Patent Application
20190153552
This document relates to materials and methods for determining if a subject has, or is at risk of developing, a clinical condition that can be detected based on the presence of particular markers. For example, this document relates to a cost-effective self-test for determining whether a biological fluid from the subject contains a nucleic acid or polypeptide marker for a virus (e.g., a high-risk HPV strain that may indicate cervical cancer) or a bacterium (e.g., Escherichia or Salmonella).
A large number of diagnostic assays for various clinical conditions, including assays that involve the use of polymerase chain reaction (PCR) or enzyme-linked immunosorbent assays (ELISAs), can take 24 to 48 hours or even longer to produce results, which can negatively impact urgent decision making in particularly vulnerable patients.
For example, cervical cancer often is asymptomatic at an early and curative stage. Readily available and reliable screening is important, particularly in populations without access to human papillomavirus (HPV) vaccination. The performance of a single HPV testing round has been associated with a significant reduction in the number of advanced cervical cancers, and HPV testing has been demonstrated to be more sensitive for detecting cancerous and precancerous microlesions than visual inspection with acetic acid and cytologic testing (Sankaranarayanan et al., N Engl J Med 360(14):1385-1394, 2009). Approaches such as the CAREHPV® test (Qiagen Inc.; Valencia, Calif.) offer a sensitivity of 90% and specificity of 84% (Qiao et al., The Lancet Oncol 9(10):929-936, 2008) for detecting pre-malignant or malignant lesions, but the cost, processing time, and need for laboratory facilities may be prohibitive for using such approaches in low-resource settings. Cervical cancer screening in low-resource areas also can be challenged by disease priority, social stigma, and local healthcare systems. For example, screening may be marginalized compared to acute medical problems, there may be social stigma related to HPV infection or even visiting a gynecologist in conservative communities, and/or the local healthcare infrastructure may not have the resources to support a women's health program.
The present document is based, at least in part, on the development of a point-of-care testing method that can expedite screening capabilities while providing accurate, rapid, and affordable diagnoses, which can lead to timely and informed medical intervention. The materials and methods described herein relate to the use of in-vial dry reagent storage, which can allow for rapid “mix-and-read” diagnosis with the naked eye. The materials and methods can be used for detecting various clinical conditions or viral and bacterial infections, indicating, for example, that a subject is infected with HPV or influenza virus, is a carrier of Streptococcus pneumoniae, or contains circulating cardiac endothelial cells (CECs), which can indicate cardiac emergency. The materials and methods provided herein can eliminate delays in diagnostic testing since there is no need to transport samples to a laboratory setting, and no need for specialized personnel to perform the required assays and interpret the results.
In some embodiments, for example, this document provides an inexpensive, reliable self-test for high-risk HPV. The screening test can be used to identify subjects (e.g., human females) having a high-risk carrier status, while minimizing barriers and providing an opportunity for early intervention before disease leads to significant morbidity and mortality. The self-test can be cost effective, easily distributed, and can be administered in the privacy of a user's home. This may lead to earlier detection of HPV, resulting in clinical follow up in a more timely manner.
In a first aspect, this document features a kit containing (a) a receptacle for receiving a biological fluid sample, the receptacle having a first nucleic acid reversibly attached to a first interior surface and a second nucleic acid immobilized on a second interior surface, wherein the first nucleic acid is complementary to a first nucleic acid sequence of a selected marker, and wherein the second nucleic acid is complementary to a second nucleic acid sequence of the marker; and (b) a substrate having a first portion with an integrated positive control result and a second portion for receiving a test fluid. The receptacle can be a glass vial (e.g., a glass vial with a volume of 10 to 20 mL). The first nucleic acid can be dry-stored on the first interior surface. The second nucleic acid can be coupled to an agarose film on the second interior surface. The first nucleic acid can be coupled to horseradish peroxidase (HRP). The marker can be from one or more high-risk human papillomavirus (HPV) strains (e.g., one or more of HPV 16, HPV 18, HPV 31, HPV 33, HPV 35, HPV 39, HPV 45, HPV 51, HPV 52, HPV 56, HPV 58, HPV 59, and HPV 68). The substrate can include a paper strip.
