Human chromosome 16 genes, compositions, methods of making and using same

BACKGROUND OF THE INVENTION
The assembly of contiguous cloned genomic reagents is a necessary step in the process of disease-gene identification using a positional cloning approach. The rapid development of high density genetic maps based on polymorphic simple sequence repeats has facilitated contig assembly using sequence tagged site (STS) content mapping. Most contig construction efforts have relied on yeast artificial chromosomes (YACs), since their large insert size uses the current STS map density more advantageously than bacterial-hosted systems. This approach has been validated for multiple human chromosomes with YAC coverage ranging from 65-95% for many chromosomes and contigs of 11 to 36 Mb being described (Chumakov et al., Nature 377 (Supp.):175-297, 1995; Doggett et al., Nature 377 (Supp.):335-365, 1995b; Gemmill et al., Nature 377 (Supp.):299-319, 1995; Krauter et al., Nature 377 (Supp.):321-333, 1995; Shimizu et al., Cytogenet. Cell Genet. 70:147-182, 1995; van-Heyningen et al., Cytogenet. Cell Genet. 69:127-158, 1995).
Despite numerous successes, the YAC cloning system is not a panacea for cloning the entire genome of complex organisms due to intrinsic limitations that result in substantial proportions of chimeric clones (Green et al., Genomics 11:658-669, 1991; Bellanne-Chantelot et al., Cell 70:1059-1068, 1992; Nagaraja et al., Nuc. Acids Res. 22:3406-3411, 1994), as well as clones that are rearranged, deleted or unstable (Neil et al., Nuc. Acids Res. 18:1421-1428, 1990; Wada et al., Am. J. Hum. Genet. 46:95-106, 1990; Zuo et al., Hum. Mol. Genet. 1:149-159, 1992; Szepetowski et al., Cytogenet. Cell Genet. 69:101-107, 1995). At least some of these cloned artifacts are a product of the recombinational machinery of yeast acting on the various types of repetitive elements in mammalian DNA (Neil et al., supra. 1990; Green et al., supra. 1991; Schlessinger et al., Genomics 11:783-793, 1991; Ling et al., Nuc. Acids Res. 21:6045-6046, 1993; Kouprina et al., Genomics 21:7-17, 1994; Larionov et al., Nuc. Acids Res. 22:4154-4162, 1994).
Accordingly, alternative cloning systems must be used in concert with YAC-based approaches to complement localized YAC cloning deficiencies, to enhance the resolution of the physical map, and to provide a sequence-ready resource for genome-wide DNA sequencing. Several exon trapping methodologies and vectors have been described for the rapid and efficient isolation of coding regions from genomic DNA (Auch et al., Nuc. Acids Res. 18:6743-6744, 1990; Duyk et al., Proc. Natl. Acad. Sci., USA 87:8995-8999, 1990; Buckler et al., Proc. Natl. Acad. Sci., USA 88:4005-4009, 1991; Church et al., Nature Genet. 6:98-105, 1994). The major advantage of exon trapping is that the expression of cloned genomic DNAs (cosmid, P1 or YAC) is driven by a heterologous promoter in tissue culture cells. This allows for coding sequences to be identified without prior knowledge of their tissue distribution or developmental stage of expression. A second advantage of exon trapping is that exon trapping allows for the identification of coding sequences from only the cloned template of interest, which eliminates the risk of characterizing highly conserved transcripts from duplicated loci. This is not the case for either cDNA selection or direct library screening.
Exon trapping has been used successfully to identify transcribed sequences in the Huntington's disease locus (Ambrose et al., Hum. Mol. Genet. 1:697-703, 1992; Taylor et al., Nature Genet. 2:223-227, 1992; Duyao et al., Hum. Mol. Genet. 2:673-676, 1993) and BRCA1 locus (Brody et al., Genomics 25:238-247, 1995; Brown et al., Proc. Natl. Acad. Sci., USA 92:4362-4366, 1995). In addition, a number of disease-causing genes have been identified using exon trapping, including the genes for Huntington's disease (The Huntington's Disease Collaborative Research Group, Cell 72:971-983, 1993), neurofibromatosis type 2 (Trofatter et al., Cell 72:791-800, 1993), Menkes disease (Vulpe et al., Nature Genet. 3:7-13, 1993), Batten Disease (The International Batten Disease Consortium, Cell 82:949-957, 1995), and the gene responsible for the majority of Long-QT syndrome cases (Wang et al., Nature Genet. 12:17-23, 1996).
A 700 kb CpG-rich region in band 16p13.3 has been shown to contain the disease gene for .sup..about. 90% of the cases of autosomal dominant polycystic kidney disease (PKD1) (Germino et al., Genomics 13:144-151, 1992; Somlo et al., Genomics 13:152-158, 1992; The European Polycystic Kidney Disease Consortium, Cell 77:881-894, 1994) as well as the tuburin gene (TSC2), responsible for one form of tuberous sclerosis (The European Chromosome 16 Tuberous Sclerosis Consortium, Cell 75:1305-1315, 1993). An estimated 20 genes are present in this region of chromosome 16 (Germino et al., Kidney Int. Supp. 39:S20-S25, 1993). Characterization of the region surrounding the PKD1 gene in 16p13.3, however, has been complicated by duplication of a portion of the genomic interval more proximally at 16p13.1 (The European Polycystic Kidney Disease Consortium, supra. 1994).
This chromosomal segment serves as a challenging test for large-insert cloning systems in E. coli and yeast since it resides in a GC-rich isochore (Saccone et al., Proc. Natl. Acad. Sci., USA 89:4913-4917, 1992) with an abundance of CpG islands (Harris et al., Genomics 7:195-206, 1990; Germino et al., supra. 1992), genes (Germino et al., supra. 1993) and Alu repetitive sequences (Korenberg et al., Cell 53:391-400, 1988). Chromosome 16 also contains more low-copy repeats than other chromosomes with almost 25% of its cosmid contigs hybridizing to more than one chromosomal location when analyzed by fluorescence in situ hybridization (FISH) (Okumura et al., Cytogenet. Cell Genet. 67:61-67, 1994). These types of repeats and sequence duplications interfere with "chromosome walking" techniques that are widely used for identification of genomic DNA and pose a challenge to hybridization-based methods of contig construction. This is because these techniques rely on hybridization to identify clones containing overlapping fragments of genomic DNA; thus, there is a high likelihood of "walking" into clones derived from homologues instead of clones derived from the authentic gene. In a similar manner, the sequence duplications and chromosome 16-specific repeats also interfere with the unambiguous determination of a complete cDNA sequence that encodes the corresponding protein. Furthermore, low copy repeats may lead to instability of this interval in bacteria, yeast and higher eukaryotes.
Thus, there is a need in the art for methods and compositions which enable accurate identification of genomic and cDNA sequences corresponding to authentic genes present on highly repetitive portions of chromosome 16, as well as genes similarly situated on other chromosomes. The present invention satisfies this need and provides related advantages as well.
SUMMARY OF THE INVENTION
In accordance with the present invention, there are provided isolated nucleic acids encoding a human netrin, a human ATP binding cassette transporter, a human ribosomal L3 subtype, and a human augmenter of liver regeneration.
The present invention further provides isolated protein products encoded by a human netrin gene, a human ATP binding cassette transporter gene, a human ribosomal L3 gene, and a human augmenter of liver regeneration gene.
Additionally, the present invention provides nucleic acid probes that hybridize to invention nucleic acids as well as isolated nucleic acids comprising unique gene sequences located on chromosome 16.
Further provided are vectors containing invention nucleic acids as well as host cells transformed with invention vectors.
Transgenic non-human mammals that express invention polypeptides are provided by the present invention.
The present invention includes antisense oligonucleotides, antibodies and compositions containing same.
Additionally, the invention provides methods for identifying compounds that bind to invention polypeptides. Such compounds are useful for modulating the activity of invention polypeptides.

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a schematic diagram of the P1 contig and trapped exons.
FIGS. 2A and 2B show an alignment of selected exon traps with sequences in the databases.
FIGS. 3A, 3B, and 3C show 6803 bp of hNET genomic sequence from P1 clone 53.8B (SEQ ID NO:19).
FIGS. 4A and 4B show 1743 bp of hNET cDNA and deduced amino acid sequence coding for a human homologue of chicken netrin genes (SEQ ID NOs:20 and 21).
FIGS. 4C and 4D show the nucleotide sequence of the 1.9 kb hNET cDNA including both 5' and 3' UTRs (SEQ ID NO:78).
FIG. 5 shows an amino acid comparison between chicken netrin-1 (SEQ ID NO:22), chicken netrin-2 (SEQ ID NO:23) and hNET (SEQ ID NO:21). Shaded boxes denote regions of identical homology. The laminin domains V and VI and the C-terminal domain (C) are indicated by arrows with domain V divided into three sub-components (V-1 to V-3). The asterisks identify a motif for adhesion/signaling receptors.
FIG. 6 shows a graphical representation of the homology between domains of chicken netrin-1, chicken netrin-2 and hNET.
FIG. 7 shows exon traps, RT-PCR products and cDNA from the ABCgt.1 clone. Exon traps are shown above. ABCgt.1 DNA is shown below the exon traps with the position of the Genetrapper selection (S) and repair (R) oligonucleotides indicated. The position of the RT-PCR clones are shown below the cDNA.
FIGS. 8A-8H show 5.8 kb of cDNA and deduced amino acid sequence encoding ABCgt.l clone (SEQ ID NOs:24 and 25).
FIGS. 9A-9D show an amino acid alignment of murine ABC1 (SEQ ID NO:26) and ABC2 (SEQ ID NO:27) with clone ABCgt.1 (SEQ ID NO:25). Hyphens denote gaps; asterisks denote identical residues, while periods denote conservative substitutions. The location of the ATP binding cassettes is shown by the boxed regions. Numbers at the right show the relative position of the proteins.
FIG. 10 shows the region of the transcriptional map of the PKD1 locus from which P1 clones 49.10D, 109.8C and 47.2H were isolated. The open boxes represent trapped exons with their relative position indicated below the RPL3L (SEM L3) gene. c, r and h identify the location of the capture, repair and hybridization oligonucleotides, respectively.
FIGS. 11A-11B show the nucleotide and deduced amino acid sequence of the SEM L3 cDNA, now designated RPL3L (SEQ ID NOs:28 and 29). The 5' upstream inframe stop codon is underlined and the arrows indicate the site of the polyA tract of the two shorter cDNA clones that were also isolated.
FIG. 12 shows a comparison of the deduced amino acid sequences from human (SEQ ID NO:30), bovine (SEQ ID NO:31), murine (SEQ ID NO:32) and the RPL3L (SEM L3) (SEQ ID NO:29) genes. Dashes indicate sequence identity to the human L3 gene. The nuclear targeting sequence at the N-terminal end is shaded and the bipartite motif is boxed.
FIG. 13 shows the nucleotide and deduced amino acid sequence of the hALR cDNA (SEQ ID NO:33 and 34).
FIG. 14 shows a comparison of the deduced amino acid sequences from rat ALR and human ALR (SEQ ID NOs:35 and 34), respectively.
FIGS. 15A-15J show the nucleotide and deduced amino acid sequence of full-length hABC3 cDNA (SEQ ID NOs:74 and 75).
FIG. 16 shows a physical map of the region containing the hABC3 gene.
FIG. 17A shows the deduced amino acid sequence for hABC3 (SEQ ID NO:75) aligned to the murine ABC1 (SEQ ID NO:26) and ABC2 (SEQ ID NO:27) sequences (Luciani et al., Genomics 21:150-159, 1994) and sequence predicted to be encoded by C. elegans cosmid C.48B4.4 (SEQ ID NO:77) (Wilson et al., Nature 368:32-38, 1994). Sequence identity is shown by letters, with mismatches denoted as periods. Gaps inserted during the alignment are also shown (=). For ABC1, ABC2 and C.48B4.4, only those sequences included in, and C-terminal to, the first ATP-binding domain are shown. Boxes denote the ATP binding cassettes (I and III) and the HH1 domain (II).
FIG. 17B shows a schematic diagram of the ABC3 protein showing the transmembrane (TM) domains, ATP binding cassette (ABC) domains, Linker and HH1 domains.
FIG. 18 shows a map of the genomic interval surrounding the human netrin gene.
FIG. 19A shows a GRAIL2 analysis of coding sequences in the 6.8 kb genomic sequence from 53.8B P1.
FIG. 19B shows the results of a Pustell DNA/protein matrix comparing genomic sequence to chicken netrin-2.
FIG. 20A shows alignment of the human netrin with chicken netrin-1, chicken netrin-2 and UNC-6 (SEQ ID NO:79).
FIG. 20B shows a schematic of the genomic sequence with boxes representing exons and lines denoting the introns. Untranslated region is shown in black, with the location of the start codon indicated by the arrow. The domain structure of the human netrin protein is shown below the gene structure. The position of introns in the Drosophila netrin genes is shown by arrows, with the non-conserved intron being denoted by the open arrow.

DETAILED DESCRIPTION OF THE INVENTION
All patent applications, patents, and literature references cited in this specification are hereby incorporated by reference in their entirety. In case of conflict or inconsistency, the present description, including definitions, will control.
Definitions
1. "complementary DNA (cDNA)" is defined herein as a single-stranded or double-stranded intronless DNA molecule that is derived from the authentic gene and whose sequence, or complement thereof, encodes a protein.
2. As referred to herein, a "contig" is a continuous stretch of DNA or DNA sequence, which may be represented by multiple, overlapping, clones or sequences.
3. As referred to herein, a "cosmid" is a DNA plasmid that can replicate in bacterial cells and that accommodates large DNA inserts from about 30 to about 51 kb in length.
4. The term "PI clones" refers to genomic DNAs cloned into vectors based on the P1 phage replication mechanisms. These vectors generally accommodate inserts of about 70 to about 105 kb (Pierce et al., Proc. Natl. Acad. Sci., USA, 89:2056-2060, 1992).
5. As used herein, the term "exon trapping" refers to a method for isolating genomic DNA sequences that are flanked by donor and acceptor splice sites for RNA processing.
6. "Amplification" of DNA as used herein denotes a reaction that serves to increase the concentration of a particular DNA sequence within a mixture of DNA sequences. Amplification may be carried out using polymerase chain reaction (PCR) (Saiki et al., Science, 239:487, 1988), ligase chain reaction (LCR), nucleic acid-specific based amplification (NSBA), or any method known in the art.
7. "RT-PCR" as used herein refers to coupled reverse transcription and polymerase chain reaction. This method of amplification uses an initial step in which a specific oligonucleotide, oligo dT, or a mixture of random primers is used to prime reverse transcription of RNA into single-stranded cDNA; this cDNA is then amplified using standard amplification techniques e.g. PCR.
A P1 contig containing approximately 700 kb of DNA surrounding the PKD1 and TSC2 gene was assembled from a set of 12 unique chromosome 16-derived P1 clones obtained by screening a 3 genome equivalent P1 library (Shepherd et al., Proc. Natl. Acad. Sci., USA 91:2629-2633, 1994) with 15 distinct probes. Exon trapping was used to identify transcribed sequences from this region in 16p13.3.
96 novel exon traps have been obtained containing sequences from a minimum of eighteen genes in this interval. The eighteen identified genes include five previously reported genes from the interval and a previously characterized gene whose location was unknown (Table I). Additional exon traps have been mapped to genes based on their presence in cDNAs, RT-PCR products, or their hybridization to distinct mRNA species on Northern blots.
TABLE I__________________________________________________________________________Database Homologies Accession Number Independent Transcript of BestGene.sup.a Exon Traps.sup.b Clone.sup.c Size Database Homology.sup.d Hit.sup.e P value.sup.f__________________________________________________________________________A 6 2 kb (cDNA) 8 kb Probable protein kinase [ S. cerevisiae] Z48149 6.3e-83B 1 1.3 kb (cDNA) 2.5 No Significant homologyC 1 0.55 kb (Exon Trap) 1.4 kb N-acetylglucosamine-6-phosphate deacetylase P34480 7.4e-73 0.6 kb (3' RACE) elegans]D 2 Exon trap (1.59 bp) -- Netrin-2 [G. gallus] B54665 3.7e-11 Exon trap (196 bp) -- Netrin-2 [G. gallus] B54665 6.1e-33E 1 Exon trap (100 bp) -- ABC1 gene product [M. musculus] P41233 0.0047F 3 1.1 kb (RT-PCR) 7 kb ABC2 gene product [M. musculus] P41234 3.0e-28 2 2.8 kb (cDNA) 7 kb ABC1 gene product [M. musculus] P41233 7.1e-65G 2 1.8 kb (cDNA) 2.5 kb RNA-Binding protein [Homo sapiens] L37368 2.6e-176H 2 1.2 kb (RT-PCR) 2.5 kb phi AP3 [M. musculus] S41688 2.9e-169I 1 0.45 kb (Exon Trap) 3.0 + 4.5 kb No significant homologiesJ 2 0.24 kb (RT-PCR) 2 kb Rab26 [R. norvegicus] U18771 3.6e-56K 1 Exon trap (219 bp) .sctn. 40S Ribosomal protein S4 [Homo P15880s] 7.3e-18L 5 1.7 kb (cDNA) 1.6 kb 60s Ribosomal protein L3 [Homo S34195s] 6.73-233M 1 0.7 kb (cDNA) 1.3 kb Hypothetical 17.2 Kd protein [C. P34436s] 6.2e-10__________________________________________________________________________ .sup.a Gene as denoted in FIG. 1. .sup.b Number of the trapped exon present in cloned cDNA or PCR product. .sup.c Size of clone with type of clone indicated in parentheses. .sup.d Significant homology in databases as determined by BLASTX. .sup.e Accession Number of best hit. .sup.f Smallest sum probability for the best database match. -- Northern analysis was not performed due to the small size of the exon traps. .sctn. Up to 200 copies of LLREP3 are present in the genome.
Exon trapping was performed using an improved trapping vector (Burn et al., Gene 161:183-187, 1995), with the resulting exon traps being characterized by DNA sequence analysis. In order to determine the relative efficiency of the exon trapping procedure, exon traps were compared to the cDNA sequences for those genes known to be in the interval around the PKD1 gene (FIG. 1). Single exon traps were obtained from the human homologue of the ERV1 (Lisowsky et al., Genomics 29:690-697, 1995) and the ATP6C proton pump genes (Gillespie et al., Proc. Natl. Acad. Sci., USA 88:4289-4293, 1991). The horizontal line at the top of FIG. 1 shows the position of relevant DNA markers with the scale (in kilobases). The position of NotI sites is shown below the horizontal line. The position and orientation of the known genes is indicated by arrows with the number of exon traps obtained from each gene shown in parentheses. The position of the transcription units described in this report (A through M) are shown below the known genes. The Genbank Accession numbers of corresponding exon traps are shown below each transcriptional unit. P1 clones are indicated by the overlapping lines with the name of the clone shown above the line. The position of trapped exons which did not map to characterized transcripts are shown below the P1 contig. Vertical lines denote the interval within the P1 clone(s) detected by the exon traps in hybridization studies.
In contrast, eight individual exon traps were isolated from the TSC2 gene and ten from the CCNF gene (The European Chromosome 16 Tuberous Sclerosis Consortium, supra. 1993; Kraus et al., Genomics 24:27-33, 1994). Trapped sequences from three of the exons present in the PKD1 gene were obtained (The American PKD1 Consortium, Hum. Mol. Genet. 4:575-582, 1995; The International Polycystic Kidney Disease Consortium, Cell 81:289-298, 1995; Hughes et al., Nature Genet. 10:151-160, 1995). 16 additional exon traps from the 109.8C and 47.2H P1 clones were also obtained.
Sequences present in two exon traps (Genbank Accession Nos. L75926 and L75927), localizing to the region of overlap between the 96.4B and 64.12C P1 clones, were shown to contain sequences from the previously described human homologue to the murine RNPS1 gene (Genbank Accession No. L37368), encoding an S phase-prevalent DNA/RNA-binding protein (Schmidt et al., Biochim. Biophys. Acta 1216:317-320, 1993). A comparison of these exon traps to the dbEST database indicated that they were also contained in cDNA 52161 from the I.M.A.G.E. Consortium (Lennon et al., Genomics 33:151-152, 1996). Based on these data, the hRNPS1 gene can be mapped to 16p13.3 near DNA marker D16S291 (transcript G in FIG. 1).
Two exon traps from the 1.8F P1 clone were found to have a high level of homology to the previously described murine .PHI.AP3 encoding a zinc finger-containing transcription factor (Fognani et al., EMBO J. 12:4985-4992, 1993). The m.PHI.AP3 protein, a zinc finger-containing transcription factor, is believed to function as a negative regulator for genes encoding proteins responsible for the inhibition of cell cycling (Fognani et al., supra.). The two exon traps were linked by PCR, with the resulting 1.2 kb PCR product being 85% identical at the nucleotide level to the murine .PHI.AP3 cDNA. Hybridization of the (.PHI.AP3-like exon traps to the dot blotted P1 contig indicated that the gene lies in the non-overlapping region of the 1.8F P1, between the DNA markers KLH7 and GGG12 (transcript H in FIG. 1).
Significant homology was also seen between two exon traps obtained from the 97.10G P1 and the rat Rab26gene encoding a ras-related GTP-binding protein involved in the regulation of vesicular transport (Nuoffer et al, Ann. Rev. Biochem. 63:949-990, 1994; Wagner et al., Biochem. Biophys. Res. Comm. 207:950-956, 1995). The Rab26-like exon traps were linked by RT-PCR (transcript J in FIG. 1) with the encoded sequences being 94% (83/88) identical at the protein level to Rab26. See, for example, FIG. 2 showing an alignment of the following selected exon traps with sequences in the databases. An alignment of sequences encoded by exon trap L48741 (SEQ ID NO:1) and N-acetylglucosamine-6-phosphate deacetylase from C. elegans (SEQ ID NO:2), E. coli (SEQ ID NO:3) and Haemophilus (SEQ ID NO:4). The EGF repeat from netrin-1 (SEQ ID NO:7), netrin-2 (SEQ ID NO:6) and UNC-6 (SEQ ID NO:8) are shown aligned to one of the translated netrin-like exon traps (Genbank Accession No. L75917) (SEQ ID NO:5). An alignment of sequences from the second netrin-like exon trap (Genbank Accession No. L75916) (SEQ ID NO:9) and netrin-1 (SEQ ID NO:11) and netrin-2 (SEQ ID NO:10) is shown. An alignment of the translated Rab26-like RT-PCR product (Genbank Accession Nos. L48770-L48771) (SEQ ID NO:12) and rat Rab26 (SEQ ID NO:13). Sequences encoded by exon trap L48792 (SEQ ID NO:14) are shown aligned to sequences from the pilB transcriptional repressor from Neisseria gonorrhoeae (SEQ ID NO:15), sequences predicted by computer analysis to be encoded by cosmid F44E2.6 from C. elegans (SEQ ID NO:17), the YCL33C gene product from yeast (Genbank Accession No. P25566) (SEQ ID NO:16), and a transcriptional repressor from Haemophilus (SEQ ID NO:18). Periods denote positions where gaps were inserted in the protein sequence in order to maintain alignment.
In order to correlate exon traps with individual transcripts, cDNA library screening and PCR based approaches were used to clone transcribed sequences containing selected exon traps. RT-PCR was used to link individual exon traps together in cases where the two exon traps had homology to similar sequences in the databases. In cases where only single exon traps were available, 3' RACE or cDNA library screening was used to obtain additional sequences. Sequences from the exon traps and cloned products were used to map the position, and when possible the orientation, of the corresponding transcription units.
Six unique exon traps, containing sequences from at least eight exons, were shown to be from a transcriptional unit in the centromeric most P1 clone, 94.10H (transcript A in FIG. 1). A 2 kb cDNA linking the six exon traps was isolated and shown to hybridize to an 8 kb transcript. Additional hybridization studies indicated that the gene was oriented centromeric to telomeric, with at least 6 kb of the transcript originating from sequences centromeric of the P1 contig. Extensive homology was observed between the translated cDNA and a variety of protein kinases; however, the presence of the conserved HRDLKPEN motif (SEQ ID NO:71) encoded in exon trap L48734, as well as the partial cDNA, suggests that it encodes a serine/threonine kinase (van-der-Geer et al., Ann. Rev. Cell Bio. 10:251-337, 1994).
cDNAs were isolated using sequences derived from a separate 94.10H exon trap (Genbank Accession No. L48738) and the position and orientation of the corresponding transcription unit were determined. Two cDNA species were obtained using exon trap L48738 as a probe, with the only homology between the two species arising from the 109 bases contained in the exon trap. Using oligonucleotide probes, the transcription unit was mapped to a position near the 26-6DIS DNA marker, in a telomeric to centromeric orientation; however, only one of the cDNA species mapped to the P1 contig (transcript B in FIG. 1). Based on these data, it is likely that the second cDNA species originated from a region outside of the P1 contig, possibly from the duplicated 26-6PROX marker located further centromeric in 16p13.3 (Gillespie et al., Nuc. Acids Res. 18:7071-7075, 1990).
The 110.1F P1 clone contains at least two genes in addition to the ATP6C gene. Using BLASTX to search the protein databases, significant homology was observed between sequences encoded by exon trap L48741 and the N-acetylglucosamine-6-phosphate deacetylase (nagA) proteins from C. elegans (Wilson et al., supra. 1994), E. coli (Plumbridge, Mol. Microbiol. 3:505-515, 1989) and Haemophilus (Fleischmann et al., Science 269:496-512, 1995). An alignment of the nagA proteins to the translated exon trap revealed the presence of multiple conserved regions (FIG. 2), suggesting that the exon trap contains sequences from the human nagA gene. Additional sequences from the nagA-like transcript have been cloned using 3' RACE and the transcription unit mapped to a region between NotI sites 2 and 3 in FIG. 1. The gene is oriented telomeric to centromeric with NotI site 2 being present in the 3' UTR of the RACE clone (transcript C in FIG. 1).
Two additional exon traps (Genbank Accession Nos. L75916 and L75917), mapping to the region of overlap between the 110.1F and 53.8B P1 clones (transcript D in FIG. 1), were shown to have homology with the chicken netrins (Kennedy et al., Cell 78:425-435, 1994; Serafini et al., Cell 78:409-424, 1994) and the C. elegans UNC-6 protein (Ishii et al., Neuron 9:873-881, 1992)(FIGS. 2 and 20A).
Sequences encoded by exon trap, L75917, were shown to have significant homology with the C-terminal most epidermal growth factor (EGF) repeat found in the netrin and UNC-6 proteins (FIGS. 2 and 20A). Exon trap L75917encodes sequences which are 98% identical to sequences from the third epidermal growth factor (EGF) repeat of chicken netrin-2 and 90% identical to sequences from the same region of netrin-1. The netrin-like trap, L75916, encodes sequences from the more divergent C-terminal domain of the netrins which are 43% identical to sequences contained in the C-terminal domain of netrin-1 and netrin-2 (FIGS. 2 and 20A). This region is the least conserved between UNC-6 and the netrins, with sequences being 63% conserved between netrin-1 and netrin-2 and 29% conserved between netrin-2 and UNC-6 (Serafini et al., supra.).
The netrins define a family of chemotropic factors which have been shown to play a central role in axon guidance. Axonal growth cones are guided to their target by both local cues, present in the extracellular matrix or on the surface of cells, and long-range cues in the form of diffusible chemoattractants and chemorepellents (Goodman and Shatz, Cell 72:77-98, 1993; Keynes and Cook, Curr. Opin. Neurobiol. 5:75-82, 1995).
Chicken netrin-1 and netrin-2 have been shown to function as chemoattractants for developing spinal commissural axons (Serafini et al., Cell 78:409-424, 1994; Kennedy et al., Cell 78:425-435, 1994) with netrin-1 also acting as a chemorepellant for trochlear motor axons (Colamarino and Tessier-Lavigne, Cell 81:621-629, 1995). Comparative analysis revealed the presence of extensive homology between the chicken netrins and C. elegans UNC-6 protein which is required for circumferential cell migration and axon guidance (Hedgecock et al., Neuron 4:61-85, 1990; Ishii et al., Neuron 9:873-881, 1992). More recently, two Drosophila netrins, NETA and NETB, have been described and shown to be required for commissural axon guidance as well as for guidance of motor neurons to their target muscles (Harris et al., Cell 17:217-228, 1996; Mitchell et al., Cell 17:203-215, 1996). These studies indicate that the netrin family of chemoattractant and chemorepellant proteins is conserved between invertebrates and vertebrates.
The genomic interval containing the netrin-like exon traps was sequenced in order to obtain additional sequence information from the gene and to rule out the possibility that the exon traps were derived from a pseudogene. In preliminary studies using the 53.8B genomic P1 clone, the netrin-like exon traps were mapped to a 6 kb XhoI fragment. See, for example, FIG. 18 wherein relevant DNA markers are shown on top of the horizontal line, with NotI sites (N) being shown below the line. The location and orientation of the ATP6C, CCNF, and nagA transcriptional units have been previously described (Gillespie et al., Proc. Natl. Acad. Sci., USA 88: 4289-4293, 1991; Kraus et al., Genomics 24: 27-33, 1994; Burn et al., Genome Research 6: 525-537, 1996) and are shown below the genomic interval. The two P1 clones containing the netrin gene are shown below the schematic diagram of the interval. The location of the 6.8 kb of genomic sequence is enlarged below the P1 clones. The position of the two exon traps in the 6.8 kb of genomic sequence is also indicated.
The 6 kb fragment, and the adjacent 3.5 kb XhoI fragment, were subcloned and used to screen a random shotgun library from the 53.8B P1 clone. Subclones which were positive by hybridization were sequenced with forward and reverse vector primers. A total of 88 subclones were sequenced in this manner.
Additional sequence was obtained using internal primers as well as end sequence from the parental XhoI fragments. A total of 6.8 kb of genomic sequence with an overall redundancy of 7-fold was sequenced. The GC-content for the sequenced region was found to be 68.9%, which is slightly higher than the 62.8% observed for the 53 kb of genomic sequence from the PKD1 gene, located 350 kb further telomeric (The American PKD1 Consortium, 1995, supra; Burn et al., 1996, supra).
Computer analyses were performed to identify putative exons. GRAIL2 analysis predicted six exons within the 6.8 kb of genomic sequence with database analysis indicating that all but one exon (exon 1), encoded sequences with homology to the chicken netrins. FIG. 19A shows a GRAIL2 analysis of coding sequences in the 6.8 kb of genomic sequence from the 53.8B P1, with the gray scale denoting GC-content (white to light gray is GC rich and gray to black is AT rich), vertical boxes indicating relative quality of the predicted exons. A graphical depiction of the predicted exons is shown above the vertical boxes with light colored boxes denoting exons with a score of "excellent" (>80% probability) and dark colored boxes denoting exons with a score of "good" (>60% probability). The position of exon traps L75917 and L75916 (left to right, respectively) are shown above the GRAIL2 predicted exons. The structure of the gene based on comparison of the RT-PCR products and genomic sequence is shown at the top, the position of the exons in the genomic sequence is shown by the numbers above the exons. The 5' and 3' untranslated regions are also shown.
Additionally, the 6.8 kb of genomic sequence was compared to the protein sequences of the chicken netrins using a Pustell DNA/protein matrix. The genomic sequence (translated in all six frames) was compared to chicken netrin-2 in FIG. 19B, using a PAM250 matrix with the minimum homology set at 50% and the window set at 20. Regions of homology are shown by heavy diagonal lines. Five exons were predicted by this analysis, with only the first GRAIL2 predicted exon not appearing to be bona fide. Sequences from the two exon traps were also predicted by GRAIL2; however, there were noteworthy differences (cf FIG. 19A). In predicting sequences present in exon trap L75917, GRAIL2 included an additional 55 bp at the 5' end of the exon. The first of the two exons present in exon trap L75916 was not predicted by GRAIL2, while GRAIL2 added additional bases to the 5' and 3' ends of the second exon present in this exon trap.
