1. Field of the Invention
This invention relates generally to cells that are permissive for hepatitis C virus (HCV) replication, and methods and materials for making and using them.
2. Related Art
Adaptive mutations in the HCV non-structural proteins that increase RNA replication, and the frequency of Huh-7 cells supporting detectable levels of replication, have been identified previously. (Blight, K. J. et al, Science 290:1972-1974, 2000; Guo, J. T. et al., J. Virol. 75:8516-8523, 2001; Kreiger, N. et al., J. Virol. 75:4614-4624, 2001; Lohmann, V. et al., J. Virol. 75:1437-1449, 2001). In particular, replacement of the Serine residue with Isoleucine at position 2204 in NS5A permits HCV replication in ˜10% of transfected Huh-7 cells (a 20,000-fold improvement over non-mutated HCV) and increases replication to a level sufficient for the detection of HCV RNA early after transfection. (Blight et al., 2000). The low frequency of Huh-7 cells supporting HCV replication suggests that the cellular environment may be a major determinant of HCV replication efficiency.
As used herein the term “permissive” for HCV replication, in reference to a particular cell or cell line, means that the particular cell or cell line supports HCV replication at a frequency that is greater than that of the cell or cell line from which it was derived. For example, in certain embodiments described herein, Huh-7 sublines support a higher frequency of HCV replication than the Huh-7 cell line from which they were derived. Thus, the sublines are said to be permissive for HCV replication. In some embodiments, the cell or cell line supports replication of HCV at a frequency of between about 10% to about 30%. In other embodiments, the cell or cell line supports replication of HCV at a frequency of between about 10% and about 75%.
The term “cured” refers to cells substantially free of self-replicating HCV RNA. Example 1 provides a description of one means for curing cells, within the meaning of that term as used herein.
The term “transfection” refers to the infection of a cell with a polynucleotide. The polynucleotide may be either DNA or RNA. Methods of transfecting a cell are known in the art, any of which may be used.
Frequency is ascertained by determining the percent of cells having replicating HCV RNA. One easy way to measure frequency is to determine the percentage of cells that exhibit a characteristic conferred by the HCV RNA, and any method known in the art for accomplishing this is suitable. The examples herein describe such a method utilizing HCV RNA comprising a neo gene and G418 selection.
Unless otherwise noted, conventional techniques of cell culture, molecular biology, microbiology, recombinant DNA and immunology are employed, all of which are within the skill of the art and are described in the literature.
In order to obtain cell lines permissive for HCV replication, clonal and population Huh-7 cell lines supporting adapted and non-adapted subgenomic or full-length RNA replication were cured of HCV RNA by treatment with interferon (IN). Since HCV replication can be readily blocked by IFN, prolonged treatment with IFN cures cells of HCV RNA. A higher percentage of cured cells were able to support HCV replication and facilitated the detection of both subgenomic and full-length replication by multiple assays. Thus, one embodiment described herein comprises a method of making cells and cell lines that are permissive for HCV replication. Such a method comprises curing HCV infected cells. The cured cells may then be assayed to determine the frequency at which cells support HCV replication.
The cells may be any vertebrate cells that are capable of supporting adapted or non-adapted HCV RNA replication. The methods described herein for making cells and cell lines are believed to be applicable to any cell type that is capable of supporting adapted or non-adapted HCV RNA replication. Such cells may include, for example, hepatocytes, T-cells, B-cells, or foreskin fibroblasts, and may be mammalian or more specifically human cells. A particularly useful cell type is hepatocyte cells. For example, Huh-7 cells have been shown to support HCV RNA replication.