In another aspect, this document features a kit containing (a) a receptacle for receiving a biological fluid sample, the receptacle having a nucleic acid reversibly attached to a first interior surface and a reagent reversibly attached to a second interior surface, wherein the nucleic acid is complementary to a nucleic acid sequence of a selected marker, and wherein the reagent binds specifically to a complex formed when the reversibly attached nucleic acid hybridizes to the nucleic acid sequence of the selected marker; and (b) a substrate having a first portion with an integrated positive control result and a second portion for receiving a test fluid. The receptacle can be a glass vial (e.g., a glass vial with volume of 10 to 20 mL). The reversibly attached nucleic acid can be dry-stored on the first interior surface. The reagent can be coupled to an agarose film on the second interior surface. The reagent can be hemin. The marker can be from one or more high-risk HPV strains (e.g., one or more of HPV 16, HPV 18, HPV 31, HPV 33, HPV 35, HPV 39, HPV 45, HPV 51, HPV 52, HPV 56, HPV 58, HPV 59, and HPV 68). The substrate can include a paper strip.
In another aspect, this document features a method for determining that a biological fluid contains a selected marker, where the method includes (a) providing a receptacle for receiving the biological fluid, the receptacle having a first nucleic acid reversibly attached to a first interior surface and a second nucleic acid immobilized on a second interior surface, where the first nucleic acid is complementary to a nucleic acid sequence of the marker and is labeled with a means for visual detection, and where the second nucleic acid is complementary to a second nucleic acid sequence of the marker; (b) placing a sample of the biological fluid into the receptacle, such that the first nucleic acid is released from the first interior surface, and the first and second nucleic acids hybridize to the first and second complementary nucleic acid sequences of the marker, such that the first nucleic acid becomes attached to the second interior surface via the marker and the second nucleic acid; (c) removing the biological fluid from the receptacle; (d) washing the interior of the receptacle to remove residual biological fluid; (e) placing a substrate that interacts with the means for visual detection into the receptacle, such that the means for visual detection can act on the substrate to generate a signal; and (f) visually inspecting the vial containing the substrate, or a sample of the substrate, to determine that the signal is present, thus indicating the presence of the high-risk HPV strain in the biological fluid. The receptacle can be a glass vial (e.g., a glass vial with a volume of 10 or 20 mL). The first nucleic acid can have been dry-stored on the first interior surface prior to providing the receptacle. The second nucleic acid can have been coupled to an agarose film on the second interior surface prior to providing the receptacle. The means for visual detection can be HRP. The substrate can be tetramethylbenzidine (TMB). The marker can be from one or more high-risk human HPV strains (e.g., one or more of HPV 16, HPV 18, HPV 31, HPV 33, HPV 35, HPV 39, HPV 45, HPV 51, HPV 52, HPV 56, HPV 58, HPV 59, and HPV 68). The biological fluid can include urine or vaginal fluid.
In yet another aspect, this document features a method for determining that a biological fluid contains a selected marker, where the method includes (a) providing a receptacle for receiving the biological fluid, the receptacle having a nucleic acid reversibly attached to a first interior surface and a reagent reversibly attached to a second interior surface, where the nucleic acid is complementary to a nucleic acid sequence from the marker, and where the reagent binds specifically to a complex formed when the reversibly attached nucleic acid hybridizes to the nucleic acid sequence of the marker; (b) placing a sample of the biological fluid into the receptacle, such that (i) the nucleic acid is released from the first interior surface and binds to the complementary nucleic acid sequence of the marker to form a complex, and (ii) the reagent binds to the complex to generate a signal; (c) placing in the receptacle a substrate that interacts with the complex; and (d) inspecting the vial, or a sample from the vial, to determine that the signal is present, thus indicating the presence of the marker in the biological fluid. The receptacle can be a glass vial (e.g., a glass vial with a volume of 10 or 20 mL). The nucleic acid can have been dry-stored on the first interior surface prior to providing the receptacle. The reagent can have been dry-stored on the second interior surface prior to providing the receptacle. The reagent can be hemin. The substrate can be TMB. The marker can be from one or more high-risk human HPV strains (e.g., one or more of HPV 16, HPV 18, HPV 31, HPV 33, HPV 35, HPV 39, HPV 45, HPV 51, HPV 52, HPV 56, HPV 58, HPV 59, and HPV 68). The biological fluid can include urine or vaginal fluid.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
This document provides diagnostic tests that can be applied to any sample of bodily fluid (e.g., urine, sputum, blood, serum, or cerebrospinal fluid) suspected of containing a particular marker molecule (e.g., a nucleic acid such as an RNA or DNA, or a polypeptide or protein). This document also provides kits containing the tests, as well as methods of using the test materials to detect markers from selected targets, and to determine whether cells containing a selected marker are present in a biological sample. Markers that may be detected using these materials and methods include, without limitation, nucleic acids (e.g., mutant or aberrantly expressed nucleic acids that provide a signature for a disease), peptides, polypeptides, antibodies or antibody fragments, virus particles, and bacteria.