A search of the Expressed Sequence Tags (EST) database did not reveal the presence of any ESTs from the human netrin gene. Nor was the human netrin message detected by Northern and/or RNA dot blot analysis using mRNA from over fifty different adult and fetal tissues, suggesting that hNET has an extremely restricted pattern of expression and when expressed is present in low abundance. Two murine ESTs, however, were identified from a brain library and a whole fetus library (Genbank Accession Nos. W59766 and AA048205, respectively) which have significant homology to hNET. The murine ESTs contain overlapping sequence with a total of 477 bp of contiguous sequence being represented. This 477 bp contiguous sequence aligns to the 5' end of the human netrin cDNA and includes 47 bp of 5' UTR and sequences encoding the N-terminal 143 amino acids. A comparison of the deduced human and murine protein sequence indicated that the two proteins were 89.5% (128/143) identical.
Characterization of the Human Netrin Transcript
In order to confirm the structure of the netrin gene, RT-PCR was performed using primers designed from the predicted exons. Since the predicted human netrin appeared to slightly more homologous to netrin-2 than netrin-1 (57% versus 54%, respectively) and netrin-2 is expressed in the spinal cord of chicken, adult human spinal cord polyA+ RNA was utilized as a template. RT-PCR products were obtained with only a portion of the primer pairs; however, even this required the use of nested primers and two rounds of PCR, with low yields making it necessary to use hybridization and radiolabeled probes to visualize the products. The low yield, and lack of RT-PCR products in some cases, was attributed to the high GC-content of the products (70-80%). The addition of betaine to a final concentration of 2.5 M in the PCR reactions was found to dramatically improve yield and purity of the RT-PCR products. (International Publication No. WO 96/12041; Reeves et al. (1994) Am. J. Hum. Genet. 55:A238; Baskaran et al. (1996) Genome Research 6:633-638).
Assembly of the RT-PCR products revealed a 1743 bp open reading frame (ORF) with an in-frame stop codon upstream of the proposed start methionine. In verifying the start and stop codons, a 209 bp 5' UTR and a 22 bp 3' UTR were cloned. Additional sequences from the respective UTRs were not cloned, however, since the goal of the RT-PCR experiments was to only confirm the predicted protein sequence and not to assemble a full-length cDNA. The position of the intron-exon boundaries was determined based on the comparison of the genomic sequence and the RT-PCR clones (FIG. 19A).
A 1.9 kb cDNA, hNET, was cloned by performing nested PCR using spinal cord cDNA as template and standard PCR conditions with the addition of betaine. The human netrin protein is predicted to be 580 amino acids in size, with the common domain structure of the netrin family being conserved. In FIG. 20A positions where the chicken netrins and UNC-6 sequences match the human sequence are denoted by periods while gaps introduced during the alignment are shown by hyphens. Arrows above the sequence alignment show the boundaries of the laminin VI and V domains, and C-terminal region (C) as described (Serafini et al., Cell 78: 409-424, 1994). The signal sequence (S) is also shown. V-1, V-2, and V-3 designate each of the EGF domains that constitute domain V. The hNET coding sequence and its predicted protein product are shown in FIGS. 4A and 4B. FIGS. 4C and 4D show full length hNET cDNA including both 5' and 3' UTR sequence.
Several lines of evidence rule against the possibility that the human netrin gene described herein represents a pseudogene. First, none of the exons in the coding region contain stop codons. Secondly, the overall gene structure described is highly conserved when compared to other members of the netrin/UNC-6 family. Third, despite the lack of signal in the Northern and RNA blot analysis, a mature transcript was isolated by RT-PCR. Finally, sequences in the murine EST database have been identified which are highly conserved. Taken together, these data indicate that a novel human netrin gene with a restricted pattern of expression has been identified.
Human netrins may have a significant role in neural regeneration. Though netrins do not by themselves promote axon growth, they do play a role in the orientation of axon growth. The combination of growth promoting activities with axon guidance cues would be a necessary requisite for directed neural regeneration.
The ability to clone a gene with such a restricted pattern of expression points out one of the strengths of the exon trapping procedure, since it is unlikely that the netrin gene would have been identified using cDNA selection or direct library screening. These results highlight the need for using a variety of approaches to identify and clone sequences from a large genomic contig.
Exon trapping results further show that there is a novel ATP Binding Cassette (ABC) transporter in the PKD1 locus located between the LCN1 and D16S291 markers in a centromeric to telomeric orientation. Database searches with the exon trap sequences show homology to the murine ABC1 and ABC2 genes (Luciani et al., supra. 1994). The human homologs of murine ABC1 and ABC2 have been cloned and mapped to human chromosome 9 (Luciani et al. supra. 1994). Sequences derived from the trapped exons along with those from cDNA selection and SAmple SEquencing (SASE) were used to recover overlapping partial cDNA clones.
Seven exon traps with homology to ABC transporters were isolated from P1 clones 30.1F, 64.12C and 96.4B. Additional sequences encoded by the ABC3 gene were obtained by RT-PCR (placenta and brain RNA as template) and library PCR (using commercially available lung cDNA library as template) using custom primers designed from the exon traps (Tables II and III). Three exon traps (L48758, L48759 and L48760) were obtained from the region of overlap between the 30.1F, 64.12C and 96.4B P1 clones (transcript F FIG. 1), while a fourth exon (L48753) maps to the 79.2A P1 clone, exclusively (transcript E in FIG. 1).
TABLE II__________________________________________________________________________Oligonucleotides Used to Clone Additional Sequences SEQ SEQ ID IDGene.sup.a Method.sup.b NO: Oligonucleotide 1.sup.c NO: Oligonucleotide 2.sup.d clone size.sup.e__________________________________________________________________________A Genetrapper 36 TGACGCCGTGCCCATCCAGT 37 CAGCGTGGTGTTATGTTCCT 2.0 kbB Genetrapper 38 TTGGGCCTGTGCTGAACTAC 39 CGGCAAGCTGGTGATTAACA 1.3 kbC 3'RACE 40 CGGCAGAGGATGCTGTGT 41 GCGGAGCCACCTTCATCA 0.6 kbF RT-PCR 42 GACGCTGGTGAAGGAGC 43 TCGCTGACCGCCAGGAT 1.1 kbH RT-PCR 44 CTGTCGGGAAGGTCTCACTG 45 GTTCACCGCCTTGGAGGATT 1.1 kbJ RT-PCR 46 GTGTGGGGAAGACCTGTCTG 47 AGGAGGCCTTGTTGGTGACA 0.24 kbL Genetrapper 48 ACGGACACCTGGGCTTC 49 AAACGGGAGGAGGTGGA 1.7 kbM Genetrapper 50 TGTGGCTATGAGCTGTTCTC 51 GCAGTCCCGATTCTGAATAT 0.7 kb__________________________________________________________________________ .sup.a Gene as denoted in FIG. 1 .sup.b Method used to clone additional sequences. Lifetechnologies Genetrapper system, 3'RACE and RTPCR. .sup.c Sequence of oligonucleotides used to obtain additional sequences. For the Genetrapper system, this oligonucleotide was used in the direct selection step. In the case of 3'RACE experiments, this oligonucleotide was the external prime. In the case of RTPCR experiments, the designated oligonucleotide was used as a sense primer. .sup.d Sequnce of oligonucleotides. In the Genetrapper experiments, this oligonucleotide was used in the repair step. For 3'RACE experiments, this was the internal primer. For RTPCR experiments, this was the anitsense primer. .sup.e Size of clone obtained using the primer pair.
TABLE IIIa__________________________________________________________________________Oligonucleotides Used to Clone Additional Sequences from human ABC3 SEQ ID SEQ ID cloneMethod NO: Oligonucleotide 1.sup.b NO: Oligonucleotide 2.sup.c clone name.sup.d size.sup.e__________________________________________________________________________Genetrapper 52 CATTGCCCGTGCTGTCGTG 53 CATCGCCGCCTCCTTCATG ABC3 (gt.1) 5.8 kbRT-PCR 52 CATTGCCCGTGCTGTCGTG 54 GCGGAGCCACCTTCATCA ABC3 (A12) 1.7 kbRT-PCR 55 GACGCTGGTGAAGGAGC 56 ATCCTGGCGGTCAGCGA ABC3 (3-12) 1.1 kbRT-PCR 57 AGGGATTCGACATTGCC 58 CTTCAGAGACTCAGGGGCAT ABC3 (#2) 0.5 kb__________________________________________________________________________ .sup.a Method used to clone additional sequences. Lifetechnologies Genetrapper system and RTPCR. .sup.b Sequence of oligonucleotides used to obtain additional sequences. For the Genetrapper system, this oligonucleotide was used in the direct selection step. In the case of RTPCR experiments, the designated oligonucleotide was used as a sense primer. .sup.c Sequence of oligonucleotides. In the Genetrapper experiments, this oligonucleotide was used in the repair step. For RTPCR experiments, this was the anitsense primer. .sup.d Assigned name of the isolated clone. .sup.e Size of clone obtained using the primer pair.
TABLE IIIB__________________________________________________________________________Oligonucleotides Used to Clone Additional Sequences from human ABC3 SEQ ID SEQ ID clone5' clone.sup.a NO: 5' primer.sup.b 3' clone.sup.c NO: 3' primer.sup.d clone size.sup.f__________________________________________________________________________et L48757 52 CATTGCCCGTGCTGTCGTG et L48758 54 GCGGAGCCACCTTCATCA ABC3 1.7 kbet L48758 55 GACGCTGGTGAAGGAGC et L48760 56 ATCCTGGCGGTCAGCGA ABC3 1.1 kbet L48760 57 GGGATTCGACATTGCC et L75924 58 CTTCAGAGACTCAGGGGCAT ABC3 0.5 kbsel. cDNA/SASE 76 AGCTGGCGCTCCTCCTCT et L48757 53 CATCGCCGCCTCCTTCATG ABC3 0.9__________________________________________________________________________ kb .sup.a Clone used to derive the 5' primer. .sup.b Sequence of the sense primer used in the RTPCR reaction. .sup.c Clone used to derive the 3' primer. .sup.d Sequence of the antisense primer used in the RTPCR reaction. .sup.e Assigned name of the isolated clone. .sup.f Size of clone obtained using the primer pair.
TABLE IV__________________________________________________________________________Oligonucleotides Used to Clone Sequences from the human Netrin SEQ ID SEQ ID cloneMethod.sup.a NO: Oligonucleotide 1.sup.b NO: Oligonucleotide 2.sup.c clone name.sup.d size.sup.e__________________________________________________________________________1.sup.o RT-PCR 59 GCCTGTCATCGCTCTAG 60 CAGTCGCAGGCCCTGCA2.sup.o PCR 61 GAGGACGCGCCAACATC 62 CGGCAGTAGTGGCAGTG 1121-1123 1264 bp1.sup.o RT-PCR 63 CCTGCCTCGCTTGCTCCTGC 64 CGGGCAGCCGCAGGCCGCAT2.sup.o PCR 65 CCTGCAACGGCCATGCCCGC 66 GCATCCCCGGCGGGCACCCA 1131-1141 601 bp1.sup.o RT-PCR 80 CTTGCAGGGCCTGCGAC 81 GAAGGCACAGGGTGAAC2.sup.o PCR 82 CTGCAACCAGACCACAG 83 TAGATGTGGGAGCAGCG 1125-1127 629 bp__________________________________________________________________________ .sup.a Method used to clone sequences. For 2.sup.o PCR, the 1.sup.o RTPCR product was diluted to a final concentration of one to one thousand. .sup.b Sequence of sensestrand oligonucleotides. .sup.c Sequence of antisensestrand oligonucleotides .sup.d Assigned name of the isolated cDNA clones. .sup.e Size of clone obtained using the primer pair.
Exon traps from the hABC3 transporter encoded by transcript F encode sequences with homology to the R-domain of the murine ABC1 and ABC2 genes. The R-domain is believed to play a regulatory role based on the comparison to a conserved region in CFTR. To date, only ABC1, ABC2 and CFTR have been shown to contain an R-domain (Luciani et al., supra. 1994).
Additionally, a 1.1 kb RT-PCR product which links the three exon traps from transcript F, with the RT-PCR product detecting a 7 kb message on Northern blots has been obtained. Based on a search of the dbEST database, a cDNA from this region was obtained with sequences from exon traps L75924 and L75925 being contained in cDNA 49233 from the I.M.A.G.E. Consortium (Lennon et al., supra.). The presence of both cloned reagents in the same transcription unit has been confirmed using RT-PCR.
The ATP binding cassette (ABC) transporters, or traffic ATPs, comprise a family of more than 100 proteins responsible for the transport of a wide variety of substrates across cell membranes in both prokaryotic and eukaryotic cells (Higgins, C. F., Annu. Rev. Cell. Biol. 8:67-113, 1992; Higgins, C. F. Cell 82:693-696, 1995). Proteins belonging to the ABC transporter superfamily are linked by strong structural similarities. Typically ABC transporters have four conserved domains, two hydrophobic domains which may impart substrate specificity (Payne et al., Mol. Gen. Genet. 200:493-496, 1985; Foote et al., Nature 345:255-258, 1990; Anderson et al., Science 253:202-205, 1991; Shustik et al., Br. J. Haematol. 79:50-56, 1991; Covitz et al., EMBO J. 13:1752-1759, 1994), and two highly conserved domains associated with ATP binding and hydrolysis (Higgins, supra. 1992). ABC transporters govern unidirectional transport of molecules into or out of cells and across subcellular membranes (Higgins, supra. 1992). Their substrates range from heavy metals (Ouellette et al., Res. Microbiol. 142:737-746 1991) to peptides and full size proteins (Gartner et al., Nature Genet. 1:16-23 1992).
In eukaryotic cells, ABC transporters exist either as single large symmetrical proteins containing all four domains or as dimers resulting from the association of two smaller polypeptides each containing a hydrophobic and ATP-binding domain. Examples of this multimeric structural form are human TAP proteins (Kelly et al., Nature 355:641-644 1992) and the functional PMP70 protein (Kamijo et al., J. Biol. Chem. 265:4534-40 1990). This multimeric structure is also found in numerous prokaryotic ABC transporters. The hydrophobic regions are comprised of up to six transmembrane spanning segments. Each ATP binding domain operates independently and may or may not be functionally equivalent (Kerem et al., Science 245:1073-80 1989; Mimmack et al., Proc. Natl. Acad. Sci., USA 86:8257-61 1989; Cutting et al., Nature 346:366-369 1990; Kerppola et al., J. Biol. Chem. 266:9857-65 1991).
Several of the ABC transporters thus far identified in humans have been shown to be clinically important. For example, overexpression of P-glycoproteins is responsible for multi-drug resistance in tumors (Gottesman et al., Ann. Rev. Biochem. 62:385-427 1993). Classical cystic fibrosis (CF) as well as a large proportion of cases of bilateral congenital disease of the vas deferens (CBAVD) are caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), an ABC transporter (Kerem et al., supra.; Cutting et al., supra.). Defects in ABC transporters have also been implicated in Zellweger syndrome (Gartner et al., supra.), and adrenoleukodystrophy (Mosser et al., Nature 361:726-730 1993).
Two members of a novel ABC transporter subgroup (murine ABC1 and ABC2 ) have been shown to contain domains similar to the regulatory R-domain of CFTR (Luciani et al., supra. 1994). Functionally, the mouse ABC1 protein has been shown to play a role in macrophage engulfment of apoptotic cells (Luciani et al., EMBO J. 16:226-235, 1996), while the function of ABC2 remains unknown. All three proteins contain a large charged region containing several potential phosphorylation sites (Kerem et al., supra.; Luciani et al., supra. 1994). The charged amino acid residues within this region are sequentially arranged in blocks of alternating positive and negative charge.
A common feature of these particular ABC transporters, including hABC3, is the presence of a large linker domain between the two ATP binding cassettes. The presence of numerous polar residues and potential phosphorylation sites in the linker domain suggest that this region may play a regulatory role perhaps similar to that of the R-domain of CFTR (Kerem et al., supra.). In addition, the four proteins also contain a hydrophobic region, the HH1 domain (Luciani et al., supra. 1994), within the conserved linker domain. Although there is little homology at the sequence level between the HH1 domains of hABC3 and the murine ABCs, they appear to be structurally conserved with each domain predicted to have .beta.-sheet conformation. The similarity between these proteins would suggest that they all belong to the same ABC subfamily, originally defined by ABC1 and ABC2 (Luciani et al., supra. 1994). The genes encoding the human homologues of ABC1 and ABC2 have been mapped to human chromosome 9 at q22-q31 and q34, respectively (Luciani et al., supra. 1994).
Despite being members of the same subfamily, it is likely that ABC1, ABC2 and hABC3 have different functional roles. The differences present in the transmembrane and linker domains of ABC1, ABC2 and hABC3 may confer each with a unique substrate specificity. For example, alterations and mutations in the transmembrane domains of both prokaryotic and eukaryotic ABC transporters have been shown to alter substrate specificity (Payne et al., supra.; Foote et al., supra.; Covitz et al., supra.) while changes to the R-domain of CFTR have been shown to alter its ion selectivity (Anderson et al., supra.; Rich et al., Science 253:205-207 1991). The differences in the expression patterns of ABC1, ABC2 and hABC3 also suggest that the proteins may be functionally distinct. Murine ABC1 and ABC2 have been shown to be expressed at varying levels in a wide variety of adult and embryonic tissues, with the highest levels of ABC1 expression being seen in pregnant uterus and regions rich in monocytic cells while highest levels of ABC2 expression were seen in brain (Luciani et al., supra. 1994; Luciani et al., supra. 1996). In contrast, hABC3 is preferentially expressed in lung with significantly lower levels of expression being seen in brain, heart, and pancreas.
Apart from the structural differences between ABC1, ABC2 and hABC3, it is always possible that the three proteins play similar functional roles in different cell populations. To date, no function has been proposed for murine ABC2. However, recent data indicate that ABC1 is required for the engulfment of cells undergoing apoptosis, though the molecular mechanism underlying ABC1 function is unknown (Luciani et al., supra. 1996). If hABC3 functions in a manner similar to ABC1, it could be expressed by pulmonary macrophages involved in host defense.
ABC transporters have been described for substrates ranging from small ions to large polysaccharides and proteins. Based on the high level of expression in lung, the substrate for hABC3 may play an integral role in the lung function, including ion or polysaccharide transport. Further clues may be provided by a closer examination of hABC3 expression in the lung. These studies would include the identification of the lung cells responsible for hABC3 expression as well as determining the subcellular localization of hABC3. The identification and cloning of the hABC3 cDNA may have implications for cystic fibrosis, since it contains a potential R-domain and is expressed at highest levels in the lung. If hABC3 does play an integral role in lung function, then modulation or alteration of hABC3 substrate specificity could have significant therapeutic implications for CF.
Several cDNAs were cloned using the GeneTrapper direct selection system and oligos designed from the 5' most trapped exon encoding sequences with homology to ABC1 (trapped exon L48747). The longest clone isolated with the GeneTrapper system from a normal human lung cDNA library using custom oligonucleotides designed from the 5' most exon trap was 5719 bp in length (ABCgt.1). An additional cDNA clone (ABC.5) was isolated using a radiolabeled 1.1 kb RT-PCR product (ABC3-12) as a probe (FIG. 15). The 5' end of the ABC3 cDNA was further characterized using 5' RACE, with several RACE products containing multiple in-frame stop codons upstream of the start methionine.
Accordingly, the present invention provides a novel human ABC gene which has homology to the murine ABC1 and ABC2 genes, as well as sequences predicted to be encoded by cosmid C48B4.4 from C. elegans (Wilson et al., supra.). A 6.4 kb cDNA has been assembled for the hABC3 transporter. The assembled cDNA contains a 5116 nucleotide long open reading frame encoding 1705 amino acids, with the predicted protein having a molecular weight of 191 kDa. The proposed start methionine is 50 bp upstream of the 5' end of clone ABCgt.1.
Five trapped exons from P1 clones 109.8C and 47.2H were shown to contain sequences with homology to the human ribosomal protein L3 cDNA, with hybridization studies indicating that the L3-like gene is oriented centromeric to telomeric (transcript L in FIG. 1). The ribosomal L3 gene product is one of five essential proteins for peptidyltransferase activity in the large ribosomal subunit (Schulze and Nierhaus, EMBO J. 1:609-613, 1982). Not surprisingly, the L3 amino acid sequence is highly conserved across species. Mammalian L3 genes showing .about.98% protein sequence identity have been characterized from man (Genbank Accession No. X73460), mouse (Peckham et al., Genes Dev. 3:2062-2071, 1989), rat (Kuwano and Wool, Biochem. Biophys. Res. Comm. 187:58-64, 1992) and cow (Simonic et al., Biochim. Biophys. Acta 1219:706-710, 1994). The cumulative percent identity between the trapped exons and the reported human ribosomal protein L3 cDNA was 74% (537/724) at the nucleotide level.
A full-length cDNA encoding a novel ribosomal L3 protein subtype, SEM L3, was isolated and sequenced (FIG. 11). This gene is now designated RPL3L and has been assigned GenBank Accession No. U65581. The deduced protein sequence is 407 amino acids long and shows 77% identity to other known mammalian L3 proteins, which are themselves highly conserved. Hybridization analysis of human genomic DNA suggests this novel gene is single copy and has a tissue specific pattern of expression.
The expression pattern of the previously identified human L3 gene and the novel human RPL3L was determined using multiple tissue Northern blots. The human L3 gene showed a ubiquitous pattern of expression in all tissues with the highest expression in the pancreas. In contrast, the novel gene described herein is strongly expressed in skeletal muscle and heart tissue, with low levels of expression in the pancreas. This novel gene, RPL3L (Ribosomal Protein L3-Like), is located in a gene-rich region near the PKD1 and TSC2 genes on chromosome 16p13.3.
The RPL3L protein is more closely related to the above mentioned cytoplasmic ribosomal proteins than to previously described nucleus-encoded mitochondrial proteins (Graack et al., Eur. J. Biochem. 206:373-380, 1992). The presence of a highly conserved nuclear localization sequence in the RPL3L further supports the hypothesis that it represents a novel cytoplasmic L3ribosomal protein subtype and not a nucleus-encoded mitochondrial protein.
In addition, an exon trap (Genbank Accession No. L48792) from a gene which is located telomeric of the L3-like gene was obtained (transcript M in FIG. 1). Sequences encoded by transcript M were shown to have homology to pilB from Neisseria gonorrhoeae (Taha et al., EMBO J. 7:4367-4378, 1988) as well as to a computer predicted 17.2 kDa protein encoded by cosmid F44E2.6 from C. elegans (Wilson et al., supra.).
Using sequences from exon trap L48792, a 600 bp partial cDNA was isolated and it was determined that the corresponding gene is oriented centromeric to telomeric. A 1.3 kb message was detected by the cDNA on Northern blots. Sequences conserved between the partial cDNA and the hypothetical 17.2 kDa protein were also conserved in the pilB protein from Neisseria gonorrhoeae (Taha et al., supra. 1988), a hypothetical 19.3 kDa protein from yeast (Genbank Accession No. P25566), and a fimbrial transcription regulation repressor from Haemophilus (Fleischmann et al., Science 269:496-512 1995) (FIG. 2). The pilB protein has homology to histidine kinase sensors and has been shown to play a role in the repression of pilin production in Neisseria gonorrhoeae (Taha et al., supra. 1988; Taha et al., Mol. Microbiol. 5:137-148, 1991). However, residues conserved between pilB, transcript M and the C. elegans, yeast, and Haemophilus sequences do not include the conserved histidine kinase domains from pilB (Taha et al., supra. 1991). These findings suggest that the conserved region in transcript M has a function which is independent of the proposed histidine kinase sensor activity of pilB.
An additional exon trap from region of overlap between the 109.8C and 47.2H P1 clones was shown to contain human LLRep3 sequences (Slynn et al., Nuc. Acids Res. 18:681, 1990). Hybridization studies indicated that the LLRep3 sequences (transcript K in FIG. 1) were located between the sazD and L3-like genes. The region of highest gene density appears to be at the telomeric end of this cloned interval, particularly the region between TSC2 and D16S84, with a minimum of five genes mapping to this region (transcription units K, L and M, sazD and hERV1).
Also mapped to this region, was an exon trap which is 86% identical (170/197) at the nucleotide level to the previously described rat augmenter of liver regeneration (Hagiya et al., Proc. Natl. Acad. Sci., USA 91:8142-8146, 1994). ALR is a growth factor which augments the growth of damaged liver tissue while having no effect on the resting liver. Studies have demonstrated that rat ALR is capable of augmenting hepatocytic regeneration following hepatectomy.
This ALR-like exon trap was also shown to contain sequences from the recently described hERV1 gene, which encodes a functional homologue to yeast ERV1 (Lisowsky et al., supra.).
A 468 bp cDNA, hALR, has been obtained from the human ALR gene (FIG. 13). The ALR sequences encode a 119 amino acid protein which is 84.8% identical and 94.1% similar to the rat ALR protein (FIG. 14).
The cloning of human ALR has significant implications in the treatment of degenerative liver diseases. For example, biologically active rat ALR has been produced from COS-7 cells expressing rat ALR cDNA (Hagiya et al., supra.). Accordingly, recombinant hALR could be used in the treatment of damaged liver. In addition, a construct expressing hALR could be used in gene therapy to treat chronic liver diseases.
Forty three of the trapped exons did not have significant homology to sequences in the protein or DNA databases, nor were ESTs (expressed sequence tags) containing sequences from the exon traps observed in dbEST. The absence of ESTs containing sequences from these novel exon traps is not surprising since one of the criterion for selecting exon traps for further analysis was the presence of an EST in the database. These trapped exons are likely to represent bona fide products, since in many cases they were trapped multiple times from different P1 clones and in combination with flanking exons.
The present invention encompasses novel human genes an isolated nucleic acids comprising unique exon sequences from chromosome 16. The sequences described herein provide a valuable resource for transcriptional mapping and create a set of sequence-ready templates for a gene-rich interval responsible for at least two inheritable diseases.
Accordingly, the present invention provides isolated nucleic acids encoding human netrin (hNET), human ATP Binding Cassette transporter (hABC3), human ribosomal L3 (RPL3L) and human augmenter of liver regeneration (hALR) polypeptides. The present invention further provides isolated nucleic acids comprising unique exon sequences from chromosome 16. The term "nucleic acids" (also referred to as polynucleotides) encompasses RNA as well as single and double-stranded DNA, cDNA and oligonucleotides. As used herein, the phrase "isolated" means a polynucleotide that is in a form that does not occur in nature.
One means of isolating polynucleotides encoding invention polypeptides is to probe a human tissue-specific library with a natural or artificially designed DNA probe using methods well known in the art. DNA probes derived from the human netrin gene, hNET, the human ABC transporter gene, hABC3, the human ribosomal protein L3 gene, RPL3L, or the human augmenter of liver regeneration gene, hALR, are particularly useful for this purpose. DNA and cDNA molecules that encode invention polypeptides can be used to obtain complementary genomic DNA, cDNA or RNA from human, mammalian, or other animal sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, by methods described in more detail below.
The present invention encompasses isolated nucleic acid sequences, including sense and antisense oligonucleotide sequences, derived from the sequences shown in FIGS. 3, 4, 8, 11 and 15. hNET-, hABC3-, RPL3L- (SEM L3-), and hALR-derived sequences may also be associated with heterologous sequences, including promoters, enhancers, response elements, signal sequences, polyadenylation sequences, and the like. Furthermore, the nucleic acids can be modified to alter stability, solubility, binding affinity, and specificity. For example, invention-derived sequences can further include nuclease-resistant phosphorothioate, phosphoroamidate, and methylphosphonate derivatives, as well as "protein nucleic acid" (PNA) formed by conjugating bases to an amino acid backbone as described in Nielsen et al., Science, 254:1497, 1991. The nucleic acid may be derivatized by linkage of the .alpha.-anomer nucleotide, or by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage. Furthermore, the nucleic acid sequences of the present invention may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, biotin, and the like.
In general, nucleic acid manipulations according to the present invention use methods that are well known in the art, as disclosed in, for example, Sambrook et al., Molecular Cloning, A Laboratory Manual 2d Ed. (Cold Spring Harbor, N.Y., 1989), or Ausubel et al., Current Protocols in Molecular Biology (Greene Assoc., Wiley Interscience, New York, N.Y., 1992).
Examples of nucleic acids are RNA, cDNA, or genomic DNA encoding a human netrin, a human ABC transporter, a human ribosomal L3 subtype, or a human augmenter of liver regeneration polypeptide. Such nucleic acids may have coding sequences substantially the same as the coding sequence shown in FIGS. 3, 4, 8, 11 and 15, respectively.
The present invention further provides isolated oligonucleotides corresponding to sequences within the hNET, hABC3, RPL3L (formerly SEM L3), hALR genes, or within the respective cDNAs, which, alone or together, can be used to discriminate between the authentic expressed gene and homologues or other repeated sequences. These oligonucleotides may be from about 12 to about 60 nucleotides in length, preferably about 18 nucleotides, may be single- or double-stranded, and may be labeled or modified as described below.
This invention also encompasses nucleic acids which differ from the nucleic acids shown in FIGS. 3, 4, 8, 11 and 15, but which have the same phenotype, i.e., encode substantially the same amino acid sequence set forth in FIGS. 3, 4, 8, 11 and 15, respectively. Phenotypically similar nucleic acids are also referred to as "functionally equivalent nucleic acids". As used herein, the phrase "functionally equivalent nucleic acids" encompasses nucleic acids characterized by slight and non-consequential sequence variations that will function in substantially the same manner to produce the same protein product(s) as the nucleic acids disclosed herein. In particular, functionally equivalent nucleic acids encode proteins that are the same as those disclosed herein or that have conservative amino acid variations. For example, conservative variations include substitution of a non-polar residue with another non-polar residue, or substitution of a charged residue with a similarly charged residue. These variations include those recognized by skilled artisans as those that do not substantially alter the tertiary structure of the protein.
Further provided are nucleic acids encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, and human augmenter of liver regeneration polypeptides that, by virtue of the degeneracy of the genetic code, do not necessarily hybridize to the invention nucleic acids under specified hybridization conditions. Preferred nucleic acids encoding the invention polypeptide are comprised of nucleotides that encode substantially the same amino acid sequence set forth in FIGS. 4, 8, 11 and 15. Alternatively, preferred nucleic acids encoding the invention polypeptide(s) hybridize under high stringency conditions to substantially the entire sequence, or substantial portions (i.e., typically at least 12 to 60 nucleotides) of the nucleic acid sequence set forth in FIGS. 3, 4, 8, 11 and 15, respectively.
Stringency of hybridization, as used herein, refers to conditions under which polynucleotide hybrids are stable. As known to those of skill in the art, the stability of hybrids is a function of sodium ion concentration and temperature. (See, for example, Sambrook et al., supra.).
The present invention provides isolated polynucleotides operatively linked to a promoter of RNA transcription, as well as other regulatory sequences. As used herein, the phrase "operatively linked" refers to the functional relationship of the polynucleotide with regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences. For example, operative linkage of a polynucleotide to a promoter refers to the physical and functional relationship between the polynucleotide and the promoter such that transcription of DNA is initiated from the promoter by an RNA polymerase that specifically recognizes and binds to the promoter, and wherein the promoter directs the transcription of RNA from the polynucleotide.