It is demonstrated herein that Huh-7 sublines that have been cured are permissive for HCV RNA replication. For the replicon containing the highly adaptive NS5A S2204I mutation, at least 30% of the Huh-7.5 cells can be transduced to G418 resistance. A comparable fraction was positive for the NS3 antigen by FACS. Similarly, for the SG replicons lacking neo (
Other embodiments comprise methods of making cells and cell lines that are permissive for HCV replication. Such methods comprise curing infected cells, and subsequently assaying sublines to determine the frequency with which a particular subline supports HCV replication. Sublines that are particularly permissive may then be identified. The infected cells may be cured by any means. For example, treatment with interferon-α is an effective means of curing cells of HCV infection, although any effective means of curing may be utilized within the scope of this invention.
The most highly permissive sublines (Huh-7.5 and Huh-7.8) were obtained from G418-selected clones that harbored replicons without adaptive changes in the NS3-5B region (at the population sequence level). These cells may represent a subpopulation of the original Huh-7 parental line that are permissive for replication of unmodified replicons as well as more permissive for replicons with adaptive mutations. Curing of other replicon-containing cell lines did not always yield a cell population that was more permissive for the replicons tested. For instance, curing the Huh-7 population containing the SG-Neo (S2204I) replicon, yielded a cell substrate that was unchanged in its ability to support SG-Neo (S2204I), but less efficient (23-fold) for initiation of SG-Neo (5AΔ47) (
The ability to study HCV replication directly after transfection, without the need for G418 selection, allowed for examination of replication of subgenomic replicons lacking neo as well as full-length HCV genome RNAs. Initial attempts to create a monocistronic replicon by fusing cellular ubiquitin in-frame between the first 12 amino acids of core and NS3 {SG-5′Ub-NS3 (S2204I); FIG. 1} were unsuccessful. A bicistronic derivative with ubiquitin fused to NS3-5B was viable, suggesting that the failure of SG-5′Ub-NS3 (S2204I) to replicate was not due to a defect in processing at the ubiquitin/NS3 junction (data not shown). Rather, the fusion of the ubiquitin-coding sequence near the HCV 5′ NTR may have interfered with translation due to the formation of deleterious RNA secondary structures or RNA replication, by disrupting RNA elements that lie in the HCV 5′ NTR or its complement. Fusion of the HCV 5′ NTR to the EMCV IRES yielded a subgenomic replicon that replicated better than SG-Neo (S2204I) (
A similar picture was observed for replication of the full-length constructs containing the NS5A S2204I adaptive change (
In an attempt to further enhance HCV replication in cell culture, the effect of other amino acid substitutions at position 2204 in NS5A was examined. Efficient subgenomic RNA replication was observed for Ile and Val and to a much lesser extent, Ala at position 2204 (
Combining NS5A adaptive mutations resulted in replicons that were either impaired (A2199T+S2204I) or unable to replicate (S2197P+A2199T+S2204I) in Huh-7.5 cells (
The phosphorylation of NS5A is conserved among divergent HCV genotypes (Reed, K. E. et al, J. Virol. 71:7187-7197, 1997) suggesting that it plays an important role in the virus life cycle. We previously showed that NS5A hyperphosphorylation is not essential for HCV replication (Blight, K. J. et al., Science 290:1972-1974, 2000). Following the recent identification of S2194 as a major phosphate acceptor site for subtype 1b (Katze, M. G. et al, Virology 278:501-513), Ala or Asp was substituted at this position and the effect on HCV replication was examined in the context of the S2204I adaptive mutation. Given the incompatibilities observed when combining NS5A mutations, the absolute replication efficiencies of the different mutants could not be evaluated, however replicating RNAs were recovered that harbored these substitutions at the 2194 locus. These results show that phosphorylation at S2194 is not an absolute requirement for replication of this subtype 1b isolate.
Various embodiments of the invention are described in the following examples. These examples are to be considered exemplary only, and are not intended to be limiting.