In some cases, an existing PCR or ELISA-based test can be adapted to the platform described herein. The platform can provide a high clinical value for detecting acute illness in patients who would benefit from real-time testing and immediate administration of targeted treatment, although the platform also can be applied to any chronic condition for which there is, for example, a nucleic acid or protein marker. As compared to standard diagnostic procedures, the materials and methods provided herein typically are faster (providing real-time results) and more affordable, and allow for the possibility of self-administration.
In some embodiments, the assay platform provided herein can be used as a self-test to identify high-risk HPV carriers, in methods for determining whether a subject is a carrier of high-risk HPV. In women, high-risk types of HPV (such as types 16, 18, 31, and 45) can cause changes in the cells of the cervix that can be seen as abnormalities on a Pap test. Abnormal cervical cell changes may resolve on their own without treatment, but some untreated cervical cell changes can progress to serious abnormalities and may lead to cervical cancer over time if they are not treated. The screening tests described herein can provide for rapid and easy detection of the high-risk HPV in carriers. The tests can take advantage of target strain labeling and capturing capabilities in a receptacle (e.g., a glass vial), based on complementary HPV nucleic acid immobilization and dry reagent storage. The test can be read in real-time, without requiring laboratory facilities or personnel for the processing of results, which can address some of the main challenges with implementation in low-resource communities. The test is aimed at matching the clinical standard for HPV testing reliability, with a user-perceived level of difficulty for use and interpretation that is comparable to standard home pregnancy test use and reading.
The screening kits provided herein include a receptacle (e.g., a glass vial) as a nucleic acid diagnostic platform that can be used as a self-test and read in real-time by a user, with minimal instruction. The described approach for nucleic acid detection can include pre-immobilization of nucleic acid (e.g., RNA or DNA) sequences that are complementary to high-risk HPV nucleic acid sequences and dry storage of reagents in the receptacle that allow for labeling and capture of target strains, and produce colorimetric results interpretable by the naked eye. In some embodiments of the test methods described herein, nucleic acids complementary to marker sequences (e.g., from high-risk HPV strains) can be modified with horseradish peroxidase (HRP) and dry-stored in vials. When the complementary nucleic acids are contacted with a fluid containing an HPV marker nucleic acid (e.g., RNA or DNA) and a tetramethylbenzidine (TMB) substrate, the fluid can turn blue to indicate the presence of a high-risk HPV strain.
In the depicted method, one or more first nucleic acid (e.g., RNA) sequences that are complementary to HPV nucleic acid sequences (e.g., RNA sequences from one or more high-risk HPV strains) and are HRP-modified can be dry-stored on an interior surface of the receptacle (e.g., on the vial wall as depicted in
The nucleic acids attached within the receptacle typically have a length sufficient to allow for specific hybridization (e.g., 10-100 nucleotides, 15-75 nucleotides, or 20-50 nucleotides). Nucleic acid sequences for numerous HPV strains include those known in the art. Sequences that are conserved between high-risk HPV strains but are not found within low-risk HPV strains can be particularly useful. Examples of high- and low-risk HPV strains and their nucleotide sequences include the following:
The receptacle with the dry-stored and immobilized nucleic acids can be provided as depicted in item 10 of
The sample can be washed after the target nucleic acids are captured (Redon et al., DNA Microarrays for Biomedical Research: Methods and Protocols 267-278, 2009), and the fluid can be disposed of (as in item 50 of
Any suitable method, including methods known in the art, can be used to reversibly attach the first complementary nucleic acid (e.g., a first sequence from a high risk HPV strain or from another target) to an interior surface of the receptacle. In some embodiments, for example, HRP-modified first nucleic acid sequences that are complementary to sequences from one or more high-risk HPV strains can be vacuum dry-stored (Ramachandran et al.; supra) in sugar alcohol matrices (e.g., sucrose, trehalose, or polyvinyl alcohol (PVA) matrices) on the vial wall to preserve their stability (see, e.g., Stevens et al., supra; and Ivanova and Kuzmina; supra).