Promoter regions include specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. Additionally, promoter regions include sequences that modulate the recognition, binding and transcription initiation activity of RNA polymerase. Such sequences may be cis acting or may be responsive to trans acting factors. Depending upon the nature of the regulation, promoters may be constitutive or regulated. Examples of promoters are SP6, T4, T7, SV40 early promoter, cytomegalovirus (CMV) promoter, mouse mammary tumor virus (MMTV) steroid-inducible promoter, Moloney murine leukemia virus (MMLV) promoter, and the like.
Vectors that contain both a promoter and a cloning site into which a polynucleotide can be operatively linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo, and are commercially available from sources such as Stratagene (La Jolla, Calif.) and Promega Biotech (Madison, Wis.). In order to optimize expression and/or in vitro transcription, it may be necessary to remove, add or alter 5' and/or 3' untranslated portions of the clones to eliminate extra, potential inappropriate alternative translation initiation codons or other sequences that may interfere with or reduce expression, either at the level of transcription or translation. Alternatively, consensus ribosome binding sites can be inserted immediately 5' of the start codon to enhance expression. Similarly, alternative codons, encoding the same amino acid, can be substituted for coding sequences of the human netrin, human ABC3 transporter, the human ribosomal L3 subtype, or the human augmenter of liver regeneration polypeptide in order to enhance transcription (e.g., the codon preference of the host cell can be adopted, the presence of G-C rich domains can be reduced, and the like).
Examples of vectors are viruses, such as baculoviruses and retroviruses, bacteriophages, cosmids, plasmids, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.
Polynucleotides are inserted into vector genomes using methods well known in the art. For example, insert and vector DNA can be contacted, under suitable conditions, with a restriction enzyme to create complementary ends on each molecule that can pair with each other and be joined together with a ligase. Alternatively, synthetic nucleic acid linkers can be ligated to the termini of restricted polynucleotide. These synthetic linkers contain nucleic acid sequences that correspond to a particular restriction site in the vector DNA. Additionally, an oligonucleotide containing a termination codon and an appropriate restriction site can be ligated for insertion into a vector containing, for example, some or all of the following:a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in mammalian cells; enhancer/promoter sequences from the immediate early gene of human CMV for high levels of transcription; transcription termination and RNA processing signals from SV40 for mRNA stability; SV40 polyoma origins of replication and ColE1 for proper episomal replication; versatile multiple cloning sites; and T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA. Other means are well known and available in the art.
Also provided are vectors comprising a polynucleotide encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, and human augmenter of liver regeneration polypeptides, adapted for expression in a bacterial cell, a yeast cell, an amphibian cell, an insect cell, a mammalian cell and other animal cells. The vectors additionally comprise the regulatory elements necessary for expression of the polynucleotide in the bacterial, yeast, amphibian, mammalian or animal cells so located relative to the polynucleotide encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptides as to permit expression thereof. As used herein, "expression" refers to the process by which polynucleotides are transcribed into mRNA and translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA, if an appropriate eukaryotic host is selected. Regulatory elements required for expression include promoter sequences to bind RNA polymerase and transcription initiation sequences for ribosome binding. For example, a bacterial expression vector includes a promoter such as the lac promoter and for transcription initiation the Shine-Dalgarno sequence and the start codon AUG (Sambrook et al., supra.). Similarly, a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome. Such vectors can be obtained commercially or assembled by the sequences described in methods well known in the art, for example, the methods described above for constructing vectors in general. Expression vectors are useful to produce cells that express the invention receptor.
This invention provides a transformed host cell that recombinantly expresses the human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptides. Invention host cells have been transformed with a polynucleotide encoding a human netrin, a human ABC3 transporter, a human ribosomal L3 subtype, or a human augmenter of liver regeneration polypeptide. An example is a mammalian cell comprising a plasmid adapted for expression in a mammalian cell. The plasmid contains a polynucleotide encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide and the regulatory elements necessary for expression of the invention protein.
Appropriate host cells include bacteria, archebacteria, fungi, especially yeast, plant cells, insect cells and animal cells, especially mammalian cells. of particular interest are E. coli, B. subtilis, Saccharomyces cerevisiae, SF9 cells, C129 cells, 293 cells, Neurospora, and CHO cells, COS cells, HeLa cells, and immortalized mammalian myeloid and lymphoid cell lines. Preferred replication systems include M13, ColE1, SV40, baculovirus, lambda, adenovirus, artificial chromosomes, and the like. A large number of transcription initiation and termination regulatory regions have been isolated and shown to be effective in the transcription and translation of heterologous proteins in the various hosts. Examples of these regions, methods of isolation, manner of manipulation, and the like, are known in the art. Under appropriate expression conditions, host cells can be used as a source of recombinantly produced hNET, hABC3, RPL3L (formerly SEM L3) and/or hALR.
Nucleic acids (polynucleotides) encoding invention polypeptides may also be incorporated into the genome of recipient cells by recombination events. For example, such a sequence can be microinjected into a cell, and thereby effect homologous recombination at the site of an endogenous gene encoding hNET, hABC3, RPL3L (formerly SEM L3), and/or hALR an analog or pseudogene thereof, or a sequence with substantial identity to a hNET-, hABC3-, RPL3L (SEM L3-), or hALR- encoding gene. other recombination-based methods such as nonhomologous recombinations or deletion of endogenous gene by homologous recombination, especially in pluripotent cells, may also be used.
The present invention provides isolated peptides, polypeptides(s) and/or protein(s) encoded by the invention nucleic acids. The present invention also encompasses isolated polypeptides having a sequence encoded by hNET, hABC3, RPL3L (SEM L3), and hALR genes, as well as peptides of six or more amino acids derived therefrom. The polypeptide(s) may be isolated from human tissues obtained by biopsy or autopsy, or may be produced in a heterologous cell by recombinant DNA methods as described herein.
As used herein, the term "isolated" means a protein molecule free of cellular components and/or contaminants normally associated with a native in vivo environment. Invention polypeptides and/or proteins include any natural occurring allelic variant, as well as recombinant forms thereof. Invention polypeptides can be isolated using various methods well known to a person of skill in the art.
The methods available for the isolation and purification of invention proteins include, precipitation, gel filtration, and chromatographic methods including molecular sieve, ion-exchange, and affinity chromatography using e.g. hNET-, hABC3-, RPL3L- (SEM L3-), and/or hALR-specific antibodies or ligands. Other well-known methods are described in Deutscher et al., Guide to Protein Purification: Methods in Enzymology Vol. 182, (Academic Press, 1990). When the invention polypeptide to be purified is produced in a recombinant system, the recombinant expression vector may comprise additional sequences that encode additional amino-terminal or carboxy-terminal amino acids; these extra amino acids act as "tags" for immunoaffinity purification using immobilized antibodies or for affinity purification using immobilized ligands.
Peptides comprising hNET-, hABC3-, RPL3L- (SEM L3-) or hALR-specific sequences may be derived from isolated larger hNET, hABC3, RPL3L (SEM L3), or hALR polypeptides described above, using proteolytic cleavages by e.g. proteases such as trypsin and chemical treatments such as cyanogen bromide that are well-known in the art. Alternatively, peptides up to 60 residues in length can be routinely synthesized in milligram quantities using commercially available peptide synthesizers.
An example of the means for preparing the invention polypeptide(s) is to express polynucleotides encoding hNET, hABC3, RPL3L (SEM L3), and/or hALR in a suitable host cell, such as a bacterial cell, a yeast cell, an amphibian cell (i.e., oocyte), an insect cell (i.e., drosophila) or a mammalian cell, using methods well known in the art, and recovering the expressed polypeptide, again using well-known methods. Invention polypeptides can be isolated directly from cells that have been transformed with expression vectors, described below in more detail. The invention polypeptide, biologically active fragments, and functional equivalents thereof can also be produced by chemical synthesis. As used herein, "biologically active fragment" refers to any portion of the polypeptide represented by the amino acid sequence in FIGS. 4, 8, 11 and 15 that can assemble into an active protein. Synthetic polypeptides can be produced using Applied Biosystems, Inc. Model 430A or 431A automatic peptide synthesizer (Foster City, Calif.) employing the chemistry provided by the manufacturer.
Modification of the invention nucleic acids, polynucleotides, polypeptides, peptides or proteins with the following phrases: "recombinantly expressed/produced", "isolated", or "substantially pure", encompasses nucleic acids, polynucleotides, polypeptides, peptides or proteins that have been produced in such form by the hand of man, and are thus separated from their native in vivo cellular environment. As a result of this human intervention, the recombinant nucleic acids, polynucleotides, polypeptides, peptides and proteins of the invention are useful in ways that the corresponding naturally occurring molecules are not, such as identification of selective drugs or compounds.
Sequences having "substantial sequence homology" are intended to refer to nucleotide sequences that share at least about 90% identity with invention nucleic acids; and amino acid sequences that typically share at least about 95% amino acid identity with invention polypeptides. It is recognized, however, that polypeptides or nucleic acids containing less than the above-described levels of homology arising as splice variants or that are modified by conservative amino acid substitutions, or by substitution of degenerate codons are also encompassed within the scope of the present invention.
The present invention provides a nucleic acid probe comprising a polynucleotide capable of specifically hybridizing with a sequence included within the nucleic acid sequence encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide, for example, a coding sequence included within the nucleotide sequence shown in FIGS. 3, 4, 8, 11 and 15, respectively.
As used herein, a "nucleic acid probe" may be a sequence of nucleotides that includes from about 12 to about 60 contiguous bases set forth in FIGS. 3, 4, 8, 11 and 15, preferably about 18 nucleotides, may be single- or double-stranded, and may be labeled or modified as described herein. Preferred regions from which to construct probes include 5' and/or 3' coding sequences, sequences predicted to encode transmembrane domains, sequences predicted to encode cytoplasmic loops, signal sequences, ligand binding sites, and the like.
Full-length or fragments of cDNA clones can also be used as probes for the detection and isolation of related genes. When fragments are used as probes, preferably the cDNA sequences will be from the carboxyl end-encoding portion of the cDNA, and most preferably will include predicted transmembrane domain-encoding portions of the cDNA sequence. Transmembrane domain regions can be predicted based on hydropathy analysis of the deduced amino acid sequence using, for example, the method of Kyte and Doolittle (J. Mol. Biol. 157:105, 1982).
As used herein, the phrase "specifically hybridizing" encompasses the ability of a polynucleotide to recognize a sequence of nucleic acids that are complementary thereto and to form double-helical segments via hydrogen bonding between complementary base pairs. Nucleic acid probe technology is well known to those skilled in the art who will readily appreciate that such probes may vary greatly in length and may be labeled with a detectable agent, such as a radioisotope, a fluorescent dye, and the like, to facilitate detection of the probe. Invention probes are useful to detect the presence of nucleic acids encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptides. For example, the probes can be used for in situ hybridizations in order to locate biological tissues in which the invention gene is expressed. Additionally, synthesized oligonucleotides complementary to the nucleic acids of a polynucleotide encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptides are useful as probes for detecting the invention genes, their associated mRNA, or for the isolation of related genes using homology screening of genomic or cDNA libraries, or by using amplification techniques well known to one of skill in the art.
Also provided are antisense oligonucleotides having a sequence capable of binding specifically with any portion of an mRNA that encodes human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide so as to prevent translation of the mRNA. The antisense oligonucleotide may have a sequence capable of binding specifically with any portion of the sequence of the cDNA encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide. As used herein, the phrase "binding specifically" encompasses the ability of a nucleic acid sequence to recognize a complementary nucleic acid sequence and to form double-helical segments therewith via the formation of hydrogen bonds between the complementary base pairs. An example of an antisense oligonucleotide is an antisense oligonucleotide comprising chemical analogs of nucleotides (i.e., synthetic antisense oligonucleotide, SAO).
Compositions comprising an amount of the antisense oligonucleotide, (SAOC), effective to reduce expression of the human netrin, the human ABC3 transporter, the human ribosomal L3 subtype, or the human augmenter of liver regeneration polypeptide by passing through a cell membrane and binding specifically with mRNA encoding the human netrin, the human ABC3 transporter, the human ribosomal L3 subtype, or the human augmenter of liver regeneration polypeptide so as to prevent its translation and an acceptable hydrophobic carrier capable of passing through a cell membrane are also provided herein. The acceptable hydrophobic carrier capable of passing through cell membranes may also comprise a structure which binds to a receptor specific for a selected cell type and is thereby taken up by cells of the selected cell type. The structure may be part of a protein known to bind to a cell-type specific receptor.
This invention provides a means to modulate levels of expression of invention polypeptides by the use of a synthetic antisense oligonucleotide composition (SAOC) which inhibits translation of mRNA encoding these polypeptides. Synthetic oligonucleotides, or other antisense chemical structures designed to recognize and selectively bind to mRNA, are constructed to be complementary to portions of the nucleotide sequences shown in FIGS. 3, 4, 8, 11 and 15, of DNA, RNA or chemically modified, artificial nucleic acids. The SAOC is designed to be stable in the blood stream for administration to a subject by injection, or in laboratory cell culture conditions. The SAOC is de signed to be capable of passing through the cell membrane in order to enter the cytoplasm of the cell by virtue of physical and chemical properties of the SAOC which render it capable of passing through cell membranes, for example, by designing small, hydrophobic SAOC chemical structures, or by virtue of specific transport systems in the cell which recognize and transport the SAOC into the cell.
In addition, the SAOC can be designed for administration only to certain selected cell populations by targeting the SAOC to be recognized by specific cellular uptake mechanisms which bind and take up the SAOC only within select cell populations. For example, the SAOC may be designed to bind to a receptor found only in a certain cell type, as discussed supra. The SAOC is also designed to recognize and selectively bind to the target mRNA sequence, which may correspond to a sequence contained within the sequence shown in FIGS. 3, 4, 8, 11 and 15. The SAOC is designed to inactivate the target mRNA sequence by either binding to the target mRNA and inducing degradation of the mRNA by, for example, RNase I digestion, or inhibiting translation of the mRNA target by interfering with the binding of translation-regulating factors or ribosomes, or inclusion of other chemical structures, such as ribozyme sequences or reactive chemical groups which either degrade or chemically modify the target mRNA. SAOCs have been shown to be capable of such properties when directed against mRNA targets (see Cohen et al., TIPS, 10:435, 1989 and Weintraub, Sci. American, January pp.40, 1990).
This invention further provides a composition containing an acceptable carrier and any of an isolated, purified human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide, an active fragment thereof, or a purified, mature protein and active fragments thereof, alone or in combination with each other. These polypeptides or proteins can be recombinantly derived, chemically synthesized or purified from native sources. As used herein, the term "acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents.
Also provided are antibodies having specific reactivity with the human netrin, the human ABC3 transporter, the human ribosomal L3 subtype, or the human augmenter of liver regeneration polypeptides of the subject invention. Active fragments of antibodies are encompassed within the definition of "antibody". Invention antibodies can be produced by methods known in the art using the invention proteins or portions thereof as antigens. For example, polyclonal and monoclonal antibodies can be produced by methods well known in the art, as described, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory 1988).
The polypeptides of the present invention can be used as the immunogen in generating such antibodies. Alternatively, synthetic peptides can be prepared (using commercially available synthesizers) and used as immunogens. Where natural or synthetic hNET-, hABC3-, RPL3L- (SEM L3-), and/or hALR-derived peptides are used to induce a hNET-, hABC3-, RPL3L- (SEM L3-), and/or hALR-specific immune response, the peptides may be conveniently coupled to an suitable carrier such as KLH and administered in a suitable adjuvant such as Freund's. Preferably, selected peptides are coupled to a lysine core carrier substantially according to the methods of Tam, Proc. Natl. Acad. Sci, USA 85:5409-5413, 1988. The resulting antibodies may be modified to a monovalent form, such as, for example, Fab, Fab.sub.2, FAB', or FV. Anti-idiotypic antibodies may also be prepared using known methods.
In one embodiment, normal or mutated hNET, hABC3, RPL3L (SEM L3), or hALR polypeptides are used to immunize mice, after which their spleens are removed, and splenocytes used to form cell hybrids with myeloma cells and obtain clones of antibody-secreted cells according to techniques that are standard in the art. The resulting monoclonal antibodies are screened for specific binding to hNET, hABC3, RPL3L (SEM L3), and/or hALR proteins or hNET-, hABC3-, RPL3L- (SEM L3-), and/or hALR-related peptides.
In another embodiment, antibodies are screened for selective binding to normal or mutated hNET, hABC3, RPL3L (SEM L3), or hALR sequences. Antibodies that distinguish between normal and mutant forms of hNET, hABC3, RPL3L (SEM L3), or hALR may be used in diagnostic tests (see below) employing ELISA, EMIT, CEDIA, SLIFA, and the like. Anti-hNET, hABC3, RPL3L (SEM L3), or hALR antibodies may also be used to perform subcellular and histochemical localization studies. Finally, antibodies may be used to block the function of the hNET, hABC3, RPL3L (SEM L3), and/or hALR polypeptide, whether normal or mutant, or to perform rational drug design studies to identify and test inhibitors of the function (e.g., using an anti-idiotypic antibody approach).
Amino acid sequences can be analyzed by methods well known in the art to determine whether they encode hydrophobic or hydrophilic domains of the corresponding polypeptide. Altered antibodies such as chimeric, humanized, CDR-grafted or bifunctional antibodies can also be produced by methods well known in the art. Such antibodies can also be produced by hybridoma, chemical synthesis or recombinant methods described, for example, in Sambrook et al., supra., and Harlow and Lane, supra. Both anti-peptide and anti-fusion protein antibodies can be used. (see, for example, Bahouth et al., Trends Pharmacol. Sci. 12:338, 1991; Ausubel et al., supra.).
Invention antibodies can be used to isolate invention polypeptides. Additionally, the antibodies are useful for detecting the presence of the invention polypeptides, as well as analysis of polypeptide localization, composition, and structure of functional domains. Methods for detecting the presence of a human netrin, a human ABC3 transporter, a human ribosomal L3subtype, or a human augmenter of liver regeneration polypeptide comprise contacting the cell with an antibody that specifically binds to the polypeptide, under conditions permitting binding of the antibody to the polypeptide, detecting the presence of the antibody bound to the cell, and thereby detecting the presence of the invention polypeptide on the cell. With respect to the detection of such polypeptides, the antibodies can be used for in vitro diagnostic or in vivo imaging methods.
Immunological procedures useful for in vitro detection of the target human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide in a sample include immunoassays that employ a detectable antibody. Such immunoassays include, for example, ELISA, Pandex microfluorimetric assay, agglutination assays, flow cytometry, serum diagnostic assays and immunohistochemical staining procedures which are well known in the art. An antibody can be made detectable by various means well known in the art. For example, a detectable marker can be directly or indirectly attached to the antibody. Useful markers include, for example, radionuclides, enzymes, fluorogens, chromogens and chemiluminescent labels.
For in vivo imaging methods, a detectable antibody can be administered to a subject and the binding of the antibody to the invention polypeptide can be detected by imaging techniques well known in the art. Suitable imaging agents are known and include, for example, gamma-emitting radionuclides such as .sup.111 In, .sup.99m Tc, .sup.51 Cr and the like, as well as paramagnetic metal ions, which are described in U.S. Pat. No. 4,647,447. The radionuclides permit the imaging of tissues by gamma scintillation photometry, positron emission tomography, single photon emission computed tomography and gamma camera whole body imaging, while paramagnetic metal ions permit visualization by magnetic resonance imaging.
The invention provides a transgenic non-human mammal that is capable of expressing nucleic acids encoding a human netrin, a human ABC3 transporter, a human ribosomal L3 subtype, or a human augmenter of liver regeneration polypeptide. Also provided is a transgenic non-human mammal capable of expressing nucleic acids encoding a human netrin, a human ABC3 transporter, a human ribosomal L3 subtype, or a human augmenter of liver regeneration polypeptide so mutated as to be incapable of normal activity, i.e., does not express native protein.
The present invention also provides a transgenic non-human mammal having a genome comprising antisense nucleic acids complementary to nucleic acids encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide so placed as to be transcribed into antisense mRNA complementary to mRNA encoding a human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide, which hybridizes thereto and, thereby, reduces the translation thereof. The polynucleotide may additionally comprise an inducible promoter and/or tissue specific regulatory elements, so that expression can be induced, or restricted to specific cell types. Examples of polynucleotides are DNA or cDNA having a coding sequence substantially the same as the coding sequence shown in FIGS. 3, 4, 8, 11 and 15. Examples of non-human transgenic mammals are transgenic cows, sheep, goats, pigs, rabbits, rats and mice. Examples of tissue specificity-determining elements are the metallothionein promoter and the T7 promoter.
Animal model systems which elucidate the physiological and behavioral roles of invention polypeptides are produced by creating transgenic animals in which the expression of the polypeptide is altered using a variety of techniques. Examples of such techniques include the insertion of normal or mutant versions of nucleic acids encoding human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide by microinjection, retroviral infection or other means well known to those skilled in the art, into appropriate fertilized embryos to produce a transgenic animal. See, for example, Carver et al., Bio/Technology 11:1263-1270, 1993; Carver et al., Cytotechnology 9:77-84, 1992; Clark et al., Bio/Technology 7:487-492, 1989; Simons et al., Bio/Technology 6:179-183, 1988; Swanson et al., Bio/Technology 10:557-559, 1992; Velander et al., Proc. Natl. Acad. Sci., USA 89:12003-12007, 1992; Hammer et al., Nature 315:680-683, 1985; Krimpenfort et al., Bio/Technology 9:844-847, 1991; Ebert et al., Bio/Technology 9:835-838, 1991; Simons et al., Nature 328:530-532, 1987; Pittius et al., Proc. Natl. Acad. Sci., USA 85:5874-5878, 1988; Greenberg et al., Proc. Natl. Acad. Sci., USA 88:8327-8331, 1991; Whitelaw et al., Transg. Res. 1:3-13, 1991; Gordon et al., Bio/Technology 5:1183-1187, 1987; Grosveld et al., Cell 51:975-985, 1987; Brinster et al., Proc. Natl. Acad. Sci., USA 88:478-482, 1991; Brinster et al., Proc. Natl. Acad. Sci., USA 85:836-840, 1988; Brinster et al., Proc. Natl. Acad. Sci., USA 82:4438-4442, 1985; Al-Shawi et al., Mol. Cell. Biol. 10(3):1192-1198, 1990; Van Der Putten et al., Proc. Natl. Acad. Sci., USA 82:6148-6152, 1985; Thompson et al., Cell 56:313-321, 1989; Gordon et al., Science 214:1244-1246, 1981; and Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratory, 1986).
Another technique, homologous recombination of mutant or normal versions of these genes with the native gene locus in transgenic animals, may be used to alter the regulation of expression or the structure of the invention polypeptides (see, Capecchi et al., Science 244:1288, 1989; Zimmer et al., Nature 338:150, 1989). Homologous recombination techniques are well known in the art. Homologous recombination replaces the native (endogenous) gene with a recombinant or mutated gene to produce an animal that cannot express native (endogenous) protein but can express, for example, a mutated protein which results in altered expression of the human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide.
In contrast to homologous recombination, microinjection adds genes to the host genome, without removing host genes. Microinjection can produce a transgenic animal that is capable of expressing both endogenous and exogenous human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptides. Inducible promoters can be linked to the coding region of the nucleic acids to provide a means to regulate expression of the transgene. Tissue-specific regulatory elements can be linked to the coding region to permit tissue-specific expression of the transgene. Transgenic animal model systems are useful for in vivo screening of compounds for identification of ligands, i.e., agonists and antagonists, which activate or inhibit polypeptide responses.
The nucleic acids, oligonucleotides (including antisense), vectors containing same, transformed host cells, polypeptides, as well as antibodies of the present invention, can be used to screen compounds in vitro to determine whether a compound functions as a potential agonist or antagonist to the invention protein. These in vitro screening assays provide information regarding the function and activity of the invention protein, which can lead to the identification and design of compounds that are capable of specific interaction with invention proteins.
In accordance with still another embodiment of the present invention, there is provided a method for identifying compounds which bind to human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptides. The invention proteins may be employed in a competitive binding assay. Such an assay can accommodate the rapid screening of a large number of compounds to determine which compounds, if any, are capable of binding to invention polypeptides. Subsequently, more detailed assays can be carried out with those compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of invention polypeptides.
In accordance with another embodiment of the present invention, transformed host cells that recombinantly express invention polypeptides can be contacted with a test compound, and the modulating effect(s) thereof can then be evaluated by comparing the human netrin, human ABC3 transporter, human ribosomal L3 subtype, or human augmenter of liver regeneration polypeptide-mediated response in the presence and absence of test compound, or by comparing the response of test cells or control cells (i.e., cells that do not express invention polypeptides), to the presence of the compound.
As used herein, a compound or a signal that "modulates the activity" of an invention polypeptide refers to a compound or a signal that alters the activity of the human netrin, the human ABC3 transporter, the human ribosomal L3 subtype, or the human augmenter of liver regeneration polypeptide so that the activity of the invention polypeptide is different in the presence of the compound or signal than in the absence of the compound or signal. In particular, such compounds or signals include agonists and antagonists. An agonist encompasses a compound or a signal that activates polypeptide function. Alternatively, an antagonist includes a compound or signal that interferes with polypeptide function. Typically, the effect of an antagonist is observed as a blocking of agonist-induced protein activation. Antagonists include competitive and non-competitive antagonists. A competitive antagonist (or competitive blocker) interacts with or near the site specific for agonist binding. A non-competitive antagonist or blocker inactivates the function of the polypeptide by interacting with a site other than the agonist interaction site.
The following examples are intended to illustrate the invention without limiting the scope thereof.
EXAMPLE I
Contig Assembly
A. Cosmids
Multiple cosmids were used as reagents to initiate walks in YAC and P1 libraries. Clones 16-166N (D16S277), 16-191N (D16S279), 16-198N (D16S280) and 16-140N (D16S276) were previously isolated from a cosmid library (Lerner et al., Mamm. Genome 3:92-100, 1992). Cosmids cCMM65 (D16S84), c291 (D16S291), cAJ42 (ATP6C) and cKG8 were recovered from total human cosmid libraries (made in-house or by Stratagene, La Jolla, Calif.) using either a cloned insert (CMM65) or sequence-specific oligonucleotides as probe. The c326 cosmid contig and clone 413C12 originated from a flow-sorted chromosome 16 library (Stallings et al., Genomics 13(4):1031-1039, 1992). The c326 contig was comprised of clones 2H2, 77E8, 325A11 and 325B10.
B. YACs
Screening of gridded interspersed-repetitive sequence (IRS pools from Mark I, Mark II and Mega-YAC libraries) with cosmid-specific IRS probes was as previously described (Liu et al., Genomics 26:178-191, 1995). IRS probes were made from cosmids 16-166N, 16-191N, cAJ42, 16-198N, 325A11, cCMM65, and 16-140N. Biotinylated YAC probes were generated by nick-translating complex mixtures of IRS products from each YAC. Mixtures of sufficient complexity were achieved by performing independent DNA amplifications of total yeast DNA using various Alu primers (Lichter et al., Proc. Natl. Acad. Sci., USA 87:6634-6638, 1990) and then combining the appropriate reactions containing the most diverse products.
C. P1s
Chromosome walking experiments were done using a single set of membranes which contained the gridded P1 library pools (Shepherd et al., supra. 1994). The gridded filters were kindly provided by Dr. Mark Leppert and the Technology Access Section of the Utah Center for Human Genome Research at the University of Utah. P1 gridded membranes were screened using end probes derived from a set of chromosome 16 cosmids (see above) and P1 clones as they were identified. Both RNA transcripts and bubble-PCR products were utilized as end probes.
D. Probes
Radiolabeled transcripts were generated using restriction enzyme digested cosmids or P1s (AluI, HaeIII, RsaI, TaqI) as template for phage RNA polymerases T3, T7 and SP6. The T3 and T7 promoter elements were present on the cosmid-derived templates while T7 and SP6 promoter sequences were contained on the P1-based templates. Transcription reactions were performed as recommended by the manufacturer (Stratagene, La Jolla, Calif.) in the presence of [(.alpha.P.sup.32 ]-ATP (Amersham, Arlington Heights, Ill.).
Bubble-PCR products were synthesized from restriction enzyme digested P1s (AluI, HaeIII, RsaI, TaqI). Bubble adaptors with appropriate overhangs and phosphorylated 5' ends were ligated to digested P1 DNA basically as described for YACs (Riley et al., Nuc. Acids Res. 18:2887-2890, 1990). The sequence of the universal vectorette primer derived from the bubble adaptor sequence was 5'-GTTCGTACGAGAATCGCT-3' (SEQ ID NO:67), and differed from that of Riley and co-workers with 12 fewer 5' nucleotides. The T.sub.m of the truncated vectorette primer more closely matched that of the paired amplimer from the vector-derived promoter sequence (SP6, T7). The desired bubble-PCR product was gel purified prior to radiolabeling (Feinberg et al., Anal. Biochem. 132:6-13, 1983; Feinberg and Vogelstein, Anal. Biochem. 137:266-267, 1984).
The specificity of all end probes was determined prior to their use on the single set of gridded P1 filter arrays. Radiolabeled probes were pre-annealed to Cot1 DNA as recommended (Life Technologies Inc., Gaithersburg, Md.) and then hybridized to strips of nylon membrane to which were bound 10-20 ng each of the following DNAs: the cloned genomic template used to create the probe; one or more unrelated cloned genomic DNAs; cloned vector (no insert); and human genomic DNA.
Hybridizations were performed in CAK solution (5.times. SSPE, 1% SDS, 5.times. Denhardt's Solution, 100 mg/mL torula RNA) at 65.degree. C. overnight. Individual end probes were present at a concentration of 5.times.10.sup.5 cpm/mL. Hybridized membranes were washed to a final stringency of 0.1.times. SSC/0.1% SDS at 65.degree. C. The hybridization results were visualized by autoradiography. Probes which hybridized robustly to their respective cloned template while not hybridizing to unrelated cloned DNAs, vector DNA or genomic DNA were identified and used to screen the gridded P1 filters.
Hybridization to the arrayed P1 pools was performed as described for the nylon membrane strips (above) except that multiple probes were used simultaneously. Positive clones were identified, plated at a density of 200-500 cfu per 100 mm plate (LB plus 25 mg/mL kanamycin), lifted onto 82 mm HATF membranes (Millipore, Bedford, Mass.), processed for hybridization (Sambrook et al., supra.) and then rescreened with the complex probe mixture.
A single positive clone from each pool was selected and replated onto a master plate. To identify the colony purified genomic PI clone and its corresponding probe, multiple PI DNA dot blots were prepared and each hybridized to individual radiolabeled probes. All hybridizations contained a chromosome 16p13.3 reference probe, e.g. cAJ42, as well as a uniquely labeled P1 DNA probe.
EXAMPLE II
Exon Trapping
Genomic P1 clones were prepared for exon trapping experiments by digestion with PstI, double digestion with BamHI/BglII, or by partial digestion with limiting amounts of Sau3AI. Digested P1 DNAs were ligated to BamHI-cut and dephosphorylated vector, pSPL3B, while PstI-digested P1 DNA was subcloned into PstI-cut dephosphorylated vector, pSPL3B.
Ligations were performed in triplicate using 50 ng of vector DNA and 1, 3 or 6 mass equivalents of digested P1 DNA. Transformations were performed following an overnight 16.degree. C. incubation, with 1/10 and 1/2 of the transformation being plated on LB (ampicillin) plates. After overnight growth at 37.degree. C., colonies were scraped off those plates having the highest transformation efficiency (based on a comparison to "no insert" ligation controls) and miniprepped using the alkaline lysis method. To examine the proportion of the pSPL3B containing insert, a small portion of the miniprep was digested with HindIII, which cuts pSPL3B on each side of the multiple cloning site.