Huh-7 cell monolayers were propagated in Dulbecco's modified minimal essential medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 0.1 mM non-essential amino acids (DMEM-10% FBS). For cells supporting subgenomic replicons, 750 μg/ml G418 (Geneticin; Gibco-BRL) was added to the culture medium. Replicon-containing Huh-7 cells were cured of HCV RNA by initially passaging cells twice in the absence of G418. On the third passage cells were cultured with 100 IU/ml of human leukocyte-derived IFN (Sigma-Aldrich). After 3-4 days, confluent monolayers were trypsinized, plated and cultured for 24 h before the addition of IFN. Cells were passaged a total of four times in the presence of IFN and prior to the fourth passage cells were grown for 3 days without IFN. Cured cell lines were expanded and cryopreserved at early passage levels. Further experiments were conducted using cells that been passaged less that 20-30 times from these cryopreserved seed lots.
Standard recombinant DNA technology was used to construct and purify all plasmids. Primed DNA synthesis was performed with KlenTaqLA DNA polymerase (kindly provided by Wayne Barnes, Washington University, St. Louis), and regions amplified by PCR were confirmed by automated nucleotide sequencing. Plasmid DNAs for in vitro transcription were prepared from large-scale bacterial cultures and purified by centrifugation in CsCl gradients.
All nucleotides (nt) and amino acid numbers refer to the location within the genotype 1b Con1 full-length HCV genome (Genbank Accession no. AJ238799; SEQ ID NO:27) commencing with the core-coding region. This sequence was assembled from chemically synthesized DNA oligonucleotides in a step-wise PCR assay essentially as described previously (5). Briefly, 10-12 gel-purified oligonucleotides (60-80 nt in length) with unique complementary overlaps of 16 nt were used to synthesize cDNAs spanning 600-750 bases. The final PCR products were purified, digested with appropriate restriction enzymes, and ligated into the similarly cleaved pGEM3Zf(+) plasmid vector (Promega). Multiple recombinant clones were sequenced, correct clones identified and overlapping cDNA fragments assembled into the contiguous genomic sequence: 5′NTR-C-E1-E2-p7-NS2-3-4A-4B-5A-5B-3′NTR (pHCVBMFL). The selectable replicon, pHCVrep1bBartMan/AvaII {SG-Neo (wt);
The plasmid pC-Ubi-NS3/HCVrepBBVII {SG-5′Ub-NS3 (S2204I); FIG. 1} containing ubiquitin instead of the neo gene and EMCV IRES was constructed as follows. An AscI-SacI digested PCR fragment amplified from pHCVrep12/Neo (Blight et al., unpublished results) with primers 1289 and 1290 (Table 1) and the SacI-BsrGI portion of a second PCR product generated using the primer pair 1291/1292 (Table 1) with pHCVrep1b/BBVII were ligated between the XbaI and BsrGI sites of HCVrep1b/BBVII together with the XbaI-AscI fragment from HCVrep1b/BBVII. To delete the neo gene from pHCVrep1b/BBVII, synthetic overlapping oligonucleotides 1287 and 1288 (Table 1) were hybridized and extended to create the junction between the 5′ NTR and the EMCV IRES. This product was digested with ApaLI and AclI, and inserted, together with XbaI-ApaLI and AclI-EcoRI fragments from pHCVrep1b/BBVII, into XbaI-EcoRI digested pHCVrep1b/BBVII. This construct was named p5′NTR-EMCV/HCVrepBBVII {SG-5′HE (S2204I); FIG. 1}. To replace S2204I with NS5AΔ47, the EcoRI-XhoI fragment from pHCVrep1b/BBI was ligated into similarly cleaved p5′NTR-EMCV/HCVrepBBVII, generating p5′NTR-EMCV/HCVrepBBI {SG-5′HE (5AΔ47); FIG. 1}.
