The present invention relates to the field of medicine, in particular of oncology. It provides a new prognostic and/or diagnostic marker in human cancer.
Cancer occurs when cell division gets out of control and results from impairment of a DNA repair pathway, the transformation of a normal gene into an oncogene or the malfunction of a tumor supressor gene. Many different forms of cancer exist. The incidence of these cancers varies but it represents the second highest cause of mortality, after heart disease, in most developed countries. While different forms of cancer have different properties, one factor which many cancers share is the ability to metastasize. Distant metastasis of all malignant tumors remains the primary cause of death in patients with the disease.
The therapeutic care of the patients having cancer is primarily based on surgery, radiotherapy and chemotherapy and the practitioner has to choose the most adapted therapeutic strategy for the patient. In the majority of the cases, the choice of the therapeutic protocol is based on the anatomo-pathological and clinical data. Currently, the methods to determine prognosis and select patients for adjuvant therapy rely mainly on pathological and clinical staging. However, it is very difficult to predict which localized tumor will eventuate in distant metastasis.
Therefore, there is a great need for the identification of prognostic markers that can accurately distinguish tumors associated with poor prognosis including high probability of metastasis, early disease progression, increased disease recurrence or decreased patient survival, from the others. Using such markers, the practitioner can predict the patient's prognosis and can effectively target the individuals who would most likely benefit from adjuvant therapy.
The inventors demonstrate that HP1α is overexpressed in cancer cells in comparison with non-tumoral cells and that high HP1α expression levels in cancer cells are correlated with a poor prognosis including early disease progression, increased metastasis formation, increased disease recurrence and/or decreased patient survival.
Accordingly, in a first aspect, the present invention concerns a method for predicting or monitoring clinical outcome of a subject affected with a cancer, wherein the method comprises the step of determining the expression level of HP1α in a cancer sample from said subject, a high expression level of HP1α being indicative of a poor prognosis. Preferably, a poor prognosis is a decreased patient survival and/or an early disease progression and/or an increased disease recurrence and/or an increase metastasis formation.
In a second aspect, the present invention concerns a method for diagnosing a cancer in a subject, wherein the method comprises the step of determining the expression level of HP1α in a sample from said subject, a high expression level of HP1α indicating that said subject suffers from a cancer.
In a third aspect, the present invention concerns a method for selecting a subject affected with a cancer for an adjuvant chemotherapy and/or radiotherapy or determining whether a subject affected with a cancer is susceptible to benefit from an adjuvant chemotherapy and/or radiotherapy, wherein the method comprises the step of determining the expression level of HP1α in a cancer sample from said subject, a high expression level of HP1α indicating that an adjuvant chemotherapy and/or radiotherapy is required.
In a last aspect, the present invention concerns a method for monitoring the response to a treatment of a subject affected with a cancer, wherein the method comprises the step of determining the expression level of HP1α in a cancer sample from said subject before the administration of the treatment , and in a cancer sample from said subject after the administration of the treatment, a decreased expression level of HP1α in the sample obtained after the administration of the treatment indicating that the subject is responsive to the treatment.
In one embodiment, the expression level of HP1α is determined by measuring the quantity of HP1α protein or HP1α mRNA.
In a further embodiment, the quantity of HP1α protein is measured by immunohistochemistry, semi-quantitative Western-blot or by protein or antibody arrays.
In another further embodiment, the quantity of HP1α mRNA is measured by quantitative or semi-quantitative RT-PCR, or by real time quantitative or semi-quantitative RT-PCR or by transcriptome approaches.
In another embodiment, the methods of the invention comprise the step of comparing the expression level of HP1α to a reference expression level. Additionally, the methods of the invention further comprise the step of determining whether the expression level of HP1α is high compared to said reference expression level.
In a further embodiment, the reference expression level is the expression level of HP1α in a normal sample.
Alternatively, the reference expression level is the expression level of a gene having a stable expression in different cancer samples, such as RPLPO gene.
In still another embodiment, the method according to the invention further comprises assessing at least one another cancer or prognosis markers such as tumor grade, hormone receptor status, mitotic index, tumor size, HJURP expression level or expression of proliferation markers such as Ki67, MCM2, CAF-1 p60 and CAF-1 p150.
In still another embodiment, the cancer is a solid cancer or a hematopoietic cancer, preferably a solid cancer and more preferably, an early stage solid cancer without local or systemic invasion.
Preferably, the cancer is selected from the group consisting of breast cancer, pancreas cancer, uterus and cervix cancers, ovary cancer, prostate cancer and leukemia. More preferably, the cancer is breast cancer. Even more preferably, the cancer is an early stage breast cancer without local or systemic invasion.
Frozen uterus tissue sections were stained for HP1α, β and γ by immunohistochemistry and counterstained with hematoxylin. Tissue arrays were processed identically for the three antibodies.
Mammalian cells contain three closely related Heterochromatin Protein 1 iso forms, HP1α, β and γ, which, by analogy to their unique counterpart in S. pombe, have been implicated in gene silencing, genome stability and chromosome segregation.
A first possible link between HP1 proteins and tumorigenesis was put forward through the observation that HP1 interacts with the tumor suppressor Retinoblastoma protein (Rb) (Nielsen et al, 2001b; Williams & Grafi, 2000) and participates in the Rb-dependent silencing of cell cycle genes, such as Cyclin E (Nielsen et al, 2001b). Similarly, HP1 interacts with the transcriptional co-repressor KAP-1 (Ryan et al, 1999), which is involved in the regulation of the E2F1 (Wang et al, 2007) and p53 (Wang et al, 2005) proteins. Furthermore, HP1α, and γ are found in a complex with Chromatin assembly factor 1 (CAF-1) (Murzina et al, 1999; Quivy et al, 2004), of which the intermediate subunit p60 is a validated proliferation marker in breast cancer (Polo et al, 2004). However, the specific and/or common regulation patterns of the three HP1 isoforms in relation to cell proliferation, quiescence and cancer remained elusive.
