163, 675401, +, 1239, 5; cds-WP _004179190.1, NZ_KK737547.1, 675420, 676586, +, 1167, 16; cds-WP_002898217.1, NZ_KK737547.1, 676629, 677831, -, 1203, 2040; cds-WP _002898220.1, NZ_KK737547.1, 678158, 680773, +, 2616, 171608; cds-WP _004150838.1, NZ_KK737547.1, 680978, 681751, -, 774, 5427; cds-WP_004141755.1, NZ_KK737547.1, 681748, 682539, -, 792, 11; cds-WP _002898293.1, NZ_KK737547.1, 682550, 683695, -, 1146, 0; cds-WP _023284918.1, NZ_KK737547.1, 683692, 684654, -, 963, 0; cds-WP _032429920.1, NZ_KK737547.1, 684647, 685222, -, 576, 0; cds-WP _002898303.1, NZ_KK737547.1, 685472, 686482, +, 1011, 1955; cds-WP_002898308.1, NZ_KK737547.1, 686652, 687194, +, 543, 10627; cds-WP_004179196.1, NZ_KK737547.1, 687191, 688300, -, 1110, 1098; cds-WP _004147847.1, NZ_KK737547.1, 688400, 690505, +, 2106, 3812; cds-WP_004147848.1, NZ_KK737547.1, 690518, 692425, +, 1908, 12611; cds-WP_004147849.1, NZ_KK737547.1, 692440, 693708, +, 1269, 13325; cds-WP_002898390.1, NZ_KK737547.1, 693698, 695335, +, 1638, 1035; cds-WP _002898392.1, NZ_KK737547.1, 695335, 695898, +, 564, 239; cds-WP _002898396.1, NZ_KK737547.1, 696152, 696319, +, 168, 4; cds-WP _002898398.1, NZ_KK737547.1, 696388, 696906, -, 519, 3863; cds-WP_032429922.1, NZ_KK737547.1, 696976, 698733, -, 1758, 109687; cds-WP_002898404.1, NZ_KK737547.1, 698919, 699371, +, 453, 65; cds-WP _002898408.1, NZ_KK737547.1, 699503, 700573, -, 1071, 2138616; cds-WP_002898418.1, NZ_KK737547.1, 700926, 701435, -, 510, 169; cds-WP_032429924.1, NZ_KK737547.1, 701784, 702380, +, 597, 4; cds-WP_002898422.1, NZ_KK737547.1, 702394, 704529, -, 2136, 2163; cds-WP_002898425.1, NZ_KK737547.1, 704547, 704993, -, 447, 199; cds-WP_004176653.1, NZ_KK737547.1, 705118, 707172, +, 2055, 3801; cds-WP_002898432.1, NZ_KK737547.1, 707184, 707642, -, 459, 366; cds-WP _004144085.1, NZ_KK737547.1, 707797, 708210, +, 414, 690; cds-WP _013815099.1-41, NZ_KK737547.1, 708377, 709345, -, 969, 4742; cds-AF52_RS0123935, NZ_KK737547.1, 709895, 712733, +, 2839, 58718; cds-WP _072001581.1, NZ_KK737547.1, 724264, 728283, +, 4020, 17188; cds-AF52_RS11335, NZ_KK737547.1, 728452, 729213, +, 762, 0; cds-AF52_RS27170, NZ_KK737547.1, 729248, 729418, +, 171, 364; cds-AF52_RS11330, NZ_KK737547.1, 730319, 730471, +, 153, 232; cds-AF52_RS11325, NZ_KK737547.1, 730530, 733256, +, 2727, 0; cds-WP_032429986.1, NZ_KK737547.1, 733403, 734278, +, 876, 0; cds-WP _002898441.1, NZ_KK737547.1, 734321, 734638, -, 318, 2545; cds-WP_032429928.1, NZ_KK737547.1, 734698, 735900, -, 1203, 508; cds-WP _004210995.1, NZ_KK737547.1, 736091, 736645, +, 555, 825; cds-WP_004183586.1, NZ_KK737547.1, 736663, 737451, +, 789, 897; cds-WP _032429987.1, NZ_KK737547.1, 737500, 737781, +, 282, 0; cds-WP _002898457.1, NZ_KK737547.1, 737778, 738107, -, 330, 2241; cds-WP _002898458.1, NZ_KK737547.1, 738196, 738855, -, 660, 61435; cds-WP _032429929.1, NZ_KK737547.1, 739125, 740777, +, 1653, 152; cds-AF52_RS26415, NZ_KK737547.1, 741134, 741886, -, 753, 1; cds-WP_032429931.1, NZ_KK737547.1, 741867, 742055, +, 189, 0; cds-WP _032429933.1, NZ_KK737547.1, 742225, 743190, -, 966, 27; cds-WP_004211006.1, NZ_KK737547.1, 743248, 744696, -, 1449, 221; cds-WP_002898571.1, NZ_KK737547.1, 744715, 745839, -, 1125, 3559; cds-WP _009308376.1, NZ_KK737547.1, 745876, 747483, -, 1608, 55552; cds-WP _032429935.1, NZ_KK737547.1, 747988, 749073, -, 1086, 0; cds-WP _004221441.1, NZ_KK737547.1, 749156, 750118, +, 963, 10; cds-WP_002898585.1, NZ_KK737547.1, 750115, 751395, -, 1281, 577; cds-WP_032429937.1, NZ_KK737547.1, 751398, 752885, -, 1488, 10227; cds-WP_002898590.1, NZ_KK737547.1, 753206, 753763, -, 558, 182883; cds-WP_020802183.1, NZ_KK737547.1, 753789, 754541, -, 753, 30701; cds-WP_002898595.1, NZ_KK737547.1, 754767, 756188, +, 1422, 71874; cds-WP _004141463.1, NZ_KK737547.1, 756542, 757933, +, 1392, 62263; cds-WP _002898600.1, NZ_KK737547.1, 758052, 758174, -, 123, 1257; cds-WP_021441517.1, NZ_KK737547.1, 758431, 758652, +, 222,1; cds-WP_004150831.1, NZ_KK737547.1, 758673, 759461, -, 789, 577; cds-WP_004141456.1, NZ_KK737547.1, 759577, 760026, -, 450, 0; cds-WP_004183618.1, NZ_KK737547.1, 760179, 761426, +, 1248, 36170; cds-WP_002898701.1, NZ_KK737547.1, 761495, 761722, -, 228, 41; cds-WP_002898704.1, NZ_KK737547.1, 761743, 762339, -, 597, 26; cds-WP_004224058.1, NZ_KK737547.1, 762556, 762687, -, 132, 0; cds-WP_002898708.1, NZ_KK737547.1, 762775, 762948, +, 174, 0; cds-WP _004199515.1, NZ_KK737547.1, 763111, 764049, +, 939, 0; cds-WP_004191019.1, NZ_KK737547.1, 764455, 765777, -, 1323, 0; cds-WP _004176611.1, NZ_KK737547.1, 765799, 766293, -, 495, 0; cds-WP _004141442.1, NZ_KK737547.1, 766304, 766894, -, 591, 0; cds-WP_004179289.1, NZ_KK737547.1, 766891, 767694, -, 804, 0; cds-WP _002898877.1, NZ_KK737547.1, 767691, 768083, -, 393, 0; cds-WP_004224061.1, NZ_KK737547.1, 768076, 768786, -, 711, 0; cds-WP _004179293.1, NZ_KK737547.1, 768786, 769877, -, 1092, 0; cds-WP _002898883.1, NZ_KK737547.1, 770162, 770800, +, 639, 17; cds-WP _002898886.1, NZ_KK737547.1, 770797, 771192, -, 396, 0; cds-WP_032429939.1, NZ_KK737547.1, 771378, 775340, -, 3963, 171600; cds-WP_013815099.1-42, NZ_KK737547.1, 775708, 776676, +, 969, 8388; cds-WP_032429941.1, NZ_KK737547.1, 776720, 777919, +, 1200, 7166; cds-AF52_RS0123960, NZ_KK737547.1, 777953, 778729, +, 777, 2; cds-WP _020806188.1-3, NZ_KK737547.1, 778830, 779810, -, 981, 5328; cds-WP _032429943.1, NZ_KK737547.1, 779855, 781216, +, 1362, 0; cds-WP_021440205.1, NZ_KK737547.1, 781216, 781701, +, 486, 0; cds-WP_021440204.1, NZ_KK737547.1, 781711, 782727, +, 1017, 0; cds-WP _004143751.1, NZ_KK737547.1, 782737, 783510, +, 774, 0; cds-WP _002906464.1, NZ_KK737547.1, 783507, 784385, -, 879, 1; cds-WP_148673683.1, NZ_KK737547.1, 784611, 787658, +, 3048, 3592; cds-WP_004143747.1, NZ_KK737547.1, 787670, 788554, +, 885, 0; cds-WP_002906457.1, NZ_KK737547.1, 788547, 789203, +, 657, 0; cds-AF52_RS25665, NZ_KK737547.1, 789256, 789581, -, 326, 0; cds-WP_004175994.1, NZ_KK737547.1, 789578, 789763, -, 186, 0; cds-WP _004180084.1, NZ_KK737547.1, 789942, 790760, -, 819, 0; cds-WP _021440202.1, NZ_KK737547.1, 790828, 791268, -, 441, 0; cds-WP_004180082.1, NZ_KK737547.1, 791533, 792687, +, 1155, 1632; cds-WP_020802157.1, NZ_KK737547.1, 792694, 793785, -, 1092, 0; cds-WP_004184178.1, NZ_KK737547.1, 793795, 794781, -, 987, 0; cds-WP_021440201.1, NZ_KK737547.1, 794781, 796397, -, 1617, 0; cds-WP _020324770.1, NZ_KK737547.1, 796394, 797242, -, 849, 2; cds-WP_023280140.1, NZ_KK737547.1, 797239, 798183, -, 945, 0; cds-WP_002906226.1, NZ_KK737547.1, 798194, 799816, -, 1623, 0; cds-WP_002906221.1, NZ_KK737547.1, 799986, 800996, -, 1011, 63967; cds-WP _002906218.1, NZ_KK737547.1, 801249, 801848, +, 600, 0; cds-WP _004176019.1, NZ_KK737547.1, 802022, 802975, +, 954, 132; cds-WP_032428292.1, NZ_KK737547.1, 803012, 804727, -, 1716, 3281; cds-WP_004200032.1, NZ_KK737547.1, 805090, 805776, -, 687, 5; cds-WP _021440197.1, NZ_KK737547.1, 805773, 806468, -, 696, 0; cds-WP_002906125.1, NZ_KK737547.1, 806652, 808349, -, 1698, 94103; cds-WP _002906122.1, NZ_KK737547.1, 808406, 808534, +, 129, 255; cds-WP_004143727.1, NZ_KK737547.1, 808531, 808671, -, 141, 0; cds-WP _032429948.1, NZ_KK737547.1, 808849, 809700, -, 852, 0; cds-WP_021440195.1, NZ_KK737547.1, 809814, 810707, +, 894, 0; cds-WP _004180069.1, NZ_KK737547.1, 810775, 811020, -, 246, 1; cds-WP _004151242.1, NZ_KK737547.1, 811217, 812131, -, 915, 10; cds-WP _004143718.1, NZ_KK737547.1, 812787, 812972, +, 186, 1; cds-WP_013815099.1-43, NZ_KK737547.1, 813024, 813992, +, 969, 5839; cds-WP _004143717.1, NZ_KK737547.1, 814404, 814619, +, 216, 0; cds-WP _023301896.1, NZ_KK737547.1, 814643, 815149, +, 507, 0; cds-WP _004143715.1, NZ_KK737547.1, 815166, 815348, +, 183, 0; cds-WP _021440193.1, NZ_KK737547.1, 815388, 817013, +, 1626, 0; cds-WP _032429949.1, NZ_KK737547.1, 817010, 818005, -, 996, 0; cds-WP _004148482.1, NZ_KK737547.1, 818324, 818770, -, 447, 0; cds-WP _021440191.1, NZ_KK737547.1, 818779, 819282, -, 504, 0; cds-WP_002906035.1, NZ_KK737547.1, 819427, 819831, +, 405, 1; cds-WP_002906033.1, NZ_KK737547.1, 819847, 819993, +, 147, 0; cds-WP _002906030.1, NZ_KK737547.1, 820107, 820538, +, 432, 2; cds-WP _021440189.1, NZ_KK737547.1, 820643, 821512, +, 870, 0; cds-WP_004184165.1, NZ_KK737547.1, 821514, 822200, -, 687, 349; cds-WP_004143707.1, NZ_KK737547.1, 822190, 822372, -, 183, 53; cds-WP _004151892.1, NZ_KK737547.1, 822422, 823345, +, 924, 0; cds-WP _023282626.1, NZ_KK737547.1, 823595, 824512, +, 918, 110; cds-WP _023280134.1, NZ_KK737547.1, 824828, 827128, +, 2301, 565; cds-WP_002906016.1, NZ_KK737547.1, 827278, 828159, +, 882, 1; cds-WP _004180040.1, NZ_KK737547.1, 828422, 829828, -, 1407, 388; cds-WP _002906011.1, NZ_KK737547.1, 830416, 831096, +, 681, 2; cds-AF52_RS0123990, NZ_KK737547.1, 831194, 832255, +, 1062, 7571; cds-WP_004180028.1, NZ_KK737547.1, 832290, 834467, -, 2178, 17731; cds-WP_004184162.1, NZ_KK737547.1, 834736, 835668, -, 933, 13; cds-WP_002905764.1, NZ_KK737547.1, 835768, 836202, +, 435, 0; cds-WP_004143692.1, NZ_KK737547.1, 836212, 836688, +, 477, 0; cds-WP_002905759.1, NZ_KK737547.1, 836887, 838797, +, 1911, 28; cds-WP _004189919.1, NZ_KK737547.1, 838910, 839647, +, 738, 0; cds-WP _004189922.1, NZ_KK737547.1, 839644, 841929, -, 2286, 0; cds-WP _004184158.1, NZ_KK737547.1, 841929, 843071, -, 1143, 5; cds-WP_004143686.1, NZ_KK737547.1, 843058, 843336, -, 279, 0; cds-WP_004143685.1, NZ_KK737547.1, 843339, 844094, -, 756, 0; cds-WP_004148467.1, NZ_KK737547.1, 844088, 845014, -, 927, 43; cds-WP _002905689.1, NZ_KK737547.1, 845069, 845140, -, 72, 5; cds-WP_021440182.1, NZ_KK737547.1, 845277, 846296, -, 1020, 128; cds-WP _032429953.1, NZ_KK737547.1, 846539, 847531, +, 993, 0; cds-WP_004176065.1, NZ_KK737547.1, 847618, 848358, +, 741, 0; cds-WP _032428291.1, NZ_KK737547.1, 848355, 849698, +, 1344, 0; cds-WP_004184155.1, NZ_KK737547.1, 849801, 850991, +, 1191, 1; cds-WP_032429955.1, NZ_KK737547.1, 851905, 852798, -, 894, 11; cds-WP_187079193.1, NZ_KK737547.1, 852992, 854473, -, 1482, 131945; cds-WP_002905540.1, NZ_KK737547.1, 854483, 855868, -, 1386, 23858; cds-WP_013815099.1-44, NZ_KK737547.1, 856165, 857133, +, 969, 3991; cds-WP _021440179.1, NZ_KK737547.1, 857241, 858176, -, 936, 10882; cds-WP_032429957.1, NZ_KK737547.1, 858201, 858941, -, 741, 3464; cds-WP_004189949.1, NZ_KK737547.1, 858938, 859666, -, 729, 80; cds-WP_004189951.1, NZ_KK737547.1, 859663, 860358, -, 696, 27706; cds-AF52_RS28000, NZ_KK737547.1, 860529, 860615, +, 87, 0; cds-WP _002905531.1, NZ_KK737547.1, 860775, 861881, +, 1107, 0; cds-WP _021440176.1, NZ_KK737547.1, 861919, 863091, -, 1173, 10460; cds-WP _032411533.1, NZ_KK737547.1, 863105, 864028, -, 924, 384; cds-WP_004148452.1, NZ_KK737547.1, 864221, 865261, -, 1041, 1; cds-WP _032429958.1, NZ_KK737547.1, 865660, 866916, +, 1257, 19582; cds-WP _021440173.1, NZ_KK737547.1, 867015, 868325, -, 1311, 3342; cds-WP _021440172.1, NZ_KK737547.1, 868427, 869923, -, 1497, 0; cds-WP_004179987.1, NZ_KK737547.1, 870068, 870784, +, 717, 23; cds-AF52_RS10695, NZ_KK737547.1, 870784, 871655, +, 872, 0; cds-WP_004179983.1, NZ_KK737547.1, 871540, 872472, +, 933, 9134; cds-WP _004184144.1, NZ_KK737547.1, 872561, 873352, -, 792, 0; cds-WP_004189983.1, NZ_KK737547.1, 873462, 874229, +, 768, 251; cds-WP _004176101.1, NZ_KK737547.1, 874432, 874656, +, 225, 1; cds-AF52_RS25690, NZ_KK737547.1, 874992, 875342, +, 351, 26; cds-WP _002882540.1, NZ_KK737548.1, 3401, 4102, +, 702, 237; cds-WP _002882539.1, NZ_KK737548.1, 4115, 5512, +, 1398, 1639; cds-WP_004187944.1, NZ_KK737548.1, 5509, 6501, -, 993, 4725; cds-WP_187079194.1, NZ_KK737548.1, 6505, 7437, -, 933, 44; cds-WP _002882536.1, NZ_KK737548.1, 7538, 8428, -, 891, 9319; cds-WP_002882531.1, NZ_KK737548.1, 8456, 9421, -, 966, 16; cds-WP _002882529.1, NZ_KK737548.1, 9427, 10932, -, 1506, 57; cds-WP_002882527.1, NZ_KK737548.1, 10943, 11362, -, 420, 331; cds-WP _002882520.1, NZ_KK737548.1, 11548, 13416, -, 1869, 74054; cds-WP _004151555.1, NZ_KK737548.1, 13634, 15133, +, 1500, 7228; cds-WP_002882517.1, NZ_KK737548.1, 15130, 16578, +, 1449, 1439; cds-WP _002882514.1, NZ_KK737548.1, 16582, 17574, -, 993, 393; cds-WP_002882510.1, NZ_KK737548.1, 17726, 18184, +, 459, 20; cds-WP _004144988.1, NZ_KK737548.1, 18283, 18723, +, 441, 1671; cds-WP_004144989.1, NZ_KK737548.1, 19105,


20994, +, 1890, 61084; cds-WP_004151554.1, NZ_KK737548.1, 21110, 21733, +, 624, 143; cds-WP _013815099.1-45, NZ_KK737548.1, 22264, 23232, +, 969, 5906; cds-WP_004144991.1, NZ_KK737548.1, 23416, 23796, +, 381, 30511; cds-WP _004151552.1, NZ_KK737548.1, 23804, 24619, +, 816, 218156; cds-WP_000429386.1, NZ_KK737548.1, 24669, 24908, +, 240, 196443; cds-WP _004107293.1, NZ_KK737548.1, 24959, 25429, +, 471, 442517; cds-WP _004144994.1, NZ_KK737548.1, 25444, 25977, +, 534, 309143; cds-WP_004144995.1, NZ_KK737548.1, 25990, 27531, +, 1542, 1079801; cds-WP _004144996.1, NZ_KK737548.1, 27582, 28445, +, 864, 775955; cds-WP _004144997.1, NZ_KK737548.1, 28472, 29854, +, 1383, 1371647; cds-WP_001251971.1, NZ_KK737548.1, 29875, 30294, +, 420, 176446; cds-WP _004151550.1, NZ_KK737548.1, 30991, 32361, +, 1371, 33899; cds-WP_004150309.1, NZ_KK737548.1, 32545, 34374, +, 1830, 95722; cds-WP_004150308.1, NZ_KK737548.1, 34711, 35751, +, 1041, 393; cds-WP _004145004.1, NZ_KK737548.1, 35880, 36839, +, 960, 61511; cds-WP_004151547.1, NZ_KK737548.1, 36839, 37729, +, 891, 81964; cds-WP _004145006.1, NZ_KK737548.1, 37777, 38550, +, 774, 26945; cds-WP _004145007.1, NZ_KK737548.1, 38601, 39326, +, 726, 20; cds-AF52_RS10495, NZ_KK737548.1, 39804, 40754, +, 951, 618; cds-WP _013815099.1-46, NZ_KK737548.1, 40806, 41774, -, 969, 3449; cds-AF52_RS10485, NZ_KK737548.1, 41809, 42504, +, 696, 4; cds-WP_032430005.1, NZ_KK737548.1, 42543, 43709, +, 1167, 16189; cds-WP_004895208.1, NZ_KK737548.1, 43759, 44478, +, 720, 1; cds-WP_004145102.1, NZ_KK737548.1, 44558, 45223, -, 666, 4; cds-WP_0041451001, NZ_KK737548.1, 45393, 46730, +, 1338, 18950; cds-WP_004151543.1, NZ_KK737548.1, 46776, 47342, -, 567, 5332; cds-WP_004145098.1, NZ_KK737548.1, 47379, 47954, -, 576, 2241; cds-WP_004211197.1, NZ_KK737548.1, 48264, 49223, -, 960, 21744; cds-WP _004181598.1, NZ_KK737548.1, 49198, 50376, -, 1179, 6366; cds-WP _004151539.1, NZ_KK737548.1, 50476, 50895, -, 420, 1013; cds-WP_004151538.1, NZ_KK737548.1, 51015, 52379, -, 1365, 2458; cds-WP_004150295.1, NZ_KK737548.1, 52574, 54220, -, 1647, 507683; cds-WP_004151536.1, NZ_KK737548.1, 54223, 54480, -, 258, 107480; cds-WP_004151535.1, NZ_KK737548.1, 54444, 54803, -, 360, 64588; cds-WP_000831330.1, NZ_KK737548.1, 54819, 54959, -, 141, 15915; cds-WP_004151534.1, NZ_KK737548.1, 55581, 56984, +, 1404, 94280; cds-WP _004145090.1, NZ_KK737548.1, 56989, 58089, +, 1101, 3943; cds-WP_004150293.1, NZ_KK737548.1, 58297, 59370, +, 1074, 14234; cds-WP _004173845.1, NZ_KK737548.1, 59399, 61813, +, 2415, 301071; cds-WP _050484285.1, NZ_KK737548.1, 62015, 62869, +, 855, 173; cds-WP _020806188.1-4, NZ_KK737548.1, 62970, 63950, -, 981, 6441; cds-AF52_RS25730, NZ_KK737548.1, 64019, 64090, +, 72, 286; cds-WP_021440944.1, NZ_KK737548.1, 64268, 65605, +, 1338, 89; cds-WP_004150284.1, NZ_KK737548.1, 65657, 66883, +, 1227, 206; cds-WP_004151524.1, NZ_KK737548.1, 66885, 67217, -, 333, 137; cds-WP_004151523.1, NZ_KK737548.1, 67532, 67945, +, 414, 259; cds-WP _004145074.1, NZ_KK737548.1, 68062, 68490, +, 429, 85; cds-WP _009308837.1, NZ_KK737548.1, 68627, 69451, +, 825, 3901; cds-WP_019705399.1, NZ_KK737548.1, 69553, 71214, +, 1662, 40; cds-WP_004151520.1, NZ_KK737548.1, 71206, 71928, -, 723, 465; cds-WP_002923307.1, NZ_KK737548.1, 72227, 73849, +, 1623, 628; cds-WP _002923306.1, NZ_KK737548.1, 73846, 75168, +, 1323, 4119; cds-AF52_RS24880, NZ_KK737548.1, 75270, 75617, +, 348, 22; cds-WP_002923304.1, NZ_KK737548.1, 75607, 75969, +, 363, 45; cds-WP _002923302.1, NZ_KK737548.1, 76044, 76466, +, 423, 1; cds-WP _020723563.1, NZ_KK737548.1, 76470, 77798, -, 1329, 8; cds-WP _004173855.1, NZ_KK737548.1, 77816, 79153, -, 1338, 5; cds-WP_032410116.1, NZ_KK737548.1, 79245, 79391, +, 147, 0; cds-WP_032430010.1, NZ_KK737548.1, 79379, 80302, +, 924, 1080; cds-WP_004181587.1, NZ_KK737548.1, 80462, 81646, -, 1185, 115; cds-WP_032430012.1, NZ_KK737548.1, 81822, 82655, -, 834, 3; cds-WP_002923294.1, NZ_KK737548.1, 82724, 83170, -, 447, 4; cds-WP _004145059.1, NZ_KK737548.1, 83261, 83380, -, 120, 0; cds-WP _004150272.1, NZ_KK737548.1, 83833, 84000, -, 168, 0; cds-WP_002923286.1, NZ_KK737548.1, 84013, 84108, +, 96, 96; cds-WP _004173858.1, NZ_KK737548.1, 84213, 85901, +, 1689, 56; cds-WP_002923283.1, NZ_KK737548.1, 85905, 86192, +, 288, 0; cds-WP _002923282.1, NZ_KK737548.1, 86343, 86936, +, 594, 6; cds-AF52_RS10285, NZ_KK737548.1, 86954, 88434, +, 1481, 8; cds-WP_004145056.1, NZ_KK737548.1, 88446, 89774, +, 1329, 0; cds-WP_002923280.1, NZ_KK737548.1, 89920, 91311, +, 1392, 0; cds-WP _004901545.1, NZ_KK737548.1, 91448, 91900, +, 453, 17; cds-WP_004173862.1, NZ_KK737548.1, 92029, 92352, -, 324, 6; cds-AF52_RS10260, NZ_KK737548.1, 92336, 92696, -, 361, 3; cds-WP_002923205.1, NZ_KK737548.1, 92908, 94101, +, 1194, 37490; cds-WP_021440939.1, NZ_KK737548.1, 94098, 94907, -, 810, 5492; cds-WP _021440938.1, NZ_KK737548.1, 94917, 96020, -, 1104, 5380; cds-WP_004145049.1, NZ_KK737548.1, 96162, 96881, +, 720, 0; cds-WP_021440937.1, NZ_KK737548.1, 97058, 98071, +, 1014, 0; cds-WP_004150258.1, NZ_KK737548.1, 98077, 99189, +, 1113, 0; cds-WP _004150257.1, NZ_KK737548.1, 99189, 100049, +, 861, 80; cds-WP _004145044.1, NZ_KK737548.1, 100052, 100849, +, 798, 1; cds-WP _032422633.1, NZ_KK737548.1, 101047, 102426, -, 1380, 6; cds-WP _002923158.1, NZ_KK737548.1, 102571, 102873, -, 303, 0; cds-WP _002923156.1, NZ_KK737548.1, 102971, 104293, -, 1323, 26; cds-WP _004145041.1, NZ_KK737548.1, 104305, 104619, -, 315, 1; cds-WP_002923154.1, NZ_KK737548.1, 104913, 105854, +, 942, 3; cds-WP _032426549.1, NZ_KK737548.1, 106066, 107436, +, 1371, 604; cds-WP _002923152.1, NZ_KK737548.1, 107450, 108712, +, 1263, 24145; cds-WP _032430013.1, NZ_KK737548.1, 108709, 109935, -, 1227, 21747; cds-WP _002923146.1, NZ_KK737548.1, 110063, 110803, +, 741, 1; cds-WP _032430014.1, NZ_KK737548.1, 110800, 111513, +, 714, 0; cds-WP_032428449.1, NZ_KK737548.1, 111514, 112599, +, 1086, 0; cds-WP _032428448.1, NZ_KK737548.1, 112602, 113465, +, 864, 1; cds-WP _004145033.1, NZ_KK737548.1, 113469, 113744, -, 276, 1027; cds-WP_004234160.1, NZ_KK737548.1, 113866, 114804, -, 939, 50141; cds-WP_004150245.1, NZ_KK737548.1, 114920, 116353, 1434, 5673; cds-WP_021440928.1, NZ_KK737548.1, 116378, 117280, -, 903, 1273; cds-WP_002923107.1, NZ_KK737548.1, 117443, 118606, -, 1164, 0; cds-WP _004889164.1, NZ _KK737548.1, 118652, 120016, -, 1365, 48; cds-WP_004151514.1, NZ_KK737548.1, 120020, 123127, -, 3108, 0; cds-WP _016529678.1, NZ _KK737548.1, 123127, 124251, -, 1125, 0; cds-WP _032412474.1, NZ_KK737548.1, 124458, 124580, +, 123, 1; cds-WP _032428455.1, NZ_KK737548.1, 124540, 124656, -, 117, 0; cds-WP_004173879.1, NZ_KK737548.1, 124631, 125047, +, 417, 5; cds-WP _004181564.1, NZ_KK737548.1, 125551, 126198, -, 648, 4546; cds-WP_032430016.1, NZ_KK737548.1, 126279, 127772, +, 1494, 1; cds-WP_002923020.1, NZ_KK737548.1, 127769, 128683, -, 915, 762; cds-WP_021440922.1, NZ_KK737548.1, 128779, 129405, +, 627, 0; cds-WP_021440921.1, NZ_KK737548.1, 129408, 129878, +, 471, 0; cds-WP _004145017.1, NZ_KK737548.1, 129899, 130435, -, 537, 0; cds-WP _004150236.1, NZ_KK737548.1, 130552, 131457, +, 906, 95; cds-WP_004173884.1, NZ_KK737548.1, 131586, 132395, +, 810, 1038; cds-WP_032430018.1, NZ_KK737548.1, 132420, 133274, +, 855, 4890; cds-WP_021440918.1, NZ_KK737548.1, 133264, 133824, -, 561, 3; cds-WP_004173886.1, NZ_KK737548.1, 133990, 134769, +, 780, 0; cds-WP _004145010.1, NZ_KK737548.1, 134791, 135744, +, 954, 2; cds-WP_004901462.1, NZ _KK737548.1, 135741, 136790, -, 1050, 0; cds-WP_004873113.1, NZ _KK737548.1, 137163, 137861, +, 699, 2; cds-WP_021440916.1, NZ_KK737548.1, 137912, 138202, -, 291, 0; cds-WP _002922964.1, NZ_KK737548.1, 138204, 139211, -, 1008, 0; cds-WP _002922963.1, NZ_KK737548.1, 139324, 139791, -, 468, 2; cds-WP _088296409.1, NZ_KK737548.1;NZ_KK737548.1, 140181;140442, 140442;141343, +;+, 1163, 506; cds-WP_108443077.1, NZ_KK737548.1, 141410, 141619, +, 210, 5549; cds-AF52_RS0124095, NZ_KK737548.1, 141929, 142276, -, 348, 1679; cds-AF52_RS0124105, NZ_KK737548.1, 142332, 143029, +, 698, 13238; cds-WP_021440909.1, NZ_KK737548.1, 143089, 144468, +, 1380, 23; cds-WP _004173889.1, NZ_KK737548.1, 144515, 145237, -, 723, 904; cds-AF52_RS0124110, NZ_KK737548.1, 145393, 147711, -, 2319, 1; cds-WP _002922962.1, NZ _KK737548.1, 147724, 149118, -, 1395, 0; cds-WP_032428443.1, NZ_KK737548.1, 149805, 151016, +, 1212, 47841; cds-WP_013815099.1-47, NZ_KK737548.1, 151813, 152781, -, 969, 4575; cds-WP_148673684.1, NZ_KK737548.1, 153177, 153419, -, 243, 0; cds-WP _013815099.1-48, NZ_KK737548.1, 153544, 154512, -, 969, 5237; cds-WP _050484287.1, NZ _KK737548.1, 154501, 155697, +, 1197, 0; cds-WP_002922944.1, NZ_KK737548.1, 155812, 157323, -, 1512, 667406; cds-WP_002922941.1, NZ_KK737548.1, 157345, 158196, -, 852, 52331; cds-WP_004150222.1, NZ_KK737548.1, 158639, 158884, +, 246, 5266; cds-WP_002922936.1, NZ_KK737548.1, 159036, 160025, +, 990, 45755; cds-WP_020803798.1, NZ_KK737548.1, 160188, 160958, +, 771, 1441; cds-WP_019724988.1, NZ_KK737548.1, 161023, 162327, +, 1305, 161; cds-WP_002922909.1, NZ_KK737548.1, 162420, 163187, -, 768, 62626; cds-WP_002922908.1, NZ_KK737548.1, 163297, 163899, -, 603, 121; cds-WP _021440903.1, NZ_KK737548.1, 164012, 164440, +, 429, 1; cds-WP _032430022.1, NZ_KK737548.1, 164441, 165187, -, 747, 5250; cds-WP _021440902.1, NZ_KK737548.1, 165338, 166348, -, 1011, 810; cds-WP _032428441.1, NZ_KK737548.1, 166397, 168478, -, 2082, 15838; cds-WP_004181538.1, NZ_KK737548.1, 168484, 169173, -, 690, 9448; cds-WP _004150214.1, NZ_KK737548.1, 169178, 171298, -, 2121, 331255; cds-WP_000135058.1, NZ_KK737548.1, 171317, 171592, -, 276, 78200; cds-WP _002922664.1, NZ_KK737548.1, 171647, 172270, -, 624, 44457; cds-WP_021440900.1, NZ_KK737548.1, 172529, 174205, +, 1677, 0; cds-WP_002922654.1, NZ_KK737548.1, 174211, 174828, -, 618, 11; cds-WP_021440899.1, NZ_KK737548.1, 175104, 176354, +, 1251, 7; cds-WP_004151500.1, NZ_KK737548.1, 176410, 177468, -, 1059, 7; cds-WP_023317368.1, NZ_KK737548.1, 177471, 178217, -, 747, 0; cds-WP_002922636.1, NZ_KK737548.1, 178400, 179263, -, 864, 6766; cds-AF52_RS27235, NZ_KK737548.1, 184808, 184969, -, 162, 272; cds-AF52_RS09865, NZ_KK737548.1, 185020, 185550, +, 531, 0; cds-AF52_RS27245, NZ_KK737548.1, 185584, 185730, +, 147, 219; cds-AF52_RS27250, NZ_KK737548.1, 189864, 189965, +, 102, 247; cds-AF52_RS09860, NZ_KK737548.1, 190018, 190773, +, 756, 6; cds-WP_004216995.1, NZ_KK737548.1, 190811, 190942, -, 132, 0; cds-WP_187079195.1, NZ_KK737548.1, 190941, 191795, +, 855, 1; cds-AF52_RS27260, NZ_KK737548.1, 191813, 191960, +, 148, 218; cds-AF52_RS09845, NZ_KK737548.1, 195939, 196123, +, 185, 520; cds-WP _032430029.1, NZ_KK737548.1, 196229, 197146, +, 918, 289; cds-AF52_RS09835, NZ_KK737548.1, 197178, 197753, +, 576, 14; cds-WP _013815099.1-49, NZ_KK737548.1, 197803, 198771, -, 969, 4507; cds-WP _032430030.1, NZ_KK737548.1, 198813, 199445, +, 633, 0; cds-WP _004181470.1, NZ_KK737548.1, 199673, 200161, +, 489, 62; cds-WP _009484082.1, NZ_KK737548.1, 200629, 202374, -, 1746, 190659; cds-WP _004150073.1, NZ_KK737548.1, 202498, 202818, +, 321, 0; cds-WP _021440835.1, NZ_KK737548.1, 202842, 203582, -, 741, 9; cds-WP _004150074.1, NZ_KK737548.1, 203579, 204649, -, 1071, 0; cds-WP_004145129.1, NZ_KK737548.1, 204651, 205496, -, 846, 18; cds-WP_014906831.1, NZ_KK737548.1, 205493, 206380, -, 888, 2470; cds-WP _004174008.1, NZ_KK737548.1, 206487, 207803, -, 1317, 45; cds-WP_025861226.1, NZ_KK737548.1, 208076, 208444, -, 369, 4; cds-WP_004174006.1, NZ_KK737548.1, 208441, 208662, -, 222, 105; cds-WP _004145133.1, NZ_KK737548.1, 208827, 209540, -, 714, 0; cds-WP _002920803.1, NZ_KK737548.1, 209542, 210309, -, 768, 0; cds-WP_004174005.1, NZ_KK737548.1, 210306, 211583, -, 1278, 0; cds-WP_002920807.1, NZ_KK737548.1, 211580, 212506, -, 927, 1; cds-WP_004150079.1, NZ_KK737548.1, 212568, 213677, -, 1110, 1; cds-WP_021312829.1, NZ_KK737548.1, 214101, 214484, +, 384, 3912; cds-WP _002920812.1, NZ_KK737548.1, 214753, 215856, -, 1104, 493; cds-WP _004150081.1, NZ_KK737548.1, 216114, 217358, -, 1245, 64; cds-WP _021440838.1, NZ_KK737548.1, 217506, 218771, -, 1266, 0; cds-WP_021440839.1, NZ_KK737548.1, 218890, 220413, +, 1524, 31427; cds-WP_032430034.1, NZ_KK737548.1, 220466, 221320, -, 855, 70848; cds-WP_004173994.1, NZ_KK737548.1, 221590, 222645, -, 1056, 1578; cds-WP_002920817.1, NZ_KK737548.1, 222638, 223306, -, 669, 25148; cds-WP_004173992.1, NZ_KK737548.1, 223309, 224832, -, 1524, 59532; cds-WP_002920820.1, NZ_KK737548.1, 225015, 225611, +, 597, 27; cds-WP_002920822.1, NZ_KK737548.1, 225601, 225876, +, 276, 69; cds-WP_004173989.1, NZ_KK737548.1, 225890, 226240, -, 351, 147; cds-WP _004173987.1, NZ_KK737548.1,


226391, 227017, +, 627, 102; cds-WP_004173985.1, NZ_KK737548.1, 227096, 229306, +, 2211, 1059; cds-WP_002920858.1, NZ_KK737548.1, 229410, 229655, -, 246, 14; cds-WP_002920860.1, NZ_KK737548.1, 229862, 230527, +, 666, 81487; cds-WP _002920861.1, NZ_KK737548.1, 230601, 231158, +, 558, 21215; cds-WP _004173981.1, NZ_KK737548.1, 231159, 232379, -, 1221, 42; cds-WP _004145147.1, NZ_KK737548.1, 232513, 233562, +, 1050, 35; cds-WP_002920863.1, NZ_KK737548.1, 233559, 233939, -, 381, 0; cds-WP _002920864.1, NZ_KK737548.1, 233939, 234277, -, 339, 0; cds-WP _004186016.1, NZ_KK737548.1, 234274, 235929, -, 1656, 14205; cds-WP _009308746.1, NZ_KK737548.1, 235929, 236831, -, 903, 11741; cds-WP_032430036.1, NZ_KK737548.1, 236828, 238813, -, 1986, 1243; cds-WP_002921035.1, NZ_KK737548.1, 238810, 239793, -, 984, 128; cds-WP_002921037.1, NZ_KK737548.1, 239795, 240934, -, 1140, 9; cds-WP _004181483.1, NZ_KK737548.1, 241331, 241837, -, 507, 52; cds-WP _032430038.1, NZ_KK737548.1, 241935, 242795, +, 861, 0; cds-WP_021440844.1, NZ_KK737548.1, 242934, 244502, +, 1569, 6; cds-WP_004150102.1, NZ_KK737548.1, 244502, 245446, +, 945, 1; cds-WP_004151422.1, NZ_KK737548.1, 245443, 246276, +, 834, 0; cds-WP _004173959.1, NZ_KK737548.1, 246276, 247040, +, 765, 0; cds-WP_009308750.1, NZ_KK737548.1, 247037, 247828, +, 792, 0; cds-WP_002921188.1, NZ_KK737548.1, 247816, 248214, +, 399, 0; cds-WP _002921192.1, NZ_KK737548.1, 248552, 249565, +, 1014, 0; cds-WP_004150109.1, NZ_KK737548.1, 249605, 250798, -, 1194, 32; cds-WP _002921200.1, NZ_KK737548.1, 251028, 252524, +, 1497, 7078; cds-WP _002921203.1, NZ_KK737548.1, 252580, 252915, -, 336, 30; cds-WP _004145166.1, NZ_KK737548.1, 253298, 253735, +, 438, 36715; cds-WP _002921264.1, NZ_KK737548.1, 253992, 255464, +, 1473, 46310; cds-WP_004173956.1, NZ_KK737548.1, 255592, 256344, -, 753, 148; cds-WP _004901172.1, NZ_KK737548.1, 256352, 258394, -, 2043, 8217; cds-WP_021465315.1, NZ_KK737548.1, 258577, 259848, -, 1272, 0; cds-WP _021440845.1, NZ_KK737548.1, 260042, 260884, +, 843, 980; cds-WP_002921271.1, NZ_KK737548.1, 260957, 262309, +, 1353, 24913; cds-WP_004173953.1, NZ_KK737548.1, 262363, 262986, -, 624, 64689; cds-WP_032430040.1, NZ_KK737548.1, 263113, 264261, +, 1149, 57; cds-WP _004150117.1, NZ_KK737548.1, 264501, 266153, +, 1653, 46979; cds-WP _032430042.1, NZ_KK737548.1, 266220, 266753, +, 534, 0; cds-WP_004211228.1, NZ_KK737548.1, 266788, 267546, -, 759, 1; cds-WP_004145179.1, NZ_KK737548.1, 267666, 268565, +, 900, 1130; cds-WP_002921337.1, NZ_KK737548.1, 268672, 269703, +, 1032, 25039; cds-WP _004150118.1, NZ_KK737548.1, 269975, 271297, +, 1323, 0; cds-WP_004901194.1, NZ_KK737548.1, 271335, 273386, -, 2052, 4; cds-WP _002921434.1, NZ_KK737548.1, 273581, 274510, +, 930, 126; cds-WP_032430046.1, NZ_KK737548.1, 274565, 276067, -, 1503, 69547; cds-WP _002921438.1, NZ_KK737548.1, 276287, 277573, -, 1287, 59384; cds-WP _072198875.1, NZ_KK737548.1, 277730, 279760, -, 2031, 6423; cds-WP _032430051.1, NZ_KK737548.1, 279979, 283458, -, 3480, 28; cds-WP _004173946.1, NZ_KK737548.1, 283440, 284549, -, 1110, 4; cds-WP_072001583.1, NZ_KK737548.1, 284553, 286898, -, 2346, 813; cds-WP _002921508.1, NZ_KK737548.1, 286909, 289527, -, 2619, 2; cds-WP _002921510.1, NZ_KK737548.1, 289524, 290255, -, 732, 0; cds-WP _002921513.1, NZ_KK737548.1, 290267, 290455, -, 189, 0; cds-WP _032430057.1, NZ_KK737548.1, 290624, 292177, +, 1554, 86; cds-WP_002921518.1, NZ_KK737548.1, 292177, 292374, +, 198, 2; cds-WP_004188236.1, NZ_KK737548.1, 292371, 294050, +, 1680, 2; cds-WP_032430059.1, NZ_KK737548.1, 294158, 295159, -, 1002, 0; cds-WP _002921529.1, NZ_KK737548.1, 295171, 295647, -, 477, 49; cds-WP_032430061.1, NZ_KK737548.1, 295647, 299699, -, 4053, 1; cds-WP_004151435.1, NZ_KK737548.1, 299696, 302131, -, 2436, 1; cds-WP _004173941.1, NZ_KK737548.1, 302128, 304239, -, 2112, 70; cds-WP _004173940.1, NZ_KK737548.1, 304259, 305062, -, 804, 2430; cds-WP _004186070.1, NZ_KK737548.1, 305053, 305592, -, 540, 1731; cds-WP _004145206.1, NZ_KK737548.1, 305910, 306089, -, 180, 57; cds-WP_021440859.1, NZ_KK737548.1, 306108, 307121, -, 1014, 0; cds-WP_021440860.1, NZ_KK737548.1, 307118, 308101, -, 984, 0; cds-WP_004145207.1, NZ_KK737548.1, 308112, 309014, -, 903, 0; cds-WP_002921786.1, NZ_KK737548.1, 309024, 310043, -, 1020, 0; cds-WP_050484288.1, NZ_KK737548.1, 310178, 311779, -, 1602, 0; cds-WP_013815099.1-50, NZ_KK737548.1, 311759, 312727, +, 969, 6399; cds-WP_004214574.1, NZ_KK737548.1, 313931, 315325, -, 1395, 0; cds-WP_004152427.1, NZ_KK737548.1, 315517, 317190, -, 1674, 87878; cds-WP _002921907.1, NZ_KK737548.1, 317433, 318638, -, 1206, 227; cds-WP _020803959.1, NZ_KK737548.1, 318880, 319461, -, 582, 2; cds-WP _002921914.1, NZ_KK737548.1, 319667, 320248, +, 582, 34178; cds-WP _015959126.1, NZ_KK737548.1, 320226, 320666, +, 441, 1493; cds-WP _032428435.1, NZ_KK737548.1, 320635, 322965, -, 2331, 22683; cds-WP_002921917.1, NZ_KK737548.1, 323133, 323795, +, 663, 61; cds-WP _002921918.1, NZ_KK737548.1, 323899, 324915, +, 1017, 57523; cds-WP_002921919.1, NZ_KK737548.1, 325027, 325776, +, 750, 5797; cds-WP _002921921.1, NZ_KK737548.1, 325780, 326715, +, 936, 38; cds-WP_002921927.1, NZ_KK737548.1, 326820, 328100, +, 1281, 7756; cds-WP_021440865.1, NZ_KK737548.1, 328125, 329096, +, 972, 1567; cds-WP_002921929.1, NZ_KK737548.1, 329205, 329915, -, 711, 4202; cds-WP_021440866.1, NZ_KK737548.1, 330356, 331711, +, 1356, 0; cds-WP _013815099.1-51, NZ_KK737548.1, 331921, 332889, -, 969, 4442; cds-AF52_RS26455, NZ_KK737548.1, 332922, 333029, -, 108, 0; cds-WP_002922127.1, NZ_KK737548.1, 333330, 335399, -, 2070, 99597; cds-WP _002922128.1, NZ_KK737548.1, 335409, 336320, -, 912, 47159; cds-WP_002922129.1, NZ_KK737548.1, 336447, 336746, -, 300, 0; cds-WP _004145225.1, NZ_KK737548.1, 336926, 337921, +, 996, 787; cds-WP_004188180.1, NZ_KK737548.1, 337948, 338394, -, 447, 967; cds-WP _002922133.1, NZ_KK737548.1, 338426, 338797, -, 372, 0; cds-WP _004150156.1, NZ_KK737548.1, 338966, 340420, -, 1455, 13; cds-WP_021440868.1, NZ_KK737548.1, 340513, 341835, -, 1323, 4861; cds-WP_014906789.1, NZ_KK737548.1, 342270, 343325, +, 1056, 6; cds-WP _002922346.1, NZ_KK737548.1, 343390, 344931, +, 1542, 32087; cds-WP_002922349.1, NZ_KK737548.1, 344909, 346090, +, 1182, 4; cds-WP_002922351.1, NZ_KK737548.1, 346323, 347501, +, 1179, 2721; cds-WP_004188166.1, NZ_KK737548.1, 347540, 348358, -, 819, 8; cds-WP _004173926.1, NZ_KK737548.1, 348673, 350706, +, 2034, 24344; cds-WP _002922359.1, NZ_KK737548.1, 350875, 352131, +, 1257, 17325; cds-WP _021440872.1, NZ_KK737548.1, 352174, 352659, -, 486, 1; cds-WP _021440873.1, NZ_KK737548.1, 352769, 353596, -, 828, 475; cds-WP_021440874.1, NZ_KK737548.1, 353815, 354813, +, 999, 11; cds-WP _021440875.1, NZ_KK737548.1, 354825, 355289, +, 465, 0; cds-WP_004150167.1, NZ_KK737548.1, 355314, 356243, +, 930, 8673; cds-WP _032430066.1, NZ_KK737548.1, 356280, 357599, +, 1320, 10858; cds-WP_021440877.1, NZ_KK737548.1, 357678, 359183, +, 1506, 1; cds-WP_004889285.1, NZ_KK737548.1, 359180, 359842, +, 663, 0; cds-WP_004889283.1, NZ_KK737548.1, 359835, 360695, +, 861, 0; cds-WP_021440878.1, NZ_KK737548.1, 360689, 361387, +, 699, 8; cds-WP_032430069.1, NZ_KK737548.1, 361445, 363286, -, 1842, 11; cds-WP _021440880.1, NZ_KK737548.1, 363283, 364671, -, 1389, 26820; cds-WP_004145238.1, NZ_KK737548.1, 364777, 365385, -, 609, 3706; cds-AF52_RS26460, NZ_KK737548.1, 365492, 365822, -, 331, 0; cds-WP_002922397.1, NZ_KK737548.1, 366352, 368259, +, 1908, 17445; cds-WP _019705056.1, NZ_KK737548.1, 368360, 369508, +, 1149, 50; cds-WP_002922401.1, NZ_KK737548.1, 369508, 370104, +, 597, 194; cds-WP_002922402.1, NZ_KK737548.1, 370093, 370317, -, 225, 0; cds-WP_002922410.1, NZ_KK737548.1, 370590, 370952, +, 363, 2865; cds-WP _002922413.1, NZ_KK737548.1, 371238, 372893, +, 1656, 961977; cds-WP _002922415.1, NZ_KK737548.1, 372890, 373663, +, 774, 182941; cds-WP _002922420.1, NZ_KK737548.1, 373663, 374847, +, 1185, 114488; cds-WP _002922423.1, NZ_KK737548.1, 374940, 375413, +, 474, 144831; cds-WP_004164645.1, NZ_KK737548.1, 375490, 375757, +, 268, 3576; cds-WP _032430073.1, NZ_KK737548.1, 376056, 376773, +, 718, 6385; cds-WP_004185922.1, NZ_KK737548.1, 376896, 377726, -, 831, 76711; cds-WP _002920136.1, NZ_KK737548.1, 377949, 378167, +, 219, 5; cds-WP _002920140.1, NZ_KK737548.1, 378226, 378813, -, 588, 35254; cds-WP _002920143.1, NZ_KK737548.1, 378907, 379107, -, 201, 64; cds-WP _004150031.1, NZ_KK737548.1, 379119, 380924, -, 1806, 5191; cds-WP _004151401.1, NZ_KK737548.1, 380911, 381474, -, 564, 435; cds-WP _032430077.1, NZ_KK737548.1, 381648, 383552, +, 1905, 81313; cds-WP_072145335.1, NZ_KK737548.1, 383780, 384778, +, 999, 1032; cds-WP_002920151.1, NZ_KK737548.1, 384775, 384993, +, 219, 10; cds-WP _021440811.1, NZ_KK737548.1, 385030, 385899, +, 870, 36261; cds-WP _002920158.1, NZ_KK737548.1, 385954, 386358, -, 405, 6887; cds-WP 000242758.1, NZ_KK737548.1, 386665, 387297, +, 633, 305413; cds-WP _004213494.1, NZ_KK737548.1, 387349, 389427, +, 2079, 16271; cds-WP _021440813.1, NZ_KK737548.1, 389417, 390637, -, 1221, 275; cds-WP_021440814.1, NZ_KK737548.1, 390728, 391291, -, 564, 15; cds-WP _004181446.1, NZ_KK737548.1, 391324, 391926, -, 603, 14; cds-WP _002920231.1, NZ_KK737548.1, 391916, 392083, -, 168, 88; cds-WP _002920238.1, NZ_KK737548.1, 392190, 392759, -, 570, 12570; cds-WP_002920240.1, NZ_KK737548.1, 393036, 394223, +, 1188, 1196; cds-WP_004174045.1, NZ_KK737548.1, 394220, 395542, -, 1323, 12752; cds-WP_002920243.1, NZ_KK737548.1, 395781, 398324, +, 2544, 36; cds-WP_002920249.1, NZ_KK737548.1, 398321, 398647, +, 327, 0; cds-WP_002920252.1, NZ_KK737548.1, 398801, 400174, +, 1374, 743; cds-WP_002920253.1, NZ_KK737548.1, 400247, 401251, -, 1005, 204696; cds-WP_004188345.1, NZ_KK737548.1, 401244, 402005, -, 762, 20155; cds-WP_002920259.1, NZ_KK737548.1, 401998, 402675, -, 678, 29998; cds-WP_002920260.1, NZ_KK737548.1, 402693, 403520, -, 828,120113; cds-WP_021440816.1, NZ_KK737548.1, 403599, 404885, -, 1287, 50822; cds-WP_004150047.1, NZ_KK737548.1, 404970, 406064, -, 1095, 80645; cds-WP_002920267.1, NZ_KK737548.1, 406120, 406641, -, 522, 37616; cds-WP _021440817.1, NZ_KK737548.1, 406912, 408156, -, 1245, 28; cds-WP _002920279.1, NZ_KK737548.1, 408089, 408472, -, 384, 0; cds-WP_004174029.1, NZ_KK737548.1, 408462, 408890, -, 429, 0; cds-WP_032428423.1, NZ_KK737548.1, 408880, 409413, -, 534, 0; cds-WP_004174027.1, NZ_KK737548.1, 409397, 410197, -, 801, 0; cds-WP_004185951.1, NZ_KK737548.1, 410316, 412874, +, 2559, 60576; cds-WP _032430083.1, NZ_KK737548.1, 412928, 413488, -, 561, 6649; cds-WP_032430086.1, NZ_KK737548.1, 413809, 415938, +, 2130, 722; cds-WP_004181456.1, NZ_KK737548.1, 415999, 416682, +, 684, 3656; cds-WP_002920326.1, NZ_KK737548.1, 416679, 417080, +, 402, 2640; cds-WP_004188324.1, NZ_KK737548.1, 417099, 417983, +, 885, 652; cds-WP _032430089.1, NZ_KK737548.1, 418344, 419966, +, 1623, 189131; cds-WP_002920333.1, NZ_KK737548.1, 420044, 421399, -, 1356, 50; cds-WP_001157751.1, NZ_KK737548.1, 421396, 422115, -, 720, 1838; cds-WP _002920503.1, NZ_KK737548.1, 422343, 422816, +, 474, 4; cds-WP _004150056.1, NZ_KK737548.1, 422917, 425247, +, 2331, 203816; cds-WP_013815099.1-52, NZ_KK737548.1, 425442, 426410, -, 969, 2658; cds-WP_002920506.1, NZ_KK737548.1, 426726, 426953, +, 228,6492; cds-WP_014906839.1, NZ_KK737548.1, 426982, 429300, +, 2319, 5295; cds-WP_002920509.1, NZ_KK737548.1, 429310, 429549, +, 240, 0; cds-WP _002920510.1, NZ_KK737548.1, 429638, 429907, -, 270, 6; cds-WP _032430095.1, NZ_KK737548.1, 430028, 430801, -, 774,136; cds-WP_004185961.1, NZ_KK737548.1, 430840, 431514, +, 675, 11; cds-WP_002920540.1, NZ_KK737548.1, 431573, 432148, +, 576, 2086; cds-WP_002920542.1, NZ_KK737548.1, 432485, 433801, +, 1317, 10; cds-WP _004185965.1, NZ_KK737548.1, 433904, 435997, -, 2094, 15189; cds-WP _004151407.1, NZ_KK737548.1, 436008, 438398, -, 2391, 223585; cds-WP _002920545.1, NZ_KK737548.1, 439023, 441728, +, 2706, 153020; cds-WP _002920548.1, NZ_KK737548.1, 441744, 442502, -, 759, 13848; cds-WP_032428425.1, NZ_KK737548.1, 442552, 443382, -, 831, 30867; cds-WP_002920552.1, NZ_KK737548.1, 443433, 443762, -, 330, 5090; cds-WP_002920554.1, NZ_KK737548.1, 443967, 445475, +, 1509, 69394; cds-WP_004174017.1, NZ_KK737548.1, 445538, 445837, -, 300, 0; cds-WP _016529833.1, NZ_KK737548.1, 445837, 446184, -, 348, 839; cds-WP_002920561.1, NZ_KK737548.1, 446360, 448807, -, 2448, 6228; cds-WP _002920564.1, NZ_KK737548.1, 448825, 450258, -, 1434, 6701; cds-WP_002920566.1, NZ_KK737548.1, 450258, 451553, -, 1296, 1881; cds-WP_023342583.1, NZ_KK737548.1, 451634, 453610, -, 1977, 33; cds-WP_004150069.1, NZ_KK737548.1,


453607, 455793, -, 2187, 60111; cds-WP_002920570.1, NZ_KK737548.1, 456031, 457137, -, 1107, 360; cds-WP_004151411.1, NZ_KK737548.1, 457241, 457603, +, 363, 0; cds-WP_002920773.1, NZ_KK737548.1, 457600, 458940, -, 1341, 9610; cds-WP_002920775.1, NZ_KK737548.1, 458940, 459470, -, 531, 666; cds-WP_002920777.1, NZ_KK737548.1, 459651, 460646, -, 996, 27440; cds-WP_002920779.1, NZ_KK737548.1, 460760, 461455, -, 696, 173; cds-WP_021440831.1, NZ_KK737548.1, 461577, 462614, -, 1038, 331; cds-WP_013815099.1-53, NZ_KK737548.1, 462956, 463924, -, 969, 3725; cds-AF52_RS08695, NZ_KK737548.1, 463958, 464491, +, 534, 53; cds-WP_002922602.1, NZ_KK737548.1, 464588, 465304, +, 717, 305; cds-WP _004173904.1, NZ_KK737548.1, 465415, 466056, +, 642, 52331; cds-WP _004173905.1, NZ_KK737548.1, 466092, 467108, -, 1017, 17256; cds-WP_002922598.1, NZ_KK737548.1, 467284, 467880, -, 597, 3209; cds-WP_004145270.1, NZ_KK737548.1, 468005, 468463, -, 459, 19879; cds-WP_004188117.1, NZ_KK737548.1, 468441, 469655, -, 1215, 17283; cds-WP_002922589.1, NZ_KK737548.1, 469828, 470493, +, 666, 41358; cds-WP _000091955.1, NZ_KK737548.1, 470710, 470946, +, 237, 154350; cds-WP_002922510.1, NZ_KK737548.1, 470967, 471134, +, 168, 52214; cds-WP _004173907.1, NZ_KK737548.1, 471270, 472079, +, 810, 76; cds-WP _002922501.1, NZ_KK737548.1, 472268, 472747, -, 480, 41; cds-WP_004145264.1, NZ_KK737548.1, 472744, 473520, -, 777, 26567; cds-WP_004145263.1, NZ_KK737548.1, 473520, 474794, -, 1275, 1194; cds-WP _002922498.1, NZ_KK737548.1, 474886, 475875, -, 990, 7099; cds-WP _032430101.1, NZ_KK737548.1, 475905, 476999, -, 1095, 99; cds-WP _009308781.1, NZ_KK737548.1, 477002, 478129, -, 1128, 12695; cds-WP_021440889.1, NZ_KK737548.1, 478126, 479202, -, 1077, 20421; cds-WP _021440888.1, NZ_KK737548.1, 479314, 480276, +, 963, 44723; cds-WP _032428440.1, NZ_KK737548.1, 480295, 481374, +, 1080, 9733; cds-WP _032430104.1, NZ_KK737548.1, 481418, 482587, -, 1170, 11665; cds-WP_002922468.1, NZ_KK737548.1, 482565, 483473, -, 909, 18257; cds-WP_004186128.1, NZ_KK737548.1, 483473, 484444, -, 972, 2469; cds-WP_002922465.1, NZ_KK737548.1, 484448, 485506, -, 1059, 3060; cds-WP _002922463.1, NZ_KK737548.1, 485516, 486448, -, 933, 78343; cds-WP_002922462.1, NZ_KK737548.1, 486662, 487855, +, 1194, 59787; cds-WP_002922461.1, NZ_KK737548.1, 487868, 488893, +, 1026, 30341; cds-WP_032428438.1, NZ_KK737548.1, 489062, 489850, +, 789, 24301; cds-WP_002922459.1, NZ_KK737548.1, 489856, 490803, -, 948, 2245; cds-WP _032428437.1, NZ_KK737548.1, 490807, 492078, -, 1272, 40144; cds-WP_004152046.1, NZ_KK737548.1, 492088, 493632, -, 1545, 50; cds-WP_002922436.1, NZ_KK737548.1, 493878, 494309, +, 432, 61157; cds-WP_002922429.1, NZ_KK737548.1, 494416, 494667, +, 252, 42171; cds-WP _002922428.1, NZ_KK737548.1, 494728, 495195, +, 468, 90834; cds-WP _002922427.1, NZ_KK737548.1, 495195, 496214, +, 1020, 108248; cds-WP_002922426.1, NZ_KK737548.1, 496288, 497109, +, 822, 3788; cds-AF52_RS27300, NZ_KK737548.1, 497212, 497488, -, 277, 2228; cds-WP_032430113.1, NZ_KK737548.1, 498141, 498462, -, 322, 825; cds-WP_002920130.1, NZ_KK737548.1, 498606, 499328, +, 723, 6529; cds-WP_002920128.1, NZ_KK737548.1, 499328, 499714, +, 387, 1; cds-WP_004889490.1, NZ_KK737548.1, 499714, 500073, +, 360, 127; cds-WP _002920119.1, NZ_KK737548.1, 500081, 500368, +, 288, 370; cds-WP_002920115.1, NZ_KK737548.1, 500493, 500867, +, 375, 558210; cds-WP_002920113.1, NZ_KK737548.1, 500964, 501434, +, 471, 1256241; cds-WP_002920103.1, NZ_KK737548.1, 501531, 503645, +, 2115, 5379147; cds-WP _004174069.1, NZ_KK737548.1, 503715, 504899, +, 1185, 5313536; cds-WP_004152415.1, NZ_KK737548.1, 505080, 505274, +, 195, 28800; cds-WP _002919971.1, NZ_KK737548.1, 505348, 505824, +, 477, 61616; cds-WP_020801891.1, NZ_KK737548.1, 505808, 506293, -, 486, 34; cds-WP _001181005.1, NZ_KK737548.1, 506677, 506988, +, 312, 484272; cds-WP_002919796.1, NZ_KK737548.1, 507021, 507650, +, 630, 1110399; cds-WP _002919794.1, NZ_KK737548.1, 507661, 508266, +, 606, 1813373; cds-WP _000617546.1, NZ_KK737548.1, 508263, 508565, +, 303, 742840; cds-WP _002919786.1, NZ_KK737548.1, 508583, 509404, +, 822, 1811558; cds-WP _001138115.1, NZ_KK737548.1, 509421, 509699, +, 279, 1378924; cds-WP _002919773.1, NZ_KK737548.1, 509714, 510046, +, 333, 1775303; cds-WP _002919766.1, NZ_KK737548.1, 510064, 510762, +, 699, 1917106; cds-WP_002919759.1, NZ_KK737548.1, 510775, 511185, +, 411, 1138021; cds-WP_002919754.1, NZ_KK737548.1, 511185, 511376, +, 192, 470677; cds-WP _002919751.1, NZ_KK737548.1, 511376, 511630, +, 255, 350824; cds-WP_002919748.1, NZ_KK737548.1, 511796, 512167, +, 372, 240800; cds-WP_000729185.1, NZ_KK737548.1, 512178, 512492, +, 315, 556271; cds-WP 001096200.1, NZ_KK737548.1, 512507, 513046, +, 540, 1582314; cds-WP_002919667.1, NZ_KK737548.1, 513061, 513366, +, 306, 1236396; cds-WP_002919665.1, NZ_KK737548.1, 513400, 513792, +, 393, 704910; cds-WP_002919662.1, NZ_KK737548.1, 513805, 514338, +, 534, 1098814; cds-WP _000358960.1, NZ_KK737548.1, 514348, 514701, +, 354, 975894; cds-WP_002919545.1, NZ_KK737548.1, 514716, 515219, +, 504, 747206; cds-WP_001140434.1, NZ_KK737548.1, 515223, 515402, +, 180, 356655; cds-WP _002919516.1, NZ_KK737548.1, 515406, 515840, +, 435, 1660488; cds-WP _002919515.1, NZ_KK737548.1, 515848, 517179, +, 1332, 2541458; cds-WP_000868187.1, NZ_KK737548.1, 517213, 517329, +, 117, 196565; cds-WP_002919259.1, NZ_KK737548.1, 517476, 517832, +, 357, 894926; cds-WP _002919257.1, NZ_KK737548.1, 517849, 518238, +, 390, 1399975; cds-WP_002919224.1, NZ_KK737548.1, 518272, 518892, +, 621, 1683053; cds-WP _002919219.1, NZ_KK737548.1, 518918, 519907, +, 990, 2679755; cds-WP_002919206.1, NZ_KK737548.1, 519948, 520334, +, 387, 535665; cds-WP_002919204.1, NZ_KK737548.1, 520443, 520811, +, 369, 2869; cds-WP_004185894.1, NZ_KK737548.1, 520814, 521239, +, 426, 5912; cds-WP_004145324.1, NZ_KK737548.1, 521297, 521575, +, 279, 2; cds-WP_004145325.1, NZ_KK737548.1, 521511, 521924, -, 414, 6617; cds-WP _032430127.1, NZ_KK737548.1, 522065, 523441, -, 1377, 11910; cds-WP _004212524.1, NZ_KK737548.1, 523455, 524750, -, 1296, 43275; cds-WP_032430129.1, NZ_KK737548.1, 524803, 525750, -, 948, 39804; cds-WP_004889527.1, NZ_KK737548.1, 525765, 526274, -, 510, 6761; cds-WP _032428422.1, NZ_KK737548.1, 526403, 527527, +, 1125, 7726; cds-WP _002919137.1, NZ_KK737548.1, 527499, 527972, +, 474, 39215; cds-WP_004145330.1, NZ_KK737548.1, 527999, 528541, +, 543, 46869; cds-WP _021440795.1, NZ_KK737548.1, 528546, 529118, +, 573, 16256; cds-WP_002919126.1, NZ_KK737548.1, 529122, 529940, +, 819, 2980; cds-WP_002919125.1, NZ_KK737548.1, 529937, 530194, +, 258, 36; cds-AF52_RS08260, NZ_KK737548.1, 530170, 530502, -, 333, 4; cds-AF52_RS08255, NZ_KK737548.1, 530559, 530709, -, 151, 300; cds-AF52_RS08250, NZ_KK737548.1, 538177, 538410, -, 234, 19; cds-WP_002919103.1, NZ_KK737548.1, 546983, 547204, -, 222, 0; cds-WP _032430131.1, NZ_KK737548.1, 547497, 550607, -, 3111, 235; cds-WP _002919101.1, NZ_KK737548.1, 550620, 551759, -, 1140, 17; cds-WP_021440791.1, NZ_KK737548.1, 552138, 552791, +, 654, 0; cds-WP_000462905.1, NZ_KK737548.1, 552876, 553172, -, 297, 27073; cds-WP _004144972.1, NZ_KK737548.1, 553197, 554162, -, 966, 95131; cds-WP _004144971.1, NZ_KK737548.1, 554520, 555401, -, 882, 14841; cds-WP_004188394.1, NZ_KK737548.1, 555413, 556864, -, 1452, 13239; cds-WP _002918740.1, NZ_KK737548.1, 556854, 557096, -, 243, 440; cds-WP _002918738.1, NZ_KK737548.1, 557207, 558556, -, 1350, 112325; cds-WP_002918736.1, NZ_KK737548.1, 558567, 559034, -, 468, 63644; cds-WP_019725248.1, NZ_KK737548.1, 559057, 559509, -, 453, 275700; cds-WP_002918689.1, NZ_KK737548.1, 559733, 560341, -, 609, 44; cds-WP_004211677.1, NZ_KK737548.1, 560341, 561342, -, 1002, 2; cds-WP _004211674.1, NZ_KK737548.1, 561572, 561763, +, 192, 6; cds-WP _002918686.1, NZ_KK737548.1, 561843, 563783, +, 1941, 4615; cds-WP_002918653.1, NZ_KK737548.1, 564089, 565132, +, 1044, 104680; cds-WP _004149974.1, NZ_KK737548.1, 565203, 566195, +, 993, 19077; cds-WP _002918648.1, NZ_KK737548.1, 566195, 566683, +, 489, 20341; cds-WP _032430132.1, NZ_KK737548.1, 566691, 567272, +, 582, 2953; cds-WP _002918644.1, NZ_KK737548.1, 567275, 568744, +, 1470, 80793; cds-WP_032417624.1, NZ_KK737548.1, 568782, 572579, +, 3798, 43939; cds-WP _004144958.1, NZ_KK737548.1, 572668, 574113, +, 1446, 80694; cds-WP_002918641.1, NZ_KK737548.1, 574149, 575078, -, 930, 87; cds-WP_002918640.1, NZ_KK737548.1, 575210, 575413, +, 204, 13; cds-WP_002918639.1, NZ_KK737548.1, 575421, 576353, +, 933, 36972; cds-WP _002918632.1, NZ_KK737548.1, 576359, 578326, +, 1968, 2; cds-WP_002918629.1, NZ_KK737548.1, 578406, 578681, +, 276, 212; cds-WP_002918627.1, NZ_KK737548.1, 578732, 578998, -, 267, 4; cds-WP _032428421.1, NZ_KK737548.1, 579097, 579360, -, 264, 13; cds-WP _002918625.1, NZ_KK737548.1, 579735, 580205, -, 471, 6724; cds-WP_002918570.1, NZ_KK737548.1, 580620, 581558, +, 939, 138149; cds-WP_002918568.1, NZ_KK737548.1, 581695, 582753, -, 1059, 9525; cds-WP_032430134.1, NZ_KK737548.1, 582841, 584208, -, 1368, 36; cds-WP _002918565.1, NZ_KK737548.1, 584382, 584780, -, 399, 20733; cds-WP_004900926.1, NZ_KK737548.1, 584971, 586098, +, 1128, 136975; cds-WP _002918559.1, NZ_KK737548.1, 586364, 586792, +, 429, 462292; cds-WP_000829818.1, NZ_KK737548.1, 586808, 587200, +, 393, 829996; cds-WP _002918467.1, NZ_KK737548.1, 587512, 588150, +, 639, 95770; cds-WP _002918465.1, NZ_KK737548.1, 588154, 588648, +, 495, 16819; cds-WP _004185859.1, NZ_KK737548.1, 588773, 589477, +, 705, 187; cds-WP_002918461.1, NZ_KK737548.1, 589532, 590950, -, 1419, 36736; cds-WP_004144939.1, NZ_KK737548.1, 590960, 595420, -4461, 183936; cds-WP _002918455.1, NZ_KK737548.1, 596094, 597026, +, 933, 6; cds-AF52_RS08010, NZ_KK737548.1, 597078, 597653, -, 576, 9; cds-AF52_RS08005, NZ_KK737548.1, 597707, 597899, -, 193, 289; cds-WP _032430135.1, NZ_KK737548.1, 600002, 601147, -, 1146, 38586; cds-WP_002917952.1, NZ_KK737548.1, 601212, 602102, -891, 93386; cds-WP _002917954.1, NZ_KK737548.1, 602129, 602899, -, 771, 29803; cds-WP _020802049.1, NZ_KK737548.1, 602926, 604257, -, 1332, 59840; cds-WP_002917960.1, NZ_KK737548.1, 604650, 606221, +, 1572, 47601; cds-WP_004144878.1, NZ_KK737548.1, 606434, 607297, -, 864, 5115; cds-WP _032430136.1, NZ_KK737548.1, 607361, 609469, +, 2109, 18603; cds-WP_002918206.1, NZ_KK737548.1, 609427, 609813, +, 387, 401; cds-WP _002918211.1, NZ_KK737548.1, 609839, 610429, +, 591, 1264; cds-WP_002918214.1, NZ_KK737548.1, 610439, 611014, +, 576, 2662; cds-WP_004149921.1, NZ_KK737548.1, 611136, 612176, -, 1041, 4292; cds-WP _002918218.1, NZ_KK737548.1, 612252, 612899, -, 648, 0; cds-WP _002918221.1, NZ_KK737548.1, 613028, 613564, +, 537, 0; cds-WP _002918223.1, NZ_KK737548.1, 613526, 613969, -, 444, 5521; cds-WP_002918226.1, NZ_KK737548.1, 614019, 614309, +, 291, 3162; cds-WP _002918229.1, NZ_KK737548.1, 614296, 614799, -, 504, 6; cds-WP _002918231.1, NZ_KK737548.1, 614793, 615317, -, 525, 101; cds-WP_002918232.1, NZ_KK737548.1, 615539, 616534, +, 996, 0; cds-WP_020802035.1, NZ_KK737548.1, 616540, 617418, +, 879, 682; cds-WP_020802054.1, NZ_KK737548.1, 617562, 618569, +, 1008, 13785; cds-WP _002918235.1, NZ_KK737548.1, 618614, 619858, -, 1245, 10; cds-WP _004150943.1, NZ_KK737548.1, 620003, 621934, -, 1932, 43996; cds-WP_085903200.1, NZ_KK737548.1, 621927, 622007, -, 81, 43774; cds-WP _002918241.1, NZ_KK737548.1, 622112, 622996, -, 885, 157847; cds-WP_004150944.1, NZ_KK737548.1, 623105, 625240, -, 2136, 554174; cds-WP _002918244.1, NZ_KK737548.1, 625483, 625752, -, 270, 44638; cds-WP _023280600.1, NZ_KK737548.1, 625901, 626845, -, 945, 37001; cds-WP_002918248.1, NZ_KK737548.1, 626845, 627246, -, 402, 8870; cds-WP_002918250.1, NZ_KK737548.1, 627349, 630039, -2691, 688553; cds-WP_002918252.1, NZ_KK737548.1, 630064, 631551, -, 1488, 284367; cds-WP_002918364.1, NZ_KK737548.1, 631579, 632031, -, 453, 80046; cds-WP_004144895.1, NZ_KK737548.1, 632624, 633967, +, 1344, 33330; cds-WP_013815099.1-54, NZ_KK737548.1, 634121, 635089, -, 969, 7690; cds-AF52_RS0124215, NZ_KK737548.1, 635123, 635506, +, 384, 1831; cds-WP_004174150.1, NZ_KK737548.1, 635644, 636273, +, 630, 1; cds-WP_002918367.1, NZ_KK737548.1, 636616, 637167, +, 552, 0; cds-WP_014906872.1, NZ_KK737548.1, 637209, 637457, -, 249, 0; cds-WP_002918369.1, NZ_KK737548.1, 637851, 638180, -, 330, 2597; cds-WP _002918370.1, NZ_KK737548.1, 638410, 639747, -, 1338, 54044; cds-WP_002918371.1, NZ_KK737548.1, 639740, 640588, -, 849, 3607; cds-WP_002918372.1, NZ_KK737548.1, 640682, 642616,


-, 1935, 667533; cds-WP _002918373.1, NZ_KK737548.1, 642716, 643345, -, 630, 20446; cds-WP_002918374.1, NZ_KK737548.1, 643469, 643762, +, 294, 24299; cds-WP_002918375.1, NZ_KK737548.1, 643915, 644391, -, 477, 40527; cds-WP_004149937.1, NZ_KK737548.1, 644627, 646060, +, 1434, 11082; cds-WP _002918377.1, NZ_KK737548.1, 646112, 647290, -, 1179, 256031; cds-WP_004149938.1, NZ_KK737548.1, 647306, 648271, -, 966, 24951; cds-WP _002434222.1, NZ_KK737548.1, 648365, 648622, -, 258, 159445; cds-WP _002918379.1, NZ_KK737548.1, 648643, 648954, -, 312, 318725; cds-WP _004144907.1, NZ_KK737548.1, 649215, 650186, +, 972, 44921; cds-WP_002918381.1, NZ_KK737548.1, 650383, 650655, +, 273, 15; cds-WP_002918382.1, NZ_KK737548.1, 650711, 651970, -, 1260, 35347; cds-WP _004144910.1, NZ_KK737548.1, 652024, 652278, -, 255, 10437; cds-WP _004174142.1, NZ_KK737548.1, 652415, 652705, -, 291, 6706; cds-WP _032430139.1, NZ_KK737548.1, 652705, 653340, -, 636, 14426; cds-WP_002918387.1, NZ_KK737548.1, 653359, 653910, -, 552, 2039; cds-WP_004150949.1, NZ_KK737548.1, 653915, 654697, -, 783, 28787; cds-WP_004150950.1, NZ_KK737548.1, 654705, 655517, -, 813, 121791; cds-WP_004149949.1, NZ_KK737548.1, 655727, 656704, +, 978, 31; cds-WP _002918399.1, NZ_KK737548.1, 656719, 657705, +, 987, 2327; cds-WP_002918405.1, NZ_KK737548.1, 657720, 658286, +, 567, 752; cds-WP_002918413.1, NZ_KK737548.1, 658283, 658858, +, 576, 66133; cds-WP_002918415.1, NZ_KK737548.1, 658827, 659372, +, 546, 104770; cds-WP _002918417.1, NZ_KK737548.1, 659379, 660104, +, 726, 253516; cds-WP _002918420.1, NZ_KK737548.1, 660152, 661585, +, 1434, 121513; cds-WP _002918423.1, NZ_KK737548.1, 661608, 661895, +, 288, 43629; cds-WP _004144926.1, NZ_KK737548.1, 661966, 662454, +, 489, 34804; cds-WP _002918428.1, NZ_KK737548.1, 662500, 663354, +, 855, 91008; cds-WP _002918431.1, NZ_KK737548.1, 663351, 663623, +, 273, 10476; cds-WP_032430141.1, NZ_KK737548.1, 663687, 664412, -, 726, 925; cds-WP_004889584.1, NZ_KK737548.1, 664409, 665062, -, 654, 255; cds-WP_002918444.1, NZ_KK737548.1, 665296, 667635, -, 2340, 65653; cds-WP _021440775.1, NZ_KK737548.1, 667782, 668846, -, 1065, 2259; cds-WP _032428420.1, NZ_KK737548.1, 669143, 670159, +, 1017, 0; cds-AF52_RS07625, NZ_KK737548.1, 670245, 670964, +, 720, 0; cds-WP _032430142.1, NZ_KK737548.1, 670997, 671650, +, 654, 3379; cds-WP_032175380.1, NZ_KK737548.1, 671925, 672273, +, 349, 1176; cds-AF52_RS07610, NZ_KK737548.1, 672318, 672869, -, 552, 26; cds-WP_004144865.1, NZ_KK737548.1, 672974, 673870, +, 897, 757; cds-WP_002917923.1, NZ_KK737548.1, 673912, 674280, -, 369, 8; cds-WP_002917922.1, NZ_KK737548.1, 674407, 675393, -, 987,118; cds-WP _002917920.1, NZ_KK737548.1, 675474, 675866, -, 393, 0; cds-WP_004181402.1, NZ_KK737548.1, 676212, 676508, -, 297, 0; cds-WP_002917917.1, NZ_KK737548.1, 676505, 676903, -, 399, 252; cds-WP _002917916.1, NZ_KK737548.1, 676906, 677211, -, 306, 179; cds-WP_002917914.1, NZ_KK737548.1, 677257, 677625, -, 369, 19049; cds-WP_004218213.1, NZ_KK737548.1, 677775, 678152, -, 378, 5184; cds-WP_002917909.1, NZ_KK737548.1, 678161, 678823, -, 663, 83; cds-WP _002917907.1, NZ_KK737548.1, 679164, 679940, -, 777, 229; cds-WP_002917905.1, NZ_KK737548.1, 680068, 681369, -, 1302, 150; cds-WP_050484286.1, NZ_KK737548.1, 681850, 683202, +, 1353, 10345; cds-WP_002917898.1, NZ_KK737548.1, 683281, 684768, +, 1488, 43; cds-WP _002917897.1, NZ_KK737548.1, 684898, 685452, +, 555, 9787; cds-WP_002917895.1, NZ_KK737548.1, 685468, 686715, -, 1248, 11465; cds-WP _004185787.1, NZ_KK737548.1, 686982, 687953, -, 972, 49; cds-WP_004181399.1, NZ_KK737548.1, 688225, 689214, -, 990, 23963; cds-WP_004144843.1, NZ_KK737548.1, 689288, 689788, -, 501, 7; cds-WP _021440752.1, NZ_KK737548.1, 689808, 690410, -, 603, 75; cds-WP_002917889.1, NZ_KK737548.1, 690454, 691161, +, 708, 5; cds-WP _021440751.1, NZ_KK737548.1, 691247, 692377, +, 1131, 984; cds-WP_004900808.1, NZ_KK737548.1, 692486, 694507, -, 2022, 8924; cds-WP _019704938.1, NZ_KK737548.1, 694692, 696290, -, 1599, 2; cds-WP_004144837.1, NZ_KK737548.1, 696328, 697299, -, 972, 8; cds-WP_022615670.1, NZ_KK737548.1, 697518, 699005, +, 1488, 0; cds-WP_004174225.1, NZ_KK737548.1, 699002, 700036, +, 1035, 22887; cds-WP_032430144.1, NZ_KK737548.1, 700037, 701035, +, 999, 70; cds-WP _032430145.1, NZ_KK737548.1, 701037, 702038, +, 1002, 83; cds-WP_002917724.1, NZ_KK737548.1, 702050, 702937, +, 888, 100; cds-WP _002917723.1, NZ_KK737548.1, 702934, 703230, +, 297, 0; cds-WP_023316052.1, NZ_KK737548.1, 703277, 704656, -, 1380, 1; cds-WP_002917718.1, NZ_KK737548.1, 704914, 705468, -, 555, 0; cds-WP _021440748.1, NZ_KK737548.1, 705706, 706482, +, 777, 27733; cds-WP _004174228.1, NZ_KK737548.1, 706638, 708287, -, 1650, 23; cds-WP_004174229.1, NZ_KK737548.1, 708363, 709784, -, 1422, 4130; cds-WP _004181378.1, NZ_KK737548.1, 709795, 710427, -, 633, 12988; cds-WP_002917682.1, NZ_KK737548.1, 710438, 711508, -, 1071, 8330; cds-WP_020324489.1, NZ_KK737548.1, 711664, 711849, -, 186, 0; cds-WP _002917681.1, NZ_KK737548.1, 712119, 713216, +, 1098, 571; cds-WP _002917680.1, NZ_KK737548.1, 713318, 715243, +, 1926, 136; cds-WP_002917679.1, NZ_KK737548.1, 715221, 715751, -, 531, 0; cds-WP_021440747.1, NZ_KK737548.1, 715752, 716105, -, 354, 0; cds-WP _032430191.1, NZ_KK737548.1, 716126, 717277, -, 1152, 0; cds-WP_013815099.1-55, NZ_KK737548.1, 717293, 718261, +, 969, 3565; cds-WP _015875176.1, NZ_KK737548.1, 718377, 718805, -, 429, 0; cds-WP_002917676.1, NZ_KK737548.1, 719219, 720886, +, 1668, 9; cds-WP_021440746.1, NZ_KK737548.1, 720899, 721483, +, 585, 0; cds-WP _002917670.1, NZ_KK737548.1, 721486, 721911, +, 426, 0; cds-AF52_RS0124235, NZ_KK737548.1, 721924, 723747, +, 1824, 41; cds-WP _015959037.1, NZ_KK737548.1, 723801, 724604, +, 804, 0; cds-WP _002917655.1, NZ_KK737548.1, 724656, 724961, -, 306, 0; cds-WP _002917651.1, NZ_KK737548.1, 724988, 725563, -, 576, 0; cds-WP _004144810.1, NZ_KK737548.1, 725804, 726466, +, 663, 0; cds-AF52_RS07345, NZ_KK737548.1, 726557, 728848, -, 2292, 0; cds-WP_013815099.1-56, NZ_KK737548.1, 728883, 729851, +, 969, 4849; cds-AF52_RS07335, NZ_KK737548.1, 729909, 730865, -, 957, 43; cds-WP_004174237.1, NZ_KK737548.1, 730870, 731484, -, 615, 0; cds-WP_021440741.1, NZ_KK737548.1, 731785, 732150, +, 366, 0; cds-WP _023313669.1, NZ_KK737548.1, 732219, 732491, -, 273, 0; cds-AF52_RS27330, NZ_KK737548.1, 732623, 732801, +, 179, 256; cds-AF52_RS27335, NZ_KK737548.1, 735673, 735777, -, 105, 0; cds-WP _004152286.1, NZ_KK737548.1, 736364, 737446, +, 1083, 2270; cds-WP _032430148.1, NZ_KK737548.1, 737568, 740642, +, 3075, 259161; cds-WP_023158026.1, NZ_KK737548.1, 740694, 741947, +, 1254, 40958; cds-AF52_RS25890, NZ_KK737548.1, 742013, 742153, +, 141, 0; cds-AF52_RS25895, NZ_KK737548.1, 742168, 742863, -, 696, 3; cds-AF52_RS25905, NZ_KK737548.1, 742956, 743322, +, 367, 1; cds-AF52_RS07290, NZ_KK737548.1, 743401, 743690, +, 290, 3; cds-WP _032430151.1, NZ_KK737548.1, 746080, 747084, +, 1005, 341; cds-AF52_RS07280, NZ_KK737548.1, 747266, 747803, -, 538, 10870; cds-AF52_RS25915, NZ_KK737548.1, 748423, 748868, -, 446, 106; cds-WP_004118832.1, NZ_KK737548.1, 749044, 750777, -, 1734, 37470; cds-WP_004118225.1, NZ_KK737548.1, 750785, 751732, -, 948, 42484; cds-WP_004152278.1, NZ_KK737548.1, 751777, 753381, -, 1605, 667; cds-WP_004118227.1, NZ_KK737548.1, 753394, 754314, -, 921, 0; cds-WP_004118228.1, NZ_KK737548.1, 754314, 755162, -, 849, 343; cds-WP_004118229.1, NZ_KK737548.1, 755159, 755752, -, 594, 2; cds-WP_004118840.1, NZ_KK737548.1, 755749, 756876, -, 1128, 266; cds-WP_004118231.1, NZ_KK737548.1, 757161, 757328, -, 168, 0; cds-WP_162551856.1, NZ_KK737548.1, 757257, 757469, +, 213, 0; cds-AF52_RS07235, NZ_KK737548.1, 757470, 757955, +, 486, 0; cds-WP_004197062.1, NZ_KK737548.1, 760634, 761155, +, 522, 1080; cds-WP_004197067.1, NZ_KK737548.1, 761152, 762105, +, 954, 8; cds-WP_032430155.1, NZ_KK737548.1, 762198, 764522, +, 2325, 1058535; cds-WP_023157913.1, NZ_KK737548.1, 764567, 765469, +, 903, 150849; cds-WP _032430156.1, NZ_KK737548.1, 765466, 766464, +, 999, 42033; cds-WP_004118246.1, NZ_KK737548.1, 766461, 767417, +, 957, 11037; cds-WP_004152282.1, NZ_KK737548.1, 767418, 768185, +, 768, 10521; cds-WP_004118251.1, NZ_KK737548.1, 768284, 768577, +, 294, 44; cds-AF52_RS25920, NZ_KK737548.1, 768652, 768879, +, 228, 3; cds-WP _020806188.1-5, NZ_KK737548.1, 769118, 770098, -, 981, 6587; cds-WP _032430158.1, NZ_KK737548.1, 770398, 771066, +, 669, 0; cds-WP_002885079.1, NZ_KK737548.1, 771455, 772804, +, 1350, 51; cds-WP_002885082.1, NZ_KK737548.1, 772952, 774598, +, 1647, 5836; cds-WP_002885085.1, NZ_KK737548.1, 774761, 775642, -, 882, 2; cds-WP_002885086.1, NZ_KK737548.1, 775748, 776155, +, 408, 0; cds-WP _002885088.1, NZ_KK737548.1, 776152, 776841, +, 690, 0; cds-AF52_RS0124245, NZ_KK737548.1, 777352, 777909, +, 558, 3; cds-WP_004210006.1, NZ_KK737548.1, 777970, 778659, +, 690, 9; cds-WP _032428472.1, NZ_KK737548.1, 778613, 781192, +, 2580, 5; cds-WP _004151734.1, NZ_KK737548.1, 781228, 781776, +, 549, 9; cds-WP _002885139.1, NZ_KK737548.1, 781796, 782893, +, 1098, 645; cds-WP_024623073.1, NZ_KK737548.1, 782941, 784593, -, 1653, 11697; cds-WP_004177812.1, NZ_KK737548.1, 784593, 784904, -, 312, 2016; cds-WP_002885145.1, NZ_KK737548.1, 785088, 787046, -, 1959, 366880; cds-WP_004146658.1, NZ_KK737548.1, 787147, 787347, +, 201, 0; cds-WP_004146659.1, NZ_KK737548.1, 787459, 788772, +, 1314, 1769; cds-WP_004151733.1, NZ_KK737548.1, 788809, 789495, -, 687, 21; cds-WP _012737173.1, NZ_KK737548.1, 789725, 791872, -, 2148, 2; cds-WP _023159071.1, NZ_KK737548.1, 792145, 792873, +, 729, 7539; cds-WP _004177809.1, NZ_KK737548.1, 792959, 793717, +, 759, 22; cds-WP _002885155.1, NZ_KK737548.1, 793723, 794640, +, 918, 1124; cds-AF52_RS0124265, NZ_KK737548.1, 794765, 795772, -, 1008, 71; cds-WP _002885156.1, NZ_KK737548.1, 795847, 796788, -, 942, 6; cds-WP_002885172.1, NZ_KK737548.1, 796819, 797817, -, 999, 0; cds-WP_002885173.1, NZ_KK737548.1, 797814, 799334, -, 1521, 0; cds-WP_021441042.1, NZ_KK737548.1, 799514, 801799, +, 2286, 4; cds-WP_032430167.1, NZ_KK737548.1, 801870, 802223, +, 354, 0; cds-WP _004210023.1, NZ_KK737548.1, 802245, 803003, -, 759, 2; cds-WP _004151727.1, NZ_KK737548.1, 803019, 803582, -, 564, 0; cds-WP _009484481.1, NZ_KK737548.1, 803582, 804718, -, 1137, 180; cds-WP_002885196.1, NZ_KK737548.1, 804715, 805395, -, 681, 0; cds-WP _004177787.1, NZ_KK737548.1, 805503, 806261, -, 759, 0; cds-WP_002885202.1, NZ_KK737548.1, 806258, 807106, -, 849, 0; cds-WP_021441044.1, NZ_KK737548.1, 807099, 808163, -, 1065, 0; cds-WP_002885207.1, NZ_KK737548.1, 808164, 808748, -, 585, 0; cds-WP _020802927.1, NZ_KK737548.1, 808745, 809197, -, 453, 0; cds-WP _032428478.1, NZ_KK737548.1, 809198, 809923, -, 726, 0; cds-WP_004177784.1, NZ_KK737548.1, 810079, 810513, -, 435, 93; cds-WP _004177783.1, NZ_KK737548.1, 810742, 811077, -, 336, 1037; cds-WP_002885227.1, NZ_KK737548.1, 811622, 813124, +, 1503, 129074; cds-WP_004177781.1, NZ_KK737548.1, 813174, 814112, -, 939, 2877; cds-WP _032430168.1, NZ_KK737548.1, 814352, 815704, +, 1353, 6; cds-WP _019724884.1, NZ_KK737548.1, 815798, 817213, +, 1416, 159; cds-WP _004146677.1, NZ_KK737548.1, 817219, 817341, +, 123, 2650; cds-WP_004177778.1, NZ_KK737548.1, 817489, 818445, +, 957, 44512; cds-WP _004177777.1, NZ_KK737548.1, 818455, 818826, +, 372, 1; cds-WP _002885324.1, NZ_KK737548.1, 819518, 819823, -, 306, 0; cds-WP _021441050.1, NZ_KK737548.1, 819823, 820740, -, 918, 38; cds-WP_020316611.1, NZ_KK737548.1, 820816, 820929, +, 114, 0; cds-WP _004221988.1, NZ_KK737548.1, 820886, 821569, -, 684, 0; cds-WP_002885391.1, NZ_KK737548.1, 821795, 822580, +, 786, 29; cds-WP _004177775.1, NZ_KK737548.1, 822626, 823075, -, 450, 1; cds-WP _002885393.1, NZ_KK737548.1, 823075, 824403, -, 1329, 1; cds-WP_032430193.1, NZ_KK737548.1, 824396, 826411, -, 2016, 8; cds-WP_072271759.1, NZ_KK737548.1, 826420, 828867, -, 2448, 0; cds-AF52_RS06930, NZ_KK737548.1, 829500, 829859, +, 360, 0; cds-WP _032430171.1, NZ_KK737548.1, 829892, 830562, +, 671, 9245; cds-AF52_RS27350, NZ_KK737548.1, 830663, 830977, +, 315, 6603; cds-AF52_RS0124285, NZ_KK737548.1, 831034, 831249, +, 216, 15; cds-WP_004146686.1, NZ_KK737548.1, 831244, 831366, -, 123, 0; cds-WP_004153693.1, NZ_KK737548.1, 831561, 831851, +, 291, 2; cds-WP _021441054.1, NZ_KK737548.1, 832920, 835007, -, 2088, 216; cds-WP_002885410.1, NZ_KK737548.1, 835075, 835665, -, 591, 36140; cds-WP _032430173.1, NZ_KK737548.1, 835686, 837482, -, 1797, 46; cds-WP_002885422.1, NZ_KK737548.1, 837458, 837781, -, 324, 58; cds-WP _002885423.1, NZ_KK737548.1, 837906, 839207, -, 1302, 4117; cds-WP_002885424.1, NZ_KK737548.1,