The plasmid p5′NTR-EMCV/HCVFLBM(S2204I) {FL-5′HE (S2204I); FIG. 1} was created by ligating the XbaI-HindIII fragment from p5′NTR-EMCV/HCVrepBBVII, the HindIII-AatII fragment of a PCR product amplified from p5′NTR-EMCV/HCVrepBBVII using primers 1293 and 1294 and the AatII-NotI fragment from pHCVBMFL/S2204I into pHCVBMFL/S2204I previously digested with XbaI and NotI. The selectable bicistronic full-length HCV clone pHCVBMFL(S2204I)/Neo {FL-Neo (S2204I); FIG. 1} was assembled by ligating the XbaI-HindIII fragment from pHCVrep1b/BBVII and the HindIII-EcoRI fragment from p5′NTR-EMCV/HCVBMFL(S2204I) between the XbaI and EcoRI sites of pHCVrep1b/BBVII.
To obtain plasmids with mutations at position 2204, and to introduce single A2199T or double S2197P/A2199T mutations into p5′NTR-EMCV/HCVrepBBVII, PCRs were first performed using p5′NTR-EMCV/HCVrepBBVII as a template with the reverse primer 1030 and one of the following mutant forward primers: 1319 (S2204V), 1320 (S2204A), 1322 (S2204Y), 1324 (S2204E), 1325 (S2204T), 1184 (S2204D), 1326 (A2199T+S2204I) and 1327 (S2197P+A2199T+S2204I) (Table 1). PCR-amplified products were digested with BlpI and XhoI and cloned into these sites in p5′NTR-EMCV/HCVrepBBVII. S2204 was engineered by insertion of the EcoRI-XhoI fragment from pHCVrep1bBartMan/AvaII into similarly cleaved p5′NTR-EMCV/HCVrepBBVII.
To engineer the mutation, Q1112R, into p5′NTR-EMCV/HCVrepBBVII in order to create p5′NTR-EMCV/HCVrepCloneA (Q1112R+S2204I), nt 3640-3991 of NS3 were PCR amplified from p5′NTR-EMCV/HCVrepBBVII using mutant primer 1358 and oligonucleotide 885 (Table 1). The resulting product was digested with BsrGI and EagI and combined in a ligation reaction mixture with the EagI-EcoRI and BsrGI-EcoRI fragments from p5′NTR-EMCV/HCVrepBBVII. The double mutation (E1202G+T1280I) in NS3 was created via a multistep cloning procedure. First, a PCR fragment amplified from p5′NTR-EMCV/HCVrepBBVII with forward primer 1359 and reverse primer 1356 (Table 1) was digested with ApaLI and XbaI and cloned into EcoRI-XbaI digested pGEM3Zf(+) together with the EcoRI-ApaLI fragment from pGEM3Zf(+)/HCV1bnt1796-2524, containing nt 3420-4124 in NS3 (K. J. Blight and C. M. Rice, unpublished results), generating the intermediate plasmid pGEM3Zf(+)/HCV1bnt1796-2524NS3*. Second, in a four part cloning strategy, the BsrGI-BsaAI fragment, excised from pGEM3Zf(+)/HCV1bnt1796-2524NS3*, was inserted, together with fragments BsaAI-BssHII and BssHII-EcoRI from p5′NTR-EMCV/HCVrepBBVII, into p5′NTR-EMCV/HCVrepBBVII cleaved with BsrGI and EcoRI. The resultant plasmid was named p5′NTR-EMCV/HCVrepBBVII+NS3* (E1202G+T1280I+S2204I).
The mutations S2194A and S2194D were introduced by using primer pairs 5′Ala/1030 and 5′Asp/1030 (Table 1), respectively to PCR amplify nt 6897-7186 in NS5A from pHCVrep1b/BBVIII. These mutations were incorporated into pHCVrep1b/BBVII by replacing the BlpI-XhoI portion with the corresponding BlpI-XhoI digested PCR product.