The inventors demonstrated that HP1α shows the unique property of displaying a proliferation-dependent expression pattern and that a significant overexpression of HP1α, but not β or γ, was observed in cancer cells when compared to non-tumoral cells derived from the same patient. This HP1α overexpression was observed in pancreas, uterus, ovary, prostate and breast carcinomas. These results show that HP1α constitutes a marker for diagnosis of multiple types of cancer. Inventors herein also demonstrate that HP1α expression levels in carcinomas correlate with clinical data and disease outcome. They show that high HP1α expression levels in carcinomas correlate with decreased patient survival, early disease progression, increased disease recurrence and/or increased occurrence of metastasis over time, i.e. a poor prognosis.
As used herein, the term “HP1α” refers to the heterochromatin protein 1-alpha, a highly conserved nonhistone protein. Three accession numbers correspond to the human HP1α in Genbank: NP—001120793, NP—001120794, NP—036249. This protein is encoded by the gene CBX5 (GeneID: 23468).
The term “cancer” or “tumor”, as used herein, refers to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. This term refers to any type of malignancy (primary or metastases). Typical cancers are solid or hematopoietic cancers such as breast, stomach, oesophageal, sarcoma, ovarian, endometrium, bladder, cervix uteri, rectum, colon, lung or ORL cancers, paediatric tumours (neuroblastoma, glyoblastoma multiforme), lymphoma, leukaemia, myeloma, seminoma, Hodgkin and malignant hemopathies. Preferably, the cancer is selected from the group consisting of breast cancer, pancreas cancer, uterus and cervix cancers, ovary cancer, prostate cancer and leukemia. Preferably the cancer is a solid cancer, more preferably an early stage solid cancer without local or systemic invasion. Preferably, the solid cancer is breast cancer, more preferably an early stage breast cancer without local or systemic invasion.
As used herein, the term “treatment”, “treat” or “treating” refers to any act intended to ameliorate the health status of patients such as therapy, prevention, prophylaxis and retardation of the disease. In certain embodiments, such term refers to the amelioration or eradication of a disease or symptoms associated with a disease. In other embodiments, this term refers to minimizing the spread or worsening of the disease resulting from the administration of one or more therapeutic agents to a subject with such a disease.
As used herein, the term “chemotherapeutic treatment” or “chemotherapy” refers to a cancer therapeutic treatment using chemical or biochemical substances, in particular using one or several antineoplastic agents.
The term “radiotherapeutic treatment” or “radiotherapy” is a term commonly used in the art to refer to multiple types of radiation therapy including internal and external radiation therapies or radioimmunotherapy, and the use of various types of radiations including X-rays, gamma rays, alpha particles, beta particles, photons, electrons, neutrons, radioisotopes, and other forms of ionizing radiations.
The term “adjuvant therapy”, as used herein, refers to chemotherapy or radiotherapy given as additional treatment, usually after surgical resection of the primary tumor, in a patient affected with a cancer that is at risk of metastasizing and/or likely to recur. The aim of such an adjuvant treatment is to improve the prognosis.
As used herein, the term “poor prognosis” refers to a decreased patient survival and/or an early disease progression and/or an increased disease recurrence and/or an increased metastasis formation.
As used herein, the term “subject” or “patient” refers to an animal, preferably to a mammal, even more preferably to a human, including adult, child and human at the prenatal stage. However, the term “subject” can also refer to non-human animals, in particular mammals such as dogs, cats, horses, cows, pigs, sheeps and non-human primates, among others, that are in need of treatment.
The term “sample”, as used herein, means any sample containing cells derived from a subject, preferably a sample which contains nucleic acids. Examples of such samples include fluids such as blood, plasma, saliva, urine and seminal fluid samples as well as biopsies, organs, tissues or cell samples. The sample may be treated prior to its use. The term “cancer sample” refers to any sample containing tumoral cells derived from a patient, preferably a sample which contains nucleic acids. Preferably, the sample contains only tumoral cells. The term “normal sample” refers to any sample which does not contain any tumoral cells. The methods of the invention as disclosed below, may be in vivo, ex vivo or in vitro methods, preferably in vitro methods.
In previous studies, an increased expression of HP1α has been correlated with a decreased invasive potential among several breast cancer cell lines (Kirschmann et al., 2000; Norwood et al., 2006). Inventors herein surprisingly demonstrate that high expression levels of HP1α are on the contrary associated with a poor prognosis and thus with an increase risk of death.
Accordingly, the present invention concerns a method for predicting or monitoring clinical outcome of a subject affected with a cancer, wherein the method comprises the step of determining the expression level of HP1α in a cancer sample from said subject, a high expression level of HP1α being indicative of a poor prognosis.
In an embodiment, the method further comprises the step of providing a cancer sample from the subject.
The expression level of HP1α can be determined from a cancer sample by a variety of techniques. In an embodiment, the expression level of HP1α is determined by measuring the quantity of HP1α protein or HP1α mRNA.
In a particular embodiment, the expression level of HP1α is determined by measuring the quantity of HP1α protein. The quantity of HP1α protein may be measured by any methods known by the skilled person. Usually, these methods comprise contacting the sample with a binding partner capable of selectively interacting with the HP1α protein present in the sample. The binding partner is generally a polyclonal or monoclonal antibody, preferably monoclonal. Polyclonal and monoclonal antibodies anti-HP1α are commercially available. Examples of these marketed antibodies are the mouse monoclonal anti-HP1α 2HP-1H5 from Euromedex (directed against amino acids 67-119), the rabbit polyclonal anti-HP1α H2164 from Sigma (directed against amino acids 177-191) and the mouse monoclonal anti-HP1α 2HP-2G9 from Euromedex. The other antibodies used in the different methods to quantify the HP1α protein are well known by the skilled person and are commercially available. The quantity of HP1α protein may be measured by semi-quantitative Western blots, enzyme-labeled and mediated immunoassays, such as ELISAs, biotin/avidin type assays, radioimmunoassay, immunoelectrophoresis or immunoprecipitation or by protein or antibody arrays. The protein expression level may be assessed by immunohistochemistry on a tissue section of the cancer sample (e.g. frozen or formalin-fixed paraffin embedded material). The reactions generally include revealing labels such as fluorescent, chemiluminescent, radioactive, enzymatic labels or dye molecules, or other methods for detecting the formation of a complex between the antigen and the antibody or antibodies reacted therewith. Preferably, the quantity of HP1α protein is measured by immunohistochemistry or semi-quantitative western-blot. HP1α detection by immunohistochemistry does not require an antigen-unmasking step, unlike the routinely used marker Ki-67, and thus speeds up the staining process.