839323, 840759, -, 1437, 373380; cds-WP _002885425.1, NZ_KK737548.1, 841097, 841573, +, 477, 17; cds-WP _009485424.1, NZ_KK737548.1, 841625, 842875, -, 1251, 1; cds-WP_004152420.1, NZ_KK737548.1, 843108, 843401, +, 294, 74304; cds-WP _002885441.1, NZ_KK737548.1, 843439, 845085, +, 1647, 1027168; cds-AF52_RS27360, NZ_KK737548.1, 846097, 846318, -, 222, 0; cds-WP_013815099.1-57, NZ_KK737548.1, 846353, 847321, +, 969, 2482; cds-AF52_RS25950, NZ_KK737548.1, 847378, 848127, -, 750, 0; cds-WP_004186605.1, NZ_KK737548.1, 848177, 848857, -, 681, 0; cds-WP _004186607.1, NZ_KK737548.1, 848908, 849450, -, 543, 0; cds-WP _004222578.1, NZ_KK737549.1, 190, 258, +, 69, 1; cds-WP _002887848.1, NZ_KK737549.1, 340, 2802, +, 2463, 27500; cds-WP_002887853.1, NZ_KK737549.1, 2804, 3733, +, 930, 27; cds-WP _002887863.1, NZ_KK737549.1, 3737, 5017, +, 1281, 10344; cds-WP _004222583.1, NZ_KK737549.1, 5332, 5709, +, 378, 3; cds-WP _004178561.1, NZ_KK737549.1, 5778, 6551, -, 774, 11494; cds-WP_002887871.1, NZ_KK737549.1, 6629, 8059, -, 1431, 9105; cds-WP_002887897.1, NZ_KK737549.1, 8262, 9215, +, 954, 221510; cds-WP _002887898.1, NZ_KK737549.1, 9315, 9902, +, 588, 404; cds-WP_021441173.1, NZ_KK737549.1, 10022, 11326, +, 1305, 2411; cds-WP_004177461.1, NZ_KK737549.1, 11389, 11955, -, 567, 4285; cds-WP _021441175.1, NZ_KK737549.1, 12044, 12793, -, 750, 0; cds-WP_002887909.1, NZ_KK737549.1, 12821, 13225, -, 405, 0; cds-WP_004146997.1, NZ_KK737549.1, 13611, 15527, +, 1917, 133683; cds-WP_002887955.1, NZ_KK737549.1, 15615, 16748, +, 1134, 7041; cds-WP _004192071.1, NZ_KK737549.1, 16926, 18101, +, 1176, 44; cds-WP_002887961.1, NZ_KK737549.1, 18156, 19052, +, 897, 249; cds-WP_002887965.1, NZ_KK737549.1, 19172, 19435, -, 264, 30932; cds-WP _002887969.1, NZ_KK737549.1, 19765, 20703, +, 939, 183083; cds-WP_032430302.1, NZ_KK737549.1, 20747, 23563, +, 2817, 229571; cds-WP _002887973.1, NZ_KK737549.1, 23563, 24063, +, 501, 23780; cds-WP_002887976.1, NZ_KK737549.1, 24179, 24628, +, 450, 50470; cds-WP_002887979.1, NZ_KK737549.1, 24630, 25580, +, 951, 37163; cds-WP_032430200.1, NZ_KK737549.1, 25647, 26561, +, 915, 3437; cds-WP_032428524.1, NZ_KK737549.1, 26592, 26957, +, 366, 53; cds-WP _021441178.1, NZ_KK737549.1, 26905, 27834, -, 930, 54; cds-WP_004192057.1, NZ_KK737549.1, 27927, 28556, +, 630, 4116; cds-WP _004222618.1, NZ_KK737549.1, 28562, 29266, -, 705, 30265; cds-WP _004151379.1, NZ_KK737549.1, 29259, 30887, -, 1629, 2075; cds-WP_032430201.1, NZ_KK737549.1, 31059, 32360, -, 1302, 0; cds-WP _021441180.1, NZ_KK737549.1, 32376, 34154, -, 1779, 0; cds-WP _012540458.1, NZ_KK737549.1, 34170, 34421, -, 252, 0; cds-WP_004151375.1, NZ_KK737549.1, 34577, 35917, -, 1341, 2; cds-WP _004222626.1, NZ_KK737549.1, 36174, 37202, +, 1029, 0; cds-WP _004151373.1, NZ_KK737549.1, 37233, 37526, +, 294, 0; cds-WP _004151372.1, NZ_KK737549.1, 37523, 38392, +, 870, 0; cds-WP_032428528.1, NZ_KK737549.1, 38403, 39929, +, 1527, 236; cds-WP_004222628.1, NZ_KK737549.1, 39948, 40856, +, 909, 0; cds-WP _021441183.1, NZ_KK737549.1, 41085, 41906, +, 822, 12843; cds-WP_004212571.1, NZ_KK737549.1, 42364, 43512, +, 1149, 163662; cds-WP _002888056.1, NZ_KK737549.1, 43530, 46754, +, 3225, 888223; cds-WP _002888059.1, NZ_KK737549.1, 46924, 47157, +, 234, 0; cds-WP_002888068.1, NZ_KK737549.1, 47289, 47822, +, 534, 53984; cds-WP_004145992.1, NZ_KK737549.1, 47815, 49680, +, 1866, 5627; cds-WP_002888320.1, NZ_KK737549.1, 49854, 50333, +, 480, 570; cds-WP_002888321.1, NZ_KK737549.1, 50586, 51434, -, 849, 519; cds-WP _002888323.1, NZ_KK737549.1, 51439, 51816, -, 378, 37828; cds-WP_002888324.1, NZ_KK737549.1, 51819, 52640, -, 822, 100528; cds-WP_032430205.1, NZ_KK737549.1, 52637, 53626, -, 990, 31067; cds-WP_002888329.1, NZ_KK737549.1, 53632, 54918, -, 1287, 80546; cds-WP_032103829.1, NZ_KK737549.1, 54973, 57321, -, 2349, 32646; cds-WP_002888332.1, NZ_KK737549.1, 57565, 58392, +, 828, 1392; cds-WP_002888337.1, NZ_KK737549.1, 58425, 59123, -, 699, 1201; cds-WP_004192048.1, NZ_KK737549.1, 59113, 60738, -, 1626, 53355; cds-WP _002888345.1, NZ_KK737549.1, 61063, 62427, +, 1365, 114; cds-WP_021441189.1, NZ_KK737549.1, 62607, 63146, +, 540, 39; cds-WP_002888348.1, NZ_KK737549.1, 63209, 63868, -, 660, 0; cds-WP_032428530.1, NZ_KK737549.1, 63881, 66787, -, 2907, 61095; cds-WP _021441191.1, NZ_KK737549.1, 66975, 69332, -, 2358, 401; cds-WP _002888353.1, NZ_KK737549.1, 69499, 70194, -, 696, 0; cds-WP_021441192.1, NZ_KK737549.1, 70332, 71834, -, 1503, 81; cds-WP_023279864.1, NZ_KK737549.1, 71845, 73554, -, 1710, 0; cds-WP _004145972.1, NZ_KK737549.1, 73892, 74737, +, 846, 14290; cds-WP_002888373.1, NZ_KK737549.1, 74866, 75633, +, 768, 7957; cds-WP_032430207.1, NZ_KK737549.1, 75620, 76321, -, 702, 2; cds-WP_002888430.1, NZ_KK737549.1, 76305, 77915, -, 1611, 10814; cds-WP_032428532.1, NZ_KK737549.1, 77891, 78874, -, 984, 39879; cds-AF52_RS0124360, NZ_KK737549.1, 79164, 80819, -, 1656, 781; cds-WP_002888448.1, NZ_KK737549.1, 80907, 81059, +, 153, 1298; cds-WP_004147046.1, NZ_KK737549.1, 81327, 82511, +, 1185, 8898; cds-WP_004147047.1, NZ_KK737549.1, 82545, 83855, -, 1311, 91; cds-WP _013815099.1-58, NZ_KK737549.1, 84110, 85078, +, 969, 4306; cds-WP _002888455.1, NZ_KK737549.1, 85153, 86049, +, 897, 0; cds-WP_004177420.1, NZ_KK737549.1, 86087, 86842, -, 756, 67; cds-WP_032428534.1, NZ_KK737549.1, 86873, 88087, -, 1215, 11; cds-WP_002888460.1, NZ_KK737549.1, 88098, 88961, -, 864, 0; cds-WP_004147052.1, NZ_KK737549.1, 88973, 91006, -, 2034, 12; cds-WP _002888481.1, NZ_KK737549.1, 91402, 92007, -, 606, 8; cds-WP_021441196.1, NZ_KK737549.1, 92018, 93418, -, 1401, 0; cds-WP_002888487.1, NZ_KK737549.1, 93421, 94512, -, 1092, 263; cds-WP _023287248.1, NZ_KK737549.1, 94512, 96083, -, 1572, 4; cds-WP _004222662.1, NZ_KK737549.1, 96179, 96265, -, 87, 0; cds-WP_148673689.1, NZ_KK737549.1, 96879, 97847, +, 969, 0; cds-WP_002888534.1, NZ_KK737549.1, 98242, 99966, +, 1725, 4109; cds-WP _002888536.1, NZ_KK737549.1, 99969, 100460, +, 492, 117; cds-WP_004145952.1, NZ_KK737549.1, 100641, 101645, +, 1005, 76000; cds-WP _002888541.1, NZ_KK737549.1, 102286, 102744, +, 459, 675; cds-WP_002888547.1, NZ_KK737549.1, 102747, 103688, +, 942, 15637; cds-WP_002888550.1, NZ_KK737549.1, 103685, 104050, +, 366, 12599; cds-WP_032430210.1, NZ_KK737549.1, 104066, 105832, +, 1767, 25195; cds-WP_004182923.1, NZ_KK737549.1, 105819, 107306, +, 1488, 23222; cds-WP_004177411.1, NZ_KK737549.1, 107303, 108661, +, 1359, 14166; cds-WP_002888562.1, NZ_KK737549.1, 108655, 109737, +, 1083, 25753; cds-WP _004151364.1, NZ_KK737549.1, 109740, 111056, +, 1317, 547; cds-WP _002888565.1, NZ_KK737549.1, 111056, 112330, +, 1275, 1784; cds-WP_002888566.1, NZ_KK737549.1, 112327, 113397, +, 1071, 16058; cds-WP _004145947.1, NZ_KK737549.1, 113445, 114920, +, 1476, 50440; cds-WP _002888623.1, NZ _KK737549.1, 114913, 115833, +, 921, 10736; cds-WP _002888624.1, NZ_KK737549.1, 115835, 116665, +, 831, 20887; cds-WP_002888625.1, NZ _KK737549.1, 116662, 117924, +, 1263, 753; cds-WP_002888628.1, NZ_KK737549.1, 117987, 119138, +, 1152, 53387; cds-WP_032430211.1, NZ_KK737549.1, 119239, 120156, +, 918, 253697; cds-WP_004152922.1, NZ_KK737549.1, 120473, 120976, +, 504, 19241; cds-WP_002888638.1, NZ_KK737549.1, 121039, 123744, +, 2706, 370239; cds-WP _004145942.1, NZ_KK737549.1, 123803, 124195, +, 393, 3515; cds-WP_002888644.1, NZ_KK737549.1, 124248, 124442, -, 195, 2111; cds-WP _004178596.1, NZ_KK737549.1, 124452, 125195, -, 744, 19502; cds-WP_002888649.1, NZ_KK737549.1, 125195, 125815, -, 621, 39339; cds-WP _004145938.1, NZ_KK737549.1, 126159, 127202, +, 1044, 10966; cds-WP_021441203.1, NZ_KK737549.1, 127239, 128444, -, 1206, 0; cds-WP _004145935.1, NZ_KK737549.1, 128434, 129819, -, 1386, 0; cds-WP _002888683.1, NZ_KK737549.1, 129830, 130261, -, 432, 0; cds-WP _002888684.1, NZ_KK737549.1, 130443, 131336, -, 894, 30; cds-WP_002888692.1, NZ_KK737549.1, 131470, 132033, +, 564, 106; cds-WP_002888694.1, NZ_KK737549.1, 132030, 132884, +, 855, 1498; cds-WP_021441204.1, NZ_KK737549.1, 133120, 134070, -, 951, 51; cds-WP _032428537.1, NZ_KK737549.1, 134070, 135476, -, 1407, 115; cds-WP_004147090.1, NZ_KK737549.1, 135661, 137031, -, 1371, 26; cds-WP _002888699.1, NZ_KK737549.1, 137675, 138454, +, 780, 336; cds-WP_032430213.1, NZ_KK737549.1, 138591, 141254, +, 2664, 828611; cds-WP _021441205.1, NZ_KK737549.1, 141269, 143167, +, 1899, 122054; cds-WP _002888731.1, NZ_KK737549.1, 143374, 144798, +, 1425, 765442; cds-WP_004177403.1, NZ_KK737549.1, 144963, 145247, +, 285, 19; cds-WP _002888733.1, NZ_KK737549.1, 145293, 146099, -, 807, 0; cds-WP _032430214.1, NZ_KK737549.1, 146111, 147721, -, 1611, 18; cds-WP _002888735.1, NZ_KK737549.1, 148153, 150750, +, 2598, 2880974; cds-WP _002888737.1, NZ_KK737549.1, 150937, 151299, +, 363, 1662; cds-WP_002888739.1, NZ_KK737549.1, 151372, 152166, -, 795, 491; cds-WP _002888741.1, NZ_KK737549.1, 152191, 153051, -, 861, 24090; cds-WP_072072754.1, NZ_KK737549.1, 153201, 154394, -, 1194, 6; cds-AF52_RS28060, NZ_KK737549.1, 154404, 154643, -, 240, 0; cds-WP _002888804.1, NZ_KK737549.1, 155225, 155635, -, 411, 0; cds-WP_002888808.1, NZ_KK737549.1, 155882, 156229, -, 348, 31; cds-WP _032430215.1, NZ_KK737549.1, 156375, 157973, +, 1599, 11372; cds-WP _002888816.1, NZ_KK737549.1, 158057, 160447, -, 2391, 27582; cds-WP _012542835.1, NZ_KK737549.1, 160528, 160647, +, 120, 0; cds-WP _002888819.1, NZ _KK737549.1, 160652, 161188, +, 537, 2461; cds-WP_002888821.1, NZ_KK737549.1, 161248, 161910, -, 663, 7361; cds-WP _002888823.1, NZ_KK737549.1, 162095, 163021, +, 927, 475; cds-WP _004204389.1, NZ_KK737549.1, 163018, 163788, +, 771, 353; cds-WP_023282187.1, NZ_KK737549.1, 163911, 164351, +, 441, 12; cds-WP _004145907.1, NZ _KK737549.1, 164410, 165663, +, 1254, 12146; cds-WP_002888834.1, NZ_KK737549.1, 165699, 166079, -, 381, 1723; cds-WP_002888835.1, NZ_KK737549.1, 166172, 167026, -, 855, 10982; cds-WP_002888841.1, NZ_KK737549.1, 167038, 167829, -, 792, 5032; cds-WP_004145905.1, NZ_KK737549.1, 167950, 168429, -, 480, 1550; cds-WP _071526609.1, NZ _KK737549.1, 168426, 169820, -, 1395, 16236; cds-WP _021441212.1, NZ_KK737549.1, 169883, 170764, -, 882, 39309; cds-WP _002888845.1, NZ_KK737549.1, 170824, 171279, -, 456, 64328; cds-WP _032430216.1, NZ_KK737549.1, 171442, 172158, -, 717, 414; cds-WP_004145901.1, NZ_KK737549.1, 172158, 172694, -, 537, 2; cds-WP _023282188.1, NZ_KK737549.1, 172767, 175196, +, 2430, 93160; cds-WP _021441214.1, NZ_KK737549.1, 175244, 176044, -, 801, 81; cds-WP _021441215.1, NZ_KK737549.1, 176041, 176787, -, 747, 0; cds-WP_004151943.1, NZ_KK737549.1, 176777, 177262, -, 486, 0; cds-WP _021441216.1, NZ_KK737549.1, 177255, 178448, -, 1194, 0; cds-WP _004183041.1, NZ _KK737549.1, 178435, 179421, -, 987, 37; cds-WP_032428541.1, NZ_KK737549.1, 179418, 180014, -, 597, 0; cds-WP _002889025.1, NZ_KK737549.1, 180011, 180376, -, 366, 0; cds-WP_021441218.1, NZ_KK737549.1, 180379, 180888, -, 510, 0; cds-WP _002889054.1, NZ_KK737549.1, 180888, 181310, -, 423, 131; cds-WP _004177382.1, NZ_KK737549.1, 181331, 182545, -, 1215, 6; cds-WP_004145888.1, NZ_KK737549.1, 182547, 184040, -, 1494, 4493; cds-WP _032430217.1, NZ_KK737549.1, 184037, 186010, -, 1974, 72; cds-WP_004177377.1, NZ_KK737549.1, 186020, 186862, -, 843, 3250; cds-WP _004219434.1, NZ_KK737549.1, 186847, 186984, -, 138, 2; cds-WP _023286046.1, NZ_KK737549.1, 187169, 190477, +, 3309, 1465; cds-WP_021441221.1, NZ_KK737549.1, 190734, 191291, +, 558, 0; cds-WP _004194926.1, NZ_KK737549.1, 191330, 191704, -, 375, 107; cds-WP_004147125.1, NZ_KK737549.1, 191767, 191901, -, 135, 0; cds-WP _002889208.1, NZ_KK737549.1, 192292, 194844, +, 2553, 1083; cds-WP _004178624.1, NZ_KK737549.1, 195079, 197286, +, 2208, 9555; cds-WP _002889212.1, NZ_KK737549.1, 197332, 198129, +, 798, 14123; cds-WP _004178627.1, NZ_KK737549.1, 198129, 199019, +, 891, 28095; cds-WP_032430218.1, NZ_KK737549.1, 199016, 200998, +, 1983, 328; cds-WP_002889272.1, NZ_KK737549.1, 201135, 202415, -, 1281, 42656; cds-WP _004151932.1, NZ_KK737549.1, 202596, 204014, +, 1419, 7; cds-WP_002889275.1, NZ_KK737549.1, 204096, 204440, +, 345, 39; cds-WP _002889277.1, NZ_KK737549.1, 204512, 205135, -, 624, 1529; cds-WP _002889279.1, NZ_KK737549.1, 205172, 205972, -, 801, 42804; cds-WP_002889282.1, NZ_KK737549.1, 205965, 206663, -, 699, 77574; cds-WP _004145871.1, NZ_KK737549.1, 206747, 208261, +, 1515, 18; cds-WP_004177363.1, NZ_KK737549.1, 208396, 209829, +, 1434, 34282; cds-WP _002889289.1, NZ_KK737549.1, 209996, 211153, +, 1158, 949; cds-WP _002889292.1, NZ_KK737549.1, 211272, 211658, -, 387, 21241; cds-WP _002889295.1, NZ_KK737549.1, 211766, 212590, -, 825, 118747; cds-


WP_004151931.1, NZ_KK737549.1, 212621, 215284, -, 2664, 40940; cds-WP_004177362.1, NZ_KK737549.1, 215342, 216136, -, 795, 7911; cds-WP_002889299.1, NZ_KK737549.1, 216459, 217184, +, 726, 1233533; cds-WP _004151930.1, NZ_KK737549.1, 217304, 218155, +, 852, 226348; cds-WP_002889306.1, NZ_KK737549.1, 218305, 219030, +, 726, 164210; cds-WP _002889308.1, NZ_KK737549.1, 219181, 219738, +, 558, 126140; cds-WP_004178642.1, NZ_KK737549.1, 219967, 221169, +, 1203, 1492; cds-WP _002889316.1, NZ_KK737549.1, 221407, 222165, +, 759, 36898; cds-WP _032430220.1, NZ_KK737549.1, 222178, 223035, +, 858, 4342; cds-WP _004177358.1, NZ_KK737549.1, 223047, 224399, +, 1353, 42857; cds-WP _004145860.1, NZ_KK737549.1, 224431, 226860, +, 2430, 441178; cds-WP_004178645.1, NZ_KK737549.1, 226982, 227467, +, 486, 339712; cds-WP_002889327.1, NZ_KK737549.1, 227471, 228496, +, 1026, 43278; cds-WP _004145858.1, NZ_KK737549.1, 228602, 229057, +, 456, 54552; cds-WP _004178647.1, NZ_KK737549.1, 229061, 229849, +, 789, 23440; cds-WP _002889374.1, NZ_KK737549.1, 229849, 231000, +, 1152, 2174; cds-WP_021441229.1, NZ_KK737549.1, 230997, 231596, +, 600, 18490; cds-WP_004177353.1, NZ_KK737549.1, 231614, 235096, +, 3483, 17802; cds-WP _004145855.1, NZ_KK737549.1, 235109, 236068, +, 960, 46011; cds-WP_021441230.1, NZ_KK737549.1, 236182, 238335, +, 2154, 1507; cds-WP_021441231.1, NZ_KK737549.1, 238382, 238771, +, 390, 1715; cds-WP 009309280.1, NZ_KK737549.1, 238825, 240138, +, 1314, 1268; cds-WP _002889424.1, NZ_KK737549.1, 240152, 240412, -, 261, 362; cds-WP _002889429.1, NZ_KK737549.1, 240399, 240599, -, 201, 115; cds-WP_009309281.1, NZ_KK737549.1, 240796, 241341, +, 546, 724; cds-WP _002889433.1, NZ_KK737549.1, 241338, 241751, +, 414, 1093; cds-WP_002889435.1, NZ_KK737549.1, 241794, 242492, +, 699, 937; cds-WP _004212714.1, NZ_KK737549.1, 242624, 243466, -, 843, 142; cds-WP _004151928.1, NZ_KK737549.1, 243525, 245243, -, 1719, 98057; cds-WP_032430223.1, NZ_KK737549.1, 245356, 246063, -, 708, 5762; cds-WP_002889443.1, NZ_KK737549.1, 246060, 246467, -, 408, 21380; cds-WP_002889445.1, NZ_KK737549.1, 246575, 247390, -, 816, 1546; cds-WP_002889448.1, NZ_KK737549.1, 247434, 248087, -, 654, 44; cds-WP _002889450.1, NZ_KK737549.1, 248080, 249111, -, 1032, 19; cds-WP_002889452.1, NZ_KK737549.1, 249300, 249866, +, 567, 43; cds-WP _012737430.1, NZ_KK737549.1, 256451, 257254, +, 804, 8; cds-WP_002889616.1, NZ_KK737549.1, 257300, 258205, -, 906, 2; cds-WP_021441232.1, NZ_KK737549.1, 258310, 259494, +, 1185, 6754; cds-WP_002889629.1, NZ_KK737549.1, 259597, 260394, +, 798, 338; cds-WP_021441233.1, NZ_KK737549.1, 260486, 261256, +, 771, 0; cds-WP_002889632.1, NZ_KK737549.1, 261314, 262681, -, 1368, 2567; cds-WP _032428550.1, NZ_KK737549.1, 262753, 263508, -, 756, 16; cds-WP _002889685.1, NZ_KK737549.1, 263541, 264263, +, 723, 1708; cds-WP_002889686.1, NZ_KK737549.1, 264260, 264727, -, 468, 1009; cds-WP_023286054.1, NZ_KK737549.1, 264783, 265523, +, 741, 54; cds-WP_032430225.1, NZ_KK737549.1, 265793, 266674, -, 882,3; cds-WP_004178672.1, NZ_KK737549.1, 266778, 267368, +, 591, 1; cds-WP_002889689.1, NZ_KK737549.1, 267399, 268169, -, 771, 715; cds-WP_021441237.1, NZ_KK737549.1, 268347, 270791, -, 2445, 195997; cds-WP_004145825.1, NZ_KK737549.1, 271031, 271612, +, 582, 73197; cds-WP_002889696.1, NZ_KK737549.1, 271687, 272454, +, 768, 1436; cds-WP _002889699.1, NZ_KK737549.1, 272425, 273165, -, 741, 93659; cds-WP _002889702.1, NZ_KK737549.1, 273577, 274920, +, 1344, 22540; cds-WP _002889703.1, NZ_KK737549.1, 274924, 276162, +, 1239, 26752; cds-WP_004177336.1, NZ_KK737549.1, 276155, 276949, +, 795, 9565; cds-WP_002889716.1, NZ_KK737549.1, 276942, 277580, +, 639, 28021; cds-WP _004177335.1, NZ_KK737549.1, 277587, 278183, +, 597, 6992; cds-WP _021441239.1, NZ_KK737549.1, 278196, 279419, +, 1224, 29093; cds-WP_004178678.1, NZ_KK737549.1, 279422, 279637, +, 216, 20; cds-WP _021441240.1, NZ_KK737549.1, 280018, 280878, -, 861, 13; cds-WP_002889726.1, NZ_KK737549.1, 281038, 282093, +, 1056, 327; cds-WP _002889727.1, NZ_KK737549.1, 282096, 282548, +, 453, 0; cds-WP_004152033.1, NZ_KK737549.1, 282591, 284048, -, 1458, 31423; cds-WP _002889733.1, NZ_KK737549.1, 284306, 284764, +, 459, 5367; cds-WP _002889742.1, NZ_KK737549.1, 284870, 286114, +, 1245, 1297; cds-WP _004177332.1, NZ_KK737549.1, 286172, 286570, +, 399, 8569; cds-WP _004177331.1, NZ_KK737549.1, 286656, 287348, -, 693, 9; cds-WP _032430227.1, NZ_KK737549.1, 287394, 288794, -, 1401, 1; cds-WP_032430228.1, NZ_KK737549.1, 288944, 290227, -, 1284, 1; cds-WP_032430229.1, NZ_KK737549.1, 290240, 291688, -, 1449, 3; cds-WP_002889846.1, NZ_KK737549.1, 291713, 292981, -, 1269, 30; cds-WP_002889847.1, NZ_KK737549.1, 293009, 293986, -, 978, 27; cds-WP_032430230.1, NZ_KK737549.1, 294448, 294705, +, 258, 29; cds-WP_032430232.1, NZ_KK737549.1, 294763, 295512, +, 750, 143; cds-WP_032421047.1, NZ_KK737549.1, 295784, 296248, +, 465, 1639; cds-WP _009309773.1, NZ_KK737549.1, 296439, 297173, -, 735, 0; cds-WP _021441244.1, NZ_KK737549.1, 297139, 298473, -, 1335, 0; cds-WP _032430234.1, NZ_KK737549.1, 298478, 301033, -, 2556, 16; cds-WP_009309770.1, NZ_KK737549.1, 301017, 301775, -, 759, 0; cds-AF52_RS05525, NZ_KK737549.1, 301835, 302236, -, 402, 0; cds-AF52_RS27385, NZ_KK737549.1, 302271, 302442, +, 172, 324; cds-AF52_RS27390, NZ_KK737549.1, 303421, 303558, +, 138, 1896; cds-WP_050484291.1, NZ_KK737549.1, 303624, 304661, +, 1038, 1658; cds-WP _004222859.1, NZ_KK737549.1, 304706, 305272, -, 567, 416; cds-WP_023279253.1, NZ_KK737549.1, 305685, 306554, +, 870, 0; cds-WP_021441254.1, NZ_KK737549.1, 306650, 307315, +, 666, 0; cds-WP_124053765.1, NZ_KK737549.1, 307782, 307952, -, 171, 0; cds-WP _016531458.1, NZ_KK737549.1, 308463, 309347, -, 885, 0; cds-WP_002890001.1, NZ_KK737549.1, 309344, 310216, -, 873, 0; cds-WP _002890002.1, NZ_KK737549.1, 310283, 311221, -, 939, 0; cds-WP_004177295.1, NZ_KK737549.1, 311244, 312086, -, 843, 1; cds-WP _013815099.1-59, NZ_KK737549.1, 312505, 313473, -, 969, 6075; cds-WP _013815099.1-60, NZ_KK737549.1, 313954, 314922, +, 969, 4799; cds-AF52_RS27405, NZ_KK737549.1, 314979, 315062, -, 84, 17; cds-WP _004144574.1, NZ_KK737549.1, 315352, 316455, +, 1104, 28555; cds-WP _004147253.1, NZ_KK737549.1, 316466, 317719, +, 1254, 18911; cds-AF52_RS27410, NZ_KK737549.1, 318130, 318266, -, 137, 699; cds-AF52_RS27415, NZ_KK737549.1, 319963, 320115, -, 153, 207; cds-AF52_RS05440, NZ_KK737549.1, 320150, 320659, +, 510, 0; cds-WP _032430236.1, NZ_KK737549.1, 320718, 321386, +, 669, 69; cds-WP_032430238.1, NZ_KK737549.1, 321412, 323937, +, 2526, 0; cds-WP_002890060.1, NZ_KK737549.1, 323927, 325570, +, 1644, 0; cds-WP 002890061.1, NZ_KK737549.1, 325539, 326249, +, 711, 0; cds-WP_004178714.1, NZ_KK737549.1, 326253, 326942, -, 690, 0; cds-WP_032430239.1, NZ_KK737549.1, 326932, 327684, -, 753, 0; cds-WP _004151355.1, NZ_KK737549.1, 327681, 328499, -, 819, 0; cds-WP _002890106.1, NZ_KK737549.1, 328501, 329310, -, 810, 0; cds-WP_013815099.1-61, NZ_KK737549.1, 329684, 330652, +, 969, 29151; cds-WP _002890108.1, NZ_KK737549.1, 330723, 330893, +, 171, 37579; cds-WP _002890126.1, NZ_KK737549.1, 331010, 331705, -, 696, 0; cds-WP_004151354.1, NZ_KK737549.1, 331698, 332480, -, 783, 0; cds-WP_004144594.1, NZ_KK737549.1, 332467, 333516, -, 1050, 1186; cds-WP_025861891.1, NZ_KK737549.1, 333516, 334415, -, 900, 0; cds-WP _004147267.1, NZ_KK737549.1, 334435, 335541, -, 1107, 0; cds-WP _009485305.1, NZ_KK737549.1, 335534, 335677, +, 144, 0; cds-WP_004147268.1, NZ_KK737549.1, 336117, 336893, -, 777, 0; cds-WP_032430241.1, NZ_KK737549.1, 336890, 338278, -, 1389, 0; cds-WP_032430243.1, NZ_KK737549.1, 338288, 339667, -, 1380, 0; cds-WP_021441263.1, NZ_KK737549.1, 339730, 339858, +, 129, 0; cds-WP_002890161.1, NZ_KK737549.1, 339941, 341350, +, 1410, 6; cds-WP_032430245.1, NZ_KK737549.1, 341337, 342269, +, 933, 66; cds-WP _032430246.1, NZ_KK737549.1, 342509, 343471, +, 963, 0; cds-WP_004183141.1, NZ_KK737549.1, 343483, 344250, +, 768, 0; cds-WP_004144603.1, NZ_KK737549.1, 344247, 345074, +, 828, 0; cds-WP_004147277.1, NZ_KK737549.1, 345071, 345922, +, 852, 0; cds-WP _032430247.1, NZ_KK737549.1, 346096, 347814, -, 1719, 3; cds-WP _002890201.1, NZ_KK737549.1, 348267, 349241, -, 975, 11124; cds-WP_004151350.1, NZ_KK737549.1, 349348, 350508, -, 1161, 194; cds-WP _004151349.1, NZ_KK737549.1, 350727, 351239, +, 513, 49831; cds-WP _002890204.1, NZ_KK737549.1, 351357, 352577, +, 1221, 473; cds-WP_004183146.1, NZ_KK737549.1, 352596, 353702, +, 1107, 19; cds-WP_002890210.1, NZ_KK737549.1, 353699, 354001, -, 303, 5; cds-WP_002890215.1, NZ_KK737549.1, 354254, 354457, +, 204, 360; cds-WP_004151348.1, NZ_KK737549.1, 354490, 355587, -, 1098, 53634; cds-WP_004212277.1, NZ_KK737549.1, 355687, 356370, +, 684, 0; cds-WP_002890219.1, NZ_KK737549.1, 356540, 357739, +, 1200, 0; cds-WP _002890221.1, NZ_KK737549.1, 358039, 358299, +, 261, 0; cds-WP_004232385.1, NZ_KK737549.1, 358389, 359819, +, 1431, 3256; cds-WP _002890225.1, NZ_KK737549.1, 359911, 360228, +, 318, 1; cds-WP_004177276.1, NZ_KK737549.1, 360296, 361105, -, 810, 4565; cds-WP _002890230.1, NZ_KK737549.1, 361222, 361680, +, 459, 0; cds-WP _032430252.1, NZ_KK737549.1, 361677, 362387, -, 711, 312; cds-WP_002890276.1, NZ_KK737549.1, 362716, 363249, +, 534, 322; cds-WP _002890278.1, NZ_KK737549.1, 363321, 363512, +, 192, 27; cds-WP_004144619.1, NZ_KK737549.1, 363763, 364443, +, 681, 2; cds-WP _002890284.1, NZ_KK737549.1, 364521, 364805, +, 285, 4661; cds-WP_002890285.1, NZ_KK737549.1, 364877, 365788, -, 912, 11923; cds-WP_032430253.1, NZ_KK737549.1, 365880, 366794, +, 915, 16; cds-WP _032430254.1, NZ_KK737549.1, 366868, 370005, -, 3138, 977; cds-WP _032430256.1, NZ_KK737549.1, 370002, 371207, -, 1206, 28; cds-WP_002890343.1, NZ_KK737549.1, 371390, 372079, +, 690, 12; cds-WP_002890344.1, NZ_KK737549.1, 372101, 373396, +, 1296, 5361; cds-WP_032430258.1, NZ_KK737549.1, 373810, 375129, +, 1320, 32171; cds-WP_002890348.1, NZ_KK737549.1, 375216, 376589, +, 1374, 47; cds-WP _032430260.1, NZ_KK737549.1, 376741, 378558, +, 1818, 2667; cds-WP _002890353.1, NZ_KK737549.1, 378555, 379457, -, 903, 5; cds-WP _002890357.1, NZ_KK737549.1, 379724, 380365, +, 642, 0; cds-WP_002890365.1, NZ_KK737549.1, 380552, 381097, +, 546, 100; cds-WP _023286084.1, NZ_KK737549.1, 381122, 382990, +, 1869, 0; cds-WP_004218830.1, NZ_KK737549.1, 383049, 383903, -, 855, 0; cds-WP_032430262.1, NZ_KK737549.1, 383939, 384883, -, 945, 0; cds-WP_013815099.1-62, NZ_KK737549.1, 384903, 385871, +, 969, 5529; cds-AF52_RS05135, NZ_KK737549.1, 386033, 387202, -, 1170, 4; cds-WP _013815099.1-63, NZ_KK737549.1, 387236, 388204, +, 969, 5618; cds-AF52_RS28095, NZ_KK737549.1, 388263, 388406, +, 144, 24; cds-WP _019704181.1, NZ_KK737549.1, 388474, 388707, +, 234, 0; cds-WP _032430264.1, NZ_KK737549.1, 388707, 388934, +, 228, 0; cds-AF52_RS05115, NZ_KK737549.1, 388931, 389551, +, 621, 12; cds-WP _013815099.1-64, NZ_KK737549.1, 389609, 390577, -, 969, 3658; cds-WP_021441029.1, NZ_KK737549.1, 390933, 392513, +, 1581, 0; cds-WP _004151744.1, NZ_KK737549.1, 392638, 393162, -, 525, 13884; cds-WP _004146620.1, NZ_KK737549.1, 393414, 396239, +, 2826, 23793; cds-WP_002884953.1, NZ_KK737549.1, 396240, 396596, -, 357, 3; cds-WP _002884951.1, NZ_KK737549.1, 396600, 397016, -, 417, 43; cds-WP _004151745.1, NZ_KK737549.1, 397147, 397860, -, 714, 115; cds-WP _009485000.1, NZ_KK737549.1, 398051, 399244, -, 1194, 18548; cds-WP_004214117.1, NZ_KK737549.1, 399421, 400500, -, 1080, 680; cds-WP_002884942.1, NZ_KK737549.1, 400532, 401947, -, 1416, 19636; cds-WP_032428470.1, NZ_KK737549.1, 402117, 403100, +, 984, 1; cds-WP _009484997.1, NZ_KK737549.1, 403282, 403524, -, 243, 0; cds-WP_004214118.1, NZ_KK737549.1, 403664, 404662, -, 999, 701; cds-WP _002884935.1, NZ_KK737549.1, 404763, 405251, -, 489, 201; cds-WP_002884931.1, NZ_KK737549.1, 405501, 406016, +, 516, 35255; cds-WP_004151747.1, NZ_KK737549.1, 406112, 406321, -, 210, 3; cds-WP _004219133.1, NZ_KK737549.1, 406387, 406536, +, 150, 1; cds-WP_004151748.1, NZ_KK737549.1, 406556, 407872, -, 1317, 13275; cds-WP_002884822.1, NZ_KK737549.1, 407942, 408550, -, 609, 20014; cds-WP_002884819.1, NZ_KK737549.1, 408673, 409041, -, 369, 4; cds-WP_004178269.1, NZ_KK737549.1, 409170, 411593, +, 2424, 213145; cds-WP _002884808.1, NZ_KK737549.1, 411642, 412508, -, 867, 414; cds-WP _002884807.1, NZ_KK737549.1, 412521, 413018, -, 498, 445; cds-WP _032428466.1, NZ_KK737549.1, 413206, 414129, -, 924, 235037; cds-WP_002884747.1, NZ_KK737549.1, 414244, 415533, -, 1290, 1109869; cds-WP _002884743.1, NZ_KK737549.1, 415617, 416726, -, 1110, 426756; cds-WP _002884740.1,


NZ_KK737549.1, 417097, 418287, +, 1191, 1983767; cds-WP_002884726.1, NZ_KK737549.1, 418405, 419949, +, 1545, 867090; cds-WP_002884725.1, NZ_KK737549.1, 419964, 420854, +, 891, 53461; cds-WP_002884721.1, NZ_KK737549.1, 421046, 421456, -, 411, 100; cds-WP_013815099.1-65, NZ_KK737549.1, 421813, 422781, -, 969, 5609; cds-WP_021441021.1, NZ_KK737549.1, 422896, 424173, +, 1278, 0; cds-AF52_RS04955, NZ_KK737549.1, 424257, 424484, +, 228, 10; cds-WP_013815099.1-66, NZ_KK737549.1, 424540, 425508, -, 969, 5728; cds-AF52_RS04945, NZ_KK737549.1, 425541, 425747, -, 207, 0; cds-WP_004177855.1, NZ_KK737549.1, 425768, 426088, -, 321, 0; cds-AF52_RS04935, NZ_KK737549.1, 426081, 426602, -, 522, 0; cds-WP_013815099.1-67, NZ_KK737549.1, 426636, 427604, +, 969, 5057; cds-AF52_RS0124460, NZ_KK737549.1, 427655, 427843, +, 189, 25; cds-WP_004177856.1, NZ_KK737549.1, 427951, 428460, +, 510, 89; cds-WP_019725463.1, NZ_KK737549.1, 428469, 428924, +, 456, 853; cds-WP_002884631.1, NZ_KK737549.1, 428974, 430623, -, 1650, 176176; cds-WP_004146591.1, NZ_KK737549.1, 431388, 432737, +, 1350, 388; cds-WP_002884627.1, NZ_KK737549.1, 432876, 433805, +, 930, 0; cds-WP_002884625.1, NZ_KK737549.1, 433922, 434194, +, 273, 817; cds-WP _002884619.1, NZ_KK737549.1, 434191, 435066, -, 876, 32963; cds-WP _002884616.1, NZ_KK737549.1, 435416, 436363, +, 948, 1382; cds-WP_032430268.1, NZ_KK737549.1, 436434, 437237, +, 804, 0; cds-WP _021441018.1, NZ_KK737549.1, 437247, 437654, +, 408, 0; cds-WP_032430269.1, NZ_KK737549.1, 437654, 438148, +, 495, 0; cds-WP_002884608.1, NZ_KK737549.1, 438214, 439014, +, 801, 0; cds-WP_032428464.1, NZ_KK737549.1, 439026, 439850, +, 825, 0; cds-WP _021441016.1, NZ_KK737549.1, 439923, 441155, +, 1233, 0; cds-WP_002884583.1, NZ_KK737549.1, 441148, 441957, +, 810, 1341; cds-WP_004177864.1, NZ_KK737549.1, 442045, 443676, -, 1632, 3; cds-WP _015959249.1, NZ_KK737549.1, 443806, 447489, -, 3684, 65187; cds-WP_002884578.1, NZ_KK737549.1, 447684, 448514, +, 831, 17; cds-WP_002884575.1, NZ_KK737549.1, 448564, 450348, -, 1785, 1298; cds-WP _004192658.1, NZ_KK737549.1, 450451, 451755, -, 1305, 0; cds-WP_002884559.1, NZ_KK737549.1, 451835, 453436, -, 1602, 5; cds-WP_004146576.1, NZ_KK737549.1, 453697, 454626, -, 930, 1; cds-WP_004178258.1, NZ_KK737549.1, 454783, 455244, +, 462,456; cds-WP _032425377.1, NZ_KK737549.1, 462509, 464098, +, 1590, 81404; cds-WP _002884357.1, NZ_KK737549.1, 464114, 465409, +, 1296, 199; cds-WP_032430271.1, NZ_KK737549.1, 465399, 466730, -, 1332, 36; cds-WP_021441012.1, NZ_KK737549.1, 466717, 468111, -, 1395, 0; cds-WP_002884346.1, NZ_KK737549.1, 468371, 468808, +, 438, 0; cds-WP_002884344.1, NZ_KK737549.1, 468812, 469507, -, 696, 11586; cds-WP _002884342.1, NZ_KK737549.1, 469520, 469792, -, 273, 143539; cds-WP _002884331.1, NZ_KK737549.1, 469979, 470569, -, 591, 76038; cds-WP _009485014.1, NZ_KK737549.1, 470612, 471283, -, 672, 6953; cds-WP_004178235.1, NZ_KK737549.1, 471296, 472360, -, 1065, 7997; cds-WP_002884327.1, NZ_KK737549.1, 472401, 473174, -, 774, 2239; cds-WP _002884324.1, NZ_KK737549.1, 473268, 473765, +, 498, 13616; cds-WP _004178230.1, NZ_KK737549.1, 474028, 475923, +, 1896, 1684; cds-WP_004152310.1, NZ_KK737549.1, 475923, 476558, +, 636, 36; cds-WP_004177871.1, NZ_KK737549.1, 476551, 477306, +, 756, 0; cds-WP _002884183.1, NZ_KK737549.1, 477290, 477490, +, 201, 289; cds-WP _004146302.1, NZ_KK737549.1, 477492, 478262, +, 771, 427; cds-WP_004212852.1, NZ_KK737549.1, 478259, 479392, +, 1134, 37800; cds-WP _004178221.1, NZ_KK737549.1, 479709, 481241, +, 1533, 722; cds-WP_0028841501, NZ_KK737549.1, 481414, 481719, +, 306, 16197; cds-WP _004212847.1, NZ_KK737549.1, 481723, 482040, +, 318, 72919; cds-WP_004192681.1, NZ_KK737549.1, 482083, 483423, -, 1341, 67969; cds-WP_002884146.1, NZ_KK737549.1, 483824, 488047, -, 4224, 2351100; cds-WP _004901914.1, NZ_KK737549.1, 488124, 492152, -, 4029, 2263607; cds-WP _002884142.1, NZ_KK737549.1, 492477, 492842, -, 366, 836570; cds-WP_001207203.1, NZ_KK737549.1, 492909, 493406, -, 498, 1552139; cds-WP_002884036.1, NZ_KK737549.1, 493820, 494524, -, 705, 721300; cds-WP _002884034.1, NZ_KK737549.1, 494528, 494956, -, 429, 484358; cds-WP_001287521.1, NZ_KK737549.1, 495113, 495658, -, 546, 80030; cds-WP _002883772.1, NZ_KK737549.1, 495660, 496043, -, 384, 1878; cds-WP _004174069.1-2, NZ_KK737549.1, 496380, 497564, -, 1185, 3484655; cds-WP_002883524.1, NZ_KK737549.1, 498550, 499500, +, 951, 13776; cds-WP_002883521.1, NZ_KK737549.1, 499526, 500488, -, 963, 11366; cds-WP_032430275.1, NZ_KK737549.1, 500485, 501513, -, 1029, 905; cds-WP _002883453.1, NZ_KK737549.1, 509001, 509534, -, 534, 365; cds-WP_002883450.1, NZ_KK737549.1, 509546, 510997, -, 1452, 346; cds-WP_002883449.1, NZ_KK737549.1, 511036, 511650, -, 615, 835; cds-WP_032430276.1, NZ_KK737549.1, 511650, 512981, -, 1332, 26618; cds-WP_032430277.1, NZ_KK737549.1, 513173, 515362, +, 2190, 341493; cds-WP_004150456.1, NZ_KK737549.1, 515372, 516535, +, 1164, 30762; cds-WP _002883448.1, NZ_KK737549.1, 516642, 517343, -, 702, 53616; cds-WP_004146456.1, NZ_KK737549.1, 517393, 518868, -, 1476, 72778; cds-WP _002883430.1, NZ_KK737549.1, 519047, 519535, +, 489, 7728; cds-WP _004146458.1, NZ_KK737549.1, 519532, 520335, -, 804, 93; cds-WP_002883427.1, NZ_KK737549.1, 520368, 521147, -, 780, 3656; cds-WP_002883426.1, NZ_KK737549.1, 521150, 521686, -, 537, 37996; cds-WP _002883425.1, NZ_KK737549.1, 521690, 521941, -, 252, 24160; cds-WP _004177924.1, NZ_KK737549.1, 522071, 523711, -, 1641, 14453; cds-WP _021441002.1, NZ_KK737549.1, 523708, 524313, -, 606, 13216; cds-WP _002883421.1, NZ_KK737549.1, 524327, 525082, -, 756, 25014; cds-WP _021441001.1, NZ_KK737549.1, 525153, 526601, -, 1449, 13788; cds-WP _004181652.1, NZ_KK737549.1, 526737, 527498, -, 762, 21267; cds-WP_002883417.1, NZ_KK737549.1, 527771, 528583, +, 813, 3555; cds-WP_02144100.1, NZ_KK737549.1, 528642, 530906, -, 2265, 0; cds-WP _002883415.1, NZ_KK737549.1, 531154, 532107, +, 954, 8; cds-WP_021440999.1, NZ_KK737549.1, 531995, 532894, -, 900, 9794; cds-WP_004146466.1, NZ_KK737549.1, 532983, 533783, -, 801, 15701; cds-WP_002883412.1, NZ_KK737549.1, 533828, 534820, -, 993, 2295; cds-WP_002883411.1, NZ_KK737549.1, 534930, 535550, +, 621, 1337; cds-WP _021440998.1, NZ_KK737549.1, 535713, 536633, +, 921, 4; cds-WP _021440997.1, NZ_KK737549.1, 536679, 537299, -, 621, 418; cds-WP_032430279.1, NZ_KK737549.1, 537361, 539187, -, 1827, 1679; cds-WP_002883408.1, NZ_KK737549.1, 539255, 540115, -, 861, 2036; cds-WP_002883404.1, NZ_KK737549.1, 540268, 540732, +, 465, 2169; cds-WP _002883402.1, NZ_KK737549.1, 540781, 541674, +, 894, 5427; cds-WP_002883400.1, NZ_KK737549.1, 541718, 542668, -, 951, 3825; cds-WP _002883398.1, NZ_KK737549.1, 543024, 545186, -, 2163, 41372; cds-WP_032430280.1, NZ_KK737549.1, 545250, 545966, -, 717, 5980; cds-WP _002883396.1, NZ_KK737549.1, 545966, 546868, -, 903, 2178; cds-WP_002883395.1, NZ_KK737549.1, 546865, 547572, -, 708, 1482; cds-WP _002883394.1, NZ_KK737549.1, 547569, 548393, -, 825, 18221; cds-WP_002883392.1, NZ_KK737549.1, 548429, 548632, -, 204, 8809; cds-WP_002883389.1, NZ_KK737549.1, 548779, 549099, +, 321, 344; cds-WP_002883383.1, NZ_KK737549.1, 549233, 551785, -, 2553, 39299; cds-WP_021440994.1, NZ_KK737549.1, 552143, 553084, +, 942, 614; cds-WP_012737128.1, NZ_KK737549.1, 553081, 553821, +, 741, 18009; cds-WP _004150429.1, NZ_KK737549.1, 553843, 555024, +, 1182, 24726; cds-WP_004150428.1, NZ_KK737549.1, 555028, 556224, +, 1197, 53883; cds-WP _002883322.1, NZ_KK737549.1, 557224, 558609, -, 1386, 16663; cds-WP _004186366.1, NZ_KK737549.1, 558815, 559555, -, 741, 2; cds-WP _032428460.1, NZ_KK737549.1, 559567, 560913, -, 1347, 16989; cds-WP_021440992.1, NZ_KK737549.1, 560910, 561986, -, 1077, 23520; cds-WP_002883312.1, NZ_KK737549.1, 561983, 563233, -, 1251, 18693; cds-WP _002883310.1, NZ_KK737549.1, 563235, 564365, -, 1131, 15077; cds-WP_004146507.1, NZ_KK737549.1, 564371, 565045, -, 675, 14522; cds-WP_002883307.1, NZ_KK737549.1, 565023, 565904, -, 882, 527; cds-WP_002883303.1, NZ_KK737549.1, 565923, 566990, -, 1068, 17459; cds-WP_021440991.1, NZ_KK737549.1, 566987, 568249, -, 1263, 41483; cds-WP_002883297.1, NZ_KK737549.1, 568246, 569376, -, 1131, 19217; cds-WP_002883296.1, NZ_KK737549.1, 569433, 570479, -, 1047, 1851; cds-WP_002883295.1, NZ_KK737549.1, 570493, 571596, -, 1104, 1523; cds-WP _002883293.1, NZ_KK737549.1, 571837, 573096, -, 1260, 491339; cds-WP _002883224.1, NZ_KK737549.1, 573427, 573756, -, 330, 102411; cds-WP_002883222.1, NZ_KK737549.1, 574098, 575363, +, 1266, 109357; cds-WP_072271788.1, NZ_KK737549.1, 575482, 576990, +, 1509, 7107; cds-WP _002883211.1, NZ_KK737549.1, 577010, 577936, +, 927, 2834; cds-WP_004181642.1, NZ_KK737549.1, 578067, 579065, +, 999, 1; cds-WP_002883185.1, NZ_KK737549.1, 579128, 579850, +, 723, 6630; cds-WP_032430283.1, NZ_KK737549.1, 579855, 581876, -, 2022, 8246; cds-WP _002883181.1, NZ_KK737549.1, 581989, 582270, +, 282, 2; cds-WP _002883180.1, NZ_KK737549.1, 582322, 582603, +, 282, 2853; cds-WP_002883178.1, NZ_KK737549.1, 582807, 584282, -, 1476, 58587; cds-WP_002883176.1, NZ_KK737549.1, 584435, 585325, +, 891, 14726; cds-WP _002883174.1, NZ_KK737549.1, 585322, 586866, -, 1545, 23664; cds-WP_002883173.1, NZ_KK737549.1, 586869, 588719, -, 1851, 13594; cds-WP _032430284.1, NZ_KK737549.1, 588780, 589709, -, 930, 3563; cds-WP_002883170.1, NZ_KK737549.1, 589726, 589983, -, 258, 0; cds-WP_012737117.1, NZ_KK737549.1, 589980, 591626, -, 1647, 6; cds-WP_001311244.1, NZ_KK737549.1, 591767, 591865, -, 99, 0; cds-WP_032430285.1, NZ_KK737549.1, 592220, 593740, +, 1521, 398; cds-WP_004146520.1, NZ_KK737549.1, 593766, 594104, -, 339, 104; cds-WP _004177958.1, NZ_KK737549.1, 594223, 595044, +, 822, 8379; cds-WP _032430287.1, NZ_KK737549.1, 603456, 604307, -, 852, 13533; cds-WP _004146288.1, NZ_KK737549.1, 604252, 606090, -, 1839, 29922; cds-WP_002883023.1, NZ_KK737549.1, 606457, 607557, +, 1101, 16111; cds-WP_002883021.1, NZ_KK737549.1, 607609, 607968, -, 360, 27802; cds-WP _004151856.1, NZ_KK737549.1, 607984, 608619, -, 636, 7400; cds-WP _002883016.1, NZ_KK737549.1, 608816, 610216, +, 1401, 227632; cds-WP_002883015.1, NZ_KK737549.1, 610199, 611116, -, 918, 27965; cds-WP_032430289.1, NZ_KK737549.1, 611375, 612748, -, 1374, 741; cds-WP_004187843.1, NZ_KK737549.1, 612848, 613624, -, 777, 21; cds-WP_004181637.1, NZ_KK737549.1, 613631, 614635, -, 1005, 646; cds-WP_019705783.1, NZ_KK737549.1, 614749, 615900, +, 1152, 2567; cds-WP_004181636.1, NZ_KK737549.1, 616159, 618810, +, 2652, 9828; cds-WP_021440981.1, NZ_KK737549.1, 618854, 619504, -, 651, 0; cds-WP _004220885.1, NZ_KK737549.1, 619529, 620515, +, 987, 40; cds-WP _004177977.1, NZ_KK737549.1, 620721, 621383, +, 663, 0; cds-WP _004146274.1, NZ_KK737549.1, 621438, 622541, +, 1104, 1556; cds-WP_004177983.1, NZ_KK737549.1, 622605, 623486, -, 882, 0; cds-WP _021440979.1, NZ_KK737549.1, 623630, 624517, -, 888, 0; cds-WP_021440978.1, NZ_KK737549.1, 624746, 625654, -, 909, 27360; cds-WP_021440977.1, NZ_KK737549.1, 625746, 626117, +, 372, 0; cds-WP _032428457.1, NZ_KK737549.1, 626155, 627711, -, 1557, 0; cds-WP_013815099.1-68, NZ_KK737549.1, 627780, 628748, +, 969, 4589; cds-WP _004181629.1, NZ_KK737549.1, 628916, 630052, +, 1137, 13; cds-WP _032430291.1, NZ_KK737549.1, 630027, 632459, -, 2433, 121; cds-WP_004150388.1, NZ_KK737549.1, 632462, 633622, -, 1161, 6333; cds-WP_002882924.1, NZ_KK737549.1, 633890, 634207, +, 318, 4261; cds-WP_002882922.1, NZ_KK737549.1, 634309, 634521, -, 213, 28424; cds-WP _025710954.1, NZ_KK737549.1, 634774, 636969, +, 2196, 673; cds-WP _002882921.1, NZ_KK737549.1, 637120, 638148, +, 1029, 44908; cds-WP _071600598.1, NZ_KK737549.1, 638242, 639210, +, 969, 28626; cds-WP_002882918.1, NZ_KK737549.1, 639302, 639832, +, 531, 22458; cds-WP_002882917.1, NZ_KK737549.1, 639842, 641176, +, 1335, 143779; cds-WP _032430292.1, NZ_KK737549.1, 641246, 642166, +, 921, 14172; cds-WP _032430293.1, NZ_KK737549.1, 642259, 642744, +, 486, 3901; cds-WP _002882911.1, NZ_KK737549.1, 642806, 643768, -, 963, 39385; cds-WP_002882907.1, NZ_KK737549.1, 643965, 644867, -,903,1081; cds-WP_002882903.1, NZ_KK737549.1, 645026, 645529, -, 504, 13728; cds-WP_002882901.1, NZ_KK737549.1, 645679, 646377, +, 699, 27846; cds-WP _032430294.1, NZ_KK737549.1, 646374, 647747, +, 1374, 35592; cds-WP_002882896.1, NZ_KK737549.1, 647829, 648503, -, 675, 162; cds-WP_002882894.1, NZ_KK737549.1, 648576, 649196, -, 621, 457098; cds-WP_032430295.1, NZ_KK737549.1, 649486, 650520, +, 1035, 866; cds-WP _002882891.1, NZ_KK737549.1, 650553, 651398, -, 846, 559; cds-WP _002882888.1,


NZ_KK737549.1, 651472, 652308, -, 837, 0; cds-WP_002882885.1, NZ_KK737549.1, 652619, 654085, +, 1467, 0; cds-WP _004150375.1, NZ_KK737549.1, 654082, 655341, +, 1260, 0; cds-WP_004187188.1, NZ_KK737549.1, 655491, 656321, +, 831, 2; cds-WP _002882880.1, NZ_KK737549.1, 656403, 657389, +, 987, 1; cds-WP_021440966.1, NZ_KK737549.1, 657535, 659046, +, 1512, 12; cds-WP _004181621.1, NZ_KK737549.1, 659043, 660050, +, 1008, 0; cds-WP _032430296.1, NZ_KK737549.1, 660047, 661051, +, 1005, 0; cds-WP_002882871.1, NZ_KK737549.1, 661141, 662289, +, 1149, 1; cds-WP _021440964.1, NZ_KK737549.1, 662286, 662600, +, 315, 0; cds-WP_004210464.1, NZ_KK737549.1, 662638, 663903, -, 1266, 1650; cds-WP_004178018.1, NZ_KK737549.1, 663945, 666068, -, 2124, 22086; cds-WP_021440963.1, NZ_KK737549.1, 666184, 667179, -, 996, 4; cds-WP_002882865.1, NZ_KK737549.1, 667267, 667815, -, 549, 0; cds-WP_032430297.1, NZ_KK737549.1, 667915, 668571, +, 657, 0; cds-WP _004146241.1, NZ_KK737549.1, 668571, 668894, +, 324, 0; cds-WP _002882830.1, NZ_KK737549.1, 668935, 669147, -, 213, 0; cds-WP_032430298.1, NZ_KK737549.1, 669276, 670112, -, 837, 6; cds-WP _085921749.1, NZ_KK737549.1, 670269, 673319, +, 3051, 1008492; cds-WP_002882822.1, NZ_KK737549.1, 673332, 674234, +, 903, 21748; cds-WP _032430299.1, NZ_KK737549.1, 674231, 674866, +, 636, 116385; cds-WP _004150358.1, NZ_KK737549.1, 674863, 675792, +, 930, 136306; cds-WP _019705794.1, NZ_KK737549.1, 675966, 676349, -, 384, 297; cds-WP_004150355.1, NZ_KK737549.1, 676349, 676591, -, 243, 79; cds-WP _032430300.1, NZ_KK737549.1, 676796, 677713, +, 918, 7635; cds-WP _004178031.1, NZ_KK737549.1, 677728, 678669, -, 942, 468; cds-WP _002882809.1, NZ_KK737549.1, 678714, 679151, -, 438, 7; cds-WP _004146232.1, NZ_KK737549.1, 679148, 680008, -, 861, 245; cds-WP_004151865.1, NZ_KK737549.1, 680002, 680601, -, 600, 1879; cds-WP_002882755.1, NZ_KK737549.1, 680737, 682560, -, 1824, 210469; cds-WP _002882753.1, NZ_KK737549.1, 682939, 684348, +, 1410, 111458; cds-WP_004146229.1, NZ_KK737549.1, 684537, 685586, +, 1050, 11; cds-WP_002882749.1, NZ_KK737549.1, 685595, 687004, +, 1410, 25824; cds-WP_004152951.1, NZ_KK737549.1, 687115, 687225, +, 111, 1576; cds-WP_002882745.1, NZ_KK737549.1, 687261, 688634, -, 1374, 3295; cds-WP_002882743.1, NZ_KK737549.1, 688823, 689329, -, 507, 1545; cds-WP _002882734.1, NZ_KK737549.1, 689913, 690545, +, 633, 15890; cds-WP _002882729.1, NZ_KK737549.1, 690893, 693685, -, 2793, 14370; cds-WP_004150336.1, NZ_KK737549.1, 694082, 694981, +, 900, 1990; cds-WP _004146224.1, NZ_KK737549.1, 695030, 695653, -, 624, 26320; cds-WP_004187940.1, NZ_KK737549.1, 695681, 696667, -, 987, 16802; cds-WP _002882612.1, NZ_KK737549.1, 696743, 697012, -, 270, 228; cds-WP _004178039.1, NZ_KK737549.1, 697084, 697665, +, 582, 2; cds-WP_002882596.1, NZ_KK737549.1, 697662, 698168, +, 507, 7; cds-WP_004150973.1, NZ_KK737550.1, 3504, 6077, -, 2574, 72041; cds-WP_021440571.1, NZ_KK737550.1, 6207, 6938, -, 732, 18103; cds-WP _032428369.1, NZ_KK737550.1, 6935, 7915, -, 981, 7730; cds-WP _004145664.1, NZ_KK737550.1, 8047, 8784, +, 738, 79428; cds-WP_002914111.1, NZ_KK737550.1, 9055, 9390, +, 336, 29053; cds-WP_100250063.1, NZ_KK737550.1, 9497, 9544, +, 48, 1; cds-WP _021440574.1, NZ_KK737550.1, 9645, 10805, +, 1161, 8133; cds-WP _021440575.1, NZ_KK737550.1, 10802, 11674, -, 873, 49; cds-WP _014907099.1, NZ_KK737550.1, 11737, 12858, -, 1122, 30009; cds-WP _002914114.1, NZ_KK737550.1, 12868, 13938, -, 1071, 481; cds-WP_004174804.1, NZ_KK737550.1, 14281, 14790, +, 510, 14; cds-WP _002914116.1, NZ_KK737550.1, 14783, 16006, +, 1224, 331; cds-WP _004145671.1, NZ_KK737550.1, 16020, 16502, +, 483, 4060; cds-WP _023285466.1, NZ_KK737550.1, 16511, 17881, -, 1371, 392; cds-WP_002914119.1, NZ_KK737550.1, 17938, 18396, -, 459, 77; cds-WP_002914145.1, NZ_KK737550.1, 18516, 18863, -, 348, 209740; cds-WP _002914147.1, NZ_KK737550.1, 18903, 19670, -, 768, 1111933; cds-WP_004150977.1, NZ_KK737550.1, 19702, 20250, -, 549, 737611; cds-WP _002914149.1, NZ_KK737550.1, 20269, 20517, -, 249, 186675; cds-WP _002914152.1, NZ_KK737550.1, 20777, 22141, -, 1365, 54018; cds-WP _002914153.1, NZ_KK737550.1, 22305, 23096, +, 792, 1840; cds-WP _004149392.1, NZ_KK737550.1, 23116, 24402, +, 1287, 207; cds-WP _004174800.1, NZ_KK737550.1, 24523, 25113, -, 591, 37358; cds-WP_002914158.1, NZ_KK737550.1, 25238, 26116, +, 879, 12395; cds-WP _004174799.1, NZ_KK737550.1, 26203, 27864, +, 1662, 276; cds-WP _002914160.1, NZ_KK737550.1, 28012, 28353, +, 342, 17238; cds-WP _004145682.1, NZ_KK737550.1, 28420, 28710, -, 291, 3391; cds-WP _015875096.1, NZ_KK737550.1, 28700, 29176, -, 477, 2511; cds-WP_002914164.1, NZ_KK737550.1, 29287, 29769, +, 483, 16221; cds-WP _032430315.1, NZ_KK737550.1, 30546, 30794, +, 249, 2172; cds-WP _032430316.1, NZ_KK737550.1, 31673, 32251, -, 579, 0; cds-WP _032430369.1, NZ_KK737550.1, 32977, 34431, +, 1455, 2874; cds-WP _032430317.1, NZ_KK737550.1, 34432, 35181, +, 750, 3959; cds-WP _032430318.1, NZ_KK737550.1, 35321, 36064, -, 744, 0; cds-WP_032430320.1, NZ_KK737550.1, 36079, 37839, -, 1761, 3; cds-AF52_RS03525, NZ_KK737550.1, 37916, 38458, -, 543, 0; cds-WP_013815099.1-69, NZ_KK737550.1, 38493, 39461, +, 969, 5161; cds-AF52_RS0124535, NZ_KK737550.1, 39512, 39685, +, 174, 41; cds-WP _002914289.1, NZ_KK737550.1, 39771, 40220, -, 450, 8401; cds-WP _004217497.1, NZ_KK737550.1, 40931, 41350, +, 420, 10318; cds-WP_002914284.1, NZ_KK737550.1, 41423, 41602, -, 180, 13312; cds-AF52_RS03500, NZ_KK737550.1, 41808, 42377, +, 570, 0; cds-WP_013815099.1-70, NZ_KK737550.1, 42433, 43401, -, 969, 5276; cds-AF52_RS03490, NZ_KK737550.1, 43435, 43776, +, 342, 56; cds-WP _021440595.1, NZ_KK737550.1, 43757, 44302, -, 546, 7; cds-WP _002914277.1, NZ_KK737550.1, 44310, 44609, -, 300, 238; cds-WP_004212889.1, NZ_KK737550.1, 44685, 45290, -, 606, 0; cds-WP _021440594.1, NZ_KK737550.1, 45394, 46302, +, 909, 6418; cds-WP_021440593.1, NZ_KK737550.1, 46385, 48172, -, 1788, 15537; cds-WP_004174747.1, NZ_KK737550.1, 48436, 49956, +, 1521, 3047; cds-WP_013815099.1-71, NZ_KK737550.1, 50334, 51302, +, 969, 4313; cds-WP _032430322.1, NZ_KK737550.1, 51339, 51674, +, 336, 25; cds-WP _021440597.1, NZ_KK737550.1, 51818, 53170, -, 1353, 3; cds-WP_004151037.1, NZ_KK737550.1, 53259, 53690, +, 432, 676; cds-WP 002914320.1, NZ_KK737550.1, 53874, 54119, +, 246, 38; cds-WP_002914321.1, NZ_KK737550.1, 54116, 54526, +, 411, 10; cds-WP _032428382.1, NZ_KK737550.1, 54499, 56640, +, 2142, 34; cds-WP _021440599.1, NZ_KK737550.1, 56651, 57613, +, 963, 5; cds-WP_002914328.1, NZ_KK737550.1, 57970, 59172, +, 1203, 0; cds-WP_021312381.1, NZ_KK737550.1, 59165, 60232, +, 1068, 0; cds-WP _002914330.1, NZ_KK737550.1, 60311, 61309, +, 999, 2; cds-WP_002914333.1, NZ_KK737550.1, 61487, 62233, +, 747, 584; cds-WP_021440601.1, NZ_KK737550.1, 62223, 62558, +, 336, 75; cds-WP_002914337.1, NZ_KK737550.1, 62649, 63179, +, 531, 59733; cds-WP_002914339.1, NZ_KK737550.1, 63305, 64477, +, 1173, 34339; cds-WP_002914342.1, NZ_KK737550.1, 64493, 66031, +, 1539, 129; cds-WP _004185353.1, NZ_KK737550.1, 66168, 67844, +, 1677, 79; cds-WP_004149452.1, NZ_KK737550.1, 67823, 68590, -, 768, 7974; cds-WP_002914351.1, NZ_KK737550.1, 68643, 69158, -, 516, 14017; cds-WP_002914353.1, NZ_KK737550.1, 69315, 70871, -, 1557, 153982; cds-WP_002914355.1, NZ_KK737550.1, 70938, 71366, -, 429, 746; cds-WP _004174701.1, NZ_KK737550.1, 71363, 71929, -, 567, 2794; cds-WP_002914359.1, NZ_KK737550.1, 72055, 72369, -, 315, 4223; cds-WP_000906486.1, NZ_KK737550.1, 73958, 74143, -, 186, 4496; cds-WP _004174700.1, NZ_KK737550.1, 74507, 77134, -, 2628, 416693; cds-WP_004213244.1, NZ_KK737550.1, 77385, 77885, -, 501, 22; cds-WP_002914769.1, NZ_KK737550.1, 77953, 79011, -, 1059, 170494; cds-WP_002914771.1, NZ_KK737550.1, 79102, 79599, -, 498, 118; cds-WP_032428383.1, NZ_KK737550.1, 79739, 80617, -, 879, 0; cds-WP_004149458.1, NZ_KK737550.1, 80625, 81488, -, 864, 0; cds-AF52_RS0124565, NZ_KK737550.1, 81485, 82195, -, 711, 1; cds-WP_004174694.1, NZ_KK737550.1, 82534, 83613, -, 1080, 571; cds-WP _002914812.1, NZ_KK737550.1, 83890, 84453, +, 564, 20114; cds-WP _021440607.1, NZ_KK737550.1, 84450, 85430, +, 981, 38665; cds-WP_004174693.1, NZ_KK737550.1, 85444, 85806, +, 363, 1209; cds-WP_002914815.1, NZ_KK737550.1, 85819, 86598, +, 780, 0; cds-WP_021440608.1, NZ_KK737550.1, 86756, 87115, +, 360, 0; cds-WP_002914817.1, NZ_KK737550.1, 87182, 87955, +, 774, 2042; cds-WP _004174691.1, NZ_KK737550.1, 87948, 88913, +, 966, 3190; cds-WP_004890240.1, NZ_KK737550.1, 88876, 90426, -, 1551, 107; cds-WP_004145759.1, NZ_KK737550.1, 90614, 92062, +, 1449, 0; cds-WP_021440610.1, NZ_KK737550.1, 92059, 93192, +, 1134, 0; cds-WP _004181028.1, NZ_KK737550.1, 93289, 94302, -, 1014, 465; cds-WP _032430324.1, NZ_KK737550.1, 94299, 96515, -, 2217, 51; cds-WP_002914875.1, NZ_KK737550.1, 96524, 97051, -, 528, 1922; cds-WP _004174685.1, NZ_KK737550.1, 97188, 98201, -, 1014, 302; cds-WP _032430325.1, NZ_KK737550.1, 98469, 99923, +, 1455, 356; cds-WP _004181034.1, NZ_KK737550.1, 99938, 101362, +, 1425, 53015; cds-WP _002914883.1, NZ_KK737550.1, 101544, 101852, +, 309, 4; cds-WP_032430326.1, NZ_KK737550.1, 101849, 102319, -, 471, 5; cds-WP_002914887.1, NZ_KK737550.1, 102312, 102722, -, 411, 0; cds-WP _002914891.1, NZ_KK737550.1, 102719, 103486, -, 768, 8; cds-WP_002914893.1, NZ_KK737550.1, 103486, 104028, -, 543, 0; cds-WP_021440614.1, NZ_KK737550.1, 104038, 105747, -, 1710, 0; cds-WP_032428387.1, NZ_KK737550.1, 105764, 106687, -, 924, 0; cds-WP_004890213.1, NZ_KK737550.1, 106690, 108516, -, 1827, 0; cds-WP _004151047.1, NZ_KK737550.1, 108513, 109121, -, 609, 0; cds-WP_002914925.1, NZ_KK737550.1, 109204, 109653, -, 450, 0; cds-WP _002914928.1, NZ_KK737550.1, 109863, 110207, +, 345, 0; cds-WP_004181043.1, NZ_KK737550.1, 110211, 111083, +, 873, 0; cds-WP_014907033.1, NZ_KK737550.1, 111074, 111346, +, 273, 0; cds-WP_004145781.1, NZ _KK737550.1, 111346, 112467, +, 1122, 0; cds-WP _032428388.1, NZ_KK737550.1, 112464, 113474, +, 1011, 0; cds-WP_032428389.1, NZ_KK737550.1, 113711, 115783, +, 2073, 515; cds-WP_002914970.1, NZ_KK737550.1, 115837, 117237, -, 1401, 1116; cds-WP_021440618.1, NZ_KK737550.1, 117288, 119480, -, 2193, 2644; cds-AF52_RS03110, NZ_KK737550.1, 119493, 120829, -, 1337, 6193; cds-WP_032430327.1, NZ_KK737550.1, 121092, 122363, -, 1272, 3; cds-WP _002914979.1, NZ_KK737550.1, 122541, 122855, +, 315, 0; cds-WP_002914981.1, NZ_KK737550.1, 122865, 124187, +, 1323, 0; cds-WP _032430328.1, NZ_KK737550.1, 124211, 124525, +, 315, 7; cds-WP_004151053.1, NZ_KK737550.1, 124576, 125490, +, 915, 7; cds-WP_004181055.1, NZ_KK737550.1, 125547, 126509, +, 963, 7336; cds-WP _004174672.1, NZ_KK737550.1, 126688, 127605, +, 918, 45; cds-WP_021440623.1, NZ_KK737550.1, 127602, 128423, +, 822, 8; cds-WP_004185394.1, NZ_KK737550.1, 128420, 129268, +, 849, 0; cds-WP_002915035.1, NZ _KK737550.1, 129262, 130116, +, 855, 2; cds-WP _004193741.1, NZ_KK737550.1, 130183, 130524, -, 342, 0; cds-WP_032430329.1, NZ_KK737550.1, 130591, 131478, -, 888, 1; cds-WP _002915041.1, NZ_KK737550.1, 131663, 132604, +, 942, 0; cds-WP_032430330.1, NZ_KK737550.1, 132640, 134349, +, 1710, 0; cds-WP_021440627.1, NZ_KK737550.1, 134389, 134682, -, 294, 1; cds-WP_021440628.1, NZ_KK737550.1, 134898, 137261, +, 2364, 121; cds-WP _032428391.1, NZ_KK737550.1, 137333, 138364, +, 1032, 12; cds-WP _004181072.1, NZ_KK737550.1, 138361, 139179, +, 819, 0; cds-WP_032428392.1, NZ_KK737550.1, 139179, 140174, +, 996, 11; cds-WP_021440630.1, NZ_KK737550.1, 140167, 140946, +, 780, 4991; cds-WP_032430331.1, NZ_KK737550.1, 141100, 143661, +, 2562, 2207; cds-WP _021440632.1, NZ_KK737550.1, 143781, 143933, -, 153, 0; cds-WP _002915098.1, NZ_KK737550.1, 144272, 144508, -, 237, 0; cds-WP _004151060.1, NZ_KK737550.1, 144519, 145946, -, 1428, 12; cds-WP_002915099.1, NZ_KK737550.1, 145946, 146539, -, 594, 0; cds-WP_002915102.1, NZ_KK737550.1, 146713, 147120, +, 408, 18; cds-WP _032430332.1, NZ _KK737550.1, 147129, 148016, -, 888, 42; cds-WP _021440634.1, NZ_KK737550.1, 148125, 149327, +, 1203, 223; cds-WP _021440635.1, NZ_KK737550.1, 149324, 149701, +, 378, 0; cds-WP _002915106.1, NZ_KK737550.1, 149754, 150746, -, 993, 110084; cds-WP_014907019.1, NZ_KK737550.1, 150904, 152034, -, 1131, 254576; cds-WP _002915108.1, NZ_KK737550.1, 152160, 152786, -, 627, 89268; cds-WP _004142750.1, NZ_KK737550.1, 152780, 153541, -, 762, 17550; cds-WP_004185423.1, NZ_KK737550.1, 153522, 154571, -, 1050, 2019; cds-WP_002915113.1, NZ_KK737550.1, 154568, 155047, -, 480, 9453; cds-WP _021440636.1, NZ_KK737550.1, 155047, 155757, -, 711, 274; cds-WP_002915156.1, NZ_KK737550.1, 155777, 156094, -, 318, 12566; cds-WP _002915157.1,


NZ_KK737550.1, 156235, 156561, -, 327, 0; cds-WP_002915158.1, NZ_KK737550.1, 156612, 157217, -, 606, 53547; cds-WP_004181094.1, NZ_KK737550.1, 157217, 158644, -, 1428, 11599; cds-WP_002915160.1, NZ_KK737550.1, 158654, 159562, -, 909, 545; cds-WP_072271746.1, NZ_KK737550.1, 159572, 160978, -, 1407, 17; cds-WP_004174643.1, NZ_KK737550.1, 161225, 162271, +, 1047, 98; cds-WP_002915177.1, NZ_KK737550.1, 162344, 163078, -, 735, 1364; cds-WP _021440639.1, NZ_KK737550.1, 163177, 164889, -, 1713, 87603; cds-WP_004174642.1, NZ_KK737550.1, 164889, 166688, -, 1800, 1090; cds-WP_187079196.1, NZ_KK737550.1, 167005, 167370, +, 366, 10605; cds-WP_021440641.1, NZ_KK737550.1, 167411, 168082, -, 672, 197; cds-WP_032430333.1, NZ_KK737550.1, 168557, 169666, +, 1110, 17; cds-WP_002915213.1, NZ_KK737550.1, 169730, 171028, -, 1299, 1263201; cds-WP_004142808.1, NZ_KK737550.1, 171110, 172747, -, 1638, 221219; cds-WP_002915215.1, NZ_KK737550.1, 173028, 173819, -, 792, 1; cds-WP_002915217.1, NZ_KK737550.1, 173931, 176168, -, 2238, 32423; cds-WP_023301525.1, NZ_KK737550.1, 176290, 177594, -, 1305, 3509; cds-WP_004151066.1, NZ_KK737550.1, 177708, 180458, +, 2751, 6588; cds-WP_004149562.1, NZ_KK737550.1, 180616, 181755, -, 1140,44848; cds-WP_002915223.1, NZ_KK737550.1, 181828, 183168, -, 1341, 37047; cds-WP_032428394.1, NZ_KK737550.1, 183186, 184526, -, 1341, 17358; cds-WP_002915225.1, NZ_KK737550.1, 184529, 185881, -, 1353, 18326; cds-WP_002915235.1, NZ_KK737550.1, 186353, 186796, -, 444, 2096; cds-WP_002915236.1, NZ_KK737550.1, 186801, 187595, -, 795, 4534; cds-WP_002915249.1, NZ_KK737550.1, 187595, 187924, -, 330, 2; cds-WP_002915253.1, NZ_KK737550.1, 188556, 189101, -, 546, 10178; cds-WP_004174633.1, NZ_KK737550.1, 189170, 190015, +, 846, 1107; cds-WP_002915258.1, NZ_KK737550.1, 190127, 191494, +, 1368, 63335; cds-WP_004151070.1, NZ_KK737550.1, 192004, 193293, +, 1290, 1361800; cds-WP_002915259.1, NZ_KK737550.1, 193359, 194726, +, 1368,410917; cds-WP_032430336.1, NZ_KK737550.1, 194865, 195806, +, 942, 6399; cds-WP_002915263.1, NZ_KK737550.1, 195852, 197075, -, 1224, 0; cds-WP_004151071.1, NZ_KK737550.1, 197086, 198507, -, 1422, 368; cds-WP_002915265.1, NZ_KK737550.1, 198701, 199579, -, 879, 0; cds-WP_002915267.1, NZ_KK737550.1, 199576, 200274, -, 699, 0; cds-WP_004174621.1, NZ_KK737550.1, 200271, 201293, -, 1023, 0; cds-WP_032428395.1, NZ_KK737550.1, 201290, 202696, -, 1407, 0; cds-AF52_RS0124590, NZ_KK737550.1, 202770, 204167, -, 1398, 0; cds-WP_021440649.1, NZ_KK737550.1, 204214, 205386, -, 1173, 0; cds-WP_032428396.1, NZ_KK737550.1, 205464, 205580, -, 117, 0; cds-WP_021440650.1, NZ_KK737550.1, 205658, 207601, +, 1944, 0; cds-WP_004142871.1, NZ_KK737550.1, 207698, 208453, +, 756, 197; cds-WP_032430337.1, NZ_KK737550.1, 208512, 209660, -, 1149, 0; cds-WP_002915470.1, NZ_KK737550.1, 209688, 210335, -, 648, 1; cds-WP_004151076.1, NZ_KK737550.1, 210902, 212212, +, 1311, 0; cds-WP_032430338.1, NZ_KK737550.1, 212245, 214020, +, 1776, 0; cds-WP_004181132.1, NZ_KK737550.1, 214128, 215546, +, 1419, 0; cds-WP_002915538.1, NZ_KK737550.1, 215548, 215970, +, 423, 0; cds-WP_004142883.1, NZ_KK737550.1, 216029, 216739, +, 711, 306; cds-WP_002915541.1, NZ_KK737550.1, 216788, 217888, -, 1101, 24237; cds-WP_002915543.1, NZ_KK737550.1, 217881, 218276, -, 396, 11144; cds-WP_002915545.1, NZ_KK737550.1, 218296, 219213, -, 918, 13718; cds-WP _002915549.1, NZ_KK737550.1, 219565, 219789, -, 225, 447; cds-WP_021440652.1, NZ_KK737550.1, 219987, 221192, +, 1206, 20; cds-WP_021440653.1, NZ_KK737550.1, 221192, 221623, +, 432, 6; cds-WP_002915577.1, NZ_KK737550.1, 221666, 222487, -, 822, 19531; cds-WP_002915579.1, NZ_KK737550.1, 222575, 223672, -, 1098, 16983; cds-WP_004900253.1, NZ_KK737550.1, 224055, 225110, -, 1056, 2476; cds-WP_004143921.1, NZ_KK737550.1, 225154, 225699, -, 546, 6; cds-WP_021440655.1, NZ_KK737550.1, 225693, 227216, -, 1524, 6; cds-WP_002915614.1, NZ_KK737550.1, 227213, 228037, -, 825, 3891; cds-WP_004143925.1, NZ_KK737550.1, 228046, 228723, -, 678, 39; cds-WP_002915619.1, NZ_KK737550.1, 228710, 228991, -, 282, 0; cds-WP_004143926.1, NZ_KK737550.1, 228993, 229730, -, 738, 0; cds-WP_004143927.1, NZ_KK737550.1, 229730, 230440, -, 711, 278; cds-WP_016532596.1, NZ_KK737550.1, 230437, 231231, -, 795, 1; cds-WP_002915627.1, NZ_KK737550.1, 231242, 232027, -, 786, 1; cds-WP_004143930.1, NZ_KK737550.1, 232024, 232749, -, 726, 5; cds-WP_021440657.1, NZ_KK737550.1, 232749, 233804, -, 1056, 8; cds-WP_004149602.1, NZ_KK737550.1, 233785, 234558, -, 774, 0; cds-WP_032430341.1, NZ_KK737550.1, 234551, 235120, -, 570, 1813; cds-WP_016947545.1, NZ_KK737550.1, 235110, 235715, -, 606, 0; cds-WP _002915708.1, NZ_KK737550.1, 235709, 236848, -, 1140, 624; cds-WP _021440659.1, NZ_KK737550.1, 236845, 237480, -, 636, 30; cds-WP_002915724.1, NZ_KK737550.1, 237491, 238450, -, 960, 0; cds-WP_004185466.1, NZ_KK737550.1, 238447, 239823, -, 1377, 1; cds-AF52_RS02545, NZ_KK737550.1, 240376, 241203, -, 828, 0; cds-AF52_RS26545, NZ_KK737550.1, 241259, 241436, -, 178, 208; cds-WP_170999280.1, NZ_KK737550.1, 241947, 242236, -, 290, 245; cds-WP_002915737.1, NZ_KK737550.1, 242699, 242983, +, 285, 0; cds-WP_002915739.1, NZ_KK737550.1, 242980, 243792, +, 813, 0; cds-WP_002915744.1, NZ_KK737550.1, 243811, 245475, +, 1665, 0; cds-WP_008806302.1, NZ_KK737550.1, 245486, 246175, +, 690, 0; cds-WP_021440661.1, NZ_KK737550.1, 246190, 246714, +, 525, 0; cds-WP_021440662.1, NZ_KK737550.1, 246727, 248559, +, 1833, 25; cds-WP_004900279.1, NZ_KK737550.1, 248549, 248899, +, 351, 0; cds-WP_002915806.1, NZ_KK737550.1, 248918, 249193, +, 276, 0; cds-WP_002915808.1, NZ_KK737550.1, 249215, 249661, +, 447, 0; cds-WP_002915810.1, NZ_KK737550.1, 249661, 250293, +, 633, 0; cds-WP_021440663.1, NZ_KK737550.1, 250290, 250781, +, 492, 0; cds-WP_021440664.1, NZ_KK737550.1, 250785, 251060, +, 276, 0; cds-WP_004211864.1, NZ_KK737550.1, 251071, 252087, +, 1017, 0; cds-WP_021440665.1, NZ_KK737550.1, 252084, 253472, +, 1389, 0; cds-WP_021440666.1, NZ_KK737550.1, 253484, 254596, +, 1113, 0; cds-WP_023301518.1, NZ_KK737550.1, 254593, 255945, +, 1353, 0; cds-WP_004181171.1, NZ_KK737550.1, 255948, 256502, +, 555, 0; cds-WP_002915850.1, NZ_KK737550.1, 256502, 256852, +, 351, 0; cds-WP_004185483.1, NZ_KK737550.1, 256857, 257297, +, 441, 0; cds-WP_032430342.1, NZ_KK737550.1, 257294, 258508, +, 1215, 2156; cds-WP_032428406.1, NZ_KK737550.1, 258600, 259466, +, 867, 2; cds-WP_004143954.1, NZ_KK737550.1, 259470, 260546, -, 1077, 12952; cds-WP_004174538.1, NZ_KK737550.1, 260564, 261817, -, 1254, 648; cds-AF52_RS02415, NZ_KK737550.1, 262045, 263376, +, 1332, 552; cds-WP_009485668.1, NZ_KK737550.1, 263606, 263926, +, 321, 2; cds-WP_004900323.1, NZ_KK737550.1, 263984, 265828, -, 1845, 1; cds-WP_021440669.1, NZ_KK737550.1, 265825, 269361, -, 3537, 47236; cds-WP_023301515.1, NZ_KK737550.1, 269358, 272243, -, 2886, 39381; cds-WP_004211885.1, NZ_KK737550.1, 272364, 275741, -, 3378, 20440; cds-WP_021440672.1, NZ_KK737550.1, 275754, 276077, -, 324, 0; cds-WP_004181182.1, NZ_KK737550.1, 276062, 276469, -, 408, 5; cds-WP _021440673.1, NZ_KK737550.1, 276466, 277023, -, 558, 0; cds-WP_002915932.1, NZ_KK737550.1, 277020, 277571, -, 552, 0; cds-WP_002915933.1, NZ_KK737550.1, 277757, 278551, -, 795, 6366; cds-WP_002915934.1, NZ_KK737550.1, 278558, 279433, -, 876, 24052; cds-WP_032430343.1, NZ_KK737550.1, 279679, 281925, -, 2247, 27541; cds-WP_002915936.1, NZ_KK737550.1, 281938, 282468, -, 531, 47153; cds-WP_004218186.1, NZ_KK737550.1, 282922, 283065, +, 144, 0; cds-WP_004143967.1, NZ_KK737550.1, 283151, 283846, +, 696, 0; cds-WP_002915973.1, NZ_KK737550.1, 283910, 284623, +, 714, 3156; cds-WP_002915974.1, NZ_KK737550.1, 284747, 284965, +, 219, 21540; cds-WP _032430346.1, NZ_KK737550.1, 285186, 286226, +, 1041, 177; cds-WP_004185495.1, NZ_KK737550.1, 286329, 287522, -, 1194, 472; cds-WP_002915977.1, NZ_KK737550.1, 287515, 289674, -, 2160, 13923; cds-AF52_RS28115, NZ_KK737550.1, 289938, 290202, -, 265, 0; cds-WP_002915981.1, NZ_KK737550.1, 290296, 291312, +, 1017, 3876; cds-WP_021440677.1, NZ_KK737550.1, 291273, 291752, -, 480, 34; cds-WP_032430347.1, NZ_KK737550.1, 291749, 292522, -, 774, 186; cds-WP_004174521.1, NZ_KK737550.1, 292590, 294017, -, 1428, 15142; cds-WP_004174520.1, NZ_KK737550.1, 294025, 295362, -, 1338, 5; cds-WP_021440678.1, NZ_KK737550.1, 295662, 296663, +, 1002, 53852; cds-WP_002915990.1, NZ_KK737550.1, 296656, 297918, -, 1263, 24813; cds-WP_002915991.1, NZ_KK737550.1, 298055, 298981, +, 927, 0; cds-WP_032428400.1, NZ_KK737550.1, 298947, 299660, -, 714, 348; cds-WP_002915993.1, NZ_KK737550.1, 299800, 300126, +, 327, 0; cds-WP_002915995.1, NZ_KK737550.1, 300579, 301469, +, 891, 58; cds-WP_002915996.1, NZ_KK737550.1, 301462, 302364, +, 903, 1777; cds-WP_021440680.1, NZ_KK737550.1, 302377, 303504, +, 1128, 1123; cds-WP_002915998.1, NZ_KK737550.1, 303521, 304807, +, 1287, 11755; cds-WP_032415517.1, NZ_KK737550.1, 304867, 306210, -, 1344, 0; cds-WP_026005853.1, NZ_KK737550.1, 306332, 307765, -, 1434, 2; cds-WP_002916000.1, NZ_KK737550.1, 307785, 309026, -, 1242, 18; cds-WP_004143987.1, NZ_KK737550.1, 309039, 309173, -, 135, 0; cds-WP_032428401.1, NZ_KK737550.1, 309268, 310263, +, 996, 14; cds-WP_002916001.1, NZ_KK737550.1, 310260, 311681, -, 1422, 16; cds-WP_002916003.1, NZ_KK737550.1, 311977, 312738, -, 762, 4233; cds-WP_002916048.1, NZ_KK737550.1, 313224, 314399, +, 1176, 345; cds-WP_004143995.1, NZ_KK737550.1, 314535, 315230, -, 696, 0; cds-WP_002916052.1, NZ_KK737550.1, 315479, 316657, -, 1179, 5957; cds-WP_002916055.1, NZ_KK737550.1, 316776, 317645, -, 870, 2; cds-WP_002916056.1, NZ_KK737550.1, 317748, 318209, +, 462, 10; cds-WP_002916058.1, NZ_KK737550.1, 318333, 319562, +, 1230, 42815; cds-WP_002916061.1, NZ_KK737550.1, 319681, 320559, +, 879, 584; cds-WP_013815099.1-72, NZ_KK737550.1, 320898, 321866, -, 969, 7025; cds-AF52_RS02175, NZ_KK737550.1, 321899, 322303, +, 405, 4; cds-WP_013815099.1-73, NZ_KK737550.1, 322616, 323584, +, 969, 6911; cds-WP_021440689.1, NZ_KK737550.1, 323835, 324443, +, 609, 603; cds-WP_002916190.1, NZ_KK737550.1, 324922, 325470, +, 549, 0; cds-WP_021440690.1, NZ_KK737550.1, 325541, 326077, +, 537, 0; cds-WP_002916192.1, NZ_KK737550.1, 326106, 326831, +, 726, 0; cds-WP_032430351.1, NZ_KK737550.1, 326913, 329525, +, 2613, 0; cds-WP_004185520.1, NZ_KK737550.1, 329536, 330063, +, 528, 0; cds-WP_004229447.1, NZ_KK737550.1, 330091, 330576, +, 486, 0; cds-WP_032423847.1, NZ_KK737550.1, 330594, 331496, +, 903, 0; cds-WP_021440694.1, NZ_KK737550.1, 331493, 332905, +, 1413, 23; cds-WP_002916201.1, NZ_KK737550.1, 332948, 333220, -, 273, 0; cds-WP_004144031.1, NZ_KK737550.1, 333232, 333501, -, 270, 161; cds-WP_002916204.1, NZ_KK737550.1, 333668, 333940, +, 273, 585; cds-WP_004174502.1, NZ_KK737550.1, 333947, 334972, +, 1026, 793; cds-WP_004185523.1, NZ_KK737550.1, 334985, 336922, +, 1938, 2299; cds-WP_032430352.1, NZ_KK737550.1, 336919, 338367, +, 1449, 13; cds-WP_002916274.1, NZ_KK737550.1, 338632, 338931, -, 300, 2022; cds-WP_002916277.1, NZ_KK737550.1, 339116, 340669, -, 1554, 456448; cds-WP_016947386.1, NZ_KK737550.1, 341142, 341564, -, 423, 1823; cds-WP_023301507.1, NZ_KK737550.1, 341574, 342866, -, 1293, 449; cds-WP_002916281.1, NZ_KK737550.1, 342918, 343247, -, 330, 0; cds-WP_002916282.1, NZ_KK737550.1, 343466, 343759, +, 294, 155; cds-WP_002916283.1, NZ_KK737550.1, 343790, 344362, +, 573, 2994; cds-WP_014599254.1, NZ_KK737550.1, 344441, 344644, +, 204, 0; cds-WP_004174493.1, NZ_KK737550.1, 344813, 345712, -, 900, 6439; cds-WP_004151785.1, NZ_KK737550.1, 345851, 346159, +, 309, 6; cds-WP_023285538.1, NZ_KK737550.1, 346168, 346725, +, 558, 2; cds-WP_032428403.1, NZ_KK737550.1, 346746, 347765, +, 1020, 0; cds-WP_004185540.1, NZ_KK737550.1, 347798, 348601, +, 804, 0; cds-WP_015958948.1, NZ_KK737550.1, 348965, 349894, -, 930, 3461; cds-AF52_RS02025, NZ_KK737550.1, 350024, 351103, +, 1080, 7; cds-WP_013815099.1-74, NZ_KK737550.1, 351161, 352129, -, 969, 5948; cds-AF52_RS26135, NZ_KK737550.1, 352161, 352478, +, 318, 0; cds-WP_004157874.1, NZ_KK737550.1, 352800, 353513, -, 714, 16674; cds-WP_002916298.1, NZ_KK737550.1, 353830, 354384, +, 555, 370; cds-WP_002916299.1, NZ_KK737550.1, 354620, 356137, -, 1518, 98981; cds-WP_095858446.1, NZ_KK737550.1;NZ_KK737550.1, 356147;357171, 357169;357245, -;-, 1098, 134972; cds-WP_004149758.1, NZ_KK737550.1, 357331, 359064, -, 1734, 33923; cds-WP_004185548.1, NZ_KK737550.1, 359070, 359783, -, 714, 8279; cds-WP_004144729.1, NZ_KK737550.1, 359806, 360702, -, 897, 5659; cds-WP_004144730.1, NZ_KK737550.1, 360803, 361324, +, 522, 7368; cds-WP_002916310.1, NZ_KK737550.1, 361331, 361741, -, 411, 4802; cds-