Other methods can be used to immobilize the second complementary nucleic acid (e.g., a second sequence from the high risk HPV strain or from another target) within the receptacle. For example, in some embodiments the container bottom can be coated with an agarose film that is activated by NaIO4 (Afanassiev et al., supra), with the agarose film serving to immobilize second nucleic acid segments that are amino-modified and are complementary to second nucleic acid sequences from the one or more high-risk HPV strains, such that the first and second nucleic acid sequences are complementary to different sequences from the one or more high-risk HPV strains. Activation of the agarose film can lead to formation of aldehyde groups in the agarose, allowing for covalent immobilization of amino groups on the second complementary nucleic acid segments. In some embodiments, a coating of powdered sodium dodecyl sulfate (SDS) on the agarose layer can facilitate lysis of cells in the biological fluid sample.
Other mechanisms also can be used to capture target markers in a test receptacle. For example, in some embodiments, a vial-based test can combine in-vial dry reagent storage and the use of DNAzyme (an artificial catalytic DNA; Silverman, Chem Commun 3467-3485, 2008) capable of detecting various targets such as nucleic acids and molecules secreted by cells (see, e.g., Zhou et al., Biosensors Bioelectronics 55:220-224, 2014; Wang et al., J Am Chem Soc 134:5504-5507, 2012; and Ali et al., Angewandte Chemie Int Ed 50:3751-3754, 2011). This approach typically is label-free, which can significantly reduce necessary user steps. DNAzyme and reagents required for the assays, such as a lysis buffer containing, for example, one or more enzymes (e.g., lysozyme, mutanolysin, and/or lysostaphin); one or more alkaline components (e.g., sodium hydroxide); and one or more surfactants (e.g., sodium dodecyl (lauryl) sulfate (SDS); TWEEN® (a polysorbate-type nonionic surfactant formed by ethoxylation of sorbitan before the addition of lauric acid; PLURONIC® (nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)); TRITON™ X-100 (a nonionic surfactant having the formula C14H22O(C2H4O)n (n=9 or 10), with a hydrophilic polyethylene oxide chain and an aromatic hydrocarbon (4-phenyl) lipophilic or hydrophobic group; or any other reagent that can enable the release of genomic materials from the cells), can be concentrated and dry-stored in a sugar matrix (Ramachandran et al., Analyst 139:1456-1462, 2014) in a glass vial, as depicted in step 110 of
DNAzyme constructs can be prepared as described elsewhere (see, e.g., Kang et al., Nature Commun 5:5427, DOI: 10.1038/ncomms6427, 2014). In some embodiments, a DNAzyme construct can include a fluorogenic substrate (e.g., 5′-ACTCTTCCTAGCF-rA-QGGTTCGATCAAGA-3′; SEQ ID NO:11, where (“F” indicates fluorescein-dT, “rA” indicates riboadenosine, and “Q” indicates dabcyl-dT), and a catalytic sequence (e.g., 5′-CACGGATCCTGACAAGGATGTGTGCGTTGTCGAGACCTGCGACCGGAACACT ACACTGTGTGGGATGGATTTCTTTACAGTTGTGTGCAGCTCCGTCCG-3′; SEQ ID NO:12). In some embodiments, where a DNAzyme is generated for an HPV 16 target, the fluorogenic substrate and the catalytic sequence can be covalently joined (e.g., through template-mediated enzymatic ligation) using a template marker sequence such as 5′-GCACAGGGACATAATAATGGCATTTGTTGGGGTAACCAACTATTTGTTACTG TTGTTGATACTACACGCAGTACAAATATGTCATTATGTGCTGCCATATCTACTTC AGAAACTACATATAAAAATACTAACTTTAAGGAGTACCTACGACATGGGGAGG AATATGATTTACAGTTTATTTTTCAACTGTGCAAAATAACCTTAACTGCAGACG TTATGACATACATACATTCTATGAATTCCACTATTTTGGAGGACTGGAATTTTGG TCTACAACCTCCCCCAGGAGGCACACTAGAAGATACTTATAGGTTTGTAACCC AGGCAATTGCTTGTCAAAAACATACACCTCCAGCACCTAAAGAAGATGATCCC CTTAAAAAATACACTTTTTGGGAAGTAAATTTAAAGGAAAAGTTTTCTGCAGA CCTAGATCAGTTTCCTTTTGGACG-3′ (SEQ ID NO:13), where the template marker sequence of SEQ ID NO:13 is a target-specific sequence for HPV 16. The template marker sequence can be replaced with any other sequence to be specific for a different marker (e.g., a marker for a different HPV type, another virus, a bacterium, or a mammalian cell).