In another embodiment, the expression level of HP1α is determined by measuring the quantity of HP1α mRNA. Methods for determining the quantity of mRNA are well known in the art. For example the nucleic acid contained in the sample (e.g., cell or tissue prepared from the patient) is first extracted according to standard methods, for example using lytic enzymes or chemical solutions or extracted by nucleic-acid-binding resins following the manufacturer's instructions. The extracted mRNA is then detected by hybridization (e.g., Northern blot analysis) and/or amplification (e.g., RT-PCR). Preferably quantitative or semi-quantitative RT-PCR is preferred. Real-time quantitative or semi-quantitative RT-PCR is particularly advantageous. Preferably, primer pairs were designed in order to overlap an intron, so as to distinguish cDNA amplification from putative genomic contamination. An example of primer pair which may be used in this method is presented in the experimental section and is constituted by the primers of SEQ ID NO. 8 and SEQ ID NO. 9. Other primers may be easily designed by the skilled person. Other methods of Amplification include ligase chain reaction (LCR), transcription-mediated amplification (TMA), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA). Preferably, the quantity of HP1α mRNA is measured by quantitative or semi-quantitative RT-PCR or by real-time quantitative or semi-quantitative RT-PCR or by transcriptome approaches.
In an embodiment, the method further comprises the step of comparing the expression level of HP1α to a reference expression level.
In a particular embodiment, the reference expression level is the expression level of HP1α in a normal sample. The normal sample is a non-tumoral sample, preferably from the same tissue than the cancer sample. The normal sample may be obtained from the subject affected with the cancer or from another subject, preferably a normal or healthy subject, i.e. a subject who does not suffer from a cancer. Preferably, the normal sample is obtained from the same subject than the cancer sample. Expression levels obtained from cancer and normal samples may be normalized by using expression levels of proteins which are known to have stable expression such as RPLPO (acidic ribosomal phosphoprotein PO), TBP (TATA box binding protein), GAPDH (glyceraldehyde 3-phosphate dehydrogenase) or β-actin.
In another embodiment, the reference expression level is the expression level of a gene having a stable expression in different cancer samples. Such genes include for example, RPLPO, TBP, GAPDH or β-actin. Preferably, the reference expression level is the expression level of the RPLPO gene. The use of the human acidic ribosomal phosphoprotein PO (RPLPO) gene as reference was described in the article of de Cremoux et al. (de Cremoux et al., 2004). In a preferred embodiment, the quantity of HP1α mRNA is normalized according to the quantity of RPLPO mRNA. The quantity of RPLPO mRNA is used as reference quantity (i.e. 100%). The quantity of HP1α mRNA is expressed as a relative quantity with respect to the quantity of RPLPO mRNA.
In a further embodiment, the method further comprises the step of determining whether the expression level of HP1α is high compared to the reference expression level.
If the reference expression level is the expression level of HP1α in a normal sample, the expression level of HP1α in the cancer sample is considered as high if, after normalization, the level is at least 1.5-fold higher than the expression level in the normal sample. Preferably, the expression level of HP1α in the cancer sample is considered as high if the level is at least 2-fold higher, or 3, 4, 5 or 6-fold higher, than the expression level in the normal sample.
If the reference expression level is the expression level of a gene having a stable expression in different cancer samples, in particular the expression level of the RPLPO gene, the expression level of HP1α is considered as high if the level or quantity of HP1α mRNA is of at least 7, 8, 9, 10, 11, 12, 13, 14 or 15% of the RPLPO mRNA level or quantity. In a preferred embodiment the expression level of HP1α is considered as high if the level or quantity of HP1α mRNA is of at least 10% of the RPLPO mRNA level or quantity. This cut-off value may be easily adjusted by the skilled person using another reference gene. This cut-off value is in particular applicable for breast cancer. This value may vary depending on the type of cancer and will be easily adapted by the one skilled in the art.
In an embodiment, the present method further comprises assessing at least one another cancer or prognosis marker such as tumor grade, hormone receptor status, mitotic index, tumor size, HJURP expression level or expression of proliferation markers such as Ki67, MCM2, CAF-1 p60 and CAF-1 p150, preferably expression of CAF-1 proliferation markers. These markers are commonly used and the results obtained with these markers may be combined with the results obtained with the present method in order to confirm the prognosis. The use of these markers is well-known by the skilled person. As example, the tumor grade may be determined according the Elston & Ellis method (Elston & Ellis, 2002), the hormone receptor status (estrogen and progesterone) may be determined at the protein or at the mRNA level, the mitotic index may be determined by counting mitotic cells in ten microscopic fields of a representative tissue section and the tumor size can be detected by imaging techniques (e.g. mammography), by palpation or after surgery in the excised tissue. Expression of Ki67 and CAF-1 can be assessed at the protein level or at the mRNA level. High grade, high mitotic index, large size and/or high Ki67 or CAF-1 expression are indicative for a worse prognosis. The HJURP expression level may be assessed as described in Hu et al., 2010. High HJURP expression is associated with poor clinical outcomes.
Using multivariate statistical analyses, the inventors have demonstrated, in the experimental section below, that HP1α expression levels predict disease outcome better than these standard prognostic markers.
Until now, the expression level of HP1 has been compared in different cancer cell lines but no study was performed to compare the HP1 expression levels in tumoral and non-tumoral cells. The inventors herein show, for the first time, that HP1α is specifically overexpressed in tumoral cells when compared to the HP1α expression in non-tumoral cells derived from the same patient. Such an overexpression thus constitutes a marker for diagnosis of multiple types of cancer, in particular breast cancer.
Accordingly, the present invention concerns a method for diagnosing a cancer in a subject, wherein the method comprises the step of determining the expression level of HP 1α in a sample from said subject, a high expression level of HP1α indicating that said subject suffers from a cancer.
In an embodiment, the method further comprises the step of providing a sample from the subject. Preferably, this sample is suspected to contain tumoral cells.
The expression level of HP1α in this sample is determined as described above, preferably by measuring the quantity of HP1α protein or HP1α mRNA.