Plasmid DNAs containing full-length and subgenomic HCV sequences were linearized with ScaI and a poliovirus subgenomic replicon digested with BamHI. The linearized DNAs were phenol:chloroform (1:1) extracted, and precipitated with ethanol. Pelleted DNAs were washed in 80% ethanol and resuspended in 10 mM Tris-HCl (pH 8.0)/1 mM EDTA (pH 8.0). RNA transcripts were synthesized at 37° C. for 90 min in a 100 μl reaction mixture containing 40 mM Tris-HCl (pH 7.9), 10 mM NaCl, 12 mM MgCl2, 2 mM spermidine, 10 mM dithiothreitol (DTT), 3 mM of each nucleoside triphosphate, 0.025 U of inorganic pyrophosphatase (Roche Applied Science), 100 U of RNasin (Promega), 100 U of T7 RNA polymerase (Epicentre Technologies), and 2 μg of linearized DNA. RNA was extracted with phenol-chloroform (1:1), ethanol precipitated, and the pellet washed in 80% ethanol before resuspension in ddH2O. DNA template was removed by three serial DNase digestions for 20 min at 37° C. in 33 mM Tris-HCl (pH 7.8), 66 mM KCl, 10 mM MgCl2 and 5 mM DTT containing 10 U of DNase I (Roche Applied Science). DNase-digested RNAs were extracted with phenol:chloroform (1:1), ethanol precipitated and the RNA pellet resuspended in ddH20 after washing in 80% ethanol. The RNA concentration was determined by measurement of the optical density at 260 nm and the integrity and concentration confirmed by 1% agarose gel electrophoresis and ethidium bromide staining.
In vitro-transcribed RNA was transfected into Huh-7 and IFN-cured cells by electroporation. Briefly, subconfluent Huh-7 cells were detached by trypsin treatment, collected by centrifugation (500×g, 5 min), washed three times in ice-cold RNase-free phosphate-buffered saline (PBS) and resuspended at 1.25×107 cells/ml in PBS. RNA transcripts (1 μg) were mixed with 0.4 ml of washed Huh-7 cells in a 2-mm gap cuvette (BTX) and immediately pulsed (0.92 kV, 99 μsec pulse-length, 5 pulses) using a BTX ElectroSquarePorator. Pulsed cells were left to recover for 10 min at room temperature (rt) and then diluted into 10 ml DMEM-10% FBS. Cells were plated in: (i) 35-mm diameter wells for quantifying HCV RNA and for metabolic labeling experiments; (ii) eight-well chamber slides (Becton Dickinson) for immunofluorescence studies or; (iii) 100-mm diameter dishes for fluorescent activated cell sorting (FACS) analysis and G418 selection. To determine the efficiency of G418-resistant colony formation, transfected cells were plated at multiple densities (between 1×103 and 2×105 cells), together with cells transfected with pol RNA transcripts such that the total cell number was maintained at 2×105 cells per 100-mm diameter dish. Forty-eight hours after plating, medium was replaced with DMEM-10% FBS supplemented with 1 mg/ml G418. Three weeks later, G418 resistant foci were fixed with 7% formaldehyde and stained with 1% crystal violet in 50% ethanol to facilitate colony counting. The G418 transduction efficiency was calculated based on the number of G418-selected colonies relative to the number of Huh-7 cells plated after electroporation.
Transfection efficiency was monitored for each series of RNAs by electroporating in parallel a poliovirus subgenomic replicon expressing green fluorescent protein (GFP; A. A. Kolykhalov and C. M. Rice, unpublished results). Transfected cells were observed for poliovirus replicon-induced cytopathic effect and GFP expression visualized using a fluorescent inverted microscope at 12-16 h posttransfection. After 24 h, the surviving attached cells (presumably not transfected with the poliovirus replicon) were trypsinized, mixed with trypan blue and viable cells counted to determine the percentage of cells electroporated.