EXAMPLE III
RNA Preparation
Approximately 10 .mu.g of the remaining miniprep DNA was ethanol precipitated, resuspended in 100 .mu.l of sterile PBS and electroporated into approximately 2.times.10.sup.6 COS-7 cells (in 0.7 ml of ice cold PBS) using a BioRad GenePulser electroporator (1.2 kV, 25 .mu.F and 200.OMEGA.). The electroporated cells were incubated for 10 min. on ice prior to their addition to a 100 mm tissue culture dish containing 10 ml of prewarmed complete DMEM.
Cytoplasmic RNA was isolated 48 hours post-transfection. The transfected COS-7 cells were removed from tissue culture dishes using 0.25% trypsin/1 mM EDTA (Life Technologies Inc., Gaithersburg, Md.). Trypsinized cells were washed in DMEM/10% FCS and resuspended in 400 .mu.l of ice cold TKM (10 mM Tris-HCl pH 7.5, 10 mM KCl, 1 mM MgCl.sub.2) supplemented with 1 .mu.l of RNAsin (Promega, Madison, Wis.). After adding 20 .mu.l of 10% Triton X-100, the cells were incubated for 5 min. on ice. The nuclei were removed by centrifugation at 1200 rpm for 5 min. at 4.degree. C. Thirty microliters of 5% SDS was added to the supernatant, with the cytoplasmic RNA being further purified by three rounds of extraction using phenol/chloroform/isoamyl alcohol (24:24:1). The cytoplasmic RNA was ethanol precipitated and resuspended in 50 .mu.l of H.sub.2 O.
Reverse transcription and PCR were performed on the cytoplasmic RNA prepared above as described (Church et al., supra. 1994) using commercially available exon trapping oligonucleotides (Life Technologies Inc., Gaithersburg, Md.). The resulting CUA-tailed products were shotgun subcloned into pAMP10 as recommended by the manufacturer (Life Technologies Inc.). Random clones from each ligation were analyzed by colony PCR using secondary PCR primers (Life Technologies Inc.).
Miniprep DNA containing the pAMP10/exon traps was prepared from overnight cultures by alkaline lysis using the EasyPrep manifold or a QIAwell 8 system according to the manufacturers' instructions (Pharmacia, Pistcataway, N.J. and Qiagen Inc., Chatsworth, Calif., respectively). DNA products containing trapped exons, based on comparison to the 177 bp "vector only" DNA product, were selected for sequencing.
EXAMPLE IV
Sequencing
DNA sequencing was performed using Pharmacia ALF and Applied Biosystems 377 PRISM automated DNA sequencers (Piscataway, N.J., and Foster City, Calif.). DNA sequences were aligned using Sequencher DNA analysis software (Genecodes, Ann Arbor, Mich.). DNA and protein database searches were performed using the BLASTN (Altschul et al., J. Mol. Biol. 215:403-410, 1990) and BLASTX (Altschul et al., supra. 1990; Gish et al., Nat. Genet. 3:266-272, 1993) programs. SASE sequences were analyzed by processing BLAST (Altschul et al., supra. 1990; Gish et al., supra. 1993) and FASTA (Lipman et al., Science 227:1435-1441, 1985) searches. Protein sequences were analyzed using MacVector (Oxford Molecular Group, Cambell, Calif.), BCM Launcher (Smith et al., Genome Research 6:454-462, 1996), ClustalW (Thompson et al., Nucleic Acids Res. 22:4673-4680, 1994), and PSORT (Nakai et al., Genomics 14:897-911 1992).
EXAMPLE V
RT-PCR, RACE, SASE and cDNA Isolation
Based upon the sequence determined (above) two oligonucleotide primers (Table II) were designed for each exon trap using Oligo 4.0 (National Biosciences Inc., Plymouth, Minn.).
To determine which tissue-specific library to screen for transcript or cDNA, RT-PCR reactions and/or PCR reactions were performed using different tissue-derived RNAs and/or cDNA libraries, respectively, as template with the oligonucleotide primers designed for each exon trap (above).
The oligonucleotides designed from the exons (Table II), were then used in one or more of the following positive selection formats to screen the corresponding tissue-specific cDNA library.
For RT-PCR experiments, the first oligonucleotide was used as a sense primer and the second oligonucleotide was used as an antisense primer. RT-PCR was performed as described using polyA.sup.+ RNA from adult brain and placenta (Kawasaki, In PCR Protocols: A Guide to Methods and Applications, Eds. Innis et al., Academic Press, San Diego, Calif., pp. 21-27, 1990). All PCR products were cloned using the pGEM-T vector as described by the manufacturer (Promega, Madison, Wis.).
To clone sequences 3' to selected exon traps, rapid amplification of cDNA ends (RACE) was performed as described (Frohman, PCR Met. Appl. 4:S40-S58, 1994). In 3' RACE experiments, the first oligonucleotide was used as the external primer and the second oligonucleotide was used as the internal primer.
For the Genetrapper cDNA Positive Selection System, the first oligonucleotide primer was biotinylated and used for direct selection, while the second oligonucleotide was used in the repair.
In addition to exon trapping, the cloned contig was also screened using cDNA selection essentially as described (Parimoo et al., Anal. Biochem. 228:1-17 1995), using the genomic P1 clones from this interval (Dackowski et al., Genome Res. 6:515-524, 1996). Other coding sequence was obtained by SAmple SEquencing (SASE).
SASE was performed as a functional genomics method for gene identification. Briefly, DNA from individual Pls were partially digested with Sau3A and 3 kb fragments were subcloned into the pBluescriptKS.sup.+ plasmid (Stratagene, La Jolla, Calif.). Subclones were sequenced from both ends to generate sequences semi-randomly from the P1 clone.
EXAMPLE VI
Nucleotide Sequence Analysis
hNET
A random shotgun library was prepared from the 53.8B P1 clone (FIG. 18) by subcloning randomly sheared P1 DNA into the pAMP10 vector (Life Technologies Inc., Gaithersburg, Md.) essentially as described (Andersson et al., (1994) Anal. Biochem. 218:300-308). P1 DNA was randomly sheared using a nebulizer (Hudson RCI, Temecula, Calif.). The library was initially screened with a 6 kb XhoI fragment, which had been shown to contain the netrin encoding exon traps (FIG. 18). The library was subsequently screened with an adjacent 3.5 kb XhoI fragment in order to obtain additional clones for sequencing. Positive clones were sequenced using forward and reverse vector primers as previously described (The American PKD1 Consortium (1995) Hum. Mol. Genet. 4:575-582).
The genomic sequence was edited and assembled using Sequencher (GeneCodes, Ann Arbor, Mich.). The coding region was predicted using the World Wide Web version of the GRAIL2 program (Uberbacher and Mural (1991) Proc. Natl. Acad. Sci., USA 88:11261-11265; Xu et al. (1994) Genet. Eng. N.Y. 16:241-253) and a MacVector (Oxford Molecular Group, Cambell, Calif.) Pustell DNA/protein matrix analysis comparing the genomic sequence (translated in all reading frames) to the chicken netrins. Database searches were performed using BLASTN (Altschul et al. (1990) J. Mol. Biol. 215:403-410) and BLASTX (Altschul et al., 1990, supra; Gish and States (1993) Nat. Genet. 3:266-272).
RT-PCR: Both adult (brain, heart, kidney, leukocytes, liver, lung, a lymphoblastoid cell line, placenta, spleen, and testis) and fetal (kidney and brain) cDNA libraries were prescreened for the presence of netrin cDNAs by PCR as described (Van Raay et al., 1996, supra). Nested RT-PCR was utilized to clone transcribed sequences from the netrin gene. Briefly, spinal cord polyA+ RNA (Clontech, Palo Alto, Calif.) was reverse transcribed using random primers as described (Kawasaki, 1990 In "PCR Protocols: A Guide to Methods and Applications" (M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White. Eds.), pp. 21-27, Academic Press, Inc., San Diego).
Primers for PCR (Table IV) were designed based on the exons predicted from the analysis of the genomic sequence and used to amplify spinal cord RNA since spinal cord has been previously shown to express low levels of chicken netrin (Serafini et al. supra.). Nested PCR was required to detect RT-PCR products from human spinal cord RNA. Spinal cord RNA was reverse transcribed with random primers and primary PCR was performed in the presence of 2.5 M betaine (Sigma Chemical Co., St. Louis, Mo.) using the primers designed from the gene model (Table IV). The primary PCR reactions were then diluted 1:20 and secondary PCR was performed on 1 .mu.L of the diluted primary reactions using nested primers (also designed from the gene model), again in the presence of betaine. The inclusion of betaine at a final concentration of 2.5 M in the PCR reactions dramatically increased the purity and yield of the human netrin RT-PCR products (see, for example, International Publication No. WO 96/12041; Reeves et al. (1994) Am. J. Hum. Genet. 55:A238; Baskaran et al. (1996) Genome Research 6:633-638).
RT-PCR products were subcloned using pGEM-T (Promega, Madison, Wis.) as recommended by the manufacturer. The resulting RT-PCR clones were sequenced with vector primers and internal primers using the ABI dye terminator chemistry (Perkin Elmer, Foster City, Calif.) and an ABI 377automated sequencer (Perkin Elmer, Foster City, Calif.). Multiple sequence alignments were performed using ClustalW (Thompson et al., (1994) Nucleic Acids Res. 22:4673-4680).
Sequence analysis of the RT-PCR products indicated that hNET contains at least six exons. The RT-PCR data indicate that the fourth predicted exon is actually split by an intron in the human netrin gene and is present as two exons. Three of the RT-PCR exons were shown to be identical to the original exon traps. Aside from the extra exon, the gene model is nearly identical to the RT-PCR products. The cDNA coding sequence, predicted protein product and full length sequence are shown in FIGS. 4A through 4C, respectively.
Northern blot analysis: Genomic and RT-PCR probes were radiolabeled (Feinberg and Vogelstein, Anal. Biochem. 132:6-13, 1983) and used to probe Northern blots containing RNAs from a variety of adult tissues (Clontech, Palo Alto, Calif.), including a panel of RNAs from different neural tissues including spinal cord. In addition, a human RNA Master Blot (Clontech, Palo Alto, Calif.) containing RNAs from 50 different adult and fetal tissues was screened as recommended by the manufacturer.
hABC3
A human lung cDNA library (LTI, Gaithersburg, Md.) was screened with the GeneTrapper system (LTI, Gaithersburg, Md.) using capture and repair oligonucleotides (5'-CATTGCCCGTGCTGTCGTG-3' (SEQ ID NO:52) and 5'-CATCGCCGCCTCCTTCATG-3' (SEQ ID NO:53), respectively) designed from trapped exon L48757, the 5' most trapped exon with homology to murine ABC1. Direct cDNA library screening was also performed using an RT-PCR clone as probe. 5' RACE (Frohman, M. A. in Methods Enzymol. (J. N. Abelson and M. I. Simon Eds.) pp. 340-356, Academic Press, San Diego, Calif., 1993) was used to isolate additional 5' sequences from the ABC3 transcript.
Northern blot analysis: A 679 bp fragment from the 3' untranslated region (UTR) of the ABC3 cDNA was radiolabeled by random priming (Feinberg et al., supra. 1983) and used to probe a multiple tissue northern blot (Clontech, Palo Alto, Calif.) under conditions recommended by the manufacturer.
Identification of coding sequence for the novel ABC transporter: The gene for a novel ATP binding cassette (ABC) transporter, designated ABC3, has been mapped to the PKD1 locus on chromosome 16 (Burn et al., Genome Res. 6:525-537, 1996). Eight exons from the hABC3gene were obtained from the 30.1F, 64.12C and 96.4B P1 clones using exon trapping. See, FIG. 16 showing the genomic interval surrounding the hABC3 gene at the top, with NotI sites, DNA markers, and distance in kilobases (in kb) also being shown. Genomic P1 clone s from the interval which contain sequence from the hABC3 gene are shown below the genomic map. The relative position of the hABC3 cDNA is provided below the P1 clones, with the selected cDNA, trapped exons, RT-PCR clones, and cDNAs being indicated. Trapped exons and RT-PCR clones used in the isolation of additional hABC3 sequences have been labeled. The discontinuity in the line for clone ABCgt.1 represents the absence of an alternatively spliced exon.
Seven of these trapped exons encoded sequences having homology to murine ABC1 and ABC2 based on BLASTX analysis (Altschul et al., supra. 1990; Gish et al., supra. 1993), with sequences from the trapped exons L48758, L48759, and L48760 having highest homology. Sequences encoded by the trapped exon L48760 also had homology to a Caenorhabditis elegans ABC transporter predicted from genomic sequence (Wilson et al., supra.).
cDNA selection yielded a single 261 bp cDNA clone which mapped near the 5' end of the ABC3 gene. Like L48760, this clone encoded sequences having homology to the hypothetical C. elegans ABC transporter. Initial analysis of the SASE results from the 30.1F P1 clone indicated that 4 of the 164 reactions encoded sequences with homology to ABC1 or ABC2. Subsequent comparison of the SASE data to the final hABC3 cDNA indicated that an additional seven sequencing reactions contained coding sequences from the ABC3 gene. A total of 1.6 kb of ABC3 coding sequence aligned with the SASE data. In that only 3.5 kb of coding sequence from the 5' end of the hABC3 gene map to the 30.1F P1 clone, this represents a level of 45% coverage for the SASE analysis.
Assembly and analysis of a cDNA for the novel ABC transporter: Two complementary approaches were employed to assemble the full-length hABC3cDNA. First, RT-PCR was utilized to link the trapped exons, selected cDNA, and SASE data. Secondly, cDNA library screening was performed using direct selection as well as radiolabeled probes.
Using primers designed from the trapped exons L48757, L48758, L48760 and L75924, three RT-PCR products, containing 3.3 kb of coding sequence were cloned (Table I and FIG. 16). An additional RT-PCR primer was designed from a region of identity between the selected cDNA and the SASE data (Table I). A 900 bp RT-PCR clone was obtained using the latter primer in conjunction with a trapped exon derived primer. In total, 4.2 kb of coding sequence was obtained using RT-PCR.
Several cDNAs were cloned using the GeneTrapper direct selection system and oligos designed from the 5' most trapped exon encoding sequences with homology to ABC1 (trapped exon L48747). The longest clone isolated with the GeneTrapper system was 5719 bp in length (ABCgt.1) (FIG. 8). This cDNA contains a 792 bp 3' untranslated region with a consensus polyadenylation--cleavage site 20 bp upstream of the polyA tail. An additional cDNA clone (ABC.5) was isolated using a radiolabeled 1.1 kb RT-PCR product (ABC3-12) as a probe (FIG. 16). The 5' end of the ABC3 cDNA was further characterized using 5' RACE, with several RACE products containing multiple in-frame stop codons upstream of the start methionine.
Sequence analysis indicated that clone ABCgt.1 lacks 147 bp of sequence found in the RT-PCR clones and the cDNA clone ABC.5. The additional 147 bp segment is likely to be the result of alternative splicing, in that it does not interrupt the open reading frame. The presence of both transcript populations has been confirmed by PCR using primers flanking the alternatively spliced exon.
A 6.4 kb cDNA has been assembled for the hABC3 transporter. The assembled cDNA contains a 5116 nucleotide long open reading frame encoding 1705 amino acids, with the predicted protein having a molecular weight of 191 kDa. The proposed start methionine is 50 bp upstream of the 5' end of clone ABCgt.1. Although the sequence surrounding the start methionine matches the Kozak sequence in only 6 of 10 positions (Kozak, J. Cell Biol. 115:887-903, 1991), the two positions which have been shown to be critical for function (an A at -3 and a G at +4) are conserved in hABC3. The hABC3 cDNA contains a 792 bp 3' UTR with a consensus polyadenylation/cleavage site 20 bp upstream of the polyA tract.
A 6.8 kb transcript is detected by a 3' UTR cDNA probe on northern blots with highest levels of expression being observed in lung with lesser amounts in brain, heart, and pancreas. Significantly lower levels of expression were observed in placenta and skeletal muscle after longer exposure times. The ABC3 transcript was not detected in either liver or kidney.
RPL3L (SEM L3)
The longest cDNA is 1548 nucleotides in length (FIG. 11). All three cDNAs have an open reading frame (ORF) of 1224 nucleotide with the longest cDNA containing a 48 nucleotide 5' untranslated region. An inframe stop codon at position 7 is followed by the Kozak initiation sequence CCACCATGT (SEQ ID NO:68) (Kozak, supra.). The 3' UTR for each of the three cDNAs vary in length, and lacks a consensus polyadenylation cleavage site.
The longest cDNA was compared to the human, bovine and murine ribosomal L3 genes. At the nucleotide level there is only 74% identity between the RPL3L (SEM L3) cDNA and the consensus from these other ribosomal L3 cDNAs. This is in sharp contrast to the 98% identity shared between human, bovine, and murine L3 nucleotide sequences. There is no similarity between the 3' UTR of the cDNAs isolated here and the other L3 genes.
hALR
Sequences were cloned from the human ALR gene by 3' RACE using primers (e.g., external 5'-TGGCCCAGTTCATACATTTA-3' (SEQ ID NO:69) and internal 5'-TTACCCCTGTGAGGAGTGTG-3' (SEQ ID NO:70)) designed from the exon trap. A total of 468 bp have been obtained from the human ALR gene (FIG. 13).
EXAMPLE VII
Amino Acid Sequence Analysis
hNET
hNET cDNA has at least 210 bp of 5'untranslated sequence, a 5' start methionine codon, a 3' stop codon (TGA) and is predicted to be 580 amino acids in length (FIG. 4), with the common domain structure of the netrin family being conserved (FIG. 20A). Overall, the human netrin was found to have higher homology to chicken netrin-2 than netrin-1, i.e., 56.3% versus 53.9%. As is the case with the other members of the netrin family, the region of greatest conservation includes the three EGF repeats, while the C-terminal domains are less well conserved (FIG. 20A). The EGF repeats are 78.7% and 82.2% identical between the human netrin and chicken netrin-1 and netrin-2, respectively, and 66.3% identical when compared to UNC-6. The C-terminal domains of the human netrin and chicken netrin-1 and -2 are 41.9% and 42.5% indentical, respectively with the same domain of UNC-6 being only 29.4% identical to human netrin. Overall, the human netrin more closely resembles the chicken netrins and UNC-6 than Drosophila NETA and NETB, since NETA contains an expansion in the C-domain while NETB contains additional sequences in the VI and V-1 domains (Harris et al., 1996, supra; Mitchell et al., 1996, supra).
The Structure of the Netrin Genes is Conserved Between Drosophila and Human
The positions of the introns in the human gene were compared to the encoded protein to determine if the overall gene structure of the netrin/UNC-6 family is conserved (FIG. 20B). This analysis revealed striking similarities between the Drosophila netrin genes and the human netrin gene. In the human gene, exon 1 contains the signal peptide, domain VI and the first EGF domain (domain V-1), while exons two and three each contain an EGF repeat, domains V-2 and V-3, respectively. Exons 4, 5, and 6 contain portions of the C-domain. With the exception of an additional intron in the C-domain, this motif/exon arrangement is conserved in the Drosophila netrin genes. The coding regions of the two Drosophila netrin genes have been shown to be highly conserved with each being disrupted by six introns that occur in homologous sites (Harris et al., 1996, supra). The position of five of the six Drosophila introns was found to be conserved in the human gene (FIG. 20B). The UNC-6 gene contains 12 introns in the coding region (Ishii et al., 1992, supra), the position of five of which correlate with the positions of the introns in the human gene. Interestingly, the sixth Drosophila intron that does not have a counterpart in the human gene and is the only intron from Drosophila that is not conserved in the UNC-6 gene.
hABC3
Database searches revealed homology between ABC3 and murine ABC1 and ABC2 (Luciani et al., supra. 1994). In addition to the murine ABC1 and ABC2 proteins, ABC3 also shows homology to the putative C. elegans protein encoded by the cosmid sequence of C48B4.4 (Wilson et al., supra.). Overall, ABC3, ABC1, ABC2 and sequences encoded by C. elegans cosmid C48B4.4 have highest homology in the regions surrounding the ATP binding cassettes (FIG. 17). However, when one compares the sequence between the first ATP binding cassette and the second transmembrane domain, referred to as the linker domain (Luciani et al., supra. 1994), ABC3 shares much lower homology to these same 3 proteins listed above (amino acids 765-1044 in ABC3 in FIG. 17). The linker domain of ABC3 is approximately 200 residues shorter than the linker domain present in ABC1 and ABC2. Consequently, an optimum protein alignment positions a gap in the ABC3 sequence immediately C-terminal of a conserved HH1 hydrophobic domain (Luciani et al., supra. 1994), located at position 917 through 959 in ABC3 (FIG. 17). Additional comparisons indicate that the ABC3 linker domain is nearly identical in size to the linker domain encoded by C. elegans cosmid C48B4.4. As is the case with ABC1 and ABC2, the linker domain of ABC3 contains numerous polar residues and several potential phosphorylation sites.
Further analysis of the deduced ABC3 protein sequence revealed additional similarities to the ABC1/ABC2 subfamily. Based on PSORT analysis (Nakai et al., supra.), the ABC3 protein does not appear to contain an N-terminal signal sequence and is likely to be a Type III membrane protein (Singer, Annu. Rev. Cell Biol. 6:247-296 1990), with sequences N-terminal of the first transmembrane domain being located in the cytoplasm (FIG. 17). Similar topography has been described for ABC1 (Luciani et al., supra. 1994) and all other ABC transported described to date (Higgins, supra. 1992). As mentioned above, murine ABC1 and ABC2 have been shown to contain a novel hydrophobic region, HH1, within the conserved linker domain. Although the HH1 domain is not well conserved at the amino acid level in ABC3, an HH1 domain does appear to be present within the linker region based on hydrophilicity analysis. A similar HH1 domain is also found in sequences encoded by cosmid C48B4.4 from C. elegans. In all these cases, the HH1 domain is predicted to have a .beta.-sheet conformation.
RPL3L (SEM L3)
The RPL3L (SEM L3) cDNA open reading frame predicts a 407 amino acid polypeptide of 46.3 kD (FIG. 11). In vitro transcription--translation of RPL3L (SEM L3) cDNA resulted in a protein product with an apparent molecular weight of 46 kD which is in close agreement with the predicted weight of 46.3 kD.
Two nuclear targeting sequences, which are 100% conserved between man, mouse and cow, diverged slightly in the RPL3L (SEM L3) amino acid sequence. The first targeting site is the 21 amino acid N-terminal oligopeptide. The serine and arginine present at positions 13 and 19 respectively, in human, bovine and murine L3are replaced with histidines in RPL3L (SEM L3) (FIG. 12). The second potential nuclear targeting site is the bipartite motif. Here the human, bovine and murine proteins have a KKR-(aa).sub.12 -KRR at position 341-358 while the SEM L3 gene has KKR-(aa).sub.10 -HHSRQ at position 341-358. The second half of this bipartite motif, while remaining basic, does not match those found in other nuclear targeting motifs (Simonic et al., supra. 1994). Overall, there is 77.2% amino acid identity between the RPL3L (SEM L3) and the consensus from the other mammalian L3 ribosomal genes, with 56% of the nucleotide differences between RPL3L (SEM L3) and the human L3 being silent.
hALR
hALR cDNA sequences encode a 119 amino acid protein which is 84.8% identical and 94.1% similar to the rat ALR protein (see, FIGS. 13 and 14).