WP_002916312.1, NZ_KK737550.1, 361722, 361988, -, 267, 3366; cds-WP_004185555.1, NZ_KK737550.1, 362234, 363217, +, 984, 9759; cds-WP_002916317.1, NZ_KK737550.1, 363368, 364027, -, 660, 756; cds-WP_004144734.1, NZ_KK737550.1, 364191, 364502, -, 312, 0; cds-WP_002916321.1, NZ_KK737550.1, 364552, 365280, +, 729, 199; cds-WP_002916322.1, NZ_KK737550.1, 365399, 366832, +, 1434, 384; cds-WP_004185561.1, NZ_KK737550.1, 366957, 367316, +, 360, 0; cds-WP_009308616.1, NZ_KK737550.1, 367366, 369375, +, 2010, 1; cds-WP_009308617.1, NZ_KK737550.1, 369377, 369988, +, 612, 5; cds-WP_009308618.1, NZ_KK737550.1, 369978, 370481, +, 504, 1; cds-WP_004174442.1, NZ_KK737550.1, 370602, 371345, -, 744, 326; cds-WP_004900541.1, NZ_KK737550.1, 371408, 374281, -, 2874, 1279756; cds-WP_002916479.1, NZ_KK737550.1, 374488, 374877, -, 390, 455166; cds-WP_002916480.1, NZ_KK737550.1, 374902, 375996, -, 1095, 485020; cds-WP_002916481.1, NZ_KK737550.1, 376419, 377621, -, 1203, 4360; cds-WP_021440702.1, NZ_KK737550.1, 377632, 378810, -, 1179, 15; cds-WP_002916483.1, NZ_KK737550.1, 378807, 380123, -, 1317, 20014; cds-WP_002916486.1, NZ_KK737550.1, 380147, 380725, -, 579, 157; cds-WP_002916488.1, NZ_KK737550.1, 380892, 381221, +, 330, 7542; cds-WP_004144746.1, NZ_KK737550.1, 381545, 382141, +, 597, 13511; cds-WP_002916493.1, NZ_KK737550.1, 382225, 383457, -, 1233, 23718; cds-WP_002916495.1, NZ_KK737550.1, 383727, 384386, -, 660, 563; cds-WP_002916497.1, NZ_KK737550.1, 384554, 385447, +, 894, 193; cds-WP_002916499.1, NZ_KK737550.1, 385501, 386268, -, 768, 44696; cds-WP_004144747.1, NZ_KK737550.1, 386358, 386993, -, 636, 54; cds-WP_002916504.1, NZ_KK737550.1, 387145, 388002, -, 858, 6997; cds-WP_004144748.1, NZ_KK737550.1, 388193, 389272, -, 1080, 1627091; cds-WP_002916508.1, NZ_KK737550.1, 389370, 390533, -, 1164, 245189; cds-WP_002916512.1, NZ_KK737550.1, 390573, 391601, -, 1029, 34366; cds-WP_004174438.1, NZ_KK737550.1, 391987, 393978, -, 1992,494518; cds-WP_004151780.1, NZ_KK737550.1, 394257, 395015, +, 759, 1776; cds-WP_032428408.1, NZ_KK737550.1, 395393, 396661, +, 1269, 0; cds-WP_021440705.1, NZ_KK737550.1, 396798, 398438, -, 1641, 0; cds-WP_032430353.1, NZ_KK737550.1, 398452, 399921, -, 1470, 0; cds-WP_004211378.1, NZ_KK737550.1, 399937, 400701, -, 765, 0; cds-WP_032430354.1, NZ_KK737550.1, 400711, 401505, -, 795, 0; cds-WP_032428409.1, NZ_KK737550.1, 401489, 402259, -, 771, 0; cds-WP_032430355.1, NZ_KK737550.1, 402269, 402799, -, 531, 8; cds-WP_004149797.1, NZ_KK737550.1, 402810, 404066, -, 1257, 0; cds-WP_004174432.1, NZ_KK737550.1, 404093, 405289, -, 1197, 6; cds-WP_004149799.1, NZ_KK737550.1, 405286, 406212, -, 927, 12562; cds-WP_021440707.1, NZ_KK737550.1, 406301, 407089, -, 789, 21015; cds-WP_021440708.1, NZ_KK737550.1, 407103, 407852, -, 750, 26308; cds-WP_004174429.1, NZ_KK737550.1, 407852, 408874, -, 1023, 46956; cds-WP_004144765.1, NZ_KK737550.1, 408885, 409193, -, 309, 616; cds-WP_004151769.1, NZ_KK737550.1, 409190, 409513, -, 324, 528; cds-WP_032428411.1, NZ_KK737550.1, 409941, 411161, +, 1221, 9; cds-WP_002916572.1, NZ_KK737550.1, 411289, 412209, -, 921, 48275; cds-WP_004149805.1, NZ_KK737550.1, 412443, 414419, -, 1977, 7027; cds-WP_002916578.1, NZ_KK737550.1, 414428, 414559, -, 132, 42; cds-WP_157828762.1, NZ_KK737550.1, 414740, 415063, +, 324, 5408; cds-WP_004149807.1, NZ_KK737550.1, 415261, 416415, +, 1155, 21538; cds-WP_002916587.1, NZ_KK737550.1, 416803, 418197, +, 1395, 641; cds-WP_002916588.1, NZ_KK737550.1, 418275, 418775, +, 501, 76; cds-WP_002916589.1, NZ_KK737550.1, 418870, 419577, +, 708, 10; cds-WP_002916597.1, NZ_KK737550.1, 419669, 420400, +, 732, 7886; cds-WP _002916600.1, NZ_KK737550.1, 420421, 421371, +, 951, 49391; cds-WP_002916603.1, NZ_KK737550.1, 421546, 422109, +, 564, 7245; cds-WP_002916605.1, NZ_KK737550.1, 422109, 422525, +, 417, 57; cds-WP_002916607.1, NZ_KK737550.1, 422578, 423231, -, 654, 516; cds-WP_004149811.1, NZ_KK737550.1, 423580, 424560, -, 981, 0; cds-WP_004144780.1, NZ_KK737550.1, 424577, 425278, +, 702, 77; cds-WP_002916613.1, NZ_KK737550.1, 425299, 425865, +, 567, 4439; cds-WP _002916614.1, NZ_KK737550.1, 425862, 426152, +, 291, 19011; cds-WP_002916615.1, NZ_KK737550.1, 426165, 426758, +, 594, 23882; cds-WP_004149812.1, NZ_KK737550.1, 426751, 427887, +, 1137, 70; cds-WP_023285550.1, NZ_KK737550.1, 428193, 429179, +, 987, 12; cds-WP_025861936.1, NZ_KK737550.1, 429226, 429729, +, 504, 2; cds-WP_004149816.1, NZ_KK737550.1, 429729, 431030, +, 1302, 10349; cds-WP_019704316.1, NZ_KK737550.1, 431078, 431797, -, 720, 60049; cds-WP_002916620.1, NZ_KK737550.1, 431848, 432174, -, 327, 2853; cds-WP_002916627.1, NZ_KK737550.1, 432174, 432893, -, 720, 2359; cds-AF52_RS01615, NZ_KK737550.1, 433030, 434087, +, 1058, 1132; cds-WP_004105744.1, NZ_KK737550.1, 434116, 434391, +, 276, 11034; cds-WP_004900580.1, NZ_KK737550.1, 434441, 435523, +, 1083,32301; cds-WP_004144787.1, NZ_KK737550.1, 435715, 436968, +, 1254, 6484; cds-WP_009484134.1, NZ_KK737550.1, 437012, 439150, -, 2139, 13; cds-WP_002916694.1, NZ_KK737550.1, 439570, 440283, +, 714, 13995; cds-AF52_RS01580, NZ_KK737550.1, 441124, 441340, -, 217, 2353; cds-WP_004188553.1, NZ_KK737550.1, 441437, 442030, -, 594, 1903; cds-WP_021314147.1, NZ_KK737550.1, 442734, 443219, -, 486, 1924; cds-WP_004150912.1, NZ_KK737550.1, 443216, 443509, -, 294, 10; cds-AF52_RS27585, NZ_KK737550.1, 444170, 444344, +, 175, 348; cds-WP_032175380.1-2, NZ_KK737550.1, 445134, 445482, +, 349, 1650; cds-WP_004217775.1, NZ_KK737550.1, 445564, 446940, +, 1377, 13; cds-WP_004150915.1, NZ_KK737550.1, 446951, 448099, +, 1149, 4032; cds-WP_004188550.1, NZ_KK737550.1, 448100, 449011, -, 912, 0; cds-WP_021440720.1, NZ_KK737550.1, 449109, 449711, +, 603, 1; cds-WP_004174409.1, NZ_KK737550.1, 449798, 450142, +, 345, 3; cds-WP_002916738.1, NZ_KK737550.1, 450342, 450530, +, 189, 3250; cds-WP_004149825.1, NZ_KK737550.1, 450707, 451888, -, 1182, 747; cds-WP _002916740.1, NZ_KK737550.1, 452034, 453899, -, 1866, 21930; cds-WP_004217169.1, NZ_KK737550.1, 453976, 454098, -, 123, 0; cds-WP_004150918.1, NZ_KK737550.1, 454119, 454679, +, 561, 3; cds-WP_002916742.1, NZ_KK737550.1, 454727, 455593, +, 867, 404; cds-WP_002916743.1, NZ_KK737550.1, 455666, 455953, -, 288, 0; cds-WP _004144560.1, NZ_KK737550.1, 456032, 456919, -, 888, 1105; cds-WP_004105804.1, NZ_KK737550.1, 457041, 457535, -, 495, 1472; cds-WP_032412422.1, NZ_KK737550.1, 457642, 459165, -, 1524, 213; cds-WP _002916782.1, NZ_KK737550.1, 459179, 460597, -, 1419, 5729; cds-WP_002916785.1, NZ_KK737550.1, 460802, 461227, -, 426, 10923; cds-WP_004174395.1, NZ_KK737550.1, 461234, 461965, -, 732, 1464; cds-WP_004149836.1, NZ_KK737550.1, 462216, 463403, +, 1188, 108; cds-WP_002916791.1, NZ_KK737550.1, 463535, 464194, +, 660, 741; cds-WP_032430356.1, NZ_KK737550.1, 464244, 465143, -, 900, 4367; cds-WP_004144551.1, NZ_KK737550.1, 465340, 466503, +, 1164, 59; cds-WP _023286874.1, NZ_KK737550.1, 466649, 467476, +, 828, 0; cds-WP_004144550.1, NZ_KK737550.1, 467512, 468039, -, 528, 36; cds-WP_004174383.1, NZ_KK737550.1, 468096, 470279, -, 2184, 70985; cds-WP_004144547.1, NZ_KK737550.1, 470403, 471815, -, 1413, 32584; cds-WP_002916826.1, NZ_KK737550.1, 471899, 472636, -, 738, 64957; cds-WP_004181324.1, NZ_KK737550.1, 472828, 475086, -, 2259, 56355; cds-WP_002916831.1, NZ_KK737550.1, 475208, 476077, -, 870, 50; cds-WP _002916833.1, NZ_KK737550.1, 476155, 476550, -, 396, 4700; cds-WP_002916836.1, NZ_KK737550.1, 476701, 477360, +, 660, 38; cds-WP_021440728.1, NZ_KK737550.1, 477357, 478706, +, 1350, 0; cds-WP_002916840.1, NZ_KK737550.1, 478813, 479394, +, 582, 953; cds-WP_002916842.1, NZ_KK737550.1, 479475, 479789, +, 315, 34802; cds-WP_002916844.1, NZ_KK737550.1, 479862, 481757, -, 1896, 75575; cds-WP_002916845.1, NZ_KK737550.1, 481788, 482363, -, 576, 73233; cds-WP_002916846.1, NZ_KK737550.1, 482363, 483190, -, 828, 27868; cds-WP_002916847.1, NZ_KK737550.1, 483215, 483637, -, 423, 21885; cds-WP_002916848.1, NZ_KK737550.1, 483634, 484266, -, 633, 9449; cds-WP_004150921.1, NZ_KK737550.1, 484463, 485932, +, 1470, 123649; cds-WP_002916849.1, NZ_KK737550.1, 486100, 486771, +, 672, 24387; cds-WP_004900674.1, NZ_KK737550.1, 486777, 487937, +, 1161, 76494; cds-WP_004174357.1, NZ_KK737550.1, 487982, 488773, -, 792, 206; cds-WP_032430358.1, NZ_KK737550.1, 488960, 489730, +, 771, 35; cds-WP_004185664.1, NZ_KK737550.1, 489792, 490445, -, 654, 250; cds-WP_002916856.1, NZ_KK737550.1, 490823, 491095, +, 273, 7971; cds-WP_002916857.1, NZ_KK737550.1, 491131, 491328, -, 198, 11036; cds-AF52_RS28140, NZ_KK737550.1, 491320, 491470, +, 151, 0; cds-WP_002916858.1, NZ_KK737550.1, 491548, 492981, -, 1434, 11597; cds-WP 002916860.1, NZ_KK737550.1, 493040, 495877, -, 2838, 15222; cds-WP_009308672.1, NZ_KK737550.1, 495898, 497196, -, 1299, 65; cds-WP_002916862.1, NZ_KK737550.1, 497411, 498031, +, 621, 33678; cds-WP_002916864.1, NZ_KK737550.1, 498093, 499334, +, 1242, 23721; cds-WP_004144532.1, NZ_KK737550.1, 499346, 500167, -, 822, 8568; cds-WP_004150923.1, NZ_KK737550.1, 500366, 500749, -, 384, 3729; cds-WP_004144530.1, NZ_KK737550.1, 500857, 501474, +, 618, 3; cds-WP_021440736.1, NZ_KK737550.1, 501606, 501725, +, 120, 0; cds-AF52_RS27590, NZ_KK737550.1, 501736, 501798, -, 63, 0; cds-WP_013815099.1-75, NZ_KK737550.1, 501856, 502824, -, 969, 8190; cds-WP_032430359.1, NZ_KK737550.1, 502826, 502948, -, 123, 0; cds-WP_004174349.1, NZ_KK737550.1, 502938, 503762, +, 825, 2; cds-WP_002916871.1, NZ_KK737550.1, 503772, 504074, +, 303, 0; cds-WP_021440738.1, NZ_KK737550.1, 504084, 504404, +, 321, 0; cds-WP_015958999.1, NZ_KK737550.1, 504397, 506100, +, 1704, 1; cds-WP_004215466.1, NZ_KK737550.1, 506110, 506586, +, 477, 0; cds-WP_016532672.1, NZ_KK737550.1, 506588, 507262, +, 675, 1; cds-WP_002916877.1, NZ_KK737550.1, 507271, 507888, +, 618, 3362; cds-WP_025367880.1, NZ_KK737550.1, 508042, 509649, +, 1608, 3667; cds-WP_004900709.1, NZ_KK737550.1, 509694, 510707, -, 1014, 14; cds-WP _001144069.1, NZ_KK737550.1, 510945, 511160, +, 216, 42897; cds-WP_004149864.1, NZ_KK737550.1, 511272, 513017, +, 1746, 145901; cds-WP_004174339.1, NZ_KK737550.1, 513236, 515077, +, 1842, 329702; cds-WP_002917636.1, NZ_KK737550.1, 515177, 515683, -, 507, 0; cds-WP_004174338.1, NZ_KK737550.1, 516020, 516238, -, 219, 162; cds-WP_032430361.1, NZ_KK737550.1, 516309, 517406, -, 1098, 0; cds-WP_004185683.1, NZ_KK737550.1, 517403, 517888, -, 486, 0; cds-AF52_RS01195, NZ_KK737550.1, 517885, 519153, -, 1269, 2; cds-WP_020806188.1-6, NZ_KK737550.1, 519222, 520202, +, 981, 7952; cds-WP_050484295.1, NZ_KK737550.1, 520559, 522556, -, 1998, 468202; cds-WP_032430362.1, NZ_KK737550.1, 522572, 523600, -, 1029, 24116; cds-WP_032414744.1, NZ_KK737550.1, 523929, 524162, -, 234, 2424; cds-WP_032414845.1, NZ_KK737550.1, 524174, 524362, -, 189, 16; cds-WP_032430364.1, NZ_KK737550.1, 524546, 526954, -, 2409, 2; cds-AF52_RS27605, NZ_KK737550.1, 527242, 527414, +, 173, 566; cds-AF52_RS0124695, NZ_KK737550.1, 528005, 528295, +, 291, 3535; cds-WP_021441030.1, NZ_KK737550.1, 528625, 530883, +, 2259, 17; cds-WP _004177844.1, NZ_KK737550.1, 531147, 531515, -, 369, 3; cds-WP_004177843.1, NZ_KK737550.1, 531549, 533309, -, 1761, 511; cds-WP_004146634.1, NZ_KK737550.1, 533683, 533913, -, 231, 0; cds-WP_013815099.1-76, NZ_KK737550.1, 533996, 534964, -, 969, 3602; cds-WP_023285711.1, NZ_KK737550.1, 535001, 537424, +, 2424, 63511; cds-WP_013815099.1-77, NZ_KK737550.1, 537590, 538558, -, 969, 6373; cds-WP_004198387.1, NZ_KK737550.1, 538641, 539402, -, 762, 2; cds-WP_002885046.1, NZ_KK737550.1, 539413, 540426, -, 1014, 400; cds-WP_004151742.1, NZ_KK737550.1, 540423, 541181, -, 759, 0; cds-WP_032430384.1, NZ_KK737550.1, 541357, 542385, +, 1029, 0; cds-WP_013815099.1-78, NZ_KK737550.1, 542403, 543371, +, 969, 4083; cds-WP_004174268.1, NZ_KK737550.1, 543545, 543796, -, 252, 39; cds-WP_032430367.1, NZ_KK737550.1, 543799, 544413, -, 615, 1628; cds-WP_004174272.1, NZ_KK737550.1, 544514, 544750, +, 237, 7; cds-AF52_RS26555, NZ_KK737550.1, 544785, 545111, +, 327, 127; cds-WP_013815099.1-79, NZ_KK737550.1, 545145, 546113, +, 969, 4539; cds-AF52_RS0124710, NZ_KK737550.1, 546172, 546360, +, 189, 0; cds-WP_004174277.1, NZ_KK737550.1, 546368, 546568, +, 201, 0; cds-AF52_RS01075, NZ_KK737550.1, 546532, 546735, +, 204, 0; cds-WP_002885077.1, NZ_KK737551.1, 251, 709, -, 459, 7; cds-WP_004151738.1, NZ_KK737551.1, 794, 1123, +, 330, 4; cds-WP_023283136.1, NZ_KK737551.1, 1108, 2712, -, 1605, 2678; cds-WP_004177826.1, NZ_KK737551.1, 3219, 3500, +, 282, 0; cds-WP_004186517.1, NZ_KK737551.1, 3547,


4404, -, 858, 0; cds-WP _004177833.1, NZ_KK737551.1, 4401, 5234, -, 834, 5; cds-WP _004177835.1, NZ_KK737551.1, 5294, 6433, -, 1140, 0; cds-WP _013815099.1-80, NZ_KK737551.1, 6546, 7514, -, 969, 4148; cds-AF52_RS01030, NZ_KK737551.1, 7646, 8203, -, 558, 0; cds-AF52_RS01025, NZ_KK737551.1, 8492, 9028, -, 537, 35; cds-AF52_RS0124720, NZ_KK737551.1, 9021, 9488, -, 468, 0; cds-AF52_RS01020, NZ_KK737551.1, 10314, 10625, -, 312, 0; cds-AF52_RS26200, NZ_KK737551.1, 10743, 10920, +, 178, 407; cds-AF52_RS01015, NZ_KK737551.1, 11477, 12304, -, 828, 26; cds-AF52_RS01010, NZ_KK737551.1, 12683, 13012, +, 330, 0; cds-AF52_RS27655, NZ_KK737551.1, 13210, 13361, +, 152, 432; cds-AF52_RS01000, NZ_KK737551.1, 13462, 13718, +, 257, 623; cds-WP _002885500.1, NZ_KK737551.1, 14025, 15053, -, 1029, 8751; cds-WP _002885506.1, NZ_KK737551.1, 15095, 15661, +, 567, 64376; cds-WP_002885511.1, NZ_KK737551.1, 15735, 15866, +, 132, 376; cds-WP _002885518.1, NZ_KK737551.1, 16026, 16172, +, 147, 193; cds-WP_002885521.1, NZ_KK737551.1, 16316, 16633, +, 318, 11; cds-WP_002885523.1, NZ_KK737551.1, 16630, 17163, -, 534, 0; cds-WP_002885526.1, NZ_KK737551.1, 17277, 17636, -, 360, 4; cds-WP _002885530.1, NZ_KK737551.1, 17647, 18042, -, 396, 789; cds-WP_004177729.1, NZ_KK737551.1, 18053, 18787, -, 735, 7918; cds-WP_004177727.1, NZ _KK737551.1, 18780, 20570, -, 1791, 10998; cds-WP _004146714.1, NZ_KK737551.1, 20846, 21823, +, 978, 1; cds-WP _021441059.1, NZ_KK737551.1, 22006, 23508, +, 1503, 2; cds-WP _004146716.1, NZ_KK737551.1, 23546, 26875, -, 3330, 29627; cds-WP_002885536.1, NZ_KK737551.1, 26899, 27861, -, 963, 41581; cds-WP_002885537.1, NZ_KK737551.1, 28022, 29083, -, 1062, 966; cds-WP_002885538.1, NZ_KK737551.1, 29178, 29723, +, 546, 51; cds-WP _032430397.1, NZ_KK737551.1, 29767, 30498, -, 732, 2; cds-WP _004210690.1, NZ_KK737551.1, 31431, 32570, -, 1140, 11038; cds-WP_187079197.1, NZ_KK737551.1, 32584, 34095, +, 1512, 49; cds-WP _004220675.1, NZ_KK737551.1, 34100, 34549, +, 450, 2571; cds-WP _004152021.1, NZ_KK737551.1, 34566, 35921, +, 1356, 1073; cds-WP _004152020.1, NZ_KK737551.1, 35932, 37791, +, 1860, 1429; cds-WP _032430401.1, NZ_KK737551.1, 37784, 38734, +, 951, 68613; cds-WP_002885659.1, NZ_KK737551.1, 38827, 39135, +, 309, 121498; cds-WP _004146725.1, NZ_KK737551.1, 39211, 40491, +, 1281, 54204; cds-WP_004146726.1, NZ_KK737551.1, 40557, 41819, +, 1263, 154711; cds-WP_002885662.1, NZ_KK737551.1, 41822, 42826, +, 1005, 262957; cds-WP_002885663.1, NZ_KK737551.1, 42909, 43199, -, 291, 0; cds-WP _002885664.1, NZ_KK737551.1, 43422, 43619, +, 198, 0; cds-WP _002885665.1, NZ_KK737551.1, 43722, 45020, +, 1299, 44878; cds-WP_002885667.1, NZ_KK737551.1, 45171, 45596, +, 426, 5112; cds-WP _004192475.1, NZ_KK737551.1, 45633, 48065, +, 2433, 122281; cds-WP_002885669.1, NZ_KK737551.1, 48147, 48878, +, 732, 24469; cds-WP _021441063.1, NZ_KK737551.1, 49004, 50641, +, 1638, 8467; cds-WP _002885673.1, NZ_KK737551.1, 50632, 50907, -, 276, 10304; cds-WP_002885674.1, NZ_KK737551.1, 51045, 51353, -, 309, 9040; cds-WP _032428483.1, NZ_KK737551.1, 51563, 52279, +, 717, 4; cds-WP _004177697.1, NZ_KK737551.1, 52276, 53031, -, 756, 29; cds-WP _032430402.1, NZ_KK737551.1, 53139, 54203, -, 1065, 0; cds-WP_016946098.1, NZ_KK737551.1, 54566, 55966, +, 1401, 0; cds-WP _002885682.1, NZ_KK737551.1, 55979, 56284, +, 306, 0; cds-WP _002885683.1, NZ_KK737551.1, 56294, 56761, +, 468, 0; cds-WP _002885684.1, NZ_KK737551.1, 56775, 57425, +, 651, 6; cds-WP_004210671.1, NZ_KK737551.1, 57435, 58289, +, 855, 0; cds-WP_004178347.1, NZ_KK737551.1, 58289, 58975, +, 687, 1; cds-WP_009309325.1, NZ_KK737551.1, 59038, 60231, -, 1194, 0; cds-WP _002885689.1, NZ_KK737551.1, 60381, 60656, -, 276, 0; cds-WP _002885691.1, NZ_KK737551.1, 60997, 61392, +, 396, 265942; cds-WP _002885722.1, NZ_KK737551.1, 61398, 61712, +, 315, 341717; cds-WP _000135199.1, NZ_KK737551.1, 61717, 61944, +, 228, 358153; cds-WP_002886682.1, NZ_KK737551.1, 61986, 62435, +, 450, 277067; cds-WP_004177687.1, NZ_KK737551.1, 62544, 63218, -, 675, 2329; cds-WP _002886687.1, NZ_KK737551.1, 63437, 64057, +, 621, 843; cds-WP_002886688.1, NZ_KK737551.1, 64362, 65765, +, 1404, 190240; cds-WP_004210666.1, NZ_KK737551.1, 65870, 66532, -, 663, 2; cds-WP_002886691.1, NZ_KK737551.1, 66615, 67586, -, 972, 0; cds-WP_032430405.1, NZ_KK737551.1, 67662, 68486, -, 825, 0; cds-WP_021441067.1, NZ_KK737551.1, 68564, 69412, -, 849, 12; cds-WP _004152015.1, NZ_KK737551.1, 69502, 69873, +, 372, 6; cds-WP_021441068.1, NZ_KK737551.1, 69928, 71871, -, 1944, 11637; cds-WP _032430406.1, NZ_KK737551.1, 72063, 72806, +, 744, 5; cds-WP_002886706.1, NZ_KK737551.1, 72796, 73353, -, 558, 2212; cds-WP_002886707.1, NZ_KK737551.1, 73677, 73883, +, 207, 7; cds-WP_004178353.1, NZ_KK737551.1, 73945, 74817, -, 873, 11019; cds-WP_004222103.1, NZ_KK737551.1, 74848, 76857, -, 2010, 6; cds-WP_016946104.1, NZ_KK737551.1, 76876, 78108, -, 1233, 0; cds-WP _002886718.1, NZ_KK737551.1, 78310, 79647, -, 1338, 628; cds-WP _002886721.1, NZ_KK737551.1, 79828, 80466, -, 639, 112; cds-WP _002886722.1, NZ_KK737551.1, 80675, 82408, +, 1734, 3680; cds-WP_032430407.1, NZ_KK737551.1, 82405, 86181, +, 3777, 23289; cds-WP _002886724.1, NZ_KK737551.1, 86184, 86528, +, 345, 90; cds-WP_021441069.1, NZ_KK737551.1, 86566, 87039, -, 474, 60; cds-WP_171789277.1, NZ_KK737551.1, 87011, 87733, -, 723, 53; cds-WP_02144107.1, NZ_KK737551.1, 87889, 89076, -, 1188, 4947; cds-WP _002886766.1, NZ_KK737551.1, 89151, 89681, -, 531, 43916; cds-WP_002886769.1, NZ_KK737551.1, 90085, 91041, +, 957, 2647; cds-AF52_RS00620, NZ_KK737551.1, 91165, 92456, +, 1292, 0; cds-WP_032430409.1, NZ_KK737551.1, 92467, 93492, +, 1026,0; cds-WP_021312675.1, NZ_KK737551.1, 93479, 94477, +, 999, 270; cds-WP_002886827.1, NZ_KK737551.1, 94520, 95518, -, 999, 109287; cds-WP_002886886.1, NZ_KK737551.1, 95694, 97067, +, 1374, 1293; cds-WP _004177666.1, NZ_KK737551.1, 97136, 97663, +, 528, 17; cds-WP_032430410.1, NZ_KK737551.1, 97707, 98915, -, 1209, 3723; cds-WP _004177664.1, NZ_KK737551.1, 99407, 99958, -, 552, 14403; cds-WP _004152265.1, NZ_KK737551.1, 100054, 101406, +, 1353, 4104; cds-WP_021441074.1, NZ_KK737551.1, 101443, 101829, +, 387, 46482; cds-WP _002886894.1, NZ _KK737551.1, 102119, 102457, +, 339, 58; cds-WP_002886895.1, NZ_KK737551.1, 102468, 102830, +, 363, 3; cds-WP_002886896.1, NZ _KK737551.1, 102833, 103132, +, 300, 148; cds-WP_002886897.1, NZ_KK737551.1, 103154, 103930, +, 777, 30155; cds-WP_004152267.1, NZ_KK737551.1, 103944, 104588, +, 645, 369; cds-WP _004152268.1, NZ_KK737551.1, 104694, 105827, +, 1134, 21293; cds-WP_021441075.1, NZ_KK737551.1, 105811, 106929, +, 1119, 629; cds-WP_002886899.1, NZ_KK737551.1, 106926, 107666, +, 741, 445; cds-WP_002886900.1, NZ_KK737551.1, 107733, 108887, +, 1155, 16807; cds-WP _004152270.1, NZ_KK737551.1, 108910, 110820, +, 1911, 131; cds-WP _032430412.1, NZ_KK737551.1, 110898, 111140, +, 243, 513; cds-WP_002886902.1, NZ_KK737551.1, 111130, 111414, +, 285, 646; cds-WP _004222151.1, NZ_KK737551.1, 111418, 111882, -, 465, 33846; cds-WP_004186701.1, NZ_KK737551.1, 112190, 114328, -, 2139, 778; cds-WP _021441079.1, NZ _KK737551.1, 114685, 115428, -, 744, 24040; cds-WP _032410138.1, NZ _KK737551.1, 115431, 115604, -, 174, 0; cds-WP _004178377.1, NZ_KK737551.1, 115689, 115997, +, 309, 1; cds-WP_021441081.1, NZ _KK737551.1, 116088, 117395, +, 1308, 65; cds-WP_004146783.1, NZ_KK737551.1, 117422, 118774, +, 1353, 40159; cds-WP _004178379.1, NZ_KK737551.1, 118830, 120485, -, 1656, 347602; cds-WP _021441082.1, NZ_KK737551.1, 120537, 121955, -, 1419, 514974; cds-WP_004177658.1, NZ_KK737551.1, 122086, 123033, -, 948, 24; cds-WP _009309303.1, NZ_KK737551.1, 123413, 126121, +, 2709, 11; cds-WP_002886926.1, NZ_KK737551.1, 126195, 126581, -, 387, 11840; cds-WP _002886927.1, NZ_KK737551.1, 126734, 127195, -, 462, 30992; cds-WP _002886928.1, NZ_KK737551.1, 127209, 128144, -, 936, 33057; cds-WP_002886930.1, NZ_KK737551.1, 128181, 128285, -, 105, 0; cds-WP_002886939.1, NZ_KK737551.1, 128480, 128932, +, 453, 0; cds-WP _002886940.1, NZ_KK737551.1, 129175, 130149, +, 975, 1; cds-WP _002886941.1, NZ_KK737551.1, 130161, 130991, +, 831, 0; cds-WP _021441084.1, NZ_KK737551.1, 131086, 132651, +, 1566, 0; cds-WP _004152274.1, NZ_KK737551.1, 132708, 134126, +, 1419, 34; cds-WP_002886945.1, NZ_KK737551.1, 134211, 134936, +, 726, 65335; cds-WP_002886946.1, NZ_KK737551.1, 134939, 135943, -, 1005, 33; cds-WP _002886947.1, NZ_KK737551.1, 136107, 136529, +, 423, 16138; cds-WP _004186726.1, NZ_KK737551.1, 136588, 137352, +, 765, 19575; cds-WP_004152275.1, NZ_KK737551.1, 137625, 138128, -, 504, 1968; cds-WP_032430414.1, NZ_KK737551.1, 138249, 141104, -, 2856, 69623; cds-WP_002886953.1, NZ_KK737551.1, 141104, 141547, -, 444,792; cds-WP_002886954.1, NZ_KK737551.1, 141667, 143178, -, 1512,75760; cds-WP_002886955.1, NZ_KK737551.1, 143568, 144665, +, 1098, 17; cds-WP_002886956.1, NZ_KK737551.1, 144665, 145747, +, 1083, 1880; cds-WP_002886957.1, NZ_KK737551.1, 145796, 147298, -, 1503, 4014; cds-WP_032430415.1, NZ_KK737551.1, 147397, 148218, -, 822, 168; cds-WP_004177655.1, NZ_KK737551.1, 148569, 150074, +, 1506, 53557; cds-WP _004186731.1, NZ_KK737551.1, 150093, 150902, +, 810, 45259; cds-WP _004152190.1, NZ_KK737551.1, 151887, 152744, -, 858, 18344; cds-WP_004146797.1, NZ_KK737551.1, 152896, 154809, -, 1914, 36641; cds-WP _004186736.1, NZ_KK737551.1, 155315, 157255, +, 1941, 125477; cds-WP _004186740.1, NZ_KK737551.1, 157302, 158315, +, 1014, 121336; cds-WP_021314296.1, NZ_KK737551.1, 158357, 159241, +, 885, 151443; cds-WP _002886970.1, NZ_KK737551.1, 159265, 160164, +, 900, 19098; cds-WP _021441086.1, NZ _KK737551.1, 160308, 161618, -, 1311, 8; cds-WP _021441087.1, NZ_KK737551.1, 161758, 162828, -, 1071, 0; cds-WP_032430419.1, NZ_KK737551.1, 162834, 163658, -, 825, 0; cds-WP_004177643.1, NZ_KK737551.1, 163669, 164556, -, 888, 0; cds-WP _012737244.1, NZ_KK737551.1, 164546, 165430, -, 885, 0; cds-WP _004178400.1, NZ_KK737551.1, 165561, 166580, -, 1020, 74; cds-WP_021441090.1, NZ_KK737551.1, 166692, 168161, -, 1470, 0; cds-WP_032428490.1, NZ_KK737551.1, 168158, 168832, -, 675, 1; cds-AF52_RS00275, NZ_KK737551.1, 169708, 170763, +, 1056, 249; cds-WP _013815099.1-81, NZ_KK737551.1, 170797, 171765, +, 969, 9785; cds-WP_002887608.1, NZ_KK737551.1, 171853, 172632, +, 780, 12738; cds-WP _032430421.1, NZ_KK737551.1, 172610, 173461, +, 852, 0; cds-WP_032428518.1, NZ_KK737551.1, 173474, 174535, +, 1062, 0; cds-WP_004146946.1, NZ_KK737551.1, 174553, 175563, +, 1011, 0; cds-WP _021441152.1, NZ_KK737551.1, 175697, 176629, +, 933, 442; cds-WP_002887618.1, NZ_KK737551.1, 176684,178975, -, 2292, 164239; cds-WP_002887620.1, NZ_KK737551.1, 179233, 179724, -, 492, 256; cds-WP_002887623.1, NZ_KK737551.1, 179790, 180527, -, 738, 3495; cds-WP_004178536.1, NZ_KK737551.1, 180530, 181069, -, 540, 0; cds-WP _002887631.1, NZ_KK737551.1, 181172, 181645, -, 474, 1; cds-WP_004146059.1, NZ_KK737551.1, 181636, 182412, -, 777, 677; cds-WP_032430423.1, NZ_KK737551.1, 182692, 183876, +, 1185, 47458; cds-WP_009485342.1, NZ_KK737551.1, 183893, 184774, +, 882, 203; cds-WP_002887645.1, NZ_KK737551.1, 185040, 185762, +, 723, 7; cds-WP _002887647.1, NZ_KK737551.1, 185723, 186397, +, 675, 104; cds-WP_004151383.1, NZ_KK737551.1, 186403, 186861, -, 459, 44; cds-AF52_RS0124785, NZ_KK737551.1, 187200, 187601, +, 402, 0; cds-WP _013815099.1-82, NZ_KK737551.1, 187633, 188601, +, 969, 5644; cds-AF52_RS00180, NZ_KK737551.1, 188659, 189609, +, 951, 14223; cds-WP_002887652.1, NZ_KK737551.1, 189659, 190447, -, 789, 140; cds-AF52_RS27680, NZ_KK737551.1, 190554, 190682, -, 129, 0; cds-WP_013815099.1-83, NZ_KK737551.1, 190741, 191709, -, 969, 5790; cds-AF52_RS00165, NZ_KK737551.1, 191743, 192666, -, 924, 37; cds-WP_004221147.1, NZ _KK737551.1, 192690, 192860, -, 171, 0; cds-WP_002887654.1, NZ_KK737551.1, 192931, 193170, +, 240, 21; cds-WP_023317511.1, NZ_KK737551.1, 193450, 194478, -, 1029, 54524; cds-WP _015959390.1, NZ_KK737551.1, 194581, 194994, +, 414, 34; cds-WP_021441160.1, NZ_KK737551.1, 194963, 195409, +, 447, 11352; cds-WP_004146044.1, NZ_KK737551.1, 195424, 196101, +, 678, 3437; cds-WP_002887711.1, NZ_KK737551.1, 196192, 197781, +, 1590, 27045; cds-WP _032430427.1, NZ _KK737551.1, 198001, 198621, +, 621, 2204; cds-WP_002887716.1, NZ _KK737551.1, 198751, 198912, +, 162, 149; cds-WP _021441162.1, NZ_KK737551.1, 199066, 200139, +, 1074, 31152; cds-WP _004177496.1, NZ_KK737551.1, 200136, 200930, +, 795, 6292; cds-WP_004146034.1, NZ_KK737551.1, 201061, 202338, +, 1278, 98209; cds-WP_004146033.1, NZ_KK737551.1, 202734, 203534, +, 801, 1474; cds-WP_004178548.1, NZ_KK737551.1, 203648, 204970, +, 1323, 790; cds-WP_004151380.1, NZ_KK737551.1,


205023, 206246, +, 1224, 22154; cds-WP _002887789.1, NZ_KK737551.1, 206349, 207068, +, 720, 109091; cds-WP_032430428.1, NZ_KK737551.1, 207148, 208164, -, 1017, 4360; cds-WP_002887794.1, NZ_KK737551.1, 208164, 208811, -, 648, 30; cds-WP _004177487.1, NZ_KK737551.1, 208916, 209887, +, 972, 30693; cds-WP _002887800.1, NZ_KK737551.1, 209897, 211279, +, 1383, 11; cds-WP_002887802.1, NZ_KK737551.1, 211301, 212533, +, 1233, 30991; cds-WP _002887805.1, NZ_KK737551.1, 212627, 214294, -, 1668, 338131; cds-WP_002887806.1, NZ_KK737551.1, 214523, 216460, +, 1938, 3933; cds-WP_002887809.1, NZ_KK737551.1, 216549, 216878, +, 330, 3; cds-WP _002887810.1, NZ_KK737551.1, 216865, 217380, -, 516, 675; cds-WP_002887811.1, NZ_KK737551.1, 217494, 218141, +, 648, 31052; cds-WP_002887812.1, NZ_KK737551.1, 218138, 219007, -, 870, 18661; cds-WP_002887814.1, NZ_KK737551.1, 219217, 219690, +, 474, 1737; cds-WP_002887820.1, NZ_KK737551.1, 219703, 220392, +, 690, 2071; cds-WP _021441167.1, NZ_KK737551.1, 220392, 221816, +, 1425, 19621; cds-WP_004214415.1, NZ_KK737551.1, 221877, 223235, +, 1359, 41; cds-WP_002887843.1, NZ_KK737551.1, 223298, 224014, -, 717, 295117; cds-WP_004146984.1, NZ_KK737551.1, 224110, 224250, +, 141, 33720; cds-WP_002887846.1, NZ_KK737551.1, 224647, 225333, +, 687, 136;









TABLE 10




Counts table of the large (1 million) K. pneumoniae library when analyzed in bulk. Table organized as Geneid, Chr, Start, End, Strand, Length, K.pneumoniae_Large; Geneid, Chr, Start, End, Strand, Length, K.pneumoniae_Large; etc




cds-AF52_RS22895, NZ_KK737546.1, 1, 1202, +, 1202, 1555; cds-AF52_RS22890, NZ_KK737546.1, 1257, 1415, -, 159, 4951; cds-AF52_RS26590, NZ_KK737546.1, 6165, 6338, -, 174, 7449; cds-AF52_RS26600, NZ_KK737546.1, 8440, 8543, -, 104, 4687; cds-AF52_RS0122900, NZ_KK737546.1, 8577, 10166, -, 1590, 2727; cds-WP _014228879.1, NZ _KK737546.1, 10308, 10652, -, 345, 13349; cds-WP_032429382.1, NZ_KK737546.1, 10695, 10889, -, 195, 0; cds-AF52_RS0122905, NZ_KK737546.1, 11334, 11537, +, 204, 2052; cds-AF52_RS26610, NZ_KK737546.1, 11581, 11765, +, 185, 7359; cds-AF52_RS22870, NZ_KK737546.1, 12344, 12603, +, 260, 11894; cds-WP_040234937.1, NZ_KK737546.1, 13181, 13495, +, 315, 4896; cds-WP _032429384.1, NZ_KK737546.1, 13777, 14166, -, 390, 80873; cds-WP_072001558.1, NZ_KK737546.1, 14276, 14503, +, 228, 112; cds-WP _032429385.1, NZ_KK737546.1, 14506, 15060, +, 555, 31; cds-WP_072001559.1, NZ_KK737546.1, 15105, 16124, +, 1020, 27396; cds-WP _032429698.1, NZ_KK737546.1, 16117, 16581, +, 465, 8498; cds-WP_032429386.1, NZ_KK737546.1, 16595, 17035, +, 441, 39166; cds-WP_013815099.1, NZ_KK737546.1, 17339, 18307, -, 969, 102841; cds-WP _004147997.1, NZ_KK737546.1, 18343, 18546, -, 204, 3160; cds-WP_139042930.1, NZ_KK737546.1, 19315, 19434, -, 120, 1002; cds-WP_016160648.1, NZ_KK737546.1, 20352, 20567, +, 216, 0; cds-WP_032429387.1, NZ_KK737546.1, 20567, 21064, +, 498, 0; cds-WP_016160650.1, NZ_KK737546.1, 21061, 21411, +, 351, 1257; cds-WP _050484272.1, NZ_KK737546.1, 22361, 22786, +, 426, 27052; cds-WP _013815099.1-2, NZ_KK737546.1, 22812, 23780, -, 969, 85375; cds-WP _023289182.1, NZ_KK737546.1, 23903, 24127, -, 225, 13958; cds-WP_162924227.1, NZ_KK737546.1, 24306, 24470, +, 165, 2597; cds-AF52_RS24930, NZ_KK737546.1, 24454, 24816, +, 363, 8491; cds-WP _023289183.1, NZ_KK737546.1, 24768, 25091, +, 324, 72; cds-WP _023289184.1, NZ_KK737546.1, 25088, 25519, +, 432, 0; cds-WP_012542168.1, NZ_KK737546.1, 25767, 26201, +, 435, 0; cds-WP _021462603.1, NZ_KK737546.1, 26201, 27922, +, 1722, 1474; cds-WP _017898992.1, NZ_KK737546.1, 27916, 28095, +, 180, 0; cds-WP_012542166.1, NZ_KK737546.1, 28095, 29354, +, 1260, 34; cds-WP_032429388.1, NZ_KK737546.1, 29391, 30311, +, 921, 0; cds-WP _032429389.1, NZ_KK737546.1, 30389, 31675, +, 1287, 1730; cds-WP _014907814.1, NZ_KK737546.1, 31734, 31994, +, 261, 0; cds-WP _020317538.1, NZ_KK737546.1, 31975, 32292, +, 318, 0; cds-WP _014228910.1, NZ_KK737546.1, 32289, 32627, +, 339, 0; cds-WP _032429390.1, NZ_KK737546.1, 32608, 32997, +, 390, 0; cds-WP _017898997.1, NZ_KK737546.1, 32994, 33395, +, 402, 0; cds-WP_014228913.1, NZ_KK737546.1, 33427, 33888, +, 462, 2085; cds-WP_014228914.1, NZ_KK737546.1, 33946, 34311, +, 366, 0; cds-WP _032429392.1, NZ_KK737546.1, 34544, 37879, +, 3336, 311; cds-WP _014228916.1, NZ_KK737546.1, 37879, 38217, +, 339, 0; cds-WP _032429393.1, NZ_KK737546.1, 38214, 38969, +, 756, 27; cds-WP_023317958.1, NZ_KK737546.1, 38971, 39681, +, 711, 0; cds-WP _032429394.1, NZ_KK737546.1, 39714, 40061, +, 348, 405; cds-WP_023159867.1, NZ_KK737546.1, 40113, 40706, +, 594, 0; cds-AF52_RS0122945, NZ_KK737546.1, 40769, 53314, +, 12546, 37418; cds-WP _032429396.1, NZ_KK737546.1, 53376, 54872, +, 1497, 16398; cds-WP _004892953.1, NZ_KK737546.1, 55027, 55179, +, 153, 4085; cds-WP _023279886.1, NZ_KK737546.1, 55452, 56165, -, 714, 209; cds-WP _004190914.1, NZ_KK737546.1, 56162, 56554, -, 393, 0; cds-WP _004150797.1, NZ_KK737546.1, 56547, 56870, -, 324, 41; cds-AF52_RS0122950, NZ_KK737546.1, 56993, 57166, -, 174, 7048; cds-WP_004140530.1, NZ_KK737546.1, 57320, 57547, -, 228, 1026; cds-WP_021462619.1, NZ_KK737546.1, 57660, 58853, -, 1194, 60; cds-WP_004150795.1, NZ_KK737546.1, 59476, 59661, +, 186, 600; cds-WP_004148027.1, NZ_KK737546.1, 59752, 60246, +, 495, 403; cds-WP _004140514.1, NZ_KK737546.1, 60273, 60779, +, 507, 6640; cds-WP _013815099.1-3, NZ_KK737546.1, 60849, 61817, +, 969, 75419; cds-WP _032429398.1, NZ_KK737546.1, 61874, 62749, +, 876, 58; cds-WP_004140511.1, NZ_KK737546.1, 62805, 64211, +, 1407, 445; cds-WP _004183659.1, NZ_KK737546.1, 64208, 65218, +, 1011, 1247; cds-WP _004140506.1, NZ_KK737546.1, 65334, 65531, -, 198, 2840; cds-WP_004183660.1, NZ_KK737546.1, 66098, 66730, +, 633, 3615; cds-WP _004140501.1, NZ_KK737546.1, 66770, 66949, +, 180, 855; cds-WP_004150790.1, NZ_KK737546.1, 67347, 68033, +, 687, 93103; cds-WP_004150789.1, NZ_KK737546.1, 68146, 68310, -, 165, 37565; cds-WP _004140497.1, NZ_KK737546.1, 68344, 69852, -, 1509, 1479; cds-WP _021313530.1, NZ_KK737546.1, 69973, 70863, +, 891, 1942; cds-WP_004213090.1, NZ_KK737546.1, 70870, 72654, -, 1785, 63584; cds-WP _004140494.1, NZ_KK737546.1, 72728, 73936, -, 1209, 66557; cds-WP_004179363.1, NZ_KK737546.1, 74239, 75282, +, 1044, 3046; cds-WP _004148038.1, NZ_KK737546.1, 75944, 76858, +, 915, 123755; cds-WP_004150783.1, NZ_KK737546.1, 76948, 77586, +, 639, 208926; cds-WP_004140489.1, NZ_KK737546.1, 77717, 77980, +, 264, 192381; cds-WP_004140488.1, NZ_KK737546.1, 78039, 78164, -, 126, 279454; cds-WP _004213093.1, NZ_KK737546.1, 78282, 78356, -, 75, 12500; cds-WP _004150782.1, NZ_KK737546.1, 78356, 78457, -, 102, 25410; cds-WP _004176549.1, NZ_KK737546.1, 78515, 79528, -, 1014, 152388; cds-WP _004176548.1, NZ_KK737546.1, 79829, 80068, +, 240, 46471; cds-WP_014343000.1, NZ_KK737546.1, 80058, 80396, -, 339, 65296; cds-WP _020802835.1, NZ_KK737546.1, 80401, 80910, -, 510, 1570; cds-WP _021441569.1, NZ_KK737546.1, 81056, 81748, +, 693, 7422; cds-WP _020324105.1, NZ_KK737546.1, 81780, 82955, -, 1176, 2444; cds-WP_004140469.1, NZ_KK737546.1, 83063, 83857, +, 795, 44816; cds-WP_002901080.1, NZ_KK737546.1, 83841, 84287, -, 447, 36130; cds-WP _002901088.1, NZ_KK737546.1, 84404, 84904, -, 501, 3546; cds-WP _072271772.1, NZ_KK737546.1, 85151, 86287, +, 1137, 143446; cds-WP _002901096.1, NZ_KK737546.1, 86458, 86700, -, 243, 95784; cds-WP _002901192.1, NZ_KK737546.1, 86971, 87390, +, 420, 29751; cds-WP _004152360.1, NZ_KK737546.1, 87393, 88658, +, 1266, 56084; cds-WP_021441571.1, NZ_KK737546.1, 88665, 89570, -, 906, 37665; cds-WP _004176542.1, NZ_KK737546.1, 89737, 90486, +, 750, 800; cds-WP _021441573.1, NZ_KK737546.1, 90483, 91700, -, 1218, 2634; cds-WP _004179386.1, NZ_KK737546.1, 91876, 92757, +, 882, 2600; cds-WP _004220356.1, NZ_KK737546.1, 92828, 92947, -, 120, 3032; cds-WP _016946410.1, NZ_KK737546.1, 93015, 93326, +, 312, 811; cds-WP _032428825.1, NZ_KK737546.1, 93618, 94166, +, 549, 840; cds-WP_124053788.1, NZ_KK737546.1, 94180, 94551, +, 372, 1124; cds-WP_004140429.1, NZ_KK737546.1, 94548, 95831, -, 1284, 242853; cds-WP _002901234.1, NZ_KK737546.1, 95917, 97851, -, 1935, 499238; cds-WP _002901236.1, NZ_KK737546.1, 98268, 99014, +, 747, 387979; cds-WP _072143276.1, NZ_KK737546.1, 99145, 99960, +, 816, 30285; cds-WP_002901240.1, NZ_KK737546.1, 100017, 100901, -, 885, 410850; cds-WP_002901243.1, NZ_KK737546.1, 100976, 101971, -, 996, 12440905; cds-WP _002901246.1, NZ_KK737546.1, 102310, 102723, +, 414, 304542; cds-WP_002901249.1, NZ_KK737546.1, 102767, 103045, +, 279, 150857; cds-WP_002901254.1, NZ_KK737546.1, 103140, 103484, -, 345, 408912; cds-WP _002901255.1, NZ_KK737546.1, 103645, 104898, -, 1254, 63845; cds-WP _004140413.1, NZ_KK737546.1, 105070, 105711, -, 642, 361642; cds-WP _004176535.1, NZ_KK737546.1, 105721, 106740, -, 1020, 813894; cds-WP_004140411.1, NZ_KK737546.1, 106879, 108732, -, 1854, 325252; cds-WP_004176531.1, NZ_KK737546.1, 108898, 109449, +, 552, 24526; cds-WP_002901387.1, NZ_KK737546.1, 110185, 110931, -, 747, 295366; cds-WP_004176528.1, NZ_KK737546.1, 111157, 112200, +, 1044, 160209; cds-WP _032428827.1, NZ_KK737546.1, 112205, 114151, +, 1947, 280801; cds-WP _004140406.1, NZ _KK737546.1, 114331, 115311, +, 981, 73875; cds-WP _004176526.1, NZ_KK737546.1, 115355, 116698, -, 1344,88096; cds-WP _004183673.1, NZ _KK737546.1, 116881, 117291, -, 411, 71; cds-WP _002901398.1, NZ_KK737546.1, 117378, 118001, +, 624, 6220; cds-WP _032429402.1, NZ_KK737546.1, 118053, 119360, -, 1308, 12699; cds-WP _032428829.1, NZ_KK737546.1, 119454, 120086, -, 633, 1288; cds-WP _004892845.1, NZ_KK737546.1, 120086, 121621, -, 1536, 22; cds-WP_004224226.1, NZ_KK737546.1, 121594, 122772, -, 1179, 1; cds-WP _004176519.1, NZ_KK737546.1, 122775, 123335, -, 561, 2315; cds-WP _004151923.1, NZ_KK737546.1, 123332, 124042, -, 711, 286; cds-WP _021441584.1, NZ_KK737546.1, 124029, 124685, -, 657, 46325; cds-WP_002901486.1, NZ_KK737546.1, 124899, 125705, -, 807, 79436; cds-WP_002901489.1, NZ_KK737546.1, 126144, 127364, +, 1221, 100254; cds-WP _032429405.1, NZ_KK737546.1, 127361, 128395, +, 1035, 167730; cds-WP _004151922.1, NZ_KK737546.1, 128392, 129870, +, 1479, 66885; cds-WP_004892826.1, NZ_KK737546.1, 129867, 131192, +, 1326, 115895; cds-WP_021441588.1, NZ_KK737546.1, 131202, 132167, +, 966, 8587; cds-WP _004217130.1, NZ _KK737546.1, 132511, 132996, +, 486, 449436; cds-WP_004176514.1, NZ_KK737546.1, 133084, 133947, -, 864, 11332; cds-WP _032429406.1, NZ _KK737546.1, 134048, 134875, -, 828, 311552; cds-WP_002901544.1, NZ_KK737546.1, 135158, 135496, +, 339, 42067; cds-WP _013815099.1-4, NZ_KK737546.1, 135868, 136836, +, 969, 101925; cds-WP_050484274.1, NZ_KK737546.1, 136880, 137161, +, 282, 5100; cds-WP_014907779.1, NZ_KK737546.1, 137181, 137297, +, 117, 0; cds-WP_004148091.1, NZ_KK737546.1, 137309, 138667, +, 1359, 471; cds-WP_004183683.1, NZ_KK737546.1, 138721, 139068, +, 348, 0; cds-WP _002901552.1, NZ_KK737546.1, 139096, 139920, +, 825, 3449; cds-WP_032429409.1, NZ_KK737546.1, 140031, 141377, +, 1347, 42638; cds-WP _004179430.1, NZ_KK737546.1, 141390, 142148, +, 759, 45019; cds-WP _002901554.1, NZ _KK737546.1, 142206, 144464, -, 2259, 254605; cds-WP _004140343.1, NZ_KK737546.1, 144577, 144909, +, 333, 680; cds-WP_032429412.1, NZ_KK737546.1, 144969, 146360, -, 1392, 395944; cds-WP _002901611.1, NZ_KK737546.1, 146496, 147086, -, 591, 58496; cds-WP_004176511.1, NZ_KK737546.1, 147178, 147939, -, 762, 29800; cds-


WP_004140335.1, NZ_KK737546.1, 148089, 148757, -, 669, 24478; cds-WP_002901627.1, NZ_KK737546.1, 148946, 149482, +, 537, 29062; cds-WP_002901629.1, NZ_KK737546.1, 149512, 149910, -, 399, 85319; cds-AF52_RS0123015, NZ_KK737546.1, 150010, 152194, -, 2185, 7964; cds-WP_002901631.1, NZ_KK737546.1, 152466, 153005, -, 540, 184626; cds-WP_002901632.1, NZ_KK737546.1, 153060, 153803, -, 744, 145060; cds-WP_032429413.1, NZ_KK737546.1, 153829, 154242, -, 414, 66217; cds-WP_002901634.1, NZ_KK737546.1, 154512, 155150, +, 639, 12747; cds-WP_032429414.1, NZ_KK737546.1, 155235, 155912, -, 678, 24863; cds-WP_032429415.1, NZ_KK737546.1, 155961, 158246, -, 2286, 54916; cds-WP_021441592.1, NZ_KK737546.1, 158556, 159263, -, 708, 23999; cds-WP_004151911.1, NZ_KK737546.1, 159382, 159582, +, 201, 937; cds-WP_032429416.1, NZ_KK737546.1, 159691, 160638, -, 948, 384; cds-WP_021441594.1, NZ_KK737546.1, 160713, 161171, +, 459, 14421; cds-WP_004183698.1, NZ_KK737546.1, 161214, 162122, -, 909, 4716; cds-WP_004210755.1, NZ_KK737546.1, 162251, 163561, +, 1311, 347; cds-WP_002901724.1, NZ_KK737546.1, 163576, 164664, +, 1089, 2042; cds-WP_004179454.1, NZ_KK737546.1, 164667, 165926, +, 1260, 53268; cds-WP_021441596.1, NZ_KK737546.1, 166145, 166954, -, 810, 147921; cds-WP_032423750.1, NZ_KK737546.1, 166954, 168147, -, 1194, 118962; cds-WP_032429417.1, NZ_KK737546.1, 168157, 169515, -, 1359, 37404; cds-WP_021441599.1, NZ_KK737546.1, 169519, 171114, -, 1596, 36142; cds-WP_004176488.1, NZ_KK737546.1, 171114, 172676, -, 1563, 67818; cds-WP_002901735.1, NZ_KK737546.1, 172965, 173828, +, 864, 123250; cds-WP_002901738.1, NZ_KK737546.1, 173845, 174465, +, 621, 216148; cds-WP_021441600.1, NZ_KK737546.1, 174487, 175395, -, 909, 30914; cds-WP_004176482.1, NZ_KK737546.1, 175507, 176403, +, 897, 5554; cds-WP_002901746.1, NZ_KK737546.1, 176685, 177587, +, 903, 317805; cds-WP_002901749.1, NZ_KK737546.1, 177648, 178238, -, 591, 131448; cds-WP_032429418.1, NZ_KK737546.1, 178235, 178996, -, 762, 505792; cds-WP_004148112.1, NZ_KK737546.1, 178991, 179206, +, 216,3508; cds-WP_002901758.1, NZ_KK737546.1, 179251, 180297, +, 1047, 319982; cds-WP_002901761.1, NZ_KK737546.1, 180345, 180596, -, 252, 106630; cds-WP_002901763.1, NZ_KK737546.1, 181003, 183600, +, 2598, 1253282; cds-WP_002901772.1, NZ_KK737546.1, 183946, 184920, +, 975,136576; cds-WP_002901776.1, NZ_KK737546.1, 185166, 185333, +, 168, 33971; cds-WP_032429420.1, NZ_KK737546.1, 185722, 188400, +, 2679, 238620; cds-WP_032429421.1, NZ_KK737546.1, 188448, 189050, -, 603, 168913; cds-WP_002901779.1, NZ_KK737546.1, 189214, 189981, +, 768, 50501; cds-WP_002901780.1, NZ_KK737546.1, 190117, 190425, +, 309, 44487; cds-WP_002901781.1, NZ_KK737546.1, 190432, 191601, +, 1170, 81731; cds-WP_014907762.1, NZ_KK737546.1, 191793, 192530, +, 738, 29913; cds-WP_004210732.1, NZ_KK737546.1, 192530, 192856, +, 327, 68699; cds-WP_002901783.1, NZ_KK737546.1, 192988, 193206, -, 219, 317871; cds-WP_002901785.1, NZ_KK737546.1, 193482, 194231, -, 750, 269428; cds-WP_002901786.1, NZ_KK737546.1, 194303, 194482, -, 180, 54413; cds-WP_002901787.1, NZ_KK737546.1, 194641, 196575, -, 1935, 1455677; cds-WP_032421254.1, NZ_KK737546.1, 196657, 197814, -, 1158, 134855; cds-WP_004140277.1, NZ_KK737546.1, 198005, 198793, -, 789, 1099339; cds-WP_014907760.1, NZ_KK737546.1, 198992, 199534, -, 543, 7522; cds-WP_004151902.1, NZ_KK737546.1, 199782, 201161, +, 1380, 329024; cds-WP_004140269.1, NZ_KK737546.1, 201206, 202015, -, 810, 221164; cds-WP_004140266.1, NZ_KK737546.1, 202017, 203009, -, 993, 122273; cds-WP_004151901.1, NZ_KK737546.1, 203009, 203899, -, 891, 117599; cds-WP_032429422.1, NZ_KK737546.1, 204046, 205263, +, 1218, 29289; cds-WP_004892750.1, NZ_KK737546.1, 205484, 205723, -, 240, 65; cds-WP_016831904.1, NZ_KK737546.1, 205731, 206039, -, 309, 0; cds-WP_108918811.1, NZ_KK737546.1, 206036, 206677, -, 642, 427; cds-WP_016831906.1, NZ_KK737546.1, 206689, 206910, -, 222, 11; cds-WP_032426563.1, NZ_KK737546.1, 206907, 207434, -, 528, 0; cds-WP_008807811.1, NZ_KK737546.1, 207463, 208086, -, 624, 1435; cds-WP_032429423.1, NZ_KK737546.1, 208083, 208829, -, 747, 1091; cds-WP_008807813.1, NZ_KK737546.1, 208846, 209130, -, 285, 12826; cds-WP_008807814.1, NZ_KK737546.1, 209211, 209417, -, 207, 9017; cds-WP_161477215.1, NZ_KK737546.1, 209410, 209568, -, 159, 2930; cds-WP_004223168.1, NZ_KK737546.1, 209854, 210057, +, 204, 0; cds-WP_008807815.1, NZ_KK737546.1, 210087, 210734, -, 648, 785030; cds-WP_008807816.1, NZ_KK737546.1, 210731, 211165, -, 435, 338090; cds-WP_024622727.1, NZ_KK737546.1, 211385, 212074, -, 690, 226748; cds-WP_004178811.1, NZ_KK737546.1, 212179, 212412, +, 234, 2635; cds-WP_004141720.1, NZ_KK737546.1, 212452, 212772, +, 321, 34810; cds-WP_004151298.1, NZ_KK737546.1, 212859, 213005, +, 147, 1366; cds-WP_073545955.1, NZ_KK737546.1, 213046, 213897, +, 852, 48831; cds-WP_075209545.1, NZ_KK737546.1, 213902, 215317, +, 1416, 1615; cds-WP_032429424.1, NZ_KK737546.1, 215317, 215619, +, 303, 363; cds-AF52_RS21920, NZ_KK737546.1, 215616, 215912, +, 297, 7328; cds-WP_032429425.1, NZ_KK737546.1, 216035, 216298, +, 264, 51; cds-AF52_RS25000, NZ_KK737546.1, 216450, 216854, +, 405, 178; cds-WP_023286281.1, NZ_KK737546.1, 217078, 217299, +, 222, 35823; cds-WP_032429427.1, NZ_KK737546.1, 217303, 218010, +, 708, 234676; cds-WP_016831923.1, NZ_KK737546.1, 218000, 218224, +, 225, 0; cds-WP_032429428.1, NZ_KK737546.1, 218299, 218811, +, 513, 35756; cds-WP_032429704.1, NZ_KK737546.1, 218879, 219136, +, 258, 46853; cds-WP_032429429.1, NZ_KK737546.1, 219243, 219839, +, 597, 5754; cds-WP_004146340.1, NZ_KK737546.1, 220048, 220338, +, 291, 50; cds-WP_004177081.1, NZ_KK737546.1, 220335, 220697, +, 363, 0; cds-WP_023279926.1, NZ_KK737546.1, 220694, 220834, +, 141, 4; cds-WP_032429430.1, NZ_KK737546.1, 220831, 221520, +, 690, 0; cds-WP_024940884.1, NZ_KK737546.1, 222173, 222472, +, 300, 0; cds-WP_008807831.1, NZ_KK737546.1, 222469, 223008, +, 540, 3535; cds-WP_004190674.1, NZ_KK737546.1, 223005, 223349, +, 345, 2012; cds-WP_032429431.1, NZ_KK737546.1, 223346, 223621, +, 276, 143; cds-WP_004218558.1, NZ_KK737546.1, 224580, 224825, +, 246, 33190; cds-WP_013815099.1-5, NZ_KK737546.1, 225397, 226365, -, 969, 99238; cds-WP_032429432.1, NZ_KK737546.1, 226754, 227758, +, 1005, 122; cds-WP_004190663.1, NZ_KK737546.1, 227736, 229043, +, 1308, 2952; cds-AF52_RS21820, NZ_KK737546.1, 229043, 229582, +, 540, 0; cds-WP_170965341.1, NZ_KK737546.1, 229616, 229810, +, 195, 7491; cds-AF52_RS26695, NZ_KK737546.1, 231136, 231250, +, 115, 3133; cds-WP_187079184.1, NZ_KK737546.1, 231498, 232175, +, 678, 61; cds-WP_032429434.1, NZ_KK737546.1, 232159, 233271, +, 1113, 1274; cds-WP_032429435.1, NZ_KK737546.1, 233356, 234141, +, 786, 214; cds-WP_032429436.1, NZ_KK737546.1, 234152, 235105, +, 954, 103; cds-WP_142689607.1, NZ_KK737546.1, 235114, 235386, +, 273, 0; cds-WP_004217348.1, NZ_KK737546.1, 235427, 235822, +, 396, 232; cds-WP_004190649.1, NZ_KK737546.1, 235824, 236078, +, 255, 0; cds-WP_004217344.1, NZ_KK737546.1, 236307, 236690, +, 384, 0; cds-WP_008807839.1, NZ_KK737546.1, 236692, 237243, +, 552, 0; cds-WP_004190640.1, NZ_KK737546.1, 237240, 237632, +, 393, 3; cds-WP_004217341.1, NZ_KK737546.1, 237656, 238828, +, 1173,7702; cds-WP_004226994.1, NZ_KK737546.1, 238882, 239364, +, 483, 104; cds-WP_074185736.1, NZ_KK737546.1, 239502, 239696, +, 195, 2516; cds-WP_032429437.1, NZ_KK737546.1, 240136, 240315, +, 180, 162231; cds-WP_032417044.1, NZ_KK737546.1, 240325, 240810, +, 486, 863671; cds-AF52_RS21755, NZ_KK737546.1, 240849, 241094, -, 246, 152574; cds-WP_013815099.1-6, NZ_KK737546.1, 241160, 242128, -, 969, 98171; cds-WP_032429438.1, NZ_KK737546.1, 242146, 242397, -, 252, 6591; cds-WP_077254381.1, NZ_KK737546.1, 242561, 242902, +, 342, 4335; cds-AF52_RS21745, NZ_KK737546.1, 243004, 244416, +, 1413, 2199; cds-WP_013815099.1-7, NZ_KK737546.1, 244471, 245439, -, 969, 82493; cds-AF52_RS21735, NZ_KK737546.1, 245474, 246952, +, 1479, 39062; cds-WP_032429439.1, NZ_KK737546.1, 246952, 247425, +, 474, 0; cds-WP_032429440.1, NZ_KK737546.1, 247412, 247894, +, 483, 0; cds-WP_032429442.1, NZ_KK737546.1, 247904, 248284, +, 381, 15997; cds-AF52_RS21715, NZ_KK737546.1, 248281, 251259, +, 2979, 30396; cds-WP_013815099.1-8, NZ_KK737546.1, 251293, 252261, +, 969, 99011; cds-AF52_RS0123075, NZ_KK737546.1, 252965, 253330, -, 366, 26349; cds-WP_032429443.1, NZ_KK737546.1, 253422, 253970, +, 549, 4707; cds-WP_004179627.1, NZ_KK737546.1, 255020, 255439, +, 420, 13336; cds-AF52_RS0123080, NZ_KK737546.1, 255441, 256706, +, 1266, 32979; cds-WP_032429444.1, NZ_KK737546.1, 256748, 257389, +, 642, 91007; cds-WP_016831214.1, NZ_KK737546.1, 257382, 258056, -, 675, 9565; cds-WP_002901816.1, NZ_KK737546.1, 258261, 259226, -, 966, 154422; cds-WP_004140258.1, NZ_KK737546.1, 259223, 260866, -, 1644, 209872; cds-WP_021441607.1, NZ_KK737546.1, 261200, 262108, -, 909, 669; cds-WP_019705465.1, NZ_KK737546.1, 262216, 263046, +, 831, 29646; cds-WP_032429447.1, NZ_KK737546.1, 263025, 265334, -, 2310, 157256; cds-WP_002901900.1, NZ_KK737546.1, 265506, 266675, +, 1170, 152; cds-WP_021441611.1, NZ_KK737546.1, 266701, 268092, +, 1392, 9869; cds-WP_004148137.1, NZ_KK737546.1, 268083, 269072, -, 990, 24472; cds-WP_002901908.1, NZ_KK737546.1, 269225, 269893, +, 669, 292569; cds-WP_002901911.1, NZ_KK737546.1, 269949, 270173, +, 225, 252309; cds-WP_002901913.1, NZ_KK737546.1, 270173, 270532, +, 360, 119496; cds-WP_002901915.1, NZ_KK737546.1, 270561, 270779, +, 219, 2003; cds-WP_002901917.1, NZ_KK737546.1, 270882, 272279, +, 1398, 134373; cds-WP_004140239.1, NZ_KK737546.1, 272276, 273337, +, 1062, 50437; cds-WP_004888583.1, NZ_KK737546.1, 273427, 274326, -, 900, 3925; cds-WP_002901977.1, NZ_KK737546.1, 274440, 275753, +, 1314, 3573; cds-WP_002901979.1, NZ_KK737546.1, 275926, 277467, +, 1542, 83329; cds-WP_032428836.1, NZ_KK737546.1, 277569, 278621, +, 1053, 57350; cds-WP_004152131.1, NZ_KK737546.1, 278692, 279198, -, 507, 741292; cds-WP_032429452.1, NZ_KK737546.1, 279301, 280266, +, 966, 27056; cds-WP_004152134.1, NZ_KK737546.1, 280263, 280970, -, 708, 13879; cds-WP_004148146.1, NZ_KK737546.1, 281043, 281159, +, 117, 2958; cds-WP_004176446.1, NZ_KK737546.1, 281156, 282772, +, 1617, 369024; cds-WP_021441615.1, NZ_KK737546.1, 282873, 283259, -, 387, 151724; cds-WP_004190572.1, NZ_KK737546.1, 283490, 284323, +, 834, 43661; cds-WP_004152138.1, NZ_KK737546.1, 284448, 285332, -, 885, 23307; cds-WP_004190569.1, NZ_KK737546.1, 285505, 286641, +, 1137, 949; cds-WP_023287551.1, NZ_KK737546.1, 286714, 287916, +, 1203, 132; cds-WP_004152141.1, NZ_KK737546.1, 287995, 288864, +, 870, 1309; cds-AF52_RS21545, NZ_KK737546.1, 289095, 289340, +, 246, 0; cds-WP_072001575.1, NZ_KK737546.1, 289412, 289558, -, 147, 5011; cds-WP_013815099.1-9, NZ_KK737546.1, 289602, 290570, -, 969, 89107; cds-WP_187079185.1, NZ_KK737546.1, 290586, 291959, +, 1374, 14514; cds-WP_002902422.1, NZ_KK737546.1, 292005, 292940, -, 936, 493171; cds-WP_004140161.1, NZ_KK737546.1, 293174, 293608, -, 435, 145283; cds-WP_002902432.1, NZ_KK737546.1, 293690, 293902, -, 213, 2224; cds-WP_004176397.1, NZ_KK737546.1, 294046, 295170, -, 1125, 32922; cds-WP_021313170.1, NZ_KK737546.1, 295527, 299054, -, 3528, 210661; cds-WP_004140155.1, NZ_KK737546.1, 299417, 299680, +, 264, 23863; cds-WP_032429459.1, NZ_KK737546.1, 299726, 300166, -, 441, 54064; cds-WP_002902515.1, NZ_KK737546.1, 300289, 301278, -, 990, 414594; cds-WP_002902516.1, NZ_KK737546.1, 301426, 301926, -, 501, 42470; cds-WP_023279029.1, NZ_KK737546.1, 302133, 304772, +, 2640, 120215; cds-WP_004140145.1, NZ_KK737546.1, 304769, 304954, +, 186, 16264; cds-WP_002902522.1, NZ_KK737546.1, 304962, 305285, +, 324, 184882; cds-WP_004140140.1, NZ_KK737546.1, 305286, 306188, -, 903, 92140; cds-WP_032429462.1, NZ_KK737546.1, 306424, 307923, +, 1500, 7768; cds-WP_032429463.1, NZ_KK737546.1, 308048, 308938, +, 891, 12248; cds-WP_021440033.1, NZ_KK737546.1, 308982, 309965, +, 984, 47459; cds-WP_021440034.1, NZ_KK737546.1, 309968, 312235, -, 2268, 582001; cds-WP_032429464.1, NZ_KK737546.1, 312712, 314757, -, 2046, 1686240; cds-WP_032428268.1, NZ_KK737546.1, 315044, 315973, +, 930, 949070; cds-WP_032429465.1, NZ_KK737546.1, 315985, 316272, +, 288, 143281; cds-WP_020324632.1, NZ_KK737546.1, 316280, 317035, +, 756, 804337; cds-WP_021440037.1, NZ_KK737546.1, 317047, 317544, +, 498, 608321; cds-WP_002902772.1, NZ_KK737546.1, 317552, 318622, +, 1071, 733391; cds-WP_032429468.1, NZ_KK737546.1, 318619, 319386, +, 768, 386246; cds-WP_004140117.1,