Total cellular RNA was isolated using TRizol reagent (Gibco-BRL) according to the Manufacturer's protocol. One-tenth of each RNA sample was used to quantify HCV-specific RNA levels using an ABI PRISM 7700 Sequence Detector (Applied Biosystems). Real time reverse transcription (RT)-PCR amplifications were performed using the TaqMan EZ RT-PCR core reagents (Applied Biosystems) and primers specific for the HCV 5′ NTR: 5′-CCTCTAGAGCCATAGTGGTCT-3′ (SEQ ID NO: 1) (sense, 50 μM), 5′ CCAAATCTCCAGGCATTGAGC-3′ (SEQ ID NO: 2) (antisense, 50 μM) and FAM-CACCGGAATTGCCAGGACGACCGG (SEQ ID NO: 3) probe, 10 μM; (Applied Biosystems). RT reactions were incubated for 30 min at 60° C., followed by inactivation of the reverse transcriptase coupled with activation of Taq polymerase for 7 min at 95° C. Forty cycles of PCR were performed with cycling conditions of 15 sec at 95° C. and 1 min at 60° C. Synthetic HCV RNA standards of known concentration were included with each set of reactions and used to calculate a standard curve. The real time PCR signals were analyzed using SDS v1.6.3 software (Applied Biosystems).
Transfected cell monolayers were removed from 100-mm diameter culture dishes by versene/EDTA treatment and a single cell suspension prepared by passing cells through a 16-gauge needle and a 74 μm pore membrane. Cells were resuspended at 2×106 per ml, an equal volume of 4% paraformaldehyde added to the cell suspensions and incubated for 20 min at rt. Fixed cells were washed twice with PBS and the resultant cell pellet resuspended at 2×106 cells per ml in 0.1% saponin/PBS. After incubation for 20 min at rt, cells were stained (1 h at rt) with HCV-specific monoclonal antibodies (mAbs; core (C750), NS3 (1B6) and NS5B (12B7); all generously provided by Darius Moradpour, University of Freiburg, Freiburg, Germany) diluted to 10 μg/ml in 3% FBS/0.1% saponin/PBS. Cells were washed three times with 0.1% saponin/PBS and bound mAb detected by incubation for 1 h at rt with anti-mouse IgG conjugated to Alexa 488 (Molecular Probes) diluted 1:1000 in 3% FBS/0.1% saponin/PBS. Stained cells were washed three times with 0.1% saponin/PBS, resuspended in FACSflow buffer (BD Biosciences) and analyzed immediately using a FACS Calibur (BD Biosciences).
Electroporated Huh-7.5 cells seeded in eight-well chamber slides were washed with PBS and fixed in 4% paraformaldehyde for 20 min at rt. Cells were washed twice with PBS, permeabilized by incubation with 0.1% saponin/PBS for 20 min at rt and blocked with 3% goat serum for 20 min at rt. The NS5B mAb (12B7) was diluted to 10 μg/ml in 0.1% saponin/3% goat serum/PBS and incubated for 1 h at rt, followed by three washes with 0.1% saponin/PBS. Bound mAb were detected by incubating for 1 h at rt with anti-mouse IgG conjugated to Alexa 488 diluted 1:1000 in 0.1% saponin/3% goat serum/PBS. Nuclei were stained for 20 min at rt with 10 μg/ml Hoechst 33342 (Sigma-Aldrich) in PBS. Unbound fluorescent conjugate was removed by three washes with 0.1% saponin/PBS, cells mounted in Vectashield (Vector Laboratories) and viewed with a fluorescent microscope (Nikon, Eclipse TE300).
Cell monolayers in 35-mm diameter wells were incubated for 0.5-10 h in methionine-and-cysteine-deficient MEM containing 1/40th the normal concentration of methionine, 5% dialyzed FBS and Express 35S-protein labeling mix (140 μCi/ml; NEN). Labeled cells were washed once with cold PBS and harvested in 200 μl of sodium dodecyl sulfate (SDS) lysis buffer (0.1 M sodium phosphate buffer (pH 7.0), 1% SDS, 1× complete protease inhibitor cocktail (Roche Applied Science), 80 μg phenylmethylsulfonyl fluoride (PMSF) per ml) and cellular DNA sheared by repeated passage through a 27.5-gauge needle. Equal amounts of protein lysates (50 μl) were heated at 75° C. for 10 min and clarified by centrifugation prior to mixing with 200 μl of TNA (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.67% bovine serum albumin, 1 mM EDTA, 0.33% triton X-100, 80 μg of PMSF per ml). One-μl of HCV positive patient serum (JHF) was added, and immune complexes allowed to form by incubation overnight at 4° C. with rocking. Immune complexes were collected by adding 50 μl of prewashed Pansorbin cells (Calbiochem) and incubation for 1-2 h at 4° C. with rocking. Immunoprecipitates were collected by centrifugation and washed three times in TNAS (TNA containing 0.125% SDS) and once with TNE (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 80 μg of PMSF per ml), solubilized by heating at 80 ° C. for 20 min in protein sample buffer and separated on an SDS-10% polyacrylamide gel. Metabolically labeled proteins were visualized by fluorography.