In an embodiment, the method further comprises the step of comparing the expression level of HP1α to a reference expression level, preferably, the expression level of HP1α in a normal sample. The normal sample is, as described above, a non-tumoral sample, preferably from the same tissue than the sample to be tested. The normal sample may be obtained from the subject to be diagnosed or from another subject, preferably a healthy subject. Expression levels obtained from the normal sample and from the sample to be tested may be normalized using expression levels of protein which are known to have a stable expression, such as described herein above.
In a further embodiment, the method further comprises the step of determining whether the expression level of HP1α is high compared to said reference expression level. A subject is diagnosed to suffer from a cancer if the expression level of HP1α in the sample to be tested is at least 10, 25, 50 or 75% higher than in the normal sample. Preferably, the subject is diagnosed to suffer from a cancer if the expression level of HP1α in the sample to be tested is at least 25% higher than in the normal sample.
In another embodiment, the present method further comprises assessing at least one another marker used to diagnose cancer such as tumor grade, mitotic index, tumor size, HJURP expression level or expression of proliferation markers such as Ki67, MCM2, CAF-1 p60 and CAF-1 p150, preferably expression of CAF-1 proliferation markers. These markers are commonly used for diagnostic purposes and the results obtained with these markers may be combined with the results obtained with the present method in order to confirm the diagnosis.
The present invention also concerns a method for providing useful information for the diagnosis of a cancer in a subject, wherein the method comprises the step of determining the expression level of HP1α in a sample from said subject, a high expression level of HP1α indicating that said subject suffers from a cancer. In an embodiment, the method further comprises the step of providing a cancer sample from the subject.
In a further aspect, the present invention concerns a method for selecting a subject affected with a cancer for an adjuvant chemotherapy and/or radiotherapy or determining whether a subject affected with a cancer is susceptible to benefit from an adjuvant chemotherapy and/or radiotherapy, wherein the method comprises the step of determining the expression level of HP1α, in a cancer sample from said subject, a high expression level of HP1α indicating that an adjuvant chemotherapy and/or radiotherapy is required.
In an embodiment, the method further comprises the step of providing a cancer sample from the subject.
The expression level of HP1α in the cancer sample is determined as described above, preferably by measuring the quantity of HP1α protein or HP1α mRNA.
In an embodiment, the method comprises the step of comparing the reference expression level of HP1α to a reference expression level as described above in relation with the method for predicting clinical outcome. The reference expression level may be the expression level of HP1α in a normal sample or the expression level of a gene having a stable expression in different cancer samples, such as the RPLPO gene.
In a further embodiment, the method further comprises the step of determining whether the expression level of HP1α is high compared to said reference expression level. In a particular embodiment, the expression level of HP1α in the cancer sample is considered as high if, after normalization, the level is at least 1.5, 2, 3, 4, 5 or 6-fold higher than the expression level in the normal sample. Preferably, the expression level of HP1α in the cancer sample is considered as high if the level is at least 1.5-fold higher than the expression level in the normal sample. In another particular embodiment, the expression level of HP1α is considered as high if the quantity of HP1α mRNA is of at least 7, 8, 9, 10, 11, 12, 13, 14 or 15% of the RPLPO mRNA quantity. Preferably, the expression level of HP1α is considered as high if the quantity of HP1α mRNA is of at least 10% of the RPLPO mRNA quantity.
As explained above, these cut-off values are particularly adapted to breast cancer and may vary according to the type of cancer. However, the skilled person can easily adapt this cut-off.
A high expression level of HP1α indicates a decreased patient survival and/or an early disease progression and/or an increase disease recurrence and/or an increase metastasis formation. Accordingly, this type of cancer associated with poor prognosis has to be treated with adjuvant chemotherapy and/or radiotherapy in order to improve the patient's chance for survival. The type of adjuvant therapy is chosen by the practitioner.
In an embodiment, the present method further comprises assessing at least one another cancer and prognosis marker such as tumor grade, hormone receptor status, mitotic index, tumor size, HJURP expression level or expression of proliferation markers such as Ki67, MCM2, CAF-1 p60 and CAF-1 p150, preferably expression of CAF-1 proliferation markers. The results obtained with these markers may be used to confirm the result obtained with the method according to the invention and/or to orientate the choice of the adjuvant therapy.
In a last aspect, the present invention further concerns a method for monitoring the response to a treatment of a subject affected with a cancer, wherein the method comprises the step of determining the expression level of HP1α in a cancer sample from said subject before the administration of the treatment, and in a cancer sample from said subject after the administration of the treatment, a decreased expression level of HP1α in the sample obtained after the administration of the treatment indicating that the subject is responsive to the treatment.
In an embodiment, the method further comprises the step of providing a cancer sample from the subject.
The treatment may be any chemotherapeutic or radiotherapeutic treatment. A first cancer sample is obtained from the subject before the administration of the treatment. A second sample is obtained from the same subject after the administration of the treatment. Preferably, the second sample is collected when a significant effect on cell proliferation can be expected, dependent on the chosen treatment. In an embodiment, the second sample is collected at least 2 days after administration of the treatment, preferably one week after said administration.
The responsiveness of the patient to the treatment is evaluated by determining the expression level of HP1α in tumoral cells before and after the treatment. The expression level of HP1α in the cancer sample is determined as described above, preferably by measuring the quantity of HP1α protein or HP1α mRNA. A lower expression level of HP1α in tumoral cells contained in the sample collected after the treatment in comparison with the expression level of HP1α in tumoral cells contained in the sample collected before the treatment indicates that the subject is responsive to the treatment.
In an embodiment, the method further comprises assessing at least one another cancer marker such as tumor grade, hormone receptor status, mitotic index, tumor size, HJURP expression level or expression of proliferation markers such as Ki67, MCM2, CAF-1 p60 and CAF-1 p150, preferably expression of CAF-1 proliferation markers.
This method may also provide an indication of the required duration and/or intensity of the treatment. In this case, a follow-up after each cycle of treatment permits to determine if the expression level of HP1α is lower than before the treatment, and thus to adjust the treatment duration and/or intensity accordingly.