This concept can be tailored to cater to different clinical needs. For instance, when identifying low-abundance targets from complex clinical samples, a DNAzyme and its relevant chemistry can be designed to generate a fluorescent signal (Ali et al., supra; and Kang et al., Nature Commun 5:5427, 2014) that offers a higher resolution. In some embodiments, the fluorescent signal can be detected by a smart phone with a particular lens and filter attached to its camera (Zhu et al., Analyst 137:2541-2544, 2012). With an image analysis smart phone app, a user can obtain results with just a few taps on the screen.
The receptacles used in the products and methods described herein can be of any suitable size (e.g., 0.5 to 5 mL, 1 to 10 mL, 5 to 20 mL, 20 to 50 mL, 1 mL, 5 mL, 10 mL, 20 mL, 25 mL, or 50 mL), and can be made of a material to which nucleic acids and support polymers (e.g., agarose) can be reversibly or permanently attached. In general, a receptacle can be large enough to contain a typical sample of body fluid obtained from a subject, such as a 0.5 to 10 mL (e.g., 0.5 to 1 mL, 1 to 3 mL, 3 to 5 mL, 5 to 10 mL, 0.5 mL, 1 mL, 2 mL, 2.5 mL, 3 mL, 5 mL, 7.5 mL, or 10 mL) sample of urine or vaginal fluid, for example, and then to contain a suitable amount of TMB or other detectable substrate (e.g., 0.5 to 10 mL, 1 to 5 mL, 5 to 10 mL, 0.5 mL, 1 mL, 5 mL, or 10 mL of substrate). In some embodiments, the test kits provided herein can utilize commercially available glass vials (e.g., 5 to 10 mL, 10 to 20 mL, or 20 to 50 mL glass vials), which can largely reduce the need for microfabrication as compared with other point-of-care diagnostic devices.
The platform described herein can be used for detection of a wide variety of viral, bacterial, and cellular markers, and can be used with any bodily fluid sample (e.g., urine, sputum, blood, plasma, serum, cerebrospinal fluid, lymph fluid, or synovial fluid) that may contain free-floating virus particles, bacteria, or other cells of interest, for example. These materials and methods can have a high clinical value, in that they can be used to detect acute agents (e.g., acute viral agents) in vulnerable subjects that would benefit from real-time testing and immediate administration of targeted treatment.
In some embodiments, the tests can be adapted to detect various viral genetic signatures, including genes that provide resistance to antiviral treatments. The materials and methods also can be used to monitor the status of infected patients. In some cases, for example, the materials and methods provided herein can be used to detect viral agents linked to respiratory infections. Real-time, rapid detection of viral agents that cause respiratory infection can be useful to determine whether immediate treatment should be pursued, particularly for vulnerable patients such as infants, the elderly, or those who are immunocompromised. Typical tests for influenza and respiratory syncytial virus (RSV) can require 24 hours to retrieve a result. While this time frame may be acceptable for healthy adults, members of more vulnerable populations may require hospitalization in case life-threatening complications develop during the time period before results are obtained. The real-time test provided herein can allow the decision whether to hospitalize to be made immediately, and targeted treatment can be administered at the same clinical visit. Moreover, the assayed markers also can include one or more genes that confer resistance to known antiviral treatments, saving time in attempting a treatment stream that will fail.