From 22 G418-resistant clones (Blight, K. J. 2000), clones Huh-7.5 and Huh-7.8, harboring SG-Neo subgenomic replicons with no amino acid changes within the HCV NS region, as well as clone Huh-7.4, containing a replicon with the Ser to Ile change at position 2204 in NS5A, were cured. Uncloned population lines Huh-7/S2204I and Huh-7/5AΔ47 (Blight, K. J. 2000), selected with G418 after transfection of subgenomic replicons containing either S2204I in NS5A {SG-Neo (S2204I); FIG. 1} or the 47 amino acid NS5A deletion {SG-Neo (5AΔ47); FIG. 1}, were also treated with IFN. To exclude the possibility that IFN treatment alone may alter the ability of Huh-7 cells to support HCV replication, the parental Huh-7 cells were treated with IFN in parallel. Following IFN treatment, cells were shown to lack HCV RNA by a nested RT-PCR specific for the 3′ NTR where the detection limit was ˜10 molecules of HCV RNA (Kolykhalov, A. A., J. Virol. 70:3363-3371) and by sensitivity to G418.
To examine the ability of IFN-cured cell lines to support HCV replication, three G418-selectable replicons, SG-Neo (S2204I), SG-Neo (5AΔ47) and SG-Neo (wt) (
The two cured cell populations, Huh-7/5AΔ47 and Huh-7/S2204I, showed either comparable or modest increases in G418 transduction efficiencies after transfection of the adapted replicon RNA originally present within the population line (
Since the cured Huh-7.5 line was the most permissive of those tested, we examined HCV replication in this subline compared with the parental Huh-7 cells using a number of different methods. We focused on transient assays that would allow an assessment of HCV replication early after transfection without the need for G418 selection. Ninety-six hours after transfection with SG-Neo (S2204I) and SG-Neo (5AΔ47) RNA (
This finding was mirrored by the frequency of NS3-positive cells measured by FACS analysis. The percentage of NS3-positive cells was consistently higher in Huh-7.5 cells {21% for SG-Neo (S2204I) and 5% for SG-Neo (5AΔ47);
HCV protein accumulation was examined by metabolically labeling cells 96 h after transfection. Cell monolayers were labeled with 35S-methionine and -cysteine for 10 h, followed by SDS-mediated lysis and immunoprecipitation of HCV proteins with a HCV-positive patient serum (JHF) recognizing NS3, NS4B and NS5A (Grakoui, A. et al., J. Virol. 67:1385-1395). After separation of labeled proteins by SDS-PAGE, NS3, NS4B and NS5A were only visible in Huh-7.5 cells transfected with SG-Neo (S2204I) (
The ability to monitor HCV replication without selection eliminated the need for bicistronic replicons and allowed constructs with minimal heterologous elements to be tested. A subgenomic replicon was engineered in which the HCV 5′ NTR and 12 amino acids of core were fused to ubiquitin followed by the NS3-5B coding region (including the S2204I adaptive mutation in NS5A) and the 3′ NTR {SG-5′Ub-NS3 (S2204I); FIG. 1}. In this polyprotein, cellular ubiquitin carboxyl-terminal hydrolase will cleave at the ubiquitin/NS3 junction to produce NS3 with an authentic N-terminal Ala residue (2, 21). In vitro-synthesized RNA was electroporated into Huh-7.5 and Huh-7 cells and the level of HCV RNA quantified 96 h later by RT-PCR. Surprisingly, HCV RNA levels did not differ from the por control (data not shown), indicating that SG-5′Ub-NS3 (S2204I) RNA failed to replicate. It is possible that ubiquitin may interfere with the production of a functional NS3 protein. However, a bicistronic derivative, where expression of ubiquitin/NS3-5B was under the control of the EMCV IRES, replicated as efficiently as SG-Neo (S2204I) RNA (data not shown), suggesting that HCV IRES driven translation may be sensitive to RNA elements present within the core-ubiquitin coding sequence.