Although the invention has been described with reference to the disclosed embodiments, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the claims which follow the Sequence Listing.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 83- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 179 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- Leu His Leu Glu Gly Pro Phe Ile Ser Arg Gl - #u Lys Arg Gly Thr His# 15- Pro Glu Ala His Leu Arg Ser Phe Glu Ala As - #p Ala Phe Gln Asp Leu# 30- Leu Ala Thr Tyr Gly Pro Leu Asp Asn Val Ar - #g Ile Val Thr Leu Asp# 45- Pro Glu Leu Gly Arg Ser His Glu Val Phe Ar - #g Thr Leu Thr Xaa Arg# 60- Ser Ile Cys Val Ser Leu Gly His Ser Val Al - #a Asp Leu Arg Ala Ala#80- Glu Asp Ala Val Trp Ser Gly Ala Thr Phe Il - #e Thr His Leu Phe Asn# 95- Ala Met Leu Pro Phe His His Arg Asp Pro Gl - #y Ile Val Gly Leu Leu# 110- Thr Ser Asp Arg Pro Ala Gly Arg Cys Ile Ph - #e Tyr Gly Met Ile Ala# 125- Asp Gly Thr His Thr Asn Pro Ala Ala Leu Ar - #g Ile Ala His Arg Ala# 140- His Pro Gln Gly Leu Val Leu Val Thr Asp Al - #a Ile Pro Ala Leu Gly145 1 - #50 1 - #55 1 -#60- Leu Gly Asn Gly Arg His Thr Leu Gly Gln Gl - #n Glu Val Glu Val Asp# 175- Gly Leu Thr- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 90 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- His Leu Glu Gly Pro Phe Ile Ser Lys Arg Gl - #y His Pro Glu Ser Tyr# 15- Gly Asn Ile Val Thr Pro Glu Leu Glu Val Se - #r Gly His Ser Ala Leu# 30- Glu Ala Val Ser Gly Ala Ile Thr His Leu Ph - #e Asn Ala Met His His# 45- Arg Asp Pro Gly Gly Leu Leu Thr Ser Leu Ty - #r Gly Ile Asp Gly His# 60- Thr Ala Leu Arg Ile Ala Gly Leu Val Leu Va - #l Thr Asp Ala Ile Ala#80- Leu Gly Gly His Leu Gly Gln Val Gly Leu# 90- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 64 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- Leu His Leu Glu Gly Pro Lys Gly Thr His Ar - #g Ala Ala Asp Leu Asp# 15- Val Thr Leu Pro Glu Glu Val Leu Ile Val Se - #r Gly His Ser Ala Leu# 30- Ala Gly Thr Phe Thr His Leu Asn Ala Met Pr - #o Gly Leu Leu Ile Gly# 45- Ile Ala Asp Gly His Ala Arg Ala Arg Leu Le - #u Val Thr Asp Ala Gly# 60- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 55 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- Leu His Glu Pro Ser Glu Lys Gly His Arg As - #p Leu Gly Asp Thr Glu# 15- Ile Val Ser Gly His Ser Ala Ala Ala Gly Al - #a Thr Phe Thr His Leu# 30- Asn Ala Met Pro Gly Gly Ile Asp Gly His As - #n Arg Ile Leu Val Thr# 45- Asp Ile Ala Gly Leu Gly Thr# 55- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 49 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- Cys Asp Cys His Pro Val Gly Ala Ala Gly Ly - #s Thr Cys Asn Gln Thr# 15- Thr Gly Gln Cys Pro Cys Lys Asp Gly Val Th - #r Gly Leu Thr Cys Asn# 30- Arg Cys Ala Pro Gly Phe Gln Gln Ser Arg Se - #r Pro Val Ala Pro Cys# 45- Val- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 48 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Cys Asp Cys His Pro Val Gly Ala Ala Gly Ly - #s Thr Cys Asn Gln Thr# 15- Thr Gly Gln Cys Pro Cys Lys Asp Gly Val Th - #r Gly Leu Thr Cys Asn# 30- Arg Cys Ala Pro Gly Phe Gln Gln Ser Arg Se - #r Pro Val Ala Pro Cys# 45- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 44 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- Cys Asp Cys His Pro Val Gly Ala Ala Gly Th - #r Cys Asn Gln Thr Thr# 15- Gly Gln Cys Pro Cys Lys Asp Gly Val Thr Gl - #y Thr Cys Asn Arg Cys# 30- Ala Lys Gly Gln Gln Ser Arg Ser Pro Ala Pr - #o Cys# 40- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 35 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Cys Cys His Pro Val Gly Gly Cys Asn Gln Gl - #y Gln Cys Cys Lys Gly# 15- Val Thr Gly Thr Cys Asn Arg Cys Ala Lys Gl - #y Gln Gln Ser Arg Ser# 30- Val Pro Cys 35- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 49 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- His Ser Pro Ser Leu Ser Ala Glu Thr Pro Il - #e Pro Gly Pro Thr Glu# 15- Asp Ser Ser Pro Val Gln Pro Gln Asp Cys As - #p Ser His Cys Lys Pro# 30- Ala Arg Gly Ser Tyr Arg Ile Ser Leu Lys Ly - #s Phe Cys Lys Lys Asp# 45- Tyr- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 21 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- Ile Ser Pro Asp Cys Asp Ser Cys Lys Pro Al - #a Gly Tyr Ile Lys Lys# 15- Cys Lys Lys Asp Tyr 20- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 21 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:- Pro Pro Thr Ser Ser Pro Asp Cys Asp Ser Cy - #s Lys Gly Ile Lys Lys# 15- Cys Lys Lys Asp Tyr 20- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 88 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- Met Leu Val Gly Asp Ser Gly Val Gly Lys Th - #r Cys Leu Leu Val Arg# 15- Phe Lys Asp Gly Ala Phe Leu Ala Gly Thr Ph - #e Ile Ser Thr Val Gly# 30- Ile Asp Phe Arg Asn Lys Val Leu Asp Val As - #p Gly Val Lys Ala Lys# 45- Leu Gln Met Trp Asp Thr Ala Gly Gln Glu Ar - #g Phe Arg Ser Val Thr# 60- His Ala Tyr Tyr Arg Asp Ala His Ala Leu Le - #u Leu Leu Tyr Asp Val#80- Thr Asn Lys Ala Ser Phe Asp Asn 85- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 83 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:- Met Leu Val Gly Asp Ser Gly Val Gly Lys Th - #r Cys Leu Leu Val Arg# 15- Phe Lys Asp Gly Ala Phe Leu Ala Gly Thr Ph - #e Ile Ser Thr Val Gly# 30- Ile Asp Phe Arg Asn Lys Val Leu Asp Val As - #p Gly Lys Lys Leu Gln# 45- Trp Asp Thr Ala Gly Gln Glu Arg Phe Arg Se - #r Val Thr His Ala Tyr# 60- Tyr Arg Asp Ala His Ala Leu Leu Leu Leu Ty - #r Asp Thr Asn Lys Ser#80- Phe Asp Asn- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 83 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- Phe Gln Asn His Phe Glu Pro Gly Val Tyr Va - #l Cys Ala Lys Cys Gly# 15- Tyr Glu Leu Phe Ser Ser Arg Ser Lys Tyr Al - #a His Ser Ser Pro Trp# 30- Pro Ala Phe Thr Glu Thr Ile His Ala Asp Se - #r Val Ala Lys Arg Pro# 45- Glu His Asn Arg Ser Glu Ala Leu Lys Val Se - #r Cys Gly Lys Cys Gly# 60- Asn Gly Leu Gly His Glu Phe Leu Asn Asp Gl - #y Pro Lys Pro Gly Gln#80- Ser Arg Phe- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 28 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- Phe Pro Gly Tyr Val Gly Leu Phe Ser Ser Ly - #s Tyr Trp Pro Phe Thr# 15- Ile Ala Ser Val Val Leu Gly His Phe Asp Gl - #y Pro# 25- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 26 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- Glu Gly Val Tyr Cys Ala Cys Asp Leu Ser Se - #r Lys Trp Pro Ala Phe# 15- Glu Ala Cys Cys Leu Gly His Phe Gly Lys# 25- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 32 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- Phe His Phe Glu Gly Tyr Val Cys Cys Gly Gl - #u Leu Phe Ser Lys Trp# 15- Pro Ala Phe Glu Val Cys Cys Leu Gly His Ph - #e Asn Asp Gly Pro Lys# 30- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 28 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- Phe Gly Tyr Val Gly Phe Ser Ser Lys Trp Pr - #o Phe Thr Ile Asp Val# 15- Gly Asn Leu Gly His Phe Asp Gly Pro Lys Gl - #y Arg# 25- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 6803 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- GGAGCTCGGT TGGAAACCCC CCGAGGCATA ATAGGCGCTC GATAAATGTG CA - #ATAGGTGA 60- ACATGTGGTG GCTTGCAGGC GTCTGGGGGG AGACAGCAGG TTCTGGGCTG GG - #CAGGGAAT 120- TATTGGATCA ACGGGCATCT TACAGGAAAG ACTCTCAGCT CCCTGCCGCC TA - #GGACTGTC 180- CAGCCCATCT ATGCCCTCTC CCCAGCCTGT GCCCCAAAGC TGGAGCTGCC AC - #TCTAGGGG 240- TGAGGGGTGG GGTGGGGAGG GGGAGGCGAA GCACTGCGGC CTGAGTTGCA GG - #TGGGGGGA 300- GGGGAGGCGG AGCTTCTTTG TTGCAGAAGG TGCCAGGAGG GGGCAGGGCC AG - #TGGAGAGG 360- TGGGAGGTGG GAGAGGCCCC AGCCAGGGGC TGGGACAGGT GGCTGGGTCC CT - #GGGGAGCA 420- ATAAGTCCCG CTTGGGCGCT GTGGGGAGGC CCTTCCTAAC TCCCAAACAC CA - #TCTGTGAG 480- GGCTGGGGGT GGGGGCAGAG TAGCGTGTGC AGAGGACTGT TCCTGGGGAG AG - #GCCCTGTG 540- ACCAGCGGCC TCCTCCCTGG GGAGCTGGCG GTACAATGGC CCTCTGGGCC CA - #CGGCCTCC 600- CGCCGCTGCT GCTGACCCAG ATGAACAATT GGGGCAGGGC TGAGCCCCAG GC - #ACCTACTT 660- TCCCCCACCC CAGAAGCCAC CAGACGTTCT GCAGACCCCA GTCCTGGCTC AC - #AGGGAAGC 720- TGAGCTGGAG ACAAAGCCAG CCCCTCTGAT GAGGGTGGAA GAGGCTGCTG GC - #CACTGTCC 780- CTCTTGCAGC CTGGCTGGCA GCCAGTCTGG CAGTGGCCCT GACGTCCAGA GA - #CAGCTTGG 840- GTTTCCCCAG AGGCTTGTCT CTGGCCAGTG GGACCCCTCT GTCAGGCCTG GG - #CTTTTCTC 900- TCCACTGTCC CAGAATGATG ATCTCAGCCC CCATAGTCCC CCCAGGGTTC CT - #CCCACCCT 960- TAGGGTGGGG TGTCGGGGGG TGGGGGTTGG GAGCCAGAAG GACCTTGAAG AG - #GGTGGTTG1020- GGACGTTTCA GGTTCTAAGC TTGACCCACA GAGCGGAGCG TGAGCCCCGT CA - #GGTTGAGG1080- TCCCTCAACT TGTAAAGGAC ACAATTCCAT TCTCTTTATC AGGAAGCTGA GG - #GGCAGGGG1140- CCCTGTGGCA GAGAGAGAGC CCCTTAGCCC TCTCTGTTCA GTCCTCCGGT GC - #CCCCATCC1200- CTGTGCATCT GTGGCTGTCA CATGCAGATG TGTGGCAAGG AGAAGGTGCC CA - #CCAGCCAG1260- TGTCAGTTGC TCCAGGAGCC AAGCCAGGTG CCCTATCACC CTGTCTTCCC GT - #TCCTCCCC1320- TCCATGGTCA GGCCCTCCTG CTCCCTCCTC TGGTCCTTCA GTTTCCCCTA GG - #AGGCTTCC1380- GTGTCCTCCT GCCCCTCCTC TCCCCAACAG CGGGATGCGT CTACCTCTCC AT - #TCTCTTCC1440- TCCTGGTCCT TGCTCATCTC TGGTCGTGTC CAGGGTAGCA CCCACGTGGC CT - #CCTCCACC1500- AGCTGCAGGC CTGGCCTCCC ATCTGAAACG GGGCATTCAG GCCTCGATGC TG - #GCCCTGCA1560- CGGAACTTGT TCCCTGCCCC TCCCTGGGAT GCTTGGCCTC CTCTGTCAAG GA - #CCTGAAAG1620- TCGGAGGGGA GGAGGTTTCT CTGACCAGAG CTGTTCCTGG ACCCTCTTTG GT - #GGTGTCGC1680- TCCCAGGCAC AGCTACCCCA TCCCCAGCTA GTCCCCAGGC CACCCAGCTG GG - #CTTCTGCC1740- TCAGTTTCCC TGCCCAAACG TGCTGTGACG TAGGGCAGTG GGCTCCGGGT TG - #CGACCAGC1800- CCCTTCCCAT GATTAAACCC TACTCCCTGC CCCTGCAGAG GGGTCCTCAA CA - #GCTAACCA1860- AGCCCCCGAA CCCCAAGAAG CCACCCCATC CCACCCTCCA GCTTCCATGT CC - #TCCCTGCC1920- AGCTGGGCCC GTGGCAGAGG TGCCCCTAGA AACTTGCAGA CCCAGGGAGC TT - #TGGGATCA1980- GAATCTGGCC TGGTGCAGGG GATGCTGGCC TCATGTCTTA GCCCAGCTCA GG - #CCCATGGG2040- GGTGCCCCCC TTCCTCAACA TGGGCAGGAG ACACTCCAAT TTGTGCAGCT CT - #CGACTTGG2100- GCCTGATGCC ACTTGAGACT CATCAAATCC AACAGCTTCA GAGCGCGTGC TG - #AGTAACAG2160- GCATCTGGCA GGTGAGGAAA CAGGAGCCCA AGACATGCAG CCAGAAATGG GG - #CAGTTGGA2220- TTCAAAATTA GACCTGACCG AATCCTGGGT TCCTTCTACT CGAGTAGATG CT - #GCTTTGGG2280- GATGACCCTT CAACTGGTGG TTACTTGGCT TCCCTACCTG GGGAACATCC AG - #GGCCTCTG2340- CTGTCAGACC CGGGGCCTTG CCTGCCTGAT GGTCTTCAGG GAGGAGGCGA CC - #CAGACCCC2400- CGTCCAGCAC GTGGCACAGC CCCAGGAGCA GTAAAGACCT GGCTGTGGGC CC - #AGGACCCT2460- GCTGGGTGGT CCCCCACGGG CTGCGAAGGC TGAGCTGCCC CCCTCCAGAC CC - #CTCCCGCC2520- AGCGCATTCC TGGCTCCCCG GCCCCTCCCC TGGCTCCCGG GCCTCCCAGC CC - #CCTTCCCC2580- GCTGGCCCAG CCCGCGTCTG AATCTGCTTC TGATTCCAGC TCTGCGATGA GG - #CCCCCTCC2640- CCTCCCCTGC CTCCTTCCCG ACCCGAGCAG CCCCGCCCCC GGCTGGGCCC GG - #GCTTGCGC2700- CTGCTGCGCC CCCCACCCCC TCCTGGCACA GCTCGTCCGC CCTCGCTGCA GC - #CGGGAGGA2760- GGCGGCGGCC CGTGCACCGC AGGCCCCGCC CGCCCACGGC CCTTCCCGGG AG - #GCCGGGAG2820- ACCTGCTCCG CCCGGCCCTC GGTGGGTGAG TGCGAGCGGC GGGTGGGGCC TC - #CGCGGGCG2880- GAGGCACCGG GAGCGGGGGC GACGCCTGTC ATCGCTCTAG GCCCAGCGGG AG - #GACGCGCC2940- AACATCCCCG CTGCTGTGCT GGGCCCGGGG CGTGCCCGCC GCTGCTCCCA CC - #TCTGGGCC3000- GGGCTGGGGC CGCCCGGGGG CCCTGTTCCT CGGCATTGCG GGCCTGGTGG GC - #AGAGCCGC3060- GGAGAGGGCT TCTTTTCCCC AAGGGCAGCG TCTTGGGGCC CGGCCACTGG CT - #GACCCGCA3120- GCGGCTCCGG CCATGCCTGG CTGGCCCTGG GGGCTGCTGC TGACGGCAGG CA - #CGCTCTTC3180- GCCGCCCTGA GTCCTGGGCC GCCGGCGCCC GCCGACCCCT GCCACGATGA GG - #GGGGTGCG3240- CCCCGCGGCT GCGTGCCAGG ACTGGTGAAC GCCGCCCTGG GCCGCGAGGT GC - #TGGCTTCC3300- AGCACGTGCG GGCGGCCGGC CACTCGGGCC TGCGACGCCT CCGACCCGCG AC - #GGGCACAC3360- TCCCCCGCCC TCCTTACTTC CCCAGGGGGC ACGGCCAGCC CTCTGTGCTG GC - #GCTCGGAG3420- TCCCTGCCTC GGGCGCCCCT CAACGTGACT CTCACGGTGC CCCTGGGCAA GG - #CTTTTGAG3480- CTGGTCTTCG TGAGCCTGCG CTTCTGCTCA GCTCCCCCAG CCTCCGTGGC CC - #TGCTCAAG3540- TCTCAGGACC ATGGCCGCAG CTGGGCCCCG CTGGGCTTCT TCTCCTCCCA CT - #GTGACCTG3600- GACTATGGCC GTCTGCCTGC CCCTGCCAAT GGCCCAGCTG GCCCAGGGCC TG - #AGGCCCTG3660- TGCTTCCCCG CACCCCTGGC CCAGCCTGAT GGCAGCGGCC TTCTGGCCTT CA - #GCATGCAG3720- GACAGCAGCC CCCCAGGCCT GGACCTGGAC AGCAGCCCAG TGCTCCAAGA CT - #GGGTGACC3780- GCCACCGACG TCCGTGTAGT GCTCACAAGG CCTAGCACGG CAGGTGACCC CA - #GGGACATG3840- GAGGCCGTCG TCCCTTACTC CTACGCAGCC ACCGACCTCC AGGTGGGCGG GC - #GCTGCAAG3900- TGCAATGGAC ATGCCTCACG GTGCCTGCTG GACACACAGG GCCACCTGAT CT - #GCGACTGT3960- CGGCATGGCA CCGAGGGCCC TGACTGCGGC CGCTGCAAGC CCTTCTACTG CG - #ACAGGCCA4020- TGGCAGCGGG CCACTGCCCG GGAATCCCAC GCCTGCCTCG GTGAGGCCTT GG - #AGGGTGGC4080- CTGGGGACCT TGGACACAAC CAGCCTGCCC CTGACCCATC CCTCCCTGCA GC - #TTGCTCCT4140- GCAACGGCCA TGCCCGCCGC TGCCGCTTCA ACATGGAGCT GTACCGACTG TC - #CGGCCGCC4200- GCAGCGGGGG TGTCTGTCTC AACTGCCGGC ACAACACCGC CGGCCGCCAC TG - #CCACTACT4260- GCCGGGAGGG CTTCTATCGA GACCCTGGCC GTGCCCTGAG TGACCGTCGG GC - #TTGCAGGG4320- GTGAGCCACC ACCGGCCACC TGCAGGCCCT CACCCTCTGA CTTCCCAGAT CC - #CCAGACAG4380- GCTTCTGACC AGGCCCTTCC CACCTCTGTC CTCAGCCTGC GACTGTCACC CG - #GTTGGTGC4440- TGCTGGCAAG ACCTGCAACC AGACCACAGG CCAGTGTCCC TGCAAGGATG GC - #GTCACTGG4500- CCTCACCTGC AACCGCTGCG CGCCTGGCTT CCAGCAAAGC CGCTCCCCAG TG - #GCGCCCTG4560- TGTTAGTGAG TGACCCTGCC CCGCCTCAGC CACCAAGCCA AGGCCACCCC AG - #CTCCCTGC4620- TGTTGTCCCG TCTATTCCCC GAGCCCTGCA GATCTCTCTG CCCCTCCATC GC - #AGGCCATT4680- CTCCCTCCCT CTCTGCAGAG ACCCCTATCC CTGGACCCAC TGAGGACAGC AG - #CCCTGTGC4740- AGCCCCAGGG TGAGTGGACA CAGGACAGGG CCCCAGACTG GCATGACTTT GG - #GGGAGGGG4800- GCTCTGGGAG GAGAGGGTGG GGAAAGGGAG TCTGTGCCAG CCTCCCACCT TC - #TACCCAGA4860- CTGTGACTCG CACTGCAAAC CTGCCCGTGG CAGCTACCGC ATCAGCCTAA AG - #AAGTTCTG4920- CAAGAAGGAC TATGGTAGGT GCCCTCAGGC CTCCCGCGGA CCTTCCCACC TT - #CCTCCTCT4980- CCCTACCTTC CCTCCTCCGC CAGCTTCCCC TTGGAACGCC TTGACCCTTG CT - #GGGCCCCA5040- AGGCCCATCC TCATCCCTCA GGTCCTCCAC GGGCAGCGAC CCCGCCCCTT CA - #GCCCCCAC5100- TGCCCTCCTG GTGTCCTCCC CGTGCCTCCC CCTACCGCGG GCAGGCCGCC CC - #TTCCTGAC5160- CCCGCCCCCT CTCGCTCTCC CCGCAGCGGT GCAGGTGGCG GTGGGTGCGC GC - #GGCGAGGC5220- GCGCGGCGCG TGGACACGCT TCCCGGTGGC GGTGCTCGCC GTGTTCCGGA GC - #GGAGAGGA5280- GCGCGCGCGG CGCGGGAGTA GCGCGCTGTG GGTGCCCGCC GGGGATGCGG CC - #TGCGGCTG5340- CCCGCGCCTG CTCCCCGGCC GCCGCTACCT CCTGCTGGGG GGCGGGCCTG GA - #GCCGCGGC5400- TGGGGGCGCG GGGGGCCGGG GGCCCGGGCT CATCGCCGCC CGCGGAAGCC TC - #GTGCTACC5460- CTGGAGGGAC GCGTGGACGC GGCGCCTGCG GAGGCTGCAG CGACGCGAAC GG - #CGGGGGCG5520- CTGCAGCGCC GCCTGAGCCC GCCGGCTGGG CAGGGCGGCC GCTGCTCCCA CA - #TCTAGGCG5580- CACGTTCACC CTGTGCCTTC GCCTGCCAAG GAGTCCTTGC TCGCGTCGCG CG - #TGTCGCCA5640- CCTGGGCCGC CGCCCCGTCC CCGCCGGCAG CTCCCTCGGT ACCTCCCGTC TG - #GCCCTGGG5700- GGGATGTGAC CGGCGCACGG ACAGCCCGCC CCGCACAGAG GCAGATGATA TG - #GCACACCC5760- GGAGGACCCC ATGGTCTCCC GCCCTCTGGC TGTCGGCCCT GTCCCAGGGG CA - #CTGGGATA5820- CCCGGAAGGC TGTGAATCCT TCGTGATGCC GGGCCCTCTC GGGGATCTCA GA - #TCATCCCC5880- GGGGCCGCTG TGATGCACCC CCACCTGTGC GGCGACCCGC CAGGAGCGCA CT - #GACCTCCC5940- CAAAGACTGT GGCCACCGCA GGCGCCTTGG ACCCCCATGG GGGACAGGGC GT - #CCCCTGCC6000- TCCTGCAGCC CCACGAGGGC GGCGGCCTTG GCCCTGCGGC TGGGCGTCCG CG - #TCCGGGCG6060- CCCCGCGGCG TCTGCTGCCG GGTCCCGTAA CTTTCTTGGC CGCCTGTGTC CC - #CGTCTGCC6120- GGCTCCGTCC GGCCGTCCCT CTCTCTGCCG CGTCTCTGAC CCTCGGCGCC AC - #AGCTCCTC6180- AGCTCAGGGC CCGTCCCAGA ACCTCCTTCC AGCCCTTCTC CCCCGACTCG GG - #AAGGGACG6240- TCGTGCCCAC GCGGTTCCGG ATCCACGCGT GACCCGGCCG GACCGCGACT CC - #GACAGGCG6300- GCTGTCCGGG CCCCCGATGC CCTCGGCAGG GCCGTGCCAC CCCCCGCCCC TT - #GTTGTCCC6360- CCCGGGACCG GCACTGCCGT TTGCCTCCTC TCCGCACGGG ACCGGTTCCC GG - #CCGGCCCC6420- AGCTTCCGCC GCTGCGGCCG CCGACCGTCA GCGCGCATGC CCAGAGCCGG GC - #AGGCCGGA6480- GCCCCGCCGG CTCTCCGGGG TGGGCACAGG GCGACAGCTC GGCGGGGGCG GG - #GCCGAGCA6540- CGCGCGTGCG CAGAAAGGCC GGCGCGGCAG GCTGAGGAGA AAGCGGCGCG CG - #GAGGTGGG6600- TGCGCTCGGG GCGTGCGGGG GGCGCGCGGC GGGGTGGCGG GTGGCGGGGC CG - #GGTCCCCG6660- CTGTCACCGC GGTCGGCGCG TGCTGGGGGC GGGAGCGTGG GGGCCGGGCT GC - #GTGCCCCA6720- TTCGAGGCGG GGATCCCCGG CCACGCGCGG GTTGGGGGCT CCAGAGCCCG GC - #ACCGCCCG6780# 6803TTGG CCT- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1743 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1740- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:- ATG CCT GGC TGG CCC TGG GGG CTG CTG CTG AC - #G GCA GGC ACG CTC TTC 48Met Pro Gly Trp Pro Trp Gly Leu Leu Leu Th - #r Ala Gly Thr Leu Phe# 15- GCC GCC CTG AGT CCT GGG CCG CCG GCG CCC GC - #C GAC CCC TGC CAC GAT 96Ala Ala Leu Ser Pro Gly Pro Pro Ala Pro Al - #a Asp Pro Cys His Asp# 30- GAG GGG GGT GCG CCC CGC GGC TGC GTG CCA GG - #A CTG GTG AAC GCC GCC 144Glu Gly Gly Ala Pro Arg Gly Cys Val Pro Gl - #y Leu Val Asn Ala Ala# 45- CTG GGC CGC GAG GTG CTG GCT TCC AGC ACG TG - #C GGG CGG CCG GCC ACT 192Leu Gly Arg Glu Val Leu Ala Ser Ser Thr Cy - #s Gly Arg Pro Ala Thr# 60- CGG GCC TGC GAC GCC TCC GAC CCG CGA CGG GC - #A CAC TCC CCC GCC CTC 240Arg Ala Cys Asp Ala Ser Asp Pro Arg Arg Al - #a His Ser Pro Ala Leu# 80- CTT ACT TCC CCA GGG GGC ACG GCC AGC CCT CT - #G TGC TGG CGC TCG GAG 288Leu Thr Ser Pro Gly Gly Thr Ala Ser Pro Le - #u Cys Trp Arg Ser Glu# 95- TCC CTG CCT CGG GCG CCC CTC AAC GTG ACT CT - #C ACG GTG CCC CTG GGC 336Ser Leu Pro Arg Ala Pro Leu Asn Val Thr Le - #u Thr Val Pro Leu Gly# 110- AAG GCT TTT GAG CTG GTC TTC GTG AGC CTG CG - #C TTC TGC TCA GCT CCC 384Lys Ala Phe Glu Leu Val Phe Val Ser Leu Ar - #g Phe Cys Ser Ala Pro# 125- CCA GCC TCC GTG GCC CTG CTC AAG TCT CAG GA - #C CAT GGC CGC AGC TGG 432Pro Ala Ser Val Ala Leu Leu Lys Ser Gln As - #p His Gly Arg Ser Trp# 140- GCC CCG CTG GGC TTC TTC TCC TCC CAC TGT GA - #C CTG GAC TAT GGC CGT 480Ala Pro Leu Gly Phe Phe Ser Ser His Cys As - #p Leu Asp Tyr Gly Arg145 1 - #50 1 - #55 1 -#60- CTG CCT GCC CCT GCC AAT GGC CCA GCT GGC CC - #A GGG CCT GAG GCC CTG 528Leu Pro Ala Pro Ala Asn Gly Pro Ala Gly Pr - #o Gly Pro Glu Ala Leu# 175- TGC TTC CCC GCA CCC CTG GCC CAG CCT GAT GG - #C AGC GGC CTT CTG GCC 576Cys Phe Pro Ala Pro Leu Ala Gln Pro Asp Gl - #y Ser Gly Leu Leu Ala# 190- TTC AGC ATG CAG GAC AGC AGC CCC CCA GGC CT - #G GAC CTG GAC AGC AGC 624Phe Ser Met Gln Asp Ser Ser Pro Pro Gly Le - #u Asp Leu Asp Ser Ser# 205- CCA GTG CTC CAA GAC TGG GTG ACC GCC ACC GA - #C GTC CGT GTA GTG CTC 672Pro Val Leu Gln Asp Trp Val Thr Ala Thr As - #p Val Arg Val Val Leu# 220- ACA AGG CCT AGC ACG GCA GGT GAC CCC AGG GA - #C ATG GAG GCC GTC GTC 720Thr Arg Pro Ser Thr Ala Gly Asp Pro Arg As - #p Met Glu Ala Val Val225 2 - #30 2 - #35 2 -#40- CCT TAC TCC TAC GCA GCC ACC GAC CTC CAG GT - #G GGC GGG CGC TGC AAG 768Pro Tyr Ser Tyr Ala Ala Thr Asp Leu Gln Va - #l Gly Gly Arg Cys Lys# 255- TGC AAT GGA CAT GCC TCA CGG TGC CTG CTG GA - #C ACA CAG GGC CAC CTG 816Cys Asn Gly His Ala Ser Arg Cys Leu Leu As - #p Thr Gln Gly His Leu# 270- ATC TGC GAC TGT CGG CAT GGC ACC GAG GGC CC - #T GAC TGC GGC CGC TGC 864Ile Cys Asp Cys Arg His Gly Thr Glu Gly Pr - #o Asp Cys Gly Arg Cys# 285- AAG CCC TTC TAC TGC GAC AGG CCA TGG CAG CG - #G GCC ACT GCC CGG GAA 912Lys Pro Phe Tyr Cys Asp Arg Pro Trp Gln Ar - #g Ala Thr Ala Arg Glu# 300- TCC CAC GCC TGC CTC GCT TGC TCC TGC AAC GG - #C CAT GCC CGC CGC TGC 960Ser His Ala Cys Leu Ala Cys Ser Cys Asn Gl - #y His Ala Arg Arg Cys305 3 - #10 3 - #15 3 -#20- CGC TTC AAC ATG GAG CTG TAC CGA CTG TCC GG - #C CGC CGC AGC GGG GGT1008Arg Phe Asn Met Glu Leu Tyr Arg Leu Ser Gl - #y Arg Arg Ser Gly Gly# 335- GTC TGT CTC AAC TGC CGG CAC AAC ACC GCC GG - #C CGC CAC TGC CAC TAC1056Val Cys Leu Asn Cys Arg His Asn Thr Ala Gl - #y Arg His Cys His Tyr# 350- TGC CGG GAG GGC TTC TAT CGA GAC CCT GGC CG - #T GCC CTG AGT GAC CGT1104Cys Arg Glu Gly Phe Tyr Arg Asp Pro Gly Ar - #g Ala Leu Ser Asp Arg# 365- CGG GCT TGC AGG GCC TGC GAC TGT CAC CCG GT - #T GGT GCT GCT GGC AAG1152Arg Ala Cys Arg Ala Cys Asp Cys His Pro Va - #l Gly Ala Ala Gly Lys# 380- ACC TGC AAC CAG ACC ACA GGC CAG TGT CCC TG - #C AAG GAT GGC GTC ACT1200Thr Cys Asn Gln Thr Thr Gly Gln Cys Pro Cy - #s Lys Asp Gly Val Thr385 3 - #90 3 - #95 4 -#00- GGC CTC ACC TGC AAC CGC TGC GCG CCT GGC TT - #C CAG CAA AGC CGC TCC1248Gly Leu Thr Cys Asn Arg Cys Ala Pro Gly Ph - #e Gln Gln Ser Arg Ser# 415- CCA GTG GCG CCC TGT GTT AAG ACC CCT ATC CC - #T GGA CCC ACT GAG GAC1296Pro Val Ala Pro Cys Val Lys Thr Pro Ile Pr - #o Gly Pro Thr Glu Asp# 430- AGC AGC CCT GTG CAG CCC CAG GAC TGT GAC TC - #G CAC TGC AAA CCT GCC1344Ser Ser Pro Val Gln Pro Gln Asp Cys Asp Se - #r His Cys Lys Pro Ala# 445- CGT GGC AGC TAC