NZ_KK737546.1, 319389, 320177, +, 789, 143805; cds-WP_021440038.1, NZ_KK737546.1, 320178, 321602, +, 1425, 167894; cds-WP_002902876.1, NZ_KK737546.1, 321592, 322014, +, 423, 222067; cds-WP_014907683.1, NZ_KK737546.1, 322014, 323219, +, 1206,162404; cds-WP_002902877.1, NZ_KK737546.1, 323246, 324562, +, 1317, 153448; cds-WP_004194367.1, NZ_KK737546.1, 324682, 325608, +, 927, 277575; cds-WP_002902883.1, NZ_KK737546.1, 325618, 326214, +, 597, 57510; cds-WP_024940864.1, NZ_KK737546.1, 326223, 326633, +, 411, 12266; cds-WP_002902889.1, NZ_KK737546.1, 326670, 327275, -, 606, 56045; cds-WP_032429470.1, NZ_KK737546.1, 327480, 331382, +, 3903, 475495; cds-WP_020324670.1, NZ_KK737546.1, 331443, 332117, -, 675, 102437; cds-WP_021440039.1, NZ_KK737546.1, 332118, 333497, -, 1380, 55747; cds-WP_002902965.1, NZ_KK737546.1, 333494, 334579, -, 1086, 30121; cds-WP_002902967.1, NZ_KK737546.1, 334608, 336260, -, 1653, 133664; cds-WP_002902969.1, NZ_KK737546.1, 336260, 336691, -, 432, 8782; cds-WP_002902971.1, NZ_KK737546.1, 336799, 337746, -, 948, 54733; cds-WP_032429472.1, NZ_KK737546.1, 337847, 338845, +, 999, 228685; cds-WP_004151574.1, NZ_KK737546.1, 339001, 340275, -, 1275, 5660305; cds-WP_004224524.1, NZ_KK737546.1, 340488, 340634, -, 147, 43323; cds-WP_020802294.1, NZ_KK737546.1, 340804, 342009, +, 1206, 2066639; cds-WP_004140076.1, NZ_KK737546.1, 342028, 343050, +, 1023, 939181; cds-WP_004183870.1, NZ_KK737546.1, 343041, 344507, +, 1467, 861982; cds-WP_004190366.1, NZ_KK737546.1, 344529, 345869, +, 1341, 389975; cds-WP_004176358.1, NZ_KK737546.1, 345880, 346875, +, 996, 202344; cds-WP_016947259.1, NZ_KK737546.1, 346885, 348315, +, 1431, 272379; cds-WP_021440044.1, NZ_KK737546.1, 348524, 349849, -, 1326, 43019; cds-WP_020316474.1, NZ_KK737546.1, 350230, 351030, +, 801, 380; cds-WP_004140057.1, NZ_KK737546.1, 351092, 351229, -, 138, 581; cds-WP_004151568.1, NZ_KK737546.1, 351228, 352667, +, 1440, 10582; cds-WP_002903227.1, NZ_KK737546.1, 352716, 353714, -, 999, 11405; cds-WP_002903230.1, NZ_KK737546.1, 353997, 354155, +, 159, 359; cds-WP_004224558.1, NZ_KK737546.1, 354190, 354582, -, 393, 4; cds-WP_002903233.1, NZ_KK737546.1, 354833, 355066, -, 234, 0; cds-WP_021440045.1, NZ_KK737546.1, 355063, 356271, -, 1209, 36369; cds-WP_004179665.1, NZ_KK737546.1, 356375, 356728, -, 354, 9178; cds-WP_004179667.1, NZ_KK737546.1, 356965, 357444, +, 480, 157; cds-WP_004151566.1, NZ_KK737546.1, 357514, 357717, -, 204, 0; cds-WP_032429476.1, NZ_KK737546.1, 358029, 359057, +, 1029, 14117; cds-WP_032429478.1, NZ_KK737546.1, 359071, 360243, -, 1173, 254279; cds-WP_021440047.1, NZ_KK737546.1, 360295, 361887, -, 1593, 333578; cds-WP_021440048.1, NZ_KK737546.1, 362060, 363088, +, 1029, 60391; cds-WP_004190339.1, NZ_KK737546.1, 363128, 364687, -, 1560, 301714; cds-WP_032429480.1, NZ_KK737546.1, 364774, 365952, -, 1179, 627504; cds-WP_032429482.1, NZ_KK737546.1, 366154, 367800, +, 1647, 6342208; cds-WP_002903315.1, NZ_KK737546.1, 368140, 369540, +, 1401, 355650; cds-WP_021440051.1, NZ_KK737546.1, 369530, 370462, -, 933, 37806; cds-WP_021440052.1, NZ_KK737546.1, 370538, 371839, -, 1302, 13810; cds-WP_032429484.1, NZ_KK737546.1, 372095, 372457, -, 363, 1873; cds-WP_002903377.1, NZ_KK737546.1, 372700, 373419, -, 720, 32285; cds-WP_002903379.1, NZ_KK737546.1, 373548, 373883, +, 336, 8193; cds-WP_004179681.1, NZ_KK737546.1, 373880, 374602, -, 723, 179716; cds-WP_004183892.1, NZ_KK737546.1, 374639, 376021, -, 1383, 87748; cds-WP_002903384.1, NZ_KK737546.1, 376199, 377149, -, 951, 335909; cds-WP_004140012.1, NZ_KK737546.1, 377146, 377328, -, 183, 5390; cds-WP_032422490.1, NZ_KK737546.1, 377671, 379200, +, 1530, 342550; cds-WP_002903386.1, NZ_KK737546.1, 379211, 380599, +, 1389, 179783; cds-WP_004887037.1, NZ_KK737546.1, 380748, 380936, +, 189, 43255; cds-WP_002903391.1, NZ_KK737546.1, 381046, 381996, -, 951, 342137; cds-WP_002903394.1, NZ_KK737546.1, 382135, 382887, -, 753, 587250; cds-WP_004224598.1, NZ_KK737546.1, 383082, 383597, -, 516, 20280; cds-WP_002903398.1, NZ_KK737546.1, 383890, 384048, +, 159, 90; cds-AF52_RS21120, NZ_KK737546.1, 384081, 384533, -, 453, 0; cds-WP_023343160.1, NZ_KK737546.1, 384656, 384919, -, 264, 130; cds-WP_032429712.1, NZ_KK737546.1, 384927, 385493, -, 567, 770; cds-WP_072001561.1, NZ_KK737546.1, 385495, 386064, -, 570, 1861; cds-WP_032429489.1, NZ_KK737546.1, 386061, 386354, -, 294, 4393; cds-AF52_RS0123125, NZ_KK737546.1, 386354, 386536, -, 183, 5456; cds-WP_032429490.1, NZ_KK737546.1, 386715, 386915, -, 201, 3626; cds-WP_032429491.1, NZ_KK737546.1, 386912, 387394, -, 483, 39; cds-AF52_RS26290, NZ_KK737546.1, 387508, 387846, -, 339, 0; cds-WP_032429493.1, NZ_KK737546.1, 388073, 388858, -, 786, 0; cds-WP_023343167.1, NZ_KK737546.1, 388851, 389051, -, 201, 0; cds-WP_032429494.1, NZ_KK737546.1, 389051, 389578, -, 528, 27; cds-WP_032429495.1, NZ_KK737546.1, 389714, 390544, -, 831, 4488; cds-WP_032429496.1, NZ_KK737546.1, 390597, 390968, -, 372, 68865; cds-WP_187079182.1, NZ_KK737546.1, 391972, 392158, +, 187, 9330; cds-AF52_RS26730, NZ_KK737546.1, 393389, 393527, +, 139, 45938; cds-WP_032429497.1, NZ_KK737546.1, 393786, 394019, -, 234, 4277; cds-WP_032429029.1, NZ_KK737546.1, 394208, 394867, -, 660, 61280; cds-WP_023343174.1, NZ_KK737546.1, 394955, 395155, +, 201, 0; cds-WP_032429498.1, NZ_KK737546.1, 395200, 395751, +, 552, 744; cds-WP_023322342.1, NZ_KK737546.1, 395924, 396103, +, 180, 0; cds-AF52_RS21035, NZ_KK737546.1, 396093, 396482, +, 390, 8; cds-WP_013815099.1-10, NZ_KK737546.1, 396540, 397508, -, 969, 107577; cds-AF52_RS21025, NZ_KK737546.1, 397537, 398793, -, 1257, 28096; cds-WP_004143402.1, NZ_KK737546.1, 399073, 399846, -, 774, 119895; cds-WP_023301931.1, NZ_KK737546.1, 399893, 401398, -, 1506, 29878; cds-WP_021440130.1, NZ_KK737546.1, 401452, 402201, -, 750, 151475; cds-WP_021440129.1, NZ_KK737546.1, 402565, 403365, +, 801, 178; cds-AF52_RS21000, NZ_KK737546.1, 403475, 404163, +, 689, 15691; cds-WP_032429499.1, NZ_KK737546.1, 404175, 405119, +, 945, 26155; cds-WP_004143414.1, NZ_KK737546.1, 405156, 406490, +, 1335, 117154; cds-WP_004176179.1, NZ_KK737546.1, 406492, 406881, +, 390, 95; cds-WP_021440127.1, NZ_KK737546.1, 407130, 408686, +, 1557, 63390; cds-WP_021440126.1, NZ_KK737546.1, 408683, 410275, +, 1593, 106246; cds-WP_004190119.1, NZ_KK737546.1, 410287, 411021, +, 735, 669; cds-WP_004148393.1, NZ_KK737546.1, 411033, 412223, +, 1191, 58910; cds-WP_004143425.1, NZ_KK737546.1, 412359, 413696, +, 1338, 8975; cds-WP_004148392.1, NZ_KK737546.1, 413710, 414588, +, 879, 7914; cds-WP_004176181.1, NZ_KK737546.1, 414665, 416035, +, 1371, 3065; cds-WP_021440125.1, NZ_KK737546.1, 416049, 417224, +, 1176, 213; cds-WP_002904834.1, NZ_KK737546.1, 417221, 418378, +, 1158, 50567; cds-WP_002904832.1, NZ_KK737546.1, 418461, 419336, -, 876, 27012; cds-WP_021440123.1, NZ_KK737546.1, 419448, 420332, -, 885, 23669; cds-WP_002904827.1, NZ_KK737546.1, 420444, 421187, +, 744, 4054; cds-WP_002904825.1, NZ_KK737546.1, 421193, 421891, -, 699, 3622; cds-WP_032417116.1, NZ_KK737546.1, 422159, 423691, +, 1533, 4204; cds-WP_021440120.1, NZ_KK737546.1, 423703, 425031, +, 1329, 35078; cds-WP_032417115.1, NZ_KK737546.1, 425777, 427222, +, 1446, 1281378; cds-WP_021440118.1, NZ_KK737546.1, 427212, 427655, +, 444, 475209; cds-WP_002904816.1, NZ_KK737546.1, 428072, 428311, +, 240, 2133; cds-WP_009308870.1, NZ_KK737546.1, 428336, 428476, +, 141, 0; cds-WP_004148380.1, NZ_KK737546.1, 428664, 429599, +, 936, 14203; cds-WP_004143447.1, NZ_KK737546.1, 429633, 431288, -, 1656, 30112; cds-WP_002904810.1, NZ_KK737546.1, 431585, 431833, +, 249, 20038; cds-WP_002904808.1, NZ_KK737546.1, 432123, 432341, +, 219, 26530; cds-WP_004179825.1, NZ_KK737546.1, 432322, 433104, +, 783, 92944; cds-WP_004176193.1, NZ_KK737546.1, 433331, 433618, -, 288, 194; cds-WP_004143457.1, NZ_KK737546.1, 434062, 434625, +, 564, 0; cds-WP_004176194.1, NZ_KK737546.1, 434703, 435398, +, 696, 228; cds-WP_016831617.1, NZ_KK737546.1, 435414, 437915, +, 2502, 430; cds-WP_004176196.1, NZ_KK737546.1, 437903, 438907, +, 1005, 171; cds-WP_002904794.1, NZ_KK737546.1, 439049, 440341, +, 1293, 125753; cds-WP_004176197.1, NZ_KK737546.1, 440358, 441680, -, 1323, 48217; cds-WP_032417111.1, NZ_KK737546.1, 441680, 441946, -, 267, 19079; cds-WP_002904788.1, NZ_KK737546.1, 442211, 442537, -, 327, 3017; cds-WP_002904787.1, NZ_KK737546.1, 442534, 443034, -, 501, 35959; cds-WP_032429500.1, NZ_KK737546.1, 443012, 444391, -, 1380, 36567; cds-WP_002904783.1, NZ_KK737546.1, 444737, 445891, +, 1155, 32; cds-WP_032429501.1, NZ_KK737546.1, 445872, 446795, -, 924, 496; cds-WP_021440114.1, NZ_KK737546.1, 446921, 447958, +, 1038, 55144; cds-WP_032429502.1, NZ_KK737546.1, 447970, 448953, +, 984, 114418; cds-WP_014907616.1, NZ_KK737546.1, 448930, 450168, -, 1239, 4; cds-WP_032429503.1, NZ_KK737546.1, 450274, 451218, +, 945, 35801; cds-WP_032429504.1, NZ_KK737546.1, 451228, 451983, -, 756, 2851; cds-WP_002904646.1, NZ_KK737546.1, 452160, 452471, -, 312, 57; cds-WP_002904643.1, NZ_KK737546.1, 452493, 452756, -, 264, 40789; cds-WP_004176215.1, NZ_KK737546.1, 453039, 454067, +, 1029, 24; cds-WP_002904638.1, NZ_KK737546.1, 454091, 454897, +, 807, 4620; cds-WP_021440110.1, NZ_KK737546.1, 454894, 455685, +, 792, 28623; cds-WP_021440109.1, NZ_KK737546.1, 455682, 456341, +, 660, 122; cds-WP_021440108.1, NZ_KK737546.1, 456352, 457425, -, 1074, 9740; cds-WP_004143508.1, NZ_KK737546.1, 457500, 458345, +, 846, 57923; cds-WP_032417109.1, NZ_KK737546.1, 458342, 459499, -, 1158, 2253; cds-WP_032417108.1, NZ_KK737546.1, 459707, 460129, +, 423, 28561; cds-WP_004176220.1, NZ_KK737546.1, 460285, 461472, +, 1188, 56409; cds-WP_002904624.1, NZ_KK737546.1, 461701, 461991, +, 291, 10309; cds-WP_004176221.1, NZ_KK737546.1, 462200, 462961, +, 762, 7413; cds-WP_004143517.1, NZ_KK737546.1, 463122, 463442, +, 321, 373; cds-WP_032429505.1, NZ_KK737546.1, 463433, 463813, +, 381, 23087; cds-WP_021440101.1, NZ_KK737546.1, 464024, 464470, -, 447, 80666; cds-WP_004183995.1, NZ_KK737546.1, 464724, 466175, -, 1452, 195298; cds-WP_021440100.1, NZ_KK737546.1, 466289, 466819, -, 531, 31486; cds-WP_004148352.1, NZ_KK737546.1, 466897, 468321, -, 1425, 484159; cds-WP_004190206.1, NZ_KK737546.1, 468436, 468804, -, 369, 1736; cds-AF52_RS0123140, NZ_KK737546.1, 468804, 469730, -, 927, 1485; cds-WP_021440098.1, NZ_KK737546.1, 469811, 471199, -, 1389, 2430; cds-WP_002904495.1, NZ_KK737546.1, 471301, 472179, +, 879, 9398; cds-WP_009308907.1, NZ_KK737546.1, 472133, 472615, -, 483, 8842; cds-WP_021440097.1, NZ_KK737546.1, 472760, 473704, +, 945, 86178; cds-WP_002904489.1, NZ_KK737546.1, 473719, 474480, -, 762, 263545; cds-WP_016532445.1, NZ_KK737546.1, 474482, 475468, -, 987, 10377; cds-WP_032429506.1, NZ_KK737546.1, 475461, 476696, -, 1236, 44; cds-WP_004179774.1, NZ_KK737546.1, 476871, 478019, +, 1149, 22498; cds-WP_021440094.1, NZ_KK737546.1, 478034, 478918, +, 885, 3859; cds-WP_021440093.1, NZ_KK737546.1, 479004, 479954, +, 951, 22435; cds-WP_004179768.1, NZ_KK737546.1, 480018, 481337, +, 1320, 79551; cds-WP_004179766.1, NZ_KK737546.1, 481383, 482177, -, 795, 67966; cds-WP_002904407.1, NZ_KK737546.1, 482379, 483578, +, 1200, 47204; cds-WP_002904403.1, NZ_KK737546.1, 483647, 484315, -, 669, 73116; cds-WP_004217987.1, NZ_KK737546.1, 484359, 484487, -, 129, 1259; cds-WP_013815099.1-11, NZ_KK737546.1, 484550, 485518, -, 969, 73302; cds-WP_032429507.1, NZ_KK737546.1, 485643, 486077, +, 435, 4439; cds-WP_002904397.1, NZ_KK737546.1, 486098, 486472, +, 375, 145401; cds-WP_002904394.1, NZ_KK737546.1, 486513, 486731, +, 219,88400; cds-WP_004143566.1, NZ_KK737546.1, 486780, 487679, -, 900, 35707; cds-WP_021440091.1, NZ_KK737546.1, 487875, 489071, +, 1197, 13816; cds-WP_002904389.1, NZ_KK737546.1, 489201, 489683, +, 483, 31; cds-WP_004176246.1, NZ_KK737546.1, 489719, 490417, -, 699, 69; cds-WP_004148342.1, NZ_KK737546.1, 490427, 491224, -, 798, 1; cds-WP_032429508.1, NZ_KK737546.1, 491224, 492297, -, 1074, 53; cds-WP_015958384.1, NZ_KK737546.1, 492297, 493871, -, 1575, 36; cds-WP_032429509.1, NZ_KK737546.1, 493933, 495204, -, 1272, 0; cds-WP_004148338.1, NZ_KK737546.1, 495376, 496479, -, 1104, 7121; cds-WP_004183961.1, NZ_KK737546.1, 496628, 497026, -, 399, 0; cds-WP_029602386.1, NZ_KK737546.1, 497094, 498191, +, 1098, 1847; cds-WP_004205985.1, NZ_KK737546.1, 498160, 498375, +, 216, 83683; cds-WP_021440087.1, NZ_KK737546.1, 498428, 498868, -, 441, 120445; cds-WP_004183956.1, NZ_KK737546.1, 499122, 500186, -, 1065, 1082;


cds-WP _021440086.1, NZ_KK737546.1, 500383, 503490, +, 3108, 28210; cds-WP_032429510.1, NZ_KK737546.1, 503545, 504810, +, 1266, 256634; cds-WP _021440085.1, NZ_KK737546.1, 504841, 505929, -, 1089, 64022; cds-WP_004176262.1, NZ_KK737546.1, 506016, 506276, -, 261, 39274; cds-WP_021440083.1, NZ_KK737546.1, 506568, 507434, +, 867, 25979; cds-WP_002210513.1, NZ_KK737546.1, 507455, 508216, -, 762, 58752; cds-AF52_RS0123150, NZ_KK737546.1, 508478, 509380, +, 903, 23137; cds-WP_004224682.1, NZ_KK737546.1, 509392, 510657, +, 1266, 73032; cds-WP _002210516.1, NZ_KK737546.1, 510650, 511270, +, 621, 6456; cds-WP _004176276.1, NZ_KK737546.1, 511275, 512057, +, 783, 20802; cds-WP _013815099.1-12, NZ_KK737546.1, 512157, 513125, -, 969, 92834; cds-AF52_RS0123155, NZ_KK737546.1, 513181, 514545, +, 1365, 2935; cds-WP _021440081.1, NZ_KK737546.1, 514572, 515498, -, 927, 55422; cds-AF52_RS0123160, NZ_KK737546.1, 515809, 516421, +, 613, 7; cds-WP_004195995.1, NZ_KK737546.1, 516452, 516571, -, 120, 0; cds-WP_004143607.1, NZ_KK737546.1, 516972, 518189, +, 1218, 36209; cds-WP_032429511.1, NZ_KK737546.1, 518210, 518722, -, 513, 4599; cds-WP_004183942.1, NZ_KK737546.1, 518888, 519361, -, 474, 285438; cds-WP _004173721.1, NZ_KK737546.1, 519807, 519941, -, 135, 11024; cds-WP_020316505.1, NZ_KK737546.1, 520183, 520305, +, 123, 0; cds-WP _013815099.1-13, NZ_KK737546.1, 520461, 521429, +, 969, 92525; cds-WP _032429512.1, NZ_KK737546.1, 521466, 522074, +, 609, 76962; cds-WP _004143611.1, NZ_KK737546.1, 522071, 522193, -, 123, 0; cds-WP_004219446.1, NZ_KK737546.1, 522248, 522376, -, 129, 0; cds-WP _004176282.1, NZ_KK737546.1, 522548, 523222, +, 675, 0; cds-WP _015958377.1, NZ_KK737546.1, 523273, 524115, -, 843, 55035; cds-WP _002903735.1, NZ_KK737546.1, 524143, 524529, +, 387, 1394; cds-WP _032417100.1, NZ_KK737546.1, 524607, 526652, -, 2046, 26183; cds-WP_032429513.1, NZ_KK737546.1, 526783, 527532, +, 750, 361122; cds-WP _002903730.1, NZ_KK737546.1, 527624, 528310, +, 687, 173988; cds-WP _004183938.1, NZ_KK737546.1, 528363, 528794, -, 432, 106855; cds-WP_032429514.1, NZ_KK737546.1, 529059, 530522, -, 1464, 9389; cds-WP_032429515.1, NZ_KK737546.1, 530776, 532059, -, 1284, 41224; cds-WP _072143281.1, NZ_KK737546.1, 532173, 532535, -, 363, 8384; cds-WP _002903720.1, NZ_KK737546.1, 532644, 532985, +, 342, 163336; cds-WP_002903719.1, NZ_KK737546.1, 533064, 533624, +, 561, 316122; cds-WP_032428279.1, NZ_KK737546.1, 533618, 534328, -, 711, 96596; cds-WP _002903714.1, NZ_KK737546.1, 534430, 534699, +, 270, 158610; cds-WP_032429516.1, NZ_KK737546.1, 534850, 537285, +, 2436, 35850; cds-WP _004152235.1, NZ_KK737546.1, 537296, 537913, +, 618, 10483; cds-WP _002903710.1, NZ_KK737546.1, 537915, 538772, +, 858, 1481; cds-WP_004209765.1, NZ_KK737546.1, 538814, 539422, +, 609, 11771; cds-WP _021440073.1, NZ_KK737546.1, 539556, 540851, +, 1296, 58846; cds-WP _032428278.1, NZ_KK737546.1, 540804, 541499, -, 696, 46070; cds-WP _002903701.1, NZ_KK737546.1, 541627, 542847, -, 1221, 394131; cds-WP_002903700.1, NZ_KK737546.1, 542971, 543873, -, 903, 2529; cds-WP _002903698.1, NZ_KK737546.1, 544004, 545254, +, 1251, 31956; cds-WP _029884324.1, NZ_KK737546.1, 545594, 547081, +, 1488, 298071; cds-WP _002903693.1, NZ_KK737546.1, 547246, 547665, +, 420, 36423; cds-WP _013815099.1-14, NZ_KK737546.1, 548708, 549676, -, 969, 75382; cds-WP _050484275.1, NZ_KK737546.1, 549709, 550482, +, 774, 44851; cds-WP_004224649.1, NZ_KK737546.1, 550496, 550612, +, 117, 17570; cds-WP _032429518.1, NZ_KK737546.1, 550656, 550985, -, 330, 91899; cds-WP_002903681.1, NZ_KK737546.1, 550972, 551334, -, 363, 570420; cds-WP_002903679.1, NZ_KK737546.1, 551777, 552811, +, 1035, 79626; cds-WP _004176297.1, NZ_KK737546.1, 553036, 554691, +, 1656, 0; cds-WP_009486289.1, NZ_KK737546.1, 554691, 555533, +, 843, 90; cds-WP _032428276.1, NZ_KK737546.1, 555551, 555850, +, 300, 0; cds-WP _004143105.1, NZ_KK737546.1, 555843, 556676, +, 834, 538; cds-WP_032429519.1, NZ_KK737546.1, 556676, 557476, +, 801, 0; cds-WP _004148291.1, NZ_KK737546.1, 557613, 558572, +, 960, 1589; cds-WP _004152239.1, NZ_KK737546.1, 558576, 559193, +, 618, 1173; cds-WP _021440066.1, NZ_KK737546.1, 559193, 560095, +, 903, 34; cds-WP _002903632.1, NZ_KK737546.1, 560085, 561011, -, 927, 129412; cds-AF52_RS20250, NZ_KK737546.1, 561169, 562206, -, 1038, 4231; cds-AF52_RS20245, NZ_KK737546.1, 562264, 562518, -, 255, 23083; cds-WP_032429520.1, NZ_KK737546.1, 563260, 563512, -, 253, 18095; cds-AF52_RS20235, NZ_KK737546.1, 563544, 564125, -, 582, 12; cds-WP_032428274.1, NZ_KK737546.1, 564433, 565356, -, 924, 75938; cds-WP_016529947.1, NZ_KK737546.1, 565520, 565876, -, 357, 990; cds-WP _032429521.1, NZ_KK737546.1, 566032, 567648, +, 1617, 149691; cds-WP _004176303.1, NZ_KK737546.1, 567645, 568364, +, 720, 91521; cds-WP _020803870.1, NZ_KK737546.1, 568345, 569295, -, 951, 8146; cds-WP _004152245.1, NZ_KK737546.1, 569363, 572140, -, 2778, 22243; cds-WP_004148278.1, NZ_KK737546.1, 572782, 574293, +, 1512, 64; cds-WP _004152246.1, NZ_KK737546.1, 574348, 576000, +, 1653, 27194; cds-WP _032417097.1, NZ_KK737546.1, 576164, 577780, +, 1617, 8790; cds-WP_004143067.1, NZ_KK737546.1, 578370, 578759, -, 390, 3061; cds-WP_004151556.1, NZ_KK737546.1, 578752, 579516, -, 765, 25994; cds-WP_032429522.1, NZ_KK737546.1, 579506, 580858, -, 1353, 8882; cds-WP _009308944.1, NZ_KK737546.1, 580868, 582070, -, 1203, 700; cds-WP _032429523.1, NZ_KK737546.1, 582081, 582737, -, 657, 29; cds-WP_002903522.1, NZ_KK737546.1, 582748, 583434, -, 687, 27064; cds-WP_004151560.1, NZ_KK737546.1, 583604, 584410, +, 807, 27428; cds-WP _032429524.1, NZ_KK737546.1, 584407, 584970, -, 564, 41664; cds-WP _002903460.1, NZ_KK737546.1, 585072, 585980, -, 909, 47486; cds-WP_021440059.1, NZ_KK737546.1, 586147, 587457, +, 1311, 97543; cds-WP_020805029.1, NZ_KK737546.1, 587457, 588902, +, 1446, 412512; cds-WP_017879817.1, NZ_KK737546.1, 589022, 590140, +, 1119, 67305; cds-WP _072001564.1, NZ_KK737546.1, 590269, 591363, +, 1095, 251793; cds-WP _072001565.1, NZ_KK737546.1, 591373, 592209, +, 837, 114369; cds-WP _021314545.1, NZ_KK737546.1, 592340, 592711, -, 372, 508964; cds-WP _032429525.1, NZ_KK737546.1, 593013, 593564, -, 552, 1629; cds-AF52_RS27770, NZ_KK737546.1, 593656, 594012, +, 357, 0; cds-WP_013815099.1-15, NZ_KK737546.1, 596036, 597004, -, 969, 91647; cds-AF52_RS25145, NZ_KK737546.1, 597030, 597290, +, 261, 6878; cds-WP _004150800.1, NZ_KK737546.1, 597408, 598658, -, 1251, 8405681; cds-WP _004150801.1, NZ_KK737546.1, 598899, 599549, +, 651, 92532; cds-WP _021313538.1, NZ_KK737546.1, 599566, 600024, +, 459, 108442; cds-WP _004150803.1, NZ_KK737546.1, 600081, 601187, +, 1107, 1072857; cds-WP _004140557.1, NZ_KK737546.1, 601242, 601883, +, 642, 995954; cds-WP_004176557.1, NZ_KK737546.1, 601887, 603257, +, 1371, 1471179; cds-WP_004213084.1, NZ_KK737546.1, 603312, 603674, -, 363, 42374; cds-WP _004183655.1, NZ_KK737546.1, 603758, 604564, -, 807, 2556; cds-WP _004150807.1, NZ_KK737546.1, 604848, 605519, +, 672, 266724; cds-WP_004147969.1, NZ_KK737546.1, 605519, 606985, +, 1467, 417181; cds-WP_004176560.1, NZ_KK737546.1, 607071, 608192, +, 1122, 370138; cds-WP _004150810.1, NZ_KK737546.1, 608332, 609564, -, 1233, 1529; cds-WP_004150811.1, NZ_KK737546.1, 609823, 610959, +, 1137, 105522; cds-WP _004150812.1, NZ_KK737546.1, 610943, 611800, +, 858, 98488; cds-WP _004150813.1, NZ_KK737546.1, 611797, 612582, +, 786, 11628; cds-WP _004140590.1, NZ_KK737546.1, 612579, 613625, +, 1047, 371271; cds-WP_032429526.1, NZ_KK737546.1, 613672, 615396, -, 1725, 64823; cds-WP _032429527.1, NZ_KK737546.1, 615393, 617021, -, 1629, 4749; cds-WP_032429528.1, NZ_KK737546.1, 617259, 619262, -, 2004, 3176901; cds-WP_009484250.1, NZ_KK737546.1, 619282, 620235, -, 954, 10562; cds-AF52_RS0123220, NZ_KK737546.1, 620263, 620421, -, 159, 37058; cds-AF52_RS0123225, NZ_KK737546.1, 620476, 621173, +, 698, 374498; cds-WP _032429529.1, NZ_KK737546.1, 621229, 622248, -, 1020, 0; cds-AF52_RS25155, NZ_KK737546.1, 622341, 622724, -, 384, 4803; cds-WP_013815099.1-16, NZ_KK737546.1, 622777, 623745, -, 969, 82668; cds-AF52_RS19995, NZ_KK737546.1, 623776, 625125, -, 1350, 10753; cds-WP _004179336.1, NZ_KK737546.1, 625161, 626168, -, 1008, 96294; cds-WP_004211823.1, NZ_KK737546.1, 626411, 627205, +, 795, 749; cds-WP _004140612.1, NZ_KK737546.1, 627241, 628203, +, 963, 103882; cds-WP_032429531.1, NZ_KK737546.1, 628228, 628572, -, 345, 40962; cds-WP _004179333.1, NZ_KK737546.1, 628663, 629493, -, 831, 134505; cds-WP_004140619.1, NZ_KK737546.1, 629508, 630419, -, 912, 179458; cds-WP _002900801.1, NZ_KK737546.1, 630468, 631712, -, 1245, 77452; cds-WP _002900798.1, NZ_KK737546.1, 631712, 632413, -, 702, 71743; cds-WP _004176566.1, NZ_KK737546.1, 632406, 633605, -, 1200, 182418; cds-WP _004140630.1, NZ_KK737546.1, 633739, 633870, -, 132, 8111; cds-WP _016946615.1, NZ_KK737546.1, 633910, 637356, +, 3447, 544299; cds-WP _023159039.1, NZ_KK737546.1, 637514, 638479, +, 966, 267974; cds-WP_002900788.1, NZ_KK737546.1, 638608, 638865, -, 258, 114310; cds-WP _004147941.1, NZ_KK737546.1, 638963, 639118, +, 156,9701; cds-WP _004140640.1, NZ_KK737546.1, 639115, 639750, +, 636, 98084; cds-WP _004140642.1, NZ_KK737546.1, 639803, 639925, -, 123, 22483; cds-WP _004150817.1, NZ_KK737546.1, 639994, 642183, +, 2190, 2772151; cds-WP_002900781.1, NZ_KK737546.1, 642241, 642780, -, 540, 111735; cds-WP_002900778.1, NZ_KK737546.1, 642975, 644279, -, 1305, 114871; cds-WP _002900775.1, NZ_KK737546.1, 644525, 645067, -, 543, 293387; cds-WP _004147935.1, NZ_KK737546.1, 645103, 646113, -, 1011, 298912; cds-WP_023286229.1, NZ_KK737546.1, 646137, 646964, -, 828, 54277; cds-WP _014342994.1, NZ_KK737546.1, 646945, 647583, -, 639, 145031; cds-WP_002900683.1, NZ_KK737546.1, 647605, 647979, -, 375, 119400; cds-WP_002900681.1, NZ_KK737546.1, 647984, 648340, -, 357, 63987; cds-WP_002900680.1, NZ_KK737546.1, 648602, 650035, -, 1434, 2067333; cds-WP _009484238.1, NZ_KK737546.1, 650332, 651126, -, 795, 133394; cds-WP _021441547.1, NZ_KK737546.1, 651137, 652141, -, 1005, 166485; cds-WP_002900674.1, NZ_KK737546.1, 652138, 652779, -, 642, 94396; cds-WP _002900671.1, NZ_KK737546.1, 652769, 653791, -, 1023, 272915; cds-WP _002900669.1, NZ_KK737546.1, 653793, 654602, -, 810, 75679; cds-WP_032428777.1, NZ_KK737546.1, 654728, 655969, -, 1242, 2528380; cds-WP _000103754.1, NZ_KK737546.1, 656059, 656295, -, 237, 4349737; cds-WP _002899294.1, NZ_KK737546.1, 656506, 657240, -, 735, 3787661; cds-WP _009308402.1, NZ_KK737546.1, 657253, 658182, -, 930, 837616; cds-WP_002899288.1, NZ_KK737546.1, 658198, 659151, -, 954, 801173; cds-WP_004140697.1, NZ_KK737546.1, 659205, 660365, -, 1161, 2780718; cds-WP _000290724.1, NZ_KK737546.1, 660506, 660679, -, 174, 7861409; cds-WP_002899276.1, NZ_KK737546.1, 660696, 661217, -, 522, 16103854; cds-WP _004183641.1, NZ_KK737546.1, 661359, 661943, +, 585, 117482; cds-WP _002899271.1, NZ_KK737546.1, 661981, 662934, -, 954, 139504; cds-AF52_RS19800, NZ_KK737546.1, 663634, 666601, +, 2968, 5110388; cds-WP _014342992.1, NZ_KK737546.1, 666598, 666849, +, 252, 27867; cds-WP_004218670.1, NZ_KK737546.1, 666888, 667916, -, 1029, 6498; cds-WP_004176581.1, NZ_KK737546.1, 667933, 669147, +, 1215, 0; cds-WP_002899104.1, NZ_KK737546.1, 669202, 670737, -, 1536, 536958; cds-WP _004140718.1, NZ_KK737546.1, 670849, 671760, -, 912, 493945; cds-WP _004179323.1, NZ_KK737546.1, 671776, 672429, -, 654, 589320; cds-WP_002899099.1, NZ_KK737546.1, 672439, 673023, -, 585, 386355; cds-WP _002899096.1, NZ_KK737546.1, 673253, 674461, +, 1209, 65303; cds-WP_004150824.1, NZ_KK737546.1, 674575, 675135, +, 561, 387448; cds-WP _032428773.1, NZ_KK737546.1, 675261, 676307, +, 1047, 492273; cds-WP_002898994.1, NZ_KK737546.1, 676380, 676631, +, 252, 123986; cds-WP _002898992.1, NZ_KK737546.1, 676934, 677188, +, 255, 356709; cds-WP _014907855.1, NZ_KK737546.1, 677314, 678432, +, 1119, 205047; cds-WP_002898988.1, NZ_KK737546.1, 678504, 678617, +, 114, 54268; cds-WP_032429533.1, NZ_KK737546.1, 678603, 679667, -, 1065, 267887; cds-WP_004140735.1, NZ_KK737546.1, 679873, 680793, +, 921, 242186; cds-WP _002898984.1, NZ_KK737546.1, 680965, 682191, +, 1227, 3783; cds-WP_002898981.1, NZ_KK737546.1, 682283, 682669, +, 387, 11264; cds-WP_002898978.1, NZ_KK737546.1, 682670, 682897, -, 228, 11996; cds-WP _002898967.1, NZ_KK737546.1, 682964, 685492, -, 2529, 2457436; cds-WP_004183630.1, NZ_KK737546.1, 685485, 687038, -, 1554, 2763996; cds-WP _021441537.1, NZ_KK737546.1, 687290, 688450, +, 1161,


161371; cds-WP_004179313.1, NZ_KK737546.1, 688485, 689078, -, 594, 44901; cds-WP_021441536.1, NZ_KK737546.1, 689145, 689672, -, 528, 8715; cds-WP _004191006.1, NZ_KK737546.1, 689822, 690304, -, 483, 16763; cds-WP_004140758.1, NZ_KK737546.1, 690408, 690962, -, 555, 96957; cds-WP_004140764.1, NZ_KK737546.1, 690985, 691722, -, 738, 120652; cds-WP _032429534.1, NZ_KK737546.1, 691811, 692749, -, 939, 67714; cds-WP _020804646.1, NZ_KK737546.1, 693463, 694368, -, 906, 7242; cds-WP_032428769.1, NZ_KK737546.1, 694483, 695343, +, 861, 4063; cds-WP_002898927.1, NZ_KK737546.1, 695362, 696039, +, 678, 65750; cds-WP _013815099.1-17, NZ_KK737546.1, 696673, 697641, +, 969, 85984; cds-AF52_RS0123255, NZ_KK737546.1, 697961, 698214, +, 254, 1095; cds-WP_148673676.1, NZ_KK737546.1, 698298, 699011, +, 714, 24790; cds-WP _072001576.1, NZ_KK737546.1, 699534, 699737, -, 204, 1027; cds-WP_020806188.1, NZ_KK737546.1, 699763, 700743, +, 981, 278320; cds-WP_002906471.1, NZ_KK737546.1, 701021, 701311, -, 291, 10; cds-AF52_RS0123260, NZ_KK737546.1, 701331, 702492, -, 1162, 3186; cds-WP_187079186.1, NZ_KK737546.1, 702608, 703498, +, 891, 67740; cds-WP _032429537.1, NZ_KK737546.1, 703493, 704992, -, 1500, 367746; cds-WP_021440209.1, NZ_KK737546.1, 705116, 705691, +, 576, 332162; cds-WP_004151231.1, NZ_KK737546.1, 705866, 707248, +, 1383, 7333; cds-WP_021440211.1, NZ_KK737546.1, 707363, 711103, +, 3741, 31767; cds-WP _004148517.1, NZ_KK737546.1, 711100, 712644, +, 1545, 317; cds-WP _002906547.1, NZ_KK737546.1, 712644, 713339, +, 696, 7982; cds-WP_004180107.1, NZ_KK737546.1, 713336, 714016, +, 681,17705; cds-WP_032429538.1, NZ_KK737546.1, 714449, 715294, -, 846, 112919; cds-WP_021440213.1, NZ_KK737546.1, 715371, 717026, -, 1656, 181; cds-WP _004189830.1, NZ_KK737546.1, 717084, 718052, -, 969, 313; cds-WP_004189827.1, NZ_KK737546.1, 718049, 718753, -, 705, 57; cds-WP_004151228.1, NZ_KK737546.1, 718965, 719546, +, 582, 32211; cds-WP _021440214.1, NZ_KK737546.1, 719670, 719897, -, 228, 84008; cds-WP _021440215.1, NZ_KK737546.1, 719968, 720585, -, 618, 34906; cds-WP _014343117.1, NZ_KK737546.1, 720663, 721514, -, 852, 15500; cds-WP_002906697.1, NZ_KK737546.1, 721553, 722332, -, 780, 0; cds-WP_021440216.1, NZ_KK737546.1, 722316, 723242, -, 927, 32780; cds-WP_021440217.1, NZ_KK737546.1, 723252, 723761, -, 510, 1145; cds-WP_032429539.1, NZ_KK737546.1, 723773, 724705, -, 933, 0; cds-WP _032429540.1, NZ_KK737546.1, 724723, 726036, -, 1314, 1625; cds-WP_032429541.1, NZ_KK737546.1, 726061, 727182, -, 1122, 4; cds-WP_004898544.1, NZ_KK737546.1, 727172, 728179, -, 1008, 4680; cds-WP _004180132.1, NZ_KK737546.1, 728271, 728822, -, 552, 2; cds-WP _021440220.1, NZ_KK737546.1, 729096, 729983, +, 888, 53738; cds-WP _002906778.1, NZ_KK737546.1, 730173, 731627, +, 1455, 681026; cds-WP_002906779.1, NZ_KK737546.1, 731678, 731899, -, 222, 36126; cds-WP_032429542.1, NZ_KK737546.1, 732068, 733129, -, 1062, 733351; cds-WP _032429543.1, NZ_KK737546.1, 733388, 735493, +, 2106, 251082; cds-AF52_RS0123265, NZ_KK737546.1, 735691, 737396, +, 1706, 39278; cds-WP_002906788.1, NZ_KK737546.1, 737494, 737793, -, 300, 8258; cds-WP_032428300.1, NZ_KK737546.1, 737883, 738113, -, 231, 123; cds-WP_021440225.1, NZ_KK737546.1, 738075, 739010, +, 936, 166272; cds-WP_002906792.1, NZ_KK737546.1, 739074, 740111, -, 1038, 262936; cds-WP _002906794.1, NZ_KK737546.1, 740177, 740758, -, 582, 106049; cds-WP _002906796.1, NZ_KK737546.1, 740921, 741439, +, 519, 56835; cds-WP _004180135.1, NZ_KK737546.1, 741436, 741885, +, 450, 97896; cds-WP _002906801.1, NZ_KK737546.1, 741894, 742127, -, 234, 50559; cds-WP _009484786.1, NZ_KK737546.1, 742144, 743742, -, 1599, 246499; cds-WP _021440226.1, NZ_KK737546.1, 744012, 745445, +, 1434, 83200; cds-WP _004200090.1, NZ_KK737546.1, 745459, 746208, -, 750, 51219; cds-AF52_RS25200, NZ_KK737546.1, 746297, 746392, -, 96, 14; cds-WP_013815099.1-18, NZ_KK737546.1, 746451, 747419, -, 969, 90897; cds-AF52_RS0123285, NZ_KK737546.1, 747453, 747536, -, 84, 0; cds-WP _002906891.1, NZ_KK737546.1, 747732, 747824, +, 93, 633; cds-AF52_RS0123290, NZ_KK737546.1, 747881, 748849, +, 969, 120621; cds-WP_002906893.1, NZ_KK737546.1, 748942, 749193, -, 252, 60062; cds-WP_004189776.1, NZ_KK737546.1, 749331, 749528, -, 198, 8701; cds-WP_004175940.1, NZ_KK737546.1, 749677, 749799, +, 123, 3704; cds-WP _004175939.1, NZ_KK737546.1, 750140, 751567, -, 1428, 11487; cds-WP _004143773.1, NZ_KK737546.1, 751590, 752396, -, 807, 182; cds-WP _032429544.1, NZ_KK737546.1, 752386, 753315, -, 930, 41; cds-WP_004151215.1, NZ_KK737546.1, 753317, 754330, -, 1014, 1013; cds-AF52_RS0123305, NZ_KK737546.1, 754347, 755492, -, 1146, 51978; cds-WP _032429724.1, NZ_KK737546.1, 755797, 757209, -, 1413, 262555; cds-WP _032429545.1, NZ_KK737546.1, 757897, 759294, +, 1398, 3629; cds-WP_020802114.1, NZ_KK737546.1, 759294, 760304, +, 1011, 3082; cds-WP_004180143.1, NZ_KK737546.1, 760304, 760429, +, 126, 0; cds-WP_187079190.1, NZ_KK737546.1, 760525, 760692, +, 168, 2900; cds-WP_013815099.1-19, NZ_KK737546.1, 760738, 761706, -, 969, 75405; cds-WP_077254734.1, NZ_KK737546.1, 761708, 761899, -, 192, 262; cds-WP _004143781.1, NZ_KK737546.1, 762045, 762275, +, 231, 6005; cds-WP_032429546.1, NZ_KK737546.1, 762288, 764249, -, 1962, 696215; cds-WP_020806151.1, NZ_KK737546.1, 764283, 764450, +, 168, 32855; cds-WP _002907473.1, NZ_KK737546.1, 764461, 765030, -, 570, 37906; cds-WP_032428296.1, NZ_KK737546.1, 765216, 766382, +, 1167, 948; cds-WP_004151213.1, NZ_KK737546.1, 766359, 767228, -, 870, 10800; cds-WP_004151212.1, NZ_KK737546.1, 767409, 768305, +, 897, 31741; cds-WP_002907480.1, NZ_KK737546.1, 768352, 769020, -, 669, 146312; cds-WP_021440235.1, NZ_KK737546.1, 769281, 769877, -, 597, 7403; cds-WP_002907483.1, NZ_KK737546.1, 769874, 770878, -, 1005, 12453; cds-WP_004891515.1, NZ_KK737546.1, 770990, 771970, +, 981, 43801; cds-WP _002907487.1, NZ_KK737546.1, 771956, 772534, -, 579, 162222; cds-WP _002907489.1, NZ_KK737546.1, 772588, 774243, -, 1656, 1298757; cds-WP _032428297.1, NZ_KK737546.1, 774681, 775769, +, 1089, 12845; cds-WP _021440237.1, NZ_KK737546.1, 775816, 777321, -, 1506, 18050; cds-WP _002907549.1, NZ_KK737546.1, 777363, 778706, -, 1344, 17867; cds-WP _021440238.1, NZ_KK737546.1, 778946, 779686, +, 741, 47166; cds-WP_004143799.1, NZ_KK737546.1, 779683, 780303, +, 621, 1015; cds-WP_004143800.1, NZ_KK737546.1, 780481, 781404, +, 924, 1601215; cds-WP _021440239.1, NZ_KK737546.1, 781704, 784076, +, 2373, 92031; cds-WP _004143804.1, NZ_KK737546.1, 784146, 785264, -, 1119, 249721; cds-WP_002907563.1, NZ_KK737546.1, 785289, 785564, -, 276, 60900; cds-WP _002907640.1, NZ_KK737546.1, 785669, 786196, -, 528, 123504; cds-WP_004143806.1, NZ_KK737546.1, 786456, 786818, +, 363, 69245; cds-WP_002907644.1, NZ_KK737546.1, 786828, 787013, -, 186, 80535; cds-WP_032429547.1, NZ_KK737546.1, 787257, 787721, -, 465, 86599; cds-WP_032428298.1, NZ_KK737546.1, 787915, 789069, +, 1155, 1278270; cds-WP_004151209.1, NZ_KK737546.1, 789227, 790228, +, 1002, 1341336; cds-WP_021440243.1, NZ_KK737546.1, 790264, 791304, -, 1041, 123889; cds-WP_004227851.1, NZ_KK737546.1, 791495, 791632, +, 138, 44745; cds-WP_021440244.1, NZ_KK737546.1, 791748, 793118, +, 1371, 146732; cds-WP _002907652.1, NZ_KK737546.1, 793335, 793550, +, 216, 270834; cds-WP_002907654.1, NZ_KK737546.1, 793626, 794066, +, 441, 121849; cds-WP_002907658.1, NZ_KK737546.1, 794145, 794726, +, 582, 527488; cds-WP_004143816.1, NZ_KK737546.1, 794726, 795304, +, 579, 211043; cds-AF52_RS19200, NZ_KK737546.1, 795297, 797532, +, 2236, 334540; cds-WP_002907730.1, NZ_KK737546.1, 797533, 798585, +, 1053, 412447; cds-WP _002907731.1, NZ_KK737546.1, 798596, 799216, +, 621, 209627; cds-WP _002907733.1, NZ_KK737546.1, 799219, 799917, +, 699, 149587; cds-WP_032429549.1, NZ_KK737546.1, 799919, 800554, +, 636, 333083; cds-WP_004151206.1, NZ_KK737546.1, 801162, 802667, +, 1506, 1880325; cds-WP _021440245.1, NZ_KK737546.1, 802778, 803383, +, 606, 109826; cds-WP_032428303.1, NZ_KK737546.1, 803426, 804286, -, 861, 103301; cds-WP_032429550.1, NZ_KK737546.1, 804348, 805622, -, 1275, 782225; cds-WP _032428304.1, NZ_KK737546.1, 805747, 806403, -, 657, 179793; cds-WP _032428306.1, NZ_KK737546.1, 806461, 806784, -, 324, 140521; cds-WP _004143831.1, NZ_KK737546.1, 806877, 808001, -, 1125, 154406; cds-WP_002907749.1, NZ_KK737546.1, 808269, 808736, +, 468, 133004; cds-AF52_RS19130, NZ_KK737546.1, 808959, 810134, +, 1176, 76525; cds-WP _013815099.1-20, NZ_KK737546.1, 810186, 811154, -, 969, 89311; cds-AF52_RS25210, NZ_KK737546.1, 811180, 811386, +, 207, 21469; cds-WP _004143833.1, NZ_KK737546.1, 811420, 811860, -, 441, 294271; cds-WP_002907752.1, NZ_KK737546.1, 812033, 812269, +, 237, 13001; cds-WP_004143835.1, NZ_KK737546.1, 812280, 813176, +, 897, 60162; cds-WP _002907754.1, NZ_KK737546.1, 813176, 815200, +, 2025, 42961; cds-WP_032429551.1, NZ_KK737546.1, 815193, 815711, -, 519, 43543; cds-WP_021440254.1, NZ_KK737546.1, 815781, 816677, -, 897, 774078; cds-WP _004189722.1, NZ_KK737546.1, 816726, 816968, -, 243, 4707; cds-WP _004175857.1, NZ_KK737546.1, 817108, 817707, +, 600, 30718; cds-WP _002907763.1, NZ_KK737546.1, 817761, 818858, +, 1098, 64695; cds-WP _013815099.1-21, NZ_KK737546.1, 818914, 819882, +, 969, 76709; cds-WP _002907764.1, NZ_KK737546.1, 820003, 820410, +, 408, 26548; cds-WP_002907766.1, NZ_KK737546.1, 820548, 821195, +, 648, 152129; cds-WP_032429552.1, NZ_KK737546.1, 821243, 821590, -, 348, 218025; cds-WP _004151204.1, NZ_KK737546.1, 821931, 822803, +, 873, 297257; cds-WP_004200127.1, NZ_KK737546.1, 822758, 823243, -, 486, 96695; cds-WP _002907771.1, NZ_KK737546.1, 823713, 824294, +, 582, 544830; cds-WP_002907773.1, NZ_KK737546.1, 824356, 825522, -, 1167, 204037; cds-WP_004152976.1, NZ_KK737546.1, 825690, 825779, -, 90, 19582; cds-WP_002907778.1, NZ_KK737546.1, 826075, 827100, +, 1026, 62844; cds-WP_004180170.1, NZ_KK737546.1, 827027, 828031, -, 1005, 25938; cds-WP _002907785.1, NZ_KK737546.1, 828144, 829325, +, 1182, 33014; cds-WP _032429553.1, NZ_KK737546.1, 829618, 830766, +, 1149, 342801; cds-WP _021440257.1, NZ_KK737546.1, 830803, 831438, -, 636, 157108; cds-WP_032429554.1, NZ_KK737546.1, 831668, 833041, +, 1374, 80544; cds-WP_004180172.1, NZ_KK737546.1, 833217, 833453, +, 237, 142; cds-AF52_RS0123325, NZ_KK737546.1, 833594, 834171, -, 578, 24175; cds-AF52_RS25220, NZ_KK737546.1, 835237, 835697, -, 461, 2239; cds-WP _032428308.1, NZ_KK737546.1, 836525, 837277, -, 753, 10; cds-WP _004180175.1, NZ_KK737546.1, 837376, 838302, +, 927, 4408; cds-WP_002907799.1, NZ_KK737546.1, 838299, 839183, -, 885, 4001; cds-WP_021440259.1, NZ_KK737546.1, 839340, 839855, +, 516, 0; cds-WP_004184289.1, NZ_KK737546.1, 839863, 840699, +, 837, 2175; cds-WP_002907802.1, NZ_KK737546.1, 840787, 840936, -, 150, 2077; cds-WP _004143863.1, NZ_KK737546.1, 841338, 841772, +, 435, 196; cds-WP_021440261.1, NZ_KK737546.1, 841818, 842534, +, 717, 28591; cds-WP_002907807.1, NZ_KK737546.1, 842619, 842828, +, 210, 15401; cds-WP _002907811.1, NZ_KK737546.1, 843141, 843776, -, 636, 349048; cds-WP _002907812.1, NZ_KK737546.1, 844026, 844655, +, 630, 229762; cds-WP_004189677.1, NZ_KK737546.1, 844660, 845430, -, 771, 2016; cds-WP_004175834.1, NZ_KK737546.1, 845522, 845905, +, 384, 6203; cds-WP_004175829.1, NZ_KK737546.1, 845937, 846620, +, 684, 195293; cds-WP_032428309.1, NZ_KK737546.1, 846965, 848668, +, 1704, 30793; cds-WP_004175825.1, NZ_KK737546.1, 848712, 849671, +, 960, 0; cds-WP _016197619.1, NZ_KK737546.1, 849668, 850618, +, 951, 11; cds-WP_021440263.1, NZ_KK737546.1, 850615, 851595, +, 981, 41; cds-WP _021440264.1, NZ_KK737546.1, 851592, 852563, +, 972, 0; cds-WP_002907918.1, NZ_KK737546.1, 852929, 853456, +, 528, 398887; cds-WP_032429555.1, NZ_KK737546.1, 853574, 854062, +, 489, 214127; cds-AF52_RS25225, NZ_KK737546.1, 854099, 854194, -, 96, 26421; cds-AF52_RS0123345, NZ_KK737546.1, 854208, 855739, -, 1532, 51773; cds-WP _021440267.1, NZ_KK737546.1, 855856, 856773, +, 918, 8233; cds-WP _021440268.1, NZ_KK737546.1, 856847, 857836, -, 990, 626; cds-WP_032429556.1, NZ_KK737546.1, 857857, 859275, -, 1419, 91; cds-WP _032428310.1, NZ_KK737546.1, 859287, 860276, -, 990, 0; cds-WP _021440271.1, NZ_KK737546.1, 860571, 861470, -, 900, 2548; cds-WP _032428312.1, NZ_KK737546.1, 861678, 862646, +, 969, 1211; cds-WP_021440273.1, NZ_KK737546.1, 862658, 863941, +, 1284, 6; cds-WP_002908128.1, NZ_KK737546.1, 863931, 864410, +, 480, 474; cds-WP_021440274.1, NZ_KK737546.1, 864407, 865288, +, 882, 11385; cds-WP_002908130.1, NZ_KK737546.1,


865288, 866271, +, 984, 27568; cds-WP_032429558.1, NZ_KK737546.1, 866268, 867098, +, 831, 0; cds-WP_002908134.1, NZ_KK737546.1, 867100, 867915, +, 816, 0; cds-WP_032429559.1, NZ_KK737546.1, 867942, 869363, +, 1422, 260; cds-WP_026005880.1, NZ_KK737546.1, 869443, 869691, +, 249, 2595; cds-WP_004145368.1, NZ_KK737546.1, 869857, 870765, -, 909, 1146594; cds-WP_002908189.1, NZ_KK737546.1, 871055, 871195, +, 141, 11816; cds-WP_004189584.1, NZ_KK737546.1, 871242, 872132, -, 891, 16076; cds-WP_004175762.1, NZ_KK737546.1, 872273, 872980, +, 708, 8776; cds-WP_021440277.1, NZ_KK737546.1, 872982, 873638, +, 657, 20433; cds-WP_032429560.1, NZ_KK737546.1, 873648, 874829, +, 1182,0; cds-WP_004891326.1, NZ_KK737546.1, 874841, 875764, +, 924, 78; cds-WP_032428313.1, NZ_KK737546.1, 875812, 877203, +, 1392, 2622; cds-WP_002908202.1, NZ_KK737546.1, 877227, 877997, +, 771, 9791; cds-WP_004145376.1, NZ_KK737546.1, 878017, 878889, -, 873, 10098; cds-WP_002908205.1, NZ_KK737546.1, 878996, 879775, +, 780, 46; cds-WP_004200174.1, NZ_KK737546.1, 879785, 881464, +, 1680, 352; cds-WP_004151179.1, NZ_KK737546.1, 881488, 882258, +, 771, 4382; cds-WP_013815099.1-22, NZ_KK737546.1, 883311, 884279, -, 969, 92098; cds-AF52_RS0123360, NZ_KK737546.1, 884312, 884632, +, 321, 33876; cds-WP_032428316.1, NZ_KK737546.1, 885134, 885976, -, 843, 14; cds-WP_014599186.1, NZ_KK737546.1, 885973, 886419, -, 447, 955; cds-WP_002908216.1, NZ_KK737546.1, 886431, 886985, -, 555, 78; cds-WP_021440283.1, NZ_KK737546.1, 886982, 888934, -, 1953, 51; cds-WP_021440284.1, NZ_KK737546.1, 888931, 889389, -, 459, 9698; cds-WP_021440285.1, NZ_KK737546.1, 889373, 889603, -, 231, 0; cds-WP_004189553.1, NZ_KK737546.1, 889600, 890337, -, 738, 57; cds-WP_032428317.1, NZ_KK737546.1, 890387, 891046, -, 660, 240; cds-WP_004151165.1, NZ_KK737546.1, 891043, 891666, -, 624, 1700; cds-WP_182920176.1, NZ_KK737546.1, 891750, 893090, -, 1341, 14620; cds-WP_002908285.1, NZ_KK737546.1, 893101, 894885, -, 1785, 28068; cds-WP_004217200.1, NZ_KK737546.1, 894888, 895643, -, 756, 49; cds-WP_002908289.1, NZ_KK737546.1, 896145, 896516, +, 372, 2396; cds-WP_002908292.1, NZ_KK737546.1, 896524, 897594, -, 1071, 21042; cds-WP_002908294.1, NZ_KK737546.1, 897587, 899356, -, 1770, 318384; cds-WP_002908297.1, NZ_KK737546.1, 899430, 900518, -, 1089, 423628; cds-WP_021313976.1, NZ_KK737546.1, 900821, 901900, +, 1080, 11349; cds-WP_021440289.1, NZ_KK737546.1, 902147, 904297, +, 2151, 3220; cds-WP_014343153.1, NZ_KK737546.1, 904340, 904501, -, 162, 0; cds-AF52_RS18635, NZ_KK737546.1, 904465, 905497, -, 1033, 24885; cds-WP_004148650.1, NZ_KK737546.1, 905793, 906992, +, 1200, 4290; cds-WP_004175720.1, NZ_KK737546.1, 907108, 907542, +, 435, 29713; cds-WP_032428318.1, NZ_KK737546.1, 908108, 909340, +, 1233, 21231; cds-WP_002908370.1, NZ_KK737546.1, 909377, 909769, +, 393, 46198; cds-WP_021440293.1, NZ_KK737546.1, 909898, 910485, -, 588, 0; cds-WP_002908374.1, NZ_KK737546.1, 910785, 911507, -, 723, 28975; cds-WP_032429562.1, NZ_KK737546.1, 911494, 912258, -, 765, 12076; cds-WP_032428319.1, NZ_KK737546.1, 912322, 913089, -, 768, 46487; cds-WP_002908378.1, NZ_KK737546.1, 913182, 914084, -, 903, 7792; cds-WP_004148675.1, NZ_KK737546.1, 914081, 915058, -, 978, 21043; cds-WP_021440296.1, NZ_KK737546.1, 915048, 916100, -, 1053,622; cds-WP_004213478.1, NZ_KK737546.1, 916097, 917122, -, 1026, 33791; cds-WP_002908416.1, NZ_KK737546.1, 917119, 917940, -, 822, 50221; cds-WP_004891261.1, NZ_KK737546.1, 918446, 920518, +, 2073, 22304; cds-WP_004175711.1, NZ_KK737546.1, 920627, 921400, -, 774, 0; cds-WP_004148681.1, NZ_KK737546.1, 921394, 922389, -, 996, 0; cds-WP_032429563.1, NZ_KK737546.1, 922370, 923407, -, 1038, 3654; cds-WP_002908454.1, NZ_KK737546.1, 923404, 924366, -, 963, 10; cds-WP_032429564.1, NZ_KK737546.1, 924372, 925523, -, 1152, 94; cds-WP_016947511.1, NZ_KK737546.1, 925520, 926605, -, 1086, 45; cds-WP_032429565.1, NZ_KK737546.1, 926750, 927643, -, 894, 163; cds-WP_002908526.1, NZ_KK737546.1, 927750, 928352, +, 603, 12; cds-WP_021440299.1, NZ_KK737546.1, 928358, 929938, +, 1581, 4421; cds-WP_021440300.1, NZ_KK737546.1, 929951, 930676, -, 726, 21145; cds-AF52_RS0123375, NZ_KK737546.1, 930779, 931975, -, 1197, 1250; cds-WP_004180340.1, NZ_KK737546.1, 932051, 933067, -, 1017, 348; cds-WP_021440302.1, NZ_KK737546.1, 933064, 934014, -, 951, 3534; cds-WP_032429566.1, NZ_KK737546.1, 934007, 934813, -, 807, 0; cds-WP_004175683.1, NZ_KK737546.1, 934824, 935690, -, 867, 138; cds-WP_021440303.1, NZ_KK737546.1, 935708, 936652, -, 945, 99; cds-WP_024622675.1, NZ_KK737546.1, 936654, 938318, -, 1665, 39230; cds-WP_004184404.1, NZ_KK737546.1, 938496, 939308, +, 813, 2789; cds-WP_016530930.1, NZ_KK737546.1, 939400, 940458, +, 1059, 80742; cds-WP_004151840.1, NZ_KK737546.1, 940448, 941455, +, 1008, 2; cds-WP_004151841.1, NZ_KK737546.1, 941452, 942201, +, 750, 502; cds-WP_014907413.1, NZ_KK737546.1, 942185, 942928, -, 744, 12657; cds-WP_004175664.1, NZ_KK737546.1, 942985, 943821, -, 837, 53670; cds-WP_004148701.1, NZ_KK737546.1, 943837, 945159, -, 1323, 45470; cds-WP_032429567.1, NZ_KK737546.1, 945231, 947084, -, 1854, 29961; cds-WP_002908844.1, NZ_KK737546.1, 947211, 947849, +, 639, 40032; cds-WP_004180357.1, NZ_KK737546.1, 947867, 948079, -, 213, 20153; cds-WP_014907411.1, NZ_KK737546.1, 948069, 948227, -, 159, 2178; cds-WP_004217210.1, NZ_KK737546.1, 948316, 948447, -, 132, 27626; cds-WP_002908859.1, NZ_KK737546.1, 948585, 949997, +, 1413, 1803984; cds-WP_032429569.1, NZ_KK737546.1, 950310, 950546, +, 237, 3280507; cds-WP_004143241.1, NZ_KK737546.1, 950608, 951594, -, 987, 268703; cds-WP_002908865.1, NZ_KK737546.1, 951694, 952110, -, 417, 85331; cds-WP_002908867.1, NZ_KK737546.1, 952122, 953342, -, 1221, 39769; cds-AF52_RS18405, NZ_KK737546.1, 953339, 954046, -, 708, 32; cds-WP_013815099.1-23, NZ_KK737546.1, 954079, 955047, +, 969, 119323; cds-AF52_RS18395, NZ_KK737546.1, 955104, 955679, -, 576, 35363; cds-WP_002908876.1, NZ_KK737546.1, 955654, 956400, -, 747, 114860; cds-WP_002908877.1, NZ_KK737546.1, 956417, 957904, -, 1488, 310645; cds-WP_004143232.1, NZ_KK737546.1, 957907, 958284, -, 378, 21374; cds-WP_002908880.1, NZ_KK737546.1, 958767, 958964, -, 198, 1915; cds-WP_014343173.1, NZ_KK737546.1, 958963, 959100, +, 138, 342; cds-WP_004143228.1, NZ_KK737546.1, 959201, 959596, +, 396, 3546; cds-WP_002908882.1, NZ_KK737546.1, 959593, 960225, +, 633, 21772; cds-WP_004151846.1, NZ_KK737546.1, 960480, 961664, +, 1185, 2465; cds-WP_021440309.1, NZ_KK737546.1, 961720, 964812, -, 3093, 20562; cds-WP_032429570.1, NZ_KK737546.1, 964809, 965918, -, 1110, 3403; cds-WP_020805192.1, NZ_KK737546.1, 965993, 966529, -, 537, 19513; cds-WP_021440311.1, NZ_KK737546.1, 966703, 967698, -, 996, 52150; cds-WP_004175653.1, NZ_KK737546.1, 967795, 968706, +, 912, 9886; cds-WP_004180366.1, NZ_KK737546.1, 968865, 969863, +, 999, 163694; cds-WP_002908998.1, NZ_KK737546.1, 969863, 970900, +, 1038, 86793; cds-WP_004212506.1, NZ_KK737546.1, 970900, 971661, +, 762, 209796; cds-WP_182920187.1, NZ_KK737546.1, 971718, 972905, +, 1188, 187314; cds-WP_002909005.1, NZ_KK737546.1, 972988, 974019, -, 1032, 48590; cds-WP_002909008.1, NZ_KK737546.1, 974043, 975023, -, 981, 40005; cds-WP_004212509.1, NZ_KK737546.1, 975593, 975913, +, 321, 148895; cds-WP_002909014.1, NZ_KK737546.1, 976011, 976259, -, 249, 59621; cds-WP_002909015.1, NZ_KK737546.1, 976464, 976874, -, 411, 42030; cds-WP_004175614.1, NZ_KK737546.1, 976871, 979927, -, 3057, 246657; cds-WP_004148729.1, NZ_KK737546.1, 980146, 981258, +, 1113, 76160; cds-WP_002909055.1, NZ_KK737546.1, 981641, 984019, -, 2379, 3907518; cds-WP_009484225.1, NZ_KK737546.1, 984095, 984214, +, 120, 935; cds-WP_002909061.1, NZ_KK737546.1, 984359, 985192, +, 834, 318327; cds-WP_021440317.1, NZ_KK737546.1, 985347, 986393, +, 1047, 122406; cds-WP_002909070.1, NZ_KK737546.1, 986501, 986728, +, 228, 24091; cds-WP_021440318.1, NZ_KK737546.1, 986758, 988200, -, 1443, 372190; cds-WP_002909082.1, NZ_KK737546.1, 988314, 988778, -, 465, 39613; cds-WP_020803964.1, NZ_KK737546.1, 988860, 989609, -, 750, 115809; cds-WP_004180371.1, NZ_KK737546.1, 989609, 990160, -, 552, 21685; cds-WP_002909085.1, NZ_KK737546.1, 990397, 991197, +, 801, 393433; cds-WP_004151850.1, NZ_KK737546.1, 991234, 992220, -, 987, 62671; cds-WP_014907393.1, NZ_KK737546.1, 992342, 993775, -, 1434, 44410; cds-WP_002909089.1, NZ_KK737546.1, 994056, 994970, +, 915, 128855; cds-WP_020802655.1, NZ_KK737546.1, 995020, 996273, +, 1254, 83757; cds-WP_021440321.1, NZ_KK737546.1, 996270, 996623, +, 354, 3002; cds-WP_002909098.1, NZ_KK737546.1, 996676, 996975, -, 300, 651882; cds-WP_015958605.1, NZ_KK737546.1, 996980, 999367, -, 2388, 2685901; cds-WP_002909105.1, NZ_KK737546.1, 999383, 1000366, -, 984, 790367; cds-WP_001386830.1, NZ_KK737546.1, 1000505, 1000549, -, 45, 984; cds-WP_000124850.1, NZ_KK737546.1, 1000673, 1001029, -, 357, 11167969; cds-WP_001124225.1, NZ_KK737546.1, 1001080, 1001277, -, 198, 7290760; cds-WP_004189469.1, NZ_KK737546.1, 1001370, 1001912, -, 543, 8581305; cds-WP_032429575.1, NZ_KK737546.1, 1001916, 1003844, -, 1929, 8369298; cds-WP_002910028.1, NZ_KK737546.1, 1004276, 1004509, -, 234, 3434; cds-WP_002910030.1, NZ_KK737546.1, 1004781, 1005539, -, 759, 139199; cds-WP_032429576.1, NZ_KK737546.1, 1005896, 1006828, +, 933, 25256; cds-WP_004184572.1, NZ_KK737546.1, 1006923, 1007207, +, 285, 25485; cds-WP_032429577.1, NZ_KK737546.1, 1007313, 1008185, +, 873, 302380; cds-WP_014343181.1, NZ_KK737546.1, 1008229, 1009017, -, 789, 206279; cds-WP_002910042.1, NZ_KK737546.1, 1009186, 1009482, +, 297, 129044; cds-WP_032103891.1, NZ_KK737546.1, 1009595, 1009735, +, 141, 2526; cds-WP_072271743.1, NZ_KK737546.1, 1010163, 1010810, +, 648, 13558; cds-WP_004194006.1, NZ_KK737546.1, 1011313, 1011486, -, 174, 1343; cds-WP_002910077.1, NZ_KK737546.1, 1011630, 1013090, +, 1461, 510612; cds-WP_002910079.1, NZ_KK737546.1, 1013125, 1013454, +, 330, 37066; cds-WP_002910080.1, NZ_KK737546.1, 1013517, 1014344, -, 828, 214381; cds-WP_002910083.1, NZ_KK737546.1, 1014400, 1015404, -, 1005, 282745; cds-WP_004151853.1, NZ_KK737546.1, 1015401, 1016414, -, 1014, 412449; cds-WP_004145396.1, NZ_KK737546.1, 1016426, 1017334, -, 909, 310605; cds-WP_002910089.1, NZ_KK737546.1, 1017349, 1018269, -, 921, 144698; cds-WP_004148754.1, NZ_KK737546.1, 1018355, 1019989, -, 1635, 2245889; cds-WP_002910095.1, NZ_KK737546.1, 1020727, 1021374, -, 648, 25320; cds-WP_004145398.1, NZ_KK737546.1, 1021558, 1021773, -, 216, 38; cds-WP_002910097.1, NZ_KK737546.1, 1021851, 1024526, +, 2676, 2669653; cds-WP_002910100.1, NZ_KK737546.1, 1024674, 1025291, -, 618, 75555; cds-WP_004145401.1, NZ_KK737546.1, 1025299, 1025430, +, 132, 1594; cds-WP_002910103.1, NZ_KK737546.1, 1025853, 1026260, +, 408, 2182248; cds-WP_002910105.1, NZ_KK737546.1, 1026382, 1027284, -, 903, 3193508; cds-WP_002910107.1, NZ_KK737546.1, 1027482, 1028495, -, 1014, 224160; cds-WP_002910108.1, NZ_KK737546.1, 1028585, 1029487, -, 903, 413028; cds-WP_032429578.1, NZ_KK737546.1, 1029600, 1030058, +, 459, 338226; cds-WP_004151854.1, NZ_KK737546.1, 1030101, 1030943, +, 843, 474339; cds-WP_032428322.1, NZ_KK737546.1, 1031951, 1032394, -, 444, 180616; cds-WP_021440328.1, NZ_KK737546.1, 1032502, 1033398, +, 897, 317; cds-WP_032429579.1, NZ_KK737546.1, 1033395, 1034072, -, 678, 93625; cds-WP_002910191.1, NZ_KK737546.1, 1034072, 1034782, -, 711, 111746; cds-WP_019705142.1, NZ_KK737546.1, 1034779, 1036314, -, 1536, 99385; cds-WP_004180382.1, NZ_KK737546.1, 1036311, 1040054, -, 3744, 211732; cds-WP_032428329.1, NZ_KK737546.1, 1040221, 1040334, -, 114, 0; cds-WP_032428323.1, NZ_KK737546.1, 1040460, 1041848, -, 1389, 16754; cds-WP_004175566.1, NZ_KK737546.1, 1042160, 1043938, +, 1779, 78910; cds-WP_002910198.1, NZ_KK737546.1, 1043949, 1044599, +, 651, 72496; cds-WP_002910201.1, NZ_KK737546.1, 1044596, 1045978, -, 1383, 67689; cds-WP_004175564.1, NZ_KK737546.1, 1046130, 1048730, -, 2601, 3428; cds-WP_021440334.1, NZ_KK737546.1, 1048730, 1052797, -, 4068, 160; cds-WP_004145418.1, NZ_KK737546.1, 1052808, 1053596, -, 789, 0; cds-WP_004152255.1, NZ_KK737546.1, 1053606, 1054490, -, 885, 0; cds-WP_032429580.1, NZ_KK737546.1, 1054492, 1055748, -, 1257, 0; cds-WP_021440335.1, NZ_KK737546.1, 1055991, 1057172, -, 1182, 0; cds-WP_002910380.1, NZ_KK737546.1, 1057240, 1057593, +, 354, 96068; cds-WP_002910387.1, NZ_KK737546.1, 1057831, 1058073, +, 243, 41540; cds-WP_004152258.1, NZ_KK737546.1, 1058291, 1058971, -, 681, 102568; cds-WP_002910389.1,


NZ_KK737546.1, 1059108, 1059338, -, 231, 14910; cds-WP_002910392.1, NZ_KK737546.1, 1059602, 1060702, +, 1101, 395416; cds-WP_002910393.1, NZ_KK737546.1, 1060789, 1061643, -, 855, 1190831; cds-WP_032429581.1, NZ_KK737546.1, 1061683, 1062495, -, 813, 402633; cds-WP_004145428.1, NZ_KK737546.1, 1062499, 1062891, -, 393, 57633; cds-WP_004898979.1, NZ_KK737546.1, 1062891, 1063739, -, 849, 268295; cds-WP_002910403.1, NZ_KK737546.1, 1063739, 1064821, -, 1083, 118008; cds-WP_002910404.1, NZ_KK737546.1, 1064864, 1066120, -, 1257, 267787; cds-WP_002910405.1, NZ_KK737546.1, 1066391, 1067002, +, 612, 435167; cds-WP_004898981.1, NZ_KK737546.1, 1067002, 1067850, +, 849, 1069941; cds-WP_002910407.1, NZ_KK737546.1, 1068034, 1068981, +, 948, 5984409; cds-WP_004200291.1, NZ_KK737546.1, 1069106, 1070785, +, 1680, 195660; cds-WP_004175547.1, NZ_KK737546.1, 1070786, 1071832, -, 1047, 117709; cds-WP_002910437.1, NZ_KK737546.1, 1072054, 1072329, -, 276, 236728; cds-WP_004180389.1, NZ_KK737546.1, 1072602, 1073186, +, 585, 550048; cds-WP_002910443.1, NZ_KK737546.1, 1073304, 1074395, +, 1092, 1696062; cds-WP_004145442.1, NZ_KK737546.1, 1074477, 1074806, -, 330, 117884; cds-WP_002910453.1, NZ_KK737546.1, 1074890, 1075804, -, 915, 126143; cds-WP_032429582.1, NZ_KK737546.1, 1075936, 1077351, -, 1416, 0; cds-WP_004175538.1, NZ_KK737546.1, 1077371, 1077814, -, 444, 295; cds-WP_004175532.1, NZ_KK737546.1, 1077817, 1078353, -, 537, 0; cds-WP_021440342.1, NZ_KK737546.1, 1078334, 1079350, -, 1017, 83; cds-AF52_RS17835, NZ_KK737546.1, 1079380, 1081143, -, 1764, 219; cds-WP_171991785.1, NZ_KK737546.1, 1081277, 1084693, -, 3417, 55425; cds-WP_004899005.1, NZ_KK737546.1, 1084708, 1085919, -, 1212, 48158; cds-WP_004899008.1, NZ_KK737546.1, 1085924, 1086181, -, 258, 1207; cds-WP_013815099.1-24, NZ_KK737546.1, 1086223, 1087191, +, 969, 75293; cds-WP_071603213.1, NZ_KK737546.1, 1087273, 1088052, -, 780, 0; cds-AF52_RS25250, NZ_KK737546.1, 1088184, 1089413, -, 1230, 6210; cds-AF52_RS26885, NZ_KK737546.1, 1089482, 1089616, +, 135, 6244; cds-WP_187079183.1, NZ_KK737546.1, 1089947, 1090528, -, 582, 8381; cds-AF52_RS0123460, NZ_KK737546.1, 1090628, 1090912, -, 285, 37502; cds-AF52_RS26890, NZ_KK737546.1, 1095758, 1095891, -, 134, 10854; cds-AF52_RS25260, NZ_KK737546.1, 1096147, 1096341, +, 195, 10832; cds-WP_050484277.1, NZ_KK737546.1, 1096700, 1097497, -, 798, 1645; cds-AF52_RS26910, NZ_KK737546.1, 1101418, 1101547, -, 130, 3625; cds-WP_024622687.1, NZ_KK737546.1, 1101978, 1103318, +, 1341, 0; cds-WP_032429587.1, NZ_KK737546.1, 1103315, 1103968, +, 654, 0; cds-WP_032429588.1, NZ_KK737546.1, 1103972, 1105669, +, 1698, 0; cds-AF52_RS27855, NZ_KK737546.1, 1105856, 1105980, +, 125, 1266; cds-AF52_RS17780, NZ_KK737546.1, 1106131, 1108194, +, 2064, 14640; cds-WP_013815099.1-25, NZ_KK737546.1, 1108246, 1109214, -, 969, 71088; cds-WP_050484282.1, NZ_KK737546.1, 1109194, 1110111, +, 918, 74270; cds-WP_032429589.1, NZ_KK737546.1, 1110157, 1110477, -, 321, 9972; cds-WP_032429590.1, NZ_KK737546.1, 1110545, 1110808, -, 264, 660; cds-WP_032429591.1, NZ_KK737546.1, 1110819, 1111511, -, 693, 407; cds-WP_032429592.1, NZ_KK737546.1, 1111564, 1113084, -, 1521, 11383; cds-WP_032429593.1, NZ_KK737546.1, 1113085, 1114761, -, 1677, 53251; cds-WP_032429594.1, NZ_KK737546.1, 1114766, 1115335, -, 570, 7498; cds-WP_032429596.1, NZ_KK737546.1, 1115340, 1115555, -, 216, 2711; cds-WP_087749278.1, NZ_KK737546.1, 1115890, 1116027, -, 138, 4; cds-WP_032429598.1, NZ_KK737546.1, 1116030, 1116497, -, 468, 13020; cds-WP_020804048.1, NZ_KK737546.1, 1116494, 1117024, -, 531, 10697; cds-WP_004151282.1, NZ_KK737546.1, 1117027, 1117275, -, 249, 171; cds-WP_032429600.1, NZ_KK737546.1, 1118641, 1118994, -, 354, 545426; cds-WP_004884209.1, NZ_KK737546.1, 1119587, 1120087, -, 501, 32949; cds-WP_032429601.1, NZ_KK737546.1, 1120084, 1120224, -, 141, 12; cds-WP_032429603.1, NZ_KK737546.1, 1120221, 1120583, -, 363, 483; cds-WP_004141687.1, NZ_KK737546.1, 1120580, 1120870, -, 291, 1400; cds-WP_032429604.1, NZ_KK737546.1, 1120863, 1121033, -, 171, 1809; cds-WP_032429606.1, NZ_KK737546.1, 1121014, 1121481, -, 468, 3; cds-WP_032429607.1, NZ_KK737546.1, 1121740, 1121937, -, 198, 0; cds-WP_032429608.1, NZ_KK737546.1, 1121930, 1122235, -, 306, 173; cds-WP_077254738.1, NZ_KK737546.1, 1122226, 1122615, -, 390, 65040; cds-AF52_RS25290, NZ_KK737546.1, 1122697, 1122954, -, 258, 37718; cds-WP_001096658.1, NZ_KK737546.1, 1123182, 1123418, -, 237, 3; cds-WP_032429609.1, NZ_KK737546.1, 1123418, 1123792, -, 375, 2330; cds-WP_050484278.1, NZ_KK737546.1, 1123792, 1124439, -, 648, 99512; cds-WP_032429610.1, NZ_KK737546.1, 1124546, 1124806, -, 261, 52978; cds-WP_032429612.1, NZ_KK737546.1, 1124803, 1125198, -, 396, 12917; cds-AF52_RS0123495, NZ_KK737546.1, 1125195, 1125496, -, 302, 12; cds-WP_187079187.1, NZ_KK737546.1, 1125496, 1126911, -, 1416, 35789; cds-WP_187079188.1, NZ_KK737546.1, 1126916, 1127767, -, 852, 37543; cds-WP_004151298.1-2, NZ_KK737546.1, 1127808, 1127954, -, 147, 661; cds-WP_004141720.1-2, NZ_KK737546.1, 1128041, 1128361, -, 321, 6614; cds-WP_023284762.1, NZ_KK737546.1, 1128411, 1128626, -, 216, 3393; cds-WP_019704102.1, NZ_KK737546.1, 1128726, 1129358, +, 633, 159168; cds-WP_074440723.1, NZ_KK737546.1, 1129864, 1129989, +, 126, 58333; cds-WP_072001571.1, NZ_KK737546.1, 1129982, 1130188, +, 207, 56891; cds-WP_032429616.1, NZ_KK737546.1, 1130270, 1130554, +, 285, 95492; cds-AF52_RS27875, NZ_KK737546.1, 1130566, 1130764, +, 199, 8822; cds-WP_014342891.1, NZ_KK737546.1, 1130734, 1131069, +, 336, 7226; cds-WP_032429617.1, NZ_KK737546.1, 1131066, 1131689, +, 624, 37346; cds-WP_032429618.1, NZ_KK737546.1, 1131686, 1132114, +, 429, 3574; cds-WP_032429619.1, NZ_KK737546.1, 1132111, 1132767, +, 657, 37703; cds-WP_032429620.1, NZ_KK737546.1, 1132764, 1133933, +, 1170, 64092; cds-WP_032429621.1, NZ_KK737546.1, 1134147, 1134491, +, 345, 7496; cds-WP_072001572.1, NZ_KK737546.1, 1134484, 1134678, +, 195, 1; cds-WP_032429622.1, NZ_KK737546.1, 1134675, 1134866, +, 192, 485; cds-WP_032429623.1, NZ_KK737546.1, 1134863, 1135081, +, 219, 2; cds-WP_019725112.1, NZ_KK737546.1, 1135085, 1135327, +, 243, 14; cds-WP_032429624.1, NZ_KK737546.1, 1135375, 1136637, +, 1263, 107160; cds-AF52_RS0123510, NZ_KK737546.1, 1136676, 1136903, +, 228, 3756; cds-WP_004145468.1, NZ_KK737546.1, 1136878, 1137687, -, 810, 12884; cds-WP_004175494.1, NZ_KK737546.1, 1137699, 1138994, -, 1296, 1415; cds-WP_032429625.1, NZ_KK737546.1, 1139298, 1140224, -, 927, 121506; cds-WP_002910717.1, NZ_KK737546.1, 1140323, 1140799, +, 477, 137394; cds-WP_004148802.1, NZ_KK737546.1, 1140849, 1142492, -, 1644, 5085370; cds-WP_002910720.1, NZ_KK737546.1, 1142776, 1143669, +, 894, 335627; cds-WP_004175491.1, NZ_KK737546.1, 1143675, 1144394, -, 720, 22; cds-WP_004148803.1, NZ_KK737546.1, 1144391, 1145266, -, 876, 0; cds-WP_004148804.1, NZ_KK737546.1, 1145263, 1146549, -, 1287, 179; cds-WP_004175489.1, NZ_KK737546.1, 1146559, 1147473, -, 915, 378; cds-WP_004189329.1, NZ_KK737546.1, 1147583, 1148641, -, 1059, 0; cds-WP_004225356.1, NZ_KK737546.1, 1148931, 1149077, +, 147, 11; cds-WP_024622740.1, NZ_KK737546.1, 1149129, 1151423, -, 2295, 2733; cds-WP_021440352.1, NZ_KK737546.1, 1151452, 1152660, -, 1209, 13080; cds-WP_004145486.1, NZ_KK737546.1, 1152688, 1154019, -, 1332, 53606; cds-WP_004211070.1, NZ_KK737546.1, 1154045, 1155034, -, 990, 16; cds-WP_002910764.1, NZ_KK737546.1, 1155128, 1156069, -, 942, 57; cds-WP_004148810.1, NZ_KK737546.1, 1156246, 1156389, +, 144, 0; cds-WP_004145488.1, NZ_KK737546.1, 1156687, 1156809, +, 123, 113; cds-WP_024622741.1, NZ_KK737546.1, 1156847, 1157647, -, 801, 175; cds-WP_032425076.1, NZ_KK737546.1, 1157640, 1158626, -, 987, 682; cds-WP_002910830.1, NZ_KK737546.1, 1159065, 1159811, -, 747, 14229; cds-WP_008804319.1, NZ_KK737546.1, 1159828, 1160643, -, 816, 397; cds-WP_004184646.1, NZ_KK737546.1, 1160640, 1161569, -, 930, 238; cds-WP_004211064.1, NZ_KK737546.1, 1161563, 1163002, -, 1440, 882; cds-AF52_RS26335, NZ_KK737546.1, 1163005, 1163203, -, 199, 0; cds-WP_004175476.1, NZ_KK737546.1, 1163388, 1165133, +, 1746, 99609; cds-WP_023328505.1, NZ_KK737546.1, 1165384, 1167504, +, 2121, 364051; cds-WP_002910846.1, NZ_KK737546.1, 1167546, 1168157, -, 612, 386548; cds-WP_002910883.1, NZ_KK737546.1, 1168333, 1169247, +, 915, 1280; cds-WP_002910885.1, NZ_KK737546.1, 1169340, 1171073, +, 1734, 261506; cds-WP_002910887.1, NZ_KK737546.1, 1171090, 1172160, -, 1071, 1023236; cds-WP_004175465.1, NZ_KK737546.1, 1172170, 1173468, -, 1299, 2108262; cds-WP_032409324.1, NZ_KK737546.1, 1173567, 1173713, -, 147, 358; cds-WP_032429737.1, NZ_KK737546.1, 1173790, 1175322, +, 1533, 384016; cds-WP_002910890.1, NZ_KK737546.1, 1175397, 1176116, -, 720, 451966; cds-WP_004151442.1, NZ_KK737546.1, 1176365, 1177915, +, 1551, 290109; cds-WP_002910894.1, NZ_KK737546.1, 1178044, 1178574, +, 531, 167067; cds-WP_002910895.1, NZ_KK737546.1, 1178725, 1179069, +, 345, 22372; cds-WP_021440363.1, NZ_KK737546.1, 1179076, 1179522, -, 447, 148142; cds-WP_004180422.1, NZ_KK737546.1, 1179617, 1180276, -, 660, 231313; cds-WP_002910898.1, NZ_KK737546.1, 1180293, 1180574, -, 282, 56408; cds-WP_004180423.1, NZ_KK737546.1, 1180701, 1181399, +, 699, 617086; cds-WP_002910900.1, NZ_KK737546.1, 1181423, 1182235, +, 813, 2944661; cds-WP_002910902.1, NZ_KK737546.1, 1182239, 1182508, +, 270, 761645; cds-WP_187079189.1, NZ_KK737546.1, 1182586, 1183701, -, 1116, 144380; cds-WP_002910904.1, NZ_KK737546.1, 1183783, 1185468, -, 1686, 1632526; cds-WP_002910905.1, NZ_KK737546.1, 1185674, 1186255, -, 582, 60173; cds-WP_004151443.1, NZ_KK737546.1, 1186294, 1186989, -, 696, 61651; cds-WP_004175456.1, NZ_KK737546.1, 1187135, 1189045, -, 1911, 338260; cds-WP_002910910.1, NZ_KK737546.1, 1189176, 1189520, +, 345, 73588; cds-WP_004145519.1, NZ_KK737546.1, 1189521, 1189706, -, 186, 43011; cds-WP_004145520.1, NZ_KK737546.1, 1189795, 1191150, +, 1356, 139475; cds-WP_004180429.1, NZ_KK737546.1, 1191154, 1191732, +, 579, 74475; cds-WP_004151445.1, NZ_KK737546.1, 1191895, 1193259, +, 1365, 1416980; cds-WP_024622747.1, NZ_KK737546.1, 1193442, 1195025, +, 1584, 280834; cds-WP_004145524.1, NZ_KK737546.1, 1195059, 1196618, -, 1560, 856546; cds-WP_002910917.1, NZ_KK737546.1, 1197065, 1198036, +, 972, 2364158; cds-WP_002910918.1, NZ_KK737546.1, 1198093, 1198893, +, 801, 2331765; cds-WP_004145526.1, NZ_KK737546.1, 1198906, 1199757, +, 852, 2204752; cds-WP_002910920.1, NZ_KK737546.1, 1199820, 1200278, +, 459, 133571; cds-WP_009484665.1, NZ_KK737546.1, 1200697, 1201263, +, 567, 113729; cds-WP_002910922.1, NZ_KK737546.1, 1201267, 1202061, -, 795, 107700; cds-WP_002910924.1, NZ_KK737546.1, 1202123, 1203871, -, 1749, 264791; cds-WP_001062678.1, NZ_KK737546.1, 1204059, 1204268, -, 210, 1529418; cds-WP_071526670.1, NZ_KK737546.1, 1204351, 1204425, -, 75, 559602; cds-WP_002911374.1, NZ_KK737546.1, 1205016, 1205306, -, 291, 177976; cds-WP_002911375.1, NZ_KK737546.1, 1205381, 1205524, -, 144, 60709; cds-WP_004145533.1, NZ_KK737546.1, 1205684, 1205923, +, 240, 155909; cds-WP_002911378.1, NZ_KK737546.1, 1205980, 1206771, -, 792, 614517; cds-WP_072200054.1, NZ_KK737546.1, 1206898, 1208319, +, 1422, 75371; cds-WP_002911381.1, NZ_KK737546.1, 1208385, 1209269, -, 885, 2037296; cds-WP_004145536.1, NZ_KK737546.1, 1209505, 1211553, -, 2049, 3502314; cds-WP_002911385.1, NZ_KK737546.1, 1211573, 1212250, -, 678, 1229646; cds-WP_002911386.1, NZ_KK737546.1, 1212348, 1212845, -, 498, 138596; cds-WP_002911387.1, NZ_KK737546.1, 1212978, 1214261, +, 1284, 110841; cds-WP_002911388.1, NZ_KK737546.1, 1214230, 1216863, +, 2634, 930500; cds-WP_032429627.1, NZ_KK737546.1, 1216988, 1218421, +, 1434, 160902; cds-WP_002911393.1, NZ_KK737546.1, 1218537, 1218776, +, 240, 130994; cds-WP_002911395.1, NZ_KK737546.1, 1218874, 1219065, +, 192, 51; cds-WP_009484457.1, NZ_KK737546.1, 1219062, 1219715, -, 654, 15; cds-WP_014907334.1, NZ_KK737546.1, 1219872, 1220840, +, 969, 212057; cds-WP_002911398.1, NZ_KK737546.1, 1220945, 1221088, +, 144, 98019; cds-WP_002911404.1, NZ_KK737546.1, 1221724, 1222062, -, 339, 245869; cds-WP_032429628.1, NZ_KK737546.1, 1222079, 1222948, -, 870, 278904; cds-WP_004151448.1, NZ_KK737546.1, 1222952, 1223326, -, 375, 35547; cds-WP_002911406.1, NZ_KK737546.1, 1223439, 1223669, +, 231, 41108; cds-WP_002911407.1, NZ_KK737546.1, 1223748, 1224407, +, 660, 357376; cds-WP_004151449.1, NZ_KK737546.1, 1224411, 1226471, -, 2061, 478551; cds-WP_004180434.1, NZ_KK737546.1, 1226592, 1227251, -, 660, 434735; cds-WP_004184662.1, NZ_KK737546.1, 1227391,