The present invention further concerns the use of HP1α as a prognosis marker in cancer, preferably in human cancer and more preferably in human breast cancer. In a preferred embodiment, HP1α is used as a prognosis marker in an early stage breast cancer without local or systemic invasion. As used herein, the term “prognosis marker” refers to a compound, i.e. HP1α, used to predict or monitor clinical outcome of a subject affected with a cancer.
The present invention also concerns the use of HP1α as a diagnosis marker for cancer, preferably for human cancer and more preferably for human breast cancer. As used herein, the term “diagnosis marker” refers to a compound, i.e. HP1α, used to diagnose a cancer in a subject.
The present invention also concerns the use of HP1α as a marker for selecting a subject affected with a cancer for an adjuvant therapy and/or radiotherapy or determining whether a subject affected with a cancer is susceptible to benefit from an adjuvant chemotherapy and/or radiotherapy. Preferably, the cancer is a human cancer and more preferably for human breast cancer.
The present invention further concerns the use of HP1α as a marker for monitoring the response to a treatment of a subject affected with a cancer. Preferably, the cancer is a human cancer and more preferably for human breast cancer.
HP1α may be used as marker in any one of the methods of the invention as described above.
In another aspect, the present invention further concerns a kit
(a) for predicting or monitoring clinical outcome of a subject affected with a cancer; and/or
(b) for diagnosing a cancer in a subject; and/or
(c) for selecting a subject affected with a cancer for an adjuvant therapy and/or radiotherapy or determining whether a subject affected with a cancer is susceptible to benefit from an adjuvant chemotherapy and/or radiotherapy; and/or
(d) for monitoring the response to a treatment of a subject affected with a cancer,
wherein the kit comprises
(i) at least one antibody specific to HP1α and, optionally, means for detecting the formation of the complex between HP1α and said at least one antibody; and/or
(ii) at least one probe specific to the HP1α mRNA or cDNA and, optionally, means for detecting the hybridization of said at least one probe on HP1α mRNA or cDNA; and/or
(iii) at least one nucleic acid primer pair specific to HP1α mRNA or cDNA and, optionally, means for amplifying and/or detecting said mRNA or cDNA; and,
(iv) optionally, a leaflet providing guidelines to use such a kit.
Further aspects and advantages of the present invention will be described in the following examples, which should be regarded as illustrative and not limiting.
Cell Culture and Synchronization
Wi38 primary lung fibroblasts (ATCC) and BJ primary foreskin fibroblasts (ATCC) were cultured in MEMc medium (GIBCO), MCF7 breast cancer cells and HeLa cervical carcinoma cells in DMEM (GIBCO), Hs578T breast cancer cells in RPMI medium (GIBCO) containing 10 mM insulin (Sigma) and Hs578Bst healthy mammary cells (ATCC) in DMEM containing 30 ng/ml Epidermal Growth Factor (TEBU). Media were supplemented with 10% fetal calf serum (Eurobio) and 10 mg/ml penicillin and streptomycin (GIBCO).
For synchronization in quiescence, primary cells were grown in serum-free medium for at least 72 h and MCF7 cells for 48 h in medium containing 10 nM of the anti-estrogen ICI182780 (Fischer Bioblock Scientific) (Carroll et al, 2000).
Synchronization was checked by flow cytometry as in (Polo et al, 2004) and data analyzed using FlowJo (Tree Star Inc.).
HeLa cells were synchronized in the different stages of the cell cycle as described in (Polo et al, 2004). BJ cells were synchronized similarly, except that they were blocked for 14 h, released for 10 h, blocked again for 14 h and released for 3 h, 6 h or 12 h for S-phase, G2 and G1, respectively. For mitotic BJ cells, 10 ng/ml nocodozole was added 4 h after the second release from thymidine and cells were harvested 10 h later. Synchronization was analyzed by flow cytometry as described in (Polo et al, 2004). Analysis of flow cytometry data was done using FlowJo (Tree Star Inc.) software.
Transfections and siRNAs
HeLa cells, plated in medium without antibiotics, were transfected with 30 nM siRNA using Oligofectamine reagent (Invitrogen) and Optimem 1 medium (Gibco). siRNA sequences: siGFP: AAGCUGGAGUACAACUACAAC (SEQ ID No. 1); siHP1α—1: CCUGAGAAAAACUUGGAUUTT (SEQ ID No. 2) (Obuse et al, 2004); siHP1α—3: GGGAGAAGTCAGAAAGTAA (SEQ ID No. 3); siHP1β: AGGAATATGTGGTGGAAAA (SEQ ID No. 4); siHPly: AGGTCTTGATCCTGAAAGA (SEQ ID No. 5).
BJ primary cells were transfected at passage 27 (8 passages after reception from ATCC) using nucleofection (Amaxa), according to manufacturer's instructions. Briefly, 4×105 cells were transfected with 0.8 nmol siRNA (Dharmacon) or 1 μg of plasmid DNA in 100 μl Nucleofector solution R (Amaxa), using the nucleofection program X-001. Cells were subsequently plated at a density of 7000 cells/cm2 to permit cell proliferation without reaching confluency within 4 days.
Live Cell Imaging
For live cell imaging, BJ cells were transfected twice with siRNA, with a 72 h interval.
A plasmid coding for H2B-cherry was introduced in the second transfection, and cells were plated on glass bottom dishes (Mattek). Movies were made using the BioStation system (Nikon). Images were acquired every 20 minutes, during a period of 24 hours, starting 48 hours after the second transfection. Movies were analyzed using Image J.
Cell Extracts
For total cell extracts, after a wash in PBS, cells were scraped from plates in 1× Laemmli buffer (60 mM Tris-Hcl pH 6.8; 10% glycerol; 2% sodium dodecyl sulfate (SDS); 1% 2-mercaptoethanol and 0.002% bromophenol blue) and these extracts were boiled 10 min before storage at −20° C.
Chromatin-bound cell extracts were made according to (Martini et al, 1998). Protein concentrations were determined using Bio-Rad Protein Assay solution.