CGC ATC AGC CTA AAG AAG TT - #C TGC AAG AAG GAC TAT1392Arg Gly Ser Tyr Arg Ile Ser Leu Lys Lys Ph - #e Cys Lys Lys Asp Tyr# 460- GCG GTG CAG GTG GCG GTG GGT GCG CGC GGC GA - #G GCG CGC GGC GCG TGG1440Ala Val Gln Val Ala Val Gly Ala Arg Gly Gl - #u Ala Arg Gly Ala Trp465 4 - #70 4 - #75 4 -#80- ACA CGC TTC CCG GTG GCG GTG CTC GCC GTG TT - #C CGG AGC GGA GAG GAG1488Thr Arg Phe Pro Val Ala Val Leu Ala Val Ph - #e Arg Ser Gly Glu Glu# 495- CGC GCG CGG CGC GGG AGT AGC GCG CTG TGG GT - #G CCC GCC GGG GAT GCG1536Arg Ala Arg Arg Gly Ser Ser Ala Leu Trp Va - #l Pro Ala Gly Asp Ala# 510- GCC TGC GGC TGC CCG CGC CTG CTC CCC GGC CG - #C CGC TAC CTC CTG CTG1584Ala Cys Gly Cys Pro Arg Leu Leu Pro Gly Ar - #g Arg Tyr Leu Leu Leu# 525- GGG GGC GGG CCT GGA GCC GCG GCT GGG GGC GC - #G GGG GGC CGG GGG CCC1632Gly Gly Gly Pro Gly Ala Ala Ala Gly Gly Al - #a Gly Gly Arg Gly Pro# 540- GGG CTC ATC GCC GCC CGC GGA AGC CTC GTG CT - #A CCC TGG AGG GAC GCG1680Gly Leu Ile Ala Ala Arg Gly Ser Leu Val Le - #u Pro Trp Arg Asp Ala545 5 - #50 5 - #55 5 -#60- TGG ACG CGG CGC CTG CGG AGG CTG CAG CGA CG - #C GAA CGG CGG GGG CGC1728Trp Thr Arg Arg Leu Arg Arg Leu Gln Arg Ar - #g Glu Arg Arg Gly Arg# 575# 1743 GACys Ser Ala Ala 580- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 580 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- Met Pro Gly Trp Pro Trp Gly Leu Leu Leu Th - #r Ala Gly Thr Leu Phe# 15- Ala Ala Leu Ser Pro Gly Pro Pro Ala Pro Al - #a Asp Pro Cys His Asp# 30- Glu Gly Gly Ala Pro Arg Gly Cys Val Pro Gl - #y Leu Val Asn Ala Ala# 45- Leu Gly Arg Glu Val Leu Ala Ser Ser Thr Cy - #s Gly Arg Pro Ala Thr# 60- Arg Ala Cys Asp Ala Ser Asp Pro Arg Arg Al - #a His Ser Pro Ala Leu# 80- Leu Thr Ser Pro Gly Gly Thr Ala Ser Pro Le - #u Cys Trp Arg Ser Glu# 95- Ser Leu Pro Arg Ala Pro Leu Asn Val Thr Le - #u Thr Val Pro Leu Gly# 110- Lys Ala Phe Glu Leu Val Phe Val Ser Leu Ar - #g Phe Cys Ser Ala Pro# 125- Pro Ala Ser Val Ala Leu Leu Lys Ser Gln As - #p His Gly Arg Ser Trp# 140- Ala Pro Leu Gly Phe Phe Ser Ser His Cys As - #p Leu Asp Tyr Gly Arg145 1 - #50 1 - #55 1 -#60- Leu Pro Ala Pro Ala Asn Gly Pro Ala Gly Pr - #o Gly Pro Glu Ala Leu# 175- Cys Phe Pro Ala Pro Leu Ala Gln Pro Asp Gl - #y Ser Gly Leu Leu Ala# 190- Phe Ser Met Gln Asp Ser Ser Pro Pro Gly Le - #u Asp Leu Asp Ser Ser# 205- Pro Val Leu Gln Asp Trp Val Thr Ala Thr As - #p Val Arg Val Val Leu# 220- Thr Arg Pro Ser Thr Ala Gly Asp Pro Arg As - #p Met Glu Ala Val Val225 2 - #30 2 - #35 2 -#40- Pro Tyr Ser Tyr Ala Ala Thr Asp Leu Gln Va - #l Gly Gly Arg Cys Lys# 255- Cys Asn Gly His Ala Ser Arg Cys Leu Leu As - #p Thr Gln Gly His Leu# 270- Ile Cys Asp Cys Arg His Gly Thr Glu Gly Pr - #o Asp Cys Gly Arg Cys# 285- Lys Pro Phe Tyr Cys Asp Arg Pro Trp Gln Ar - #g Ala Thr Ala Arg Glu# 300- Ser His Ala Cys Leu Ala Cys Ser Cys Asn Gl - #y His Ala Arg Arg Cys305 3 - #10 3 - #15 3 -#20- Arg Phe Asn Met Glu Leu Tyr Arg Leu Ser Gl - #y Arg Arg Ser Gly Gly# 335- Val Cys Leu Asn Cys Arg His Asn Thr Ala Gl - #y Arg His Cys His Tyr# 350- Cys Arg Glu Gly Phe Tyr Arg Asp Pro Gly Ar - #g Ala Leu Ser Asp Arg# 365- Arg Ala Cys Arg Ala Cys Asp Cys His Pro Va - #l Gly Ala Ala Gly Lys# 380- Thr Cys Asn Gln Thr Thr Gly Gln Cys Pro Cy - #s Lys Asp Gly Val Thr385 3 - #90 3 - #95 4 -#00- Gly Leu Thr Cys Asn Arg Cys Ala Pro Gly Ph - #e Gln Gln Ser Arg Ser# 415- Pro Val Ala Pro Cys Val Lys Thr Pro Ile Pr - #o Gly Pro Thr Glu Asp# 430- Ser Ser Pro Val Gln Pro Gln Asp Cys Asp Se - #r His Cys Lys Pro Ala# 445- Arg Gly Ser Tyr Arg Ile Ser Leu Lys Lys Ph - #e Cys Lys Lys Asp Tyr# 460- Ala Val Gln Val Ala Val Gly Ala Arg Gly Gl - #u Ala Arg Gly Ala Trp465 4 - #70 4 - #75 4 -#80- Thr Arg Phe Pro Val Ala Val Leu Ala Val Ph - #e Arg Ser Gly Glu Glu# 495- Arg Ala Arg Arg Gly Ser Ser Ala Leu Trp Va - #l Pro Ala Gly Asp Ala# 510- Ala Cys Gly Cys Pro Arg Leu Leu Pro Gly Ar - #g Arg Tyr Leu Leu Leu# 525- Gly Gly Gly Pro Gly Ala Ala Ala Gly Gly Al - #a Gly Gly Arg Gly Pro# 540- Gly Leu Ile Ala Ala Arg Gly Ser Leu Val Le - #u Pro Trp Arg Asp Ala545 5 - #50 5 - #55 5 -#60- Trp Thr Arg Arg Leu Arg Arg Leu Gln Arg Ar - #g Glu Arg Arg Gly Arg# 575- Cys Ser Ala Ala 580- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 606 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- Met Pro Arg Arg Gly Ala Glu Gly Pro Leu Al - #a Leu Leu Leu Ala Ala# 15- Ala Trp Leu Ala Gln Pro Leu Arg Gly Gly Ty - #r Pro Gly Leu Asn Met# 30- Phe Ala Val Gln Thr Ala Gln Pro Asp Pro Cy - #s Tyr Asp Glu His Gly# 45- Leu Pro Arg Arg Cys Ile Pro Asp Phe Val As - #n Ser Ala Phe Gly Lys# 60- Glu Val Lys Val Ser Ser Thr Cys Gly Lys Pr - #o Pro Ser Arg Tyr Cys#80- Val Val Thr Glu Lys Gly Glu Glu Gln Val Ar - #g Ser Cys His Leu Cys# 95- Asn Ala Ser Asp Pro Lys Arg Ala His Pro Pr - #o Ser Phe Leu Thr Asp# 110- Leu Asn Asn Pro His Asn Leu Thr Cys Trp Gl - #n Ser Asp Ser Tyr Val# 125- Gln Tyr Pro His Asn Val Thr Leu Thr Leu Se - #r Leu Gly Lys Lys Phe# 140- Glu Val Thr Tyr Val Ser Leu Gln Phe Cys Se - #r Pro Arg Pro Glu Ser145 1 - #50 1 - #55 1 -#60- Met Ala Ile Tyr Lys Ser Met Asp Tyr Gly Ly - #s Thr Trp Val Pro Phe# 175- Gln Phe Tyr Ser Thr Gln Cys Arg Lys Met Ty - #r Asn Lys Pro Ser Arg# 190- Ala Ala Ile Thr Lys Gln Asn Glu Gln Glu Al - #a Ile Cys Thr Asp Ser# 205- His Thr Asp Val Arg Pro Leu Ser Gly Gly Le - #u Ile Ala Phe Ser Thr# 220- Leu Asp Gly Arg Pro Thr Ala His Asp Phe As - #p Asn Ser Pro Val Leu225 2 - #30 2 - #35 2 -#40- Gln Asp Trp Val Thr Ala Thr Asp Ile Lys Va - #l Thr Phe Ser Arg Leu# 255- His Thr Phe Gly Asp Glu Asn Glu Asp Asp Se - #r Glu Leu Ala Arg Asp# 270- Ser Tyr Phe Tyr Ala Val Ser Asp Leu Gln Va - #l Gly Gly Arg Cys Lys# 285- Cys Asn Gly His Ala Ser Arg Cys Val Arg As - #p Arg Asp Asp Asn Leu# 300- Val Cys Asp Cys Lys His Asn Thr Ala Gly Pr - #o Glu Cys Asp Arg Cys305 3 - #10 3 - #15 3 -#20- Lys Pro Phe His Tyr Asp Arg Pro Trp Gln Ar - #g Ala Thr Ala Arg Glu# 335- Ala Asn Glu Cys Val Ala Cys Asn Cys Asn Le - #u His Ala Arg Arg Cys# 350- Arg Phe Asn Met Glu Leu Tyr Lys Leu Ser Gl - #y Arg Lys Ser Gly Gly# 365- Val Cys Leu Asn Cys Arg His Asn Thr Ala Gl - #y Arg His Cys His Tyr# 380- Cys Lys Glu Gly Phe Tyr Arg Asp Leu Ser Ly - #s Pro Ile Ser His Arg385 3 - #90 3 - #95 4 -#00- Lys Ala Cys Lys Glu Cys Asp Cys His Pro Va - #l Gly Ala Ala Gly Gln# 415- Thr Cys Asn Gln Thr Thr Gly Gln Cys Pro Cy - #s Lys Asp Gly Val Thr# 430- Gly Ile Thr Cys Asn Arg Cys Ala Lys Gly Ty - #r Gln Gln Ser Arg Ser# 445- Pro Ile Ala Pro Cys Ile Lys Ile Pro Ala Al - #a Pro Pro Pro Thr Ala# 460- Ala Ser Ser Thr Glu Glu Pro Ala Asp Cys As - #p Ser Tyr Cys Lys Ala465 4 - #70 4 - #75 4 -#80- Ser Lys Gly Lys Leu Lys Ile Asn Met Lys Ly - #s Tyr Cys Lys Lys Asp# 495- Tyr Ala Val Gln Ile His Ile Leu Lys Ala Gl - #u Lys Asn Ala Asp Trp# 510- Trp Lys Phe Thr Val Asn Ile Ile Ser Val Ty - #r Lys Gln Gly Ser Asn# 525- Arg Leu Arg Arg Gly Asp Gln Thr Leu Trp Va - #l His Ala Lys Asp Ile# 540- Ala Cys Lys Cys Pro Lys Val Lys Pro Met Ly - #s Lys Tyr Leu Leu Leu545 5 - #50 5 - #55 5 -#60- Gly Ser Thr Glu Asp Ser Pro Asp Gln Ser Gl - #y Ile Ile Ala Asp Lys# 575- Ser Ser Leu Val Ile Gln Trp Arg Asp Thr Tr - #p Ala Arg Arg Leu Arg# 590- Lys Phe Gln Gln Arg Glu Lys Lys Gly Lys Cy - #s Arg Lys Ala# 605- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 581 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:- Leu Arg Leu Leu Leu Thr Thr Ser Val Leu Ar - #g Leu Ala Arg Ala Ala# 15- Asn Pro Glu Val Ala Gln Gln Thr Pro Pro As - #p Pro Cys Tyr Asp Glu# 30- Ser Gly Ala Pro Arg Arg Cys Ile Pro Glu Ph - #e Val Asn Ala Ala Phe# 45- Gly Lys Glu Val Gln Ala Ser Ser Thr Cys Gl - #y Lys Pro Pro Thr Arg# 60- His Cys Asp Ala Ser Asp Pro Arg Arg Ala Hi - #s Pro Pro Ala Tyr Leu#80- Thr Asp Leu Asn Thr Ala Ala Asn Met Thr Cy - #s Trp Arg Ser Glu Thr# 95- Leu His His Leu Pro His Asn Val Thr Leu Th - #r Leu Ser Leu Gly Lys# 110- Lys Phe Glu Val Val Tyr Val Ser Leu Gln Ph - #e Cys Ser Pro Arg Pro# 125- Glu Ser Thr Ala Ile Phe Lys Ser Met Asp Ty - #r Gly Lys Thr Trp Val# 140- Pro Tyr Gln Tyr Tyr Ser Ser Gln Cys Arg Ly - #s Ile Tyr Gly Lys Pro145 1 - #50 1 - #55 1 -#60- Ser Lys Ala Thr Val Thr Lys Gln Asn Glu Gl - #n Glu Ala Leu Cys Thr# 175- Asp Gly Leu Thr Asp Leu Tyr Pro Leu Thr Gl - #y Gly Leu Ile Ala Phe# 190- Ser Thr Leu Asp Gly Arg Pro Ser Ala Gln As - #p Phe Asp Ser Ser Pro# 205- Val Leu Gln Asp Trp Val Thr Ala Thr Asp Il - #e Arg Val Val Phe Ser# 220- Arg Pro His Leu Phe Arg Glu Leu Gly Gly Ar - #g Glu Ala Gly Glu Glu225 2 - #30 2 - #35 2 -#40- Asp Gly Gly Ala Gly Ala Thr Pro Tyr Tyr Ty - #r Ser Val Gly Glu Leu# 255- Gln Val Gly Gly Arg Cys Lys Cys Asn Gly Hi - #s Ala Ser Arg Cys Val# 270- Lys Asp Lys Glu Gln Lys Leu Val Cys Asp Cy - #s Lys His Asn Thr Glu# 285- Gly Pro Glu Cys Asp Arg Cys Lys Pro Phe Hi - #s Tyr Asp Arg Pro Trp# 300- Gln Arg Ala Ser Ala Arg Glu Ala Asn Glu Cy - #s Leu Ala Cys Asn Cys305 3 - #10 3 - #15 3 -#20- Asn Leu His Ala Arg Arg Cys Arg Phe Asn Me - #t Glu Leu Tyr Lys Leu# 335- Ser Gly Arg Lys Ser Gly Gly Val Cys Leu As - #n Cys Arg His Asn Thr# 350- Ala Gly Arg His Cys His Tyr Cys Lys Glu Gl - #y Phe Tyr Arg Asp Leu# 365- Ser Lys Ser Ile Thr Asp Arg Lys Ala Cys Ly - #s Ala Cys Asp Cys His# 380- Pro Val Gly Ala Ala Gly Lys Thr Cys Asn Gl - #n Thr Thr Gly Gln Cys385 3 - #90 3 - #95 4 -#00- Pro Cys Lys Asp Gly Val Thr Gly Leu Thr Cy - #s Asn Arg Cys Ala Lys# 415- Gly Phe Gln Gln Ser Arg Ser Pro Val Ala Pr - #o Cys Ile Lys Ile Pro# 430- Ala Ile Asn Pro Thr Ser Leu Val Thr Ser Th - #r Glu Ala Pro Ala Asp# 445- Cys Asp Ser Tyr Cys Lys Pro Ala Lys Gly As - #n Tyr Lys Ile Asn Met# 460- Lys Lys Tyr Cys Lys Lys Asp Tyr Val Val Gl - #n Val Asn Ile Leu Glu465 4 - #70 4 - #75 4 -#80- Met Glu Thr Val Ala Asn Trp Ala Lys Phe Th - #r Ile Asn Ile Leu Ser# 495- Val Tyr Lys Cys Arg Asp Glu Arg Val Lys Ar - #g Gly Asp Asn Phe Leu# 510- Trp Ile His Leu Lys Asp Leu Ser Cys Lys Cy - #s Pro Lys Ile Gln Ile# 525- Ser Lys Lys Tyr Leu Val Met Gly Ile Ser Gl - #u Asn Ser Thr Asp Arg# 540- Pro Gly Leu Met Ala Asp Lys Asn Ser Leu Va - #l Ile Gln Trp Arg Asp545 5 - #50 5 - #55 5 -#60- Ala Trp Thr Arg Arg Leu Arg Lys Leu Gln Ar - #g Arg Glu Lys Lys Gly# 575- Lys Cys Val Lys Pro 580- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 5894 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 2..5053- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:#CTG CCA TTG CTG TTT 46 GAA CTC TTC Lys Val Leu Val Thr Val Leu Glu Leu P - #he Leu Pro Leu Leu Phe# 15- TCT GGG ATC CTC ATC TGG CTC CGC TTG AAG AT - #T CAG TCG GAA AAT GTG 94Ser Gly Ile Leu Ile Trp Leu Arg Leu Lys Il - #e Gln Ser Glu Asn Val# 30- CCC AAC GCC ACC ATC TAC CCG GGC CAG TCC AT - #C CAG GAG CTG CCT CTG 142Pro Asn Ala Thr Ile Tyr Pro Gly Gln Ser Il - #e Gln Glu Leu Pro Leu# 45- TTC TTC ACC TTC CCT CCG CCA GGA GAC ACC TG - #G GAG CTT GCC TAC ATC 190Phe Phe Thr Phe Pro Pro Pro Gly Asp Thr Tr - #p Glu Leu Ala Tyr Ile# 60- CCT TCT CAC AGT GAC GCT GCC AAG GCC GTC AC - #T GAG ACA GTG CGC AGG 238Pro Ser His Ser Asp Ala Ala Lys Ala Val Th - #r Glu Thr Val Arg Arg# 75- GCA CTT GTG ATC AAC ATG CGA GTG CGC GGC TT - #T CCC TCC GAG AAG GAC 286Ala Leu Val Ile Asn Met Arg Val Arg Gly Ph - #e Pro Ser Glu Lys Asp# 95- TTT GAG GAC TAC ATT AGG TAC GAC AAC TGC TC - #G TCC AGC GTG CTG GCC 334Phe Glu Asp Tyr Ile Arg Tyr Asp Asn Cys Se - #r Ser Ser Val Leu Ala# 110- GCC GTG GTC TTC GAG CAC CCC TTC AAC CAC AG - #C AAG GAG CCC CTG CCG 382Ala Val Val Phe Glu His Pro Phe Asn His Se - #r Lys Glu Pro Leu Pro# 125- CTG GCG GTG AAA TAT CAC CTA CGG TTC AGT TA - #C ACA CGG AGA AAT TAC 430Leu Ala Val Lys Tyr His Leu Arg Phe Ser Ty - #r Thr Arg Arg Asn Tyr# 140- ATG TGG ACC CAA ACA GGC TCC TTT TTC CTG AA - #A GAG ACA GAA GGC TGG 478Met Trp Thr Gln Thr Gly Ser Phe Phe Leu Ly - #s Glu Thr Glu Gly Trp# 155- CAC ACT ACT TCC CTT TTC CCG CTT TTC CCA AA - #C CCA GGA CCA AGG GAA 526His Thr Thr Ser Leu Phe Pro Leu Phe Pro As - #n Pro Gly Pro Arg Glu160 1 - #65 1 - #70 1 -#75- CTA ACA TCC CCT GAT GGC GGA GAA CCT GGG TA - #C ATC CGG GAA GGC TTC 574Leu Thr Ser Pro Asp Gly Gly Glu Pro Gly Ty - #r Ile Arg Glu Gly Phe# 190- CTG GCC GTG CAG CAT GCT GTG GAC CGG GCC AT - #C ATG GAG TAC CAT GCC 622Leu Ala Val Gln His Ala Val Asp Arg Ala Il - #e Met Glu Tyr His Ala# 205- GAT GCC GCC ACA CGC CAG CTG TTC CAG AGA CT - #G ACG GTG ACC ATC AAG 670Asp Ala Ala Thr Arg Gln Leu Phe Gln Arg Le - #u Thr Val Thr Ile Lys# 220- AGG TTC CCG TAC CCG CCG TTC ATC GCA GAC CC - #C TTC CTC GTG GCC ATC 718Arg Phe Pro Tyr Pro Pro Phe Ile Ala Asp Pr - #o Phe Leu Val Ala Ile# 235- CAG TAC CAG CTG CCC CTG CTG CTG CTG CTC AG - #C TTC ACC TAC ACC GCG 766Gln Tyr Gln Leu Pro Leu Leu Leu Leu Leu Se - #r Phe Thr Tyr Thr Ala240 2 - #45 2 - #50 2 -#55- CTC ACC ATT GCC CGT GCT GTC GTG CAG GAG AA - #G GAA AGG AGG CTG AAG 814Leu Thr Ile Ala Arg Ala Val Val Gln Glu Ly - #s Glu Arg Arg Leu Lys# 270- GAG TAC ATG CGC ATG ATG GGG CTC AGC AGC TG - #G CTG CAC TGG AGT GCC 862Glu Tyr Met Arg Met Met Gly Leu Ser Ser Tr - #p Leu His Trp Ser Ala# 285- TGG TTC CTC TTG TTC TTC CTC TTC CTC CTC AT - #C GCC GCC TCC TTC ATG 910Trp Phe Leu Leu Phe Phe Leu Phe Leu Leu Il - #e Ala Ala Ser Phe Met# 300- ACC CTG CTC TTC TGT GTC AAG GTG AAG CCA AA - #T GTA GCC GTG CTG TCC 958Thr Leu Leu Phe Cys Val Lys Val Lys Pro As - #n Val Ala Val Leu Ser# 315- CGC AGC GAC CCC TCC CTG GTG CTC GCC TTC CT - #G CTG TGC TTC GCC ATC1006Arg Ser Asp Pro Ser Leu Val Leu Ala Phe Le - #u Leu Cys Phe Ala Ile320 3 - #25 3 - #30 3 -#35- TCT ACC ATC TCC TTC AGC TTC ATG GTC AGC AC - #C TTC TTC AGC AAA GCC1054Ser Thr Ile Ser Phe Ser Phe Met Val Ser Th - #r Phe Phe Ser Lys Ala# 350- AAC ATG GCA GCA GCC TTC GGA GGC TTC CTC TA - #C TTC TTC ACC TAC ATC1102Asn Met Ala Ala Ala Phe Gly Gly Phe Leu Ty - #r Phe Phe Thr Tyr Ile# 365- CCC TAC TTC TTC GTG GCC CCT CGG TAC AAC TG - #G ATG ACT CTG AGC CAG1150Pro Tyr Phe Phe Val Ala Pro Arg Tyr Asn Tr - #p Met Thr Leu Ser Gln# 380- AAG CTC TGC TCC TGC CTC CTG TCT AAT GTC GC - #C ATG GCA ATG GGA GCC1198Lys Leu Cys Ser Cys Leu Leu Ser Asn Val Al - #a Met Ala Met Gly Ala# 395- CAG CTC ATT GGG AAA TTT GAG GCG AAA GGC AT - #G GGC ATC CAG TGG CGA1246Gln Leu Ile Gly Lys Phe Glu Ala Lys Gly Me - #t Gly Ile Gln Trp Arg400 4 - #05 4 - #10 4 -#15- GAC CTC CTG AGT CCC GTC AAC GTG GAC GAC GA - #C TTC TGC TTC GGG CAG1294Asp Leu Leu Ser Pro Val Asn Val Asp Asp As - #p Phe Cys Phe Gly Gln# 430- GTG CTG GGG ATG CTG CTG CTG GAC TCT GTG CT - #C TAT GGC CTG GTG ACC1342Val Leu Gly Met Leu Leu Leu Asp Ser Val Le - #u Tyr Gly Leu Val Thr# 445- TGG TAC ATG GAG GCC GTC TTC CCA GGG CAG TT - #C GGC GTG CCT CAG CCC1390Trp Tyr Met Glu Ala Val Phe Pro Gly Gln Ph - #e Gly Val Pro Gln Pro# 460- TGG TAC TTC TTC ATC ATG CCC TCC TAT TGG TG - #T GGG AAG CCA AGG GCG1438Trp Tyr Phe Phe Ile Met Pro Ser Tyr Trp Cy - #s Gly Lys Pro Arg Ala# 475- GTT GCA GGG AAG GAG GAA GAA GAC AGT GAC CC - #C GAG AAA GCA CTC AGA1486Val Ala Gly Lys Glu Glu Glu Asp Ser Asp Pr - #o Glu Lys Ala Leu Arg480 4 - #85 4 - #90 4 -#95- AAC GAG TAC TTT GAA GCC GAG CCA GAG GAC CT - #G GTG GCG GGG ATC AAG1534Asn Glu Tyr Phe Glu Ala Glu Pro Glu Asp Le - #u Val Ala Gly Ile Lys# 510- ATC AAG CAC CTG TCC AAG GTG TTC AGG GTG GG - #A AAT AAG GAC AGG GCG1582Ile Lys His Leu Ser Lys Val Phe Arg Val Gl - #y Asn Lys Asp Arg Ala# 525- GCC GTC AGA GAC CTG AAC CTC AAC CTG TAC GA - #G GGA CAG ATC ACC GTC1630Ala Val Arg Asp Leu Asn Leu Asn Leu Tyr Gl - #u Gly Gln Ile Thr Val# 540- CTG CTG GGC CAC AAC GGT GCC GGG AAG ACC AC - #C ACC CTC TCC ATG CTC1678Leu Leu Gly His Asn Gly Ala Gly Lys Thr Th - #r Thr Leu Ser Met Leu# 555- ACA GGT CTC TTT CCC CCC ACC AGT GGA CGG GC - #A TAC ATC AGC GGG TAT1726Thr Gly Leu Phe Pro Pro Thr Ser Gly Arg Al - #a Tyr Ile Ser Gly Tyr560 5 - #65 5 - #70 5 -#75- GAA ATT TCC CAG GAC ATG GTT CAG ATC CGG AA - #G AGC CTG GGC CTG TGC1774Glu Ile Ser Gln Asp Met Val Gln Ile Arg Ly - #s Ser Leu Gly Leu Cys# 590- CCG CAG CAC GAC ATC CTG TTT GAC AAC TTG AC - #A GTC GCA GAG CAC CTT1822Pro Gln His Asp Ile Leu Phe Asp Asn Leu Th - #r Val Ala Glu His Leu# 605- TAT TTC TAC GCC CAG CTG AAG GGC CTG TCA CG - #T CAG AAG TGC CCT GAA1870Tyr Phe Tyr Ala Gln Leu Lys Gly Leu Ser Ar - #g Gln Lys Cys Pro Glu# 620- GAA GTC AAG CAG ATG CTG CAC ATC ATC GGC CT - #G GAG GAC AAG TGG AAC1918Glu Val Lys Gln Met Leu His Ile Ile Gly Le - #u Glu Asp Lys Trp Asn# 635- TCA CGG AGC CGC TTC CTG AGC GGG GGC ATG AG - #G CGC AAG CTC TCC ATC1966Ser Arg Ser Arg Phe Leu Ser Gly Gly Met Ar - #g Arg Lys Leu Ser Ile640 6 - #45 6 - #50 6 -#55- GGC ATC GCC CTC ATC GCA GGC TCC AAG GTG CT - #G ATA CTG GAC GAG CCC2014Gly Ile Ala Leu Ile Ala Gly Ser Lys Val Le - #u Ile Leu Asp Glu Pro# 670- ACC TCG GGC ATG GAC GCC ATC TCC AGG AGG GC - #C ATC TGG GAT CTT CTT2062Thr Ser Gly Met Asp Ala Ile Ser Arg Arg Al - #a Ile Trp Asp Leu Leu# 685- CAG CGG CAG AAA AGT GAC CGC ACC ATC GTG CT - #G ACC ACC CAC TTC ATG2110Gln Arg Gln Lys Ser Asp Arg Thr Ile Val Le - #u Thr Thr His Phe Met# 700- GAC GAG GCT GAC CTG CTG GGA GAC CGC ATC GC - #C ATC ATG GCC AAG GGG2158Asp Glu Ala Asp Leu Leu Gly Asp Arg Ile Al - #a Ile Met Ala Lys Gly# 715- GAG CTG CAG TGC TGC GGG TCC TCG CTG TTC CT - #C AAG CAG AAA TAC GGT2206Glu Leu Gln Cys Cys Gly Ser Ser Leu Phe Le - #u Lys Gln Lys Tyr Gly720 7 - #25 7 - #30 7 -#35- GCC GGC TAT CAC ATG ACG CTG GTG AAG GAG CC - #G CAC TGC AAC CCG GAA2254Ala Gly Tyr His Met Thr Leu Val Lys Glu Pr - #o His Cys Asn Pro Glu# 750- GAC ATC TCC CAG CTG GTC CAC CAC CAC GTG CC - #C AAC GCC ACG CTG GAG2302Asp Ile Ser Gln Leu Val His His His Val Pr - #o Asn Ala Thr Leu Glu# 765- AGC AGC GCT GGG GCC GAG CTG TCT TTC ATC CT - #T CCC AGA GAG AGC ACG2350Ser Ser Ala Gly Ala Glu Leu Ser Phe Ile Le - #u Pro Arg Glu Ser Thr# 780- CAC AGG TTT GAA GGT CTC TTT GCT AAA CTG GA - #G AAG AAG CAG AAA GAG2398His Arg Phe Glu Gly Leu Phe Ala Lys Leu Gl - #u Lys Lys Gln Lys Glu# 795- CTG GGC ATT GCC AGC TTT GGG GCA TCC ATC AC - #C ACC ATG GAG GAA GTC2446Leu Gly Ile Ala Ser Phe Gly Ala Ser Ile Th - #r Thr Met Glu Glu Val800 8 - #05 8 - #10 8 -#15- TTC CTT CGG GTC GGG AAG CTG GTG GAC AGC AG - #T ATG GAC ATC CAG GCC2494Phe Leu Arg Val Gly Lys Leu Val Asp Ser Se - #r Met Asp Ile Gln Ala# 830- ATC CAG CTC CCT GCC CTG CAG TAC CAG CAC GA - #G AGG CGC GCC AGC GAC2542Ile Gln Leu Pro Ala Leu Gln Tyr Gln His Gl - #u Arg Arg Ala Ser Asp# 845- TGG GCT GTG GAC AGC AAC CTC TGT GGG GCC AT - #G GAC CCC TCC GAC GGC2590Trp Ala Val Asp Ser Asn Leu Cys Gly Ala Me - #t Asp Pro Ser Asp Gly# 860- ATT GGA GCC CTC ATC GAG GAG GAG CGC ACC GC - #T GTC AAG CTC AAC ACT2638Ile Gly Ala Leu Ile Glu Glu Glu Arg Thr Al - #a Val Lys Leu Asn Thr# 875- GGG CTC GCC CTG CAC TGC CAG CAA TTC TGG GC - #C ATG TTC CTG AAG AAG2686Gly Leu Ala Leu His Cys Gln Gln Phe Trp Al - #a Met Phe Leu Lys Lys880 8 - #85 8 - #90 8 -#95- GCC GCA TAC AGC TGG CGC GAG TGG AAA ATG GT - #G GCG GCA CAG GTC CTG2734Ala Ala Tyr Ser Trp Arg Glu Trp Lys Met Va - #l Ala Ala Gln Val Leu# 910- GTG CCT CTG ACC TGC GTC ACC CTG GCC CTC CT - #G GCC ATC AAC TAC TCC2782Val Pro Leu Thr Cys Val Thr Leu Ala Leu Le - #u Ala Ile Asn Tyr Ser# 925- TCG GAG CTC TTC GAC GAC CCC ATG CTG AGG CT - #G ACC TTG GGC GAG TAC2830Ser Glu Leu Phe Asp Asp Pro Met Leu Arg Le - #u Thr Leu Gly Glu Tyr# 940- GGC AGA ACC GTC GTG CCC TTC TCA GTT CCC GG - #G ACC TCC CAG CTG GGT2878Gly Arg Thr Val Val Pro Phe Ser Val Pro Gl - #y Thr Ser Gln Leu Gly# 955- CAG CAG CTG TCA GAG CAT CTG AAA GAC GCA CT - #G CAG GCT GAG GGA CAG2926Gln Gln Leu Ser Glu His Leu Lys Asp Ala Le - #u Gln Ala Glu Gly Gln960 9 - #65 9 - #70 9 -#75- GAG CCC CGC GAG GTG CTC GGT GAC CTG GAG GA - #G TTC TTG ATC TTC AGG2974Glu Pro Arg Glu Val Leu Gly Asp Leu Glu Gl - #u Phe Leu Ile Phe Arg# 990- GCT TCT GTG GAG GGG GGC GGC TTT AAT GAG CG - #G TGC CTT GTG GCA GCG3022Ala Ser Val Glu Gly Gly Gly Phe Asn Glu Ar - #g Cys Leu Val Ala Ala# 10050- TCC TTC AGA GAT GTG GGA GAG CGC ACG GTC GT - #C AAC GCC TTG TTC AAC3070Ser Phe Arg Asp Val Gly Glu Arg Thr Val Va - #l Asn Ala Leu Phe Asn# 10205- AAC CAG GCG TAC CAC TCT CCA GCC ACT GCC CT - #G GCC GTC GTG GAC AAC3118Asn Gln Ala Tyr His Ser Pro Ala Thr Ala Le - #u Ala Val Val Asp