1227738, -, 348, 80556; cds-WP_002911418.1, NZ_KK737546.1, 1227883, 1229061, +, 1179, 6539; cds-WP_002911423.1, NZ_KK737546.1, 1229119, 1229760, -, 642, 433668; cds-WP_002911425.1, NZ_KK737546.1, 1229799, 1231610, -, 1812, 100427; cds-WP_002911427.1, NZ_KK737546.1, 1231833, 1233308, -, 1476, 2242978; cds-WP _004145554.1, NZ_KK737546.1, 1233319, 1233468, -, 150, 295228; cds-WP_004145555.1, NZ_KK737546.1, 1233628, 1234533, +, 906, 662750; cds-WP_002911440.1, NZ_KK737546.1, 1234659, 1236101, +, 1443, 1727847; cds-WP _032429629.1, NZ_KK737546.1, 1236142, 1237116, -, 975, 163120; cds-WP_004148858.1, NZ_KK737546.1, 1237234, 1238553, -, 1320, 1351572; cds-WP _004180437.1, NZ_KK737546.1, 1238569, 1239513, -, 945, 648434; cds-WP _002911449.1, NZ_KK737546.1, 1239592, 1240344, +, 753, 126894; cds-WP_004212745.1, NZ_KK737546.1, 1240344, 1241129, +, 786, 25764; cds-WP _004148860.1, NZ_KK737546.1, 1241193, 1242203, -, 1011, 311948; cds-WP _002911454.1, NZ_KK737546.1, 1242212, 1242823, -, 612, 113180; cds-WP_002911456.1, NZ_KK737546.1, 1242903, 1243424, -, 522, 190997; cds-WP_002911459.1, NZ_KK737546.1, 1243459, 1244199, -, 741, 2268049; cds-WP_002911477.1, NZ_KK737546.1, 1244227, 1244670, -, 444, 393106; cds-WP_002911479.1, NZ_KK737546.1, 1244672, 1246459, -, 1788, 3121888; cds-WP_004145564.1, NZ_KK737546.1, 1246727, 1247293, +, 567, 299718; cds-WP_009307531.1, NZ_KK737546.1, 1247290, 1248108, +, 819, 82307; cds-WP _002911484.1, NZ_KK737546.1, 1248161, 1248556, +, 396, 82812; cds-WP_004175417.1, NZ_KK737546.1, 1248596, 1249339, +, 744, 245025; cds-WP_032429630.1, NZ_KK737546.1, 1249336, 1250340, +, 1005, 486093; cds-WP _032429631.1, NZ_KK737546.1, 1250422, 1251165, -, 744, 325423; cds-WP _015958659.1, NZ_KK737546.1, 1251242, 1251811, -, 570, 1230; cds-WP_004151452.1, NZ_KK737546.1, 1252047, 1253780, +, 1734, 1212075; cds-WP _002911497.1, NZ_KK737546.1, 1253842, 1254981, -, 1140, 22011; cds-WP _021440394.1, NZ_KK737546.1, 1254986, 1256569, -, 1584, 0; cds-WP _002911500.1, NZ_KK737546.1, 1256923, 1257351, +, 429, 29911; cds-WP _004175414.1, NZ_KK737546.1, 1257375, 1258799, -, 1425, 154473; cds-WP _002911505.1, NZ_KK737546.1, 1258774, 1259562, -, 789, 14368; cds-WP_002911507.1, NZ_KK737546.1, 1259724, 1260704, -, 981, 11322; cds-WP_004184670.1, NZ_KK737546.1, 1260719, 1262233, -, 1515, 4751; cds-WP _009484443.1, NZ_KK737546.1, 1262296, 1263276, -, 981, 530; cds-WP_160540596.1, NZ _KK737546.1, 1263638, 1263736, +, 99, 0; cds-WP_004175413.1, NZ_KK737546.1, 1264168, 1264677, +, 510, 40275; cds-WP_004148869.1, NZ_KK737546.1, 1264748, 1264906, -, 159, 65; cds-WP_002911522.1, NZ_KK737546.1, 1264972, 1266483, +, 1512, 73967; cds-WP_002911524.1, NZ_KK737546.1, 1266521, 1266772, -, 252, 42929; cds-WP_021440395.1, NZ_KK737546.1, 1266923, 1268344, +, 1422, 12522; cds-WP_021440396.1, NZ_KK737546.1, 1268394, 1269032, -, 639, 74378; cds-AF52_RS0123570, NZ_KK737546.1, 1269204, 1269384, +, 181, 0; cds-WP_004141101.1, NZ_KK737546.1, 1269442, 1269939, +, 498, 206156; cds-WP_024622766.1, NZ_KK737546.1, 1269975, 1270214, -, 240, 17841; cds-WP _004151453.1, NZ_KK737546.1, 1270406, 1271617, +, 1212, 127232; cds-WP_004141106.1, NZ_KK737546.1, 1271642, 1272310, -, 669, 102824; cds-WP_004180444.1, NZ_KK737546.1, 1272409, 1273290, -, 882, 21839; cds-WP_002911537.1, NZ_KK737546.1, 1273958, 1274506, -, 549, 54323; cds-WP _002911538.1, NZ_KK737546.1, 1274564, 1276396, -, 1833, 566251; cds-WP_002911539.1, NZ_KK737546.1, 1276393, 1277049, -, 657, 111855; cds-WP_002911541.1, NZ_KK737546.1, 1277511, 1277735, +, 225, 83847; cds-WP_032429632.1, NZ_KK737546.1, 1277803, 1278525, -, 723, 647671; cds-WP_024622767.1, NZ_KK737546.1, 1278843, 1279595, -, 753, 49226; cds-WP_002911547.1, NZ_KK737546.1, 1279592, 1280260, -, 669, 356050; cds-WP _021313403.1, NZ_KK737546.1, 1280276, 1281262, -, 987, 257269; cds-WP _004141135.1, NZ_KK737546.1, 1281358, 1282158, -, 801, 273068; cds-WP_004899206.1, NZ_KK737546.1, 1282359, 1283846, +, 1488,365360; cds-WP_004189223.1, NZ_KK737546.1, 1283888, 1284322, -, 435, 19280; cds-WP_004180447.1, NZ_KK737546.1, 1284695, 1285318, +, 624, 234843; cds-WP_002911586.1, NZ_KK737546.1, 1285351, 1285542, -, 192, 64874; cds-WP_002911589.1, NZ_KK737546.1, 1285676, 1285897, +, 222, 263; cds-WP_013815099.1-26, NZ_KK737546.1, 1286063, 1287031, -, 969, 106043; cds-AF52_RS25350, NZ_KK737546.1, 1287063, 1287197, -, 135, 575; cds-WP _004184683.1, NZ_KK737546.1, 1287375, 1288286, +, 912, 53524; cds-WP_024622769.1, NZ_KK737546.1, 1288261, 1288755, -, 495, 41563; cds-WP_004153246.1, NZ_KK737546.1, 1288736, 1290136, -, 1401, 115612; cds-WP_002911594.1, NZ_KK737546.1, 1290213, 1290920, -, 708, 45503; cds-WP_004151461.1, NZ_KK737546.1, 1290963, 1291244, -, 282, 9461; cds-WP _002911596.1, NZ_KK737546.1, 1291783, 1292928, +, 1146, 88322; cds-WP _004227143.1, NZ_KK737546.1, 1293381, 1294181, +, 801, 206942; cds-WP_009484428.1, NZ_KK737546.1, 1294767, 1295462, +, 696, 27021; cds-WP_016946077.1, NZ_KK737546.1, 1295493, 1295690, +, 198, 13612; cds-WP_022631352.1, NZ_KK737546.1, 1295840, 1296781, -, 942, 221391; cds-WP_004175385.1, NZ_KK737546.1, 1296860, 1297810, -, 951, 24362; cds-WP_002911729.1, NZ_KK737546.1, 1297917, 1298834, -, 918, 1483; cds-WP_004148971.1, NZ_KK737546.1, 1299334, 1300968, -, 1635, 48332; cds-WP _022631351.1, NZ_KK737546.1, 1301560, 1302264, +, 705, 65423; cds-WP_004151466.1, NZ_KK737546.1, 1302261, 1303238, +, 978, 42311; cds-WP_004184763.1, NZ_KK737546.1, 1303359, 1304291, +, 933, 23291; cds-WP_032429633.1, NZ_KK737546.1, 1304202, 1305824, -, 1623, 5997; cds-WP_004141189.1, NZ_KK737546.1, 1306097, 1306342, +, 246, 41059; cds-WP_004148975.1, NZ_KK737546.1, 1306472, 1307926, +, 1455, 647867; cds-WP _004151469.1, NZ_KK737546.1, 1308292, 1309728, -, 1437, 13548; cds-AF52_RS25355, NZ_KK737546.1, 1310050, 1310136, -, 87, 1862; cds-WP _022631349.1, NZ_KK737546.1, 1310278, 1311381, +, 1104, 38443; cds-WP_002911798.1, NZ_KK737546.1, 1311378, 1312349, -, 972, 31317; cds-WP _004180471.1, NZ_KK737546.1, 1312556, 1313392, -, 837, 101847; cds-WP_016532101.1, NZ_KK737546.1, 1313585, 1314160, -, 576, 476; cds-WP_022631348.1, NZ_KK737546.1, 1314292, 1315206, +, 915, 11079; cds-WP_002911862.1, NZ_KK737546.1, 1315212, 1315547, -, 336, 12948; cds-WP _002911866.1, NZ_KK737546.1, 1315554, 1315886, -, 333, 5953; cds-WP _004144110.1, NZ_KK737546.1, 1315984, 1316112, +, 129, 2154; cds-WP_016831855.1, NZ_KK737546.1, 1316109, 1318019, -, 1911, 104748; cds-WP _014907250.1, NZ_KK737546.1, 1318030, 1318491, -, 462, 128087; cds-WP _022631347.1, NZ_KK737546.1, 1318835, 1320154, +, 1320, 37573; cds-WP_022631346.1, NZ_KK737546.1, 1320201, 1320941, +, 741, 9198; cds-WP _032429739.1, NZ_KK737546.1, 1320901, 1321857, -, 957, 96524; cds-WP _004175282.1, NZ_KK737546.1, 1321973, 1322362, +, 390, 76337; cds-WP_002911879.1, NZ_KK737546.1, 1322384, 1323115, -, 732, 113225; cds-WP _004200363.1, NZ_KK737546.1, 1323314, 1324423, +, 1110, 286379; cds-WP_004200364.1, NZ_KK737546.1, 1324466, 1325533, -, 1068, 45509; cds-WP _021440419.1, NZ_KK737546.1, 1325561, 1326301, -, 741, 32188; cds-WP_002911883.1, NZ_KK737546.1, 1326616, 1326939, -, 324, 768700; cds-WP_032429634.1, NZ_KK737546.1, 1327107, 1328165, -, 1059, 644843; cds-WP _021440421.1, NZ_KK737546.1, 1328264, 1328737, -, 474, 567867; cds-WP_004153104.1, NZ_KK737546.1, 1328913, 1330076, -, 1164, 257567; cds-WP_032429635.1, NZ_KK737546.1, 1330257, 1331681, +, 1425, 290164; cds-WP_002912106.1, NZ_KK737546.1, 1331905, 1334007, -, 2103, 67589; cds-WP_002912109.1, NZ_KK737546.1, 1334247, 1334558, +, 312, 67117; cds-WP_004148994.1, NZ_KK737546.1, 1334740, 1336098, -, 1359, 833543; cds-WP _096335043.1, NZ_KK737546.1, 1336088, 1336150, -, 63, 22519; cds-WP _004175276.1, NZ_KK737546.1, 1336388, 1337278, -, 891, 26244; cds-WP _004152513.1, NZ_KK737546.1, 1337317, 1338141, -, 825, 57863; cds-WP_004899375.1, NZ_KK737546.1, 1338318, 1338368, +, 51, 10026; cds-WP _002912152.1, NZ_KK737546.1, 1338514, 1339413, +, 900, 162932; cds-WP _009307478.1, NZ_KK737546.1, 1339453, 1340757, +, 1305, 222518; cds-WP_032429636.1, NZ_KK737546.1, 1340754, 1341815, +, 1062, 191747; cds-WP_004144133.1, NZ_KK737546.1, 1341812, 1342879, +, 1068, 111285; cds-WP _002912227.1, NZ _KK737546.1, 1342879, 1343469, +, 591, 129433; cds-WP_004175272.1, NZ _KK737546.1, 1343469, 1344206, +, 738, 130620; cds-WP_004180497.1, NZ _KK737546.1, 1344188, 1344964, +, 777, 287876; cds-WP_032429637.1, NZ_KK737546.1, 1344958, 1345557, +, 600, 355077; cds-WP_004198893.1, NZ_KK737546.1, 1345750, 1346127, +, 378, 91346; cds-AF52_RS25360, NZ_KK737546.1, 1346124, 1346378, +, 255, 16194; cds-AF52_RS16545, NZ_KK737546.1, 1351106, 1351364, +, 259, 18616; cds-AF52_RS16540, NZ_KK737546.1, 1351435, 1352232, +, 798, 168178; cds-AF52_RS27905, NZ_KK737546.1, 1352265, 1352369, +, 105, 2218; cds-AF52_RS0123600, NZ_KK737546.1, 1352352, 1353032, +, 681, 193940; cds-AF52_RS0123605, NZ _KK737546.1, 1353102, 1353650, -, 549, 111817; cds-WP_013815099.1-27, NZ _KK737546.1, 1353685, 1354653, +, 969, 141110; cds-AF52_RS25365, NZ_KK737546.1, 1354708, 1355376, -, 669, 583060; cds-WP_072269281.1, NZ_KK737546.1, 1355472, 1356614, -, 1143, 1233442; cds-WP _032429639.1, NZ_KK737546.1, 1356615, 1357508, -, 894, 2252091; cds-WP_004890861.1, NZ_KK737546.1, 1357505, 1358659, -, 1155, 3100352; cds-WP_004214006.1, NZ_KK737546.1, 1358675, 1360570, -, 1896, 5136627; cds-WP _004175264.1, NZ_KK737546.1, 1360586, 1361326, -, 741, 889895; cds-WP_002912373.1, NZ_KK737546.1, 1361326, 1362093, -, 768, 924818; cds-WP_013815099.1-28, NZ_KK737546.1, 1362205, 1363173, +, 969, 231689; cds-WP _032429640.1, NZ_KK737546.1, 1364205, 1365209, +, 1005, 980506; cds-AF52_RS26960, NZ_KK737546.1, 1368345, 1368481, +, 137, 5942; cds-AF52_RS26965, NZ_KK737546.1, 1368526, 1368645, -, 120, 2202; cds-WP_032429643.1, NZ_KK737546.1, 1368690, 1368818, +, 129, 334; cds-WP_032429644.1, NZ_KK737546.1, 1369241, 1370407, -, 1167, 2984414; cds-WP _004899416.1, NZ_KK737546.1, 1370571, 1371941, -, 1371, 1627961; cds-WP _004180506.1, NZ_KK737546.1, 1371964, 1373379, -, 1416, 2796554; cds-WP _020802781.1, NZ_KK737546.1, 1373607, 1375013, -, 1407, 18049258; cds-WP_013815099.1-29, NZ_KK737546.1, 1375211, 1376179, -, 969, 130594; cds-WP _020802783.1, NZ_KK737546.1, 1376246, 1377643, -, 1398, 290143; cds-WP _032429645.1, NZ_KK737546.1, 1377862, 1378497, -, 636, 9017; cds-AF52_RS26980, NZ_KK737546.1, 1381542, 1381660, -, 119, 81482; cds-WP_072001573.1, NZ_KK737546.1, 1381682, 1382065, -, 384, 271607; cds-WP_032429646.1, NZ_KK737546.1, 1382073, 1383821, -, 1749, 1746484; cds-WP _020801666.1, NZ_KK737546.1, 1383842, 1384609, -, 768, 519511; cds-WP_020801633.1, NZ_KK737546.1, 1384619, 1385788, -, 1170, 927633; cds-WP_032429647.1, NZ_KK737546.1, 1385800, 1386888, -, 1089, 745825; cds-WP _032429746.1, NZ_KK737546.1, 1386888, 1388180, -, 1293, 529439; cds-WP _020801632.1, NZ_KK737546.1, 1388137, 1389291, -, 1155, 326178; cds-WP_020801659.1, NZ_KK737546.1, 1389302, 1390468, -, 1167, 609459; cds-WP_020801642.1, NZ_KK737546.1, 1390472, 1391422, -, 951, 857941; cds-WP_013815099.1-30, NZ_KK737546.1, 1391484, 1392452, +, 969, 245994; cds-WP_032429648.1, NZ_KK737546.1, 1392641, 1394812, -, 2172, 4029423; cds-WP _072001574.1, NZ_KK737546.1, 1394831, 1395262, -, 432, 1214349; cds-WP_020801619.1, NZ_KK737546.1, 1395269, 1396402, -, 1134, 3138056; cds-WP _032429649.1, NZ_KK737546.1, 1396548, 1397981, -, 1434, 1879818; cds-WP _032429650.1, NZ _KK737546.1, 1398272, 1398394, +, 123, 68814; cds-WP_020806188.1-2, NZ_KK737546.1, 1398736, 1399716, -, 981, 348459; cds-WP _004184823.1, NZ_KK737546.1, 1400141, 1400770, -, 630, 472747; cds-WP_001741945.1, NZ_KK737546.1, 1401163, 1402053, -, 891, 973226; cds-WP _004151147.1, NZ_KK737546.1, 1402818, 1404401, +, 1584, 323106; cds-WP_032412678.1, NZ_KK737546.1, 1404896, 1406743, -, 1848, 416214; cds-WP_004151145.1, NZ_KK737546.1, 1406774, 1407355, -, 582, 285730; cds-WP _002912442.1, NZ_KK737546.1, 1407446, 1408087, -, 642, 942516; cds-WP _032429651.1, NZ_KK737546.1, 1408202, 1409050, -, 849, 40077; cds-WP_032429652.1, NZ_KK737546.1, 1409188, 1410540, +, 1353, 51574; cds-WP _032429747.1, NZ_KK737546.1, 1410830, 1412686, +, 1857, 82379; cds-WP_032429653.1, NZ_KK737546.1, 1412701, 1413402, +, 702, 7273; cds-WP_032409828.1, NZ_KK737546.1, 1413640, 1413780, +, 141, 5453; cds-WP_004899454.1, NZ_KK737546.1, 1413896, 1414507, +, 612, 29871; cds-WP _004149053.1, NZ _KK737546.1, 1414781, 1416055, -, 1275, 59949; cds-WP_032429654.1, NZ_KK737546.1, 1416356, 1417594, +, 1239, 12333; cds-WP _004149055.1, NZ_KK737546.1, 1417594,


1420716, +, 3123, 254416; cds-WP_032429655.1, NZ_KK737546.1, 1420717, 1423794, +, 3078, 286474; cds-WP_032429656.1, NZ_KK737546.1, 1423796, 1425211, +, 1416, 6738; cds-WP_004149058.1, NZ_KK737546.1, 1425208, 1426686, +, 1479, 9506; cds-WP_004175198.1, NZ_KK737546.1, 1426683, 1427405, +, 723, 42123; cds-WP _004144192.1, NZ_KK737546.1, 1427724, 1429085, +, 1362, 88078; cds-WP_004151134.1, NZ_KK737546.1, 1429328, 1430224, +, 897, 158983; cds-WP_032429657.1, NZ_KK737546.1, 1430465, 1431238, -, 774, 1130; cds-WP_032429748.1, NZ_KK737546.1, 1431249, 1432112, -, 864, 32673; cds-WP _004200464.1, NZ_KK737546.1, 1432084, 1432989, -, 906, 0; cds-WP_004149062.1, NZ_KK737546.1, 1432986, 1434023, -, 1038, 1569; cds-WP _004180553.1, NZ_KK737546.1, 1434020, 1435642, -, 1623, 5672; cds-WP _002912648.1, NZ_KK737546.1, 1435762, 1436916, -, 1155, 69259; cds-WP _032429658.1, NZ_KK737546.1, 1437214, 1437876, -, 663, 329; cds-WP _016529109.1, NZ_KK737546.1, 1437925, 1439202, -, 1278, 1983; cds-WP_032429659.1, NZ_KK737546.1, 1439273, 1440736, -, 1464, 2990; cds-WP_004144197.1, NZ_KK737546.1, 1440746, 1442113, -, 1368, 75466; cds-WP_004144198.1, NZ_KK737546.1, 1442320, 1443261, +, 942, 104278; cds-WP_032429660.1, NZ_KK737546.1, 1443284, 1444285, -, 1002, 41144; cds-WP _004180592.1, NZ_KK737546.1, 1444540, 1445289, +, 750, 3305; cds-WP_023285368.1, NZ_KK737546.1, 1445316, 1446923, +, 1608, 8240; cds-WP _004175116.1, NZ_KK737546.1, 1447005, 1448288, +, 1284, 18180; cds-WP _002912704.1, NZ_KK737546.1, 1448347, 1449399, -, 1053, 223502; cds-WP _002912707.1, NZ_KK737546.1, 1449547, 1450347, -, 801, 16044; cds-WP_004151131.1, NZ_KK737546.1, 1450344, 1451117, -, 774, 107383; cds-WP_009307427.1, NZ_KK737546.1, 1451435, 1451857, +, 423, 32804; cds-WP _004175111.1, NZ_KK737546.1, 1451854, 1452768, -, 915, 15306; cds-WP _009307426.1, NZ_KK737546.1, 1452889, 1454700, +, 1812, 461; cds-WP_009307425.1, NZ_KK737546.1, 1454703, 1456046, +, 1344, 584; cds-WP _004149074.1, NZ_KK737546.1, 1456036, 1456935, -, 900, 5333; cds-WP _002912749.1, NZ_KK737546.1, 1457119, 1457436, +, 318, 7186; cds-WP_072269284.1, NZ_KK737546.1, 1457408, 1457872, +, 465, 36940; cds-WP _032429661.1, NZ_KK737546.1, 1457869, 1458978, -, 1110, 404269; cds-WP _002912753.1, NZ_KK737546.1, 1459132, 1461165, +, 2034, 1928940; cds-WP_002912756.1, NZ_KK737546.1, 1461280, 1461750, -, 471, 97365; cds-WP_004144215.1, NZ_KK737546.1, 1461798, 1462517, -, 720, 75206; cds-WP_002912760.1, NZ_KK737546.1, 1462511, 1464199, -, 1689, 287113; cds-WP_002912762.1, NZ_KK737546.1, 1464429, 1464542, +, 114, 7769; cds-WP_022631308.1, NZ_KK737546.1, 1464517, 1465254, -, 738, 65956; cds-WP _022631307.1, NZ_KK737546.1, 1465238, 1466185, -, 948, 13847; cds-WP _023285369.1, NZ_KK737546.1, 1466178, 1467335, -, 1158, 22797; cds-WP_002912823.1, NZ_KK737546.1, 1467343, 1468260, -, 918, 35998; cds-WP_009307419.1, NZ_KK737546.1, 1468397, 1470694, -, 2298,580783; cds-WP_002912827.1, NZ_KK737546.1, 1470889, 1472634, +, 1746, 1879089; cds-WP_002912829.1, NZ _KK737546.1, 1472720, 1473274, +, 555, 70578; cds-WP_004180615.1, NZ_KK737546.1, 1473497, 1474447, -, 951, 205716; cds-WP_002912831.1, NZ_KK737546.1, 1474636, 1475223, -, 588, 40401; cds-WP _009307418.1, NZ _KK737546.1, 1475378, 1475947, +, 570, 19616; cds-WP _032429662.1, NZ_KK737546.1, 1475981, 1477420, -, 1440, 134356; cds-WP _022631304.1, NZ_KK737546.1, 1477692, 1479086, -, 1395, 58013; cds-WP_032429663.1, NZ_KK737546.1, 1479102, 1480964, -, 1863, 143583; cds-WP_002912842.1, NZ_KK737546.1, 1481107, 1481940, -, 834, 122151; cds-WP_004175080.1, NZ_KK737546.1, 1482096, 1483460, -, 1365, 39007; cds-WP_002912862.1, NZ_KK737546.1, 1483817, 1484749, -, 933, 40948; cds-WP _002912865.1, NZ_KK737546.1, 1485107, 1485505, +, 399, 9176; cds-WP_002912867.1, NZ_KK737546.1, 1485502, 1486197, +, 696, 14086; cds-WP _002912869.1, NZ_KK737546.1, 1486325, 1487209, +, 885, 53082; cds-WP _004211527.1, NZ_KK737546.1, 1487485, 1488201, +, 717, 88470; cds-WP_002912871.1, NZ_KK737546.1, 1488272, 1489282, -, 1011, 1164934; cds-WP_004175074.1, NZ_KK737546.1, 1489298, 1490818, -, 1521, 5497921; cds-WP_002912878.1, NZ_KK737546.1, 1490937, 1491935, -, 999, 8270135; cds-WP _002912919.1, NZ_KK737546.1, 1492232, 1493254, -, 1023, 1235678; cds-WP _021440476.1, NZ_KK737546.1, 1493410, 1494567, -, 1158, 154646; cds-WP_002912924.1, NZ_KK737546.1, 1494583,1495251, -, 669, 1228762; cds-WP_004151123.1, NZ_KK737546.1, 1495612, 1496445, +, 834, 52046; cds-WP_032429664.1, NZ_KK737546.1, 1496516, 1498489, -, 1974, 394780; cds-WP_002912929.1, NZ_KK737546.1, 1498988, 1500457, -, 1470, 370398; cds-WP _002912932.1, NZ_KK737546.1, 1500636, 1501502, -, 867, 36115; cds-WP_002912935.1, NZ_KK737546.1, 1501768, 1502817, +, 1050, 9504; cds-WP_002912937.1, NZ_KK737546.1, 1502890, 1503744, +, 855, 461314; cds-WP _021440480.1, NZ_KK737546.1, 1503795, 1505489, -, 1695, 507455; cds-WP_002912941.1, NZ_KK737546.1, 1505506, 1506444, -, 939, 233183; cds-WP_032428355.1, NZ_KK737546.1, 1506445, 1507575, -, 1131, 164545; cds-WP_032429665.1, NZ_KK737546.1, 1507911, 1509092, +, 1182, 110886; cds-WP_004175066.1, NZ_KK737546.1, 1509132, 1509386, -, 255, 79389; cds-WP_002912951.1, NZ_KK737546.1, 1509534, 1510106, +, 573, 1023021; cds-WP_002912952.1, NZ_KK737546.1, 1510177, 1511367, -, 1191, 180523; cds-WP _004200498.1, NZ_KK737546.1, 1511575, 1513041, +, 1467, 584617; cds-WP_021463904.1, NZ_KK737546.1, 1513162, 1514139, +, 978, 3681; cds-WP_072269286.1, NZ_KK737546.1, 1514177, 1514890, +, 714, 212062; cds-WP_002912967.1, NZ_KK737546.1, 1515317, 1515886, +, 570, 555550; cds-WP_021440487.1, NZ_KK737546.1, 1516075, 1517637, +, 1563, 90033; cds-WP_032429666.1, NZ_KK737546.1, 1517706, 1519511, +, 1806, 35953; cds-WP_004200501.1, NZ_KK737546.1, 1519521, 1520615, +, 1095, 63485; cds-WP _004149131.1, NZ_KK737546.1, 1520615, 1521640, +, 1026, 150414; cds-WP _004151118.1, NZ_KK737546.1, 1521642, 1523231, +, 1590, 469776; cds-WP _002912974.1, NZ_KK737546.1, 1523235, 1523579, -, 345, 245751; cds-WP _002912975.1, NZ_KK737546.1, 1523911, 1525107, -, 1197, 237418; cds-WP _002912977.1, NZ_KK737546.1, 1525104, 1525823, -, 720, 205172; cds-WP _004144263.1, NZ_KK737546.1, 1525971, 1527728, +, 1758, 208464; cds-WP_002912979.1, NZ_KK737546.1, 1527865, 1528149, +, 285, 573763; cds-WP_004189004.1, NZ_KK737546.1, 1528208, 1529095, -, 888, 201346; cds-AF52_RS0123640, NZ_KK737546.1, 1529200, 1530485, +, 1286, 8164; cds-WP _024622810.1, NZ_KK737546.1, 1530504, 1531100, -, 597, 2121; cds-WP_002912986.1, NZ_KK737546.1, 1531183, 1531944, +, 762, 68058; cds-WP_004144267.1, NZ_KK737546.1, 1531964, 1532971, -, 1008,353952; cds-WP_004195346.1, NZ_KK737546.1, 1533158, 1533385, +, 228,37995; cds-WP_002912990.1, NZ_KK737546.1, 1533404, 1535164, +, 1761, 1309564; cds-WP_032429667.1, NZ_KK737546.1, 1535502, 1536611, +, 1110, 84771; cds-WP_032428356.1, NZ_KK737546.1, 1536786, 1537277, +, 492, 3985337; cds-WP _002912994.1, NZ _KK737546.1, 1537344, 1538978, -, 1635, 254156; cds-AF52_RS0123645, NZ _KK737546.1, 1539025, 1539722, -, 698, 451234; cds-WP_020324457.1, NZ _KK737546.1, 1540115, 1541275, +, 1161, 210434; cds-WP _002912996.1, NZ_KK737546.1, 1541238, 1542674, -, 1437, 81754; cds-WP _004184919.1, NZ_KK737546.1, 1542823, 1544466, -, 1644, 225620; cds-WP_016530253.1, NZ_KK737546.1, 1544541, 1545194, -, 654, 15227; cds-WP_021440495.1, NZ_KK737546.1, 1545194, 1546258, -, 1065, 35048; cds-WP _032429668.1, NZ_KK737546.1, 1546332, 1547384, -, 1053, 279985; cds-WP_032429669.1, NZ_KK737546.1, 1547488, 1548582, -, 1095, 20381269; cds-WP_002913006.1, NZ_KK737546.1, 1549354, 1552011, +, 2658, 1098779; cds-WP_002913007.1, NZ_KK737546.1, 1552027, 1552677, +, 651, 688409; cds-WP _032429670.1, NZ_KK737546.1, 1552723, 1555563, -, 2841, 473899; cds-WP_032429671.1, NZ_KK737546.1, 1555695, 1558328, -, 2634, 3845578; cds-WP_002913014.1, NZ_KK737546.1, 1558475, 1559203, +, 729, 93090; cds-WP_002913016.1, NZ_KK737546.1, 1559548, 1561833, +, 2286, 8482742; cds-WP _004140835.1, NZ_KK737546.1, 1561935, 1563065, +, 1131, 2586750; cds-WP _002913017.1, NZ_KK737546.1, 1563065, 1563319, +, 255, 47576; cds-WP_032429672.1, NZ_KK737546.1, 1563783, 1564853, -, 1071, 5956593; cds-WP_002913019.1, NZ_KK737546.1, 1564863, 1566209, -, 1347, 5352892; cds-WP_004214634.1, NZ_KK737546.1, 1566481, 1568103, +, 1623, 3218; cds-WP_015958752.1, NZ_KK737546.1, 1568093, 1569352, +, 1260, 6448; cds-WP_004184966.1, NZ_KK737546.1, 1569349, 1570527, +, 1179, 128543; cds-WP_032428357.1, NZ_KK737546.1, 1570549, 1571352, -, 804, 8626; cds-WP _002913045.1, NZ_KK737546.1, 1571367, 1572656, -, 1290, 32948; cds-WP_004175029.1, NZ_KK737546.1, 1572699, 1573904, -, 1206, 5192; cds-WP_002913046.1, NZ_KK737546.1, 1573915, 1574700, -, 786, 2539; cds-WP_004184973.1, NZ_KK737546.1, 1574905, 1576101, -, 1197, 151671; cds-WP_019705497.1, NZ_KK737546.1, 1576204, 1576746, -, 543, 92788; cds-WP_024622815.1, NZ_KK737546.1, 1577021, 1577962, -, 942, 77846; cds-WP_032429673.1, NZ_KK737546.1, 1578100, 1578525, +, 426, 12955; cds-WP _021440500.1, NZ_KK737546.1, 1578581, 1579957, -, 1377, 30430; cds-WP _021440501.1, NZ_KK737546.1, 1579954, 1580919, -, 966, 285; cds-WP _002913098.1, NZ_KK737546.1, 1580919, 1581776, -, 858, 100045; cds-WP _021440502.1, NZ_KK737546.1, 1581791, 1582549, -, 759, 21627; cds-WP_002913103.1, NZ_KK737546.1, 1582546, 1584216, -, 1671, 20764; cds-WP_021440503.1, NZ_KK737546.1, 1584299, 1585588, -, 1290, 6713; cds-WP_004184987.1, NZ_KK737546.1, 1585724, 1586185, -, 462, 97739; cds-WP _004214593.1, NZ _KK737546.1, 1586243, 1587163, +, 921, 24691; cds-WP_004151107.1, NZ_KK737546.1, 1587218, 1588675, -, 1458, 1037504; cds-WP _032429674.1, NZ_KK737546.1, 1588682, 1590211, -, 1530, 2251171; cds-WP _032429675.1, NZ_KK737546.1, 1590381, 1592222, -, 1842, 2114408; cds-WP _002913148.1, NZ_KK737546.1, 1592219, 1592521, -, 303, 542349; cds-WP _002913150.1, NZ_KK737546.1, 1592518, 1593072, -, 555, 1533827; cds-WP_002913152.1, NZ_KK737546.1, 1593084, 1593626, -, 543, 1029777; cds-WP_002913156.1, NZ_KK737546.1, 1593641, 1594618, -, 978, 2419389; cds-WP_023285394.1, NZ_KK737546.1, 1594615, 1597341, -, 2727, 4677790; cds-WP _002913158.1, NZ_KK737546.1, 1597374, 1598711, -, 1338, 2656024; cds-WP _002913160.1, NZ_KK737546.1, 1598708, 1599208, -, 501, 1150177; cds-WP_002913162.1, NZ_KK737546.1, 1599211, 1601019, -, 1809, 7951496; cds-WP_002913178.1, NZ_KK737546.1, 1601106, 1601780, -, 675, 2168125; cds-WP _002913181.1, NZ_KK737546.1, 1601796, 1602242, -, 447, 1015210; cds-WP_021440508.1, NZ_KK737546.1, 1602894, 1603820, -, 927, 113926; cds-WP _002913185.1, NZ_KK737546.1, 1604693, 1605910, +, 1218, 702922; cds-WP_002913188.1, NZ_KK737546.1, 1605992, 1606591, +, 600, 154086; cds-WP _032428358.1, NZ_KK737546.1, 1606636, 1608468, -, 1833, 236088; cds-WP _019705510.1, NZ_KK737546.1, 1608545, 1609204, -, 660, 202494; cds-WP_002913193.1, NZ_KK737546.1, 1609216, 1609710, -, 495, 184865; cds-WP_002913194.1, NZ_KK737546.1, 1609798, 1610253, -, 456, 57638; cds-WP _002913195.1, NZ_KK737546.1, 1610591, 1611793, +, 1203, 5459924; cds-WP _002913196.1, NZ_KK737546.1, 1611994, 1614141, +, 2148, 8670279; cds-WP_032429676.1, NZ_KK737546.1, 1614234, 1614785, -, 552, 167200; cds-WP _004174991.1, NZ_KK737546.1, 1614843, 1615394, -, 552, 332685; cds-WP_004180746.1, NZ_KK737546.1, 1615457, 1616095, -, 639, 96601; cds-WP_004174988.1, NZ_KK737546.1, 1616276, 1616905, +, 630, 15222; cds-WP _002913200.1, NZ _KK737546.1, 1616971, 1617333, +, 363, 358484; cds-WP_002913203.1, NZ _KK737546.1, 1617352, 1618245, +, 894, 657420; cds-WP_004217247.1, NZ _KK737546.1, 1618225, 1618341, -, 117, 26237; cds-WP _032429677.1, NZ_KK737546.1, 1618461, 1618988, +, 528, 115641; cds-WP_002913206.1, NZ_KK737546.1, 1618994, 1619767, -, 774, 218155; cds-WP_002913207.1, NZ_KK737546.1, 1619775, 1620491, -, 717, 310020; cds-WP_002913208.1, NZ_KK737546.1, 1620488, 1621174, -, 687, 113593; cds-WP _002913209.1, NZ_KK737546.1, 1621239, 1622021, -, 783, 346869; cds-WP_002913210.1, NZ_KK737546.1, 1622289, 1623071, -, 783, 566324; cds-WP_004140952.1, NZ_KK737546.1, 1623117, 1623278, +, 162, 84026; cds-WP _014599227.1, NZ_KK737546.1, 1623359, 1623928, -, 570, 12650; cds-WP _032429678.1, NZ_KK737546.1, 1624064, 1625581, -, 1518, 1035331; cds-WP_002913214.1, NZ_KK737546.1, 1625615, 1626103, -, 489, 412096; cds-WP_004151102.1, NZ_KK737546.1, 1626320, 1627009, -, 690, 145164; cds-WP _021440515.1, NZ_KK737546.1, 1626999, 1628267, -, 1269, 293090; cds-WP_002913220.1, NZ_KK737546.1, 1628343, 1629263, -, 921, 862372; cds-WP_002913221.1, NZ_KK737546.1, 1629449,


1630108, -, 660, 547236; cds-WP_002913226.1, NZ_KK737546.1, 1630135, 1630947, -, 813, 456700; cds-WP_002913227.1, NZ_KK737546.1, 1630947, 1631960, -, 1014, 382869; cds-WP_021440517.1, NZ_KK737546.1, 1632024, 1633160, -, 1137, 213714; cds-WP_032429679.1, NZ_KK737546.1, 1633271, 1634248, +, 978, 71752; cds-WP_004149211.1, NZ_KK737546.1, 1634335, 1635510, -, 1176, 5016; cds-WP_002913291.1, NZ_KK737546.1, 1635720, 1636940, -, 1221, 909813; cds-WP_032429751.1, NZ_KK737546.1, 1637099, 1639087, +, 1989, 73970; cds-WP_002913338.1, NZ_KK737546.1, 1639149, 1639430, -, 282, 114554; cds-WP_032429680.1, NZ_KK737546.1, 1639462, 1640010, -, 549, 314494; cds-WP_002913340.1, NZ_KK737546.1, 1640010, 1640819, -, 810, 136632; cds-WP_0041749601, NZ_KK737546.1, 1640819, 1641643, -, 825, 884971; cds-WP_002913342.1, NZ_KK737546.1, 1641646, 1642731, -, 1086, 441138; cds-WP_002913346.1, NZ_KK737546.1, 1642773, 1643705, -, 933, 410804; cds-WP_002913348.1, NZ_KK737546.1, 1643873, 1644424, +, 552, 251769; cds-WP_002913355.1, NZ_KK737546.1, 1644445, 1644930, -, 486, 735571; cds-WP_032429681.1, NZ_KK737546.1, 1645140, 1647284, -, 2145, 1716483; cds-WP_002913358.1, NZ_KK737546.1, 1647284, 1648594, -, 1311, 1076943; cds-WP_002913359.1, NZ_KK737546.1, 1648754, 1649038, -, 285, 72284; cds-WP_002913360.1, NZ_KK737546.1, 1649412, 1650734, +, 1323, 1220127; cds-WP_002913362.1, NZ_KK737546.1, 1650796, 1651557, -, 762, 475817; cds-WP_004149224.1, NZ_KK737546.1, 1651847, 1652776, +, 930, 21191; cds-WP_004174945.1, NZ_KK737546.1, 1653189, 1653671, +, 483, 171605; cds-WP_032428359.1, NZ_KK737546.1, 1654039, 1654920, +, 882, 53558; cds-WP_021440524.1, NZ_KK737546.1, 1654930, 1655838, -, 909, 5876; cds-WP_009486224.1, NZ_KK737546.1, 1655971, 1656429, +, 459, 748; cds-WP_023282888.1, NZ_KK737546.1, 1656426, 1657622, +, 1197, 54839; cds-WP_099119320.1, NZ_KK737546.1, 1657961, 1658032, +, 72, 11865; cds-WP_002913372.1, NZ_KK737546.1, 1658103, 1659317, -, 1215, 184501; cds-WP_004188912.1, NZ_KK737546.1, 1659406, 1659591, +, 186, 94; cds-WP_004153200.1, NZ_KK737546.1, 1659588, 1659701, -, 114, 1; cds-WP_004149230.1, NZ_KK737546.1, 1659700, 1661397, +, 1698, 132432; cds-WP_002913374.1, NZ_KK737546.1, 1661409, 1662146, +, 738, 94035; cds-WP_002913377.1, NZ _KK737546.1, 1662200, 1663165, -, 966, 492627; cds-WP_004154521.1, NZ_KK737546.1, 1663429, 1664664, +, 1236, 78732; cds-WP_032428368.1, NZ_KK737546.1, 1664661, 1666322, -, 1662, 2473; cds-WP_002913417.1, NZ_KK737546.1, 1666503, 1667495, +, 993, 555624; cds-WP_002913419.1, NZ_KK737546.1, 1667626, 1667985, +, 360, 26832; cds-WP_002913421.1, NZ_KK737546.1, 1668043, 1669284, -, 1242, 55976; cds-WP_002913423.1, NZ_KK737546.1, 1669631, 1670833, +, 1203, 1130101; cds-WP_032429682.1, NZ_KK737546.1, 1670882, 1673053, -, 2172, 54710; cds-WP_002913434.1, NZ_KK737546.1, 1673558, 1673911, +, 354, 12081; cds-WP_002913435.1, NZ_KK737546.1, 1673915, 1674307, +, 393, 54256; cds-WP_004145598.1, NZ_KK737546.1, 1674359, 1675777, -, 1419, 2171725; cds-WP_021440528.1, NZ_KK737546.1, 1676741, 1677667, -, 927, 243197; cds-WP_021440529.1, NZ_KK737546.1, 1677756, 1678754, +, 999, 280663; cds-WP_002913440.1, NZ_KK737546.1, 1678751, 1678969, -, 219, 75410; cds-WP_004180820.1, NZ_KK737546.1, 1678971, 1680986, -, 2016, 187688; cds-WP_004180822.1, NZ_KK737546.1, 1681056, 1682117, -, 1062, 426485; cds-WP_004174922.1, NZ_KK737546.1, 1682348, 1683109, +, 762, 189855; cds-WP_002913498.1, NZ_KK737546.1, 1683286, 1684257, +, 972, 388795; cds-WP_002913505.1, NZ_KK737546.1, 1684638, 1684895, +, 258, 2073672; cds-WP_021440531.1, NZ_KK737546.1, 1684940, 1686667, +, 1728, 9211480; cds-WP_000522253.1, NZ_KK737546.1, 1686710, 1687219, +, 510, 2727897; cds-WP_004890526.1, NZ_KK737546.1, 1687261, 1687500, -, 240, 15477; cds-WP_004890524.1, NZ_KK737546.1, 1687497, 1688363, -, 867, 4994; cds-WP_004174915.1, NZ_KK737546.1, 1688446, 1689744, +, 1299, 35406; cds-WP_004890521.1, NZ_KK737546.1, 1689885, 1690280, +, 396, 34883; cds-WP_004890515.1, NZ_KK737546.1, 1690277, 1691188, -, 912, 79384; cds-WP_002913623.1, NZ_KK737546.1, 1691307, 1692401, -, 1095, 60166; cds-WP_004890510.1, NZ_KK737546.1, 1692391, 1693266, -, 876, 36145; cds-WP_002913626.1, NZ_KK737546.1, 1693266, 1694099, -, 834, 79208; cds-WP_032429684.1, NZ_KK737546.1, 1694099, 1695121, -, 1023, 28242; cds-AF52_RS25445, NZ_KK737546.1, 1695322, 1695665, +, 344, 23988; cds-WP_020803947.1, NZ_KK737546.1, 1695761, 1696660, -, 900, 487147; cds-WP_002913630.1, NZ_KK737546.1, 1696755, 1697330, -, 576, 303648; cds-WP_002913635.1, NZ_KK737546.1, 1697392, 1697841, -, 450, 45986; cds-WP_002913637.1, NZ_KK737546.1, 1697828, 1698253, -, 426, 124078; cds-WP_002913639.1, NZ_KK737546.1, 1698465, 1699337, +, 873, 892736; cds-WP_032429685.1, NZ_KK737546.1, 1699337, 1700236, +, 900, 366182; cds-WP_002913642.1, NZ_KK737546.1, 1700280, 1701332, -, 1053, 115365; cds-WP_032428360.1, NZ_KK737546.1, 1701378, 1701863, -, 486, 2645; cds-WP_004174905.1, NZ_KK737546.1, 1701875, 1702534, -, 660, 8092; cds-WP_021440537.1, NZ_KK737546.1, 1702544, 1703443, -, 900, 1877; cds-WP_032429686.1, NZ_KK737546.1, 1703464, 1704825, -, 1362, 4542; cds-WP_021440539.1, NZ_KK737546.1, 1704837, 1706240, -, 1404,32; cds-WP_004149260.1, NZ_KK737546.1, 1706237, 1707469, -, 1233, 17; cds-WP_032429687.1, NZ_KK737546.1, 1707669, 1708856, -, 1188, 0; cds-WP_004180842.1, NZ_KK737546.1, 1708846, 1709685, -, 840, 0; cds-WP_004152003.1, NZ_KK737546.1, 1709695, 1711098, -, 1404, 248; cds-WP_002913719.1, NZ_KK737546.1, 1711110, 1711397, -, 288, 93; cds-WP_000387720.1, NZ_KK737546.1, 1711526, 1711816, -, 291, 23; cds-WP_021440542.1, NZ_KK737546.1, 1711855, 1712871, -, 1017, 267; cds-WP_004180847.1, NZ_KK737546.1, 1712861, 1713667, -, 807, 26750; cds-WP_002913725.1, NZ_KK737546.1, 1713664, 1714353, -, 690, 35635; cds-WP_021440543.1, NZ_KK737546.1, 1714331, 1714810, -, 480, 0; cds-WP_002913729.1, NZ_KK737546.1, 1714823, 1715158, -, 336, 243; cds-WP_004185057.1, NZ_KK737546.1, 1715377, 1717656, -, 2280, 1193846; cds-WP_002913732.1, NZ_KK737546.1, 1717951, 1718907, +, 957, 117788; cds-WP_004149269.1, NZ_KK737546.1, 1718924, 1720918, +, 1995, 420775; cds-WP_009309515.1, NZ_KK737546.1, 1720908, 1721954, -, 1047, 39107; cds-WP_002913754.1, NZ_KK737546.1, 1722018, 1722614, -, 597, 111588; cds-WP_032429689.1, NZ_KK737546.1, 1722673, 1724655, -, 1983, 2332; cds-WP_004185072.1, NZ_KK737546.1, 1725028, 1728141, +, 3114, 186241; cds-WP_100181659.1, NZ_KK737546.1, 1728269, 1728328, -, 60, 332512; cds-WP_002913764.1, NZ_KK737546.1, 1728694, 1729047, +, 354, 46452; cds-WP_021440546.1, NZ_KK737546.1, 1729051, 1730178, +, 1128, 331260; cds-WP_002913768.1, NZ_KK737546.1, 1730205, 1730408, +, 204, 170347; cds-WP_002913770.1, NZ_KK737546.1, 1730457, 1731152, -, 696, 49633; cds-WP_021440547.1, NZ_KK737546.1, 1731229, 1733232, -, 2004, 106394; cds-WP_032429690.1, NZ_KK737546.1, 1733242, 1734117, -, 876, 77201; cds-WP_002913801.1, NZ_KK737546.1, 1734237, 1734950, -, 714, 646693; cds-WP_004149279.1, NZ_KK737546.1, 1735167, 1736201, -, 1035, 872043; cds-WP_002913803.1, NZ_KK737546.1, 1736218, 1737096, -, 879, 2822910; cds-WP_002913804.1, NZ_KK737546.1, 1737250, 1737816, +, 567, 417123; cds-WP_002913805.1, NZ_KK737546.1, 1737820, 1738290, +, 471, 532898; cds-WP_002913806.1, NZ_KK737546.1, 1738352, 1739413, -, 1062, 248952; cds-WP_004221267.1, NZ_KK737546.1, 1739468, 1739584, -, 117, 3898; cds-WP_002913807.1, NZ_KK737546.1, 1739636, 1741099, +, 1464, 654058; cds-WP_002913810.1, NZ_KK737546.1, 1741109, 1741468, +, 360, 55418; cds-WP_023301620.1, NZ_KK737546.1, 1741596, 1742519, +, 924, 229413; cds-WP_020947395.1, NZ_KK737546.1, 1742516, 1743217, -, 702, 168705; cds-WP_002913824.1, NZ_KK737546.1, 1743316, 1744602, -, 1287, 309755; cds-WP_002913827.1, NZ_KK737546.1, 1744698, 1745324, -, 627, 462095; cds-WP 021440551.1, NZ_KK737546.1, 1745542, 1746975, -, 1434, 158141; cds-WP_021440552.1, NZ_KK737546.1, 1746985, 1747878, -, 894, 3483; cds-WP_004149288.1, NZ_KK737546.1, 1748142, 1749179, +, 1038, 87988; cds-WP_004145656.1, NZ_KK737546.1, 1749176, 1749817, +, 642, 184624; cds-WP_002913838.1, NZ_KK737546.1, 1749998, 1752058, +, 2061, 1139557; cds-WP_002913839.1, NZ _KK737546.1, 1752062, 1753594, +, 1533, 415855; cds-WP_032429691.1, NZ_KK737546.1, 1753648, 1755876, -, 2229,36138; cds-WP_004174861.1, NZ_KK737546.1, 1756247, 1756420, +, 174, 10998; cds-WP_004221278.1, NZ_KK737546.1, 1756517, 1757428, -, 912, 26098; cds-WP_021440556.1, NZ_KK737546.1, 1757502, 1758734, +, 1233, 131304; cds-WP_021440557.1, NZ_KK737546.1, 1759028, 1760206, +, 1179, 10614; cds-WP_009309501.1, NZ_KK737546.1, 1760190, 1762058, +, 1869, 32755; cds-WP_004151979.1, NZ_KK737546.1, 1762153, 1763730, -, 1578, 1688331; cds-WP_004151980.1, NZ_KK737546.1, 1763798, 1765264, -, 1467, 1035553; cds-WP_015958798.1, NZ_KK737546.1, 1765423, 1766814, +, 1392, 201938; cds-WP_004144303.1, NZ_KK737546.1, 1766798, 1767016, -, 219, 7702; cds-WP_021313079.1, NZ_KK737546.1, 1767066, 1768145, -, 1080, 15051; cds-WP_020317242.1, NZ_KK737546.1, 1768329, 1768808, -, 480, 6422; cds-WP_032418518.1, NZ_KK737546.1, 1769030, 1769722, -, 693, 13944; cds-WP_004144309.1, NZ_KK737546.1, 1770089, 1771567, -, 1479, 659840; cds-WP_002913889.1, NZ_KK737546.1, 1771681, 1772859, -, 1179, 1212608; cds-WP_002913890.1, NZ_KK737546.1, 1772870, 1773490, -, 621, 1257848; cds-WP_004149335.1, NZ_KK737546.1, 1773525, 1774799, -, 1275, 1136210; cds-WP_002913892.1, NZ_KK737546.1, 1774891, 1776012, -, 1122, 877919; cds-WP_004149336.1, NZ_KK737546.1, 1776039, 1777034, -, 996, 1246544; cds-WP_002913894.1, NZ_KK737546.1, 1777311, 1778477, -, 1167, 786978; cds-WP_004144312.1, NZ_KK737546.1, 1778961, 1779392, -, 432, 2141976; cds-WP_004890414.1, NZ_KK737546.1, 1779553, 1781877, -, 2325, 37340; cds-WP_021440561.1, NZ_KK737546.1, 1781878, 1786827, -, 4950, 1114128; cds-WP_002913950.1, NZ_KK737546.1, 1787033, 1787890, +, 858, 345441; cds-WP_032429692.1, NZ_KK737546.1, 1788117, 1788959, +, 843, 77470; cds-WP_021440563.1, NZ_KK737546.1, 1789030, 1789806, -, 777, 479480; cds-WP_002913953.1, NZ_KK737546.1, 1789905, 1791191, -, 1287, 1154616; cds-WP_002913954.1, NZ_KK737546.1, 1791262, 1791462, -, 201, 555439; cds-WP_002913956.1, NZ_KK737546.1, 1791464, 1791799, -, 336, 677131; cds-WP_032429693.1, NZ_KK737546.1, 1791801, 1793651, -, 1851, 1665981; cds-WP_004174835.1, NZ_KK737546.1, 1793667, 1794182, -, 516, 864867; cds-WP_002913979.1, NZ_KK737546.1, 1794257, 1794580, -, 324, 526111; cds-WP_002913991.1, NZ_KK737546.1, 1794598, 1794984, -, 387, 440727; cds-WP_002913992.1, NZ_KK737546.1, 1795011, 1796225, -, 1215, 1656612; cds-WP_002913993.1, NZ_KK737546.1, 1796404, 1796895, -, 492, 466070; cds-WP_004185116.1, NZ_KK737546.1, 1797130, 1797864, -, 735, 262672; cds-WP_002913995.1, NZ_KK737546.1, 1797985, 1798788, +, 804, 440062; cds-WP_021440564.1, NZ_KK737546.1, 1798835, 1799671, -, 837, 7931; cds-WP_021440565.1, NZ_KK737546.1, 1799771, 1800751, -, 981, 28928; cds-WP_023301580.1, NZ_KK737546.1, 1800742, 1801380, -, 639, 27902; cds-WP_002914002.1, NZ_KK737546.1, 1801505, 1802782, +, 1278, 252359; cds-WP_004144329.1, NZ_KK737546.1, 1802779, 1803915, -, 1137, 145066; cds-WP_021440567.1, NZ_KK737546.1, 1803998, 1804831, -, 834, 15578; cds-WP_002914018.1, NZ_KK737546.1, 1804831, 1806267, -, 1437, 5117; cds-WP_015958809.1, NZ_KK737546.1, 1806337, 1809612, -, 3276, 25983; cds-WP_004214134.1, NZ_KK737546.1, 1809725, 1810921, +, 1197, 6888; cds-WP_002914024.1, NZ_KK737546.1, 1810995, 1811417, +, 423, 1383; cds-WP_002914027.1, NZ_KK737546.1, 1811473, 1812726, -, 1254, 7400237; cds-WP_004185137.1, NZ_KK737546.1, 1813052, 1814242, +, 1191, 185039; cds-WP_002914032.1, NZ_KK737546.1, 1814317, 1814655, -, 339, 178238; cds-WP_004149357.1, NZ_KK737546.1, 1814721, 1816058, -, 1338, 416716; cds-WP_002914033.1, NZ_KK737546.1, 1816045, 1816731, -, 687, 163313; cds-WP_004888415.1, NZ_KK737546.1, 1816761, 1818182, -, 1422, 146319; cds-WP_004185139.1, NZ_KK737546.1, 1818773, 1822660, -, 3888, 1011965; cds-WP_004144346.1, NZ_KK737546.1, 1822836, 1824452, +, 1617, 64332; cds-WP_071603195.1, NZ_KK737546.1, 1824449, 1824991, -, 543, 32744; cds-WP_004180922.1, NZ_KK737546.1, 1825021, 1825656, -, 636, 10014; cds-WP_004144349.1, NZ_KK737546.1, 1825870, 1826718, +, 849, 347660; cds-WP_004888420.1, NZ_KK737546.1, 1826775, 1827035, +, 261, 102322; cds-WP_004144351.1, NZ_KK737546.1, 1827048, 1827428, -, 381, 87553; cds-WP_004888422.1, NZ_KK737546.1, 1827428, 1828159, -, 732, 295750; cds-WP_002914062.1,


NZ_KK737546.1, 1828171, 1828908, -, 738, 438297; cds-WP_002914063.1, NZ_KK737546.1, 1828920, 1829825, -, 906, 2036644; cds-WP_002914065.1, NZ_KK737546.1, 1829822, 1830502, -, 681, 599061; cds-WP_002914067.1, NZ_KK737546.1, 1830752, 1831726, -, 975,1004806; cds-WP_002914069.1, NZ_KK737546.1, 1831742, 1833541, -, 1800, 3510419; cds-WP_004144354.1, NZ_KK737546.1, 1833727, 1834206, -, 480, 109916; cds-WP_029140701, NZ_KK737546.1, 1834203, 1835159, -, 957, 1684700; cds-WP_002914072.1, NZ_KK737546.1, 1835159, 1835809, -, 651, 2744542; cds-WP_002914074.1, NZ_KK737546.1, 1835842, 1836417, -, 576, 2128499; cds-WP_121980491.1, NZ_KK737546.1, 1836414, 1836509, -, 96, 37984; cds-WP_004144357.1, NZ_KK737546.1, 1836838, 1838457, +, 1620, 148519; cds-WP_002914079.1, NZ_KK737546.1, 1838442, 1839179, -, 738, 54254; cds-WP_002914082.1, NZ_KK737546.1, 1839311, 1840642, +, 1332, 1695291; cds-WP_002914084.1, NZ_KK737546.1, 1840688, 1841071, -, 384, 54144; cds-WP_002914088.1, NZ_KK737546.1, 1841384, 1842073, +, 690, 34340; cds-WP_002914089.1, NZ_KK737546.1, 1842131, 1843216, -, 1086, 39770; cds-WP_002914091.1, NZ_KK737546.1, 1843420, 1843845, +, 426, 193891; cds-WP_002914092.1, NZ_KK737546.1, 1843915, 1844613, +, 699, 37770; cds-WP_004149373.1, NZ_KK737546.1, 1844648, 1847299, +, 2652, 607237; cds-WP_002914094.1, NZ_KK737546.1, 1847420, 1848775, +, 1356, 501477; cds-WP_004888435.1, NZ_KK737546.1, 1848817, 1849140, +, 324, 11662; cds-WP_004144368.1, NZ_KK737546.1, 1849144, 1850442, -, 1299, 405638; cds-AF52_RS14425, NZ_KK737547.1, 98, 328, -, 231, 1972; cds-WP_002890376.1, NZ_KK737547.1, 349, 636, -, 288, 0; cds-AF52_RS0123765, NZ_KK737547.1, 642, 842, -, 201, 0; cds-AF52_RS27035, NZ_KK737547.1, 876, 1049, +, 174, 8249; cds-AF52_RS14415, NZ_KK737547.1, 4070, 4221, +, 152, 3753; cds-AF52_RS14410, NZ KK737547.1, 4277, 4528, -, 252, 106; cds-WP_002890386.1, NZ KK737547.1, 4875, 5477, -, 603, 943006; cds-AF52_RS14400, NZ KK737547.1, 5700, 5873, -, 174, 14306; cds-AF52_RS27040, NZ_KK737547.1, 7013, 7174, -, 162, 5211; cds-WP_032429763.1, NZ_KK737547.1, 7192, 7758, -, 567, 2455; cds-WP_032429764.1, NZ_KK737547.1, 7833, 7949, +, 117, 371; cds-WP_002890390.1, NZ KK737547.1, 8014, 9078, +, 1065, 547712; cds-WP_002890395.1, NZ_KK737547.1, 9187, 10314, +, 1128, 3318011; cds-WP_002890398.1, NZ_KK737547.1, 10337, 10669, +, 333, 2027704; cds-WP_0028904001, NZ_KK737547.1, 10696, 12543, +, 1848, 4132887; cds-WP_002890403.1, NZ_KK737547.1, 12554, 13525, +, 972, 501608; cds-WP_002890404.1, NZ_KK737547.1, 13662, 14027, +, 366, 22094; cds-WP_004144646.1, NZ_KK737547.1, 14052, 14747, +, 696, 13310; cds-WP_002890412.1, NZ KK737547.1, 14802, 15686, -, 885, 1865428; cds-WP_002890414.1, NZ_KK737547.1, 15985, 16524, -, 540, 82266; cds-WP_002890417.1, NZ_KK737547.1, 16672, 17121, +, 450, 56399; cds-WP_004144650.1, NZ_KK737547.1, 17125, 18228, +, 1104, 109188; cds-WP_001021161.1, NZ_KK737547.1, 18316,18786, +, 471, 510789; cds-WP_002891356.1, NZ _KK737547.1, 18806, 19225, +, 420, 1104461; cds-WP_004177267.1, NZ_KK737547.1, 19297, 20268, +, 972, 290796; cds-WP_004177266.1, NZ_KK737547.1, 20261, 20764, +, 504, 21052; cds-WP_004191727.1, NZ_KK737547.1, 20810, 21784, -, 975, 177519; cds-WP_004144655.1, NZ_KK737547.1, 21845, 23707, -, 1863, 628267; cds-WP_004144656.1, NZ_KK737547.1, 23726, 24625, -, 900, 344235; cds-WP_032429766.1, NZ_KK737547.1, 24626, 24868, -, 243, 72487; cds-WP_004151340.1, NZ_KK737547.1, 25050, 26498, +, 1449, 266996; cds-WP_032429768.1, NZ KK737547.1, 26565, 27041, -, 477, 39367; cds-WP_002891460.1, NZ_KK737547.1, 27092, 27685, -, 594, 15995; cds-WP_002891462.1, NZ_KK737547.1, 27648, 28559, -, 912, 75185; cds-WP_002891465.1, NZ_KK737547.1, 28751, 29242, +, 492, 437824; cds-WP_004144660.1, NZ_KK737547.1, 29286,30650, -, 1365, 162323; cds-WP_004177261.1, NZ_KK737547.1, 30810, 31988, -, 1179, 167345; cds-WP_002891473.1, NZ_KK737547.1, 32320, 33684, -, 1365, 990; cds-WP_002891476.1, NZ KK737547.1, 33695, 34513, -, 819, 7661; cds-WP_032103307.1, NZ_KK737547.1, 34588, 36267, -, 1680, 1642; cds-WP_002891541.1, NZ_KK737547.1, 36278, 36598, -, 321, 20; cds-WP_032429771.1, NZ KK737547.1, 36612, 38288, -, 1677, 1407; cds-WP_032419345.1, NZ KK737547.1, 38285, 39106, -, 822, 3705; cds-WP_002891624.1, NZ_KK737547.1, 39259, 40017, +, 759, 57657; cds-WP_004178748.1, NZ_KK737547.1, 40057, 40389, -, 333, 66937; cds-WP_002891629.1, NZ_KK737547.1, 40639, 41526, -, 888, 3958484; cds-WP_002891634.1, NZ_KK737547.1, 41538, 41867, -, 330, 2163146; cds-WP_002891635.1, NZ_KK737547.1, 41867, 42478, -, 612, 6154700; cds-WP 032424651.1, NZ_KK737547.1, 42468, 44459, -, 1992, 20664858; cds-WP 002891641.1, NZ_KK737547.1, 44479, 45423, -, 945, 12372381; cds-WP_032429776.1, NZ KK737547.1, 45903, 47378, -, 1476, 102547; cds-WP_002891647.1, NZ_KK737547.1, 47422, 48000, -, 579, 265209; cds-WP_032429779.1, NZ_KK737547.1, 48303, 48620, +, 318, 83877; cds-WP_004147333.1, NZ_KK737547.1, 48966, 50264, +, 1299, 8571044; cds-WP_002891804.1, NZ KK737547.1, 50574, 51197, +, 624, 1780159; cds-WP_002891807.1, NZ_KK737547.1, 51448, 52722, +, 1275, 1859620; cds-WP_004151336.1, NZ_KK737547.1, 52906, 55260, +, 2355, 4555732; cds-WP_002444653.1, NZ KK737547.1, 55470, 55742, +, 273, 1354090; cds-WP_004177252.1, NZ_KK737547.1, 55957, 57831, +, 1875, 1018832; cds-WP_004144680.1, NZ KK737547.1, 57980, 58348, +, 369, 7422; cds-WP 002891860.1, NZ_KK737547.1, 58460, 58861, +, 402, 49972; cds-WP_002891863.1, NZ_KK737547.1, 58973, 59674, -, 702, 111838; cds-WP_032429782.1, NZ_KK737547.1, 59741, 61441, -, 1701, 61314; cds-WP_004151335.1, NZ_KK737547.1, 61569, 62387, +, 819, 47454; cds-WP_002891871.1, NZ KK737547.1, 62432, 63484, -, 1053, 91569; cds-WP_002891873.1, NZ_KK737547.1, 63600, 64058, +, 459, 59440; cds-WP_032429784.1, NZ_KK737547.1, 64102, 65874, +, 1773, 281123; cds-WP_032429785.1, NZ KK737547.1, 65867, 67645, +, 1779, 68565; cds-WP_002891893.1, NZ KK737547.1, 67889, 68227, +, 339, 85; cds-WP_004152876.1, NZ KK737547.1, 68261, 69547, +, 1287, 20500; cds-WP_020804789.1, NZ KK737547.1, 69602, 70465, -, 864, 117982; cds-WP_002891903.1, NZ_KK737547.1, 70682, 71173, +, 492, 86484; cds-WP_004142687.1, NZ_KK737547.1, 71211, 71522, -, 312, 11108; cds-WP_004178755.1, NZ_KK737547.1, 71590, 71997, -, 408, 80318; cds-WP_013815099.1-31, NZ KK737547.1, 72608, 73576, -, 969, 126563; cds-WP_004147373.1, NZ_KK737547.1, 74028, 77174, -, 3147, 5463951; cds-WP_004177236.1, NZ KK737547.1, 77197, 78390, -, 1194, 2821536; cds-WP_002892080.1, NZ_KK737547.1, 78533, 79183, +, 651, 222061; cds-WP_032429786.1, NZ_KK737547.1, 79313, 82660, +, 3348, 1456054; cds-WP_032429788.1, NZ KK737547.1, 82696, 83595, -, 900, 35929; cds-WP_002892136.1, NZ_KK737547.1, 83663, 83836, -, 174, 14896; cds-WP_002892142.1, NZ_KK737547.1, 83849, 84376, -, 528, 5852; cds-WP_002892144.1, NZ_KK737547.1, 84446, 84823, +, 378, 7742; cds-WP_002892145.1, NZ_KK737547.1, 84974, 85525, +, 552, 276003; cds-WP_032429789.1, NZ_KK737547.1, 85618, 87525, +, 1908, 301165; cds-WP_002892173.1, NZ_KK737547.1, 87583, 87915, +, 333, 175413; cds-WP_002892177.1, NZ_KK737547.1, 87915, 88520, +, 606, 268229; cds-WP_002892181.1, NZ KK737547.1, 88632, 90506, +, 1875, 2627528; cds-WP_032423667.1, NZ KK737547.1, 90729, 91373, +, 645, 401190; cds-WP_002892189.1, NZ_KK737547.1, 91502, 92464, +, 963, 73258; cds-WP_002892192.1, NZ KK737547.1, 92528, 93832, +, 1305, 191639; cds-WP_002892195.1, NZ KK737547.1, 93868, 95544, -, 1677, 194975; cds-WP_004147385.1, NZ_KK737547.1, 95770, 96990, -, 1221, 2887; cds-WP_002892203.1, NZ_KK737547.1, 97260, 98912, +, 1653, 289483; cds-WP_002892205.1, NZ_KK737547.1, 99018, 99497, -, 480, 47726; cds-WP_004151327.1, NZ_KK737547.1, 99700, 100494, -, 795, 26260; cds-WP_004893800.1, NZ KK737547.1, 100626, 103127, -, 2502, 180177; cds-WP_002892208.1, NZ_KK737547.1, 103234, 103644, +, 411, 13163; cds-WP_004893797.1, NZ KK737547.1, 103641, 104099, -, 459, 24645; cds-WP_002892258.1, NZ_KK737547.1, 104096, 105013, -, 918, 106223; cds-WP_004893793.1, NZ_KK737547.1, 105154, 105831, +, 678, 30641; cds-WP_004893788.1, NZ_KK737547.1, 105818, 106600, +, 783, 136969; cds-WP_002892263.1, NZ_KK737547.1, 106708, 107562, -, 855, 457456; cds-WP_009484702.1, NZ_KK737547.1, 107621, 108430, -, 810, 230047; cds-WP_004196998.1, NZ_KK737547.1, 108420, 109043, -, 624, 37536; cds-WP_032429794.1, NZ_KK737547.1, 109014, 109700, +, 687, 21131; cds-WP_032429796.1, NZ_KK737547.1, 109697, 112111, +, 2415, 84430; cds-WP_004219504.1, NZ_KK737547.1, 112088, 112201, -, 114, 650; cds-WP_004142997.1, NZ_KK737547.1, 112293, 113438, +, 1146, 14824; cds-WP_004151323.1, NZ_KK737547.1, 113546, 114622, -, 1077, 51527; cds-WP_032429798.1, NZ_KK737547.1, 114734, 115801, -, 1068, 92684; cds-WP_004151322.1, NZ_KK737547.1, 115798, 116307, -, 510, 63144; cds-WP_032429801.1, NZ_KK737547.1, 116404, 116742, -, 339, 33724; cds-WP_004151320.1, NZ KK737547.1, 116850, 117572, -, 723, 417009; cds-WP_004151319.1, NZ_KK737547.1, 117576, 118070, -, 495, 380935; cds-WP_004143010.1, NZ_KK737547.1, 118246, 119631, +, 1386, 792501; cds-WP_004143016.1, NZ_KK737547.1, 119677, 119889, -, 213, 32605; cds-WP_004143017.1, NZ KK737547.1, 119891, 120757, -, 867, 363687; cds-WP_013815099.1-32, NZ_KK737547.1, 121337, 122305, +, 969, 118264; cds-AF52_RS25480, NZ_KK737547.1, 122362, 122511, +, 150, 927; cds-WP_002893005.1, NZ KK737547.1, 122529, 123590, +, 1062, 1898; cds-AF52_RS13845, NZ_KK737547.1, 123655, 124524, +, 870, 9556; cds-WP_013815099.1-33, NZ KK737547.1, 124555, 125523, +, 969, 112625; cds-AF52_RS27075, NZ KK737547.1, 125582, 125707, +, 126, 4800; cds-AF52_RS13835, NZ_KK737547.1, 125760, 126170, -, 411, 52; cds-AF52_RS27080, NZ_KK737547.1, 127801, 127981, -, 181, 5461; cds-AF52_RS13830, NZ_KK737547.1, 128015, 130339, -, 2325, 167471; cds-WP_021441375.1, NZ_KK737547.1, 130436, 131470, -, 1035, 29857; cds-WP_004151823.1, NZ_KK737547.1, 132136, 133002, -, 867, 63081; cds-WP_004223482.1, NZ _KK737547.1, 133111, 134538, +, 1428,461; cds-WP_004142570.1, NZ_KK737547.1, 134609, 135853, +, 1245, 127477; cds-WP_004176981.1, NZ_KK737547.1, 135857, 136837, -, 981, 90028; cds-WP_004183289.1, NZ KK737547.1, 137086, 137502, +, 417, 9981; cds-WP_016946855.1, NZ_KK737547.1, 137522, 138673, -, 1152, 1473; cds-WP_032429809.1, NZ KK737547.1, 138675, 139697, -, 1023, 791; cds-WP_021441372.1, NZ_KK737547.1, 139714, 140919, -, 1206, 1821; cds-WP_021441371.1, NZ_KK737547.1, 141107, 142483, -, 1377, 29313; cds-WP_032428635.1, NZ_KK737547.1, 142591, 144789, -, 2199, 60749; cds-WP_032428633.1, NZ KK737547.1, 144849, 145931, -, 1083, 257; cds-WP_032428631.1, NZ_KK737547.1, 146327, 147811, -, 1485, 103382; cds-WP_004176990.1, NZ_KK737547.1, 147970, 149271, +, 1302, 5587; cds-WP_002892824.1, NZ_KK737547.1, 149285, 149650, +, 366, 44; cds-WP_021441367.1, NZ KK737547.1, 150030, 151529, +, 1500, 14366; cds-WP_021441366.1, NZ_KK737547.1, 151507, 152049, +, 543, 41800; cds-WP_004178885.1, NZ_KK737547.1, 152067, 152429, -, 363, 72645; cds-WP_004178884.1, NZ_KK737547.1, 152430, 152732, -, 303,163604; cds-WP_021441365.1, NZ KK737547.1, 152816, 153931, -, 1116, 115126; cds-WP_004183273.1, NZ_KK737547.1, 153948, 155120, -, 1173, 55679; cds-WP_002892774.1, NZ_KK737547.1, 155238, 155921, -, 684, 422814; cds-WP_009308086.1, NZ_KK737547.1, 156346, 157533, +, 1188, 181; cds-WP_004223434.1, NZ_KK737547.1, 157578, 159311, +, 1734, 61324; cds-WP_004183270.1, NZ_KK737547.1, 159399, 160175, +, 777, 1; cds-WP_032429971.1, NZ_KK737547.1, 160201, 160935, +, 735, 20386; cds-WP_013815099.1-34, NZ_KK737547.1, 160961, 161929, -, 969, 89015; cds-AF52_RS13690, NZ_KK737547.1, 161961, 162431, -, 471, 8; cds-WP_021441356.1, NZ KK737547.1, 162670, 163593, +, 924, 0; cds-WP_004147437.1, NZ KK737547.1, 163758, 165275, +, 1518, 0; cds-WP_021441355.1, NZ_KK737547.1, 165380, 166750, +, 1371, 0; cds-WP_021441354.1, NZ_KK737547.1, 166750, 168150, +, 1401, 0; cds-WP_187079191.1, NZ_KK737547.1, 168174, 169184, +, 1011, 0; cds-WP_004177009.1, NZ KK737547.1, 169200, 169841, -, 642, 0; cds-WP_004152946.1, NZ_KK737547.1, 170025, 171047, -, 1023, 0; cds-WP_004142660.1, NZ_KK737547.1, 171067, 172551, -, 1485, 0; cds-WP_002892597.1, NZ_KK737547.1, 172584, 173507, -, 924, 0; cds-WP_004191476.1, NZ_KK737547.1, 173937, 174956, -, 1020, 0; cds-AF52_RS13635, NZ_KK737547.1, 175058, 176062, +, 1005, 0; cds-WP_004147428.1, NZ_KK737547.1, 176984, 178015, -, 1032, 0; cds-WP_004191478.1, NZ_KK737547.1, 178025, 179197, -, 1173, 0; cds-WP_004215104.1, NZ_KK737547.1,


179194, 180114, -, 921, 0; cds-WP_187079192.1, NZ_KK737547.1, 180220, 181188, -, 969, 96885; cds-AF52_RS0123810, NZ_KK737547.1, 181222, 181695, +, 474, 39233; cds-WP_032429814.1, NZ_KK737547.1, 181760, 183334, -, 1575, 67862; cds-WP_002892402.1, NZ_KK737547.1, 183628, 183900, -, 273, 219389; cds-WP_002892400.1, NZ_KK737547.1, 184001, 184921, -, 921, 180254; cds-WP_032429816.1, NZ_KK737547.1, 185432, 186298, +, 867, 80798; cds-WP 032428620.1, NZ_KK737547.1, 186371, 187675, -, 1305, 3861; cds-WP_004142684.1, NZ_KK737547.1, 187721, 187861, -, 141, 0; cds-WP_002892370.1, NZ_KK737547.1, 188186, 188356, +, 171, 19207; cds-AF52_RS27950, NZ_KK737547.1, 188435, 188512, -, 78, 8504; cds-WP_013815099.1-35, NZ_KK737547.1, 188546, 189514, +, 969, 107322; cds-AF52_RS13575, NZ_KK737547.1, 189571, 190284, -, 714, 238; cds-WP_004183295.1, NZ_KK737547.1, 190287, 191030, -, 744, 659; cds-WP_004176974.1, NZ_KK737547.1, 191045, 191515, -, 471, 98; cds-WP_002893017.1, NZ_KK737547.1, 191508, 191942, -, 435, 32; cds-WP_004178896.1, NZ_KK737547.1, 192190, 192843, -, 654, 169857; cds-WP_004142557.1, NZ_KK737547.1, 192963, 193331, -, 369, 21712; cds-WP_014599061.1, NZ_KK737547.1, 193331, 193912, -, 582, 59410; cds-WP_171991789.1, NZ_KK737547.1, 194092, 195207, +, 1116, 345369; cds-WP_002893035.1, NZ_KK737547.1, 195238, 195579, +, 342, 194085; cds-WP_002893037.1, NZ_KK737547.1, 195597, 195845, -, 249, 78641; cds-WP_032428645.1, NZ_KK737547.1, 196348, 199071, +, 2724, 218080; cds-WP_021441380.1, NZ_KK737547.1, 199124, 200203, +, 1080,323; cds-WP_032429823.1, NZ_KK737547.1, 200217, 203309, +, 3093, 11165; cds-WP_004176956.1, NZ_KK737547.1, 203658, 204377, -, 720, 12902; cds-WP_004178906.1, NZ_KK737547.1, 204425, 205540, -, 1116, 1610; cds-WP_021441381.1, NZ_KK737547.1, 205867, 207534, +, 1668, 79781; cds-WP_004178910.1, NZ_KK737547.1, 207553, 208506, +, 954, 0; cds-WP_008805546.1, NZ_KK737547.1, 208509, 209402, +, 894, 0; cds-WP_004223507.1, NZ_KK737547.1, 209406, 210443, +, 1038, 16; cds-WP_021441382.1, NZ_KK737547.1, 210433, 211443, +, 1011, 3445; cds-WP_021441383.1, NZ_KK737547.1, 211541, 212809, +, 1269, 38837; cds-WP_032428650.1, NZ_KK737547.1, 212913, 213821, -, 909, 75; cds-WP_032429824.1, NZ_KK737547.1, 213946, 215280, +, 1335, 6397; cds-WP_004176948.1, NZ_KK737547.1, 215277, 216740, -, 1464, 117; cds-WP_004176946.1, NZ_KK737547.1, 216982, 217833, +, 852, 0; cds-WP_002893187.1, NZ_KK737547.1, 217881, 218522, +, 642, 0; cds-WP_002893189.1, NZ_KK737547.1, 218537, 219202, +, 666, 1174; cds-WP_004151676.1, NZ_KK737547.1, 219195, 219956, +, 762, 0; cds-WP_032428652.1, NZ_KK737547.1, 220010, 220774, -, 765, 40; cds-WP_004183313.1, NZ_KK737547.1, 220955, 222292, +, 1338, 0; cds-WP_104443363.1, NZ_KK737547.1, 222667, 222822, -, 156, 6; cds-WP_077254746.1, NZ_KK737547.1, 223649, 223759, -, 111, 3011; cds-WP_013815099.1-36, NZ_KK737547.1, 223803, 224771, -, 969, 84879; cds-WP_022615459.1, NZ_KK737547.1, 225071, 226066, -, 996, 58006; cds-WP_009483809.1, NZ_KK737547.1, 226423, 227127, -, 705, 12728; cds-WP_021441389.1, NZ_KK737547.1, 227114, 227950, -, 837, 3211; cds-WP_032429827.1, NZ_KK737547.1, 227943, 228776, -, 834, 16681; cds-WP_021441390.1, NZ_KK737547.1, 228776, 229798, -, 1023, 12174; cds-WP_009308119.1, NZ_KK737547.1, 229918, 231486, -, 1569, 96673; cds-WP_002893466.1, NZ_KK737547.1, 231692, 232387, +, 696, 15612; cds-WP_032429829.1, NZ_KK737547.1, 232508, 234172, -, 1665, 303764; cds-WP_004147503.1, NZ_KK737547.1, 234186, 235658, -, 1473, 541257; cds-WP_004151671.1, NZ_KK737547.1, 235672, 236259, -, 588, 22169; cds-WP_004142478.1, NZ_KK737547.1, 236388, 238421, +, 2034, 27997; cds-WP_071603220.1, NZ_KK737547.1, 238467, 238994, -, 528, 102977; cds-WP_021441392.1, NZ_KK737547.1, 239138, 240394, +, 1257, 58155; cds-WP_021441393.1, NZ_KK737547.1, 240391, 241284, -, 894, 7289; cds-WP_004183326.1, NZ_KK737547.1, 241539, 242144, +, 606, 28603; cds-WP_021441395.1, NZ_KK737547.1, 242203, 243702, -, 1500, 5481096; cds-WP_032428654.1, NZ_KK737547.1, 243717, 245135, -, 1419, 9418081; cds-WP_004893550.1, NZ_KK737547.1, 245170, 246120, -, 951, 6265779; cds-WP_004893549.1, NZ_KK737547.1, 246113, 246943, -, 831, 6587574; cds-WP_032429976.1, NZ_KK737547.1, 247255, 248205, +, 951, 476712; cds-WP_021441398.1, NZ_KK737547.1, 248202, 249164, -, 963, 438720; cds-WP_004885708.1, NZ_KK737547.1, 249320, 250408, -, 1089, 4576918; cds-WP_032429833.1, NZ_KK737547.1, 250410, 251936, -, 1527, 11740788; cds-WP_032428655.1, NZ_KK737547.1, 251936, 252544, -, 609, 4899624; cds-WP_021441401.1, NZ_KK737547.1, 252555, 253496, -, 942, 5522241; cds-WP_021441402.1, NZ_KK737547.1, 253614, 254273, -, 660, 66600; cds-WP_021441403.1, NZ_KK737547.1, 254340, 256568, -, 2229, 795972; cds-WP_004147519.1, NZ_KK737547.1, 256828, 258036, +, 1209, 25053; cds-WP_004176919.1, NZ_KK737547.1, 258064, 258267, +, 204, 1758; cds-WP_021441404.1, NZ_KK737547.1, 258278, 262159, +, 3882, 274012; cds-WP_002893737.1, NZ_KK737547.1, 262224, 263018, -, 795, 40816; cds-WP_004147521.1, NZ_KK737547.1, 263015, 264007, -, 993, 1532; cds-WP_032429835.1, NZ_KK737547.1, 264004, 265011, -, 1008, 93208; cds-WP_032429836.1, NZ_KK737547.1, 265124, 266365, +, 1242, 10123; cds-WP_004147526.1, NZ_KK737547.1, 266628, 267587, -, 960, 94477; cds-WP_032429837.1, NZ_KK737547.1, 267776, 268951, +, 1176, 52608; cds-WP_004147529.1, NZ_KK737547.1, 268961, 270568, +, 1608, 51446; cds-WP_020324582.1, NZ_KK737547.1, 270582, 271433, +, 852, 285072; cds-WP_024622880.1, NZ_KK737547.1, 271442, 272188, +, 747, 68530; cds-WP_002893892.1, NZ_KK737547.1, 272189, 272602, +, 414, 9998; cds-WP_021441407.1, NZ_KK737547.1, 272959, 275064, +, 2106, 1074299; cds-WP_002893903.1, NZ_KK737547.1, 275169, 275366, +, 198, 119357; cds-WP_004178982.1, NZ_KK737547.1, 275363, 275767, -, 405, 141853; cds-WP_021441408.1, NZ_KK737547.1, 275742, 276044, -, 303, 13347; cds-WP_021464368.1, NZ_KK737547.1, 276228, 276971, -, 744, 2038; cds-WP_032429838.1, NZ_KK737547.1, 277029, 278117, -, 1089, 0; cds-WP_020801584.1, NZ_KK737547.1, 278281, 279783, +, 1503, 76; cds-WP_002894035.1, NZ_KK737547.1, 279780, 280778, +, 999, 2170; cds-WP_002894036.1, NZ_KK737547.1, 280799, 281863, +, 1065, 9724; cds-WP_004178989.1, NZ_KK737547.1, 281965, 283206, +, 1242, 168287; cds-WP_004210859.1, NZ_KK737547.1, 283420, 284619, -, 1200, 364; cds-WP_004183373.1, NZ_KK737547.1, 284721, 285749, +, 1029, 3335; cds-WP_032429839.1, NZ_KK737547.1, 285810, 287078, -, 1269, 78548; cds-WP_032429841.1, NZ_KK737547.1, 287104, 288462, -, 1359, 22657; cds-WP_004151655.1, NZ_KK737547.1, 288573, 289382, -, 810, 183754; cds-WP_072157843.1, NZ_KK737547.1, 289504, 290454, -, 951, 6262; cds-WP_032429842.1, NZ_KK737547.1, 290600, 291838, -, 1239, 0; cds-WP_002894159.1, NZ_KK737547.1, 291835, 293070, -, 1236, 0; cds-WP_032429843.1, NZ_KK737547.1, 293067, 294329, -, 1263, 41648; cds-WP_002894164.1, NZ_KK737547.1, 294781, 295389, +, 609, 2022; cds-WP_032429844.1, NZ_KK737547.1, 295402, 296898, +, 1497, 1763; cds-WP_032429847.1, NZ_KK737547.1, 296895, 297923, +, 1029, 174; cds-WP_032429849.1, NZ_KK737547.1, 297966, 298907, -, 942, 2180; cds-WP_004223619.1, NZ_KK737547.1, 298919, 299923, -, 1005, 0; cds-WP_004147555.1, NZ_KK737547.1, 299920, 300909, -, 990, 0; cds-WP_021441413.1, NZ_KK737547.1, 300906, 302408, -, 1503, 946; cds-WP_032429851.1, NZ_KK737547.1, 302453, 303433, -, 981, 615; cds-WP_032429853.1, NZ_KK737547.1, 303842, 306151, +, 2310, 0; cds-WP_002894357.1, NZ_KK737547.1, 306259, 306801, -, 543, 12225; cds-WP_004142397.1, NZ_KK737547.1, 306798, 307487, -, 690, 38935; cds-WP_020802207.1, NZ_KK737547.1, 307629, 308774, +, 1146, 3; cds-WP_004212613.1, NZ_KK737547.1, 308775, 309401, -, 627, 47384; cds-WP_002894369.1, NZ_KK737547.1, 309386, 310609, -, 1224, 79364; cds-WP_004147565.1, NZ_KK737547.1, 310720, 311652, -, 933, 39881; cds-WP_002894375.1, NZ_KK737547.1, 311833, 312582, -, 750, 6292; cds-WP_002894394.1, NZ_KK737547.1, 312994, 313557, +, 564, 3177344; cds-WP_004183398.1, NZ_KK737547.1, 313745, 315310, +, 1566, 1004454; cds-WP_002894401.1, NZ_KK737547.1, 315387, 315815, -, 429, 45962; cds-WP_002894404.1, NZ_KK737547.1, 316002, 316412, -, 411, 142584; cds-WP_032429854.1, NZ_KK737547.1, 316591, 317388, -, 798, 33598; cds-WP_004142371.1, NZ_KK737547.1, 317481, 318854, -, 1374, 129290; cds-WP_072143258.1, NZ_KK737547.1, 319136, 319711, +, 576, 215433; cds-WP_002439184.1, NZ_KK737547.1, 319906, 320115, +, 210, 1411471; cds-WP_002894459.1, NZ_KK737547.1, 320183, 320566, -, 384, 109315; cds-WP_002894461.1, NZ_KK737547.1, 320656, 321444, +, 789, 96487; cds-WP_002894464.1, NZ_KK737547.1, 321687, 321893, +, 207, 47421; cds-WP_002894467.1, NZ_KK737547.1, 322084, 323049, -, 966, 1807706; cds-WP_020803604.1, NZ_KK737547.1, 323230, 324189, -, 960, 106567; cds-WP_002894472.1, NZ_KK737547.1, 324320, 324964, -, 645, 96620; cds-WP_002894474.1, NZ_KK737547.1, 325069, 325332, -, 264, 105601; cds-WP_002894539.1, NZ_KK737547.1, 325445, 326644, -, 1200, 964851; cds-WP_004147579.1, NZ_KK737547.1, 326783, 327931, -, 1149, 626250; cds-WP_002894613.1, NZ_KK737547.1, 327943, 329055, -, 1113, 125684; cds-WP_002894617.1, NZ_KK737547.1, 329055, 330956, -, 1902, 541301; cds-WP_002894620.1, NZ_KK737547.1, 330984, 331451, -, 468, 253214; cds-WP_002894623.1, NZ_KK737547.1, 331455, 331772, -, 318, 120045; cds-WP_004151650.1, NZ_KK737547.1, 331995, 332624, -, 630, 14421; cds-WP_004176879.1, NZ_KK737547.1, 332697, 333347, -, 651, 258468; cds-WP_032429857.1, NZ_KK737547.1, 333340, 334371, -, 1032, 473285; cds-WP_002894693.1, NZ_KK737547.1, 334371, 334961, -, 591, 596226; cds-WP_004147581.1, NZ_KK737547.1, 334976, 337558, -, 2583, 3344331; cds-WP_032429977.1, NZ_KK737547.1, 337785, 338267, +, 483, 57647; cds-WP_032429859.1, NZ_KK737547.1, 338313, 340106, -, 1794, 46679; cds-WP_032429860.1, NZ_KK737547.1, 340172, 341842, -, 1671, 5999; cds-WP_002894706.1, NZ_KK737547.1, 342216, 342941, -, 726, 290778; cds-WP_002894707.1, NZ_KK737547.1, 342941, 343615, -, 675, 266857; cds-WP_002894709.1, NZ_KK737547.1, 343615, 344355, -, 741, 228136; cds-WP_002894712.1, NZ_KK737547.1, 344520, 345431, -, 912, 1511799; cds-WP_032429861.1, NZ_KK737547.1, 345786, 347324, -, 1539, 659377; cds-WP_004197606.1, NZ_KK737547.1, 347450, 348328, -, 879, 1232034; cds-WP_002894722.1, NZ_KK737547.1, 348476, 348949, -, 474, 439781; cds-WP_004176871.1, NZ_KK737547.1, 348946, 349992, -, 1047, 368834; cds-WP_002894730.1, NZ_KK737547.1, 350146, 351570, -, 1425, 1445594; cds-WP_032429863.1, NZ_KK737547.1, 351750, 352925, +, 1176, 23577; cds-WP_002894734.1, NZ_KK737547.1, 354033, 355697, -, 1665, 104408; cds-WP_002894738.1, NZ_KK737547.1, 355976, 356728, -, 753, 132508; cds-WP_002894742.1, NZ_KK737547.1, 356845, 358065, -, 1221, 808857; cds-WP_002894747.1, NZ_KK737547.1, 358074, 359222, -, 1149, 550694; cds-WP _002894749.1, NZ_KK737547.1, 359336, 360136, -, 801, 993594; cds-WP_032429865.1, NZ_KK737547.1, 360451, 362418, +, 1968, 797303; cds-WP_002894753.1, NZ_KK737547.1, 362597, 364264, +, 1668, 2855847; cds-WP_004142270.1, NZ_KK737547.1, 364318, 364626, -, 309, 4329; cds-WP_004152230.1, NZ_KK737547.1, 364699, 366102, +, 1404, 31599; cds-WP_002894759.1, NZ_KK737547.1, 366150, 366482, +, 333, 5129; cds-WP_166686314.1, NZ_KK737547.1, 366534, 366977, -, 444, 56948; cds-WP_002894761.1, NZ_KK737547.1, 367099, 367551, -, 453, 955694; cds-WP_002894765.1, NZ_KK737547.1, 367843, 368373, -, 531, 381317; cds-WP_002894767.1, NZ_KK737547.1, 368525, 368818, -, 294, 86266; cds-WP_004152229.1, NZ_KK737547.1, 368952, 369725, -, 774, 157401; cds-WP_002894771.1, NZ_KK737547.1, 369909, 370457, +, 549, 1066784; cds-WP_002894773.1, NZ_KK737547.1, 370490, 372130, +, 1641, 3674512; cds-WP_004179052.1, NZ_KK737547.1, 372185, 372622, +, 438, 219332; cds-WP_002894776.1, NZ_KK737547.1, 372604, 373281, -, 678, 147672; cds-WP_021441429.1, NZ_KK737547.1, 373278, 375965, -, 2688, 24059; cds-WP_032429868.1, NZ_KK737547.1, 375966, 376541, -, 576, 0; cds-WP_021441430.1, NZ_KK737547.1, 376552, 378600, -, 2049, 18; cds-WP_004152226.1, NZ_KK737547.1, 378621, 380300, -, 1680, 593; cds-WP_020323459.1, NZ_KK737547.1, 380300, 380389, -, 90, 0; cds-WP_004142243.1, NZ_KK737547.1, 380696, 380905, +, 210, 850; cds-WP_032429869.1, NZ_KK737547.1, 381089, 382531, +, 1443, 37365; cds-WP_004893379.1, NZ_KK737547.1, 382503, 383981, -, 1479, 10909; cds-WP_002894919.1, NZ_KK737547.1, 384249, 384992, +, 744, 16210; cds-WP_004176857.1,