Antibodies
Primary antibodies: mouse monoclonal anti-HP1α 2HP-1H5 from Euromedex and rabbit polyclonal anti-HP1α H2164 from Sigma (directed against amino acids 67-119 and 177-191, respectively) for immunofluorescence and immunohistochemistry, mouse monoclonal anti-HP1α 2HP-2G9 for Western blot (Euromedex), mouse monoclonal anti-HP1β 1MOD1A9 (Euromedex), mouse monoclonal anti-HP1γ 2MOD-1G6-AS (Euromedex), anti-CREST human serum, rabbit polyclonal anti-CAF-1 p60, mouse monoclonal anti-β-actin AC-15 (Sigma), mouse monoclonal anti-KL1 antibody (Dako), rabbit polyclonal anti-Cyclin A (Santa Cruz), mouse monoclonal anti-H3S10P (Abcam ab14955) and rabbit polyclonal anti-Cdt1 (Santa Cruz 28262).
Secondary antibodies: Fluorescein isothiocyanate (FITC) or Texas Red-coupled antibodies (immunofluorescence) or horseradish peroxidase-coupled antibodies (Western Blotting) were from Interchim.
Western Blotting
After 30 min treatment with 25 U benzonase nuclease (Novagen), cell extracts were loaded on 4-12% gradient gels (Invitrogen), using 1×MES migration buffer (Invitrogen), followed by Western Blotting procedures as in (Martini et al, 1998).
Immunofluorescence
After fixation in 2% paraformaldehyde, cells were permeabilized in 0.2% Triton X-100 in PBS. Immunofluorescence detection was carried out as in (Martini et al, 1998). Coverslips were mounted in Vectashield mounting medium containing 4′,6-Diamidino-2-phenylindole (DAPI) (Vector Laboratories).
For immunofluorescence on tissue samples, 8 μm cryosections made from frozen mammary tissues (Curie Institute, Paris, France) were fixed on glass slides in 3% paraformaldehyde and immunostained as above.
Immunohistochemistry
8 μm cryosections from frozen mammary tissues (Curie Institute, Paris, France) or frozen tissue arrays (FMC401, Biomax) were used. Sections, fixed on glass slides in 3% paraformaldehyde and permeabilized in PBS containing 0.5% Triton for 4 min, were incubated 5 min in 3% H2O2 (Prolabo) for peroxidase inhibition and blocked in PBS containing 1% BSA and 5% non-fat milk. Incubation with primary antibody diluted in blocking solution was followed by revelation with horseradish peroxidase-coupled secondary antibody (DakoCytomation) and Diaminobenzidine (DakoCytomation) before counterstaining with hematoxyline (Merck). Slides were dehydrated in increasing ethanol concentrations and toluene before mounting in Entellan mounting medium (Merck).
RNA Extraction, Quantitative RT-PCR and Primers
The mRNeasy mini kit (Qiagen) was used for total RNA extraction from cell lines or frozen patient samples and cDNA were produced using Superscript II reverse transcriptase (Invitrogen) with 1 μg RNA and 3 μg of random primers (Invitrogen) per reaction. The Lightcycler 2.0 System (Roche) and the Lightcycler FastStart DNA Master SYBR Green I reaction kit (Roche) were used for quantitative PCR. For the patient samples, the 96-well plate Step One Plus system (Applied Biosystems) and the SYBR Green PCR Master mix (Applied Biosystems) were used. Duplicates were measured and three subsequent cDNA dilutions were carried out to assess primer efficiency. Primer pairs were designed in order to overlap an intron, so as to distinguish cDNA amplification from putative genomic contamination. Primers: RPLPO forward: GGCGACCTGGAAGTCCAACT (SEQ ID NO. 6); RPLPO reverse: CCATCAGCACCACAGCCTTC (SEQ ID NO. 7); HP1α forward: GATCATTGGGGCAACAGATT (SEQ ID NO. 8); HP1α reverse: TGCAAGAACCAGGTCAGCTT (SEQ ID NO. 9); CAF-1 p150 forward: CAGCAGTACCAGTCCCTTCC (SEQ ID NO. 10); CAF-1 p150 reverse: TCTTTGCAGTCTGAGCTTGTTC (SEQ ID NO. 11); CAF-1 p60 forward: CGGACACTCCACCAAGTTCT (SEQ ID NO. 12); CAF-1 p60 reverse: CCAGGCGTCTCTGACTGAAT (SEQ ID NO. 13). The quantity of HP1α mRNA was normalized according to the human acidic ribosomal phosphoprotein PO (RPLPO) (de Cremoux et al, 2004) by applying x=E(Cp RPLPO-Cp HP1α), in which E was the mean efficiency of primer pairs and in which x reflected the quantity of HP1α mRNA relative to the quantity of RPLPO mRNA in a given sample.
Breast Cancer Patient Samples and Statistics
The present study included 92 breast cancer samples, selected from the Institut Curie Biological Resources Center for treatment with primary conservative tumorectomy (median tumor size: 18 mm [6-50 mm]). Patients were diagnosed in 1995 and found to be lymph node negative (NO) and metastasis free (MO). Patients were informed of research purposes and did not express opposition. Patient's and tumor characteristics are provided in the above Table I. RNA was extracted from cryopreserved tissue and analyzed as described above. RNA of 86 samples was of sufficient quality for further analysis.
Differences between groups were analysed by χ 2 or Fisher exact tests for categorical variables and Kruskal-Wallis for continuous variables. Recurrence-free and alive patients were censored at the date of their last known contact. Survival data were defined as the time from diagnosis of breast cancer until the occurrence of disease progression, defined as local recurrence in the treated breast, regional recurrence in lymph node-bearing areas, controlateral breast cancer or distant recurrences. Determination of a cut-off value prognostic for the Disease free Interval (DFI) was computed using a Cox proportional risks model. A Wald test was used to evaluate the prognostic value of this variable on each event. The overall survival (OS), Metastasis Free Interval and DFI rates were estimated by the Kaplan-Meier method, and groups were compared using a log-rank test. Multivariate analysis was carried out to assess the relative influence of prognostic factors on OS and DFI, using the Cox stepwise forward procedure (Cox 1972). Significance level was 0.05. Analyses were performed using R software 2.5.0 version.