Asn# 10350- CTT CTG TTC AAG CTG CTG TGC GGG CCT CAC GC - #C TCC ATT GTG GTC TCC3166Leu Leu Phe Lys Leu Leu Cys Gly Pro His Al - #a Ser Ile Val Val Ser# 10551045 - # 1050- AAC TTC CCC CAG CCC CGG AGC GCC CTG CAG GC - #T GCC AAG GAC CAG TTT3214Asn Phe Pro Gln Pro Arg Ser Ala Leu Gln Al - #a Ala Lys Asp Gln Phe# 10705- AAC GAG GGC CGG AAG GGA TTC GAC ATT GCC CT - #C AAC CTG CTC TTC GCC3262Asn Glu Gly Arg Lys Gly Phe Asp Ile Ala Le - #u Asn Leu Leu Phe Ala# 10850- ATG GCA TTC TTG GCC AGC ACG TTC TCC ATC CT - #G GCG GTC AGC GAG AGG3310Met Ala Phe Leu Ala Ser Thr Phe Ser Ile Le - #u Ala Val Ser Glu Arg# 11005- GCC GTG CAG GCC AAG CAT GTG CAG TTT GTG AG - #T GGA GTC CAC GTG GCC3358Ala Val Gln Ala Lys His Val Gln Phe Val Se - #r Gly Val His Val Ala# 11150- AGT TTC TGG CTC TCT GCT CTG CTG TGG GAC CT - #C ATC TCC TTC CTC ATC3406Ser Phe Trp Leu Ser Ala Leu Leu Trp Asp Le - #u Ile Ser Phe Leu Ile# 11351125 - # 1130- CCC AGT CTG CTG CTG CTG GTG GTG TTT AAG GC - #C TTC GAC GTG CGT GCC3454Pro Ser Leu Leu Leu Leu Val Val Phe Lys Al - #a Phe Asp Val Arg Ala# 11505- TTC ACG CGG GAC GGC CAC ATG GCT GAC ACC CT - #G CTG CTG CTC CTG CTC3502Phe Thr Arg Asp Gly His Met Ala Asp Thr Le - #u Leu Leu Leu Leu Leu# 11650- TAC GGC TGG GCC ATC ATC CCC CTC ATG TAC CT - #G ATG AAC TTC TTC TTC3550Tyr Gly Trp Ala Ile Ile Pro Leu Met Tyr Le - #u Met Asn Phe Phe Phe# 11805- TTG GGG GCG GCC ACT GCC TAC ACG AGG CTG AC - #C ATC TTC AAC ATC CTG3598Leu Gly Ala Ala Thr Ala Tyr Thr Arg Leu Th - #r Ile Phe Asn Ile Leu# 11950- TCA GGC ATC GCC ACC TTC CTG ATG GTC ACC AT - #C ATG CGC ATC CCA GCT3646Ser Gly Ile Ala Thr Phe Leu Met Val Thr Il - #e Met Arg Ile Pro Ala# 12151205 - # 1210- GTA AAA CTG GAA GAA CTT TCC AAA ACC CTG GA - #T CAC GTG TTC CTG GTG3694Val Lys Leu Glu Glu Leu Ser Lys Thr Leu As - #p His Val Phe Leu Val# 12305- CTG CCC AAC CAC TGT CTG GGG ATG GCA GTC AG - #C AGT TTC TAC GAG AAC3742Leu Pro Asn His Cys Leu Gly Met Ala Val Se - #r Ser Phe Tyr Glu Asn# 12450- TAC GAG ACG CGG AGG TAC TGC ACC TCC TCC GA - #G GTC GCC GCC CAC TAC3790Tyr Glu Thr Arg Arg Tyr Cys Thr Ser Ser Gl - #u Val Ala Ala His Tyr# 12605- TGC AAG AAA TAT AAC ATC CAG TAC CAG GAG AA - #C TTC TAT GCC TGG AGC3838Cys Lys Lys Tyr Asn Ile Gln Tyr Gln Glu As - #n Phe Tyr Ala Trp Ser# 12750- GCC CCG GGG GTC GGC CGG TTT GTG GCC TCC AT - #G GCC GCC TCA GGG TGC3886Ala Pro Gly Val Gly Arg Phe Val Ala Ser Me - #t Ala Ala Ser Gly Cys# 12951285 - # 1290- GCC TAC CTC ATC CTG CTC TTC CTC ATC GAG AC - #C AAC CTG CTT CAG AGA3934Ala Tyr Leu Ile Leu Leu Phe Leu Ile Glu Th - #r Asn Leu Leu Gln Arg# 13105- CTC AGG GGC ATC CTC TGC GCC CTC CGG AGG AG - #G CGG ACA CTG ACA GAA3982Leu Arg Gly Ile Leu Cys Ala Leu Arg Arg Ar - #g Arg Thr Leu Thr Glu# 13250- TTA TAC ACC CGG ATG CCT GTG CTT CCT GAG GA - #C CAA GAT GTA GCG GAC4030Leu Tyr Thr Arg Met Pro Val Leu Pro Glu As - #p Gln Asp Val Ala Asp# 13405- GAG AGG ACC CGC ATC CTG GCC CCC AGC CCG GA - #C TCC CTG CTC CAC ACA4078Glu Arg Thr Arg Ile Leu Ala Pro Ser Pro As - #p Ser Leu Leu His Thr# 13550- CCT CTG ATT ATC AAG GAG CTC TCC AAG GTG TA - #C GAG CAG CGG GTG CCC4126Pro Leu Ile Ile Lys Glu Leu Ser Lys Val Ty - #r Glu Gln Arg Val Pro# 13751365 - # 1370- CTC CTG GCC GTG GAC AGG CTC TCC CTC GCG GT - #G CAG AAA GGG GAG TGC4174Leu Leu Ala Val Asp Arg Leu Ser Leu Ala Va - #l Gln Lys Gly Glu Cys# 13905- TTC GGC CTG CTG GGC TTC AAT GGA GCC GGG AA - #G ACC ACG ACT TTC AAA4222Phe Gly Leu Leu Gly Phe Asn Gly Ala Gly Ly - #s Thr Thr Thr Phe Lys# 14050- ATG CTG ACC GGG GAG GAG AGC CTC ACT TCT GG - #G GAT GCC TTT GTC GGG4270Met Leu Thr Gly Glu Glu Ser Leu Thr Ser Gl - #y Asp Ala Phe Val Gly# 14205- GGT CAC AGA ATC AGC TCT GAT GTC GGA AAG GT - #G CGG CAG CGG ATC GGC4318Gly His Arg Ile Ser Ser Asp Val Gly Lys Va - #l Arg Gln Arg Ile Gly# 14350- TAC TGC CCG CAG TTT GAT GCC TTG CTG GAC CA - #C ATG ACA GGC CGG GAG4366Tyr Cys Pro Gln Phe Asp Ala Leu Leu Asp Hi - #s Met Thr Gly Arg Glu# 14551445 - # 1450- ATG CTG GTC ATG TAC GCT CGG CTC CGG GGC AT - #C CCT GAG CGC CAC ATC4414Met Leu Val Met Tyr Ala Arg Leu Arg Gly Il - #e Pro Glu Arg His Ile# 14705- GGG GCC TGC GTG GAG AAC ACT CTG CGG GGC CT - #G CTG CTG GAG CCA CAT4462Gly Ala Cys Val Glu Asn Thr Leu Arg Gly Le - #u Leu Leu Glu Pro His# 14850- GCC AAC AAG CTG GTC AGG ACG TAC AGT GGT GG - #T AAC AAG CGG AAG CTG4510Ala Asn Lys Leu Val Arg Thr Tyr Ser Gly Gl - #y Asn Lys Arg Lys Leu# 15005- AGC ACC GGC ATC GCC CTG ATC GGA GAG CCT GC - #T GTC ATC TTC CTG GAC4558Ser Thr Gly Ile Ala Leu Ile Gly Glu Pro Al - #a Val Ile Phe Leu Asp# 15150- GAG CCG TCC ACT GGC ATG GAC CCC GTG GCC CG - #G CGC CTG CTT TGG GAC4606Glu Pro Ser Thr Gly Met Asp Pro Val Ala Ar - #g Arg Leu Leu Trp Asp# 15351525 - # 1530- ACC GTG GCA CGA GCC CGA GAG TCT GGC AAG GC - #C ATC ATC ATC ACC TCC4654Thr Val Ala Arg Ala Arg Glu Ser Gly Lys Al - #a Ile Ile Ile Thr Ser# 15505- CAC AGC ATG GAG GAG TGT GAG GCC CTG TGC AC - #C CGG CTG GCC ATC ATG4702His Ser Met Glu Glu Cys Glu Ala Leu Cys Th - #r Arg Leu Ala Ile Met# 15650- GTG CAG GGG CAG TTC AAG TGC CTG GGC AGC CC - #C CAG CAC CTC AAG AGC4750Val Gln Gly Gln Phe Lys Cys Leu Gly Ser Pr - #o Gln His Leu Lys Ser# 15805- AAG TTC GGC AGC GGC TAC TCC CTG CGG GCC AA - #G GTG CAG AGT GAA GGG4798Lys Phe Gly Ser Gly Tyr Ser Leu Arg Ala Ly - #s Val Gln Ser Glu Gly# 15950- CAA CAG GAG GCG CTG GAG GAG TTC AAG GCC TT - #C GTG GAC CTG ACC TTT4846Gln Gln Glu Ala Leu Glu Glu Phe Lys Ala Ph - #e Val Asp Leu Thr Phe# 16151605 - # 1610- CCA GGC AGC GTC CTG GAA GAT GAG CAC CAA GG - #C ATG GTC CAT TAC CAC4894Pro Gly Ser Val Leu Glu Asp Glu His Gln Gl - #y Met Val His Tyr His# 16305- CTG CCG GGC CGT GAC CTC AGC TGG GCG AAG GT - #T TTC GGT ATT CTG GAG4942Leu Pro Gly Arg Asp Leu Ser Trp Ala Lys Va - #l Phe Gly Ile Leu Glu# 16450- AAA GCC AAG GAA AAG TAC GGC GTG GAC GAC TA - #C TCC GTG AGC CAG ATC4990Lys Ala Lys Glu Lys Tyr Gly Val Asp Asp Ty - #r Ser Val Ser Gln Ile# 16605- TCG CTG GAA CAG GTC TTC CTG AGC TTC GCC CA - #C CTG CAG CCG CCC ACC5038Ser Leu Glu Gln Val Phe Leu Ser Phe Ala Hi - #s Leu Gln Pro Pro Thr# 16750- GCA GAG GAG GGG CGA TGAGGGGTGG CGGCTGTCTC GCCATCAGG - #C AGGGACAGGA5093Ala Glu Glu Gly Arg1680- CGGGCAAGCA GGGCCCATCT TACATCCTCT CTCTCCAAGT TTATCTCATC CT - #TTATTTTT5153- AATCACTTTT TTCTATGATG GATATGAAAA ATTCAAGGCA GTATGCACAG AA - #TGGACGAG5213- TGCAGCCCAG CCCTCATGCC CAGGATCAGC ATGCGCATCT CCATGTCTGC AT - #ACTCTGGA5273- GTTCACTTTC CCAGAGCTGG GGCAGGCCGG GCAGTCTGCG GGCAAGCTCC GG - #GGTCTCTG5333- GGTGGAGAGC TGACCCAGGA AGGGCTGCAG CTGAGCTGGG GGTTGAATTT CT - #CCAGGCAC5393- TCCCTGGAGA GAGGACCCAG TGACTTGTCC AAGTTTACAC ACGACACTAA TC - #TCCCCTGG5453- GGAGGAAGCG GGAAGCCAGC CAGGTTGAAC TGTAGCGAGG CCCCCAGGCC GC - #CAGGAATG5513- GACCATGCAG ATCACTGTCA GTGGAGGGAA GCTGCTGACT GTGATTAGGT GC - #TGGGGTCT5573- TAGCGTCCAG CGCAGCCCGG GGGCATCCTG GAGGCTCTGC TCCTTAGGGC AT - #GGTAGTCA5633- CCGCGAAGCC GGGCACCGTC CCACAGCATC TCCTAGAAGC AGCCGGCACA GG - #AGGGAAGG5693- TGGCCAGGCT CGAAGCAGTC TCTGTTTCCA GCACTGCACC CTCAGGAAGT CG - #CCCGCCCC5753- AGGACACGCA GGGACCACCC TAAGGGCTGG GTGGCTGTCT CAAGGACACA TT - #GAATACGT5813- TGTGACCATC CAGAAAATAA ATGCTGAGGG GACACAAAAA AAAAAAAAAA AA - #AAAAAAAA5873# 5894AA A- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1684 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:- Lys Val Leu Val Thr Val Leu Glu Leu Phe Le - #u Pro Leu Leu Phe Ser# 15- Gly Ile Leu Ile Trp Leu Arg Leu Lys Ile Gl - #n Ser Glu Asn Val Pro# 30- Asn Ala Thr Ile Tyr Pro Gly Gln Ser Ile Gl - #n Glu Leu Pro Leu Phe# 45- Phe Thr Phe Pro Pro Pro Gly Asp Thr Trp Gl - #u Leu Ala Tyr Ile Pro# 60- Ser His Ser Asp Ala Ala Lys Ala Val Thr Gl - #u Thr Val Arg Arg Ala# 80- Leu Val Ile Asn Met Arg Val Arg Gly Phe Pr - #o Ser Glu Lys Asp Phe# 95- Glu Asp Tyr Ile Arg Tyr Asp Asn Cys Ser Se - #r Ser Val Leu Ala Ala# 110- Val Val Phe Glu His Pro Phe Asn His Ser Ly - #s Glu Pro Leu Pro Leu# 125- Ala Val Lys Tyr His Leu Arg Phe Ser Tyr Th - #r Arg Arg Asn Tyr Met# 140- Trp Thr Gln Thr Gly Ser Phe Phe Leu Lys Gl - #u Thr Glu Gly Trp His145 1 - #50 1 - #55 1 -#60- Thr Thr Ser Leu Phe Pro Leu Phe Pro Asn Pr - #o Gly Pro Arg Glu Leu# 175- Thr Ser Pro Asp Gly Gly Glu Pro Gly Tyr Il - #e Arg Glu Gly Phe Leu# 190- Ala Val Gln His Ala Val Asp Arg Ala Ile Me - #t Glu Tyr His Ala Asp# 205- Ala Ala Thr Arg Gln Leu Phe Gln Arg Leu Th - #r Val Thr Ile Lys Arg# 220- Phe Pro Tyr Pro Pro Phe Ile Ala Asp Pro Ph - #e Leu Val Ala Ile Gln225 2 - #30 2 - #35 2 -#40- Tyr Gln Leu Pro Leu Leu Leu Leu Leu Ser Ph - #e Thr Tyr Thr Ala Leu# 255- Thr Ile Ala Arg Ala Val Val Gln Glu Lys Gl - #u Arg Arg Leu Lys Glu# 270- Tyr Met Arg Met Met Gly Leu Ser Ser Trp Le - #u His Trp Ser Ala Trp# 285- Phe Leu Leu Phe Phe Leu Phe Leu Leu Ile Al - #a Ala Ser Phe Met Thr# 300- Leu Leu Phe Cys Val Lys Val Lys Pro Asn Va - #l Ala Val Leu Ser Arg305 3 - #10 3 - #15 3 -#20- Ser Asp Pro Ser Leu Val Leu Ala Phe Leu Le - #u Cys Phe Ala Ile Ser# 335- Thr Ile Ser Phe Ser Phe Met Val Ser Thr Ph - #e Phe Ser Lys Ala Asn# 350- Met Ala Ala Ala Phe Gly Gly Phe Leu Tyr Ph - #e Phe Thr Tyr Ile Pro# 365- Tyr Phe Phe Val Ala Pro Arg Tyr Asn Trp Me - #t Thr Leu Ser Gln Lys# 380- Leu Cys Ser Cys Leu Leu Ser Asn Val Ala Me - #t Ala Met Gly Ala Gln385 3 - #90 3 - #95 4 -#00- Leu Ile Gly Lys Phe Glu Ala Lys Gly Met Gl - #y Ile Gln Trp Arg Asp# 415- Leu Leu Ser Pro Val Asn Val Asp Asp Asp Ph - #e Cys Phe Gly Gln Val# 430- Leu Gly Met Leu Leu Leu Asp Ser Val Leu Ty - #r Gly Leu Val Thr Trp# 445- Tyr Met Glu Ala Val Phe Pro Gly Gln Phe Gl - #y Val Pro Gln Pro Trp# 460- Tyr Phe Phe Ile Met Pro Ser Tyr Trp Cys Gl - #y Lys Pro Arg Ala Val465 4 - #70 4 - #75 4 -#80- Ala Gly Lys Glu Glu Glu Asp Ser Asp Pro Gl - #u Lys Ala Leu Arg Asn# 495- Glu Tyr Phe Glu Ala Glu Pro Glu Asp Leu Va - #l Ala Gly Ile Lys Ile# 510- Lys His Leu Ser Lys Val Phe Arg Val Gly As - #n Lys Asp Arg Ala Ala# 525- Val Arg Asp Leu Asn Leu Asn Leu Tyr Glu Gl - #y Gln Ile Thr Val Leu# 540- Leu Gly His Asn Gly Ala Gly Lys Thr Thr Th - #r Leu Ser Met Leu Thr545 5 - #50 5 - #55 5 -#60- Gly Leu Phe Pro Pro Thr Ser Gly Arg Ala Ty - #r Ile Ser Gly Tyr Glu# 575- Ile Ser Gln Asp Met Val Gln Ile Arg Lys Se - #r Leu Gly Leu Cys Pro# 590- Gln His Asp Ile Leu Phe Asp Asn Leu Thr Va - #l Ala Glu His Leu Tyr# 605- Phe Tyr Ala Gln Leu Lys Gly Leu Ser Arg Gl - #n Lys Cys Pro Glu Glu# 620- Val Lys Gln Met Leu His Ile Ile Gly Leu Gl - #u Asp Lys Trp Asn Ser625 6 - #30 6 - #35 6 -#40- Arg Ser Arg Phe Leu Ser Gly Gly Met Arg Ar - #g Lys Leu Ser Ile Gly# 655- Ile Ala Leu Ile Ala Gly Ser Lys Val Leu Il - #e Leu Asp Glu Pro Thr# 670- Ser Gly Met Asp Ala Ile Ser Arg Arg Ala Il - #e Trp Asp Leu Leu Gln# 685- Arg Gln Lys Ser Asp Arg Thr Ile Val Leu Th - #r Thr His Phe Met Asp# 700- Glu Ala Asp Leu Leu Gly Asp Arg Ile Ala Il - #e Met Ala Lys Gly Glu705 7 - #10 7 - #15 7 -#20- Leu Gln Cys Cys Gly Ser Ser Leu Phe Leu Ly - #s Gln Lys Tyr Gly Ala# 735- Gly Tyr His Met Thr Leu Val Lys Glu Pro Hi - #s Cys Asn Pro Glu Asp# 750- Ile Ser Gln Leu Val His His His Val Pro As - #n Ala Thr Leu Glu Ser# 765- Ser Ala Gly Ala Glu Leu Ser Phe Ile Leu Pr - #o Arg Glu Ser Thr His# 780- Arg Phe Glu Gly Leu Phe Ala Lys Leu Glu Ly - #s Lys Gln Lys Glu Leu785 7 - #90 7 - #95 8 -#00- Gly Ile Ala Ser Phe Gly Ala Ser Ile Thr Th - #r Met Glu Glu Val Phe# 815- Leu Arg Val Gly Lys Leu Val Asp Ser Ser Me - #t Asp Ile Gln Ala Ile# 830- Gln Leu Pro Ala Leu Gln Tyr Gln His Glu Ar - #g Arg Ala Ser Asp Trp# 845- Ala Val Asp Ser Asn Leu Cys Gly Ala Met As - #p Pro Ser Asp Gly Ile# 860- Gly Ala Leu Ile Glu Glu Glu Arg Thr Ala Va - #l Lys Leu Asn Thr Gly865 8 - #70 8 - #75 8 -#80- Leu Ala Leu His Cys Gln Gln Phe Trp Ala Me - #t Phe Leu Lys Lys Ala# 895- Ala Tyr Ser Trp Arg Glu Trp Lys Met Val Al - #a Ala Gln Val Leu Val# 910- Pro Leu Thr Cys Val Thr Leu Ala Leu Leu Al - #a Ile Asn Tyr Ser Ser# 925- Glu Leu Phe Asp Asp Pro Met Leu Arg Leu Th - #r Leu Gly Glu Tyr Gly# 940- Arg Thr Val Val Pro Phe Ser Val Pro Gly Th - #r Ser Gln Leu Gly Gln945 9 - #50 9 - #55 9 -#60- Gln Leu Ser Glu His Leu Lys Asp Ala Leu Gl - #n Ala Glu Gly Gln Glu# 975- Pro Arg Glu Val Leu Gly Asp Leu Glu Glu Ph - #e Leu Ile Phe Arg Ala# 990- Ser Val Glu Gly Gly Gly Phe Asn Glu Arg Cy - #s Leu Val Ala Ala Ser# 10050- Phe Arg Asp Val Gly Glu Arg Thr Val Val As - #n Ala Leu Phe Asn Asn# 10205- Gln Ala Tyr His Ser Pro Ala Thr Ala Leu Al - #a Val Val Asp Asn Leu# 10401030 - # 1035- Leu Phe Lys Leu Leu Cys Gly Pro His Ala Se - #r Ile Val Val Ser Asn# 10550- Phe Pro Gln Pro Arg Ser Ala Leu Gln Ala Al - #a Lys Asp Gln Phe Asn# 10705- Glu Gly Arg Lys Gly Phe Asp Ile Ala Leu As - #n Leu Leu Phe Ala Met# 10850- Ala Phe Leu Ala Ser Thr Phe Ser Ile Leu Al - #a Val Ser Glu Arg Ala# 11005- Val Gln Ala Lys His Val Gln Phe Val Ser Gl - #y Val His Val Ala Ser# 11201110 - # 1115- Phe Trp Leu Ser Ala Leu Leu Trp Asp Leu Il - #e Ser Phe Leu Ile Pro# 11350- Ser Leu Leu Leu Leu Val Val Phe Lys Ala Ph - #e Asp Val Arg Ala Phe# 11505- Thr Arg Asp Gly His Met Ala Asp Thr Leu Le - #u Leu Leu Leu Leu Tyr# 11650- Gly Trp Ala Ile Ile Pro Leu Met Tyr Leu Me - #t Asn Phe Phe Phe Leu# 11805- Gly Ala Ala Thr Ala Tyr Thr Arg Leu Thr Il - #e Phe Asn Ile Leu Ser# 12001190 - # 1195- Gly Ile Ala Thr Phe Leu Met Val Thr Ile Me - #t Arg Ile Pro Ala Val# 12150- Lys Leu Glu Glu Leu Ser Lys Thr Leu Asp Hi - #s Val Phe Leu Val Leu# 12305- Pro Asn His Cys Leu Gly Met Ala Val Ser Se - #r Phe Tyr Glu Asn Tyr# 12450- Glu Thr Arg Arg Tyr Cys Thr Ser Ser Glu Va - #l Ala Ala His Tyr Cys# 12605- Lys Lys Tyr Asn Ile Gln Tyr Gln Glu Asn Ph - #e Tyr Ala Trp Ser Ala# 12801270 - # 1275- Pro Gly Val Gly Arg Phe Val Ala Ser Met Al - #a Ala Ser Gly Cys Ala# 12950- Tyr Leu Ile Leu Leu Phe Leu Ile Glu Thr As - #n Leu Leu Gln Arg Leu# 13105- Arg Gly Ile Leu Cys Ala Leu Arg Arg Arg Ar - #g Thr Leu Thr Glu Leu# 13250- Tyr Thr Arg Met Pro Val Leu Pro Glu Asp Gl - #n Asp Val Ala Asp Glu# 13405- Arg Thr Arg Ile Leu Ala Pro Ser Pro Asp Se - #r Leu Leu His Thr Pro# 13601350 - # 1355- Leu Ile Ile Lys Glu Leu Ser Lys Val Tyr Gl - #u Gln Arg Val Pro Leu# 13750- Leu Ala Val Asp Arg Leu Ser Leu Ala Val Gl - #n Lys Gly Glu Cys Phe# 13905- Gly Leu Leu Gly Phe Asn Gly Ala Gly Lys Th - #r Thr Thr Phe Lys Met# 14050- Leu Thr Gly Glu Glu Ser Leu Thr Ser Gly As - #p Ala Phe Val Gly Gly# 14205- His Arg Ile Ser Ser Asp Val Gly Lys Val Ar - #g Gln Arg Ile Gly Tyr# 14401430 - # 1435- Cys Pro Gln Phe Asp Ala Leu Leu Asp His Me - #t Thr Gly Arg Glu Met# 14550- Leu Val Met Tyr Ala Arg Leu Arg Gly Ile Pr - #o Glu Arg His Ile Gly# 14705- Ala Cys Val Glu Asn Thr Leu Arg Gly Leu Le - #u Leu Glu Pro His Ala# 14850- Asn Lys Leu Val Arg Thr Tyr Ser Gly Gly As - #n Lys Arg Lys Leu Ser# 15005- Thr Gly Ile Ala Leu Ile Gly Glu Pro Ala Va - #l Ile Phe Leu Asp Glu# 15201510 - # 1515- Pro Ser Thr Gly Met Asp Pro Val Ala Arg Ar - #g Leu Leu Trp Asp Thr# 15350- Val Ala Arg Ala Arg Glu Ser Gly Lys Ala Il - #e Ile Ile Thr Ser His# 15505- Ser Met Glu Glu Cys Glu Ala Leu Cys Thr Ar - #g Leu Ala Ile Met Val# 15650- Gln Gly Gln Phe Lys Cys Leu Gly Ser Pro Gl - #n His Leu Lys Ser Lys# 15805- Phe Gly Ser Gly Tyr Ser Leu Arg Ala Lys Va - #l Gln Ser Glu Gly Gln# 16001590 - # 1595- Gln Glu Ala Leu Glu Glu Phe Lys Ala Phe Va - #l Asp Leu Thr Phe Pro# 16150- Gly Ser Val Leu Glu Asp Glu His Gln Gly Me - #t Val His Tyr His Leu# 16305- Pro Gly Arg Asp Leu Ser Trp Ala Lys Val Ph - #e Gly Ile Leu Glu Lys# 16450- Ala Lys Glu Lys Tyr Gly Val Asp Asp Tyr Se - #r Val Ser Gln Ile Ser# 16605- Leu Glu Gln Val Phe Leu Ser Phe Ala His Le - #u Gln Pro Pro Thr Ala# 16801670 - # 1675- Glu Glu Gly Arg- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1375 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- Cys Met Glu Glu Glu Pro Thr His Leu Arg Le - #u Gly Val Ser Ile Gln# 15- Asn Leu Val Lys Val Tyr Arg Asp Gly Met Ly - #s Val Ala Val Asp Gly# 30- Leu Ala Leu Asn Phe Tyr Glu Gly Gln Ile Th - #r Ser Phe Leu Gly His# 45- Asn Gly Ala Gly Lys Thr Thr Thr Met Ser Il - #e Leu Thr Gly Leu Phe# 60- Pro Pro Thr Ser Gly Thr Ala Tyr Ile Leu Gl - #y Lys Asp Ile Arg Ser#80- Glu Met Ser Ser Ile Arg Gln Asn Leu Gly Va - #l Cys Pro Gln His Asn# 95- Val Leu Phe Asp Met Leu Thr Val Glu Glu Hi - #s Ile Trp Phe Tyr Ala# 110- Arg Leu Lys Gly Leu Ser Glu Lys His Val Ly - #s Ala Glu Met Glu Gln# 125- Met Ala Leu Asp Val Gly Leu Pro Pro Ser Ly - #s Leu Lys Ser Lys Thr# 140- Ser Gln Leu Ser Gly Gly Met Gln Arg Lys Le - #u Ser Val Ala Leu Ala145 1 - #50 1 - #55 1 -#60- Phe Val Gly Gly Ser Lys Val Val Ile Leu As - #p Glu Pro Thr Ala Gly# 175- Val Asp Pro Tyr Ser Arg Arg Gly Ile Trp Gl - #u Leu Leu Leu Lys Tyr# 190- Arg Gln Gly Arg Thr Ile Ile Leu Ser Thr Hi - #s His Met Asp Glu Ala# 205- Asp Ile Leu Gly Asp Arg Ile Ala Ile Ile Se - #r His Gly Lys Leu Cys# 220- Cys Val Gly Ser Ser Leu Phe Leu Lys Asn Gl - #n Leu Gly Thr Gly Tyr225 2 - #30 2 - #35 2 -#40- Tyr Leu Thr Leu Val Lys Lys Asp Val Glu Se - #r Ser Leu Ser Ser Cys# 255- Arg Asn Ser Ser Ser Thr Val Ser Cys Leu Ly - #s Lys Glu Asp Ser Val# 270- Ser Gln Ser Ser Ser Asp Ala Gly Leu Gly Se - #r Asp His Glu Ser Asp# 285- Thr Leu Thr Ile Asp Val Ser Ala Ile Ser As - #n Leu Ile Arg Lys His# 300- Val Ser Glu Ala Arg Leu Val Glu Asp Ile Gl - #y His Glu Leu Thr Tyr305 3 - #10 3 - #15 3 -#20- Val Leu Pro Tyr Glu Ala Ala Lys Glu Gly Al - #a Phe Val Glu Leu Phe# 335- His Glu Ile Asp Asp Arg Leu Ser Asp Leu Gl - #y Ile Ser Ser Tyr Gly# 350- Ile Ser Glu Thr Thr Leu Glu Glu Ile Phe Le - #u Lys Val Ala Glu Glu# 365- Ser Gly Val Asp Ala Glu Thr Ser Asp Gly Th - #r Leu Pro Ala Arg Arg# 380- Asn Arg Arg Ala Phe Gly Asp Lys Gln Ser Cy - #s Leu His Pro Phe Thr385 3 - #90 3 - #95 4 -#00- Glu Asp Asp Ala Val Asp Pro Asn Asp Ser As - #p Ile Asp Pro Glu Ser# 415- Arg Glu Thr Asp Leu Leu Ser Gly Met Asp Gl - #y Lys Gly Ser Tyr Gln# 430- Leu Lys Gly Trp Lys Leu Thr Gln Gln Gln Ph - #e Val Ala Leu Leu Trp# 445- Lys Arg Leu Leu Ile Ala Arg Arg Ser Arg Ly - #s Gly Phe Phe Ala Gln# 460- Ile Val Leu Pro Ala Val Phe Val Cys Ile Al - #a Leu Val Phe Ser Leu465 4 - #70 4 - #75 4 -#80- Ile Val Pro Pro Phe Gly Lys Tyr Pro Ser Le - #u Glu Leu Gln Pro Trp# 495- Met Tyr Asn Glu Gln Tyr Thr Phe Val Ser As - #n Asp Ala Pro Glu Asp# 510- Met Gly Thr Gln Glu Leu Leu Asn Ala Leu Th - #r Lys Asp Pro Gly Phe# 525- Gly Thr Arg Cys Met Glu Gly Asn Pro Ile Pr - #o Asp Thr Pro Cys Leu# 540- Ala Gly Glu Glu Asp Trp Thr Ile Ser Pro Va - #l Pro Gln Ser Ile Val545 5 - #50 5 - #55 5 -#60- Asp Leu Phe Gln Asn Gly Asn Trp Thr Met Ly - #s Asn Pro Ser Pro Ala# 575- Cys Gln Cys Ser Ser Asp Lys Ile Lys Lys Me - #t Leu Pro Val Cys Pro# 590- Pro Gly Ala Gly Gly Leu Pro Pro Pro Gln Ar - #g Lys Gln Lys Thr Ala# 605- Asp Ile Leu Gln Asn Leu Thr Gly Arg Asn Il - #e Ser Asp Tyr Leu Val# 620- Lys Thr Tyr Val Gln Ile Ile Ala Lys Ser Le - #u Lys Asn Lys Ile Trp625 6 - #30 6 - #35 6 -#40- Val Asn Glu Phe Arg Tyr Gly Gly Phe Ser Le - #u Gly Val Ser Asn Ser# 655- Gln Ala Leu Pro Pro Ser His Glu Val Asn As - #p Ala Ile Lys Gln Met# 670- Lys Lys Leu Leu Lys Leu Thr Lys Asp Thr Se - #r Ala Asp Arg Phe Leu# 685- Ser Ser Leu Gly Arg Phe Met Ala Gly Leu As - #p Thr Lys Asn Asn Val# 700- Lys Val Trp Phe Asn Asn Lys Gly Trp His Al - #a Ile Ser Ser Phe Leu705 7 - #10 7 - #15 7 -#20- Asn Val Ile Asn Asn Ala Ile Leu Arg Ala As - #n Leu Gln Lys Gly Glu# 735- Asn Pro Ser Gln Tyr Gly Ile Thr Ala Phe As - #n His Pro Leu Asn Leu# 750- Thr Lys Gln Gln Leu Ser Glu Val Ala Leu Me - #t Thr Thr Ser Val Asp# 765- Val Leu Val Ser Ile Cys Val Ile Phe Ala Me - #t Ser Phe Val Pro Ala# 780- Ser Phe Val Val Phe Leu Ile Gln Glu Arg Va - #l Ser Lys Ala Lys His785 7 - #90 7 - #95 8 -#00- Leu Gln Phe Ile Ser Gly Val Lys Pro Val Il - #e Tyr Trp Leu Ser Asn# 815- Phe Val Trp Asp Met Cys Asn Tyr Val Val Pr - #o Ala Thr Leu Val Ile# 830- Ile Ile Phe Ile Cys Phe Gln Gln Lys Ser Ty - #r Val Ser Ser Thr Asn# 845- Leu Pro Val Leu Ala Leu Leu Leu Leu Leu Ty - #r Gly Trp Ser Ile Thr# 860- Pro Leu Met Tyr Pro Ala Ser Phe Val Phe Ly - #s Ile Pro Ser Thr Ala865 8 - #70 8 - #75 8 -#80- Tyr Val Val Leu Thr Ser Val Asn Leu Phe Il - #e Gly Ile Asn Gly Ser# 895- Val Ala Thr Phe