In some cases, a test for detecting influenza or RSV can, in some embodiments, be similar to that for detecting HPV, except that instead of urine or cervical fluid, sputum can be used as the biological fluid sample. The sputum can be directly expelled by the subject into a vial containing an immobilized, amino-modified nucleic acid (e.g., HRP-modified RNA) complementary to one or more RSV markers. TMB subsequently added to the vial will turn blue if the marker(s) are present.
Other viral agents can be screened for in blood samples using the methods and materials provided herein. These include, without limitation, hepatitis A, B, and C (e.g., to determine treatment for acute hepatitis), herpes simplex virus (e.g., to determine treatment of aseptic meningitis), cytomegalovirus (e.g., to determine treatment for infectious mononucleosis), human immunodeficiency virus (HIV) (e.g., for post-exposure prophylactic monitoring), rabies (e.g., to determine treatment for encephalitis), and varicella-zoster virus (e.g., to determine treatment for chickenpox).
In addition, the tests provided herein can be used to assay for the presence of bacterial agents in a biological fluid sample. For example, the disclosed materials and methods can be used to detect bacterial endotoxins and/or exotoxins, including those produced by members of the Escherichia, Salmonella, Shigella, Pseudomonas, Borderella, and Vibrio genera, which often are responsible for acute illness. In such cases, a lipopolysaccharide (LPS) probe for the LPS signature of a bacterial agent, rather than a nucleic acid probe for the genetic signature of the agent, can be linked to HRP. As for methods that involve detecting a genetic signature, an added substrate (e.g., TMB) can generate a visible signal if the matching LPS signature is present in the test sample. It is noted that methods utilizing LPS probes would likely not include using SDS to facilitate cell lysis.
Further, it is noted that the platform provided herein may be useful for detecting bacteria or other cells (e.g., eukaryotic cells) directly. Such assays can utilize a sealed vial that can be mixed (e.g., vortexed) without disrupting conjugates between the marker to be detected and the probe(s) within the vial. For assays designed to detect bacteria, SDS can be used to lyse at least some of the bacterial cells, and the lysate can be added to a vial in which nucleic acids with sequences complementary to, for example, the 16S RNA of the target bacteria have been dry-stored and immobilized. Bacterial detection using DNAzyme-based methods may not require dry-storage of anything other than the DNAzyme, since bacterial lysates can specifically react with an immobilized DNAzyme designed for the target bacteria. Methods of detecting eukaryotic (e.g., endothelial) cells can utilize a vial in which DNA complementary to a sequence from the target cells has been immobilized. The rest of the procedure and detection mechanism can be carried out as described herein for bacteria or virus particles.
The methods and materials described herein also can utilize immunoglobulins of various types (e.g., IgA, IgD, IgE, IgG, and IgM) for real-time testing of exposure to pathogens, immunization status, and allergens. For such applications, the SDS used for cell lysis may be replaced with a detergent such as TRITON® X-100 or TWEEN®, for example. Antibodies (e.g., anti-IgA, anti-IgD, anti-IgE, anti-IgG, or anti-IgM antibodies), can be immobilized within a glass vial using, for example, a method that relies on a condensation reaction between an aldehyde group on the antibodies and the hydrazide group on the modified glass surface, as described elsewhere (Gering et al., J Colloid Interface Sci 252(1):50-55, 2002). HRP-functionalized secondary antibodies can be dry-stored in a sugar matrix on another interior surface of the vial. A fluid sample containing target molecules can be added to the vial, where the target molecules can be captured by the pre-immobilized antibodies, and the dry-stored, HRP-functionalized antibodies can be rehydrated by the fluid and released from the sugar matrix. The target molecules then can become sandwiched between the pre-immobilized antibodies and the HRP-functionalized antibodies. At this point, the vial can be washed (e.g., three times), and the TMB substrate can be added.
In addition, the materials and methods provided herein can be used to test for free-floating genetic markers in the blood or another bodily fluid, expanding blood liquid biopsies to a real-time application. For such methods, first and second nucleic acid probes, or a nucleic acid probe such as a DNAzyme and a reagent that can specifically bind to the DNAzyme when it is recognized by the genetic material of interest, can be positioned within a receptacle (e.g., where a first, HRP labeled nucleic acid is reversibly attached to an inner surface of the receptacle, and a second nucleic acid is immobilized on a second inner surface of the receptacle), without a reagent for lysing cells. If the genetic marker of interest is present within a sample added to the receptacle, it can bind to the first and second nucleic acid probes, resulting in generation of a signal that is retained within the receptacle after washing, thus indicating a positive result.