A replicon lacking neo but retaining the EMCV IRES (SG-5′HE derivatives;
Thus far, the best single mutation that has been identified is the S2204I substitution in NS5A. To examine the importance of Ile at this position and to see if replication efficiency could be improved further, a number of other amino acids were tested at this position and compared the replication efficiency of these replicons to SG-5′HE (S2204I) or the unmodified parent, SG-5′HE (S2204) (
The replication efficiency of subgenomic replicons carrying multiple adaptive mutations in NS5A was investigated. NS5A mutations S2197P, A2199T and S2204I independently enhance G418-resistant colony formation approximately 2,500-, 15,000- and 20,000-fold, respectively (5). SG-5′HE replicons (
NS3 changes at positions 1112 (Q to R), 1202 (E to G) and 1280 (T to I) were engineered into SG-5′HE (S2204I) (
The role of NS5A phosphorylation in HCV replication remains a mystery. Previously, differences were noted in the extent of NS5A phosphorylation between replicons with different adaptive mutations in NS5A (Blight et al. 2000). For example, replicons with S2197C, S2197P or S2204I expressed minimal or no p58 as assessed by one-dimensional SDS-PAGE separation of immunoprecipated NS5A, suggesting that NS5A hyperphosphorylation is not essential for HCV replication. Recently, S2194 in NS5A of a subtype 1b isolate was identified as the-primary site of p56 phosphorylation (Katze et al. 2000). To assess the possible requirement for phosphorylation of NS5A S2194, this residue was mutated in SG-Neo (S2204I) (
Figure Legends
As various modifications could be made in the constructions and methods herein described and illustrated without departing from the scope of the invention, it is intended that all matter contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative rather than limiting. Thus, the breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments.
GAT
CCCCCCTCCTTGGCCAGCTC (SEQ ID NO:26)
aNucleotide changes are highlighted in bold and the resultant codon is underlined
bRestriction sites used for cDNA cloning are underlined
cThe polarities of oligonucleotides are indicated either the HCV genome RNA sense (+) or its complement (−)
This application is the national stage application of PCT Patent Application No. PCT/U.S.2003/36634, filed Nov. 13, 2003, which claims priority to U.S. Provisional Application No. 60/426,256, filed Nov. 13, 2002.
This invention was made with U.S. Government support under grant numbers CA57973 and AI40034. The U.S. Government may have certain rights in this invention.
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/US03/36634 | 11/13/2003 | WO | 00 | 10/11/2005 |
Publishing Document | Publishing Date | Country | Kind |
---|---|---|---|
WO2004/044182 | 5/27/2004 | WO | A |
Number | Name | Date | Kind |
---|---|---|---|
6127116 | Rice | Oct 2000 | A |
6630343 | Bartenschlager | Oct 2003 | B1 |
Number | Date | Country |
---|---|---|
1 267 167 | Dec 2002 | EP |
WO 0189364 | Nov 2001 | WO |
WO 02059321 | Aug 2002 | WO |
Number | Date | Country | |
---|---|---|---|
20060099595 A1 | May 2006 | US |
Number | Date | Country | |
---|---|---|---|
60426256 | Nov 2002 | US |