NZ_KK7375471, 385007, 385663, +, 657,66059; cds-WP_004183433.1, NZ_KK737547.1, 385657, 386589, +, 933,799927; cds-WP_004183435.1, NZ_KK737547.1,386579, 387322, +, 744, 43630; cds-WP_002894928.1, NZ_KK737547.1, 387404, 388129, +, 726, 48084; cds-WP_004176855.1, NZ_KK737547.1, 388126, 389121, +, 996, 17400; cds-WP_004183438.1, NZ_KK737547.1, 389131, 389775, +, 645, 17329; cds-WP_002894935.1, NZ_KK737547.1, 389791, 390582, +, 792, 120566; cds-WP_004183439.1, NZ_KK737547.1, 390673, 391956, -, 1284, 12944352; cds-WP_004142216.1, NZ_KK737547.1, 392597, 393001, +, 405, 5320365; cds-WP_002894949.1, NZ_KK737547.1, 392995, 393342, +, 348, 6047984; cds-WP_004179067.1, NZ_KK737547.1, 393342, 395108, +, 1767, 18938181; cds-WP_002894954.1, NZ_KK737547.1, 395124, 395840, +, 717, 5803723; cds-WP_012068464.1, NZ_KK737547.1, 396222, 399029, +, 2808, 27024889; cds-WP_004142209.1, NZ_KK737547.1, 399044, 400270, +, 1227, 6268512; cds-WP_002895039.1, NZ_KK737547.1, 400374, 401540, +, 1167, 8673088; cds-WP_002895043.1, NZ_KK737547.1, 401540, 402409, +, 870, 3387838; cds-WP_002895047.1, NZ_KK737547.1, 403234, 404802, +, 1569, 2416197; cds-WP_002895049.1, NZ_KK737547.1, 404818, 405957, +, 1140, 1366863; cds-WP_002895051.1, NZ_KK737547.1, 405973, 406089, +, 117, 99743; cds-WP_002895053.1, NZ_KK737547.1, 406089, 406379, +, 291, 29736; cds-WP_002895056.1, NZ_KK737547.1, 406529, 406933, +, 405, 436989; cds-WP_004152221.1, NZ_KK737547.1, 406930, 407622, +, 693, 1202036; cds-WP_002895061.1, NZ_KK737547.1, 407626, 408054, +, 429, 325615; cds-WP_004179068.1, NZ_KK737547.1, 408154, 409479, +, 1326, 850591; cds-WP_032429872.1, NZ_KK737547.1, 409609, 410901, +, 1293, 2741269; cds-WP_002895068.1, NZ_KK737547.1, 410936, 411460, +, 525, 3120660; cds-WP_002895071.1, NZ_KK737547.1, 411470, 412264, +, 795, 1820126; cds-WP_032409073.1, NZ_KK737547.1, 413744, 413893, -, 150, 1815; cds-WP_002895074.1, NZ_KK737547.1, 413963, 415006, +, 1044,30470; cds-WP_004151689.1, NZ_KK737547.1, 415042, 415761, +, 720, 54509; cds-WP_004147641.1, NZ_KK737547.1, 415758, 416702, -, 945, 10267; cds-WP_002895084.1, NZ_KK737547.1, 416820, 417185, -, 366, 91257; cds-WP_002895086.1, NZ_KK737547.1, 417500, 418552, +, 1053, 12692; cds-WP_002895089.1, NZ_KK737547.1, 418626, 419378, -, 753, 5333687; cds-WP_023302155.1, NZ_KK737547.1, 419670, 420713, -, 1044, 517873; cds-WP_004179071.1, NZ_KK737547.1, 420707, 421855, -, 1149, 818264; cds-WP_004142166.1, NZ_KK737547.1, 421858, 422904, -, 1047, 1986555; cds-WP_002895150.1, NZ_KK737547.1, 422914, 423930, -, 1017, 1402109; cds-WP_032428718.1, NZ_KK737547.1, 424140, 425612, -, 1473, 78046; cds-WP_032429873.1, NZ_KK737547.1, 425680, 426468, -, 789, 21176; cds-WP_002895156.1, NZ_KK737547.1, 426621, 426770, +, 150, 3911; cds-WP_032428721.1, NZ_KK737547.1, 426913, 427686, +, 774, 140771; cds-WP_002895159.1, NZ_KK737547.1, 427686, 428375, +, 690, 57819; cds-WP_004176832.1, NZ_KK737547.1, 428378, 429436, +, 1059, 193198; cds-WP_002895164.1, NZ_KK737547.1, 429437, 430255, -, 819, 64049; cds-WP_002895166.1, NZ_KK737547.1, 430484, 431479, +, 996, 431903; cds-WP_002895168.1, NZ_KK737547.1, 431589, 431855, -, 267, 681374; cds-WP_004147654.1, NZ_KK737547.1, 431907, 432212, -, 306, 534032; cds-WP_004151693.1, NZ_KK737547.1, 432339, 432584, -, 246, 317490; cds-WP_004176831.1, NZ_KK737547.1, 432913, 434124, +, 1212, 261455; cds-WP_032429874.1, NZ_KK737547.1, 434280, 435014, +, 735, 465946; cds-WP_004151695.1, NZ_KK737547.1, 435056, 435610, -, 555, 169933; cds-WP_002895280.1, NZ_KK737547.1, 435692, 435904, -, 213, 26331; cds-WP_032428722.1, NZ_KK737547.1, 436289, 436435, +, 147, 44; cds-WP_002895283.1, NZ_KK737547.1, 436640, 437146, +, 507,12223; cds-WP_072271782.1, NZ_KK737547.1, 437163, 438086, -, 924,34578; cds-AF52_RS0123875, NZ_KK737547.1, 438125, 441190, -, 3066, 26654; cds-WP_032429876.1, NZ_KK737547.1, 441191, 442276, -, 1086, 0; cds-WP_021441450.1, NZ_KK737547.1, 442810, 443241, +, 432, 3809; cds-WP_020316497.1, NZ_KK737547.1, 443293, 445980, +, 2688, 54205; cds-WP_004142122.1, NZ_KK737547.1, 446254, 447537, -, 1284, 1546721; cds-WP_004182478.1, NZ_KK737547.1, 447692, 449011, +, 1320, 213615; cds-WP_021441452.1, NZ_KK737547.1, 449008, 449964, +, 957, 34390; cds-WP_002895358.1, NZ_KK737547.1, 450026, 450751, +, 726, 210801; cds-AF52_RS27965, NZ_KK737547.1, 450894, 451647, +, 754, 560431; cds-WP_160333877.1, NZ_KK737547.1, 451644, 452582, +, 939, 1510645; cds-WP_032428723.1, NZ_KK737547.1, 452579, 454105, +, 1527, 889768; cds-WP_004147672.1, NZ_KK737547.1, 454204, 455586, +, 1383, 206692; cds-WP_002895575.1, NZ_KK737547.1, 456305, 456781, -, 477, 17200; cds-WP_004223758.1, NZ_KK737547.1, 456852, 458141, -, 1290, 94796; cds-WP_032429877.1, NZ_KK737547.1, 458355, 459395, +, 1041, 61569; cds-WP_004183475.1, NZ_KK737547.1, 459392, 460549, +, 1158, 48014; cds-WP_032429878.1, NZ_KK737547.1, 460533, 461288, +, 756, 10440; cds-WP_002895648.1, NZ_KK737547.1, 461281, 462003, +, 723, 39078; cds-WP_004152853.1, NZ_KK737547.1, 461945, 462667, -, 723, 8646; cds-WP_002895652.1, NZ_KK737547.1, 462754, 462966, -, 213, 42201; cds-WP_004147678.1, NZ_KK737547.1, 463378, 465399, +, 2022, 1099513; cds-WP_032429879.1, NZ_KK737547.1, 465648, 466745, -, 1098, 68781; cds-WP_002895659.1, NZ_KK737547.1, 466749, 467420, -, 672, 103988; cds-WP_021441454.1, NZ_KK737547.1, 467420, 469060, -, 1641, 27740; cds-WP_004142092.1, NZ_KK737547.1, 469165, 470070, -, 906, 4685; cds-WP_002895665.1, NZ_KK737547.1, 470405, 471394, +, 990, 198020; cds-WP_021441455.1, NZ_KK737547.1, 471418, 471930, +, 513, 62327; cds-WP_002895670.1, NZ_KK737547.1, 471934, 472422, +, 489, 35748; cds-WP_002895672.1, NZ_KK737547.1, 472415, 472663, +, 249, 1552; cds-WP_002895674.1, NZ_KK737547.1, 472665, 473117, +, 453, 11003; cds-WP_004142079.1, NZ_KK737547.1, 473163, 473867, +, 705, 105515; cds-WP_032429880.1, NZ_KK737547.1, 474048, 475013, -, 966, 56829; cds-WP_032429882.1, NZ_KK737547.1, 475010, 476254, -, 1245, 51518; cds-WP_004179098.1, NZ_KK737547.1, 476251, 477012, -, 762, 8279; cds-WP_004176793.1, NZ_KK737547.1, 477144, 477581, +, 438, 111954; cds-WP_004142068.1, NZ_KK737547.1, 477642, 478748, -, 1107, 131060; cds-WP_004212202.1, NZ_KK737547.1, 478878, 480011, -, 1134, 40528; cds-WP_032429883.1, NZ_KK737547.1, 480001, 481740, -, 1740, 193594; cds-WP_002895745.1, NZ_KK737547.1, 481733, 482728, -, 996, 138867; cds-WP_002895746.1, NZ_KK737547.1, 482728, 483387, -, 660, 42359; cds-WP_004223785.1, NZ_KK737547.1, 483461, 484384, -, 924, 8974; cds-WP_004142057.1, NZ_KK737547.1, 484376, 484513, +, 138, 0; cds-WP_019705008.1, NZ_KK737547.1, 484801, 486132, +, 1332, 328; cds-AF52_RS27125, NZ_KK737547.1, 486247, 486348, -, 102, 3043; cds-WP_032429885.1, NZ_KK737547.1, 488364, 488701, -, 338, 32043; cds-WP 002895750.1, NZ_KK737547.1, 488735, 489484, +, 750, 459; cds-WP_002895753.1, NZ_KK737547.1, 489498, 490343, +, 846, 2929; cds-WP_002895757.1, NZ_KK737547.1, 490343, 491335, +, 993, 0; cds-WP_032429886.1, NZ_KK737547.1, 491550, 492905, +, 1356, 284327; cds-WP_004147693.1, NZ_KK737547.1, 493093, 495249, +, 2157, 226505; cds-WP_004179105.1, NZ_KK737547.1, 495279, 496247, +, 969, 35195; cds-WP_004176772.1, NZ_KK737547.1, 496357, 496617, -, 261, 217080; cds-WP_032428726.1, NZ_KK737547.1, 496903, 497169, -, 267, 3502; cds-WP_004183485.1, NZ_KK737547.1, 497190, 497450, -, 261, 651; cds-WP_016529094.1, NZ_KK737547.1, 497590, 498204, -, 615, 99399; cds-WP_021441457.1, NZ_KK737547.1, 498301, 499215, +, 915, 61245; cds-WP_021441458.1, NZ_KK737547.1, 499218, 501413, -, 2196, 57906; cds-WP_004142040.1, NZ_KK737547.1, 501525, 502247, -, 723, 627524; cds-WP_002895837.1, NZ_KK737547.1, 502244, 502903, -, 660, 843647; cds-WP_002895839.1, NZ_KK737547.1, 503029, 503775, -, 747, 3283577; cds-WP_002895841.1, NZ_KK737547.1, 504184, 504687, -, 504, 247067; cds-WP_002895842.1, NZ_KK737547.1, 504925, 505812, -, 888, 25043; cds-WP_002895845.1, NZ_KK737547.1, 506164, 506676, +, 513, 1191159; cds-WP_021441460.1, NZ_KK737547.1, 506767, 508347, -, 1581, 605016; cds-WP_002895851.1, NZ_KK737547.1, 508616, 508741, -, 126, 141450; cds-WP_004176765.1, NZ_KK737547.1, 508927, 509400, +, 474, 69952; cds-WP_021441462.1, NZ_KK737547.1, 509397, 510509, +, 1113, 241712; cds-WP_004176762.1, NZ_KK737547.1, 510679, 512055, +, 1377, 379138; cds-WP_004151705.1, NZ_KK737547.1, 512124, 512840, +, 717, 62810; cds-WP_002895871.1, NZ_KK737547.1, 512986, 513900, -, 915, 516696; cds-WP_002895874.1, NZ_KK737547.1, 514101, 514886, -, 786, 60490; cds-WP_002895876.1, NZ_KK737547.1, 515065, 516657, +, 1593, 379598; cds-WP_021441465.1, NZ_KK737547.1, 517192, 519555, -, 2364, 39; cds-WP_004183491.1, NZ_KK737547.1, 519571, 520872, -, 1302, 2087; cds-WP_004219745.1, NZ_KK737547.1, 521115, 522245, +, 1131, 50133; cds-WP_004176744.1, NZ_KK737547.1, 522242, 523507, -, 1266, 95866; cds-WP_004212174.1, NZ_KK737547.1, 523647, 524462, -, 816, 290108; cds-WP_032429888.1, NZ_KK737547.1, 524639, 527071, -, 2433, 0; cds-WP_004183492.1, NZ_KK737547.1, 527076, 527975, -, 900, 2767; cds-WP_004141998.1, NZ_KK737547.1, 528130, 528885, -, 756, 46701; cds-WP_032429890.1, NZ_KK737547.1, 528885, 530120, -, 1236, 33666; cds-WP_004147725.1, NZ_KK737547.1, 530356, 531297, +, 942, 19509; cds-WP_004151710.1, NZ_KK737547.1, 531315, 533174, +, 1860, 280532; cds-WP_012068490.1, NZ_KK737547.1, 533207, 534748, +, 1542, 426411; cds-WP_002892997.1, NZ_KK737547.1, 534795, 535715, +, 921, 92962; cds-WP_004147729.1, NZ_KK737547.1, 535717, 536628, +, 912, 25599; cds-WP_032429891.1, NZ_KK737547.1, 537149, 538474, -, 1326, 528772; cds-WP_004176729.1, NZ_KK737547.1, 538707, 539948, -, 1242, 1387271; cds-WP_004151712.1, NZ_KK737547.1, 540327, 540710, +, 384, 72067; cds-WP_029884283.1, NZ_KK737547.1, 540826, 541935, +, 1110, 76782; cds-WP_004176727.1, NZ_KK737547.1, 541938, 542564, -, 627, 31119; cds-AF52_RS27135, NZ_KK737547.1, 542764, 542887, -, 124, 11223; cds-WP_171290763.1, NZ_KK737547.1, 551069, 551268, -, 200, 8854; cds-WP_179139609.1, NZ_KK737547.1, 552619, 552832, +, 214, 13777; cds-AF52_RS11970, NZ_KK737547.1, 559347, 559565, +, 219, 13068; cds-WP_032428727.1, NZ_KK737547.1, 559740, 559868, +, 129, 0; cds-WP_032429893.1, NZ_KK737547.1, 560520, 561722, +, 1203, 590429; cds-WP_004151717.1, NZ_KK737547.1, 561761, 562519, -, 759, 209211; cds-WP_004141974.1, NZ_KK737547.1, 562621, 563214, -, 594, 189315; cds-WP_004141972.1, NZ_KK737547.1, 563542, 564774, +, 1233, 64037; cds-WP_004141971.1, NZ_KK737547.1, 564812, 565624, -, 813, 275497; cds-WP_004151719.1, NZ_KK737547.1, 565624, 566826, -, 1203, 58742; cds-WP_032429895.1, NZ_KK737547.1, 566909, 567472, +, 564, 8191; cds-WP_032429979.1, NZ_KK737547.1, 567650, 569335, -, 1686, 93104; cds-WP_002896351.1, NZ_KK737547.1, 569602, 569985, +, 384, 54043; cds-WP_002896352.1, NZ_KK737547.1, 569992, 570255, -, 264, 56774; cds-WP_004179132.1, NZ_KK737547.1, 570458, 570745, +, 288, 69385; cds-WP_004179133.1, NZ_KK737547.1, 570729, 571451, +, 723, 16551; cds-WP_002896363.1, NZ_KK737547.1, 571566, 572468, +, 903, 33061; cds-WP_002896365.1, NZ_KK737547.1, 572557, 573036, +, 480, 179856; cds-WP_002896368.1, NZ_KK737547.1, 573385, 574497, +, 1113, 62099; cds-WP_002896370.1, NZ_KK737547.1, 574661, 575794, +, 1134, 114210; cds-WP_002896371.1, NZ_KK737547.1, 575805, 576758, +, 954, 2384; cds-WP_002896372.1, NZ_KK737547.1, 576755, 577600, +, 846, 31102; cds-WP_002896376.1, NZ_KK737547.1, 577658, 578146, +, 489, 106634; cds-WP_004147758.1, NZ_KK737547.1, 578188, 579315, +, 1128, 130123; cds-WP_002896380.1, NZ_KK737547.1, 579394, 580110, +, 717, 21539; cds-WP_002896382.1, NZ_KK737547.1, 580107, 581579, +, 1473, 12453; cds-WP_002896384.1, NZ_KK737547.1, 581666, 582397, -, 732, 93184; cds-WP_004141917.1, NZ_KK737547.1, 582581, 583249, -, 669, 271337; cds-WP_002896386.1, NZ_KK737547.1, 583249, 583965, -, 717, 96170; cds-WP_002896390.1, NZ_KK737547.1, 583972, 584703, -, 732, 244487; cds-WP_002896392.1, NZ_KK737547.1, 584724, 585452, -, 729, 159177; cds-WP_002896394.1, NZ_KK737547.1, 585679, 586194, -, 516, 90003; cds-AF52_RS11825, NZ_KK737547.1, 587073, 587345, +, 273, 388; cds-WP_013815099.1-37, NZ_KK737547.1, 587378, 588346, +, 969, 95238; cds-AF52_RS11815, NZ_KK737547.1, 588400, 589278, +, 879, 31580; cds-WP_032429899.1, NZ_KK737547.1, 589310, 590140, +, 831, 143774; cds-WP_002896399.1, NZ_KK737547.1, 590137, 591150, -, 1014, 311737; cds-WP_004209682.1, NZ_KK737547.1, 591238,


592680, -, 1443, 61543; cds-WP _032429901.1, NZ_KK737547.1, 592691, 593692, -, 1002, 57611; cds-WP _004176700.1, NZ_KK737547.1, 593731, 595449, -, 1719, 184566; cds-WP_002896408.1, NZ_KK737547.1, 595601, 596035, +, 435, 2159; cds-WP _004147771.1, NZ_KK737547.1, 596247, 597215, -, 969, 0; cds-WP _004176696.1, NZ_KK737547.1, 597226, 598878, -, 1653, 226; cds-AF52_RS11770, NZ_KK737547.1, 599022, 599681, -, 660, 5904; cds-WP _013815099.1-38, NZ_KK737547.1, 599738, 600706, -, 969, 92460; cds-AF52_RS11760, NZ_KK737547.1, 600739, 600987, -, 249, 13780; cds-WP _032429902.1, NZ_KK737547.1, 601103, 601798, -, 696, 2582; cds-WP _013815099.1-39, NZ_KK737547.1, 602061, 603029, -, 969, 83115; cds-WP _032429903.1, NZ_KK737547.1, 603283, 604941, +, 1659, 154950; cds-WP_002896440.1, NZ_KK737547.1, 605088, 606203, +, 1116, 510930; cds-WP_032429904.1, NZ_KK737547.1, 606200, 608140, +, 1941, 227455; cds-WP _002896516.1, NZ_KK737547.1, 608217, 608438, -, 222, 179488; cds-WP _002896520.1, NZ_KK737547.1, 608764, 609081, +, 318, 738868; cds-WP_002896522.1, NZ_KK737547.1, 609112, 611391, +, 2280, 2753192; cds-WP _001040187.1, NZ_KK737547.1, 611511, 611729, -, 219, 393746; cds-WP _002898014.1, NZ_KK737547.1, 612083, 612784, -, 702, 135965; cds-WP _004224003.1, NZ_KK737547.1, 612829, 614550, -, 1722, 116655; cds-WP_032429906.1, NZ_KK737547.1, 614551, 616317, -, 1767, 305259; cds-WP _002898019.1, NZ_KK737547.1, 616432, 617400, -, 969, 650347; cds-WP _000228469.1, NZ_KK737547.1, 617933, 618427, +, 495, 345735; cds-AF52_RS0123915, NZ_KK737547.1, 618563, 622808, +, 4246, 1364564; cds-WP_002898132.1, NZ_KK737547.1, 622931, 623542, +, 612, 356677; cds-WP _004179165.1, NZ_KK737547.1, 623551, 624894, +, 1344, 837337; cds-WP _002898139.1, NZ_KK737547.1, 624985, 626277, +, 1293, 3143502; cds-WP_004147794.1, NZ_KK737547.1, 626478, 628916, +, 2439, 5353; cds-WP_004150845.1, NZ_KK737547.1, 628927, 629544, +, 618, 13769; cds-WP _004150844.1, NZ_KK737547.1, 629546, 630409, +, 864, 0; cds-WP _032429909.1, NZ_KK737547.1, 630684, 631832, +, 1149, 192456; cds-WP_002898145.1, NZ_KK737547.1, 631995, 632735, -, 741, 45432; cds-WP _002898148.1, NZ_KK737547.1, 632927, 635209, -, 2283, 2677902; cds-WP _032429911.1, NZ_KK737547.1, 635261, 636118, -, 858, 159177; cds-WP_004150842.1, NZ_KK737547.1, 636504, 638264, -, 1761, 793281; cds-WP _002898152.1, NZ_KK737547.1, 638380, 639072, +, 693, 2304; cds-WP _004176687.1, NZ_KK737547.1, 639261, 640349, +, 1089, 245942; cds-WP_002898157.1, NZ_KK737547.1, 640423, 641706, +, 1284, 297945; cds-WP _002898160.1, NZ_KK737547.1, 641881, 642564, +, 684, 373879; cds-WP _002898162.1, NZ_KK737547.1, 642698, 644371, +, 1674, 41143787; cds-WP_002898165.1, NZ_KK737547.1, 644523, 644810, +, 288, 867236; cds-WP_032411196.1, NZ_KK737547.1, 645016, 647280, +, 2265, 1354; cds-WP_004201387.1, NZ_KK737547.1, 647317, 649065, +, 1749, 416393; cds-WP _016946992.1, NZ_KK737547.1, 649062, 650042, +, 981, 33582; cds-WP _032429912.1, NZ_KK737547.1, 650097, 651326, +, 1230, 100009; cds-WP_002898177.1, NZ_KK737547.1, 651390, 651572, +, 183, 79898; cds-WP _032429914.1, NZ_KK737547.1, 651569, 652315, +, 747, 215041; cds-WP _002898182.1, NZ_KK737547.1, 652453, 653346, +, 894, 1211; cds-WP_004141786.1, NZ_KK737547.1, 653323, 654102, -, 780, 38118; cds-WP_002898187.1, NZ_KK737547.1, 654224, 655024, +, 801, 191885; cds-WP _032429915.1, NZ_KK737547.1, 655021, 656343, +, 1323, 388587; cds-WP _004150840.1, NZ_KK737547.1, 656324, 657028, +, 705, 167868; cds-WP _004176682.1, NZ_KK737547.1, 657028, 661476, +, 4449, 1250961; cds-WP_002898195.1, NZ_KK737547.1, 661677, 663467, +, 1791, 269014; cds-WP_002898198.1, NZ_KK737547.1, 663770, 664321, +, 552, 1123889; cds-WP_002898200.1, NZ_KK737547.1, 664335, 664982, +, 648, 739570; cds-WP_002898202.1, NZ_KK737547.1, 665051, 666241, -, 1191, 1081062; cds-WP _004141771.1, NZ_KK737547.1, 666429, 667508, -, 1080, 1093646; cds-WP _032429917.1, NZ_KK737547.1, 668100, 669500, -, 1401, 936523; cds-AF52_RS11510, NZ_KK737547.1, 669581, 670140, -, 560, 53773; cds-WP _013815099.1-40, NZ_KK737547.1, 670203, 671171, -, 969, 83748; cds-WP_004179185.1, NZ_KK737547.1, 671515, 672726, +, 1212, 12093; cds-WP_023286202.1, NZ_KK737547.1, 672849, 674138, +, 1290, 1846; cds-WP_032429918.1, NZ_KK737547.1, 674163, 675401, +, 1239, 29855; cds-WP _004179190.1, NZ_KK737547.1, 675420, 676586, +, 1167, 6640; cds-WP _002898217.1, NZ_KK737547.1, 676629, 677831, -, 1203, 273890; cds-WP_002898220.1, NZ_KK737547.1, 678158, 680773, +, 2616, 2074497; cds-WP_004150838.1, NZ_KK737547.1, 680978, 681751, -, 774, 39185; cds-WP _004141755.1, NZ_KK737547.1, 681748, 682539, -, 792, 2; cds-WP_002898293.1, NZ_KK737547.1, 682550, 683695, -, 1146, 0; cds-WP _023284918.1, NZ_KK737547.1, 683692, 684654, -, 963, 103; cds-WP _032429920.1, NZ_KK737547.1, 684647, 685222, -, 576, 5723; cds-WP _002898303.1, NZ_KK737547.1, 685472, 686482, +, 1011, 270949; cds-WP _002898308.1, NZ_KK737547.1, 686652, 687194, +, 543, 173724; cds-WP_004179196.1, NZ_KK737547.1, 687191, 688300, -, 1110, 147560; cds-WP _004147847.1, NZ_KK737547.1, 688400, 690505, +, 2106, 407687; cds-WP _004147848.1, NZ_KK737547.1, 690518, 692425, +, 1908, 775594; cds-WP_004147849.1, NZ_KK737547.1, 692440, 693708, +, 1269, 312050; cds-WP _002898390.1, NZ_KK737547.1, 693698, 695335, +, 1638, 266739; cds-WP_002898392.1, NZ_KK737547.1, 695335, 695898, +, 564, 55751; cds-WP _002898396.1, NZ_KK737547.1, 696152, 696319, +, 168, 47894; cds-WP_002898398.1, NZ_KK737547.1, 696388, 696906, -, 519, 425771; cds-WP_032429922.1, NZ_KK737547.1, 696976, 698733, -, 1758, 859103; cds-WP _002898404.1, NZ_KK737547.1, 698919, 699371, +, 453, 10147; cds-WP _002898408.1, NZ_KK737547.1, 699503, 700573, -, 1071, 25234677; cds-WP _002898418.1, NZ_KK737547.1, 700926, 701435, -, 510, 581309; cds-WP _032429924.1, NZ_KK737547.1, 701784, 702380, +, 597, 5441; cds-WP_002898422.1, NZ_KK737547.1, 702394, 704529, -, 2136, 457626; cds-WP_002898425.1, NZ_KK737547.1, 704547, 704993, -, 447, 97253; cds-WP _004176653.1, NZ_KK737547.1, 705118, 707172, +, 2055, 166336; cds-WP _002898432.1, NZ_KK737547.1, 707184, 707642, -, 459, 143320; cds-WP_004144085.1, NZ_KK737547.1, 707797, 708210, +, 414, 87062; cds-WP _013815099.1-41, NZ_KK737547.1, 708377, 709345, -, 969, 90258; cds-AF52_RS0123935, NZ_KK737547.1, 709895, 712733, +, 2839, 98135; cds-WP_072001581.1, NZ_KK737547.1, 724264, 728283, +, 4020, 126506; cds-AF52_RS11335, NZ_KK737547.1, 728452, 729213, +, 762, 3722; cds-AF52_RS27170, NZ_KK737547.1, 729248, 729418, +, 171, 5587; cds-AF52_RS11330, NZ_KK737547.1, 730319, 730471, +, 153, 5558; cds-AF52_RS11325, NZ_KK737547.1, 730530, 733256, +, 2727, 1036; cds-WP _032429986.1, NZ_KK737547.1, 733403, 734278, +, 876, 24424; cds-WP_002898441.1, NZ_KK737547.1, 734321, 734638, -, 318, 79501; cds-WP_032429928.1, NZ_KK737547.1, 734698, 735900, -, 1203, 45747; cds-WP _004210995.1, NZ_KK737547.1, 736091, 736645, +, 555, 146; cds-WP _004183586.1, NZ_KK737547.1, 736663, 737451, +, 789, 37090; cds-WP_032429987.1, NZ_KK737547.1, 737500, 737781, +, 282, 85267; cds-WP_002898457.1, NZ_KK737547.1, 737778, 738107, -, 330, 19018; cds-WP _002898458.1, NZ_KK737547.1, 738196, 738855, -, 660, 1330575; cds-WP_032429929.1, NZ_KK737547.1, 739125, 740777, +, 1653, 21092; cds-AF52_RS26415, NZ_KK737547.1, 741134, 741886, -, 753, 164273; cds-WP_032429931.1, NZ_KK737547.1, 741867, 742055, +, 189, 23256; cds-WP_032429933.1, NZ_KK737547.1, 742225, 743190, -, 966, 78286; cds-WP_004211006.1, NZ_KK737547.1, 743248, 744696, -, 1449, 314711; cds-WP_002898571.1, NZ_KK737547.1, 744715, 745839, -, 1125, 170899; cds-WP_009308376.1, NZ_KK737547.1, 745876, 747483, -, 1608, 296541; cds-WP _032429935.1, NZ_KK737547.1, 747988, 749073, -, 1086, 1500; cds-WP_004221441.1, NZ_KK737547.1, 749156, 750118, +, 963, 2502; cds-WP_002898585.1, NZ_KK737547.1, 750115, 751395, -, 1281, 69322; cds-WP _032429937.1, NZ_KK737547.1, 751398, 752885, -, 1488, 161500; cds-WP _002898590.1, NZ_KK737547.1, 753206, 753763, -, 558, 1114762; cds-WP_020802183.1, NZ_KK737547.1, 753789, 754541, -, 753, 635242; cds-WP_002898595.1, NZ_KK737547.1, 754767, 756188, +, 1422, 611289; cds-WP _004141463.1, NZ_KK737547.1, 756542, 757933, +, 1392, 417647; cds-WP_002898600.1, NZ_KK737547.1, 758052, 758174, -, 123, 42488; cds-WP_021441517.1, NZ_KK737547.1, 758431, 758652, +, 222, 36440; cds-WP_004150831.1, NZ_KK737547.1, 758673, 759461, -, 789, 13776; cds-WP_004141456.1, NZ_KK737547.1, 759577, 760026, -, 450, 4346; cds-WP_004183618.1, NZ_KK737547.1, 760179, 761426, +, 1248, 259151; cds-WP_002898701.1, NZ_KK737547.1, 761495, 761722, -, 228, 47815; cds-WP _002898704.1, NZ_KK737547.1, 761743, 762339, -, 597, 165165; cds-WP_004224058.1, NZ_KK737547.1, 762556, 762687, -, 132, 218; cds-WP _002898708.1, NZ_KK737547.1, 762775, 762948, +, 174, 1458; cds-WP_004199515.1, NZ_KK737547.1, 763111, 764049, +, 939, 30679; cds-WP _004191019.1, NZ_KK737547.1, 764455, 765777, -, 1323, 16; cds-WP _004176611.1, NZ_KK737547.1, 765799, 766293, -, 495, 0; cds-WP _004141442.1, NZ_KK737547.1, 766304, 766894, -, 591, 341; cds-WP_004179289.1, NZ_KK737547.1, 766891, 767694, -, 804, 287; cds-WP_002898877.1, NZ_KK737547.1, 767691, 768083, -, 393, 521; cds-WP_004224061.1, NZ_KK737547.1, 768076, 768786, -, 711, 0; cds-WP _004179293.1, NZ_KK737547.1, 768786, 769877, -, 1092, 30553; cds-WP_002898883.1, NZ_KK737547.1, 770162, 770800, +, 639, 101810; cds-WP_002898886.1, NZ_KK737547.1, 770797, 771192, -, 396, 77265; cds-WP _032429939.1, NZ_KK737547.1, 771378, 775340, -, 3963, 3104138; cds-WP_013815099.1-42, NZ_KK737547.1, 775708, 776676, +, 969, 81545; cds-WP_032429941.1, NZ_KK737547.1, 776720, 777919, +, 1200, 132163; cds-AF52_RS0123960, NZ_KK737547.1, 777953, 778729, +, 777, 16000; cds-WP _020806188.1-3, NZ_KK737547.1, 778830, 779810, -, 981, 236518; cds-WP_032429943.1, NZ_KK737547.1, 779855, 781216, +, 1362, 601; cds-WP_021440205.1, NZ_KK737547.1, 781216, 781701, +, 486, 0; cds-WP _021440204.1, NZ_KK737547.1, 781711, 782727, +, 1017, 0; cds-WP _004143751.1, NZ_KK737547.1, 782737, 783510, +, 774, 600; cds-WP _002906464.1, NZ_KK737547.1, 783507, 784385, -, 879, 1299; cds-WP_148673683.1, NZ_KK737547.1, 784611, 787658, +, 3048, 10212; cds-WP_004143747.1, NZ_KK737547.1, 787670, 788554, +, 885, 70; cds-WP _002906457.1, NZ_KK737547.1, 788547, 789203, +, 657, 26; cds-AF52_RS25665, NZ_KK737547.1, 789256, 789581, -, 326, 38227; cds-WP _004175994.1, NZ_KK737547.1, 789578, 789763, -, 186, 63; cds-WP_004180084.1, NZ_KK737547.1, 789942, 790760, -, 819, 6021; cds-WP_021440202.1, NZ_KK737547.1, 790828, 791268, -, 441,11478; cds-WP_004180082.1, NZ_KK737547.1, 791533, 792687, +, 1155, 6624; cds-WP_020802157.1, NZ_KK737547.1, 792694, 793785, -, 1092, 2676; cds-WP _004184178.1, NZ_KK737547.1, 793795, 794781, -, 987, 72; cds-WP_021440201.1, NZ_KK737547.1, 794781, 796397, -, 1617, 1165; cds-WP_020324770.1, NZ_KK737547.1, 796394, 797242, -, 849, 116; cds-WP_023280140.1, NZ_KK737547.1, 797239, 798183, -, 945, 0; cds-WP _002906226.1, NZ_KK737547.1, 798194, 799816, -, 1623, 1452; cds-WP _002906221.1, NZ_KK737547.1, 799986, 800996, -, 1011, 317694; cds-WP_002906218.1, NZ_KK737547.1, 801249, 801848, +, 600, 614; cds-WP_004176019.1, NZ_KK737547.1, 802022, 802975, +, 954, 1688; cds-WP _032428292.1, NZ_KK737547.1, 803012, 804727, -, 1716, 22446; cds-WP_004200032.1, NZ_KK737547.1, 805090, 805776, -, 687, 30823; cds-WP_021440197.1, NZ_KK737547.1, 805773, 806468, -, 696, 81894; cds-WP_002906125.1, NZ_KK737547.1, 806652, 808349, -, 1698, 625582; cds-WP _002906122.1, NZ_KK737547.1, 808406, 808534, +, 129, 4931; cds-WP_004143727.1, NZ_KK737547.1, 808531, 808671, -, 141, 7305; cds-WP_032429948.1, NZ_KK737547.1, 808849, 809700, -, 852, 163; cds-WP_021440195.1, NZ_KK737547.1, 809814, 810707, +, 894, 50587; cds-WP_004180069.1, NZ_KK737547.1, 810775, 811020, -, 246, 10989; cds-WP _004151242.1, NZ_KK737547.1, 811217, 812131, -, 915, 444; cds-WP_004143718.1, NZ_KK737547.1, 812787, 812972, +, 186, 473; cds-WP_013815099.1-43, NZ_KK737547.1, 813024, 813992, +, 969, 89267; cds-WP_004143717.1, NZ_KK737547.1, 814404, 814619, +, 216, 0; cds-WP _023301896.1, NZ_KK737547.1, 814643, 815149, +, 507, 0; cds-WP _004143715.1, NZ_KK737547.1, 815166, 815348, +, 183, 0; cds-WP_021440193.1, NZ_KK737547.1, 815388, 817013, +, 1626, 232357; cds-WP_032429949.1, NZ_KK737547.1, 817010, 818005, -, 996, 1; cds-WP _004148482.1, NZ_KK737547.1, 818324, 818770, -, 447, 43; cds-WP_021440191.1, NZ_KK737547.1, 818779, 819282, -, 504, 10376; cds-WP _002906035.1,


NZ_KK737547.1, 819427, 819831, +, 405, 35; cds-WP _002906033.1, NZ_KK737547.1, 819847, 819993, +, 147, 357; cds-WP_002906030.1, NZ_KK737547.1, 820107, 820538, +, 432, 2763; cds-WP_021440189.1, NZ_KK737547.1, 820643, 821512, +, 870, 3678; cds-WP _004184165.1, NZ_KK737547.1, 821514, 822200, -, 687, 2391; cds-WP _004143707.1, NZ_KK737547.1, 822190, 822372, -, 183, 53; cds-WP _004151892.1, NZ_KK737547.1, 822422, 823345, +, 924, 0; cds-WP _023282626.1, NZ_KK737547.1, 823595, 824512, +, 918, 29284; cds-WP_023280134.1, NZ_KK737547.1, 824828, 827128, +, 2301, 136507; cds-WP_002906016.1, NZ_KK737547.1, 827278, 828159, +, 882, 78850; cds-WP _004180040.1, NZ_KK737547.1, 828422, 829828, -, 1407, 17110; cds-WP_002906011.1, NZ_KK737547.1, 830416, 831096, +, 681, 27589; cds-AF52_RS0123990, NZ_KK737547.1, 831194, 832255, +, 1062, 256954; cds-WP_004180028.1, NZ_KK737547.1, 832290, 834467, -, 2178, 110646; cds-WP _004184162.1, NZ_KK737547.1, 834736, 835668, -, 933, 14627; cds-WP_002905764.1, NZ_KK737547.1, 835768, 836202, +, 435, 0; cds-WP_004143692.1, NZ_KK737547.1, 836212, 836688, +, 477, 0; cds-WP_002905759.1, NZ_KK737547.1, 836887, 838797, +, 1911, 4406; cds-WP _004189919.1, NZ_KK737547.1, 838910, 839647, +, 738, 9875; cds-WP_004189922.1, NZ_KK737547.1, 839644, 841929, -, 2286, 18511; cds-WP_004184158.1, NZ_KK737547.1, 841929, 843071, -, 1143, 168494; cds-WP _004143686.1, NZ_KK737547.1, 843058, 843336, -, 279, 35446; cds-WP _004143685.1, NZ_KK737547.1, 843339, 844094, -, 756, 81893; cds-WP_004148467.1, NZ_KK737547.1, 844088, 845014, -, 927, 101614; cds-WP _002905689.1, NZ_KK737547.1, 845069, 845140, -, 72, 25427; cds-WP _021440182.1, NZ_KK737547.1, 845277, 846296, -, 1020, 61209; cds-WP_032429953.1, NZ_KK737547.1, 846539, 847531, +, 993, 542; cds-WP _004176065.1, NZ_KK737547.1, 847618, 848358, +, 741, 4849; cds-WP_032428291.1, NZ_KK737547.1, 848355, 849698, +, 1344, 1561; cds-WP _004184155.1, NZ_KK737547.1, 849801, 850991, +, 1191, 9; cds-WP_032429955.1, NZ_KK737547.1, 851905, 852798, -, 894, 3604; cds-WP_187079193.1, NZ_KK737547.1, 852992, 854473, -, 1482, 299036; cds-WP _002905540.1, NZ_KK737547.1, 854483, 855868, -, 1386, 462698; cds-WP _013815099.1-44, NZ_KK737547.1, 856165, 857133, +, 969, 77334; cds-WP_021440179.1, NZ_KK737547.1, 857241, 858176, -, 936, 121117; cds-WP _032429957.1, NZ_KK737547.1, 858201, 858941, -, 741, 44000; cds-WP_004189949.1, NZ_KK737547.1, 858938, 859666, -, 729, 95471; cds-WP_004189951.1, NZ_KK737547.1, 859663, 860358, -, 696, 313058; cds-AF52_RS28000, NZ_KK737547.1, 860529, 860615, +, 87, 14657; cds-WP_002905531.1, NZ_KK737547.1, 860775, 861881, +, 1107, 21844; cds-WP _021440176.1, NZ_KK737547.1, 861919, 863091, -, 1173, 57973; cds-WP _032411533.1, NZ_KK737547.1, 863105, 864028, -, 924, 45503; cds-WP_004148452.1, NZ_KK737547.1, 864221, 865261, -, 1041, 5433; cds-WP _032429958.1, NZ_KK737547.1, 865660, 866916, +, 1257, 162978; cds-WP _021440173.1, NZ_KK737547.1, 867015, 868325, -, 1311, 3895; cds-WP_021440172.1, NZ_KK737547.1, 868427, 869923, -, 1497, 9155; cds-WP_004179987.1, NZ_KK737547.1, 870068, 870784, +, 717, 3797; cds-AF52_RS10695, NZ_KK737547.1, 870784, 871655, +, 872, 28316; cds-WP _004179983.1, NZ_KK737547.1, 871540, 872472, +, 933, 165382; cds-WP _004184144.1, NZ_KK737547.1, 872561, 873352, -, 792, 292; cds-WP_004189983.1, NZ_KK737547.1, 873462, 874229, +, 768, 3849; cds-WP _004176101.1, NZ_KK737547.1, 874432, 874656, +, 225, 34680; cds-AF52_RS25690, NZ_KK737547.1, 874992, 875342, +, 351, 25784; cds-WP_002882540.1, NZ_KK737548.1, 3401, 4102, +, 702, 78994; cds-WP _002882539.1, NZ KK737548.1, 4115, 5512, +, 1398, 229461; cds-WP_004187944.1, NZ_KK737548.1, 5509, 6501, -, 993, 446202; cds-WP_187079194.1, NZ_KK737548.1, 6505, 7437, -, 933, 349287; cds-WP _002882536.1, NZ_KK737548.1, 7538, 8428, -, 891, 298510; cds-WP _002882531.1, NZ_KK737548.1, 8456, 9421, -, 966, 124181; cds-WP _002882529.1, NZ KK737548.1, 9427, 10932, -, 1506, 304766; cds-WP_002882527.1, NZ KK737548.1, 10943, 11362, -, 420, 27382; cds-WP_002882520.1, NZ_KK737548.1, 11548, 13416, -, 1869, 242639; cds-WP _004151555.1, NZ_KK737548.1, 13634, 15133, +, 1500, 201649; cds-WP _002882517.1, NZ_KK737548.1, 15130, 16578, +, 1449, 152389; cds-WP _002882514.1, NZ KK737548.1, 16582, 17574, -, 993, 3762; cds-WP_002882510.1, NZ_KK737548.1, 17726, 18184, +, 459, 113853; cds-WP_004144988.1, NZ_KK737548.1, 18283, 18723, +, 441, 332983; cds-WP _004144989.1, NZ KK737548.1, 19105, 20994, +, 1890, 2127687; cds-WP _004151554.1, NZ KK737548.1, 21110, 21733, +, 624, 258106; cds-WP_013815099.1-45, NZ_KK737548.1, 22264, 23232, +, 969, 117299; cds-WP _004144991.1, NZ_KK737548.1, 23416, 23796, +, 381, 199415; cds-WP_004151552.1, NZ_KK737548.1, 23804, 24619, +, 816, 4392704; cds-WP_000429386.1, NZ KK737548.1, 24669, 24908, +, 240, 2872007; cds-WP _004107293.1, NZ_KK737548.1, 24959, 25429, +, 471, 6642779; cds-WP_004144994.1, NZ KK737548.1, 25444, 25977, +, 534, 6104178; cds-WP_004144995.1, NZ KK737548.1, 25990, 27531, +, 1542, 18931573; cds-WP _004144996.1, NZ KK737548.1, 27582, 28445, +, 864,10231881; cds-WP_004144997.1, NZ KK737548.1, 28472, 29854, +, 1383, 16958859; cds-WP_001251971.1, NZ_KK737548.1, 29875, 30294, +, 420, 2306219; cds-WP _004151550.1, NZ_KK737548.1, 30991, 32361, +, 1371, 844003; cds-WP _004150309.1, NZ_KK737548.1, 32545, 34374, +, 1830, 2220161; cds-WP_004150308.1, NZ_KK737548.1, 34711, 35751, +, 1041, 737210; cds-WP_004145004.1, NZ_KK737548.1, 35880, 36839, +, 960, 178859; cds-WP _004151547.1, NZ_KK737548.1, 36839, 37729, +, 891, 332626; cds-WP _004145006.1, NZ_KK737548.1, 37777, 38550, +, 774, 576806; cds-WP _004145007.1, NZ_KK737548.1, 38601, 39326, +, 726, 156276; cds-AF52_RS10495, NZ KK737548.1, 39804, 40754, +, 951, 6868; cds-WP _013815099.1-46, NZ_KK737548.1, 40806, 41774, -, 969, 75849; cds-AF52_RS10485, NZ_KK737548.1, 41809, 42504, +, 696, 283; cds-WP _032430005.1, NZ KK737548.1, 42543, 43709, +, 1167, 27371; cds-WP_004895208.1, NZ_KK737548.1, 43759, 44478, +, 720, 10530; cds-WP_004145102.1, NZ_KK737548.1, 44558, 45223, -, 666, 42385; cds-WP _004145100.1, NZ_KK737548.1, 45393, 46730, +, 1338, 224594; cds-WP _004151543.1, NZ_KK737548.1, 46776, 47342, -, 567, 234698; cds-WP_004145098.1, NZ_KK737548.1, 47379, 47954, -, 576, 113809; cds-WP _004211197.1, NZ KK737548.1, 48264, 49223, -, 960, 17183; cds-WP_004181598.1, NZ KK737548.1, 49198, 50376, -, 1179, 56333; cds-WP _004151539.1, NZ_KK737548.1, 50476, 50895, -, 420, 847; cds-WP _004151538.1, NZ_KK737548.1, 51015, 52379, -, 1365, 242071; cds-WP_004150295.1, NZ_KK737548.1, 52574, 54220, -, 1647, 8657178; cds-WP _004151536.1, NZ_KK737548.1, 54223, 54480, -, 258, 980675; cds-WP_004151535.1, NZ KK737548.1, 54444, 54803, -, 360, 1854190; cds-WP_000831330.1, NZ_KK737548.1, 54819, 54959, -, 141, 705189; cds-WP _004151534.1, NZ KK737548.1, 55581, 56984, +, 1404, 1092569; cds-WP _004145090.1, NZ_KK737548.1, 56989, 58089, +, 1101, 598571; cds-WP_004150293.1, NZ_KK737548.1, 58297, 59370, +, 1074, 658733; cds-WP_004173845.1, NZ KK737548.1, 59399, 61813, +, 2415, 2357890; cds-WP_050484285.1, NZ_KK737548.1, 62015, 62869, +, 855, 137808; cds-WP_020806188.1-4, NZ_KK737548.1, 62970, 63950, -, 981, 237712; cds-AF52_RS25730, NZ KK737548.1, 64019, 64090, +, 72, 51; cds-WP_021440944.1, NZ_KK737548.1, 64268, 65605, +, 1338, 7543; cds-WP_004150284.1, NZ_KK737548.1, 65657, 66883, +, 1227, 28440; cds-WP_004151524.1, NZ_KK737548.1, 66885, 67217, -, 333, 13001; cds-WP_004151523.1, NZ KK737548.1, 67532, 67945, +, 414, 6433373; cds-WP_004145074.1, NZ_KK737548.1, 68062, 68490, +, 429, 7777986; cds-WP_009308837.1, NZ KK737548.1, 68627, 69451, +, 825, 172207; cds-WP_019705399.1, NZ_KK737548.1, 69553, 71214, +, 1662, 227816; cds-WP_004151520.1, NZ_KK737548.1, 71206, 71928, -, 723, 5456; cds-WP_002923307.1, NZ KK737548.1, 72227, 73849, +, 1623, 42435; cds-WP _002923306.1, NZ_KK737548.1, 73846, 75168, +, 1323, 48015; cds-AF52_RS24880, NZ KK737548.1, 75270, 75617, +, 348, 7700; cds-WP_002923304.1, NZ_KK737548.1, 75607, 75969, +, 363, 18926; cds-WP _002923302.1, NZ_KK737548.1, 76044, 76466, +, 423, 3345; cds-WP_020723563.1, NZ_KK737548.1, 76470, 77798, -, 1329, 7215; cds-WP_004173855.1, NZ KK737548.1, 77816, 79153, -, 1338, 7806; cds-WP _032410116.1, NZ KK737548.1, 79245, 79391, +, 147, 17; cds-WP_032430010.1, NZ_KK737548.1, 79379, 80302, +, 924, 311334; cds-WP _004181587.1, NZ_KK737548.1, 80462, 81646, -, 1185, 159442; cds-WP_032430012.1, NZ_KK737548.1, 81822, 82655, -, 834, 117320; cds-WP _002923294.1, NZ KK737548.1, 82724, 83170, -, 447, 204845; cds-WP _004145059.1, NZ KK737548.1, 83261, 83380, -, 120, 192891; cds-WP _004150272.1, NZ KK737548.1, 83833, 84000, -, 168, 1951; cds-WP _002923286.1, NZ KK737548.1, 84013, 84108, +, 96, 1209; cds-WP _004173858.1, NZ_KK737548.1, 84213, 85901, +, 1689, 227731; cds-WP _002923283.1, NZ_KK737548.1, 85905, 86192, +, 288, 73917; cds-WP _002923282.1, NZ KK737548.1, 86343, 86936, +, 594, 13516; cds-AF52_RS10285, NZ KK737548.1, 86954, 88434, +, 1481, 8631; cds-WP_004145056.1, NZ KK737548.1, 88446, 89774, +, 1329, 602; cds-WP _002923280.1, NZ_KK737548.1, 89920, 91311, +, 1392, 110; cds-WP _004901545.1, NZ KK737548.1, 91448, 91900, +, 453, 72093; cds-WP _004173862.1, NZ KK737548.1, 92029, 92352, -, 324, 20629; cds-AF52_RS10260, NZ KK737548.1, 92336, 92696, -, 361, 60335; cds-WP_002923205.1, NZ_KK737548.1, 92908, 94101, +, 1194, 25438; cds-WP_021440939.1, NZ_KK737548.1, 94098, 94907, -, 810, 3136; cds-WP _021440938.1, NZ_KK737548.1, 94917, 96020, -, 1104, 33158; cds-WP _004145049.1, NZ KK737548.1, 96162, 96881, +, 720, 72845; cds-WP _021440937.1, NZ KK737548.1, 97058, 98071, +, 1014, 9869; cds-WP _004150258.1, NZ KK737548.1, 98077, 99189, +, 1113, 2439; cds-WP _004150257.1, NZ_KK737548.1, 99189, 100049, +, 861, 9739; cds-WP_004145044.1, NZ_KK737548.1, 100052, 100849, +, 798, 12392; cds-WP _032422633.1, NZ KK737548.1, 101047, 102426, -, 1380, 0; cds-WP _002923158.1, NZ_KK737548.1, 102571, 102873, -, 303, 0; cds-WP_002923156.1, NZ KK737548.1, 102971, 104293, -, 1323, 8830; cds-WP_004145041.1, NZ_KK737548.1, 104305, 104619, -, 315, 18809; cds-WP_002923154.1, NZ_KK737548.1, 104913, 105854, +, 942, 30657; cds-WP _032426549.1, NZ KK737548.1, 106066, 107436, +, 1371, 258; cds-WP_002923152.1, NZ_KK737548.1, 107450, 108712, +, 1263, 1191; cds-WP _032430013.1, NZ_KK737548.1, 108709, 109935, -, 1227, 21143; cds-WP _002923146.1, NZ KK737548.1, 110063, 110803, +, 741, 3402; cds-WP_032430014.1, NZ_KK737548.1, 110800, 111513, +, 714, 0; cds-WP _032428449.1, NZ _KK737548.1, 111514, 112599, +, 1086, 8784; cds-WP _032428448.1, NZ_KK737548.1, 112602, 113465, +, 864, 16714; cds-WP_004145033.1, NZ _KK737548.1, 113469, 113744, -, 276, 12418; cds-WP _004234160.1, NZ_KK737548.1, 113866, 114804, -, 939, 134513; cds-WP _004150245.1, NZ_KK737548.1, 114920, 116353, -, 1434, 307706; cds-WP_021440928.1, NZ KK737548.1, 116378, 117280, -, 903, 326926; cds-WP_002923107.1, NZ_KK737548.1, 117443, 118606, -, 1164, 0; cds-WP_004889164.1, NZ_KK737548.1, 118652, 120016, -, 1365, 139; cds-WP _004151514.1, NZ_KK737548.1, 120020, 123127, -, 3108, 1365; cds-WP_016529678.1, NZ KK737548.1, 123127, 124251, -, 1125, 468; cds-WP_032412474.1, NZ_KK737548.1, 124458, 124580, +, 123, 122; cds-WP_032428455.1, NZ_KK737548.1, 124540, 124656, -, 117, 0; cds-WP_004173879.1, NZ_KK737548.1, 124631, 125047, +, 417, 1319; cds-WP _004181564.1, NZ_KK737548.1, 125551, 126198, -, 648, 68804; cds-WP_032430016.1, NZ KK737548.1, 126279, 127772, +, 1494, 10140; cds-WP_002923020.1, NZ_KK737548.1, 127769, 128683, -, 915, 8578; cds-WP _021440922.1, NZ_KK737548.1, 128779, 129405, +, 627, 2111; cds-WP _021440921.1, NZ _KK737548.1, 129408, 129878, +, 471, 15895; cds-WP _004145017.1, NZ_KK737548.1, 129899, 130435, -, 537, 32865; cds-WP_004150236.1, NZ_KK737548.1, 130552, 131457, +, 906, 48766; cds-WP _004173884.1, NZ KK737548.1, 131586, 132395, +, 810, 85509; cds-WP_032430018.1, NZ_KK737548.1, 132420, 133274, +, 855, 11939; cds-WP_021440918.1, NZ _KK737548.1, 133264, 133824, -, 561, 2869; cds-WP _004173886.1, NZ_KK737548.1, 133990, 134769, +, 780, 19165; cds-WP _004145010.1, NZ_KK737548.1, 134791,135744, +, 954, 8401; cds-WP _004901462.1, NZ _KK737548.1, 135741, 136790, -, 1050, 3168; cds-WP_004873113.1, NZ_KK737548.1, 137163, 137861, +, 699, 61071; cds-WP_021440916.1, NZ_KK737548.1, 137912, 138202, -, 291, 30534; cds-WP_002922964.1, NZ_KK737548.1, 138204, 139211, -, 1008, 13865; cds-WP _002922963.1, NZ KK737548.1, 139324, 139791, -, 468, 1864; cds-WP _088296409.1, NZ_KK737548.1;NZ_KK737548.1, 140181;140442, 140442;141343, +;+, 1163, 186054; cds-


WP_108443077.1, NZ_KK737548.1, 141410, 141619, +, 210, 32093; cds-AF52_RS0124095, NZ_KK737548.1, 141929, 142276, -, 348, 43549; cds-AF52_RS0124105, NZ_KK737548.1, 142332, 143029, +, 698, 367704; cds-WP _021440909.1, NZ _KK737548.1, 143089, 144468, +, 1380, 100124; cds-WP_004173889.1, NZ_KK737548.1, 144515, 145237, -, 723, 13044; cds-AF52_RS0124110, NZ_KK737548.1, 145393, 147711, -, 2319, 18830; cds-WP_002922962.1, NZ_KK737548.1, 147724, 149118, -, 1395, 3096; cds-WP _032428443.1, NZ_KK737548.1, 149805, 151016, +, 1212, 363760; cds-WP_013815099.1-47, NZ_KK737548.1, 151813, 152781, -, 969, 114996; cds-WP_148673684.1, NZ_KK737548.1, 153177, 153419, -, 243, 2961; cds-WP_013815099.1-48, NZ_KK737548.1, 153544, 154512, -, 969, 102286; cds-WP_050484287.1, NZ_KK737548.1, 154501, 155697, +, 1197, 36374; cds-WP_002922944.1, NZ_KK737548.1, 155812, 157323, -, 1512, 10905803; cds-WP _002922941.1, NZ_KK737548.1, 157345, 158196, -, 852, 2728325; cds-WP _004150222.1, NZ_KK737548.1, 158639, 158884, +, 246, 295574; cds-WP_002922936.1, NZ_KK737548.1, 159036, 160025, +, 990, 312131; cds-WP_020803798.1, NZ_KK737548.1, 160188, 160958, +, 771, 12515; cds-WP _019724988.1, NZ_KK737548.1, 161023, 162327, +, 1305, 14867; cds-WP _002922909.1, NZ_KK737548.1, 162420, 163187, -, 768, 1279287; cds-WP_002922908.1, NZ _KK737548.1, 163297, 163899, -, 603, 31420; cds-WP_021440903.1, NZ _KK737548.1, 164012, 164440, +, 429, 31342; cds-WP _032430022.1, NZ_KK737548.1, 164441, 165187, -, 747, 301235; cds-WP_021440902.1, NZ_KK737548.1, 165338, 166348, -, 1011, 207054; cds-WP_032428441.1, NZ_KK737548.1, 166397, 168478, -, 2082, 2207495; cds-WP_004181538.1, NZ_KK737548.1, 168484, 169173, -, 690, 509186; cds-WP _004150214.1, NZ_KK737548.1, 169178, 171298, -, 2121, 5641939; cds-WP_000135058.1, NZ_KK737548.1, 171317, 171592, -, 276, 1378005; cds-WP _002922664.1, NZ_KK737548.1, 171647, 172270, -, 624, 1924019; cds-WP _021440900.1, NZ _KK737548.1, 172529, 174205, +, 1677, 25246; cds-WP_002922654.1, NZ_KK737548.1, 174211, 174828, -, 618, 49808; cds-WP _021440899.1, NZ _KK737548.1, 175104, 176354, +, 1251, 22109; cds-WP_004151500.1, NZ_KK737548.1, 176410, 177468, -, 1059, 46080; cds-WP _023317368.1, NZ_KK737548.1, 177471, 178217, -, 747, 42202; cds-WP_002922636.1, NZ_KK737548.1, 178400, 179263, -, 864, 198597; cds-AF52_RS27235, NZ_KK737548.1, 184808, 184969, -, 162, 4768; cds-AF52_RS09865, NZ_KK737548.1, 185020, 185550, +, 531, 3877; cds-AF52_RS27245, NZ_KK737548.1, 185584, 185730, +, 147, 10526; cds-AF52_RS27250, NZ_KK737548.1, 189864, 189965, +, 102, 2559; cds-AF52_RS09860, NZ_KK737548.1, 190018, 190773, +, 756, 886; cds-WP_004216995.1, NZ_KK737548.1, 190811, 190942, -, 132, 678; cds-WP_187079195.1, NZ_KK737548.1, 190941, 191795, +, 855, 35248; cds-AF52_RS27260, NZ_KK737548.1, 191813, 191960, +, 148, 3539; cds-AF52_RS09845, NZ_KK737548.1, 195939, 196123, +, 185, 8068; cds-WP_032430029.1, NZ_KK737548.1, 196229, 197146, +, 918, 271640; cds-AF52_RS09835, NZ_KK737548.1, 197178, 197753, +, 576, 111506; cds-WP _013815099.1-49, NZ_KK737548.1, 197803, 198771, -, 969, 93686; cds-WP _032430030.1, NZ_KK737548.1, 198813, 199445, +, 633, 36; cds-WP _004181470.1, NZ_KK737548.1, 199673, 200161, +, 489, 17224; cds-WP_009484082.1, NZ_KK737548.1, 200629, 202374, -, 1746, 89768; cds-WP _004150073.1, NZ_KK737548.1, 202498, 202818, +, 321, 20775; cds-WP_021440835.1, NZ_KK737548.1, 202842, 203582, -, 741, 36397; cds-WP_004150074.1, NZ_KK737548.1, 203579, 204649, -, 1071,8653; cds-WP_004145129.1, NZ_KK737548.1, 204651, 205496, -, 846, 11179; cds-WP_014906831.1, NZ_KK737548.1, 205493, 206380, -, 888, 10136; cds-WP_004174008.1, NZ_KK737548.1, 206487, 207803, -, 1317, 37472; cds-WP_025861226.1, NZ_KK737548.1, 208076, 208444, -, 369, 30812; cds-WP_004174006.1, NZ_KK737548.1, 208441, 208662, -, 222, 14973; cds-WP _004145133.1, NZ_KK737548.1, 208827, 209540, -, 714, 31; cds-WP_002920803.1, NZ_KK737548.1, 209542, 210309, -, 768, 61889; cds-WP_004174005.1, NZ_KK737548.1, 210306, 211583, -, 1278, 7602; cds-WP_002920807.1, NZ_KK737548.1, 211580, 212506, -, 927, 17967; cds-WP _004150079.1, NZ_KK737548.1, 212568, 213677, -, 1110, 104314; cds-WP_021312829.1, NZ_KK737548.1, 214101, 214484, +, 384, 24972; cds-WP _002920812.1, NZ_KK737548.1, 214753, 215856, -, 1104, 279373; cds-WP _004150081.1, NZ_KK737548.1, 216114, 217358, -, 1245, 81023; cds-WP_021440838.1, NZ_KK737548.1, 217506, 218771, -, 1266, 11296; cds-WP _021440839.1, NZ_KK737548.1, 218890, 220413, +, 1524, 370909; cds-WP_032430034.1, NZ_KK737548.1, 220466, 221320, -, 855, 4546492; cds-WP_004173994.1, NZ_KK737548.1, 221590, 222645, -, 1056, 226502; cds-WP_002920817.1, NZ_KK737548.1, 222638, 223306, -, 669, 194274; cds-WP_004173992.1, NZ_KK737548.1, 223309, 224832, -, 1524, 1132043; cds-WP _002920820.1, NZ_KK737548.1, 225015, 225611, +, 597, 185808; cds-WP_002920822.1, NZ_KK737548.1, 225601, 225876, +, 276, 116734; cds-WP_004173989.1, NZ_KK737548.1, 225890, 226240, -, 351, 83293; cds-WP_004173987.1, NZ_KK737548.1, 226391, 227017, +, 627, 201186; cds-WP_004173985.1, NZ_KK737548.1, 227096, 229306, +, 2211, 230480; cds-WP_002920858.1, NZ_KK737548.1, 229410, 229655, -, 246, 65473; cds-WP _002920860.1, NZ_KK737548.1, 229862, 230527, +, 666, 1367312; cds-WP _002920861.1, NZ_KK737548.1, 230601, 231158, +, 558, 581903; cds-WP_004173981.1, NZ_KK737548.1, 231159, 232379, -, 1221, 45226; cds-WP_004145147.1, NZ_KK737548.1, 232513, 233562, +, 1050, 13201; cds-WP _002920863.1, NZ_KK737548.1, 233559, 233939, -, 381, 5001; cds-WP_002920864.1, NZ_KK737548.1, 233939, 234277, -, 339, 11231; cds-WP_004186016.1, NZ_KK737548.1, 234274, 235929, -, 1656, 144768; cds-WP _009308746.1, NZ_KK737548.1, 235929, 236831, -, 903, 32927; cds-WP _032430036.1, NZ_KK737548.1, 236828, 238813, -, 1986, 253367; cds-WP _002921035.1, NZ_KK737548.1, 238810, 239793, -, 984, 276970; cds-WP_002921037.1, NZ_KK737548.1, 239795, 240934, -, 1140, 80157; cds-WP _004181483.1, NZ_KK737548.1, 241331, 241837, -, 507, 87762; cds-WP _032430038.1, NZ_KK737548.1, 241935, 242795, +, 861, 1601; cds-WP_021440844.1, NZ_KK737548.1, 242934, 244502, +, 1569, 11730; cds-WP_004150102.1, NZ_KK737548.1, 244502, 245446, +, 945, 98; cds-WP_004151422.1, NZ_KK737548.1, 245443, 246276, +, 834, 4014; cds-WP_004173959.1, NZ_KK737548.1, 246276, 247040, +, 765, 35; cds-WP_009308750.1, NZ_KK737548.1, 247037, 247828, +, 792, 268; cds-WP_002921188.1, NZ_KK737548.1, 247816, 248214, +, 399, 29092; cds-WP_002921192.1, NZ_KK737548.1, 248552, 249565, +, 1014, 167751; cds-WP _004150109.1, NZ_KK737548.1, 249605, 250798, -, 1194, 241549; cds-WP_002921200.1, NZ_KK737548.1, 251028, 252524, +, 1497, 1416618; cds-WP _002921203.1, NZ_KK737548.1, 252580, 252915, -, 336, 35574; cds-WP _004145166.1, NZ_KK737548.1, 253298, 253735, +, 438, 792663; cds-WP_002921264.1, NZ_KK737548.1, 253992, 255464, +, 1473, 936575; cds-WP_004173956.1, NZ_KK737548.1, 255592, 256344, -, 753, 52247; cds-WP_004901172.1, NZ_KK737548.1, 256352, 258394, -, 2043, 1227223; cds-WP _021465315.1, NZ_KK737548.1, 258577, 259848, -, 1272, 2; cds-WP _021440845.1, NZ_KK737548.1, 260042, 260884, +, 843, 327335; cds-WP _002921271.1, NZ_KK737548.1, 260957, 262309, +, 1353, 833260; cds-WP_004173953.1, NZ_KK737548.1, 262363, 262986, -, 624, 76227; cds-WP _032430040.1, NZ_KK737548.1, 263113, 264261, +, 1149, 2259; cds-WP_004150117.1, NZ_KK737548.1, 264501, 266153, +, 1653, 196401; cds-WP_032430042.1, NZ_KK737548.1, 266220, 266753, +, 534, 6608; cds-WP _004211228.1, NZ_KK737548.1, 266788, 267546, -, 759, 113421; cds-WP_004145179.1, NZ_KK737548.1, 267666, 268565, +, 900, 89028; cds-WP_002921337.1, NZ_KK737548.1, 268672, 269703, +, 1032, 44526; cds-WP_004150118.1, NZ_KK737548.1, 269975, 271297, +, 1323, 21700; cds-WP _004901194.1, NZ_KK737548.1, 271335, 273386, -, 2052, 1283; cds-WP_002921434.1, NZ_KK737548.1, 273581, 274510, +, 930, 237778; cds-WP _032430046.1, NZ_KK737548.1, 274565, 276067, -, 1503, 828516; cds-WP _002921438.1, NZ_KK737548.1, 276287, 277573, -, 1287, 1479359; cds-WP_072198875.1, NZ_KK737548.1, 277730, 279760, -, 2031, 243566; cds-WP_032430051.1, NZ_KK737548.1, 279979, 283458, -, 3480, 49097; cds-WP _004173946.1, NZ_KK737548.1, 283440, 284549, -, 1110, 44189; cds-WP_072001583.1, NZ_KK737548.1, 284553, 286898, -, 2346, 60561; cds-WP_002921508.1, NZ_KK737548.1, 286909, 289527, -, 2619, 15404; cds-WP_002921510.1, NZ_KK737548.1, 289524, 290255, -, 732, 5525; cds-WP_002921513.1, NZ_KK737548.1, 290267, 290455, -, 189, 611; cds-WP _032430057.1, NZ_KK737548.1, 290624, 292177, +, 1554, 12600; cds-WP _002921518.1, NZ_KK737548.1, 292177, 292374, +, 198, 109; cds-WP_004188236.1, NZ_KK737548.1, 292371, 294050, +, 1680, 2777; cds-WP _032430059.1, NZ_KK737548.1, 294158, 295159, -, 1002, 152596; cds-WP _002921529.1, NZ_KK737548.1, 295171, 295647, -, 477, 7019; cds-WP _032430061.1, NZ_KK737548.1, 295647, 299699, -, 4053, 26039; cds-WP_004151435.1, NZ_KK737548.1, 299696, 302131, -, 2436, 52571; cds-WP_004173941.1, NZ_KK737548.1, 302128, 304239, -, 2112, 46217; cds-WP_004173940.1, NZ_KK737548.1, 304259, 305062, -, 804, 20892; cds-WP_004186070.1, NZ_KK737548.1, 305053, 305592, -, 540, 9813; cds-WP _004145206.1, NZ_KK737548.1, 305910, 306089, -, 180, 54; cds-WP _021440859.1, NZ_KK737548.1, 306108, 307121, -, 1014, 35415; cds-WP_021440860.1, NZ_KK737548.1, 307118, 308101, -, 984, 0; cds-WP_004145207.1, NZ_KK737548.1, 308112, 309014, -, 903, 0; cds-WP_002921786.1, NZ_KK737548.1, 309024, 310043, -, 1020, 22946; cds-WP _050484288.1, NZ_KK737548.1, 310178, 311779, -, 1602, 26610; cds-WP _013815099.1-50, NZ_KK737548.1, 311759, 312727, +, 969, 88916; cds-WP _004214574.1, NZ_KK737548.1, 313931, 315325, -, 1395, 3910; cds-WP_004152427.1, NZ_KK737548.1, 315517, 317190, -, 1674, 830388; cds-WP_002921907.1, NZ_KK737548.1, 317433, 318638, -, 1206, 356870; cds-WP _020803959.1, NZ_KK737548.1, 318880, 319461, -, 582, 3977; cds-WP_002921914.1, NZ_KK737548.1, 319667, 320248, +, 582, 147585; cds-WP _015959126.1, NZ_KK737548.1, 320226, 320666, +, 441, 85942; cds-WP _032428435.1, NZ_KK737548.1, 320635, 322965, -, 2331, 254740; cds-WP _002921917.1, NZ_KK737548.1, 323133, 323795, +, 663, 42398; cds-WP_002921918.1, NZ_KK737548.1, 323899, 324915, +, 1017, 34414; cds-WP_002921919.1, NZ_KK737548.1, 325027, 325776, +, 750, 54328; cds-WP_002921921.1, NZ_KK737548.1, 325780, 326715, +, 936, 20624; cds-WP_002921927.1, NZ_KK737548.1, 326820, 328100, +, 1281, 386171; cds-WP _021440865.1, NZ_KK737548.1, 328125, 329096, +, 972, 53634; cds-WP _002921929.1, NZ_KK737548.1, 329205, 329915, -, 711, 377913; cds-WP_021440866.1, NZ_KK737548.1, 330356, 331711, +, 1356, 247291; cds-WP_013815099.1-51, NZ_KK737548.1, 331921, 332889, -, 969, 87704; cds-AF52_RS26455, NZ_KK737548.1, 332922, 333029, -, 108, 9876; cds-WP _002922127.1, NZ_KK737548.1, 333330, 335399, -, 2070, 2150851; cds-WP_002922128.1, NZ_KK737548.1, 335409, 336320, -, 912, 1027908; cds-WP_002922129.1, NZ_KK737548.1, 336447, 336746, -, 300, 4834; cds-WP _004145225.1, NZ_KK737548.1, 336926, 337921, +, 996, 17672; cds-WP _004188180.1, NZ_KK737548.1, 337948, 338394, -, 447, 42779; cds-WP_002922133.1, NZ_KK737548.1, 338426, 338797, -, 372, 38554; cds-WP _004150156.1, NZ_KK737548.1, 338966, 340420, -, 1455, 6087; cds-WP_021440868.1, NZ_KK737548.1, 340513, 341835, -, 1323, 19430; cds-WP_014906789.1, NZ_KK737548.1, 342270, 343325, +, 1056, 271; cds-WP_002922346.1, NZ_KK737548.1, 343390, 344931, +, 1542, 3214; cds-WP_002922349.1, NZ_KK737548.1, 344909, 346090, +, 1182, 10093; cds-WP _002922351.1, NZ_KK737548.1, 346323, 347501, +, 1179, 117819; cds-WP_004188166.1, NZ_KK737548.1, 347540, 348358, -, 819, 241221; cds-WP_004173926.1, NZ_KK737548.1, 348673, 350706, +, 2034,64352; cds-WP_002922359.1, NZ_KK737548.1, 350875, 352131, +, 1257, 103958; cds-WP _021440872.1, NZ_KK737548.1, 352174, 352659, -, 486, 12175; cds-WP_021440873.1, NZ_KK737548.1, 352769, 353596, -, 828, 239916; cds-WP_021440874.1, NZ_KK737548.1, 353815, 354813, +, 999, 322918; cds-WP _021440875.1, NZ_KK737548.1, 354825, 355289, +, 465, 10305; cds-WP _004150167.1, NZ_KK737548.1, 355314, 356243, +, 930, 42242; cds-WP_032430066.1, NZ_KK737548.1, 356280, 357599, +, 1320, 39616; cds-WP _021440877.1, NZ_KK737548.1, 357678, 359183, +, 1506, 5209; cds-WP _004889285.1, NZ_KK737548.1, 359180, 359842, +, 663, 0; cds-WP_004889283.1, NZ_KK737548.1, 359835, 360695, +, 861, 0; cds-WP_021440878.1, NZ_KK737548.1, 360689, 361387, +, 699,


7158; cds-WP _032430069.1, NZ_KK737548.1, 361445, 363286, -, 1842, 34136; cds-WP _021440880.1, NZ_KK737548.1, 363283, 364671, -, 1389, 9492; cds-WP _004145238.1, NZ_KK737548.1, 364777, 365385, -, 609, 3860; cds-AF52_RS26460, NZ_KK737548.1, 365492, 365822, -, 331, 6477; cds-WP_002922397.1, NZ_KK737548.1, 366352, 368259, +, 1908, 428257; cds-WP_019705056.1, NZ_KK737548.1, 368360, 369508, +, 1149, 180708; cds-WP _002922401.1, NZ_KK737548.1, 369508, 370104, +, 597, 54715; cds-WP_002922402.1, NZ_KK737548.1, 370093, 370317, -, 225, 52144; cds-WP_002922410.1, NZ_KK737548.1, 370590, 370952, +, 363, 68281; cds-WP _002922413.1, NZ_KK737548.1, 371238, 372893, +, 1656, 7196470; cds-WP_002922415.1, NZ_KK737548.1, 372890, 373663, +, 774, 1777534; cds-WP _002922420.1, NZ_KK737548.1, 373663, 374847, +, 1185, 1174373; cds-WP _002922423.1, NZ_KK737548.1, 374940, 375413, +, 474, 274342; cds-WP _004164645.1, NZ_KK737548.1, 375490, 375757, +, 268, 33251; cds-WP _032430073.1, NZ_KK737548.1, 376056, 376773, +, 718, 66143; cds-WP _004185922.1, NZ_KK737548.1, 376896, 377726, -, 831, 2225266; cds-WP_002920136.1, NZ_KK737548.1, 377949, 378167, +, 219, 41284; cds-WP_002920140.1, NZ_KK737548.1, 378226, 378813, -, 588, 546102; cds-WP_002920143.1, NZ_KK737548.1, 378907, 379107, -, 201, 20632; cds-WP_004150031.1, NZ_KK737548.1, 379119, 380924, -, 1806, 293931; cds-WP _004151401.1, NZ_KK737548.1, 380911, 381474, -, 564, 230938; cds-WP _032430077.1, NZ_KK737548.1, 381648, 383552, +, 1905, 386389; cds-WP _072145335.1, NZ_KK737548.1, 383780, 384778, +, 999, 171825; cds-WP _002920151.1, NZ_KK737548.1, 384775, 384993, +, 219, 102817; cds-WP _021440811.1, NZ_KK737548.1, 385030, 385899, +, 870, 401350; cds-WP_002920158.1, NZ_KK737548.1, 385954, 386358, -, 405, 247860; cds-WP_000242758.1, NZ_KK737548.1, 386665, 387297, +, 633, 2469155; cds-WP _004213494.1, NZ_KK737548.1, 387349, 389427, +, 2079, 482463; cds-WP _021440813.1, NZ_KK737548.1, 389417, 390637, -, 1221, 72376; cds-WP_021440814.1, NZ_KK737548.1, 390728, 391291, -, 564, 7791; cds-WP_004181446.1, NZ_KK737548.1, 391324, 391926, -, 603, 4817; cds-WP _002920231.1, NZ_KK737548.1, 391916, 392083, -, 168, 159337; cds-WP_002920238.1, NZ_KK737548.1, 392190, 392759, -, 570, 517303; cds-WP_002920240.1, NZ_KK737548.1, 393036, 394223, +, 1188, 315997; cds-WP_004174045.1, NZ_KK737548.1, 394220, 395542, -, 1323, 241006; cds-WP _002920243.1, NZ_KK737548.1, 395781, 398324, +, 2544, 368; cds-WP_002920249.1, NZ_KK737548.1, 398321, 398647, +, 327, 56; cds-WP _002920252.1, NZ_KK737548.1, 398801, 400174, +, 1374, 21172; cds-WP _002920253.1, NZ_KK737548.1, 400247, 401251, -, 1005, 1628472; cds-WP _004188345.1, NZ_KK737548.1, 401244, 402005, -, 762, 742145; cds-WP_002920259.1, NZ_KK737548.1, 401998, 402675, -, 678, 978307; cds-WP_002920260.1, NZ_KK737548.1, 402693, 403520, -, 828, 2102251; cds-WP _021440816.1, NZ_KK737548.1, 403599, 404885, -, 1287, 2961174; cds-WP _004150047.1, NZ_KK737548.1, 404970, 406064, -, 1095, 1976832; cds-WP _002920267.1, NZ_KK737548.1, 406120, 406641, -, 522, 879644; cds-WP _021440817.1, NZ_KK737548.1, 406912, 408156, -, 1245, 20266; cds-WP _002920279.1, NZ_KK737548.1, 408089, 408472, -, 384, 11520; cds-WP_004174029.1, NZ_KK737548.1, 408462, 408890, -, 429, 400; cds-WP _032428423.1, NZ_KK737548.1, 408880, 409413, -, 534, 337; cds-WP _004174027.1, NZ_KK737548.1, 409397, 410197, -, 801, 429; cds-WP_004185951.1, NZ_KK737548.1, 410316, 412874, +, 2559, 799955; cds-WP _032430083.1, NZ_KK737548.1, 412928, 413488, -, 561, 84082; cds-WP_032430086.1, NZ_KK737548.1, 413809, 415938, +, 2130, 530286; cds-WP_004181456.1, NZ_KK737548.1, 415999, 416682, +, 684, 571928; cds-WP _002920326.1, NZ_KK737548.1, 416679, 417080, +, 402, 633277; cds-WP_004188324.1, NZ_KK737548.1, 417099, 417983, +, 885, 413361; cds-WP_032430089.1, NZ_KK737548.1, 418344, 419966, +, 1623, 3536828; cds-WP_002920333.1, NZ_KK737548.1, 420044, 421399, -, 1356, 399017; cds-WP_001157751.1, NZ_KK737548.1, 421396, 422115, -, 720, 503347; cds-WP_002920503.1, NZ_KK737548.1, 422343, 422816, +, 474, 197114; cds-WP_004150056.1, NZ_KK737548.1, 422917, 425247, +, 2331, 1729992; cds-WP _013815099.1-52, NZ_KK737548.1, 425442, 426410, -, 969, 74729; cds-WP_002920506.1, NZ_KK737548.1, 426726, 426953, +, 228, 58960; cds-WP_014906839.1, NZ_KK737548.1, 426982, 429300, +, 2319, 192491; cds-WP_002920509.1, NZ_KK737548.1, 429310, 429549, +, 240, 6893; cds-WP _002920510.1, NZ_KK737548.1, 429638, 429907, -, 270, 161209; cds-WP_032430095.1, NZ_KK737548.1, 430028, 430801, -, 774, 16324; cds-WP_004185961.1, NZ_KK737548.1, 430840, 431514, +, 675, 32055; cds-WP _002920540.1, NZ_KK737548.1, 431573, 432148, +, 576, 526982; cds-WP _002920542.1, NZ_KK737548.1, 432485, 433801, +, 1317, 50162; cds-WP_004185965.1, NZ_KK737548.1, 433904, 435997, -, 2094, 978790; cds-WP_004151407.1, NZ_KK737548.1, 436008, 438398, -, 2391, 2717367; cds-WP _002920545.1, NZ_KK737548.1, 439023, 441728, +, 2706, 2268244; cds-WP_002920548.1, NZ_KK737548.1, 441744, 442502, -, 759, 455361; cds-WP _032428425.1, NZ_KK737548.1, 442552, 443382, -, 831, 407433; cds-WP _002920552.1, NZ_KK737548.1, 443433, 443762, -, 330, 145325; cds-WP_002920554.1, NZ_KK737548.1, 443967, 445475, +, 1509, 5219154; cds-WP _004174017.1, NZ_KK737548.1, 445538, 445837, -, 300, 404090; cds-WP _016529833.1, NZ_KK737548.1, 445837, 446184, -, 348, 100822; cds-WP _002920561.1, NZ_KK737548.1, 446360, 448807, -, 2448, 601319; cds-WP_002920564.1, NZ_KK737548.1, 448825, 450258, -, 1434, 100206; cds-WP _002920566.1, NZ_KK737548.1, 450258, 451553, -, 1296, 542379; cds-WP _023342583.1, NZ_KK737548.1, 451634, 453610, -, 1977, 132790; cds-WP_004150069.1, NZ_KK737548.1, 453607, 455793, -, 2187, 667729; cds-WP_002920570.1, NZ_KK737548.1, 456031, 457137, -, 1107, 293797; cds-WP_004151411.1, NZ_KK737548.1, 457241, 457603, +, 363, 50; cds-WP_002920773.1, NZ_KK737548.1, 457600, 458940, -, 1341, 32205; cds-WP_002920775.1, NZ_KK737548.1, 458940, 459470, -, 531, 37835; cds-WP _002920777.1, NZ_KK737548.1, 459651, 460646, -, 996, 90666; cds-WP_002920779.1, NZ_KK737548.1, 460760, 461455, -, 696, 102889; cds-WP _021440831.1, NZ_KK737548.1, 461577, 462614, -, 1038, 247677; cds-WP _013815099.1-53, NZ_KK737548.1, 462956, 463924, -, 969, 74280; cds-AF52_RS08695, NZ_KK737548.1, 463958, 464491, +, 534, 6821; cds-WP_002922602.1, NZ_KK737548.1, 464588, 465304, +, 717, 610162; cds-WP _004173904.1, NZ_KK737548.1, 465415, 466056, +, 642, 219995; cds-WP _004173905.1, NZ_KK737548.1, 466092, 467108, -, 1017, 666450; cds-WP_002922598.1, NZ_KK737548.1, 467284, 467880, -, 597, 181712; cds-WP _004145270.1, NZ_KK737548.1, 468005, 468463, -, 459, 232596; cds-WP _004188117.1, NZ_KK737548.1, 468441, 469655, -, 1215, 377680; cds-WP_002922589.1, NZ_KK737548.1, 469828, 470493, +, 666, 174826; cds-WP_000091955.1, NZ_KK737548.1, 470710, 470946, +, 237, 1494509; cds-WP _002922510.1, NZ_KK737548.1, 470967, 471134, +, 168, 1094159; cds-WP_004173907.1, NZ_KK737548.1, 471270, 472079, +, 810, 35285; cds-WP_002922501.1, NZ_KK737548.1, 472268, 472747, -, 480, 269868; cds-WP _004145264.1, NZ_KK737548.1, 472744, 473520, -, 777, 575687; cds-WP _004145263.1, NZ_KK737548.1, 473520, 474794, -, 1275, 682296; cds-WP_002922498.1, NZ_KK737548.1, 474886, 475875, -, 990, 615731; cds-WP_032430101.1, NZ_KK737548.1, 475905, 476999, -, 1095, 549355; cds-WP _009308781.1, NZ_KK737548.1, 477002, 478129, -, 1128, 185272; cds-WP_021440889.1, NZ_KK737548.1, 478126, 479202, -, 1077, 321300; cds-WP_021440888.1, NZ_KK737548.1, 479314, 480276, +, 963, 96309; cds-WP _032428440.1, NZ_KK737548.1, 480295, 481374, +, 1080, 375531; cds-WP_032430104.1, NZ_KK737548.1, 481418, 482587, -, 1170, 429916; cds-WP_002922468.1, NZ_KK737548.1, 482565, 483473, -, 909, 743593; cds-WP _004186128.1, NZ_KK737548.1, 483473, 484444, -, 972, 234360; cds-WP _002922465.1, NZ_KK737548.1, 484448, 485506, -, 1059, 971595; cds-WP _002922463.1, NZ_KK737548.1, 485516, 486448, -, 933, 908721; cds-WP_002922462.1, NZ_KK737548.1, 486662, 487855, +, 1194, 1370002; cds-WP_002922461.1, NZ_KK737548.1, 487868, 488893, +, 1026, 1895422; cds-WP_032428438.1, NZ_KK737548.1, 489062, 489850, +, 789, 597524; cds-WP_002922459.1, NZ_KK737548.1, 489856, 490803, -, 948, 296894; cds-WP_032428437.1, NZ_KK737548.1, 490807, 492078, -, 1272, 232473; cds-WP _004152046.1, NZ_KK737548.1, 492088, 493632, -, 1545, 242983; cds-WP_002922436.1, NZ_KK737548.1, 493878, 494309, +, 432, 931506; cds-WP_002922429.1, NZ_KK737548.1, 494416, 494667, +, 252, 1132760; cds-WP_002922428.1, NZ_KK737548.1, 494728, 495195, +, 468, 1894414; cds-WP _002922427.1, NZ_KK737548.1, 495195, 496214, +, 1020, 1533632; cds-WP_002922426.1, NZ_KK737548.1, 496288, 497109, +, 822, 373563; cds-AF52_RS27300, NZ_KK737548.1, 497212, 497488, -, 277, 18761; cds-WP _032430113.1, NZ_KK737548.1, 498141, 498462, -, 322, 12112; cds-WP_002920130.1, NZ_KK737548.1, 498606, 499328, +, 723, 419387; cds-WP_002920128.1, NZ_KK737548.1, 499328, 499714, +, 387, 28701; cds-WP _004889490.1, NZ_KK737548.1, 499714, 500073, +, 360, 48653; cds-WP_002920119.1, NZ_KK737548.1, 500081, 500368, +, 288, 98470; cds-WP_002920115.1, NZ_KK737548.1, 500493, 500867, +, 375, 7784182; cds-WP_002920113.1, NZ_KK737548.1, 500964, 501434, +, 471, 16601278; cds-WP _002920103.1, NZ_KK737548.1, 501531, 503645, +, 2115, 89066909; cds-WP _004174069.1, NZ_KK737548.1, 503715, 504899, +, 1185, 85971667; cds-WP _004152415.1, NZ_KK737548.1, 505080, 505274, +, 195, 36146; cds-WP_002919971.1, NZ_KK737548.1, 505348, 505824, +, 477, 88812; cds-WP_020801891.1, NZ_KK737548.1, 505808, 506293, -, 486, 14222; cds-WP_001181005.1, NZ_KK737548.1, 506677, 506988, +, 312, 13923212; cds-WP_002919796.1, NZ_KK737548.1, 507021, 507650, +, 630, 23488641; cds-WP _002919794.1, NZ_KK737548.1, 507661, 508266, +, 606, 23551825; cds-WP _000617546.1, NZ_KK737548.1, 508263, 508565, +, 303, 11695539; cds-WP_002919786.1, NZ_KK737548.1, 508583, 509404, +, 822, 38043802; cds-WP _001138115.1, NZ_KK737548.1, 509421, 509699, +, 279, 16401637; cds-WP_002919773.1, NZ_KK737548.1, 509714, 510046, +, 333, 16496081; cds-WP_002919766.1, NZ_KK737548.1, 510064, 510762, +, 699, 29338149; cds-WP_002919759.1, NZ_KK737548.1, 510775, 511185, +, 411, 14820490; cds-WP _002919754.1, NZ_KK737548.1, 511185, 511376, +, 192, 6056967; cds-WP_002919751.1, NZ_KK737548.1, 511376, 511630, +, 255, 5197239; cds-WP _002919748.1, NZ_KK737548.1, 511796, 512167, +, 372, 9325206; cds-WP_000729185.1, NZ_KK737548.1, 512178, 512492, +, 315, 13302073; cds-WP _001096200.1, NZ_KK737548.1, 512507, 513046, +, 540, 27987517; cds-WP_002919667.1, NZ_KK737548.1, 513061, 513366, +, 306, 20541713; cds-WP_002919665.1, NZ_KK737548.1, 513400, 513792, +, 393, 13759116; cds-WP _002919662.1, NZ_KK737548.1, 513805, 514338, +, 534, 20426559; cds-WP _000358960.1, NZ_KK737548.1, 514348, 514701, +, 354, 17910734; cds-WP_002919545.1, NZ_KK737548.1, 514716, 515219, +, 504, 18203191; cds-WP _001140434.1, NZ_KK737548.1, 515223, 515402, +, 180, 6094160; cds-WP _002919516.1, NZ_KK737548.1, 515406, 515840, +, 435, 23514844; cds-WP_002919515.1, NZ_KK737548.1, 515848, 517179, +, 1332, 43372031; cds-WP _000868187.1, NZ_KK737548.1, 517213, 517329, +, 117, 3506399; cds-WP _002919259.1, NZ_KK737548.1, 517476, 517832, +, 357, 13915840; cds-WP _002919257.1, NZ_KK737548.1, 517849, 518238, +, 390, 20066577; cds-WP_002919224.1, NZ_KK737548.1, 518272, 518892, +, 621, 22477649; cds-WP _002919219.1, NZ_KK737548.1, 518918, 519907, +, 990, 45116302; cds-WP_002919206.1, NZ_KK737548.1, 519948, 520334, +, 387, 10630712; cds-WP_002919204.1, NZ_KK737548.1, 520443, 520811, +, 369, 32303; cds-WP_004185894.1, NZ_KK737548.1, 520814, 521239, +, 426, 37238; cds-WP _004145324.1, NZ_KK737548.1, 521297, 521575, +, 279, 56176; cds-WP_004145325.1, NZ_KK737548.1, 521511, 521924, -, 414, 131535; cds-WP_032430127.1, NZ_KK737548.1, 522065, 523441, -, 1377, 698494; cds-WP_004212524.1, NZ_KK737548.1, 523455, 524750, -, 1296, 515197; cds-WP _032430129.1, NZ_KK737548.1, 524803, 525750, -, 948, 994930; cds-WP_004889527.1, NZ_KK737548.1, 525765, 526274, -, 510, 940649; cds-WP_032428422.1, NZ_KK737548.1, 526403, 527527, +, 1125, 67815; cds-WP _002919137.1, NZ_KK737548.1, 527499, 527972, +, 474, 518432; cds-WP_004145330.1, NZ_KK737548.1, 527999, 528541, +, 543, 737861; cds-WP_021440795.1, NZ_KK737548.1, 528546, 529118, +, 573, 508410; cds-WP_002919126.1, NZ_KK737548.1, 529122, 529940, +, 819, 931050; cds-WP _002919125.1, NZ_KK737548.1, 529937, 530194, +, 258, 37634; cds-