Results
HP1α Expression Depends on Cell Proliferation
Recent studies have described a downregulation of HP1 proteins in differentiated blood cells compared to undifferentiated blood cells (Baxter et al, 2004; Gilbert et al, 2003; Istomina et al, 2003; Ritou et al, 2007). This downregulation could be a common response to cell cycle exit, or a specific consequence of (blood) cell differentiation. To address this issue, the inventors examined whether transient cell cycle exit, which is not accompanied by a differentiation process, similarly results in HP1 downregulation. Using two different human primary fibroblast cell lines (WI38 and BJ), in which quiescence is induced by serum starvation, the inventors observed lower protein levels of HP1α, but not β or γ, in quiescent cells compared to proliferating cells (
The observed downregulation of HP1α in quiescence could either be specific for the quiescent state or reflect an expression restricted to a specific stage of the cell cycle. The inventors therefore analyzed HP1α levels during the cell cycle in synchronized HeLa cells. In contrast to the cell cycle marker Cyclin A, they did not observe significant variation in HP1α levels in the synchronized cell populations (
HP1α is Overexpressed in Breast Cancer Cells
The proliferation-dependent expression of HP1α suggests a possible differential expression between tumoral and non-tumoral cells, as found for proliferation markers including CAF-1 p60 (Polo et al, 2004). To examine this issue, the inventors used mammary cells derived from the same patient, either tumoral (Hs578T) or non-tumoral (Hs578Bst) (Hackett et al, 1977), to be relevant in our comparison. Besides total cell extract, they analyzed levels of HP1 proteins both in the soluble fraction and in the fraction bound to chromatin (
Both in the chromatin-bound and in the soluble nuclear fraction, the inventors observed higher HP1α levels in tumoral Hs578T cells than in non-tumoral Hs578Bst cells, while HP1β or γ display little differences in expression compared to the loading control β-actin (
The present analysis of chromatin-bound and soluble fractions suggests that overexpressed HP1α in tumoral cells is partially chromatin-bound and thus possibly important for chromatin organization. This seems consistent with its nuclear localization, which is granular and diffuse in the non-tumoral mammary cells but clearly localized into discrete spots in a large fraction of the breast cancer cells (
HP1α Downregulation Results in Mitotic Defects
The proliferation-dependent expression of HP1α, which is not observed for HP1β or γ, points to a unique function of this isoform and suggests that high amounts of this protein could confer an advantage for cell growth. Interestingly, downregulation of CAF-1 p150 results in a pronounced S-phase arrest in a manner that depends on its interaction with HP1 proteins (Quivy et al, 2008; Quivy et al, 2004). The inventors thus tested whether high expression levels of HP1α, β or γ are required for human cancer cell proliferation. By transfecting HeLa cells with siRNA against HP1α, β or γ, they obtained a specific downregulation of each of the HP1 isoforms (
Since HeLa cells already show a high fraction of deficient mitoses (˜20%) and of micronucleated cells (˜10%), the inventors used primary fibroblasts, proficient for cell cycle control and checkpoint activity for further analysis. Transient transfection with two different siRNAs against HP1α resulted in a specific downregulation of this isoform (
HP1α Overexpression in Human Cancer Samples
The proliferation-dependent expression of HP1α and its overexpression in breast cancer cells lines prompted the inventors to study HP1α expression in the physiological context of human cancer. First, data from published transcriptome studies performed in different tissue types, were analyzed using the Oncomine database (Rhodes et al, 2004). These data showed that HP1α is significantly and consistently overexpressed in several types of solid tumors, as well as in leukemia (
The present results in cultured cells systematically showed that the difference in HP1α protein levels was more pronounced than the corresponding mRNA levels (
To determine the importance of HP1α overexpression for tumor growth and disease outcome, cryopreserved breast carcinoma specimens that were collected in 1995, were selected. The inventors focused on node negative and metastasis-free invasive carcinoma of which the size (median 18 mm; range 6-50 mm) permitted primary conservative tumorectomy. These cases would benefit from new prognostic markers for the indication of adjuvant chemotherapy. Patient's and tumor characteristics are provided in Table I as presented below.
The median follow-up is 146 months (range 30-161). At 10 years, overall survival, distant recurrence and disease progression rates were 90% [83-97%], 87% [80-95%] and 70% [61-81%], respectively. HP1α mRNA expression levels were measured by quantitative RT-PCR in 86 samples and expression levels were normalized to the reference gene ribosomal protein P0-like protein (RPLPO) (de Cremoux et al, 2004). The inventors found that high levels of HP1α tend to associate with increased age of the patient (p=0.0014) and larger, highly mitotic, grade III tumors (non-significant) (
In multivariate analyses, adjusted for known prognostic factors (i.e. patient's age, mitotic index, tumor grade, tumor size, hormone receptor status and Ki67 levels), only HP1α expression is an independent prognostic factor for overall survival (p=0.0431): high (>10) HP1α levels are associated with an increased risk of death (Relative Risk=3.76 [1.03-13.7]). Similarly, adjusted for the same parameters, only high HP1α expression (p=0.0077; Relative Risk=3.02 [1.38-6.63]) and high tumor grade (p=0.0170; Relative Risk for grade III=4.53 [1.51-13.6]) are pejorative for disease progression.
In conclusion, the present results of immunohistochemistry demonstrate that HP1α, but not β or γ, is overexpressed in multiple types of human cancer cells. Furthermore, quantitative RT-PCR analysis carried out for HP1α showed significant correlation with clinopathological data and disease outcome. In the present series of 86 small breast tumors, high HP1α expression remained the only independent prognostic factor for overall survival after adjustment for classical prognostic markers, such as the mitotic index, tumor grade, tumor size, hormone receptor status or Ki67. Taken together, these data demonstrate that HP1α constitutes a new chromatin-related marker of cell proliferation and tumorigenesis of clinical relevance for prognosis of breast cancer and other types of cancer.
Discussion
A Unique Regulation of the HP1α Isoform
The HP1 family of proteins has been identified more than 20 years ago (James & Elgin, 1986), but the common or divergent functions of the three isoforms remain largely unknown. The present results show that in human cells, the HP1α isoform has unique properties, not shared by HP1β and γ. The protein is expressed in a proliferation-dependent manner, being downregulated during transient cell cycle exit. In line with these findings, cultured cancer cells overexpress HP1α compared to non-tumoral cells. Importantly, this is validated in patient samples. These data thus demonstrate a unique regulation of HP1α, which is not paralleled by HP1β or 7.