As noted herein, the materials described can be included in kits for detecting selected markers of, for example, particular viruses or bacteria. A kit can include a receptacle having one or more nucleic acid, polypeptide, or LPS probes reversibly and/or permanently immobilized on one or more interior surfaces. In some cases, a kit can include a receptacle having a nucleic acid probe and a reagent reversibly immobilized on one or more interior surfaces. In some embodiments, a kit also can include a control component showing a positive control, a negative control, or both. The control component also can include a portion for receiving a test sample, which may facilitate comparison to the positive and/or negative controls. The support can be, for example, a test paper strip. In some cases, the support (e.g., the test paper strip) included with the kits provided herein and integrated with the control(s) can be calibrated to compensate for background noise, facilitating interpretation of the result.
TABLE 1 provides the estimated cost for one embodiment of a test as provided herein (based on Sigma Aldrich products unless otherwise stated).
The invention will be further described in the following example, which does not limit the scope of the invention described in the claims.
A test platform is developed using high-risk HPV strains (HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and/or 68) and low risk HPV strains (HPV types 6, 11, 40, 42, 43, 44, 53, 54, 61, 72, 73, and/or 81; de Sanjose et al., The Lancet Oncol 11(11):1048-1056, 2010) added to sterile saline as substrates at variable concentrations consistent with what would be expected in a biological sample (<1 femtomole, 600,000,000 copies (Denny et al., JAMA 294(17):2173-2181, 2005)). The sensitivity and specificity of the test are calculated and adjusted until the levels displayed by the clinical standard test are reached. This demonstrates efficacy and performance of the low-cost platform as compared to standard of care tests.
In particular, silanized clear glass vials (20 mL, Thermo Fisher Scientific) are obtained. One percent (1%) agarose in purified water is poured into the vial at 70° C., such that the bottom interior surface of the vial is covered. After agarose gelling occurs, the vial is dried in air. 20 mM NaIO4 is prepared under suitable conditions (e.g., in a chemical hood that can vent hazardous gases). The NaIO4 solution is added into the agarose-coated vials at room temperature for 30 minutes for agarose activation. The activation leads to the formation of aldehyde groups in the agarose, enabling the covalent binding of amino groups. DNA is suspended in spotting buffer (0.15 M NaCl, 0.1 M NaHCO3, pH8.5), and pipetted onto the agarose film in the vial. The vial is incubated in a humid incubator overnight, and dried at room temperature. Drops of sodium borohydride solution (50 mg NaBH4 in 30 mL Phosphate Buffer Saline (PBS) with 10 mL ethanol) is pipetted into the vial under suitable conditions (e.g., in a chemical hood). After five minutes, the vial is washed three times with 0.2% sodium dodecyl sulfate (SDS) for 2 minutes, then washed twice in distilled water for 1 minute, and dried at room temperature.
Amino-modified complementary DNA segments are immobilized on the activated agarose film via NH2 groups, and the vial is dried at room temperature. Horseradish peroxidase (HRP)-modified DNA segments are added to sugar alcohol matrices (sucrose, trehalose, polyvinyl alcohol (PVA)) to preserve their stability, and then added into the vial, which is then vacuum-dried at 30° C. for 2 hours. The product is stored in a dry place at room temperature.
Patients undergoing HPV screening as clinically indicated (based on reflex HPV test if atypical cells of unknown significance (ASCUS) are found by Pap Smear) are enrolled in the test. The same number of age-matched patients (control cohort) with low risk for cervical cancer and undergoing routine Pap Smear testing also are enrolled. This tests the detection kit with real samples and real patients, to validate performance in the field and ease of interpretability by users. An additional urine sample from test subjects is obtained for laboratory testing and optimization if such becomes necessary.
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
This application claims priority from U.S. Provisional Application Ser. No. 62/334,922, filed May 11, 2016.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2017/031870 | 5/10/2017 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62334922 | May 2016 | US |