AF52_RS08260, NZ_KK737548.1, 530170, 530502, -, 333, 75251; cds-AF52_RS08255, NZ_KK737548.1, 530559, 530709, -, 151, 12731; cds-AF52_RS08250, NZ_KK737548.1, 538177, 538410, -, 234, 3591; cds-WP_002919103.1, NZ_KK737548.1, 546983, 547204, -, 222, 65420; cds-WP _032430131.1, NZ_KK737548.1, 547497, 550607, -, 3111, 529916; cds-WP_002919101.1, NZ_KK737548.1, 550620, 551759, -, 1140, 447; cds-WP _021440791.1, NZ_KK737548.1, 552138, 552791, +, 654, 125; cds-WP _000462905.1, NZ_KK737548.1, 552876, 553172, -, 297, 557070; cds-WP _004144972.1, NZ_KK737548.1, 553197, 554162, -, 966, 1916724; cds-WP_004144971.1, NZ_KK737548.1, 554520, 555401, -, 882, 345561; cds-WP_004188394.1, NZ_KK737548.1, 555413, 556864, -, 1452, 183432; cds-WP _002918740.1, NZ_KK737548.1, 556854, 557096, -, 243, 20177; cds-WP _002918738.1, NZ_KK737548.1, 557207, 558556, -, 1350, 2170589; cds-WP _002918736.1, NZ_KK737548.1, 558567, 559034, -, 468, 959810; cds-WP_019725248.1, NZ_KK737548.1, 559057, 559509, -, 453, 769097; cds-WP _002918689.1, NZ_KK737548.1, 559733, 560341, -, 609, 55157; cds-WP_004211677.1, NZ_KK737548.1, 560341, 561342, -, 1002, 40800; cds-WP_004211674.1, NZ_KK737548.1, 561572, 561763, +, 192, 718; cds-WP_002918686.1, NZ_KK737548.1, 561843, 563783, +, 1941, 242023; cds-WP _002918653.1, NZ_KK737548.1, 564089, 565132, +, 1044, 1537883; cds-WP_004149974.1, NZ_KK737548.1, 565203, 566195, +, 993, 1126220; cds-WP _002918648.1, NZ_KK737548.1, 566195, 566683, +, 489, 218079; cds-WP_032430132.1, NZ_KK737548.1, 566691, 567272, +, 582, 292261; cds-WP _002918644.1, NZ_KK737548.1, 567275, 568744, +, 1470, 848513; cds-WP_032417624.1, NZ_KK737548.1, 568782, 572579, +, 3798, 471741; cds-WP _004144958.1, NZ_KK737548.1, 572668, 574113, +, 1446, 235187; cds-WP _002918641.1, NZ_KK737548.1, 574149, 575078, -, 930, 52780; cds-WP_002918640.1, NZ_KK737548.1, 575210, 575413, +, 204, 11585; cds-WP_002918639.1, NZ_KK737548.1, 575421, 576353, +, 933, 4699; cds-WP_002918632.1, NZ_KK737548.1, 576359, 578326, +, 1968, 31318; cds-WP_002918629.1, NZ_KK737548.1, 578406, 578681, +, 276, 3111; cds-WP_002918627.1, NZ_KK737548.1, 578732, 578998, -, 267, 67237; cds-WP _032428421.1, NZ_KK737548.1, 579097, 579360, -, 264, 56015; cds-WP_002918625.1, NZ_KK737548.1, 579735, 580205, -, 471, 42796; cds-WP_002918570.1, NZ_KK737548.1, 580620, 581558, +, 939, 507488; cds-WP _002918568.1, NZ_KK737548.1, 581695, 582753, -, 1059, 104206; cds-WP_032430134.1, NZ_KK737548.1, 582841, 584208, -, 1368, 443774; cds-WP_002918565.1, NZ_KK737548.1, 584382, 584780, -, 399, 224565; cds-WP _004900926.1, NZ_KK737548.1, 584971, 586098, +, 1128, 454372; cds-WP _002918559.1, NZ_KK737548.1, 586364, 586792, +, 429, 10587461; cds-WP _000829818.1, NZ_KK737548.1, 586808, 587200, +, 393, 17960410; cds-WP_002918467.1, NZ_KK737548.1, 587512, 588150, +, 639, 2829176; cds-WP_002918465.1, NZ_KK737548.1, 588154, 588648, +, 495, 355647; cds-WP_004185859.1, NZ_KK737548.1, 588773, 589477, +, 705, 62543; cds-WP _002918461.1, NZ_KK737548.1, 589532, 590950, -, 1419, 89470; cds-WP _004144939.1, NZ_KK737548.1, 590960, 595420, -, 4461, 1428391; cds-WP _002918455.1, NZ_KK737548.1, 596094, 597026, +, 933, 2; cds-AF52_RS08010, NZ_KK737548.1, 597078, 597653, -, 576, 442; cds-AF52_RS08005, NZ_KK737548.1, 597707, 597899, -, 193, 6221; cds-WP _032430135.1, NZ_KK737548.1, 600002, 601147, -, 1146, 1042218; cds-WP _002917952.1, NZ_KK737548.1, 601212, 602102, -, 891, 1395156; cds-WP _002917954.1, NZ_KK737548.1, 602129, 602899, -, 771, 734559; cds-WP_020802049.1, NZ_KK737548.1, 602926, 604257, -, 1332, 1178567; cds-WP _002917960.1, NZ_KK737548.1, 604650, 606221, +, 1572, 886123; cds-WP_004144878.1, NZ_KK737548.1, 606434, 607297, -, 864, 129056; cds-WP_032430136.1, NZ_KK737548.1, 607361, 609469, +, 2109, 492859; cds-WP _002918206.1, NZ_KK737548.1, 609427, 609813, +, 387, 21760; cds-WP _002918211.1, NZ_KK737548.1, 609839, 610429, +, 591, 213889; cds-WP_002918214.1, NZ_KK737548.1, 610439, 611014, +, 576, 177089; cds-WP_004149921.1, NZ_KK737548.1, 611136, 612176, -, 1041, 22802; cds-WP _002918218.1, NZ_KK737548.1, 612252, 612899, -, 648, 31769; cds-WP_002918221.1, NZ_KK737548.1, 613028, 613564, +, 537, 11061; cds-WP_002918223.1, NZ_KK737548.1, 613526, 613969, -, 444, 45042; cds-WP_002918226.1, NZ_KK737548.1, 614019, 614309, +, 291,66975; cds-WP_002918229.1, NZ_KK737548.1, 614296, 614799, -, 504, 82351; cds-WP_002918231.1, NZ_KK737548.1, 614793, 615317, -, 525, 108463; cds-WP_002918232.1, NZ_KK737548.1, 615539, 616534, +, 996, 81; cds-WP_020802035.1, NZ_KK737548.1, 616540, 617418, +, 879, 20; cds-WP_020802054.1, NZ_KK737548.1, 617562, 618569, +, 1008, 231425; cds-WP _002918235.1, NZ_KK737548.1, 618614, 619858, -, 1245, 461556; cds-WP_004150943.1, NZ_KK737548.1, 620003, 621934, -, 1932, 2899246; cds-WP _085903200.1, NZ_KK737548.1, 621927, 622007, -, 81, 512584; cds-WP_002918241.1, NZ_KK737548.1, 622112, 622996, -, 885, 7436332; cds-WP _004150944.1, NZ_KK737548.1, 623105, 625240, -, 2136, 9234085; cds-WP_002918244.1, NZ_KK737548.1, 625483, 625752, -, 270, 809875; cds-WP _023280600.1, NZ_KK737548.1, 625901, 626845, -, 945, 280166; cds-WP _002918248.1, NZ_KK737548.1, 626845, 627246, -, 402, 286021; cds-WP_002918250.1, NZ_KK737548.1, 627349, 630039, -, 2691, 8538168; cds-WP_002918252.1, NZ_KK737548.1, 630064, 631551, -, 1488, 2985235; cds-WP_002918364.1, NZ_KK737548.1, 631579, 632031, -, 453, 1483274; cds-WP _004144895.1, NZ_KK737548.1, 632624, 633967, +, 1344, 349178; cds-WP_013815099.1-54, NZ_KK737548.1, 634121, 635089, -, 969, 76858; cds-AF52_RS0124215, NZ_KK737548.1, 635123, 635506, +, 384, 22118; cds-WP _004174150.1, NZ_KK737548.1, 635644, 636273, +, 630, 5359; cds-WP_002918367.1, NZ_KK737548.1, 636616, 637167, +, 552, 12850; cds-WP _014906872.1, NZ_KK737548.1, 637209, 637457, -, 249, 7601; cds-WP_002918369.1, NZ_KK737548.1, 637851, 638180, -, 330, 1150903; cds-WP _002918370.1, NZ_KK737548.1, 638410, 639747, -, 1338, 338049; cds-WP_002918371.1, NZ_KK737548.1, 639740, 640588, -, 849, 917950; cds-WP_002918372.1, NZ_KK737548.1, 640682, 642616, -, 1935, 6966241; cds-WP _002918373.1, NZ_KK737548.1, 642716, 643345, -, 630, 1898481; cds-WP_002918374.1, NZ_KK737548.1, 643469, 643762, +, 294, 777412; cds-WP_002918375.1, NZ_KK737548.1, 643915, 644391, -, 477, 368896; cds-WP_004149937.1, NZ_KK737548.1, 644627, 646060, +, 1434, 434926; cds-WP_002918377.1, NZ_KK737548.1, 646112, 647290, -, 1179, 1372336; cds-WP_004149938.1, NZ_KK737548.1, 647306, 648271, -, 966, 1411901; cds-WP _002434222.1, NZ_KK737548.1, 648365, 648622, -, 258, 4211150; cds-WP _002918379.1, NZ_KK737548.1, 648643, 648954, -, 312, 5488232; cds-WP_004144907.1, NZ_KK737548.1, 649215, 650186, +, 972, 522255; cds-WP_002918381.1, NZ_KK737548.1, 650383, 650655, +, 273, 40785; cds-WP_002918382.1, NZ_KK737548.1, 650711, 651970, -, 1260, 1087431; cds-WP 004144910.1, NZ_KK737548.1, 652024, 652278, -, 255, 222976; cds-WP_004174142.1, NZ_KK737548.1, 652415, 652705, -, 291, 118949; cds-WP_032430139.1, NZ_KK737548.1, 652705, 653340, -, 636, 1017239; cds-WP _002918387.1, NZ_KK737548.1, 653359, 653910, -, 552, 480820; cds-WP_004150949.1, NZ_KK737548.1, 653915, 654697, -, 783, 718536; cds-WP _004150950.1, NZ_KK737548.1, 654705, 655517, -, 813, 404117; cds-WP_004149949.1, NZ_KK737548.1, 655727, 656704, +, 978, 123967; cds-WP_002918399.1, NZ_KK737548.1, 656719, 657705, +, 987, 314470; cds-WP_002918405.1, NZ_KK737548.1, 657720, 658286, +, 567, 176349; cds-WP _002918413.1, NZ_KK737548.1, 658283, 658858, +, 576, 855942; cds-WP _002918415.1, NZ_KK737548.1, 658827, 659372, +, 546, 302911; cds-WP_002918417.1, NZ_KK737548.1, 659379, 660104, +, 726, 891765; cds-WP_002918420.1, NZ_KK737548.1, 660152, 661585, +, 1434, 1574281; cds-WP_002918423.1, NZ_KK737548.1, 661608, 661895, +, 288, 452096; cds-WP_004144926.1, NZ_KK737548.1, 661966, 662454, +, 489, 613726; cds-WP_002918428.1, NZ_KK737548.1, 662500, 663354, +, 855, 916140; cds-WP _002918431.1, NZ_KK737548.1, 663351, 663623, +, 273, 202731; cds-WP _032430141.1, NZ_KK737548.1, 663687, 664412, -, 726, 294669; cds-WP_004889584.1, NZ_KK737548.1, 664409, 665062, -, 654, 277973; cds-WP _002918444.1, NZ_KK737548.1, 665296, 667635, -, 2340, 885159; cds-WP_021440775.1, NZ_KK737548.1, 667782, 668846, -, 1065, 885; cds-WP _032428420.1, NZ_KK737548.1, 669143, 670159, +, 1017, 986; cds-AF52_RS07625, NZ_KK737548.1, 670245, 670964, +, 720, 2; cds-WP_032430142.1, NZ_KK737548.1, 670997, 671650, +, 654, 40137; cds-WP_032175380.1, NZ_KK737548.1, 671925, 672273, +, 349, 33713; cds-AF52_RS07610, NZ_KK737548.1, 672318, 672869, -, 552, 6017; cds-WP_004144865.1, NZ_KK737548.1, 672974, 673870, +, 897, 167113; cds-WP_002917923.1, NZ_KK737548.1, 673912, 674280, -, 369, 221403; cds-WP _002917922.1, NZ_KK737548.1, 674407, 675393, -, 987, 57725; cds-WP _002917920.1, NZ_KK737548.1, 675474, 675866, -, 393, 45; cds-WP_004181402.1, NZ_KK737548.1, 676212, 676508, -, 297, 19256; cds-WP_002917917.1, NZ_KK737548.1, 676505, 676903, -, 399, 306949; cds-WP_002917916.1, NZ_KK737548.1, 676906, 677211, -, 306, 337574; cds-WP _002917914.1, NZ_KK737548.1, 677257, 677625, -, 369, 800021; cds-WP_004218213.1, NZ_KK737548.1, 677775, 678152, -, 378, 165924; cds-WP _002917909.1, NZ_KK737548.1, 678161, 678823, -, 663, 373196; cds-WP _002917907.1, NZ_KK737548.1, 679164, 679940, -, 777, 236304; cds-WP_002917905.1, NZ_KK737548.1, 680068, 681369, -, 1302, 46145; cds-WP _050484286.1, NZ_KK737548.1, 681850, 683202, +, 1353, 417918; cds-WP_002917898.1, NZ_KK737548.1, 683281, 684768, +, 1488, 19925; cds-WP _002917897.1, NZ_KK737548.1, 684898, 685452, +, 555, 52195; cds-WP_002917895.1, NZ_KK737548.1, 685468, 686715, -, 1248, 519398; cds-WP _004185787.1, NZ_KK737548.1, 686982, 687953, -, 972, 208496; cds-WP _004181399.1, NZ_KK737548.1, 688225, 689214, -, 990, 1188918; cds-WP_004144843.1, NZ_KK737548.1, 689288, 689788, -, 501, 25821; cds-WP _021440752.1, NZ_KK737548.1, 689808, 690410, -, 603, 145293; cds-WP_002917889.1, NZ_KK737548.1, 690454, 691161, +, 708, 4627; cds-WP_021440751.1, NZ_KK737548.1, 691247, 692377, +, 1131, 193114; cds-WP_004900808.1, NZ_KK737548.1, 692486, 694507, -, 2022, 614033; cds-WP _019704938.1, NZ_KK737548.1, 694692, 696290, -, 1599, 34871; cds-WP _004144837.1, NZ_KK737548.1, 696328, 697299, -, 972, 25207; cds-WP_022615670.1, NZ_KK737548.1, 697518, 699005, +, 1488, 3593; cds-WP_004174225.1, NZ_KK737548.1, 699002, 700036, +, 1035, 5473; cds-WP _032430144.1, NZ_KK737548.1, 700037, 701035, +, 999, 8; cds-WP _032430145.1, NZ_KK737548.1, 701037, 702038, +, 1002, 0; cds-WP _002917724.1, NZ_KK737548.1, 702050, 702937, +, 888, 17; cds-WP _002917723.1, NZ_KK737548.1, 702934, 703230, +, 297, 172; cds-WP_023316052.1, NZ_KK737548.1, 703277, 704656, -, 1380, 106433; cds-WP_002917718.1, NZ_KK737548.1, 704914, 705468, -, 555, 27060; cds-WP _021440748.1, NZ_KK737548.1, 705706, 706482, +, 777, 14276; cds-WP_004174228.1, NZ_KK737548.1, 706638, 708287, -, 1650, 102247; cds-WP _004174229.1, NZ_KK737548.1, 708363, 709784, -, 1422, 49574; cds-WP _004181378.1, NZ_KK737548.1, 709795, 710427, -, 633, 218082; cds-WP _002917682.1, NZ_KK737548.1, 710438, 711508, -, 1071, 194797; cds-WP_020324489.1, NZ_KK737548.1, 711664, 711849, -, 186, 285; cds-WP_002917681.1, NZ_KK737548.1, 712119, 713216, +, 1098, 58050; cds-WP _002917680.1, NZ_KK737548.1, 713318, 715243, +, 1926, 171682; cds-WP_002917679.1, NZ_KK737548.1, 715221, 715751, -, 531, 3181; cds-WP _021440747.1, NZ_KK737548.1, 715752, 716105, -, 354, 0; cds-WP _032430191.1, NZ_KK737548.1, 716126, 717277, -, 1152, 84; cds-WP _013815099.1-55, NZ_KK737548.1, 717293, 718261, +, 969, 83005; cds-WP_015875176.1, NZ_KK737548.1, 718377, 718805, -, 429, 0; cds-WP_002917676.1, NZ_KK737548.1, 719219, 720886, +, 1668, 0; cds-WP _021440746.1, NZ_KK737548.1, 720899, 721483, +, 585, 199; cds-WP_002917670.1, NZ_KK737548.1, 721486, 721911, +, 426, 0; cds-AF52_RS0124235, NZ_KK737548.1, 721924, 723747, +, 1824, 613; cds-WP_015959037.1, NZ_KK737548.1, 723801, 724604, +, 804, 2069; cds-WP_002917655.1, NZ_KK737548.1, 724656, 724961, -, 306, 6316; cds-WP _002917651.1, NZ_KK737548.1, 724988, 725563, -, 576, 6938; cds-WP_004144810.1, NZ_KK737548.1, 725804, 726466, +, 663, 92; cds-AF52_RS07345, NZ_KK737548.1, 726557, 728848, -, 2292, 516; cds-WP_013815099.1-56, NZ_KK737548.1, 728883, 729851, +, 969, 86529; cds-AF52_RS07335, NZ_KK737548.1, 729909, 730865, -, 957, 4037; cds-WP _004174237.1, NZ_KK737548.1, 730870, 731484, -, 615, 25791; cds-WP_021440741.1, NZ_KK737548.1,


731785, 732150, +, 366, 0; cds-WP _023313669.1, NZ_KK737548.1, 732219, 732491, -, 273, 2; cds-AF52_RS27330, NZ_KK737548.1, 732623, 732801, +, 179, 10056; cds-AF52_RS27335, NZ_KK737548.1, 735673, 735777, -, 105, 402; cds-WP_004152286.1, NZ_KK737548.1, 736364, 737446, +, 1083, 634011; cds-WP_032430148.1, NZ_KK737548.1, 737568, 740642, +, 3075, 5841286; cds-WP_023158026.1, NZ_KK737548.1, 740694, 741947, +, 1254, 1006959; cds-AF52_RS25890, NZ_KK737548.1, 742013, 742153, +,141,0; cds-AF52_RS25895, NZ_KK737548.1, 742168, 742863, -, 696, 2728; cds-AF52_RS25905, NZ_KK737548.1, 742956, 743322, +, 367, 15951; cds-AF52_RS07290, NZ_KK737548.1, 743401, 743690, +, 290, 37108; cds-WP_032430151.1, NZ_KK737548.1, 746080, 747084, +, 1005, 196375; cds-AF52_RS07280, NZ_KK737548.1, 747266, 747803, -, 538, 39105; cds-AF52_RS25915, NZ_KK737548.1, 748423, 748868, -, 446, 178635; cds-WP _004118832.1, NZ_KK737548.1, 749044, 750777, -, 1734, 131963; cds-WP _004118225.1, NZ_KK737548.1, 750785, 751732, -, 948, 7913; cds-WP _004152278.1, NZ_KK737548.1, 751777, 753381, -, 1605, 16545; cds-WP_004118227.1, NZ_KK737548.1, 753394, 754314, -, 921, 2588; cds-WP_004118228.1, NZ_KK737548.1, 754314, 755162, -, 849, 13601; cds-WP_004118229.1, NZ_KK737548.1, 755159, 755752, -, 594, 16685; cds-WP _004118840.1, NZ_KK737548.1, 755749, 756876, -, 1128, 40920; cds-WP_004118231.1, NZ_KK737548.1, 757161, 757328, -, 168, 9704; cds-WP_162551856.1, NZ_KK737548.1, 757257, 757469, +, 213, 10598; cds-AF52_RS07235, NZ_KK737548.1, 757470, 757955, +, 486, 54801; cds-WP _004197062.1, NZ_KK737548.1, 760634, 761155, +, 522, 125338; cds-WP_004197067.1, NZ_KK737548.1, 761152, 762105, +, 954, 67681; cds-WP_032430155.1, NZ_KK737548.1, 762198, 764522, +, 2325, 14189294; cds-WP _023157913.1, NZ_KK737548.1, 764567, 765469, +, 903, 3231750; cds-WP_032430156.1, NZ_KK737548.1, 765466, 766464, +, 999, 1939377; cds-WP _004118246.1, NZ_KK737548.1, 766461, 767417, +, 957, 671120; cds-WP_004152282.1, NZ_KK737548.1, 767418, 768185, +, 768, 373062; cds-WP_004118251.1, NZ_KK737548.1, 768284, 768577, +, 294, 159364; cds-AF52_RS25920, NZ_KK737548.1, 768652, 768879, +, 228, 138561; cds-WP_020806188.1-5, NZ_KK737548.1, 769118, 770098, -, 981, 246880; cds-WP _032430158.1, NZ_KK737548.1, 770398, 771066, +, 669, 5672; cds-WP _002885079.1, NZ_KK737548.1, 771455, 772804, +, 1350, 141057; cds-WP _002885082.1, NZ_KK737548.1, 772952, 774598, +, 1647, 203513; cds-WP_002885085.1, NZ_KK737548.1, 774761, 775642, -, 882, 91987; cds-WP _002885086.1, NZ_KK737548.1, 775748, 776155, +, 408, 16550; cds-WP_002885088.1, NZ_KK737548.1, 776152, 776841, +, 690, 37745; cds-AF52_RS0124245, NZ_KK737548.1, 777352, 777909, +, 558, 4; cds-WP _004210006.1, NZ_KK737548.1, 777970, 778659, +, 690, 6118; cds-WP_032428472.1, NZ_KK737548.1, 778613, 781192, +, 2580, 62010; cds-WP _004151734.1, NZ_KK737548.1, 781228, 781776, +, 549, 1529; cds-WP_002885139.1, NZ_KK737548.1, 781796, 782893, +, 1098, 15864; cds-WP _024623073.1, NZ_KK737548.1, 782941, 784593, -, 1653, 185052; cds-WP _004177812.1, NZ_KK737548.1, 784593, 784904, -, 312, 114208; cds-WP_002885145.1, NZ_KK737548.1, 785088, 787046, -, 1959, 4557317; cds-WP_004146658.1, NZ_KK737548.1, 787147, 787347, +, 201, 23239; cds-WP _004146659.1, NZ_KK737548.1, 787459, 788772, +, 1314, 253488; cds-WP_004151733.1, NZ_KK737548.1, 788809, 789495, -, 687, 127393; cds-WP_012737173.1, NZ_KK737548.1, 789725, 791872, -, 2148, 65155; cds-WP_023159071.1, NZ_KK737548.1, 792145, 792873, +, 729, 24017; cds-WP _004177809.1, NZ_KK737548.1, 792959, 793717, +, 759, 50780; cds-WP _002885155.1, NZ_KK737548.1, 793723, 794640, +, 918, 183357; cds-AF52_RS0124265, NZ_KK737548.1, 794765, 795772, -, 1008, 16827; cds-WP_002885156.1, NZ_KK737548.1, 795847, 796788, -, 942, 845; cds-WP _002885172.1, NZ_KK737548.1, 796819, 797817, -, 999, 441; cds-WP _002885173.1, NZ_KK737548.1, 797814, 799334, -, 1521, 0; cds-WP _021441042.1, NZ_KK737548.1, 799514, 801799, +, 2286, 4599; cds-WP _032430167.1, NZ_KK737548.1, 801870, 802223, +, 354, 29816; cds-WP_004210023.1, NZ_KK737548.1, 802245, 803003, -, 759, 9298; cds-WP _004151727.1, NZ_KK737548.1, 803019, 803582, -, 564, 41; cds-WP _009484481.1, NZ_KK737548.1, 803582, 804718, -, 1137, 2648; cds-WP_002885196.1, NZ_KK737548.1, 804715, 805395, -, 681, 123825; cds-WP_004177787.1, NZ_KK737548.1, 805503, 806261, -, 759, 13; cds-WP_002885202.1, NZ_KK737548.1, 806258, 807106, -, 849, 0; cds-WP _021441044.1, NZ_KK737548.1, 807099, 808163, -, 1065, 90; cds-WP _002885207.1, NZ_KK737548.1, 808164, 808748, -, 585, 94; cds-WP_020802927.1, NZ_KK737548.1, 808745, 809197, -, 453, 0; cds-WP_032428478.1, NZ_KK737548.1, 809198, 809923, -, 726, 42054; cds-WP _004177784.1, NZ_KK737548.1, 810079, 810513, -, 435, 81260; cds-WP_004177783.1, NZ_KK737548.1, 810742, 811077, -, 336, 247081; cds-WP _002885227.1, NZ_KK737548.1, 811622, 813124, +, 1503, 351556; cds-WP_004177781.1, NZ_KK737548.1, 813174, 814112, -, 939, 13833; cds-WP_032430168.1, NZ_KK737548.1, 814352, 815704, +, 1353, 3754; cds-WP _019724884.1, NZ_KK737548.1, 815798, 817213, +, 1416, 41889; cds-WP_004146677.1, NZ_KK737548.1, 817219, 817341, +, 123, 45198; cds-WP_004177778.1, NZ_KK737548.1, 817489, 818445, +, 957, 764271; cds-WP _004177777.1, NZ_KK737548.1, 818455, 818826, +, 372, 59010; cds-WP _002885324.1, NZ_KK737548.1, 819518, 819823, -, 306, 2619; cds-WP_021441050.1, NZ_KK737548.1, 819823, 820740, -, 918, 5633; cds-WP _020316611.1, NZ_KK737548.1, 820816, 820929, +, 114, 131; cds-WP _004221988.1, NZ_KK737548.1, 820886, 821569, -, 684, 15555; cds-WP _002885391.1, NZ_KK737548.1, 821795, 822580, +, 786, 58586; cds-WP _004177775.1, NZ_KK737548.1, 822626, 823075, -, 450, 66; cds-WP_002885393.1, NZ_KK737548.1, 823075, 824403, -, 1329, 39709; cds-WP _032430193.1, NZ_KK737548.1, 824396, 826411, -, 2016, 6886; cds-WP _072271759.1, NZ_KK737548.1, 826420, 828867, -, 2448, 29448; cds-AF52_RS06930, NZ_KK737548.1, 829500, 829859, +, 360, 67293; cds-WP _032430171.1, NZ_KK737548.1, 829892, 830562, +, 671, 169625; cds-AF52_RS27350, NZ_KK737548.1, 830663, 830977, +, 315, 122729; cds-AF52_RS0124285, NZ_KK737548.1, 831034, 831249, +, 216, 2932; cds-WP_004146686.1, NZ_KK737548.1, 831244, 831366, -, 123, 7616; cds-WP_004153693.1, NZ_KK737548.1, 831561, 831851, +, 291, 19; cds-WP _021441054.1, NZ_KK737548.1, 832920, 835007, -, 2088, 36944; cds-WP_002885410.1, NZ_KK737548.1, 835075, 835665, -, 591, 221619; cds-WP _032430173.1, NZ_KK737548.1, 835686, 837482, -, 1797, 434177; cds-WP_002885422.1, NZ_KK737548.1, 837458, 837781, -, 324, 22461; cds-WP _002885423.1, NZ_KK737548.1, 837906, 839207, -, 1302, 214260; cds-WP_002885424.1, NZ_KK737548.1, 839323, 840759, -, 1437, 5601066; cds-WP _002885425.1, NZ_KK737548.1, 841097, 841573, +, 477, 39334; cds-WP _009485424.1, NZ_KK737548.1, 841625, 842875, -, 1251, 25636; cds-WP _004152420.1, NZ_KK737548.1, 843108, 843401, +, 294, 3385628; cds-WP_002885441.1, NZ_KK737548.1, 843439, 845085, +, 1647, 22417959; cds-AF52_RS27360, NZ_KK737548.1, 846097, 846318, -, 222, 36; cds-WP_013815099.1-57, NZ_KK737548.1, 846353, 847321, +, 969, 74545; cds-AF52_RS25950, NZ_KK737548.1, 847378, 848127, -, 750, 4403; cds-WP _004186605.1, NZ_KK737548.1, 848177, 848857, -, 681, 298; cds-WP_004186607.1, NZ_KK737548.1, 848908, 849450, -, 543, 5; cds-WP_004222578.1, NZ_KK737549.1, 190, 258, +, 69, 23694; cds-WP _002887848.1, NZ_KK737549.1, 340, 2802, +, 2463, 412549; cds-WP_002887853.1, NZ KK737549.1, 2804, 3733, +, 930, 114769; cds-WP _002887863.1, NZ KK737549.1, 3737, 5017, +, 1281, 125557; cds-WP_004222583.1, NZ_KK737549.1, 5332, 5709, +, 378, 21959; cds-WP_004178561.1, NZ_KK737549.1, 5778, 6551, -, 774, 252818; cds-WP_002887871.1, NZ_KK737549.1, 6629, 8059, -, 1431, 34858; cds-WP_002887897.1, NZ KK737549.1, 8262, 9215, +, 954, 4733179; cds-WP _002887898.1, NZ_KK737549.1, 9315, 9902, +, 588, 161965; cds-WP_021441173.1, NZ_KK737549.1, 10022, 11326, +, 1305, 84681; cds-WP_004177461.1, NZ_KK737549.1, 11389, 11955, -, 567, 6890; cds-WP _021441175.1, NZ KK737549.1, 12044, 12793, -, 750, 13107; cds-WP_002887909.1, NZ_KK737549.1, 12821, 13225, -, 405, 122; cds-WP_004146997.1, NZ_KK737549.1, 13611, 15527, +, 1917, 10358104; cds-WP _002887955.1, NZ_KK737549.1, 15615, 16748, +, 1134, 1015878; cds-WP _004192071.1, NZ KK737549.1, 16926, 18101, +, 1176, 650335; cds-WP _002887961.1, NZ_KK737549.1, 18156, 19052, +, 897, 590231; cds-WP_002887965.1, NZ_KK737549.1, 19172, 19435, -, 264, 708935; cds-WP _002887969.1, NZ_KK737549.1, 19765, 20703, +, 939, 765531; cds-WP _032430302.1, NZ KK737549.1, 20747, 23563, +, 2817, 4756655; cds-WP_002887973.1, NZ KK737549.1, 23563, 24063, +, 501, 185115; cds-WP _002887976.1, NZ_KK737549.1, 24179, 24628, +, 450, 321586; cds-WP _002887979.1, NZ_KK737549.1, 24630, 25580, +, 951, 767522; cds-WP _032430200.1, NZ_KK737549.1, 25647, 26561, +, 915, 328683; cds-WP _032428524.1, NZ KK737549.1, 26592, 26957, +, 366, 93247; cds-WP_021441178.1, NZ_KK737549.1, 26905, 27834, -, 930, 97445; cds-WP_004192057.1, NZ_KK737549.1, 27927, 28556, +, 630, 445489; cds-WP_004222618.1, NZ_KK737549.1, 28562, 29266, -, 705, 1010562; cds-WP_004151379.1, NZ_KK737549.1, 29259, 30887, -, 1629, 371534; cds-WP _032430201.1, NZ KK737549.1, 31059, 32360, -, 1302, 7372; cds-WP_021441180.1, NZ KK737549.1, 32376, 34154, -, 1779, 10; cds-WP _012540458.1, NZ_KK737549.1, 34170, 34421, -, 252, 0; cds-WP_004151375.1, NZ KK737549.1, 34577, 35917, -, 1341, 7081; cds-WP _004222626.1, NZ KK737549.1, 36174, 37202, +, 1029, 122; cds-WP _004151373.1, NZ_KK737549.1, 37233, 37526, +, 294, 0; cds-WP _004151372.1, NZ_KK737549.1, 37523, 38392, +, 870, 0; cds-WP _032428528.1, NZ_KK737549.1, 38403, 39929, +, 1527, 1014; cds-WP_004222628.1, NZ_KK737549.1, 39948, 40856, +, 909, 1768; cds-WP_021441183.1, NZ_KK737549.1, 41085, 41906, +, 822, 271359; cds-WP_004212571.1, NZ_KK737549.1, 42364, 43512, +, 1149, 2133036; cds-WP _002888056.1, NZ KK737549.1, 43530, 46754, +, 3225, 7750280; cds-WP_002888059.1, NZ_KK737549.1, 46924, 47157, +, 234, 23476; cds-WP_002888068.1, NZ_KK737549.1, 47289, 47822, +, 534, 151935; cds-WP_004145992.1, NZ KK737549.1, 47815, 49680, +, 1866, 120987; cds-WP _002888320.1, NZ KK737549.1, 49854, 50333, +, 480, 163580; cds-WP _002888321.1, NZ KK737549.1, 50586, 51434, -, 849, 202640; cds-WP _002888323.1, NZ KK737549.1, 51439, 51816, -, 378, 209920; cds-WP_002888324.1, NZ KK737549.1, 51819, 52640, -, 822, 429410; cds-WP _032430205.1, NZ_KK737549.1, 52637, 53626, -, 990, 1015031; cds-WP _002888329.1, NZ KK737549.1, 53632, 54918, -, 1287, 1725030; cds-WP_032103829.1, NZ_KK737549.1, 54973, 57321, -, 2349, 2067987; cds-WP _002888332.1, NZ_KK737549.1, 57565, 58392, +, 828, 274658; cds-WP_002888337.1, NZ_KK737549.1, 58425, 59123, -, 699, 17731; cds-WP_004192048.1, NZ_KK737549.1, 59113, 60738, -, 1626, 135652; cds-WP_002888345.1, NZ KK737549.1, 61063, 62427, +, 1365, 6757; cds-WP_021441189.1, NZ KK737549.1, 62607, 63146, +, 540, 160515; cds-WP_002888348.1, NZ_KK737549.1, 63209, 63868, -, 660, 181842; cds-WP_032428530.1, NZ KK737549.1, 63881, 66787, -, 2907, 1306674; cds-WP_021441191.1, NZ KK737549.1, 66975, 69332, -, 2358, 371699; cds-WP _002888353.1, NZ KK737549.1, 69499, 70194, -, 696, 4; cds-WP_021441192.1, NZ_KK737549.1, 70332, 71834, -, 1503, 120892; cds-WP_023279864.1, NZ_KK737549.1, 71845, 73554, -, 1710, 13143; cds-WP _004145972.1, NZ KK737549.1, 73892, 74737, +, 846, 201388; cds-WP _002888373.1, NZ_KK737549.1, 74866, 75633, +, 768, 25011; cds-WP _032430207.1, NZ KK737549.1, 75620, 76321, -, 702, 12190; cds-WP _002888430.1, NZ_KK737549.1, 76305, 77915, -, 1611, 109717; cds-WP _032428532.1, NZ KK737549.1, 77891, 78874, -, 984, 536525; cds-AF52_RS0124360, NZ KK737549.1, 79164, 80819, -, 1656, 220236; cds-WP_002888448.1, NZ_KK737549.1, 80907, 81059, +, 153, 916; cds-WP _004147046.1, NZ KK737549.1, 81327, 82511, +, 1185, 25337; cds-WP_004147047.1, NZ_KK737549.1, 82545, 83855, -, 1311, 62235; cds-WP_013815099.1-58, NZ_KK737549.1, 84110, 85078, +, 969, 97463; cds-WP_002888455.1, NZ_KK737549.1, 85153, 86049, +, 897, 12239; cds-WP_004177420.1, NZ_KK737549.1, 86087, 86842, -, 756, 38347; cds-WP _032428534.1, NZ KK737549.1, 86873, 88087, -, 1215, 2254; cds-WP _002888460.1, NZ_KK737549.1, 88098, 88961, -, 864, 163; cds-WP _004147052.1, NZ_KK737549.1, 88973, 91006, -, 2034, 5852; cds-WP _002888481.1, NZ_KK737549.1, 91402, 92007, -, 606, 151420; cds-WP _021441196.1, NZ KK737549.1, 92018, 93418, -, 1401, 188181; cds-WP _002888487.1, NZ KK737549.1, 93421, 94512, -, 1092, 162916; cds-WP_023287248.1, NZ KK737549.1, 94512, 96083, -, 1572, 67274; cds-WP _004222662.1, NZ_KK737549.1, 96179, 96265, -,


87, 197; cds-WP_148673689.1, NZ_KK737549.1, 96879, 97847, +, 969, 7756; cds-WP_002888534.1, NZ_KK737549.1, 98242, 99966, +, 1725, 106634; cds-WP_002888536.1, NZ_KK737549.1, 99969, 100460, +, 492, 34465; cds-WP_004145952.1, NZ_KK737549.1, 100641, 101645, +, 1005,844064; cds-WP_002888541.1, NZ_KK737549.1, 102286, 102744, +, 459, 502965; cds-WP_002888547.1, NZ_KK737549.1, 102747, 103688, +, 942, 1003916; cds-WP_002888550.1, NZ_KK737549.1, 103685, 104050, +, 366, 378996; cds-WP_032430210.1, NZ_KK737549.1, 104066, 105832, +, 1767, 1169896; cds-WP_004182923.1, NZ_KK737549.1, 105819, 107306, +, 1488, 928773; cds-WP_004177411.1, NZ_KK737549.1, 107303, 108661, +, 1359, 506708; cds-WP_002888562.1, NZ_KK737549.1, 108655, 109737, +, 1083, 460631; cds-WP_004151364.1, NZ_KK737549.1, 109740, 111056, +, 1317, 484869; cds-WP_002888565.1, NZ_KK737549.1, 111056, 112330, +, 1275, 702879; cds-WP_002888566.1, NZ_KK737549.1, 112327, 113397, +, 1071, 233394; cds-WP_004145947.1, NZ_KK737549.1, 113445, 114920, +, 1476, 660188; cds-WP_002888623.1, NZ_KK737549.1, 114913, 115833, +, 921, 398617; cds-WP_002888624.1, NZ_KK737549.1, 115835, 116665, +, 831, 691946; cds-WP_002888625.1, NZ_KK737549.1, 116662, 117924, +, 1263, 1053512; cds-WP_002888628.1, NZ_KK737549.1, 117987, 119138, +, 1152, 2662650; cds-WP_032430211.1, NZ_KK737549.1, 119239, 120156, +, 918, 4078659; cds-WP_004152922.1, NZ_KK737549.1, 120473, 120976, +, 504, 255914; cds-WP_002888638.1, NZ_KK737549.1, 121039, 123744, +, 2706, 2716537; cds-WP_004145942.1, NZ_KK737549.1, 123803, 124195, +, 393, 65160; cds-WP_002888644.1, NZ_KK737549.1, 124248, 124442, -, 195, 70345; cds-WP_004178596.1, NZ_KK737549.1, 124452, 125195, -, 744, 180488; cds-WP_002888649.1, NZ_KK737549.1, 125195, 125815, -, 621, 89111; cds-WP_004145938.1, NZ_KK737549.1, 126159, 127202, +, 1044, 593109; cds-WP_021441203.1, NZ_KK737549.1, 127239, 128444, -, 1206, 11093; cds-WP_004145935.1, NZ_KK737549.1, 128434, 129819, -, 1386, 15587; cds-WP_002888683.1, NZ_KK737549.1, 129830, 130261, -, 432, 61983; cds-WP_002888684.1, NZ_KK737549.1, 130443, 131336, -, 894, 79927; cds-WP_002888692.1, NZ_KK737549.1, 131470, 132033, +, 564, 96632; cds-WP_002888694.1, NZ_KK737549.1, 132030, 132884, +, 855, 131469; cds-WP_021441204.1, NZ_KK737549.1, 133120, 134070, -, 951, 109998; cds-WP_032428537.1, NZ_KK737549.1, 134070, 135476, -, 1407, 151204; cds-WP_004147090.1, NZ_KK737549.1, 135661, 137031, -, 1371, 79821; cds-WP_002888699.1, NZ_KK737549.1, 137675, 138454, +, 780, 180064; cds-WP_032430213.1, NZ_KK737549.1, 138591, 141254, +, 2664, 6767104; cds-WP_021441205.1, NZ_KK737549.1, 141269, 143167, +, 1899, 2284319; cds-WP_002888731.1, NZ_KK737549.1, 143374, 144798, +, 1425, 14502708; cds-WP_004177403.1, NZ_KK737549.1, 144963, 145247, +, 285, 2574; cds-WP_002888733.1, NZ_KK737549.1, 145293, 146099, -, 807, 997; cds-WP_032430214.1, NZ_KK737549.1, 146111, 147721, -, 1611, 33580; cds-WP_002888735.1, NZ_KK737549.1, 148153, 150750, +, 2598, 27379809; cds-WP_002888737.1, NZ_KK737549.1, 150937, 151299, +, 363, 63052; cds-WP_002888739.1, NZ_KK737549.1, 151372, 152166, -, 795, 407131; cds-WP_002888741.1, NZ_KK737549.1, 152191, 153051, -, 861, 385681; cds-WP_072072754.1, NZ_KK737549.1, 153201, 154394, -, 1194, 25097; cds-AF52_RS28060, NZ_KK737549.1, 154404, 154643, -, 240, 9265; cds-WP_002888804.1, NZ_KK737549.1, 155225, 155635, -, 411, 9411; cds-WP_002888808.1, NZ_KK737549.1, 155882, 156229, -, 348, 63767; cds-WP_032430215.1, NZ_KK737549.1, 156375, 157973, +, 1599, 39129; cds-WP_002888816.1, NZ_KK737549.1, 158057, 160447, -, 2391, 549148; cds-WP_012542835.1, NZ_KK737549.1, 160528, 160647, +, 120, 2199; cds-WP_002888819.1, NZ_KK737549.1, 160652, 161188, +, 537, 154074; cds-WP_002888821.1, NZ_KK737549.1, 161248, 161910, -, 663, 280673; cds-WP_002888823.1, NZ_KK737549.1, 162095, 163021, +, 927, 251694; cds-WP_004204389.1, NZ_KK737549.1, 163018, 163788, +, 771, 153501; cds-WP_023282187.1, NZ_KK737549.1, 163911, 164351, +, 441, 40044; cds-WP_004145907.1, NZ_KK737549.1, 164410, 165663, +, 1254, 346272; cds-WP_002888834.1, NZ_KK737549.1, 165699, 166079, -, 381, 244172; cds-WP_002888835.1, NZ_KK737549.1, 166172, 167026, -, 855, 313840; cds-WP_002888841.1, NZ_KK737549.1, 167038, 167829, -, 792, 88013; cds-WP_004145905.1, NZ_KK737549.1, 167950, 168429, -, 480, 149581; cds-WP_071526609.1, NZ_KK737549.1, 168426, 169820, -, 1395, 563060; cds-WP_021441212.1, NZ_KK737549.1, 169883, 170764, -, 882, 796606; cds-WP_002888845.1, NZ_KK737549.1, 170824, 171279, -, 456, 1561582; cds-WP_032430216.1, NZ_KK737549.1, 171442, 172158, -, 717, 209417; cds-WP_004145901.1, NZ_KK737549.1, 172158, 172694, -, 537, 8043; cds-WP_023282188.1, NZ_KK737549.1, 172767, 175196, +, 2430, 68336; cds-WP_021441214.1, NZ_KK737549.1, 175244, 176044, -, 801, 3045; cds-WP_021441215.1, NZ_KK737549.1, 176041, 176787, -, 747, 189; cds-WP_004151943.1, NZ_KK737549.1, 176777, 177262, -, 486, 0; cds-WP_021441216.1, NZ_KK737549.1, 177255, 178448, -, 1194, 0; cds-WP_004183041.1, NZ_KK737549.1, 178435, 179421, -, 987, 72; cds-WP_032428541.1, NZ_KK737549.1, 179418, 180014, -, 597, 20; cds-WP_002889025.1, NZ_KK737549.1, 180011, 180376, -, 366, 0; cds-WP_021441218.1, NZ_KK737549.1, 180379, 180888, -, 510, 29; cds-WP_002889054.1, NZ_KK737549.1, 180888, 181310, -, 423, 16136; cds-WP_004177382.1, NZ_KK737549.1, 181331, 182545, -, 1215,3214; cds-WP_004145888.1, NZ_KK737549.1, 182547, 184040, -, 1494, 1; cds-WP_032430217.1, NZ_KK737549.1, 184037, 186010, -, 1974, 7652; cds-WP_004177377.1, NZ_KK737549.1, 186020, 186862, -, 843, 2050; cds-WP_004219434.1, NZ_KK737549.1, 186847, 186984, -, 138, 380; cds-WP_023286046.1, NZ_KK737549.1, 187169, 190477, +, 3309, 166060; cds-WP_021441221.1, NZ_KK737549.1, 190734, 191291, +, 558, 37241; cds-WP_004194926.1, NZ_KK737549.1, 191330, 191704, -, 375, 52731; cds-WP_004147125.1, NZ_KK737549.1, 191767, 191901, -, 135, 1100; cds-WP_002889208.1, NZ_KK737549.1, 192292, 194844, +, 2553, 1187198; cds-WP_004178624.1, NZ_KK737549.1, 195079, 197286, +, 2208, 461560; cds-WP_002889212.1, NZ_KK737549.1, 197332, 198129, +, 798, 64349; cds-WP_004178627.1, NZ_KK737549.1, 198129, 199019, +, 891, 64099; cds-WP_032430218.1, NZ_KK737549.1, 199016, 200998, +, 1983, 64559; cds-WP_002889272.1, NZ_KK737549.1, 201135, 202415, -, 1281, 175957; cds-WP_004151932.1, NZ_KK737549.1, 202596, 204014, +, 1419, 98124; cds-WP_002889275.1, NZ_KK737549.1, 204096, 204440, +, 345, 113317; cds-WP_002889277.1, NZ_KK737549.1, 204512, 205135, -, 624, 20798; cds-WP_002889279.1, NZ_KK737549.1, 205172, 205972, -, 801, 221441; cds-WP_002889282.1, NZ_KK737549.1, 205965, 206663, -, 699, 322932; cds-WP_004145871.1, NZ_KK737549.1, 206747, 208261, +, 1515, 385447; cds-WP_004177363.1, NZ_KK737549.1, 208396, 209829, +, 1434, 2121361; cds-WP_002889289.1, NZ_KK737549.1, 209996, 211153, +, 1158, 316129; cds-WP_002889292.1, NZ_KK737549.1, 211272, 211658, -, 387, 256641; cds-WP_002889295.1, NZ_KK737549.1, 211766, 212590, -, 825, 520771; cds-WP_004151931.1, NZ_KK737549.1, 212621, 215284, -, 2664, 561080; cds-WP_004177362.1, NZ_KK737549.1, 215342, 216136, -, 795, 1111066; cds-WP_002889299.1, NZ_KK737549.1, 216459, 217184, +, 726, 18849230; cds-WP_004151930.1, NZ_KK737549.1, 217304, 218155, +, 852, 5254594; cds-WP_002889306.1, NZ_KK737549.1, 218305, 219030, +, 726, 2075746; cds-WP_002889308.1, NZ_KK737549.1, 219181, 219738, +, 558, 1751119; cds-WP_004178642.1, NZ_KK737549.1, 219967, 221169, +, 1203, 313381; cds-WP_002889316.1, NZ_KK737549.1, 221407, 222165, +, 759, 1021112; cds-WP_032430220.1, NZ_KK737549.1, 222178, 223035, +, 858, 590514; cds-WP_004177358.1, NZ_KK737549.1, 223047, 224399, +, 1353, 3106135; cds-WP_004145860.1, NZ_KK737549.1, 224431, 226860, +, 2430, 8487188; cds-WP_004178645.1, NZ_KK737549.1, 226982, 227467, +, 486, 1608172; cds-WP_002889327.1, NZ_KK737549.1, 227471, 228496, +, 1026, 2260246; cds-WP_004145858.1, NZ_KK737549.1, 228602, 229057, +, 456, 640910; cds-WP_004178647.1, NZ_KK737549.1, 229061, 229849, +, 789, 1344052; cds-WP_002889374.1, NZ_KK737549.1, 229849, 231000, +, 1152, 249780; cds-WP_021441229.1, NZ_KK737549.1, 230997, 231596, +, 600, 103599; cds-WP_004177353.1, NZ_KK737549.1, 231614, 235096, +, 3483, 655506; cds-WP_004145855.1, NZ_KK737549.1, 235109, 236068, +, 960, 710937; cds-WP_021441230.1, NZ_KK737549.1, 236182, 238335, +, 2154, 285486; cds-WP_021441231.1, NZ_KK737549.1, 238382, 238771, +, 390, 262302; cds-WP_009309280.1, NZ_KK737549.1, 238825, 240138, +, 1314, 123806; cds-WP_002889424.1, NZ_KK737549.1, 240152, 240412, -, 261, 98862; cds-WP_002889429.1, NZ_KK737549.1, 240399, 240599, -, 201, 82280; cds-WP_009309281.1, NZ_KK737549.1, 240796, 241341, +, 546, 30829; cds-WP_002889433.1, NZ_KK737549.1, 241338, 241751, +, 414, 27647; cds-WP_002889435.1, NZ_KK737549.1, 241794, 242492, +, 699, 166067; cds-WP_004212714.1, NZ_KK737549.1, 242624, 243466, -, 843, 194511; cds-WP_004151928.1, NZ_KK737549.1, 243525, 245243, -, 1719, 1924168; cds-WP_032430223.1, NZ_KK737549.1, 245356, 246063, -, 708, 268838; cds-WP_002889443.1, NZ_KK737549.1, 246060, 246467, -, 408, 153146; cds-WP_002889445.1, NZ_KK737549.1, 246575, 247390, -, 816, 332397; cds-WP_002889448.1, NZ_KK737549.1, 247434, 248087, -, 654, 88125; cds-WP_002889450.1, NZ_KK737549.1, 248080, 249111, -, 1032, 174588; cds-WP_002889452.1, NZ_KK737549.1, 249300, 249866, +, 567, 125613; cds-WP_012737430.1, NZ_KK737549.1, 256451, 257254, +, 804, 188396; cds-WP_002889616.1, NZ_KK737549.1, 257300, 258205, -, 906, 1799; cds-WP_021441232.1, NZ_KK737549.1, 258310, 259494, +, 1185, 4959; cds-WP_002889629.1, NZ_KK737549.1, 259597, 260394, +, 798, 152691; cds-WP_021441233.1, NZ_KK737549.1, 260486, 261256, +, 771, 7298; cds-WP_002889632.1, NZ_KK737549.1, 261314, 262681, -, 1368, 421394; cds-WP_032428550.1, NZ_KK737549.1, 262753, 263508, -, 756, 84437; cds-WP_002889685.1, NZ_KK737549.1, 263541, 264263, +, 723, 162501; cds-WP_002889686.1, NZ_KK737549.1, 264260, 264727, -, 468, 31252; cds-WP_023286054.1, NZ_KK737549.1, 264783, 265523, +, 741, 32421; cds-WP_032430225.1, NZ_KK737549.1, 265793, 266674, -, 882, 61735; cds-WP_004178672.1, NZ_KK737549.1, 266778, 267368, +, 591, 4469; cds-WP_002889689.1, NZ_KK737549.1, 267399, 268169, -, 771, 24206; cds-WP_021441237.1, NZ_KK737549.1, 268347, 270791, -, 2445, 1660237; cds-WP_004145825.1, NZ_KK737549.1, 271031, 271612, +, 582, 527877; cds-WP_002889696.1, NZ_KK737549.1, 271687, 272454, +, 768, 373734; cds-WP_002889699.1, NZ_KK737549.1, 272425, 273165, -, 741, 617590; cds-WP_002889702.1, NZ_KK737549.1, 273577, 274920, +, 1344, 491045; cds-WP_002889703.1, NZ_KK737549.1, 274924, 276162, +, 1239, 398615; cds-WP_004177336.1, NZ_KK737549.1, 276155, 276949, +, 795, 217564; cds-WP_002889716.1, NZ_KK737549.1, 276942, 277580, +, 639, 545235; cds-WP_004177335.1, NZ_KK737549.1, 277587, 278183, +, 597, 244642; cds-WP_021441239.1, NZ_KK737549.1, 278196, 279419, +, 1224, 373936; cds-WP_004178678.1, NZ_KK737549.1, 279422, 279637, +, 216, 9928; cds-WP_021441240.1, NZ_KK737549.1, 280018, 280878, -, 861, 23909; cds-WP_002889726.1, NZ_KK737549.1, 281038, 282093, +, 1056, 185369; cds-WP_002889727.1, NZ_KK737549.1, 282096, 282548, +, 453, 3010; cds-WP_004152033.1, NZ_KK737549.1, 282591, 284048, -, 1458, 1250572; cds-WP_002889733.1, NZ_KK737549.1, 284306, 284764, +, 459, 247995; cds-WP_002889742.1, NZ_KK737549.1, 284870, 286114, +, 1245, 309863; cds-WP_004177332.1, NZ_KK737549.1, 286172, 286570, +, 399, 164036; cds-WP_004177331.1, NZ_KK737549.1, 286656, 287348, -, 693, 60306; cds-WP_032430227.1, NZ_KK737549.1, 287394, 288794, -, 1401, 73836; cds-WP_032430228.1, NZ_KK737549.1, 288944, 290227, -, 1284, 14890; cds-WP_032430229.1, NZ_KK737549.1, 290240, 291688, -, 1449, 69785; cds-WP_002889846.1, NZ_KK737549.1, 291713, 292981, -, 1269, 285818; cds-WP_002889847.1, NZ_KK737549.1, 293009, 293986, -, 978, 7165; cds-WP_032430230.1, NZ_KK737549.1, 294448, 294705, +, 258, 238647; cds-WP_032430232.1, NZ_KK737549.1, 294763, 295512, +, 750, 521946; cds-WP_032421047.1, NZ_KK737549.1, 295784, 296248, +, 465, 340478; cds-WP_009309773.1, NZ_KK737549.1, 296439, 297173, -, 735, 151510; cds-WP_021441244.1, NZ_KK737549.1, 297139, 298473, -, 1335, 38137; cds-WP_032430234.1, NZ_KK737549.1, 298478, 301033, -, 2556, 25580; cds-WP_009309770.1, NZ_KK737549.1, 301017, 301775, -, 759, 977; cds-AF52_RS05525, NZ_KK737549.1, 301835, 302236, -,


402, 41; cds-AF52_RS27385, NZ_KK737549.1, 302271, 302442, +, 172, 7547; cds-AF52_RS27390, NZ_KK737549.1, 303421, 303558, +, 138, 37873; cds-WP_050484291.1, NZ_KK737549.1, 303624, 304661, +, 1038, 159782; cds-WP_004222859.1, NZ_KK737549.1, 304706, 305272, -, 567, 183199; cds-WP_023279253.1, NZ_KK737549.1, 305685, 306554, +, 870, 180; cds-WP_021441254.1, NZ_KK737549.1, 306650, 307315, +, 666, 2842; cds-WP_124053765.1, NZ_KK737549.1, 307782, 307952, -, 171, 12; cds-WP_016531458.1, NZ_KK737549.1, 308463, 309347, -, 885, 1013; cds-WP_002890001.1, NZ_KK737549.1, 309344, 310216, -, 873, 0; cds-WP_002890002.1, NZ_KK737549.1, 310283, 311221, -, 939, 793; cds-WP_004177295.1, NZ_KK737549.1, 311244, 312086, -, 843, 86; cds-WP_013815099.1-59, NZ_KK737549.1, 312505, 313473, -, 969, 84338; cds-WP_013815099.1-60, NZ_KK737549.1, 313954, 314922, +, 969, 91958; cds-AF52_RS27405, NZ_KK737549.1, 314979, 315062, -, 84, 582; cds-WP_004144574.1, NZ_KK737549.1, 315352, 316455, +, 1104, 249622; cds-WP_004147253.1, NZ_KK737549.1, 316466, 317719, +, 1254, 460212; cds-AF52_RS27410, NZ_KK737549.1, 318130, 318266, -, 137, 3789; cds-AF52_RS27415, NZ_KK737549.1, 319963, 320115, -, 153, 5721; cds-AF52_RS05440, NZ_KK737549.1, 320150, 320659, +, 510, 32; cds-WP_032430236.1, NZ_KK737549.1, 320718, 321386, +, 669, 13350; cds-WP_032430238.1, NZ_KK737549.1, 321412, 323937, +, 2526, 0; cds-WP_002890060.1, NZ_KK737549.1, 323927, 325570, +, 1644, 1230; cds-WP_002890061.1, NZ_KK737549.1, 325539, 326249, +, 711, 0; cds-WP_004178714.1, NZ_KK737549.1, 326253, 326942, -, 690, 0; cds-WP_032430239.1, NZ_KK737549.1, 326932, 327684, -, 753, 26; cds-WP_004151355.1, NZ_KK737549.1, 327681, 328499, -, 819, 0; cds-WP_002890106.1, NZ_KK737549.1, 328501, 329310, -, 810, 29; cds-WP_013815099.1-61, NZ_KK737549.1, 329684, 330652, +, 969, 65957; cds-WP_002890108.1, NZ_KK737549.1, 330723, 330893, +, 171, 195; cds-WP_002890126.1, NZ_KK737549.1, 331010, 331705, -, 696, 14454; cds-WP_004151354.1, NZ_KK737549.1, 331698, 332480, -, 783, 814; cds-WP_004144594.1, NZ_KK737549.1, 332467, 333516, -, 1050, 120; cds-WP_025861891.1, NZ_KK737549.1, 333516, 334415, -, 900, 503; cds-WP_004147267.1, NZ_KK737549.1, 334435, 335541, -, 1107, 99; cds-WP_009485305.1, NZ_KK737549.1, 335534, 335677, +, 144, 0; cds-WP_004147268.1, NZ_KK737549.1, 336117, 336893, -, 777, 224; cds-WP_032430241.1, NZ_KK737549.1, 336890, 338278, -, 1389, 3658; cds-WP_032430243.1, NZ_KK737549.1, 338288, 339667, -, 1380, 671; cds-WP_021441263.1, NZ_KK737549.1, 339730, 339858, +, 129, 0; cds-WP_002890161.1, NZ_KK737549.1, 339941, 341350, +, 1410, 86264; cds-WP_032430245.1, NZ_KK737549.1, 341337, 342269, +, 933, 3695; cds-WP_032430246.1, NZ_KK737549.1, 342509, 343471, +, 963, 0; cds-WP_004183141.1, NZ_KK737549.1, 343483, 344250, +, 768, 38; cds-WP_004144603.1, NZ_KK737549.1, 344247, 345074, +, 828, 321; cds-WP_004147277.1, NZ_KK737549.1, 345071, 345922, +, 852, 4618; cds-WP_032430247.1, NZ_KK737549.1, 346096, 347814, -, 1719, 18; cds-WP_002890201.1, NZ_KK737549.1, 348267, 349241, -, 975, 415278; cds-WP_004151350.1, NZ_KK737549.1, 349348, 350508, -, 1161, 326728; cds-WP_004151349.1, NZ_KK737549.1, 350727, 351239, +, 513, 157439; cds-WP_002890204.1, NZ_KK737549.1, 351357, 352577, +, 1221, 249861; cds-WP_004183146.1, NZ_KK737549.1, 352596, 353702, +, 1107, 130413; cds-WP_002890210.1, NZ_KK737549.1, 353699, 354001, -, 303, 53454; cds-WP_002890215.1, NZ_KK737549.1, 354254, 354457, +, 204, 33679; cds-WP_004151348.1, NZ_KK737549.1, 354490, 355587, -, 1098, 188050; cds-WP_004212277.1, NZ_KK737549.1, 355687, 356370, +, 684, 20267; cds-WP_002890219.1, NZ_KK737549.1, 356540, 357739, +, 1200, 0; cds-WP_002890221.1, NZ_KK737549.1, 358039, 358299, +, 261, 53493; cds-WP_004232385.1, NZ_KK737549.1, 358389, 359819, +, 1431, 217240; cds-WP_002890225.1, NZ_KK737549.1, 359911, 360228, +, 318, 6450; cds-WP_004177276.1, NZ_KK737549.1, 360296, 361105, -, 810, 228727; cds-WP_002890230.1, NZ_KK737549.1, 361222, 361680, +, 459, 9212; cds-WP_032430252.1, NZ_KK737549.1, 361677, 362387, -, 711, 601240; cds-WP_002890276.1, NZ_KK737549.1, 362716, 363249, +, 534, 71070; cds-WP_002890278.1, NZ_KK737549.1, 363321, 363512, +, 192, 204882; cds-WP_004144619.1, NZ_KK737549.1, 363763, 364443, +, 681, 29222; cds-WP_002890284.1, NZ_KK737549.1, 364521, 364805, +, 285, 157879; cds-WP_002890285.1, NZ_KK737549.1, 364877, 365788, -, 912, 210016; cds-WP_032430253.1, NZ_KK737549.1, 365880, 366794, +, 915, 83998; cds-WP_032430254.1, NZ_KK737549.1, 366868, 370005, -, 3138, 159653; cds-WP_032430256.1, NZ_KK737549.1, 370002, 371207, -, 1206, 66082; cds-WP_002890343.1, NZ_KK737549.1, 371390, 372079, +, 690, 287455; cds-WP_002890344.1, NZ_KK737549.1, 372101, 373396, +, 1296, 283053; cds-WP_032430258.1, NZ_KK737549.1, 373810, 375129, +, 1320, 142392; cds-WP_002890348.1, NZ_KK737549.1, 375216, 376589, +, 1374, 111308; cds-WP_032430260.1, NZ_KK737549.1, 376741, 378558, +, 1818, 24568; cds-WP_002890353.1, NZ_KK737549.1, 378555, 379457, -, 903, 1946; cds-WP_002890357.1, NZ_KK737549.1, 379724, 380365, +, 642, 2; cds-WP_002890365.1, NZ_KK737549.1, 380552, 381097, +, 546, 0; cds-WP_023286084.1, NZ_KK737549.1, 381122, 382990, +, 1869, 1257; cds-WP_004218830.1, NZ_KK737549.1, 383049, 383903, -, 855, 14; cds-WP_032430262.1, NZ_KK737549.1, 383939, 384883, -, 945, 985; cds-WP_013815099.1-62, NZ_KK737549.1, 384903, 385871, +, 969, 75759; cds-AF52_RS05135, NZ_KK737549.1, 386033, 387202, -, 1170, 22580; cds-WP_013815099.1-63, NZ_KK737549.1, 387236, 388204, +, 969, 77881; cds-AF52_RS28095, NZ_KK737549.1, 388263, 388406, +, 144, 235; cds-WP_019704181.1, NZ_KK737549.1, 388474, 388707, +, 234, 0; cds-WP_032430264.1, NZ_KK737549.1, 388707, 388934, +, 228, 34; cds-AF52_RS05115, NZ_KK737549.1, 388931, 389551, +, 621, 4024; cds-WP_013815099.1-64, NZ_KK737549.1, 389609, 390577, -, 969, 79007; cds-WP_021441029.1, NZ_KK737549.1, 390933, 392513, +, 1581, 3563; cds-WP_004151744.1, NZ_KK737549.1, 392638, 393162, -, 525, 350301; cds-WP_004146620.1, NZ_KK737549.1, 393414, 396239, +, 2826, 4592608; cds-WP_002884953.1, NZ_KK737549.1, 396240, 396596, -, 357, 58371; cds-WP_002884951.1, NZ_KK737549.1, 396600, 397016, -, 417, 20168; cds-WP_004151745.1, NZ_KK737549.1, 397147, 397860, -, 714, 69562; cds-WP_009485000.1, NZ_KK737549.1, 398051, 399244, -, 1194, 161312; cds-WP_004214117.1, NZ_KK737549.1, 399421, 400500, -, 1080, 62826; cds-WP_002884942.1, NZ_KK737549.1, 400532, 401947, -, 1416, 260885; cds-WP_032428470.1, NZ_KK737549.1, 402117, 403100, +, 984, 131099; cds-WP_009484997.1, NZ_KK737549.1, 403282, 403524, -, 243, 724; cds-WP_004214118.1, NZ_KK737549.1, 403664, 404662, -, 999, 8686; cds-WP_002884935.1, NZ_KK737549.1, 404763, 405251, -, 489, 21365; cds-WP_002884931.1, NZ_KK737549.1, 405501, 406016, +, 516, 101789; cds-WP_004151747.1, NZ_KK737549.1, 406112, 406321, -, 210, 158785; cds-WP_004219133.1, NZ_KK737549.1, 406387, 406536, +, 150, 36669; cds-WP_004151748.1, NZ_KK737549.1, 406556, 407872, -, 1317, 430631; cds-WP_002884822.1, NZ_KK737549.1, 407942, 408550, -, 609, 1550542; cds-WP_002884819.1, NZ_KK737549.1, 408673, 409041, -, 369, 56028; cds-WP_004178269.1, NZ_KK737549.1, 409170, 411593, +, 2424, 1290721; cds-WP_002884808.1, NZ_KK737549.1, 411642, 412508, -, 867, 151315; cds-WP_002884807.1, NZ_KK737549.1, 412521, 413018, -, 498, 295385; cds-WP_032428466.1, NZ_KK737549.1, 413206, 414129, -, 924, 1918850; cds-WP_002884747.1, NZ_KK737549.1, 414244, 415533, -, 1290, 10417857; cds-WP_002884743.1, NZ_KK737549.1, 415617, 416726, -, 1110, 2808619; cds-WP_002884740.1, NZ_KK737549.1, 417097, 418287, +, 1191, 6495824; cds-WP_002884726.1, NZ_KK737549.1, 418405, 419949, +, 1545, 4927055; cds-WP_002884725.1, NZ_KK737549.1, 419964, 420854, +, 891, 684378; cds-WP_002884721.1, NZ_KK737549.1, 421046, 421456, -, 411, 12674; cds-WP_013815099.1-65, NZ_KK737549.1, 421813, 422781, -, 969, 90331; cds-WP_021441021.1, NZ_KK737549.1, 422896, 424173, +, 1278, 81857; cds-AF52_RS04955, NZ_KK737549.1, 424257, 424484, +, 228, 3965; cds-WP_013815099.1-66, NZ_KK737549.1, 424540, 425508, -, 969, 88884; cds-AF52_RS04945, NZ_KK737549.1, 425541, 425747, -, 207, 33; cds-WP_004177855.1, NZ_KK737549.1, 425768, 426088, -, 321, 0; cds-AF52_RS04935, NZ_KK737549.1, 426081, 426602, -, 522, 23; cds-WP_013815099.1-67, NZ_KK737549.1, 426636, 427604, +, 969, 96999; cds-AF52_RS0124460, NZ_KK737549.1, 427655, 427843, +, 189, 4185; cds-WP_004177856.1, NZ_KK737549.1, 427951, 428460, +, 510, 5728; cds-WP_019725463.1, NZ_KK737549.1, 428469, 428924, +, 456, 83521; cds-WP_002884631.1, NZ_KK737549.1, 428974, 430623, -, 1650, 2615975; cds-WP_004146591.1, NZ_KK737549.1, 431388, 432737, +, 1350, 203566; cds-WP_002884627.1, NZ_KK737549.1, 432876, 433805, +, 930, 4745; cds-WP_002884625.1, NZ_KK737549.1, 433922, 434194, +, 273, 41613; cds-WP_002884619.1, NZ_KK737549.1, 434191, 435066, -, 876, 604599; cds-WP_002884616.1, NZ_KK737549.1, 435416, 436363, +, 948, 9845; cds-WP_032430268.1, NZ_KK737549.1, 436434, 437237, +, 804, 35037; cds-WP_021441018.1, NZ_KK737549.1, 437247, 437654, +, 408, 4; cds-WP_032430269.1, NZ_KK737549.1, 437654, 438148, +, 495, 11843; cds-WP_002884608.1, NZ_KK737549.1, 438214, 439014, +, 801, 6; cds-WP_032428464.1, NZ_KK737549.1, 439026, 439850, +, 825, 11; cds-WP_021441016.1, NZ_KK737549.1, 439923, 441155, +, 1233, 4308; cds-WP_002884583.1, NZ_KK737549.1, 441148, 441957, +, 810, 60475; cds-WP_004177864.1, NZ_KK737549.1, 442045, 443676, -, 1632, 43931; cds-WP_015959249.1, NZ_KK737549.1, 443806, 447489, -, 3684, 819846; cds-WP_002884578.1, NZ_KK737549.1, 447684, 448514, +, 831, 298650; cds-WP_002884575.1, NZ_KK737549.1, 448564, 450348, -, 1785, 17140; cds-WP_004192658.1, NZ_KK737549.1, 450451, 451755, -, 1305, 50659; cds-WP_002884559.1, NZ_KK737549.1, 451835, 453436, -, 1602, 159445; cds-WP_004146576.1, NZ_KK737549.1, 453697, 454626, -, 930, 27365; cds-WP_004178258.1, NZ_KK737549.1, 454783, 455244, +, 462, 97808; cds-WP_032425377.1, NZ_KK737549.1, 462509, 464098, +, 1590, 915070; cds-WP_002884357.1, NZ_KK737549.1, 464114, 465409, +, 1296, 115760; cds-WP_032430271.1, NZ_KK737549.1, 465399, 466730, -, 1332, 20469; cds-WP_021441012.1, NZ_KK737549.1, 466717, 468111, -, 1395, 11111; cds-WP_002884346.1, NZ_KK737549.1, 468371, 468808, +, 438, 10948; cds-WP_002884344.1, NZ_KK737549.1, 468812, 469507, -, 696, 845667; cds-WP_002884342.1, NZ_KK737549.1, 469520, 469792, -, 273, 2549261; cds-WP_002884331.1, NZ_KK737549.1, 469979, 470569, -, 591, 451451; cds-WP_009485014.1, NZ_KK737549.1, 470612, 471283, -, 672, 192952; cds-WP_004178235.1, NZ_KK737549.1, 471296, 472360, -, 1065, 717037; cds-WP_002884327.1, NZ_KK737549.1, 472401, 473174, -, 774, 231025; cds-WP_002884324.1, NZ_KK737549.1, 473268, 473765, +, 498, 296492; cds-WP_004178230.1, NZ_KK737549.1, 474028, 475923, +, 1896, 519887; cds-WP_004152310.1, NZ_KK737549.1, 475923, 476558, +, 636, 162216; cds-WP_004177871.1, NZ_KK737549.1, 476551, 477306, +, 756, 42874; cds-WP_002884183.1, NZ_KK737549.1, 477290, 477490, +, 201, 648; cds-WP_004146302.1, NZ_KK737549.1, 477492, 478262, +, 771, 8910; cds-WP_004212852.1, NZ_KK737549.1, 478259, 479392, +, 1134, 165772; cds-WP_004178221.1, NZ_KK737549.1, 479709, 481241, +, 1533, 202961; cds-WP_002884150.1, NZ_KK737549.1, 481414, 481719, +, 306, 111267; cds-WP_004212847.1, NZ_KK737549.1, 481723, 482040, +, 318, 291667; cds-WP_004192681.1, NZ_KK737549.1, 482083, 483423, -, 1341, 65313; cds-WP_002884146.1, NZ_KK737549.1, 483824, 488047, -, 4224, 30752610; cds-WP_004901914.1, NZ_KK737549.1, 488124, 492152, -, 4029, 36371778; cds-WP_002884142.1, NZ_KK737549.1, 492477, 492842, -, 366, 15023714; cds-WP_001207203.1, NZ_KK737549.1, 492909, 493406, -, 498, 28604293; cds-WP_002884036.1, NZ_KK737549.1, 493820, 494524, -, 705, 20771520; cds-WP_002884034.1, NZ_KK737549.1, 494528, 494956, -, 429, 11326001; cds-WP_001287521.1, NZ_KK737549.1, 495113, 495658, -, 546, 548182; cds-WP_002883772.1, NZ_KK737549.1, 495660, 496043, -, 384, 646760; cds-WP_004174069.1-2, NZ_KK737549.1, 496380, 497564, -, 1185, 58638224; cds-WP_002883524.1, NZ_KK737549.1, 498550, 499500, +, 951, 539956; cds-WP_002883521.1, NZ_KK737549.1, 499526, 500488, -, 963, 252625; cds-WP_032430275.1, NZ_KK737549.1, 500485, 501513, -, 1029, 280045; cds-WP_002883453.1, NZ_KK737549.1, 509001, 509534, -, 534, 211155; cds-WP_002883450.1, NZ_KK737549.1, 509546, 510997, -, 1452, 455332; cds-WP_002883449.1, NZ_KK737549.1, 511036, 511650, -, 615, 528237; cds-WP_032430276.1, NZ_KK737549.1, 511650, 512981, -, 1332, 1829920; cds-


WP_032430277.1, NZ_KK737549.1, 513173, 515362, +, 2190, 4512192; cds-WP _004150456.1, NZ_KK737549.1, 515372, 516535, +, 1164, 1563949; cds-WP _002883448.1, NZ_KK737549.1, 516642, 517343, -, 702, 930364; cds-WP_004146456.1, NZ_KK737549.1, 517393, 518868, -, 1476, 2001970; cds-WP_002883430.1, NZ_KK737549.1, 519047, 519535, +, 489, 171563; cds-WP _004146458.1, NZ_KK737549.1, 519532, 520335, -, 804, 90926; cds-WP_002883427.1, NZ_KK737549.1, 520368, 521147, -, 780, 307953; cds-WP_002883426.1, NZ_KK737549.1, 521150, 521686, -, 537, 495898; cds-WP _002883425.1, NZ_KK737549.1, 521690, 521941, -, 252, 353414; cds-WP _004177924.1, NZ_KK737549.1, 522071, 523711, -, 1641, 911888; cds-WP _021441002.1, NZ_KK737549.1, 523708, 524313, -, 606, 266043; cds-WP_002883421.1, NZ_KK737549.1, 524327, 525082, -, 756, 590827; cds-WP _021441001.1, NZ_KK737549.1, 525153, 526601, -, 1449, 572531; cds-WP _004181652.1, NZ_KK737549.1, 526737, 527498, -, 762, 298899; cds-WP_002883417.1, NZ_KK737549.1, 527771, 528583, +, 813, 713032; cds-WP_021441000.1, NZ_KK737549.1, 528642, 530906, -, 2265, 12977; cds-WP _002883415.1, NZ_KK737549.1, 531154, 532107, +, 954, 39218; cds-WP _021440999.1, NZ_KK737549.1, 531995, 532894, -, 900, 161624; cds-WP _004146466.1, NZ_KK737549.1, 532983, 533783, -, 801, 695800; cds-WP _002883412.1, NZ_KK737549.1, 533828, 534820, -, 993, 563485; cds-WP_002883411.1, NZ_KK737549.1, 534930, 535550, +, 621, 189238; cds-WP_021440998.1, NZ_KK737549.1, 535713, 536633, +, 921, 69865; cds-WP _021440997.1, NZ_KK737549.1, 536679, 537299, -, 621, 168082; cds-WP _032430279.1, NZ_KK737549.1, 537361, 539187, -, 1827, 710872; cds-WP _002883408.1, NZ_KK737549.1, 539255, 540115, -, 861, 225749; cds-WP_002883404.1, NZ_KK737549.1, 540268, 540732, +, 465, 141018; cds-WP _002883402.1, NZ_KK737549.1, 540781, 541674, +, 894, 570077; cds-WP_002883400.1, NZ_KK737549.1, 541718, 542668, -, 951, 710333; cds-WP_002883398.1, NZ_KK737549.1, 543024, 545186, -, 2163, 558453; cds-WP _032430280.1, NZ_KK737549.1, 545250, 545966, -, 717, 54548; cds-WP _002883396.1, NZ_KK737549.1, 545966, 546868, -, 903, 442366; cds-WP_002883395.1, NZ_KK737549.1, 546865, 547572, -, 708, 105401; cds-WP _002883394.1, NZ_KK737549.1, 547569, 548393, -, 825, 86176; cds-WP _002883392.1, NZ_KK737549.1, 548429, 548632, -, 204, 14747; cds-WP _002883389.1, NZ_KK737549.1, 548779, 549099, +, 321, 70300; cds-WP_002883383.1, NZ_KK737549.1, 549233, 551785, -, 2553, 2026914; cds-WP _021440994.1, NZ_KK737549.1, 552143, 553084, +, 942, 72238; cds-WP _012737128.1, NZ_KK737549.1, 553081, 553821, +, 741, 455096; cds-WP _004150429.1, NZ_KK737549.1, 553843, 555024, +, 1182, 693573; cds-WP _004150428.1, NZ_KK737549.1, 555028, 556224, +, 1197, 308187; cds-WP_002883322.1, NZ_KK737549.1, 557224, 558609, -, 1386, 348110; cds-WP_004186366.1, NZ_KK737549.1, 558815, 559555, -, 741, 93331; cds-WP_032428460.1, NZ_KK737549.1, 559567, 560913, -, 1347, 44692; cds-WP_021440992.1, NZ_KK737549.1, 560910, 561986, -, 1077, 286733; cds-WP _002883312.1, NZ_KK737549.1, 561983, 563233, -, 1251, 251740; cds-WP_002883310.1, NZ_KK737549.1, 563235, 564365, -, 1131, 327100; cds-WP_004146507.1, NZ_KK737549.1, 564371, 565045, -, 675, 48960; cds-WP _002883307.1, NZ_KK737549.1, 565023, 565904, -, 882, 533483; cds-WP_002883303.1, NZ_KK737549.1, 565923, 566990, -, 1068, 1031305; cds-WP_021440991.1, NZ_KK737549.1, 566987, 568249, -, 1263, 1056318; cds-WP _002883297.1, NZ_KK737549.1, 568246, 569376, -, 1131, 373621; cds-WP _002883296.1, NZ_KK737549.1, 569433, 570479, -, 1047, 437172; cds-WP_002883295.1, NZ_KK737549.1, 570493, 571596, -, 1104, 576306; cds-WP_002883293.1, NZ_KK737549.1, 571837, 573096, -, 1260, 5057217; cds-WP_002883224.1, NZ_KK737549.1, 573427, 573756, -, 330, 1525146; cds-WP _002883222.1, NZ_KK737549.1, 574098, 575363, +, 1266, 2529857; cds-WP_072271788.1, NZ_KK737549.1, 575482, 576990, +, 1509, 510820; cds-WP _002883211.1, NZ_KK737549.1, 577010, 577936, +, 927, 94282; cds-WP _004181642.1, NZ_KK737549.1, 578067, 579065, +, 999, 273; cds-WP_002883185.1, NZ_KK737549.1, 579128, 579850, +, 723, 26302; cds-WP_032430283.1, NZ_KK737549.1, 579855, 581876, -, 2022, 221289; cds-WP_002883181.1, NZ_KK737549.1, 581989, 582270, +, 282, 10375; cds-WP_002883180.1, NZ_KK737549.1, 582322, 582603, +, 282, 58670; cds-WP_002883178.1, NZ_KK737549.1, 582807, 584282, -, 1476, 648621; cds-WP_002883176.1, NZ_KK737549.1, 584435, 585325, +, 891, 230771; cds-WP _002883174.1, NZ_KK737549.1, 585322, 586866, -, 1545, 24473; cds-WP _002883173.1, NZ_KK737549.1, 586869, 588719, -, 1851, 398149; cds-WP_032430284.1, NZ_KK737549.1, 588780, 589709, -, 930, 317689; cds-WP _002883170.1, NZ_KK737549.1, 589726, 589983, -, 258, 56658; cds-WP _012737117.1, NZ_KK737549.1, 589980, 591626, -, 1647, 150715; cds-WP_001311244.1, NZ_KK737549.1, 591767, 591865, -, 99, 4155; cds-WP _032430285.1, NZ_KK737549.1, 592220, 593740, +, 1521, 3436; cds-WP _004146520.1, NZ_KK737549.1, 593766, 594104, -, 339, 78707; cds-WP_004177958.1, NZ_KK737549.1, 594223, 595044, +, 822, 141113; cds-WP _032430287.1, NZ_KK737549.1, 603456, 604307, -, 852, 200506; cds-WP_004146288.1, NZ_KK737549.1, 604252, 606090, -, 1839, 846330; cds-WP _002883023.1, NZ_KK737549.1, 606457, 607557, +, 1101, 371532; cds-WP _002883021.1, NZ_KK737549.1, 607609, 607968, -, 360, 274916; cds-WP_004151856.1, NZ_KK737549.1, 607984, 608619, -, 636, 199526; cds-WP _002883016.1, NZ_KK737549.1, 608816, 610216, +, 1401, 3711467; cds-WP _002883015.1, NZ_KK737549.1, 610199, 611116, -, 918, 2648382; cds-WP _032430289.1, NZ_KK737549.1, 611375, 612748, -, 1374, 224302; cds-WP_004187843.1, NZ_KK737549.1, 612848, 613624, -, 777, 83418; cds-WP_004181637.1, NZ_KK737549.1, 613631, 614635, -, 1005, 80038; cds-WP _019705783.1, NZ_KK737549.1, 614749, 615900, +, 1152, 228800; cds-WP_004181636.1, NZ_KK737549.1, 616159, 618810, +, 2652, 912258; cds-WP _021440981.1, NZ_KK737549.1, 618854, 619504, -, 651, 91438; cds-WP _004220885.1, NZ_KK737549.1, 619529, 620515, +, 987, 29054; cds-WP _004177977.1, NZ_KK737549.1, 620721, 621383, +, 663, 16960; cds-WP_004146274.1, NZ_KK737549.1, 621438, 622541, +, 1104, 80137; cds-WP_004177983.1, NZ_KK737549.1, 622605, 623486, -, 882, 60472; cds-WP _021440979.1, NZ_KK737549.1, 623630, 624517, -, 888, 22672; cds-WP_021440978.1, NZ_KK737549.1, 624746, 625654, -, 909, 26842; cds-WP_021440977.1, NZ_KK737549.1, 625746, 626117, +, 372, 123; cds-WP _032428457.1, NZ_KK737549.1, 626155, 627711, -, 1557, 3169; cds-WP _013815099.1-68, NZ_KK737549.1, 627780, 628748, +, 969, 81501; cds-WP_004181629.1, NZ_KK737549.1, 628916, 630052, +, 1137, 42485; cds-WP _032430291.1, NZ_KK737549.1, 630027, 632459, -, 2433, 638865; cds-WP _004150388.1, NZ_KK737549.1, 632462, 633622, -, 1161, 182326; cds-WP _002882924.1, NZ_KK737549.1, 633890, 634207, +, 318, 85006; cds-WP_002882922.1, NZ_KK737549.1, 634309, 634521, -, 213, 471155; cds-WP_025710954.1, NZ_KK737549.1, 634774, 636969, +, 2196, 118525; cds-WP_002882921.1, NZ_KK737549.1, 637120, 638148, +, 1029, 433177; cds-WP_071600598.1, NZ_KK737549.1, 638242, 639210, +, 969, 764115; cds-WP _002882918.1, NZ_KK737549.1, 639302, 639832, +, 531, 715217; cds-WP _002882917.1, NZ_KK737549.1, 639842, 641176, +, 1335, 2039351; cds-WP _032430292.1, NZ_KK737549.1, 641246, 642166, +, 921, 278754; cds-WP _032430293.1, NZ_KK737549.1, 642259, 642744, +, 486, 113047; cds-WP _002882911.1, NZ_KK737549.1, 642806, 643768, -, 963, 1271029; cds-WP _002882907.1, NZ_KK737549.1, 643965, 644867, -, 903, 175006; cds-WP_002882903.1, NZ_KK737549.1, 645026, 645529, -, 504, 1407550; cds-WP_002882901.1, NZ_KK737549.1, 645679, 646377, +, 699, 608246; cds-WP _032430294.1, NZ_KK737549.1, 646374, 647747, +, 1374, 1189502; cds-WP_002882896.1, NZ_KK737549.1, 647829, 648503, -, 675, 61863; cds-WP_002882894.1, NZ_KK737549.1, 648576, 649196, -, 621, 5892802; cds-WP_032430295.1, NZ_KK737549.1, 649486, 650520, +, 1035, 9174; cds-WP _002882891.1, NZ_KK737549.1, 650553, 651398, -, 846, 22093; cds-WP_002882888.1, NZ_KK737549.1, 651472, 652308, -, 837, 11060; cds-WP_002882885.1, NZ_KK737549.1, 652619, 654085, +, 1467, 7; cds-WP _004150375.1, NZ_KK737549.1, 654082, 655341, +, 1260, 2; cds-WP_004187188.1, NZ_KK737549.1, 655491, 656321, +, 831, 513; cds-WP _002882880.1, NZ_KK737549.1, 656403, 657389, +, 987, 49; cds-WP_021440966.1, NZ_KK737549.1, 657535, 659046, +, 1512, 28249; cds-WP _004181621.1, NZ_KK737549.1, 659043, 660050, +, 1008, 1265; cds-WP _032430296.1, NZ_KK737549.1, 660047, 661051, +, 1005, 17336; cds-WP_002882871.1, NZ_KK737549.1, 661141, 662289, +, 1149, 1809; cds-WP _021440964.1, NZ_KK737549.1, 662286, 662600, +, 315, 13; cds-WP _004210464.1, NZ_KK737549.1, 662638, 663903, -, 1266, 208509; cds-WP_004178018.1, NZ_KK737549.1, 663945, 666068, -, 2124, 293082; cds-WP_021440963.1, NZ_KK737549.1, 666184, 667179, -, 996, 87687; cds-WP_002882865.1, NZ_KK737549.1, 667267, 667815, -, 549, 21471; cds-WP_032430297.1, NZ_KK737549.1, 667915, 668571, +, 657, 92; cds-WP _004146241.1, NZ_KK737549.1, 668571, 668894, +, 324, 0; cds-WP _002882830.1, NZ_KK737549.1, 668935, 669147, -, 213, 8300; cds-WP_032430298.1, NZ_KK737549.1, 669276, 670112, -, 837, 3246; cds-WP _085921749.1, NZ_KK737549.1, 670269, 673319, +, 3051, 8926725; cds-WP _002882822.1, NZ_KK737549.1, 673332, 674234, +, 903, 1006616; cds-WP_032430299.1, NZ_KK737549.1, 674231, 674866, +, 636, 1079641; cds-WP _004150358.1, NZ_KK737549.1, 674863, 675792, +, 930, 1006235; cds-WP_019705794.1, NZ_KK737549.1, 675966, 676349, -, 384, 70760; cds-WP _004150355.1, NZ_KK737549.1, 676349, 676591, -, 243, 17458; cds-WP_032430300.1, NZ_KK737549.1, 676796, 677713, +, 918, 246510; cds-WP_004178031.1, NZ_KK737549.1, 677728, 678669, -, 942, 390213; cds-WP _002882809.1, NZ_KK737549.1, 678714, 679151, -, 438, 13848; cds-WP_004146232.1, NZ_KK737549.1, 679148, 680008, -, 861, 174210; cds-WP_004151865.1, NZ_KK737549.1, 680002, 680601, -, 600, 385240; cds-WP _002882755.1, NZ_KK737549.1, 680737, 682560, -, 1824, 5152853; cds-WP_002882753.1, NZ_KK737549.1, 682939, 684348, +, 1410, 2047855; cds-WP_004146229.1, NZ_KK737549.1, 684537, 685586, +, 1050, 115909; cds-WP _002882749.1, NZ_KK737549.1, 685595, 687004, +, 1410, 300230; cds-WP _004152951.1, NZ_KK737549.1, 687115, 687225, +, 111, 3242; cds-WP _002882745.1, NZ_KK737549.1, 687261, 688634, -, 1374, 407027; cds-WP_002882743.1, NZ_KK737549.1, 688823, 689329, -, 507, 275564; cds-WP_002882734.1, NZ_KK737549.1, 689913, 690545, +, 633, 458917; cds-WP_002882729.1, NZ_KK737549.1, 690893, 693685, -, 2793, 751903; cds-WP_004150336.1, NZ_KK737549.1, 694082, 694981, +, 900, 497301; cds-WP_004146224.1, NZ_KK737549.1, 695030, 695653, -, 624, 615897; cds-WP _004187940.1, NZ_KK737549.1, 695681, 696667, -, 987, 424123; cds-WP_002882612.1, NZ_KK737549.1, 696743, 697012, -, 270, 47847; cds-WP_004178039.1, NZ_KK737549.1, 697084, 697665, +, 582, 36386; cds-WP _002882596.1, NZ_KK737549.1, 697662, 698168, +, 507, 34487; cds-WP_004150973.1, NZ_KK737550.1, 3504, 6077, -, 2574, 2371793; cds-WP_021440571.1, NZ_KK737550.1, 6207, 6938, -, 732, 128402; cds-WP_032428369.1, NZ_KK737550.1, 6935, 7915, -, 981, 442514; cds-WP _004145664.1, NZ_KK737550.1, 8047, 8784, +, 738, 1065870; cds-WP_002914111.1, NZ_KK737550.1, 9055, 9390, +, 336, 608517; cds-WP_100250063.1, NZ_KK737550.1, 9497, 9544, +, 48, 44554; cds-WP_021440574.1, NZ_KK737550.1, 9645, 10805, +, 1161, 376799; cds-WP_021440575.1, NZ_KK737550.1, 10802, 11674, -, 873, 411730; cds-WP_014907099.1, NZ_KK737550.1, 11737, 12858, -, 1122, 114212; cds-WP_002914114.1, NZ_KK737550.1, 12868, 13938, -, 1071, 61242; cds-WP_004174804.1, NZ_KK737550.1, 14281, 14790, +, 510, 69769; cds-WP_002914116.1, NZ_KK737550.1, 14783, 16006, +, 1224, 88010; cds-WP_004145671.1, NZ_KK737550.1, 16020, 16502, +, 483, 118173; cds-WP_023285466.1, NZ_KK737550.1, 16511,17881, -, 1371, 157907; cds-WP _002914119.1, NZ_KK737550.1, 17938, 18396, -, 459, 304091; cds-WP _002914145.1, NZ_KK737550.1, 18516, 18863, -, 348, 8306018; cds-WP_002914147.1, NZ_KK737550.1, 18903, 19670, -, 768, 22476640; cds-WP _004150977.1, NZ_KK737550.1, 19702, 20250, -, 549, 14306309; cds-WP _002914149.1, NZ_KK737550.1, 20269, 20517, -, 249, 3348707; cds-WP _002914152.1, NZ_KK737550.1, 20777, 22141, -, 1365, 1032048; cds-WP_002914153.1, NZ_KK737550.1, 22305, 23096, +, 792, 144580; cds-WP_004149392.1, NZ_KK737550.1, 23116, 24402, +, 1287, 198871; cds-WP_004174800.1, NZ_KK737550.1, 24523, 25113, -, 591, 536112; cds-