HP1α Importance in Cancer
To evaluate the clinical importance of HP1α expression, HP1α protein and mRNA levels were analyzed in human cancer by immunohistochemistry and quantitative RT-PCR. Staining of cryopreserved human tissue samples showed a significant overexpression of HP1α, but not HP1β or γ, in tumoral cells. Thus, HP1α constitutes a marker for diagnosis of multiple types of cancer. In contrast to other proliferation markers, such as Ki67, HP1α stains all tumoral cells and is thus highly suitable to determine the exact localization and extent of the tumor.
In order to quantify HP1α expression and determine its prognostic value, HP1α mRNA levels were measured in 86 small breast tumors with >10 years follow-up. The present data reveal that high HP1α expression correlates with decreased survival and increased occurrence of metastasis over time. Furthermore, multivariate analyses demonstrate that HP1α levels predict disease outcome better than standard prognostic markers. Thus, HP1α constitutes a marker of prognostic value, in breast cancer and in other types of cancer.
DNA and RNA Microarray Analysis
Total RNA was extracted from 158 well annotated frozen tumor samples and 19 healthy mammary tissues, selected from the Biological Resource center of the Institut Curie, using the RNeasy kit (Qiagen, France) and the RNA clean up kit (Macherey Nagel, France). The quality of each RNA sample was determined with an Agilent 2100 bioanalyzer. The quantity of RNA was measured by spectrophotometry at 260 nm. RNA was hybridized onto U133 plus 2.0 Affymetrix chips. Transcriptomic data were normalized using GC-RMA (Irizarry, Hobbs et al. 2003). Raw and normalized transcriptomic data are publically available at Gene Expression Omnibus (Accession number: [GSE13787]).
Reverse Phase Protein Array Analysis
For the protein arrays, 168 Frozen human tumours, among which those used for transcriptome approach, were lysed in a buffer containing 50 mM Tris (pH 6.8), 2% SDS, 5% glycerol, 2 mM DTT, 2.5 mM EDTA, 2.5 mM EGTA, 2 mM sodium orthovanadate, 10 mM sodium fluoride and a cocktail of protease (Roche, France) and phosphatase (Pierce, Perbio,
France) inhibitors. Homogenization was obtained using a TissueLyser (Qiagen, France) with 5 mm stainless steel beads (Qiagen, France) for two minutes at 30 Hz. Lysates were boiled at 100° C. for 10 minutes and stored at −80° C. Protein concentration was determined using the BCA Protein Assay Kit-Reducing Agent Compatible (Pierce, Perbio, France). For all lysates, five two-fold serial dilutions were spotted in triplicates onto nitrocellulose-coated glass slides (FAST slides, Whatman) using a MicroGrid Compact arrayer (BioRobotics, Dutscher Scientific Instrumentation, France) equipped with SMP3XB pins (Tip diameter=75 μm, volume per spot=1.2 nl; Telechem, Proteigene, France). Next, slides were incubated with avidin, biotin and peroxydase blocking reagents (Dako, France) before saturation with TBS containing 0.1% Tween-20 and 5% BSA (TBST-BSA) and overnight incubation at 4° C. with primary antibody (rabbit polyclonal anti-HP1α, H2164 from Sigma) diluted in TBST-BSA. After washes in TBST, arrays were probed with horseradish peroxidase-coupled secondary antibody (Jackson ImmunoResearch Laboratories, Interchim, France) diluted in TBST-BSA for one hour at room temperature. Signal was amplified using Bio-Rad Amplification Reagent (Bio-Rad, France) for 10 minutes at room temperature. The slides were then rinsed with TBST containing 10% DMSO for two minutes and probed with Cy5-Streptavidin (Jackson ImmunoResearch Laboratories, Interchim, France) diluted in TBST-BSA, for one hour at room temperature. Fluorescent signal was scanned using a GenePix 4000B microarray scanner (Molecular Devices, France). Spot detection and signal quantification were determined using MicroVigene software (VigeneTech Inc, MA). Signal intensity was normalized for both a negative control (no primary antibody), and for a total protein staining. For this, one slide was fixed for 15 min in a solution of 7% acetic acid and 10% methanol and then stained with Sypro Ruby protein staining solution (Molecular Probes, S11791).
Statistical Analysis
The R software v2.4.0 was used for statistical analyses. Data were transformed by Log(2) in order to normalize the distribution. Differential expression was assessed by T-tests. p values under 5% were considered significant.
Results
In the last decade, multiple studies have shown that, based on microarray mRNA expression profiles, breast cancers can be divided into four main groups: (i) the luminal breast cancers, predominantly ER positive and further divided into luminal A (low grade) and B (high grade); (ii) basal-like breast cancers, predominantly ER, PR and HER2 negative; and (iii) the HER2 overexpressing cancers (Sotiriou and Piccart 2007). HP1α expression was analyzed in these distinct classes of breast tumors.
Transcriptome data from 158 well annotated breast cancer samples and 19 healthy mammary samples were analyzed. The molecular features of the samples are summarized in
To confirm that HP1α might be of interest in the high-grade tumor subtypes (Luminal B, HER2+ and basal-like), its expression level was analyzed at the protein level with the reverse phase protein array (RPPA) technology. This micro-dot blot technology consists of depositing very small amounts (1 ng) of protein lysates on glass slides covered with nitrocellulose. Proteins of interest were then revealed using specific antibodies. In this manner, protein lysates from all 168 breast tumor samples were analyzed simultaneously for their levels of HP1α protein. The profile obtained in the different tumor types closely resembled the transcriptome profile (
Thus, these results confirm that HP1α can be used as a prognostic and diagnostic marker. HP1α expression level is particularly relevant as a prognostic marker for breast cancers due to its high expression levels in basal-like, Luminal B and HER2 overexpressing breast cancers, which are the breast cancer subtypes with the most aggressive clinical behaviour.
Furthermore, these results confirm that HP1α expression levels can be assessed in a quantitative manner not only at the mRNA level, but also at the protein level.
Number | Date | Country | Kind |
---|---|---|---|
09305351.0 | Apr 2009 | EP | regional |
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/EP2010/055423 | 4/23/2010 | WO | 00 | 10/18/2011 |