WP_002914158.1, NZ_KK737550.1, 25238, 26116, +, 879, 175738; cds-WP_004174799.1, NZ_KK737550.1, 26203, 27864, +, 1662, 1814393; cds-WP _002914160.1, NZ_KK737550.1, 28012, 28353, +, 342, 733724; cds-WP _004145682.1, NZ_KK737550.1, 28420, 28710, -, 291, 20632; cds-WP _015875096.1, NZ_KK737550.1, 28700, 29176, -, 477, 62593; cds-WP _002914164.1, NZ_KK737550.1, 29287, 29769, +, 483, 982168; cds-WP _032430315.1, NZ_KK737550.1, 30546, 30794, +, 249, 67946; cds-WP _032430316.1, NZ_KK737550.1, 31673, 32251, -, 579, 269; cds-WP _032430369.1, NZ_KK737550.1, 32977, 34431, +, 1455, 4447; cds-WP _032430317.1, NZ_KK737550.1, 34432, 35181, +, 750, 1134; cds-WP _032430318.1, NZ_KK737550.1, 35321, 36064, -, 744, 612; cds-WP_032430320.1, NZ_KK737550.1, 36079, 37839, -, 1761, 142315; cds-AF52_RS03525, NZ_KK737550.1, 37916, 38458, -, 543, 2; cds-WP_013815099.1-69, NZ_KK737550.1, 38493, 39461, +, 969, 86319; cds-AF52_RS0124535, NZ_KK737550.1, 39512, 39685, +, 174, 15827; cds-WP _002914289.1, NZ_KK737550.1, 39771, 40220, -, 450, 107121; cds-WP_004217497.1, NZ_KK737550.1, 40931, 41350, +, 420, 23961; cds-WP _002914284.1, NZ_KK737550.1, 41423, 41602, -, 180, 49982; cds-AF52_RS03500, NZ_KK737550.1, 41808, 42377, +, 570, 245730; cds-WP_013815099.1-70, NZ_KK737550.1, 42433, 43401, -, 969, 119004; cds-AF52_RS03490, NZ_KK737550.1, 43435, 43776, +, 342, 46914; cds-WP _021440595.1, NZ_KK737550.1, 43757, 44302, -, 546, 91293; cds-WP _002914277.1, NZ_KK737550.1, 44310, 44609, -, 300, 41145; cds-WP _004212889.1, NZ_KK737550.1, 44685, 45290, -, 606, 382; cds-WP_021440594.1, NZ_KK737550.1, 45394, 46302, +, 909, 19156; cds-WP _021440593.1, NZ_KK737550.1, 46385, 48172, -, 1788, 262035; cds-WP _004174747.1, NZ_KK737550.1, 48436, 49956, +, 1521, 385083; cds-WP _013815099.1-71, NZ_KK737550.1, 50334, 51302, +, 969, 103547; cds-WP _032430322.1, NZ_KK737550.1, 51339, 51674, +, 336, 12471; cds-WP _021440597.1, NZ_KK737550.1, 51818, 53170, -, 1353, 31291; cds-WP _004151037.1, NZ_KK737550.1, 53259, 53690, +, 432, 92787; cds-WP_002914320.1, NZ_KK737550.1, 53874, 54119, +, 246, 8683; cds-WP _002914321.1, NZ_KK737550.1, 54116, 54526, +, 411, 14323; cds-WP_032428382.1, NZ_KK737550.1, 54499, 56640, +, 2142, 30271; cds-WP _021440599.1, NZ_KK737550.1, 56651, 57613, +, 963, 23715; cds-WP _002914328.1, NZ_KK737550.1, 57970, 59172, +, 1203, 2954; cds-WP_021312381.1, NZ_KK737550.1, 59165, 60232, +, 1068, 280; cds-WP _002914330.1, NZ_KK737550.1, 60311, 61309, +, 999, 94330; cds-WP_002914333.1, NZ_KK737550.1, 61487, 62233, +, 747, 28085; cds-WP _021440601.1, NZ_KK737550.1, 62223, 62558, +, 336, 4422; cds-WP_002914337.1, NZ_KK737550.1, 62649, 63179, +, 531, 316895; cds-WP_002914339.1, NZ_KK737550.1, 63305, 64477, +, 1173, 172156; cds-WP _002914342.1, NZ_KK737550.1, 64493, 66031, +, 1539, 401536; cds-WP _004185353.1, NZ_KK737550.1, 66168, 67844, +, 1677, 14585; cds-WP_004149452.1, NZ_KK737550.1, 67823, 68590, -, 768, 61950; cds-WP _002914351.1, NZ_KK737550.1, 68643, 69158, -, 516, 629506; cds-WP _002914353.1, NZ_KK737550.1, 69315, 70871, -, 1557, 1108268; cds-WP _002914355.1, NZ_KK737550.1, 70938, 71366, -, 429, 140128; cds-WP _004174701.1, NZ_KK737550.1, 71363, 71929, -, 567, 219589; cds-WP _002914359.1, NZ_KK737550.1, 72055, 72369, -, 315, 230879; cds-WP _000906486.1, NZ_KK737550.1, 73958, 74143, -, 186, 498425; cds-WP _004174700.1, NZ_KK737550.1, 74507, 77134, -, 2628, 4557005; cds-WP _004213244.1, NZ_KK737550.1, 77385, 77885, -, 501, 84805; cds-WP _002914769.1, NZ_KK737550.1, 77953, 79011, -, 1059, 4693558; cds-WP _002914771.1, NZ_KK737550.1, 79102, 79599, -, 498, 76488; cds-WP_032428383.1, NZ_KK737550.1, 79739, 80617, -, 879, 1372; cds-WP _004149458.1, NZ_KK737550.1, 80625, 81488, -, 864, 2; cds-AF52_RS0124565, NZ_KK737550.1, 81485, 82195, -, 711, 0; cds-WP _004174694.1, NZ_KK737550.1, 82534, 83613, -, 1080, 169202; cds-WP_002914812.1, NZ_KK737550.1, 83890, 84453, +, 564, 37108; cds-WP _021440607.1, NZ_KK737550.1, 84450, 85430, +, 981, 152838; cds-WP _004174693.1, NZ_KK737550.1, 85444, 85806, +, 363, 12421; cds-WP _002914815.1, NZ_KK737550.1, 85819, 86598, +, 780, 190488; cds-WP_021440608.1, NZ_KK737550.1, 86756, 87115, +, 360, 1686; cds-WP _002914817.1, NZ_KK737550.1, 87182, 87955, +, 774, 368945; cds-WP _004174691.1, NZ_KK737550.1, 87948, 88913, +, 966, 295086; cds-WP_004890240.1, NZ_KK737550.1, 88876, 90426, -, 1551, 14003; cds-WP _004145759.1, NZ_KK737550.1, 90614, 92062, +, 1449, 11249; cds-WP _021440610.1, NZ_KK737550.1, 92059, 93192, +, 1134, 1828; cds-WP _004181028.1, NZ_KK737550.1, 93289, 94302, -, 1014, 5630; cds-WP_032430324.1, NZ_KK737550.1, 94299, 96515, -, 2217, 919; cds-WP_002914875.1, NZ_KK737550.1, 96524, 97051, -, 528, 94; cds-WP _004174685.1, NZ_KK737550.1, 97188, 98201, -, 1014, 117797; cds-WP _032430325.1, NZ_KK737550.1, 98469, 99923, +, 1455, 46292; cds-WP _004181034.1, NZ_KK737550.1, 99938, 101362, +, 1425, 136268; cds-WP_002914883.1, NZ_KK737550.1, 101544, 101852, +, 309, 16050; cds-WP _032430326.1, NZ_KK737550.1, 101849, 102319, -, 471, 38966; cds-WP_002914887.1, NZ_KK737550.1, 102312, 102722, -, 411, 14988; cds-WP _002914891.1, NZ_KK737550.1, 102719, 103486, -, 768, 12766; cds-WP_002914893.1, NZ_KK737550.1, 103486, 104028, -, 543, 1157; cds-WP_021440614.1, NZ_KK737550.1, 104038, 105747, -, 1710, 155; cds-WP_032428387.1, NZ_KK737550.1, 105764, 106687, -, 924, 1940; cds-WP_004890213.1, NZ_KK737550.1, 106690, 108516, -, 1827, 0; cds-WP _004151047.1, NZ_KK737550.1, 108513, 109121, -, 609, 52; cds-WP _002914925.1, NZ_KK737550.1, 109204, 109653, -, 450, 0; cds-WP_002914928.1, NZ_KK737550.1, 109863, 110207, +, 345, 47; cds-WP_004181043.1, NZ_KK737550.1, 110211, 111083, +, 873, 394; cds-WP_014907033.1, NZ_KK737550.1, 111074, 111346, +, 273, 0; cds-WP _004145781.1, NZ_KK737550.1, 111346, 112467, +, 1122, 1529; cds-WP_032428388.1, NZ_KK737550.1, 112464, 113474, +, 1011, 94; cds-WP _032428389.1, NZ_KK737550.1, 113711, 115783, +, 2073, 78007; cds-WP _002914970.1, NZ_KK737550.1, 115837, 117237, -, 1401, 85715; cds-WP_021440618.1, NZ _KK737550.1, 117288, 119480, -, 2193,5647; cds-AF52_RS03110, NZ_KK737550.1, 119493, 120829, -, 1337, 267; cds-WP_032430327.1, NZ_KK737550.1, 121092, 122363, -, 1272, 111390; cds-WP_002914979.1, NZ _KK737550.1, 122541, 122855, +, 315, 7694; cds-WP _002914981.1, NZ_KK737550.1, 122865, 124187, +, 1323, 20667; cds-WP_032430328.1, NZ_KK737550.1, 124211, 124525, +, 315, 77; cds-WP _004151053.1, NZ_KK737550.1, 124576, 125490, +, 915, 107; cds-WP_004181055.1, NZ_KK737550.1, 125547, 126509, +, 963, 26870; cds-WP_004174672.1, NZ_KK737550.1, 126688, 127605, +, 918, 147849; cds-WP_021440623.1, NZ_KK737550.1, 127602, 128423, +, 822, 19193; cds-WP_004185394.1, NZ_KK737550.1, 128420, 129268, +, 849, 31738; cds-WP_002915035.1, NZ_KK737550.1, 129262, 130116, +, 855, 40108; cds-WP _004193741.1, NZ_KK737550.1, 130183, 130524, -, 342, 535; cds-WP_032430329.1, NZ_KK737550.1, 130591, 131478, -, 888, 51956; cds-WP _002915041.1, NZ_KK737550.1, 131663, 132604, +, 942, 2028; cds-WP_032430330.1, NZ_KK737550.1, 132640, 134349, +, 1710, 24974; cds-WP_021440627.1, NZ_KK737550.1, 134389, 134682, -, 294, 42018; cds-WP _021440628.1, NZ_KK737550.1, 134898, 137261, +, 2364, 43462; cds-WP _032428391.1, NZ_KK737550.1, 137333, 138364, +, 1032, 237194; cds-WP _004181072.1, NZ_KK737550.1, 138361, 139179, +, 819, 0; cds-WP_032428392.1, NZ_KK737550.1, 139179, 140174, +, 996, 80; cds-WP_021440630.1, NZ_KK737550.1, 140167, 140946, +, 780, 652; cds-WP _032430331.1, NZ_KK737550.1, 141100, 143661, +, 2562, 607588; cds-WP_021440632.1, NZ_KK737550.1, 143781, 143933, -, 153, 27882; cds-WP_002915098.1, NZ_KK737550.1, 144272, 144508, -, 237, 10370; cds-WP_004151060.1, NZ_KK737550.1, 144519, 145946, -, 1428, 22710; cds-WP _002915099.1, NZ_KK737550.1, 145946, 146539, -, 594, 1513; cds-WP_002915102.1, NZ_KK737550.1, 146713, 147120, +, 408, 3725; cds-WP_032430332.1, NZ_KK737550.1, 147129, 148016, -, 888, 46158; cds-WP_021440634.1, NZ_KK737550.1, 148125, 149327, +, 1203, 397; cds-WP _021440635.1, NZ_KK737550.1, 149324, 149701, +, 378, 3120; cds-WP _002915106.1, NZ_KK737550.1, 149754, 150746, -, 993, 1204836; cds-WP_014907019.1, NZ_KK737550.1, 150904, 152034, -, 1131, 2942188; cds-WP _002915108.1, NZ_KK737550.1, 152160, 152786, -, 627, 429204; cds-WP _004142750.1, NZ_KK737550.1, 152780, 153541, -, 762, 452973; cds-WP _004185423.1, NZ_KK737550.1, 153522, 154571, -, 1050, 228122; cds-WP_002915113.1, NZ_KK737550.1, 154568, 155047, -, 480, 150799; cds-WP _021440636.1, NZ_KK737550.1, 155047, 155757, -, 711, 360099; cds-WP_002915156.1, NZ_KK737550.1, 155777, 156094, -, 318, 416389; cds-WP_002915157.1, NZ_KK737550.1, 156235, 156561, -, 327, 21852; cds-WP_002915158.1, NZ_KK737550.1, 156612, 157217, -, 606, 6314; cds-WP_004181094.1, NZ_KK737550.1, 157217, 158644, -, 1428, 14975; cds-WP_002915160.1, NZ_KK737550.1, 158654, 159562, -, 909, 41571; cds-WP_072271746.1, NZ_KK737550.1, 159572, 160978, -, 1407, 14295; cds-WP_004174643.1, NZ_KK737550.1, 161225, 162271, +, 1047, 107673; cds-WP _002915177.1, NZ_KK737550.1, 162344, 163078, -, 735, 110119; cds-WP _021440639.1, NZ_KK737550.1, 163177, 164889, -, 1713, 76359; cds-WP_004174642.1, NZ_KK737550.1, 164889, 166688, -, 1800, 10298; cds-WP_187079196.1, NZ_KK737550.1, 167005, 167370, +, 366, 68444; cds-WP _021440641.1, NZ_KK737550.1, 167411, 168082, -, 672, 84773; cds-WP_032430333.1, NZ_KK737550.1, 168557, 169666, +, 1110, 204082; cds-WP_002915213.1, NZ_KK737550.1, 169730, 171028, -, 1299, 14397199; cds-WP _004142808.1, NZ_KK737550.1, 171110, 172747, -, 1638, 4025716; cds-WP _002915215.1, NZ_KK737550.1, 173028, 173819, -, 792, 109376; cds-WP_002915217.1, NZ_KK737550.1, 173931, 176168, -, 2238, 1188878; cds-WP_023301525.1, NZ_KK737550.1, 176290, 177594, -, 1305, 265875; cds-WP_004151066.1, NZ_KK737550.1, 177708, 180458, +, 2751, 345845; cds-WP _004149562.1, NZ_KK737550.1, 180616, 181755, -, 1140, 264950; cds-WP_002915223.1, NZ_KK737550.1, 181828, 183168, -, 1341, 445380; cds-WP _032428394.1, NZ_KK737550.1, 183186, 184526, -, 1341, 361447; cds-WP _002915225.1, NZ_KK737550.1, 184529, 185881, -, 1353, 895462; cds-WP_002915235.1, NZ_KK737550.1, 186353, 186796, -, 444, 81130; cds-WP _002915236.1, NZ_KK737550.1, 186801, 187595, -, 795, 128659; cds-WP _002915249.1, NZ_KK737550.1, 187595, 187924, -, 330, 37775; cds-WP_002915253.1, NZ_KK737550.1, 188556, 189101, -, 546, 177257; cds-WP_004174633.1, NZ_KK737550.1, 189170, 190015, +, 846, 262956; cds-WP_002915258.1, NZ_KK737550.1, 190127, 191494, +, 1368, 1334915; cds-WP _004151070.1, NZ_KK737550.1, 192004, 193293, +, 1290, 19709321; cds-WP_002915259.1, NZ_KK737550.1, 193359, 194726, +, 1368, 4967824; cds-WP_032430336.1, NZ_KK737550.1, 194865, 195806, +, 942, 318533; cds-WP _002915263.1, NZ_KK737550.1, 195852, 197075, -, 1224, 11722; cds-WP _004151071.1, NZ_KK737550.1, 197086, 198507, -, 1422, 1497; cds-WP_002915265.1, NZ_KK737550.1, 198701, 199579, -, 879, 55; cds-WP _002915267.1, NZ_KK737550.1, 199576, 200274, -, 699, 35; cds-WP _004174621.1, NZ_KK737550.1, 200271, 201293, -, 1023, 0; cds-WP _032428395.1, NZ_KK737550.1, 201290, 202696, -, 1407, 0; cds-AF52_RS0124590, NZ_KK737550.1, 202770, 204167, -, 1398, 0; cds-WP_021440649.1, NZ_KK737550.1, 204214, 205386, -, 1173, 4336; cds-WP_032428396.1, NZ_KK737550.1, 205464, 205580, -, 117, 0; cds-WP _021440650.1, NZ_KK737550.1, 205658, 207601, +, 1944, 2591; cds-WP _004142871.1, NZ_KK737550.1, 207698, 208453, +, 756, 21341; cds-WP _032430337.1, NZ_KK737550.1, 208512, 209660, -, 1149, 171739; cds-WP_002915470.1, NZ_KK737550.1, 209688, 210335, -, 648, 13582; cds-WP _004151076.1, NZ_KK737550.1, 210902, 212212, +, 1311, 11273; cds-WP _032430338.1, NZ_KK737550.1, 212245, 214020, +, 1776, 19495; cds-WP_004181132.1, NZ_KK737550.1, 214128, 215546, +, 1419, 3; cds-WP_002915538.1, NZ_KK737550.1, 215548, 215970, +, 423, 0; cds-WP_004142883.1, NZ_KK737550.1, 216029, 216739, +, 711, 67566; cds-WP_002915541.1, NZ_KK737550.1, 216788, 217888, -, 1101, 195631; cds-WP _002915543.1, NZ_KK737550.1, 217881, 218276, -, 396, 82615; cds-WP_002915545.1, NZ_KK737550.1, 218296, 219213, -, 918, 370533; cds-WP_002915549.1, NZ_KK737550.1, 219565, 219789, -, 225, 169286; cds-WP _021440652.1, NZ_KK737550.1, 219987, 221192, +, 1206, 122964; cds-WP_021440653.1, NZ_KK737550.1, 221192, 221623, +, 432, 40034; cds-WP_002915577.1, NZ_KK737550.1, 221666, 222487, -, 822, 78300; cds-WP_002915579.1, NZ_KK737550.1, 222575, 223672, -, 1098, 290044; cds-WP _004900253.1, NZ_KK737550.1, 224055, 225110, -, 1056, 75348; cds-WP 004143921.1, NZ_KK737550.1, 225154, 225699, -, 546, 847; cds-WP_021440655.1, NZ_KK737550.1, 225693, 227216, -


1524, 22678; cds-WP_002915614.1, NZ_KK737550.1, 227213, 228037, -, 825, 16311; cds-WP_004143925.1, NZ_KK737550.1, 228046, 228723, -, 678, 33790; cds-WP_002915619.1, NZ_KK737550.1, 228710, 228991, -, 282, 846; cds-WP_004143926.1, NZ_KK737550.1, 228993, 229730, -, 738, 29425; cds-WP_004143927.1, NZ_KK737550.1, 229730, 230440, -, 711, 15699; cds-WP_016532596.1, NZ_KK737550.1, 230437, 231231, -, 795, 10787; cds-WP_002915627.1, NZ_KK737550.1, 231242, 232027, -, 786, 27225; cds-WP_004143930.1, NZ_KK737550.1, 232024, 232749, -, 726, 13293; cds-WP_021440657.1, NZ_KK737550.1, 232749, 233804, -, 1056, 48609; cds-WP_004149602.1, NZ_KK737550.1, 233785, 234558, -, 774, 61417; cds-WP_032430341.1, NZ_KK737550.1, 234551, 235120, -, 570, 1087; cds-WP_016947545.1, NZ_KK737550.1, 235110, 235715, -, 606, 439; cds-WP_002915708.1, NZ_KK737550.1, 235709, 236848, -, 1140, 19776; cds-WP_021440659.1, NZ_KK737550.1, 236845, 237480, -, 636, 417; cds-WP_002915724.1, NZ_KK737550.1, 237491, 238450, -, 960, 3265; cds-WP_004185466.1, NZ_KK737550.1, 238447, 239823, -, 1377, 95783; cds-AF52_RS02545, NZ_KK737550.1, 240376, 241203, -, 828, 6296; cds-AF52_RS26545, NZ_KK737550.1, 241259, 241436, -, 178, 5379; cds-WP_170999280.1, NZ_KK737550.1, 241947, 242236, -, 290, 16897; cds-WP_002915737.1, NZ_KK737550.1, 242699, 242983, +, 285, 0; cds-WP_002915739.1, NZ_KK737550.1, 242980, 243792, +, 813, 0; cds-WP_002915744.1, NZ_KK737550.1, 243811, 245475, +, 1665, 38; cds-WP_008806302.1, NZ_KK737550.1, 245486, 246175, +, 690, 460; cds-WP_021440661.1, NZ_KK737550.1, 246190, 246714, +, 525, 1; cds-WP_021440662.1, NZ_KK737550.1, 246727, 248559, +, 1833, 2; cds-WP_004900279.1, NZ_KK737550.1, 248549, 248899, +, 351, 0; cds-WP_002915806.1, NZ_KK737550.1, 248918, 249193, +, 276, 0; cds-WP_002915808.1, NZ_KK737550.1, 249215, 249661, +, 447, 82; cds-WP_002915810.1, NZ_KK737550.1, 249661, 250293, +, 633, 221; cds-WP_021440663.1, NZ_KK737550.1, 250290, 250781, +, 492, 19; cds-WP_021440664.1, NZ_KK737550.1, 250785, 251060, +, 276, 0; cds-WP_004211864.1, NZ_KK737550.1, 251071, 252087, +, 1017, 375; cds-WP_021440665.1, NZ_KK737550.1, 252084, 253472, +, 1389, 747; cds-WP_021440666.1, NZ_KK737550.1, 253484, 254596, +, 1113, 10035; cds-WP_023301518.1, NZ_KK737550.1, 254593, 255945, +, 1353, 0; cds-WP_004181171.1, NZ_KK737550.1, 255948, 256502, +, 555, 866; cds-WP_002915850.1, NZ_KK737550.1, 256502, 256852, +, 351, 3049; cds-WP_004185483.1, NZ_KK737550.1, 256857, 257297, +, 441, 13529; cds-WP_032430342.1, NZ_KK737550.1, 257294, 258508, +, 1215, 15192; cds-WP_032428406.1, NZ_KK737550.1, 258600, 259466, +, 867, 258189; cds-WP_004143954.1, NZ_KK737550.1, 259470, 260546, -, 1077, 99124; cds-WP_004174538.1, NZ_KK737550.1, 260564, 261817, -, 1254, 281531; cds-AF52_RS02415, NZ_KK737550.1, 262045, 263376, +, 1332, 31299; cds-WP_009485668.1, NZ_KK737550.1, 263606, 263926, +, 321, 3151; cds-WP_004900323.1, NZ_KK737550.1, 263984, 265828, -, 1845, 15585; cds-WP_021440669.1, NZ_KK737550.1, 265825, 269361, -, 3537, 352293; cds-WP_023301515.1, NZ_KK737550.1, 269358, 272243, -, 2886, 356943; cds-WP_004211885.1, NZ_KK737550.1, 272364, 275741, -, 3378, 284553; cds-WP_021440672.1, NZ_KK737550.1, 275754, 276077, -, 324, 4661; cds-WP_004181182.1, NZ_KK737550.1, 276062, 276469, -, 408, 4; cds-WP_021440673.1, NZ_KK737550.1, 276466, 277023, -, 558, 1781; cds-WP_002915932.1, NZ_KK737550.1, 277020, 277571, -, 552, 5954; cds-WP_002915933.1, NZ_KK737550.1, 277757, 278551, -, 795, 659423; cds-WP_002915934.1, NZ_KK737550.1, 278558, 279433, -, 876, 630628; cds-WP_032430343.1, NZ_KK737550.1, 279679, 281925, -, 2247,924308; cds-WP_002915936.1, NZ_KK737550.1, 281938, 282468, -, 531, 331577; cds-WP_004218186.1, NZ_KK737550.1, 282922, 283065, +, 144, 0; cds-WP_004143967.1, NZ_KK737550.1, 283151, 283846, +, 696, 19039; cds-WP_002915973.1, NZ_KK737550.1, 283910, 284623, +, 714, 125265; cds-WP_002915974.1, NZ_KK737550.1, 284747, 284965, +, 219, 150253; cds-WP_032430346.1, NZ_KK737550.1, 285186, 286226, +, 1041, 256289; cds-WP_004185495.1, NZ_KK737550.1, 286329, 287522, -, 1194, 114152; cds-WP_002915977.1, NZ_KK737550.1, 287515, 289674, -, 2160, 398432; cds-AF52_RS28115, NZ_KK737550.1, 289938, 290202, -, 265, 4096; cds-WP_002915981.1, NZ_KK737550.1, 290296, 291312, +, 1017, 910505; cds-WP_021440677.1, NZ_KK737550.1, 291273, 291752, -, 480, 19842; cds-WP_032430347.1, NZ_KK737550.1, 291749, 292522, -, 774, 348389; cds-WP_004174521.1, NZ_KK737550.1, 292590, 294017, -, 1428, 19375; cds-WP_004174520.1, NZ_KK737550.1, 294025, 295362, -, 1338, 43389; cds-WP_021440678.1, NZ_KK737550.1, 295662, 296663, +, 1002, 1489810; cds-WP_002915990.1, NZ_KK737550.1, 296656, 297918, -, 1263, 259772; cds-WP_002915991.1, NZ_KK737550.1, 298055, 298981, +, 927, 21796; cds-WP_032428400.1, NZ_KK737550.1, 298947, 299660, -, 714, 13916; cds-WP_002915993.1, NZ_KK737550.1, 299800, 300126, +, 327, 43099; cds-WP_002915995.1, NZ_KK737550.1, 300579, 301469, +, 891, 4870; cds-WP_002915996.1, NZ_KK737550.1, 301462, 302364, +, 903, 12674; cds-WP_021440680.1, NZ_KK737550.1, 302377, 303504, +, 1128, 85793; cds-WP_002915998.1, NZ_KK737550.1, 303521, 304807, +, 1287, 92047; cds-WP_032415517.1, NZ_KK737550.1, 304867, 306210, -, 1344, 6399; cds-WP_026005853.1, NZ_KK737550.1, 306332, 307765, -, 1434, 20051; cds-WP_002916000.1, NZ_KK737550.1, 307785, 309026, -, 1242, 6356; cds-WP_004143987.1, NZ_KK737550.1, 309039, 309173, -, 135, 7493; cds-WP_032428401.1, NZ_KK737550.1, 309268, 310263, +, 996, 174589; cds-WP_002916001.1, NZ_KK737550.1, 310260, 311681, -, 1422, 8169; cds-WP_002916003.1, NZ_KK737550.1, 311977, 312738, -, 762, 22841; cds-WP_002916048.1, NZ_KK737550.1, 313224, 314399, +, 1176, 27248; cds-WP_004143995.1, NZ_KK737550.1, 314535, 315230, -, 696, 9789; cds-WP_002916052.1, NZ_KK737550.1, 315479, 316657, -, 1179, 272462; cds-WP_002916055.1, NZ_KK737550.1, 316776, 317645, -, 870, 2870; cds-WP_002916056.1, NZ_KK737550.1, 317748, 318209, +, 462, 8022; cds-WP_002916058.1, NZ_KK737550.1, 318333, 319562, +, 1230, 121470; cds-WP_002916061.1, NZ_KK737550.1, 319681, 320559, +, 879, 28629; cds-WP_013815099.1-72, NZ_KK737550.1, 320898, 321866, -, 969, 75772; cds-AF52_RS02175, NZ_KK737550.1, 321899, 322303, +, 405, 1154; cds-WP_013815099.1-73, NZ_KK737550.1, 322616, 323584, +, 969, 81641; cds-WP_021440689.1, NZ_KK737550.1, 323835, 324443, +, 609, 157577; cds-WP_002916190.1, NZ_KK737550.1, 324922, 325470, +, 549, 16219; cds-WP_021440690.1, NZ_KK737550.1, 325541, 326077, +, 537, 4544; cds-WP_002916192.1, NZ_KK737550.1, 326106, 326831, +, 726, 40058; cds-WP_032430351.1, NZ_KK737550.1, 326913, 329525, +, 2613, 1853; cds-WP_004185520.1, NZ_KK737550.1, 329536, 330063, +, 528, 1420; cds-WP_004229447.1, NZ_KK737550.1, 330091, 330576, +, 486, 60091; cds-WP_032423847.1, NZ_KK737550.1, 330594, 331496, +, 903, 8562; cds-WP_021440694.1, NZ_KK737550.1, 331493, 332905, +, 1413, 8400; cds-WP_002916201.1, NZ_KK737550.1, 332948, 333220, -, 273, 25172; cds-WP_004144031.1, NZ_KK737550.1, 333232, 333501, -, 270, 21995; cds-WP_002916204.1, NZ_KK737550.1, 333668, 333940, +, 273, 42983; cds-WP_004174502.1, NZ_KK737550.1, 333947, 334972, +, 1026, 208869; cds-WP_004185523.1, NZ_KK737550.1, 334985, 336922, +, 1938, 90733; cds-WP_032430352.1, NZ_KK737550.1, 336919, 338367, +, 1449, 78446; cds-WP_002916274.1, NZ_KK737550.1, 338632, 338931, -, 300, 25889; cds-WP_002916277.1, NZ_KK737550.1, 339116, 340669, -, 1554, 3965380; cds-WP_016947386.1, NZ_KK737550.1, 341142, 341564, -, 423, 273390; cds-WP_023301507.1, NZ_KK737550.1, 341574, 342866, -, 1293, 49690; cds-WP_002916281.1, NZ_KK737550.1, 342918, 343247, -, 330, 984; cds-WP_002916282.1, NZ_KK737550.1, 343466, 343759, +, 294, 92097; cds-WP_002916283.1, NZ_KK737550.1, 343790, 344362, +, 573, 73853; cds-WP_014599254.1, NZ_KK737550.1, 344441, 344644, +, 204, 7536; cds-WP_004174493.1, NZ_KK737550.1, 344813, 345712, -, 900, 262584; cds-WP_004151785.1, NZ_KK737550.1, 345851, 346159, +, 309, 3769; cds-WP_023285538.1, NZ_KK737550.1, 346168, 346725, +, 558, 2143; cds-WP_032428403.1, NZ_KK737550.1, 346746, 347765, +, 1020, 13013; cds-WP_004185540.1, NZ_KK737550.1, 347798, 348601, +, 804, 48831; cds-WP_015958948.1, NZ_KK737550.1, 348965, 349894, -, 930, 61350; cds-AF52_RS02025, NZ_KK737550.1, 350024, 351103, +, 1080, 211; cds-WP_013815099.1-74, NZ_KK737550.1, 351161, 352129, -, 969, 81068; cds-AF52_RS26135, NZ_KK737550.1, 352161, 352478, +, 318, 4756; cds-WP_004157874.1, NZ_KK737550.1, 352800, 353513, -, 714, 62273; cds-WP_002916298.1, NZ_KK737550.1, 353830, 354384, +, 555, 10495; cds-WP_002916299.1, NZ_KK737550.1, 354620, 356137, -, 1518, 2340499; cds-WP_095858446.1, NZ_KK737550.1;NZ_KK737550.1, 356147;357171, 357169;357245, -;-, 1098, 1434989; cds-WP_004149758.1, NZ_KK737550.1, 357331, 359064, -, 1734, 290570; cds-WP_004185548.1, NZ_KK737550.1, 359070, 359783, -, 714, 532805; cds-WP_004144729.1, NZ_KK737550.1, 359806, 360702, -, 897, 400869; cds-WP_004144730.1, NZ_KK737550.1, 360803, 361324, +, 522, 163681; cds-WP_002916310.1, NZ_KK737550.1, 361331, 361741, -, 411, 143261; cds-WP_002916312.1, NZ_KK737550.1, 361722, 361988, -, 267, 89776; cds-WP_004185555.1, NZ_KK737550.1, 362234, 363217, +, 984, 485976; cds-WP_002916317.1, NZ_KK737550.1, 363368, 364027, -, 660, 161030; cds-WP_004144734.1, NZ_KK737550.1, 364191, 364502, -, 312, 20647; cds-WP_002916321.1, NZ_KK737550.1, 364552, 365280, +, 729, 130891; cds-WP_002916322.1, NZ_KK737550.1, 365399, 366832, +, 1434, 69569; cds-WP_004185561.1, NZ_KK737550.1, 366957, 367316, +, 360, 123214; cds-WP_009308616.1, NZ_KK737550.1, 367366, 369375, +, 2010, 26477; cds-WP_009308617.1, NZ_KK737550.1, 369377, 369988, +, 612, 4264; cds-WP_009308618.1, NZ_KK737550.1, 369978, 370481, +, 504, 6544; cds-WP_004174442.1, NZ_KK737550.1, 370602, 371345, -, 744, 85386; cds-WP_004900541.1, NZ_KK737550.1, 371408, 374281, -, 2874, 9658006; cds-WP_002916479.1, NZ_KK737550.1, 374488, 374877, -, 390, 2205620; cds-WP_002916480.1, NZ_KK737550.1, 374902, 375996, -, 1095, 3161974; cds-WP_002916481.1, NZ_KK737550.1, 376419, 377621, -, 1203, 170190; cds-WP_021440702.1, NZ_KK737550.1, 377632, 378810, -, 1179, 348482; cds-WP_002916483.1, NZ_KK737550.1, 378807, 380123, -, 1317, 680264; cds-WP_002916486.1, NZ_KK737550.1, 380147, 380725, -, 579, 428520; cds-WP_002916488.1, NZ_KK737550.1, 380892, 381221, +, 330, 271983; cds-WP_004144746.1, NZ_KK737550.1, 381545, 382141, +, 597, 286285; cds-WP_002916493.1, NZ_KK737550.1, 382225, 383457, -, 1233, 356525; cds-WP_002916495.1, NZ_KK737550.1, 383727, 384386, -, 660, 245535; cds-WP_002916497.1, NZ_KK737550.1, 384554, 385447, +, 894, 51205; cds-WP_002916499.1, NZ_KK737550.1, 385501, 386268, -, 768, 788861; cds-WP_004144747.1, NZ_KK737550.1, 386358, 386993, -, 636, 50054; cds-WP_002916504.1, NZ_KK737550.1, 387145, 388002, -, 858, 412448; cds-WP_004144748.1, NZ_KK737550.1, 388193, 389272, -, 1080, 15821335; cds-WP_002916508.1, NZ_KK737550.1, 389370, 390533, -, 1164, 5218215; cds-WP_002916512.1, NZ_KK737550.1, 390573, 391601, -, 1029, 1957486; cds-WP_004174438.1, NZ_KK737550.1, 391987, 393978, -, 1992, 9200859; cds-WP_004151780.1, NZ_KK737550.1, 394257, 395015, +, 759, 271935; cds-WP_032428408.1, NZ_KK737550.1, 395393, 396661, +, 1269, 38133; cds-WP_021440705.1, NZ_KK737550.1, 396798, 398438, -, 1641, 18026; cds-WP_032430353.1, NZ_KK737550.1, 398452, 399921, -, 1470, 6; cds-WP_004211378.1, NZ_KK737550.1, 399937, 400701, -, 765, 0; cds-WP_032430354.1, NZ_KK737550.1, 400711, 401505, -, 795, 14; cds-WP_032428409.1, NZ_KK737550.1, 401489, 402259, -, 771, 10; cds-WP_032430355.1, NZ_KK737550.1, 402269, 402799, -, 531, 19209; cds-WP_004149797.1, NZ_KK737550.1, 402810, 404066, -, 1257, 1026; cds-WP_004174432.1, NZ_KK737550.1, 404093, 405289, -, 1197, 113055; cds-WP_004149799.1, NZ_KK737550.1, 405286, 406212, -, 927, 33563; cds-WP_021440707.1, NZ_KK737550.1, 406301, 407089, -, 789, 47017; cds-WP_021440708.1, NZ_KK737550.1, 407103, 407852, -, 750, 43637; cds-WP_004174429.1, NZ_KK737550.1, 407852, 408874, -, 1023, 322984; cds-WP_004144765.1, NZ_KK737550.1, 408885, 409193, -, 309, 204510; cds-WP_004151769.1, NZ_KK737550.1, 409190, 409513, -, 324, 39322; cds-WP_032428411.1, NZ_KK737550.1, 409941, 411161, +, 1221, 59797; cds-WP_002916572.1, NZ_KK737550.1, 411289, 412209, -, 921, 385322; cds-WP_004149805.1, NZ_KK737550.1, 412443, 414419, -, 1977, 1108596; cds-WP_002916578.1,


NZ_KK737550.1, 414428, 414559, -, 132, 81024; cds-WP_157828762.1, NZ_KK737550.1, 414740, 415063, +, 324, 25104; cds-WP_004149807.1, NZ_KK737550.1, 415261, 416415, +, 1155, 977597; cds-WP_002916587.1, NZ_KK737550.1, 416803, 418197, +, 1395, 488743; cds-WP_002916588.1, NZ_KK737550.1, 418275, 418775, +, 501, 157364; cds-WP_002916589.1, NZ_KK737550.1, 418870, 419577, +, 708, 84446; cds-WP_002916597.1, NZ_KK737550.1, 419669, 420400, +, 732, 333278; cds-WP_002916600.1, NZ_KK737550.1, 420421, 421371, +, 951, 1116852; cds-WP_002916603.1, NZ_KK737550.1, 421546, 422109, +, 564, 238850; cds-WP_002916605.1, NZ_KK737550.1, 422109, 422525, +, 417, 101346; cds-WP_002916607.1, NZ_KK737550.1, 422578, 423231, -, 654, 60467; cds-WP_004149811.1, NZ_KK737550.1, 423580, 424560, -, 981, 56; cds-WP_004144780.1, NZ_KK737550.1, 424577, 425278, +, 702, 215297; cds-WP_002916613.1, NZ_KK737550.1, 425299, 425865, +, 567, 327123; cds-WP_002916614.1, NZ_KK737550.1, 425862, 426152, +, 291, 300982; cds-WP_002916615.1, NZ_KK737550.1, 426165, 426758, +, 594, 289517; cds-WP_004149812.1, NZ_KK737550.1, 426751, 427887, +, 1137, 246125; cds-WP_023285550.1, NZ_KK737550.1, 428193, 429179, +, 987, 46035; cds-WP_025861936.1, NZ_KK737550.1, 429226, 429729, +, 504, 19990; cds-WP_004149816.1, NZ_KK737550.1, 429729, 431030, +, 1302, 65276; cds-WP_019704316.1, NZ_KK737550.1, 431078, 431797, -, 720, 265537; cds-WP_002916620.1, NZ_KK737550.1, 431848, 432174, -, 327, 36595; cds-WP_002916627.1, NZ_KK737550.1, 432174, 432893, -, 720, 170874; cds-AF52_RS01615, NZ_KK737550.1, 433030, 434087, +, 1058, 209600; cds-WP_004105744.1, NZ_KK737550.1, 434116, 434391, +, 276, 279194; cds-WP_004900580.1, NZ_KK737550.1, 434441, 435523, +, 1083, 966916; cds-WP_004144787.1, NZ_KK737550.1, 435715, 436968, +, 1254, 1160389; cds-WP_009484134.1, NZ_KK737550.1, 437012, 439150, -, 2139, 104886; cds-WP_002916694.1, NZ_KK737550.1, 439570, 440283, +, 714, 14819; cds-AF52_RS01580, NZ_KK737550.1, 441124, 441340, -, 217, 192384; cds-WP_004188553.1, NZ_KK737550.1, 441437, 442030, -, 594, 244638; cds-WP_021314147.1, NZ_KK737550.1, 442734, 443219, -, 486, 92408; cds-WP_004150912.1, NZ_KK737550.1, 443216, 443509, -, 294, 88136; cds-AF52_RS27585, NZ_KK737550.1, 444170, 444344, +, 175, 5874; cds-WP_032175380.1-2, NZ_KK737550.1, 445134, 445482, +, 349, 32321; cds-WP_004217775.1, NZ_KK737550.1, 445564, 446940, +, 1377, 23751; cds-WP_004150915.1, NZ_KK737550.1, 446951, 448099, +, 1149, 41910; cds-WP_004188550.1, NZ_KK737550.1, 448100, 449011, -, 912, 13467; cds-WP_021440720.1, NZ_KK737550.1, 449109, 449711, +, 603, 4266; cds-WP_004174409.1, NZ_KK737550.1, 449798, 450142, +, 345, 14753; cds-WP_002916738.1, NZ_KK737550.1, 450342, 450530, +, 189, 56099; cds-WP_004149825.1, NZ_KK737550.1, 450707, 451888, -, 1182, 236221; cds-WP_002916740.1, NZ_KK737550.1, 452034, 453899, -, 1866, 997092; cds-WP_004217169.1, NZ_KK737550.1, 453976, 454098, -, 123, 9456; cds-WP_004150918.1, NZ_KK737550.1, 454119, 454679, +, 561, 37924; cds-WP_002916742.1, NZ_KK737550.1, 454727, 455593, +, 867, 216859; cds-WP_002916743.1, NZ_KK737550.1, 455666, 455953, -, 288, 24138; cds-WP_004144560.1, NZ_KK737550.1, 456032, 456919, -, 888, 17490; cds-WP_004105804.1, NZ_KK737550.1, 457041, 457535, -, 495, 162125; cds-WP_032412422.1, NZ_KK737550.1, 457642, 459165, -, 1524, 94980; cds-WP_002916782.1, NZ_KK737550.1, 459179, 460597, -, 1419, 75010; cds-WP_002916785.1, NZ_KK737550.1, 460802, 461227, -, 426, 284669; cds-WP_004174395.1, NZ_KK737550.1, 461234, 461965, -, 732, 290065; cds-WP_004149836.1, NZ_KK737550.1, 462216, 463403, +, 1188, 766; cds-WP_002916791.1, NZ_KK737550.1, 463535, 464194, +, 660, 277066; cds-WP_032430356.1, NZ_KK737550.1, 464244, 465143, -, 900, 85309; cds-WP_004144551.1, NZ_KK737550.1, 465340, 466503, +, 1164, 34031; cds-WP_023286874.1, NZ_KK737550.1, 466649, 467476, +, 828, 171362; cds-WP_004144550.1, NZ_KK737550.1, 467512, 468039, -, 528, 77031; cds-WP_004174383.1, NZ_KK737550.1, 468096, 470279, -, 2184, 837501; cds-WP_004144547.1, NZ_KK737550.1, 470403, 471815, -, 1413, 415693; cds-WP_002916826.1, NZ_KK737550.1, 471899, 472636, -, 738, 399702; cds-WP_004181324.1, NZ_KK737550.1, 472828, 475086, -, 2259, 1160059; cds-WP_002916831.1, NZ_KK737550.1, 475208, 476077, -, 870, 100129; cds-WP_002916833.1, NZ_KK737550.1, 476155, 476550, -, 396, 34620; cds-WP_002916836.1, NZ_KK737550.1, 476701, 477360, +, 660, 43517; cds-WP_021440728.1, NZ_KK737550.1, 477357, 478706, +, 1350, 22063; cds-WP_002916840.1, NZ_KK737550.1, 478813, 479394, +, 582, 86188; cds-WP_002916842.1, NZ_KK737550.1, 479475, 479789, +, 315, 423699; cds-WP_002916844.1, NZ_KK737550.1, 479862, 481757, -, 1896, 1808341; cds-WP_002916845.1, NZ_KK737550.1, 481788, 482363, -, 576, 984898; cds-WP_002916846.1, NZ_KK737550.1, 482363, 483190, -, 828, 1334902; cds-WP_002916847.1, NZ_KK737550.1, 483215, 483637, -, 423, 335767; cds-WP_002916848.1, NZ_KK737550.1, 483634, 484266, -, 633, 69201; cds-WP_004150921.1, NZ_KK737550.1, 484463, 485932, +, 1470, 2236408; cds-WP_002916849.1, NZ_KK737550.1, 486100, 486771, +, 672, 829779; cds-WP_004900674.1, NZ_KK737550.1, 486777, 487937, +, 1161, 1983418; cds-WP_004174357.1, NZ_KK737550.1, 487982, 488773, -, 792, 272823; cds-WP_032430358.1, NZ_KK737550.1, 488960, 489730, +, 771, 31171; cds-WP_004185664.1, NZ_KK737550.1, 489792, 490445, -, 654, 239659; cds-WP_002916856.1, NZ_KK737550.1, 490823, 491095, +, 273, 11088; cds-WP_002916857.1, NZ_KK737550.1, 491131, 491328, -, 198, 15411; cds-AF52_RS28140, NZ_KK737550.1, 491320, 491470, +, 151, 5035; cds-WP_002916858.1, NZ_KK737550.1, 491548, 492981, -, 1434, 852788; cds-WP_002916860.1, NZ_KK737550.1, 493040, 495877, -, 2838, 1093939; cds-WP_009308672.1, NZ_KK737550.1, 495898, 497196, -, 1299, 33220; cds-WP_002916862.1, NZ_KK737550.1, 497411, 498031, +, 621, 539498; cds-WP_002916864.1, NZ_KK737550.1, 498093, 499334, +, 1242, 1314679; cds-WP_004144532.1, NZ_KK737550.1, 499346, 500167, -, 822, 506318; cds-WP_004150923.1, NZ_KK737550.1, 500366, 500749, -, 384, 190158; cds-WP_004144530.1, NZ_KK737550.1, 500857, 501474, +, 618, 105668; cds-WP_021440736.1, NZ_KK737550.1, 501606, 501725, +, 120, 0; cds-AF52_RS27590, NZ_KK737550.1, 501736, 501798, -, 63, 993; cds-WP_013815099.1-75, NZ_KK737550.1, 501856, 502824, -, 969, 76225; cds-WP_032430359.1, NZ_KK737550.1, 502826, 502948, -, 123, 1; cds-WP_004174349.1, NZ_KK737550.1, 502938, 503762, +, 825, 1842; cds-WP_002916871.1, NZ_KK737550.1, 503772, 504074, +, 303, 2299; cds-WP_021440738.1, NZ_KK737550.1, 504084, 504404, +, 321, 0; cds-WP_015958999.1, NZ_KK737550.1, 504397, 506100, +, 1704, 9110; cds-WP_004215466.1, NZ_KK737550.1, 506110, 506586, +, 477, 316; cds-WP_016532672.1, NZ_KK737550.1, 506588, 507262, +, 675, 302; cds-WP_002916877.1, NZ_KK737550.1, 507271, 507888, +, 618, 1335; cds-WP_025367880.1, NZ_KK737550.1, 508042, 509649, +, 1608, 93528; cds-WP_004900709.1, NZ_KK737550.1, 509694, 510707, -, 1014, 56676; cds-WP_001144069.1, NZ_KK737550.1, 510945, 511160, +, 216, 624277; cds-WP_004149864.1, NZ_KK737550.1, 511272, 513017, +, 1746, 1963987; cds-WP_004174339.1, NZ_KK737550.1, 513236, 515077, +, 1842, 6340082; cds-WP_002917636.1, NZ_KK737550.1, 515177, 515683, -, 507, 17658; cds-WP_004174338.1, NZ_KK737550.1, 516020, 516238, -, 219, 32708; cds-WP_032430361.1, NZ_KK737550.1, 516309, 517406, -, 1098, 156284; cds-WP_004185683.1, NZ_KK737550.1, 517403, 517888, -, 486, 10106; cds-AF52_RS01195, NZ_KK737550.1, 517885, 519153, -, 1269, 178415; cds-WP_020806188.1-6, NZ_KK737550.1, 519222, 520202, +, 981, 266570; cds-WP_050484295.1, NZ_KK737550.1, 520559, 522556, -, 1998, 8901350; cds-WP_032430362.1, NZ_KK737550.1, 522572, 523600, -, 1029, 4587138; cds-WP_032414744.1, NZ_KK737550.1, 523929, 524162, -, 234, 1277010; cds-WP_032414845.1, NZ_KK737550.1, 524174, 524362, -, 189, 570705; cds-WP_032430364.1, NZ_KK737550.1, 524546, 526954, -, 2409, 507; cds-AF52_RS27605, NZ_KK737550.1, 527242, 527414, +, 173, 5614; cds-AF52_RS0124695, NZ_KK737550.1, 528005, 528295, +, 291, 16114; cds-WP_021441030.1, NZ_KK737550.1, 528625, 530883, +, 2259, 2317; cds-WP_004177844.1, NZ_KK737550.1, 531147, 531515, -, 369, 0; cds-WP_004177843.1, NZ_KK737550.1, 531549, 533309, -, 1761, 315; cds-WP_004146634.1, NZ_KK737550.1, 533683, 533913, -, 231, 410; cds-WP_013815099.1-76, NZ_KK737550.1, 533996, 534964, -, 969, 75173; cds-WP_023285711.1, NZ_KK737550.1, 535001, 537424, +, 2424, 156421; cds-WP_013815099.1-77, NZ_KK737550.1, 537590, 538558, -, 969, 89402; cds-WP_004198387.1, NZ_KK737550.1, 538641, 539402, -, 762, 3042; cds-WP_002885046.1, NZ_KK737550.1, 539413, 540426, -, 1014, 3153; cds-WP_004151742.1, NZ_KK737550.1, 540423, 541181, -, 759, 7432; cds-WP_032430384.1, NZ_KK737550.1, 541357, 542385, +, 1029, 13984; cds-WP_013815099.1-78, NZ_KK737550.1, 542403, 543371, +, 969, 110986; cds-WP_004174268.1, NZ_KK737550.1, 543545, 543796, -, 252, 41001; cds-WP_032430367.1, NZ_KK737550.1, 543799, 544413, -, 615, 80978; cds-WP_004174272.1, NZ_KK737550.1, 544514, 544750, +, 237, 690110; cds-AF52_RS26555, NZ_KK737550.1, 544785, 545111, +, 327, 1350550; cds-WP_013815099.1-79, NZ_KK737550.1, 545145, 546113, +, 969, 464205; cds-AF52_RS0124710, NZ_KK737550.1, 546172, 546360, +, 189, 33096; cds-WP_004174277.1, NZ_KK737550.1, 546368, 546568, +, 201, 74727; cds-AF52_RS01075, NZ_KK737550.1, 546532, 546735, +, 204, 6457; cds-WP_002885077.1, NZ_KK737551.1, 251, 709, -, 459, 10976; cds-WP_004151738.1, NZ_KK737551.1, 794, 1123, +, 330, 314006; cds-WP_023283136.1, NZ_KK737551.1, 1108, 2712, -, 1605, 401138; cds-WP_004177826.1, NZ_KK737551.1, 3219, 3500, +, 282, 1540; cds-WP_004186517.1, NZ_KK737551.1, 3547, 4404, -, 858, 344; cds-WP_004177833.1, NZ_KK737551.1, 4401, 5234, -, 834, 22813; cds-WP_004177835.1, NZ_KK737551.1, 5294, 6433, -, 1140, 9494; cds-WP_013815099.1-80, NZ_KK737551.1, 6546, 7514, -, 969, 75235; cds-AF52_RS01030, NZ_KK737551.1, 7646, 8203, -, 558, 1716; cds-AF52_RS01025, NZ_KK737551.1, 8492, 9028, -, 537, 140; cds-AF52_RS0124720, NZ_KK737551.1, 9021, 9488, -, 468, 34467; cds-AF52_RS01020, NZ_KK737551.1, 10314, 10625, -, 312, 2529; cds-AF52_RS26200, NZ_KK737551.1, 10743, 10920, +, 178, 10080; cds-AF52_RS01015, NZ_KK737551.1, 11477, 12304, -, 828, 86; cds-AF52_RS01010, NZ_KK737551.1, 12683, 13012, +, 330, 15692; cds-AF52_RS27655, NZ_KK737551.1, 13210, 13361, +, 152, 32413; cds-AF52_RS01000, NZ_KK737551.1, 13462, 13718, +, 257, 45400; cds-WP_002885500.1, NZ_KK737551.1, 14025, 15053, -, 1029, 118784; cds-WP_002885506.1, NZ_KK737551.1, 15095, 15661, +, 567, 1215422; cds-WP_002885511.1, NZ_KK737551.1, 15735, 15866, +, 132, 149218; cds-WP_002885518.1, NZ_KK737551.1, 16026, 16172, +, 147, 69614; cds-WP_002885521.1, NZ_KK737551.1, 16316, 16633, +, 318, 29341; cds-WP_002885523.1, NZ_KK737551.1, 16630, 17163, -, 534, 8214; cds-WP_002885526.1, NZ_KK737551.1, 17277, 17636, -, 360, 20614; cds-WP_002885530.1, NZ_KK737551.1, 17647, 18042, -, 396, 148830; cds-WP_004177729.1, NZ_KK737551.1, 18053, 18787, -, 735, 642493; cds-WP_004177727.1, NZ_KK737551.1, 18780, 20570, -, 1791, 290660; cds-WP_004146714.1, NZ_KK737551.1, 20846, 21823, +, 978, 134808; cds-WP_021441059.1, NZ_KK737551.1, 22006, 23508, +, 1503, 47361; cds-WP_004146716.1, NZ_KK737551.1, 23546, 26875, -, 3330, 621773; cds-WP_002885536.1, NZ_KK737551.1, 26899, 27861, -, 963, 556021; cds-WP_002885537.1, NZ_KK737551.1, 28022, 29083, -, 1062, 496037; cds-WP_002885538.1, NZ_KK737551.1, 29178, 29723, +, 546, 151327; cds-WP_032430397.1, NZ_KK737551.1, 29767, 30498, -, 732, 36883; cds-WP_004210690.1, NZ_KK737551.1, 31431, 32570, -, 1140, 330646; cds-WP_187079197.1, NZ_KK737551.1, 32584, 34095, +, 1512, 26689; cds-WP_004220675.1, NZ_KK737551.1, 34100, 34549, +, 450, 122414; cds-WP_004152021.1, NZ_KK737551.1, 34566, 35921, +, 1356, 143371; cds-WP_004152020.1, NZ_KK737551.1, 35932, 37791, +, 1860, 192600; cds-WP_032430401.1, NZ_KK737551.1, 37784, 38734, +, 951, 2581981; cds-WP_002885659.1, NZ_KK737551.1, 38827, 39135, +, 309, 2354660; cds-WP_004146725.1, NZ_KK737551.1, 39211, 40491, +, 1281, 2492143; cds-WP_004146726.1, NZ_KK737551.1, 40557, 41819, +, 1263, 1863617; cds-WP_002885662.1, NZ_KK737551.1, 41822, 42826, +, 1005, 1456846; cds-WP_002885663.1, NZ_KK737551.1, 42909, 43199, -, 291, 1281; cds-WP_002885664.1, NZ_KK737551.1, 43422, 43619, +, 198, 2929; cds-WP_002885665.1, NZ_KK737551.1, 43722, 45020, +, 1299, 1358278; cds-WP_002885667.1, NZ_KK737551.1, 45171, 45596, +, 426, 251126; cds-WP_004192475.1,


NZ_KK737551.1, 45633, 48065, +, 2433, 1484782; cds-WP_002885669.1, NZ_KK737551.1, 48147, 48878, +, 732, 220617; cds-WP _021441063.1, NZ_KK737551.1, 49004, 50641, +, 1638,141519; cds-WP_002885673.1, NZ_KK737551.1, 50632, 50907, -, 276, 394395; cds-WP_002885674.1, NZ_KK737551.1, 51045, 51353, -, 309, 169439; cds-WP _032428483.1, NZ_KK737551.1, 51563, 52279, +, 717, 135572; cds-WP _004177697.1, NZ_KK737551.1, 52276, 53031, -, 756, 126964; cds-WP _032430402.1, NZ_KK737551.1, 53139, 54203, -, 1065, 70730; cds-WP_016946098.1, NZ_KK737551.1, 54566, 55966, +, 1401, 30815; cds-WP_002885682.1, NZ_KK737551.1, 55979, 56284, +, 306, 8929; cds-WP _002885683.1, NZ_KK737551.1, 56294, 56761, +, 468, 139; cds-WP _002885684.1, NZ_KK737551.1, 56775, 57425, +, 651, 382; cds-WP _004210671.1, NZ_KK737551.1, 57435, 58289, +, 855, 3632; cds-WP_004178347.1, NZ_KK737551.1, 58289, 58975, +, 687, 83; cds-WP_009309325.1, NZ_KK737551.1, 59038, 60231, -, 1194, 3791; cds-WP_002885689.1, NZ_KK737551.1, 60381, 60656, -, 276, 13908; cds-WP_002885691.1, NZ_KK737551.1, 60997, 61392, +, 396, 7072507; cds-WP_002885722.1, NZ_KK737551.1, 61398, 61712, +, 315, 8526092; cds-WP_000135199.1, NZ_KK737551.1, 61717, 61944, +, 228, 8257795; cds-WP _002886682.1, NZ_KK737551.1, 61986, 62435, +, 450, 4461235; cds-WP _004177687.1, NZ_KK737551.1, 62544, 63218, -, 675, 221274; cds-WP _002886687.1, NZ_KK737551.1, 63437, 64057, +, 621, 277090; cds-WP _002886688.1, NZ_KK737551.1, 64362, 65765, +, 1404, 457123; cds-WP _004210666.1, NZ_KK737551.1, 65870, 66532, -, 663, 1158; cds-WP _002886691.1, NZ_KK737551.1, 66615, 67586, -, 972, 0; cds-WP _032430405.1, NZ_KK737551.1, 67662, 68486, -, 825, 29200; cds-WP _021441067.1, NZ_KK737551.1, 68564, 69412, -, 849, 121295; cds-WP _004152015.1, NZ_KK737551.1, 69502, 69873, +, 372, 102132; cds-WP _021441068.1, NZ_KK737551.1, 69928, 71871, -, 1944, 147336; cds-WP _032430406.1, NZ_KK737551.1, 72063, 72806, +, 744, 58459; cds-WP _002886706.1, NZ_KK737551.1, 72796, 73353, -, 558, 58536; cds-WP _002886707.1, NZ_KK737551.1, 73677, 73883, +, 207, 96597; cds-WP _004178353.1, NZ_KK737551.1, 73945, 74817, -, 873, 267826; cds-WP_004222103.1, NZ_KK737551.1, 74848, 76857, -, 2010, 79724; cds-WP _016946104.1, NZ_KK737551.1, 76876, 78108, -, 1233, 11961; cds-WP _002886718.1, NZ_KK737551.1, 78310, 79647, -, 1338, 316084; cds-WP _002886721.1, NZ_KK737551.1, 79828, 80466, -, 639, 202284; cds-WP _002886722.1, NZ_KK737551.1, 80675, 82408, +, 1734, 523771; cds-WP_032430407.1, NZ_KK737551.1, 82405, 86181, +, 3777, 414325; cds-WP _002886724.1, NZ_KK737551.1, 86184, 86528, +, 345, 179276; cds-WP_021441069.1, NZ_KK737551.1, 86566, 87039, -, 474, 7465; cds-WP_171789277.1, NZ_KK737551.1, 87011, 87733, -, 723, 133618; cds-WP _021441070.1, NZ_KK737551.1, 87889, 89076, -, 1188, 251445; cds-WP_002886766.1, NZ_KK737551.1, 89151, 89681, -, 531, 1637604; cds-WP_002886769.1, NZ_KK737551.1, 90085, 91041, +, 957, 231209; cds-AF52_RS00620, NZ_KK737551.1, 91165, 92456, +, 1292, 87819; cds-WP_032430409.1, NZ_KK737551.1, 92467, 93492, +, 1026, 771; cds-WP_021312675.1, NZ_KK737551.1, 93479, 94477, +, 999, 163629; cds-WP _002886827.1, NZ_KK737551.1, 94520, 95518, -, 999, 3494421; cds-WP _002886886.1, NZ_KK737551.1, 95694, 97067, +, 1374, 439488; cds-WP_004177666.1, NZ_KK737551.1, 97136, 97663, +, 528, 53707; cds-WP _032430410.1, NZ_KK737551.1, 97707, 98915, -, 1209, 3935; cds-WP _004177664.1, NZ_KK737551.1, 99407, 99958, -, 552, 310983; cds-WP _004152265.1, NZ _KK737551.1, 100054, 101406, +, 1353, 128773; cds-WP _021441074.1, NZ_KK737551.1, 101443, 101829, +, 387, 405498; cds-WP_002886894.1, NZ_KK737551.1, 102119, 102457, +, 339, 30976; cds-WP_002886895.1, NZ_KK737551.1, 102468, 102830, +, 363, 54054; cds-WP _002886896.1, NZ _KK737551.1, 102833, 103132, +, 300, 26800; cds-WP _002886897.1, NZ_KK737551.1, 103154, 103930, +, 777, 117859; cds-WP _004152267.1, NZ_KK737551.1, 103944, 104588, +, 645, 80725; cds-WP _004152268.1, NZ_KK737551.1, 104694, 105827, +, 1134, 136190; cds-WP _021441075.1, NZ_KK737551.1, 105811, 106929, +, 1119, 101248; cds-WP_002886899.1, NZ_KK737551.1, 106926, 107666, +, 741, 42288; cds-WP _002886900.1, NZ_KK737551.1, 107733, 108887, +, 1155, 8249; cds-WP _004152270.1, NZ _KK737551.1, 108910, 110820, +, 1911, 7485; cds-WP _032430412.1, NZ_KK737551.1, 110898, 111140, +, 243, 73467; cds-WP_002886902.1, NZ _KK737551.1, 111130, 111414, +, 285, 106253; cds-WP _004222151.1, NZ_KK737551.1, 111418, 111882, -, 465, 192640; cds-WP _004186701.1, NZ_KK737551.1, 112190, 114328, -, 2139, 92496; cds-WP_021441079.1, NZ_KK737551.1, 114685, 115428, -, 744, 28845; cds-WP_032410138.1, NZ _KK737551.1, 115431, 115604, -, 174, 2792; cds-WP_004178377.1, NZ_KK737551.1, 115689, 115997, +, 309, 18; cds-WP _021441081.1, NZ_KK737551.1, 116088, 117395, +, 1308, 11293; cds-WP_004146783.1, NZ_KK737551.1, 117422, 118774, +, 1353, 534131; cds-WP_004178379.1, NZ_KK737551.1, 118830, 120485, -, 1656, 2889100; cds-WP_021441082.1, NZ_KK737551.1, 120537, 121955, -, 1419, 5970343; cds-WP _004177658.1, NZ_KK737551.1, 122086, 123033, -, 948, 11346; cds-WP_009309303.1, NZ_KK737551.1, 123413, 126121, +, 2709, 273244; cds-WP_002886926.1, NZ_KK737551.1, 126195, 126581, -, 387, 228563; cds-WP _002886927.1, NZ_KK737551.1, 126734, 127195, -, 462, 377161; cds-WP_002886928.1, NZ_KK737551.1, 127209, 128144, -, 936, 944629; cds-WP_002886930.1, NZ_KK737551.1, 128181, 128285, -, 105, 2095; cds-WP _002886939.1, NZ_KK737551.1, 128480, 128932, +, 453, 0; cds-WP _002886940.1, NZ_KK737551.1, 129175, 130149, +, 975, 60723; cds-WP_002886941.1, NZ_KK737551.1, 130161, 130991, +, 831, 34085; cds-WP _021441084.1, NZ _KK737551.1, 131086, 132651, +, 1566, 38909; cds-WP_004152274.1, NZ_KK737551.1, 132708, 134126, +, 1419, 15773; cds-WP_002886945.1, NZ_KK737551.1, 134211, 134936, +, 726, 215773; cds-WP _002886946.1, NZ_KK737551.1, 134939, 135943, -, 1005, 60827; cds-WP_002886947.1, NZ_KK737551.1, 136107, 136529, +, 423, 484177; cds-WP_004186726.1, NZ_KK737551.1, 136588, 137352, +, 765, 940910; cds-WP _004152275.1, NZ_KK737551.1, 137625, 138128, -, 504, 84682; cds-WP_032430414.1, NZ_KK737551.1, 138249, 141104, -, 2856, 3194044; cds-WP_002886953.1, NZ_KK737551.1, 141104, 141547, -, 444, 395535; cds-WP_002886954.1, NZ_KK737551.1, 141667, 143178, -, 1512, 1354534; cds-WP _002886955.1, NZ_KK737551.1, 143568, 144665, +, 1098, 286102; cds-WP_002886956.1, NZ_KK737551.1, 144665, 145747, +, 1083, 171654; cds-WP _002886957.1, NZ_KK737551.1, 145796, 147298, -, 1503, 335237; cds-WP_032430415.1, NZ_KK737551.1, 147397, 148218, -, 822, 70371; cds-WP _004177655.1, NZ_KK737551.1, 148569, 150074, +, 1506, 663347; cds-WP_004186731.1, NZ_KK737551.1, 150093, 150902, +, 810, 758337; cds-WP_004152190.1, NZ_KK737551.1, 151887, 152744, -, 858, 235889; cds-WP _004146797.1, NZ_KK737551.1, 152896, 154809, -, 1914, 1196251; cds-WP_004186736.1, NZ_KK737551.1, 155315, 157255, +, 1941, 596595; cds-WP _004186740.1, NZ_KK737551.1, 157302, 158315, +, 1014, 1275171; cds-WP_021314296.1, NZ_KK737551.1, 158357, 159241, +, 885, 1047858; cds-WP_002886970.1, NZ_KK737551.1, 159265, 160164, +, 900, 273861; cds-WP_021441086.1, NZ_KK737551.1, 160308, 161618, -, 1311, 41062; cds-WP_021441087.1, NZ_KK737551.1, 161758, 162828, -, 1071, 41617; cds-WP _032430419.1, NZ_KK737551.1, 162834, 163658, -, 825, 0; cds-WP _004177643.1, NZ_KK737551.1, 163669, 164556, -, 888, 0; cds-WP_012737244.1, NZ_KK737551.1, 164546, 165430, -, 885, 1894; cds-WP _004178400.1, NZ_KK737551.1, 165561, 166580, -, 1020, 65234; cds-WP_021441090.1, NZ_KK737551.1, 166692, 168161, -, 1470, 22718; cds-WP _032428490.1, NZ _KK737551.1, 168158, 168832, -, 675, 309; cds-AF52_RS00275, NZ _KK737551.1, 169708, 170763, +, 1056, 82265; cds-WP _013815099.1-81, NZ_KK737551.1, 170797, 171765, +, 969, 94175; cds-WP _002887608.1, NZ_KK737551.1, 171853, 172632, +, 780, 25172; cds-WP_032430421.1, NZ_KK737551.1, 172610, 173461, +, 852, 59149; cds-WP_032428518.1, NZ_KK737551.1, 173474, 174535, +, 1062, 484; cds-WP_004146946.1, NZ_KK737551.1, 174553, 175563, +, 1011, 16519; cds-WP _021441152.1, NZ_KK737551.1, 175697, 176629, +, 933, 8340; cds-WP_002887618.1, NZ_KK737551.1, 176684, 178975, -, 2292, 920815; cds-WP_002887620.1, NZ_KK737551.1, 179233, 179724, -, 492, 52692; cds-WP _002887623.1, NZ_KK737551.1, 179790, 180527, -, 738, 182642; cds-WP _004178536.1, NZ_KK737551.1, 180530, 181069, -, 540, 10626; cds-WP_002887631.1, NZ_KK737551.1, 181172, 181645, -, 474, 291; cds-WP_004146059.1, NZ_KK737551.1, 181636, 182412, -, 777, 3916; cds-WP_032430423.1, NZ_KK737551.1, 182692, 183876, +, 1185, 756415; cds-WP _009485342.1, NZ_KK737551.1, 183893, 184774, +, 882, 147998; cds-WP _002887645.1, NZ_KK737551.1, 185040, 185762, +, 723, 146; cds-WP_002887647.1, NZ_KK737551.1, 185723, 186397, +, 675, 89322; cds-WP_004151383.1, NZ_KK737551.1, 186403, 186861, -, 459, 48640; cds-AF52_RS0124785, NZ _KK737551.1, 187200, 187601, +, 402, 19689; cds-WP _013815099.1-82, NZ _KK737551.1, 187633, 188601, +, 969, 69479; cds-AF52_RS00180, NZ_KK737551.1, 188659, 189609, +, 951, 1916; cds-WP _002887652.1, NZ_KK737551.1, 189659, 190447, -, 789, 288847; cds-AF52_RS27680, NZ_KK737551.1, 190554, 190682, -, 129, 1526; cds-WP_013815099.1-83, NZ_KK737551.1, 190741, 191709, -, 969, 92087; cds-AF52_RS00165, NZ _KK737551.1, 191743, 192666, -, 924, 10475; cds-WP_004221147.1, NZ _KK737551.1, 192690, 192860, -, 171, 10705; cds-WP _002887654.1, NZ_KK737551.1, 192931, 193170, +, 240, 117562; cds-WP _023317511.1, NZ_KK737551.1, 193450, 194478, -, 1029, 257008; cds-WP_015959390.1, NZ_KK737551.1, 194581, 194994, +, 414, 25584; cds-WP_021441160.1, NZ_KK737551.1, 194963, 195409, +, 447, 127968; cds-WP _004146044.1, NZ_KK737551.1, 195424, 196101, +, 678, 253479; cds-WP_002887711.1, NZ_KK737551.1, 196192, 197781, +, 1590, 1118682; cds-WP _032430427.1, NZ_KK737551.1, 198001, 198621, +, 621, 101878; cds-WP_002887716.1, NZ_KK737551.1, 198751, 198912, +, 162, 65182; cds-WP _021441162.1, NZ_KK737551.1, 199066, 200139, +, 1074, 56985; cds-WP_004177496.1, NZ_KK737551.1, 200136, 200930, +, 795, 12689; cds-WP_004146034.1, NZ_KK737551.1, 201061, 202338, +, 1278, 456165; cds-WP _004146033.1, NZ_KK737551.1, 202734, 203534, +, 801, 280957; cds-WP _004178548.1, NZ_KK737551.1, 203648, 204970, +, 1323, 221140; cds-WP _004151380.1, NZ_KK737551.1, 205023, 206246, +, 1224, 751457; cds-WP_002887789.1, NZ_KK737551.1, 206349, 207068, +, 720, 689062; cds-WP_032430428.1, NZ_KK737551.1, 207148, 208164, -, 1017, 152621; cds-WP_002887794.1, NZ_KK737551.1, 208164, 208811, -, 648, 75108; cds-WP_004177487.1, NZ_KK737551.1, 208916, 209887, +, 972, 173810; cds-WP _002887800.1, NZ_KK737551.1, 209897, 211279, +, 1383, 156119; cds-WP_002887802.1, NZ_KK737551.1, 211301, 212533, +, 1233, 257422; cds-WP _002887805.1, NZ_KK737551.1, 212627, 214294, -, 1668, 2666600; cds-WP _002887806.1, NZ_KK737551.1, 214523, 216460, +, 1938, 294289; cds-WP _002887809.1, NZ_KK737551.1, 216549, 216878, +, 330, 37604; cds-WP_002887810.1, NZ_KK737551.1, 216865, 217380, -, 516, 116598; cds-WP_002887811.1, NZ_KK737551.1, 217494, 218141, +, 648, 220817; cds-WP _002887812.1, NZ_KK737551.1, 218138, 219007, -, 870, 760718; cds-WP_002887814.1, NZ_KK737551.1, 219217, 219690, +, 474, 149466; cds-WP_002887820.1, NZ_KK737551.1, 219703, 220392, +, 690, 93493; cds-WP _021441167.1, NZ_KK737551.1, 220392, 221816, +, 1425, 85619; cds-WP _004214415.1, NZ_KK737551.1, 221877, 223235, +, 1359, 20858; cds-WP_002887843.1, NZ_KK737551.1, 223298, 224014, -, 717, 3228798; cds-WP_004146984.1, NZ_KK737551.1, 224110, 224250, +, 141, 573050; cds-WP _002887846.1, NZ_KK737551.1, 224647, 225333, +, 687, 326759;









TABLE 11








RNA FISH probes


Name
Species
Gene
Sequence (5′-3′)
Fluorophore




EUB338
Most bacteria
16s rRNA
GCT GCC TCC CGT AGG AGT (SEQ ID NO: 778)
Cy3


cspD51
MGH66
cspD
TCGCCGCCGCCCTCAGGGCA (SEQ ID NO: 779)
Alexa488


cspD53
MGH67
cspD
CGCCGCCGCCCTCAGGGCAGA (SEQ ID NO: 780)
Alexa488


cspD55
MGH68
cspD
TCGCCGCCGCCCTCAGGGCA (SEQ ID NO: 781)
Alexa488


rihC173
MGH66
rihC
GCGCCCTGCGCCAGCGGTACATCGG (SEQ ID NO: 782)
Cy3


rihC431
MGH66
rihC
GCCGCCCATGATCACCAGCCGGC (SEQ ID NO: 783)
Cy3


rihC559
MGH66
rihC
GCCCGGTTGGTGACGTCCAGCCC (SEQ ID NO: 784)
Cy3


rihC715
MGH66
rihC
GTTCCGGGCGGGCCAGCCACGC (SEQ ID NO: 785)
Cy3


rihC817
MGH66
rihC
CGCCGGCTGGCCCAGTCGTCC (SEQ ID NO: 786)
Cy3


rseB224
MGH66
rseB
TCCCGGCGCGGACCGTCCAGCT (SEQ ID NO: 787)
Alexa488


rseB520
MGH66
rseB
CTCCAGCGTTTCCCCGTCGCGGTC (SEQ ID NO: 788)
Alexa488


rseB675
MGH66
rseB
CAGTCACGCCCTGCGGGAGCCACGTC (SEQ ID NO: 789)
Alexa488


yidC145
MGH66
yidC
CTGGCCACTGGCCGGTACGCCCTG (SEQ ID NO: 790)
Cy3


yidC323
MGH66
yidC
GGCCGGTTAAGCCGCTCTGCGCCT (SEQ ID NO: 791)
Cy3


yidC872
MGH66
yidC
GGCCTGGCTGCACCAGTACCGGCT (SEQ ID NO: 792)
Cy3


yidC914
MGH66
yidC
GCCGGGCCGACCCACAGCGTGC (SEQ ID NO: 793)
Cy3









TABLE 12





Summary of genera captured by 16s rRNA DNA sequencing and BacDrop



Number of genera




Total genera captured
58 (16s rRNA); 127 (BacDrop)


Genera captured by both methods
54


Genera captured only by 16s rRNA
54


Genera captured only by BacDrop
73









TABLE 13






Genera captured


Genus
16s rRNA
BacDrop





Lachnoclostridium

4.156
4.295



Roseburia

0.726
0.606



Blautia

0.356
2.263



Anaerostipes

0.109
1.358



Cellulosilyticum

0.014
0.281



Butyrivibrio

0.002
1.361



Eubacterium

6.977
1.444



Clostridium

2.010
1.895



Candidatus Arthromitus

0.141
0.013



Ruminococcus

0.297
0.370



Oscillibacter

1.458
0.975



Dehalobacter

0.007
0.023



Mogibacterium

0.117
0.088



Halanaerobium

0.002
0.008



Lactobacillus

5.848
6.242



Streptococcus

0.014
0.080



Lactococcus

0.005
0.007



Leuconostoc

0.002
0.001



Bacillus

0.011
1.091



Bacillales incertae sedis><wbr>Bacillales Family XI. Incertae Sedis><wbr>Gemella

0.007
0.019



Staphylococcaceae><wbr>Staphylococcus

0.004
0.271



Gordonibacter

0.009
0.007



Olsenella

0.071
0.011



Corynebacteriaceae><wbr>Corynebacterium

0.032
0.127



Bifidobacteriales><wbr>Bifidobacteriaceae><wbr>Bifidobacterium

0.016
0.035



Streptomyces

0.012
0.020



Mycoplasma

0.283
0.069



Ureaplasma

0.224
0.015



Spiroplasmataceae><wbr>Spiroplasma

0.039
0.007



Acholeplasmatales><wbr>Acholeplasmataceae><wbr>Candidatus Phytoplasma

0.039
0.009



Chloroflexi><wbr>...><wbr>Dehalococcoides

0.073
0.003



Chloroflexi><wbr>Dehalococcoidia><wbr>Dehalogenimonas

0.005
NA



Deinococcus-Thermus><wbr>...><wbr>Thermus

0.002
0.001



Muribaculum

6.980
1.591



Prevotella

4.265
1.706



Alistipes

2.828
0.151



Bacteroidaceae><wbr>Bacteroides

1.787
2.525



Parabacteroides

0.402
0.764



Tannerella

0.037
0.102



Porphyromonas

0.004
0.295



Runella

0.279
0.020



Spirosoma

0.002
0.013



Cellulophaga

0.012
0.004



Gramella

0.002
NA



Blattabacteriaceae><wbr>Blattabacterium

0.002
0.004



Gemmatimonas

0.052
0.004



Helicobacter

7.076
1.040



Campylobacteraceae><wbr>Campylobacter

0.002
0.023



Desulfovibrio

0.521
0.937



Klebsiella

0.002
0.011



Psychrobacter

0.005
0.001



Acinetobacter

0.002
0.007



Pseudomonadales><wbr>Pseudomonadaceae><wbr>Pseudomonas

0.004
0.019



Pasteurellales><wbr>Pasteurellaceae><wbr>Aggregatibacter

0.002
NA



Nitrosomonadaceae><wbr>Nitrosomonas

0.002
NA



Verrucomicrobiae><wbr>...><wbr>Akkermansia

0.043
0.042



Chlamydiae><wbr>...><wbr>Chlamydia

0.002
0.004



Nitrospirae><wbr>...><wbr>Leptospirillum

0.007
0.001



Acetobacterium

NA
0.016



Desulfotomaculum

NA
0.232



Desulfitobacterium

NA
0.092



Desulfosporosinus

NA
0.009



Clostridiales incertae sedis><wbr>Clostridiales Family XVII. Incertae Sedis><wbr> Thermaerobacter

NA
0.037



Thermoanaerobacter

NA
0.011



Thermoanaerobacterales Family III. Incertae Sedis><wbr>Thermoanaerobacterium

NA
0.008



Thermoanaerobacterales Family III. Incertae Sedis><wbr>Caldicellulosiruptor

NA
0.005



Enterococcaceae><wbr>Enterococcus

NA
0.068



Oenococcus

NA
0.004



Geobacillus

NA
0.024



Lysinibacillus

NA
0.011



Paenibacillus

NA
0.178



Bacillales incertae sedis><wbr>Bacillales Family XII. Incertae Sedis><wbr>Exiguobacterium

NA
0.015



Dialister

NA
0.035



Megasphaera

NA
0.029



Selenomonas

NA
0.049



Sporomusaceae><wbr>Pelosinus

NA
0.009



Acidaminococcales><wbr>Acidaminococcaceae><wbr>Phascolarctobacterium

NA
0.029



Anaerococcus

NA
0.028



Leucobacter

NA
0.001



Arthrobacter

NA
0.004



Microlunatus

NA
0.016



Nocardioidaceae><wbr>Aeromicrobium

NA
0.013



Streptosporangiales><wbr>Thermomonosporaceae><wbr>Actinomadura

NA
0.001



Chloroflexi><wbr>...><wbr>Chloroflexus

NA
0.007



Tenacibaculum

NA
0.005



Antarcticibacterium

NA
0.005



Flavobacterium

NA
0.004



Hymenobacter

NA
0.023



Sphingobacterium

NA
0.008



Mucilaginibacter

NA
0.003



Chitinophaga

NA
0.007



Arachidicoccus

NA
0.004



Pseudodesulfovibrio

NA
0.012



Desulfomicrobiaceae><wbr>Desulfomicrobium

NA
0.015



Desulfobacterales><wbr>Desulfobacteraceae><wbr>Desulfobacter

NA
0.001



Geobacteraceae><wbr>Geobacter

NA
0.013



Myxococcaceae><wbr>Myxococcus

NA
0.004



Anaeromyxobacteraceae><wbr>Anaeromyxobacter

NA
0.001



Campylobacteraceae><wbr>Arcobacter

NA
0.020



Kosakonia

NA
0.003



Pectobacteriaceae><wbr>Dickeya

NA
0.004



Erwiniaceae><wbr>Pantoea

NA
0.008



Yersiniaceae><wbr>Serratia

NA
0.007



Legionellales><wbr>Legionellaceae><wbr>Legionella

NA
0.007



Vibrio

NA
0.025



Moraxella

NA
0.003



Pasteurellales><wbr>Pasteurellaceae><wbr>Haemophilus

NA
0.013



Alteromonadales><wbr>Colwelliaceae><wbr>Colwellia

NA
0.003



Thiotrichales><wbr>Francisellaceae><wbr>Francisella

NA
0.004


unclassified Rhizobiales><wbr>Methyloceanibacter
NA
0.001



Rhizobiaceae><wbr>Sinorhizobium/Ensifer group><wbr>Sinorhizobium

NA
0.003



Methylocystaceae><wbr>Methylocystis

NA
0.001



Paracoccus

NA
0.004



Labrenzia

NA
0.001



Rhodospirillales><wbr>Rhodospirillaceae><wbr>Azospirillum

NA
0.003



Roseomonas

NA
0.001



Neorickettsia

NA
0.004



Wolbachieae><wbr>Wolbachia

NA
0.003



Anaplasma

NA
0.001


unclassified Burkholderiales><wbr>Burkholderiales Genera incertae sedis><wbr>Thiomonas
NA
0.003



Alcaligenaceae><wbr>Bordetella

NA
0.005



Neisseriaceae><wbr>Neisseria

NA
0.007



Oligoflexia><wbr>...><wbr>Bdellovibrio

NA
0.003



Planctomycetia><wbr>...><wbr>Planctopirus

NA
0.001



Sphaerochaeta

NA
0.025



Treponema

NA
0.015



Spirochaetes><wbr>...><wbr>Brachyspira

NA
0.003



Acidobacteria><wbr>...><wbr>Terriglobus

NA
0.005



Thermotogae><wbr>...><wbr>Marinitoga

NA
0.004



Thermodesulfobacteria><wbr>...><wbr>Thermodesulfobacterium

NA
0.001



Nitrospirae><wbr>...><wbr>Nitrospira

NA
0.001






Various modifications and variations of the described methods, pharmaceutical compositions, and kits of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known customary practice within the art to which the invention pertains and may be applied to the essential features herein before set forth.

Claims
  • 1. A method of generating a single prokaryotic cell cDNA library, wherein the RNAs from different prokaryotic cells are barcoded individually, allowing the cell identity of each RNA to be retained in a single library, the method comprising: a. degrading ribosomal RNA (rRNA) and genomic DNA (gDNA) in a set of fixed and permeabilized cells;b. labeling each mRNA in the fixed and permeabilized cells, the labeling comprising separating the fixed and permeabilized cells into a plurality of first reaction volumes, reverse transcribing the mRNA into cDNA in the fixed and permeabilized cells, and adding a first barcode, a unique molecular identifier (UMI), and a poly-nucleotide tail to each first strand cDNA;c. labeling each cDNA from a same cell in the fixed and permeabilized cells, the labeling comprising separating the fixed and permeabilized cells into separate individual discrete second reaction volumes, conducting a second strand cDNA synthesis in the fixed and permeabilized cells, and adding a second barcode unique to that reaction volume to each second strand cDNA, thus labeling each cDNA with a cell-specific first and second barcode combination and a UMI; andd. amplifying the labeled cDNA and preparing a sequencing library comprising the amplified labeled cDNA.
  • 2. The method of claim 1, further comprising, prior to the degrading step, preparing a set of fixed and permeabilized cells, the preparing comprising: a. fixing each cell of a set of prokaryotic cells; andb. permeabilizing each fixed cell of the set of prokaryotic cells.
  • 3. The method of claim 1, wherein each first reaction volume comprises a plurality of RT primers, and wherein each RT primer comprises (i) a 5′ primer binding sequence (ii) a barcode sequence that is the same for all primers in the same first reaction volume but differs from the barcode sequence of primers in any other first reaction volume, and (iii) a unique molecular identifier (UMI) sequence that is different for each primer in a first reaction volume.
  • 4. The method of claim 1, wherein each second reaction volume comprises a single bead and a plurality of primers capable of hybridizing to the poly-nucleotide tail, wherein each bead comprises a plurality of capture oligonucleotides attached 5′ to the bead surface, and wherein each capture oligonucleotide comprises (i) a barcode sequence that is the same for all capture oligonucleotides on the same bead but differs from the barcode sequence of capture oligonucleotides on other beads and (ii) a capture sequence that is the same as the 5′ primer binding sequence in each RT primer.
  • 5. The method of claim 1, wherein the generating second strand cDNA step is accomplished by linear amplification using the primers capable of hybridizing to the poly-nucleotide tail.
  • 6. The method of claim 1, wherein the second barcode is a bead barcode sequence, and wherein the adding a second barcode step is accomplished by amplifying the second strand cDNA using the capture sequence on the capture oligonucleotides attached to the bead to prime linear amplification.
  • 7. The method of claim 1, wherein mRNA accounts for more than 5%, more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, or more than 80% of total aligned reads.
  • 8. The method of claim 1, wherein the mean mRNA UMI per cell is more than 25, more than 35, more than 45, more than 55, or more than 65.
  • 9. The method of claim 1, wherein each second reaction volume can be loaded with multiple fixed and permeabilized cells.
  • 10. The method of claim 1, wherein each second reaction volume comprises one, two, three, four, five, or six fixed and permeabilized cells.
  • 11. The method of claim 1, wherein each second reaction volume is an aqueous in oil droplet.
  • 12. The method of claim 1, wherein the sequencing library can distinguish species heterogeneity, strain heterogeneity, genotypic heterogeneity and/or phenotypic heterogeneity of the plurality of prokaryotic cells.
  • 13. The method of claim 1, wherein the sequencing library can distinguish species heterogeneity, strain heterogeneity, genotypic heterogeneity and/or phenotypic heterogeneity of one or more uncharacterized organisms, an environmental microbiome, or an organismal microbiome.
  • 14. The method of claim 1, wherein the sequencing library can distinguish phenotypic heterogeneity in the response of the plurality of prokaryotic cells to one or more drug treatments.
  • 15. The method of claim 1, wherein the sequencing library can distinguish phenotypic heterogeneity in the response of the plurality of prokaryotic cells to one or more antibiotic treatments.
  • 16. The method of claim 1, wherein the set of prokaryotic cells is a biological sample obtained from a subject.
CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application Nos. 63/231,899, filed Aug. 11, 2021 and 63/341,067, filed May 12, 2022. The entire contents of the above-identified applications are hereby fully incorporated herein by reference.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

This invention was made with government support under Grant No. AI117043 awarded by the National Institutes of Health. The government has certain rights in the invention. The contents of the electronic sequence listing (“BROD-5365US_ST26.xml”; Size is 850,007 bytes and it was created on Aug. 9, 2022) is herein incorporated by reference in its entirety.

Provisional Applications (2)
Number Date Country
63231899 Aug 2021 US
63341067 May 2022 US