Val Leu Glu Leu Phe Thr As - #n Asn Lys Leu Asn Asp# 910- Ile Asn Asp Ile Leu Lys Ser Val Phe Leu Il - #e Phe Pro His Phe Cys# 925- Leu Gly Arg Gly Leu Ile Asp Met Val Lys As - #n Gln Ala Met Ala Asp# 940- Ala Leu Glu Arg Phe Gly Glu Asn Arg Phe Va - #l Ser Pro Leu Ser Trp945 9 - #50 9 - #55 9 -#60- Asp Leu Val Gly Arg Asn Leu Phe Ala Met Al - #a Val Glu Gly Val Val# 975- Phe Phe Leu Ile Thr Val Leu Ile Gln Tyr Ar - #g Phe Phe Ile Arg Pro# 990- Arg Pro Val Lys Ala Lys Leu Pro Pro Leu As - #n Asp Glu Asp Glu Asp# 10050- Val Arg Arg Glu Arg Gln Arg Ile Leu Asp Gl - #y Gly Gly Gln Asn Asp# 10205- Ile Leu Glu Ile Lys Glu Leu Thr Lys Ile Ty - #r Arg Arg Lys Arg Lys# 10401030 - # 1035- Pro Ala Val Asp Arg Ile Cys Ile Gly Ile Pr - #o Pro Gly Glu Cys Phe# 10550- Gly Leu Leu Gly Val Asn Gly Ala Gly Lys Se - #r Thr Thr Phe Lys Met# 10705- Leu Thr Gly Asp Thr Pro Val Thr Arg Gly As - #p Ala Phe Leu Asn Lys# 10850- Asn Ser Ile Leu Ser Asn Ile His Glu Val Hi - #s Gln Asn Met Gly Tyr# 11005- Cys Pro Gln Phe Asp Ala Ile Thr Glu Leu Le - #u Thr Gly Arg Glu His# 11201110 - # 1115- Val Glu Phe Phe Ala Leu Leu Arg Gly Val Pr - #o Glu Lys Glu Val Gly# 11350- Lys Phe Gly Glu Trp Ala Ile Arg Lys Leu Gl - #y Leu Val Lys Tyr Gly# 11505- Glu Lys Tyr Ala Ser Asn Tyr Ser Gly Gly As - #n Lys Arg Lys Leu Ser# 11650- Thr Ala Met Ala Leu Ile Gly Gly Pro Pro Va - #l Val Phe Leu Asp Glu# 11805- Pro Thr Thr Gly Met Asp Pro Lys Ala Arg Ar - #g Phe Leu Trp Asn Cys# 12001190 - # 1195- Ala Leu Ser Ile Val Lys Glu Gly Arg Ser Va - #l Val Leu Thr Ser His# 12150- Ser Met Glu Glu Cys Glu Ala Leu Cys Thr Ar - #g Met Ala Ile Met Val# 12305- Asn Gly Arg Phe Arg Cys Leu Gly Ser Val Gl - #n His Leu Lys Asn Arg# 12450- Phe Gly Asp Gly Tyr Thr Ile Val Val Arg Il - #e Ala Gly Ser Asn Pro# 12605- Asp Leu Lys Pro Val Gln Glu Phe Phe Gly Le - #u Ala Phe Pro Gly Ser# 12801270 - # 1275- Val Leu Lys Glu Lys His Arg Asn Met Leu Gl - #n Tyr Gln Leu Pro Ser# 12950- Ser Leu Ser Ser Leu Ala Arg Ile Phe Ser Il - #e Leu Ser Gln Ser Lys# 13105- Lys Arg Leu His Ile Glu Asp Tyr Ser Val Se - #r Gln Thr Thr Leu Asp# 13250- Gln Val Phe Val Asn Phe Ala Lys Asp Gln Se - #r Asp Asp Asp His Leu# 13405- Lys Asp Leu Ser Leu His Lys Asn Gln Thr Va - #l Val Asp Val Ala Val# 13601350 - # 1355- Leu Thr Ser Phe Leu Gln Asp Glu Lys Val Ly - #s Glu Ser Tyr Val# 13750- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1457 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:- Met Glu Glu Glu Pro Thr His Leu Pro Leu Va - #l Val Cys Val Asp Lys# 15- Leu Thr Lys Val Tyr Lys Asn Asp Lys Lys Le - #u Ala Leu Asn Lys Leu# 30- Ser Leu Asn Leu Tyr Glu Asn Gln Val Val Se - #r Phe Leu Gly His Asn# 45- Gly Ala Gly Lys Thr Thr Thr Met Ser Ile Le - #u Thr Gly Leu Phe Pro# 60- Pro Thr Ser Gly Ser Ala Thr Ile Tyr Gly Hi - #s Asp Ile Arg Thr Glu#80- Met Asp Glu Ile Arg Lys Asn Leu Gly Met Cy - #s Pro Gln His Asn Val# 95- Leu Phe Asp Arg Leu Thr Val Glu Glu His Le - #u Trp Phe Tyr Ser Arg# 110- Leu Lys Ser Met Ala Gln Glu Glu Ile Arg Ly - #s Glu Thr Asp Lys Met# 125- Ile Glu Asp Leu Glu Leu Ser Asn Lys Arg Hi - #s Ser Leu Val Gln Thr# 140- Leu Ser Gly Gly Met Lys Arg Lys Leu Ser Va - #l Ala Ile Ala Phe Val145 1 - #50 1 - #55 1 -#60- Gly Gly Ser Arg Ala Ile Ile Leu Asp Glu Pr - #o Thr Ala Gly Val Asp# 175- Pro Tyr Ala Arg Arg Ala Ile Trp Asp Leu Il - #e Leu Lys Tyr Lys Pro# 190- Gly Arg Thr Ile Leu Leu Ser Thr His His Me - #t Asp Glu Ala Asp Leu# 205- Leu Gly Asp Arg Ile Ala Ile Ile Ser His Gl - #y Lys Leu Lys Cys Cys# 220- Gly Ser Pro Leu Phe Leu Lys Gly Ala Tyr Xa - #a Asp Gly Tyr Arg Leu225 2 - #30 2 - #35 2 -#40- Thr Leu Val Lys Gln Pro Ala Glu Pro Gly Th - #r Ser Gln Glu Pro Gly# 255- Leu Ala Ser Ser Pro Ser Gly Cys Pro Arg Le - #u Ser Ser Cys Ser Glu# 270- Pro Gln Val Ser Gln Phe Ile Arg Lys His Va - #l Ala Ser Ser Leu Leu# 285- Val Ser Asp Thr Ser Thr Glu Leu Ser Tyr Il - #e Leu Pro Ser Glu Ala# 300- Val Lys Lys Gly Ala Phe Glu Arg Leu Phe Gl - #n Gln Leu Glu His Ser305 3 - #10 3 - #15 3 -#20- Leu Asp Ala Leu His Leu Ser Ser Phe Gly Le - #u Met Asp Thr Thr Leu# 335- Glu Glu Val Phe Leu Lys Val Ser Glu Glu As - #p Gln Ser Leu Glu Asn# 350- Ser Glu Ala Asp Val Lys Glu Ser Arg Lys As - #p Val Leu Pro Gly Ala# 365- Glu Gly Leu Thr Ala Val Gly Gly Gln Ala Gl - #y Asn Leu Ala Arg Cys# 380- Ser Glu Leu Ala Gln Ser Gln Ala Ser Leu Gl - #n Ser Ala Ser Ser Val385 3 - #90 3 - #95 4 -#00- Gly Ser Ala Arg Gly Glu Glu Gly Thr Gly Ty - #r Ser Asp Gly Tyr Gly# 415- Asp Tyr Arg Pro Leu Phe Asp Asn Leu Gln As - #p Pro Asp Asn Val Ser# 430- Leu Gln Glu Ala Glu Met Glu Ala Leu Ala Gl - #n Val Gly Gln Gly Ser# 445- Arg Lys Leu Glu Gly Trp Trp Leu Lys Met Ar - #g Gln Phe His Gly Leu# 460- Leu Val Lys Arg Phe His Cys Ala Arg Arg As - #n Ser Lys Ala Leu Cys465 4 - #70 4 - #75 4 -#80- Ser Gln Ile Leu Leu Pro Ala Phe Phe Val Cy - #s Val Ala Met Thr Val# 495- Ala Leu Ser Val Pro Glu Ile Gly Asp Leu Pr - #o Pro Leu Val Leu Ser# 510- Pro Ser Gln Tyr His Asn Tyr Thr Gln Pro Ar - #g Gly Asn Phe Ile Pro# 525- Tyr Ala Asn Glu Glu Arg Gln Glu Tyr Arg Le - #u Arg Leu Ser Pro Asp# 540- Ala Ser Pro Gln Gln Leu Val Ser Thr Phe Ar - #g Leu Pro Ser Gly Val545 5 - #50 5 - #55 5 -#60- Gly Ala Thr Cys Val Leu Lys Ser Pro Ala As - #n Gly Ser Leu Gly Pro# 575- Met Leu Asn Leu Ser Ser Gly Glu Ser Arg Le - #u Leu Ala Ala Arg Phe# 590- Phe Asp Ser Met Cys Leu Glu Ser Phe Thr Gl - #n Gly Leu Pro Leu Ser# 605- Asn Phe Val Pro Pro Pro Pro Ser Pro Ala Pr - #o Ser Asp Ser Pro Val# 620- Xaa Pro Asp Glu Asp Ser Leu Gln Ala Trp As - #n Met Ser Leu Pro Pro625 6 - #30 6 - #35 6 -#40- Thr Ala Gly Pro Glu Thr Trp Thr Ser Ala Pr - #o Ser Leu Pro Arg Leu# 655- Val His Glu Pro Val Arg Cys Thr Cys Ser Al - #a Gln Gly Thr Gly Phe# 670- Ser Cys Pro Ser Ser Val Gly Gly His Pro Pr - #o Gln Met Arg Val Val# 685- Thr Gly Asp Ile Leu Thr Asp Ile Thr Gly Hi - #s Asn Val Ser Glu Tyr# 700- Leu Leu Phe Thr Ser Asp Arg Phe Arg Leu Hi - #s Arg Tyr Gly Ala Ile705 7 - #10 7 - #15 7 -#20- Thr Phe Gly Asn Val Gln Lys Ser Ile Pro Al - #a Ser Phe Gly Ala Arg# 735- Val Pro Pro Met Val Arg Lys Ile Ala Val Ar - #g Arg Val Ala Gln Val# 750- Leu Tyr Asn Asn Lys Gly Tyr His Ser Met Pr - #o Thr Tyr Leu Asn Ser# 765- Leu Asn Asn Ala Ile Leu Arg Ala Asn Leu Pr - #o Lys Ser Lys Gly Asn# 780- Pro Ala Ala Tyr Xaa Ile Thr Val Thr Asn Hi - #s Pro Met Asn Lys Thr785 7 - #90 7 - #95 8 -#00- Ser Ala Ser Leu Ser Leu Asp Tyr Leu Leu Gl - #n Gly Thr Asp Val Val# 815- Ile Ala Ile Phe Ile Ile Val Ala Met Ser Ph - #e Val Pro Ala Ser Phe# 830- Val Val Phe Leu Val Ala Glu Lys Ser Thr Ly - #s Ala Lys His Leu Gln# 845- Phe Val Ser Gly Cys Asn Pro Val Ile Tyr Tr - #p Leu Ala Asn Tyr Val# 860- Trp Asp Met Leu Asn Tyr Leu Val Pro Ala Th - #r Cys Cys Val Ile Ile865 8 - #70 8 - #75 8 -#80- Leu Phe Val Phe Asp Leu Pro Ala Tyr Thr Se - #r Pro Thr Asn Phe Pro# 895- Ala Val Leu Ser Leu Phe Leu Leu Tyr Gly Tr - #p Ser Ile Thr Pro Ile# 910- Met Tyr Pro Ala Ser Phe Trp Phe Glu Val Pr - #o Ser Ser Ala Tyr Val# 925- Phe Leu Ile Val Ile Asn Leu Phe Ile Gly Il - #e Thr Ala Thr Val Ala# 940- Thr Phe Leu Leu Gln Leu Phe Glu His Asp Ly - #s Asp Leu Lys Val Val945 9 - #50 9 - #55 9 -#60- Asn Ser Tyr Leu Lys Ser Cys Phe Leu Ile Ph - #e Pro Asn Tyr Asn Leu# 975- Gly His Gly Leu Met Glu Met Ala Tyr Asn Gl - #u Tyr Ile Asn Glu Tyr# 990- Tyr Ala Lys Ile Gly Gln Phe Asp Lys Met Ly - #s Ser Pro Phe Glu Trp# 10050- Asp Ile Val Thr Arg Gly Leu Val Ala Met Th - #r Val Glu Gly Phe Val# 10205- Gly Phe Phe Leu Thr Ile Met Cys Gln Tyr As - #n Phe Leu Arg Gln Pro# 10401030 - # 1035- Gln Arg Leu Pro Val Ser Thr Lys Pro Val Gl - #u Asp Asp Val Asp Val# 10550- Ala Ser Glu Arg Gln Arg Val Leu Arg Gly As - #p Ala Asp Asn Asp Met# 10705- Val Lys Ile Glu Asn Leu Thr Lys Val Tyr Ly - #s Ser Arg Lys Ile Gly# 10850- Arg Ile Leu Ala Val Asp Arg Leu Cys Leu Gl - #y Val Cys Val Pro Gly# 11005- Glu Cys Phe Gly Leu Leu Gly Val Asn Gly Al - #a Gly Lys Thr Ser Thr# 11201110 - # 1115- Phe Lys Met Leu Thr Gly Asp Glu Ser Thr Th - #r Gly Gly Glu Ala Phe# 11350- Val Asn Gly His Ser Val Leu Lys Asp Leu Le - #u Gln Val Gln Gln Ser# 11505- Leu Gly Tyr Cys Pro Gln Phe Asp Val Pro Va - #l Asp Glu Leu Thr Ala# 11650- Arg Glu His Leu Gln Leu Tyr Thr Arg Leu Ar - #g Cys Ile Pro Trp Lys# 11805- Asp Glu Ala Gln Val Val Lys Trp Ala Leu Gl - #u Lys Leu Glu Leu Thr# 12001190 - # 1195- Lys Tyr Ala Asp Lys Pro Ala Gly Thr Tyr Se - #r Gly Gly Asn Lys Arg# 12150- Lys Leu Ser Thr Ala Ile Ala Leu Ile Gly Ty - #r Pro Ala Phe Ile Phe# 12305- Leu Asp Glu Pro Thr Thr Gly Met Asp Pro Ly - #s Ala Arg Arg Phe Leu# 12450- Trp Asn Leu Ile Leu Asp Leu Ile Lys Thr Gl - #y Arg Ser Val Val Leu# 12605- Thr Ser His Ser Met Glu Glu Cys Glu Ala Le - #u Cys Thr Arg Leu Ala# 12801270 - # 1275- Ile Met Val Asn Gly Arg Leu His Cys Leu Gl - #y Ser Ile Gln His Leu# 12950- Lys Asn Arg Phe Gly Asp Gly Tyr Met Ile Th - #r Val Arg Thr Lys Ser# 13105- Ser Gln Asn Val Lys Asp Val Val Arg Phe Ph - #e Asn Arg Asn Phe Pro# 13250- Glu Ala His Ala Gln Gly Lys Thr Pro Tyr Ly - #s Val Gln Tyr Gln Leu# 13405- Lys Ser Glu His Ile Ser Leu Ala Gln Val Ph - #e Ser Lys Met Glu Gln# 13601350 - # 1355- Val Val Gly Val Leu Gly Ile Glu Asp Tyr Se - #r Val Ser Gln Thr Thr# 13750- Leu Asp Asn Val Phe Val Asn Phe Ala Lys Ly - #s Gln Ser Asp Asn Val# 13905- Glu Gln Gln Glu Ala Glu Pro Ser Ser Leu Pr - #o Ser Pro Leu Gly Leu# 14050- Leu Ser Leu Leu Arg Pro Arg Pro Ala Pro Th - #r Glu Leu Arg Ala Leu# 14205- Val Ala Asp Glu Pro Glu Asp Leu Asp Thr Gl - #u Asp Glu Gly Leu Ile# 14401430 - # 1435- Ser Phe Glu Glu Glu Arg Ala Gln Leu Ser Ph - #e Asn Thr Asp Thr Leu# 14550- Cys- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1548 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 49..1271- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:#TCC CAC 57GAGGCCC CTTCCTGTAC CTTCAGGGAT CGGCCACC ATG# Met - # Ser His# 1- CGG AAG TTT TCC GCC CCT CGG CAC GGA CAC CT - #G GGC TTC CTG CCC CAT 105Arg Lys Phe Ser Ala Pro Arg His Gly His Le - #u Gly Phe Leu Pro His# 15- AAG AGG AGC CAC CGG CAC CGG GGC AAG GTG AA - #G ACG TGG CCG CGG GAT 153Lys Arg Ser His Arg His Arg Gly Lys Val Ly - #s Thr Trp Pro Arg Asp# 35- GAC CCC AGC CAG CCC GTG CAC CTC ACG GCC TT - #C CTG GGC TAC AAG GCG 201Asp Pro Ser Gln Pro Val His Leu Thr Ala Ph - #e Leu Gly Tyr Lys Ala# 50- GGC ATG ACC CAC ACC CTG CGG GAG GTG CAC CG - #G CCG GGG CTC AAA ATT 249Gly Met Thr His Thr Leu Arg Glu Val His Ar - #g Pro Gly Leu Lys Ile# 65- TCC AAA CGG GAG GAG GTG GAG GCG GTG ACA AT - #T GTA GAA ACG CCG CCC 297Ser Lys Arg Glu Glu Val Glu Ala Val Thr Il - #e Val Glu Thr Pro Pro# 80- CTA GTG GTG GTG GGC GTG GTG GGC TAC GTG GC - #C ACC CCT CGA GGT CTC 345Leu Val Val Val Gly Val Val Gly Tyr Val Al - #a Thr Pro Arg Gly Leu# 95- CGG AGC TTC AAG ACC ATC TTT GCA GAA CAC CT - #C AGT GAT GAG TGC CGG 393Arg Ser Phe Lys Thr Ile Phe Ala Glu His Le - #u Ser Asp Glu Cys Arg100 1 - #05 1 - #10 1 -#15- CGC CGA TTC TAC AAG GAC TGG CAC AAG AGC AA - #G AAG AAA GCC TTC ACC 441Arg Arg Phe Tyr Lys Asp Trp His Lys Ser Ly - #s Lys Lys Ala Phe Thr# 130- AAG GCC TGC AAG AGG TGG CGG GAC ACA GAC GG - #G AAA AAG CAG CTA CAG 489Lys Ala Cys Lys Arg Trp Arg Asp Thr Asp Gl - #y Lys Lys Gln Leu Gln# 145- AAG GAC TTC GCC GCC ATG AAG AAG TAC TGC AA - #G GTC ATT CGG GTC ATT 537Lys Asp Phe Ala Ala Met Lys Lys Tyr Cys Ly - #s Val Ile Arg Val Ile# 160- GTC CAC ACT CAG ATG AAA CTG CTG CCC TTC CG - #G CAG AAG AAG GCC CAC 585Val His Thr Gln Met Lys Leu Leu Pro Phe Ar - #g Gln Lys Lys Ala His# 175- ATC ATG GAG ATC CAG CTG AAC GGT GGC ACG GT - #G GCC GAG AAG GTG GCC 633Ile Met Glu Ile Gln Leu Asn Gly Gly Thr Va - #l Ala Glu Lys Val Ala180 1 - #85 1 - #90 1 -#95- TGG GCC CAG GCC CGG CTG GAG AAG CAG GTG CC - #C GTG CAC AGC GTG TTC 681Trp Ala Gln Ala Arg Leu Glu Lys Gln Val Pr - #o Val His Ser Val Phe# 210- AGC CAG AGT GAG GTC ATT GAT GTC ATT GCT GT - #C ACC AAG GGT CGA GGC 729Ser Gln Ser Glu Val Ile Asp Val Ile Ala Va - #l Thr Lys Gly Arg Gly# 225- GTC AAA GGG GTC ACA AGC CGC TGG CAT ACC AA - #G AAG CTG CCG CGC AAG 777Val Lys Gly Val Thr Ser Arg Trp His Thr Ly - #s Lys Leu Pro Arg Lys# 240- ACC CAT AAG GGC CTG CGC AAG GTG GCC TGC AT - #T GGC GCC TGG CAC CCC 825Thr His Lys Gly Leu Arg Lys Val Ala Cys Il - #e Gly Ala Trp His Pro# 255- GCC CGC GTG GGC TGC TCC ATT GCT CGG GCC GG - #G CAG AAG GGC TAT CAC 873Ala Arg Val Gly Cys Ser Ile Ala Arg Ala Gl - #y Gln Lys Gly Tyr His260 2 - #65 2 - #70 2 -#75- CAC CGC ACG GAG CTC AAC AAG AAG ATC TTC CG - #C ATC GGC AGG GGC CCG 921His Arg Thr Glu Leu Asn Lys Lys Ile Phe Ar - #g Ile Gly Arg Gly Pro# 290- CAC ATG GAG GAC GGG AAG CTG GTG AAG AAC AA - #T GCA TCC ACC AGC TAC 969His Met Glu Asp Gly Lys Leu Val Lys Asn As - #n Ala Ser Thr Ser Tyr# 305- GAC GTG ACT GCC AAG TCC ATC ACA CCG CTG GG - #T GGC TTC CCC CAC TAC1017Asp Val Thr Ala Lys Ser Ile Thr Pro Leu Gl - #y Gly Phe Pro His Tyr# 320- GGG GAA GTG AAC AAC GAC TTC GTC ATG CTG AA - #G GGT TGT ATT GCT GGT1065Gly Glu Val Asn Asn Asp Phe Val Met Leu Ly - #s Gly Cys Ile Ala Gly# 335- ACC AAG AAG CGG GTC ATT ACG CTG AGA AAG TC - #C CTC CTG GTG CAT CAC1113Thr Lys Lys Arg Val Ile Thr Leu Arg Lys Se - #r Leu Leu Val His His340 3 - #45 3 - #50 3 -#55- AGT CGC CAA GCC GTG GAG AAT ATT GAG CTC AA - #G TTC ATT GAC ACC ACC1161Ser Arg Gln Ala Val Glu Asn Ile Glu Leu Ly - #s Phe Ile Asp Thr Thr# 370- TCC AAG TTC GGC CAT GGC CGC TTC CAG ACA GC - #C CAA GAG AAG AGG GCC1209Ser Lys Phe Gly His Gly Arg Phe Gln Thr Al - #a Gln Glu Lys Arg Ala# 385- TTC ATG GGC CCC CAA AAG AAG CAT CTG GAG AA - #G GAA ACG CCG GAG ACC1257Phe Met Gly Pro Gln Lys Lys His Leu Glu Ly - #s Glu Thr Pro Glu Thr# 400- TCG GGA GAC TTG TA GGCTGTGTGG GGTGGATGAA CCCTGAAGCG - # CACCGCACTG1311Ser Gly Asp Leu 405- TCTGCCCCAA TGTCTAACAA AGGCCGGAGG CGACTCTTCC TGCGAGGTCT CA - #GAGCGCTG1371- TGTAACCGCC CAAGGGGTTC ACCTTGCCTG CTGCCTAGAC AAAGCCGATT CA - #TTAAGACA1431- GGGGAATTGC AATAGAGAAA GAGTAATTCA CACAGAGCTG GCTGTGCGGG AG - #ACCGGAGT1491- TTTATGTTTT ATTATTACTC AAATCGATCT CTTTGAGCAA AAAAAAAAAA AA - #AAAAA1548- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 407 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:- Met Ser His Arg Lys Phe Ser Ala Pro Arg Hi - #s Gly His Leu Gly Phe# 15- Leu Pro His Lys Arg Ser His Arg His Arg Gl - #y Lys Val Lys Thr Trp# 30- Pro Arg Asp Asp Pro Ser Gln Pro Val His Le - #u Thr Ala Phe Leu Gly# 45- Tyr Lys Ala Gly Met Thr His Thr Leu Arg Gl - #u Val His Arg Pro Gly# 60- Leu Lys Ile Ser Lys Arg Glu Glu Val Glu Al - #a Val Thr Ile Val Glu# 80- Thr Pro Pro Leu Val Val Val Gly Val Val Gl - #y Tyr Val Ala Thr Pro# 95- Arg Gly Leu Arg Ser Phe Lys Thr Ile Phe Al - #a Glu His Leu Ser Asp# 110- Glu Cys Arg Arg Arg Phe Tyr Lys Asp Trp Hi - #s Lys Ser Lys Lys Lys# 125- Ala Phe Thr Lys Ala Cys Lys Arg Trp Arg As - #p Thr Asp Gly Lys Lys# 140- Gln Leu Gln Lys Asp Phe Ala Ala Met Lys Ly - #s Tyr Cys Lys Val Ile145 1 - #50 1 - #55 1 -#60- Arg Val Ile Val His Thr Gln Met Lys Leu Le - #u Pro Phe Arg Gln Lys# 175- Lys Ala His Ile Met Glu Ile Gln Leu Asn Gl - #y Gly Thr Val Ala Glu# 190- Lys Val Ala Trp Ala Gln Ala Arg Leu Glu Ly - #s Gln Val Pro Val His# 205- Ser Val Phe Ser Gln Ser Glu Val Ile Asp Va - #l Ile Ala Val Thr Lys# 220- Gly Arg Gly Val Lys Gly Val Thr Ser Arg Tr - #p His Thr Lys Lys Leu225 2 - #30 2 - #35 2 -#40- Pro Arg Lys Thr His Lys Gly Leu Arg Lys Va - #l Ala Cys Ile Gly Ala# 255- Trp His Pro Ala Arg Val Gly Cys Ser Ile Al - #a Arg Ala Gly Gln Lys# 270- Gly Tyr His His Arg Thr Glu Leu Asn Lys Ly - #s Ile Phe Arg Ile Gly# 285- Arg Gly Pro His Met Glu Asp Gly Lys Leu Va - #l Lys Asn Asn Ala Ser# 300- Thr Ser Tyr Asp Val Thr Ala Lys Ser Ile Th - #r Pro Leu Gly Gly Phe305 3 - #10 3 - #15 3 -#20- Pro His Tyr Gly Glu Val Asn Asn Asp Phe Va - #l Met Leu Lys Gly Cys# 335- Ile Ala Gly Thr Lys Lys Arg Val Ile Thr Le - #u Arg Lys Ser Leu Leu# 350- Val His His Ser Arg Gln Ala Val Glu Asn Il - #e Glu Leu Lys Phe Ile# 365- Asp Thr Thr Ser Lys Phe Gly His Gly Arg Ph - #e Gln Thr Ala Gln Glu# 380- Lys Arg Ala Phe Met Gly Pro Gln Lys Lys Hi - #s Leu Glu Lys Glu Thr385 3 - #90 3 - #95 4 -#00- Pro Glu Thr Ser Gly Asp Leu 405- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 403 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:- Met Ser His Arg Lys Phe Ser Ala Pro Arg Hi - #s Gly Ser Leu Gly Phe# 15- Leu Pro Arg Lys Arg Ser Ser Arg His Arg Gl - #y Lys Val Lys Ser Phe# 30- Pro Lys Asp Asp Pro Ser Lys Pro Val His Le - #u Thr Ala Phe Leu Gly# 45- Tyr Lys Ala Gly Met Thr His Ile Val Arg Gl - #u Val Asp Arg Pro Gly# 60- Ser Lys Val Asn Lys Lys Glu Val Val Glu Al - #a Val Thr Ile Val Glu#80- Thr Pro Pro Met Val Val Val Gly Ile Val Gl - #y Tyr Val Glu Thr Pro# 95- Arg Gly Leu Arg Thr Phe Lys Thr Val Phe Al - #a Glu His Ile Ser Asp# 110- Glu Cys Lys Arg Arg Phe Tyr Lys Asn Trp Hi - #s Lys Ser Lys Lys Lys# 125- Ala Phe Thr Lys Tyr Cys Lys Lys Trp Gln As - #p Glu Asp Gly Lys Lys# 140- Gln Leu Glu Lys Asp Phe Ser Ser Met Lys Ly - #s Tyr Cys Gln Val Ile145 1 - #50 1 - #55 1 -#60- Arg Val Ile Ala His Thr Gln Met Arg Leu Le - #u Pro Leu Arg Gln Lys# 175- Lys Ala His Leu Met Glu Ile Gln Val Asn Gl - #y Gly Thr Val Ala Glu# 190- Lys Leu Asp Trp Ala Arg Glu Arg Leu Glu Gl - #n Gln Val Pro Val Asn# 205- Gln Val Phe Gly Gln Asp Glu Met Ile Asp Va - #l Ile Gly Val Thr Lys# 220- Gly Lys Gly Tyr Lys Gly Val Thr Ser Arg Tr - #p His Thr Lys Lys Leu225 2 - #30 2 - #35 2 -#40- Pro Arg Lys Thr His Arg Gly Leu Arg Lys Va - #l Ala Cys Ile Gly Ala# 255- Trp His Pro Ala Arg Val Ala Phe Ser Val Al - #a Arg Ala Gly Gln Lys# 270- Gly Tyr His His Arg Thr Glu Ile Asn Lys Ly - #s Ile Tyr Lys Ile Gly# 285- Gln Gly Tyr Leu Ile Lys Asp Gly Lys Leu Il - #e Lys Asn Asn Ala Ser# 300- Thr Asp Tyr Asp Leu Ser Asp Lys Ser Ile As - #n Pro Leu Gly Gly Phe305 3 - #10 3 - #15 3 -#20- Val His Tyr Gly Glu Val Thr Asn Asp Phe Va - #l Met Leu Lys Gly Cys# 335- Val Val Gly Thr Lys Lys Arg Val Leu Thr Le - #u Arg Lys Ser Leu Leu# 350- Val Gln Thr Lys Arg Arg Ala Leu Glu Lys Il - #e Asp Leu Lys Phe Ile# 365- Asp Thr Thr Ser Lys Phe Gly His Gly Arg Ph - #e Gln Thr Met Glu Glu# 380- Lys Lys Ala Phe Met Gly Pro Leu Lys Lys As - #p Arg Ile Ala Lys Glu385 3 - #90 3 - #95 4 -#00- Glu Gly Ala- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 403 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:- Met Ser His Arg Lys Phe Ser Ala Pro Arg Hi - #s Gly Ser Leu Gly Phe# 15- Leu Pro Arg Lys Arg Ser Ser Arg His Arg Gl - #y Lys Val Lys Ser Phe# 30- Pro Lys Asp Asp Ser Ser Lys Pro Val His Le - #u Thr Ala Phe Leu Gly# 45- Tyr Lys Ala Gly Met Thr His Ile Val Arg Gl - #u Val Asp Arg Pro Gly# 60- Ser Lys Val Asn Lys Lys Glu Val Val Glu Al - #a Val Thr Ile Val Glu#80- Thr Pro Pro Met Val Ile Val Gly Ile Val Gl - #y Tyr Val Glu Thr Pro# 95- Arg Gly Leu Arg Thr Phe Lys Thr Ile Phe Al - #a Glu His Ile Ser Asp# 110- Glu Cys Lys Arg Arg Phe Tyr Lys Asn Trp Hi - #s Lys Ser Lys Lys Lys# 125- Ala Phe Thr Lys Tyr Cys Lys Lys Trp Gln As - #p Ala Asp Gly Lys Lys# 140- Gln Leu Glu Arg Asp Phe Ser Ser Met Lys Ly - #s Tyr Cys Gln Val Ile145 1 - #50 1 - #55 1 -#60- Arg Val Ile Ala His Thr Gln Met Arg Leu Le - #u Pro Leu Arg Gln Lys# 175- Lys Ala His Leu Met Glu Val Gln Val Asn Gl - #y Gly Thr Val Ala Glu# 190- Lys Leu Asp Trp Ala Arg Glu Arg Leu Glu Gl - #n Gln Val Pro Val Asn# 205- Gln Val Phe Gly Gln Asp Glu Met Ile Asp Va - #l Ile Gly Val Thr Lys# 220- Gly Lys Gly Tyr Lys Gly Val Thr Ser Arg Tr - #p His Thr Lys Lys Leu225 2 - #30 2 - #35 2 -#40- Pro Arg Lys Thr His Arg Gly Leu Arg Lys Va - #l Ala Cys Ile Gly Ala# 255- Trp His Pro Ala Arg Val Ala Phe Ser Val Al - #a Arg Ala Gly Gln Lys# 270- Gly Tyr His His Arg Thr Glu Ile Asn Lys Ly - #s Ile Tyr Lys Ile Gly# 285- Gln Gly Tyr Leu Ile Lys Asp Gly Lys Leu Il - #e Lys Asn Asn Ala Ser# 300- Thr Asp Tyr Asp Leu Ser Asp Lys Ser Ile As - #n Pro Leu Gly Gly Phe305 3 - #10 3 - #15 3 -#20- Val His Tyr Gly Glu Val Thr Asn Asp Phe Va - #l Met Leu Lys Gly Cys# 335- Val Val Gly Thr Lys Lys Arg Val Leu Thr Le - #u Arg Lys Ser Leu Leu# 350- Val Gln Thr Lys Arg Arg Ala Leu Glu Lys Il - #e Asp Leu Lys Phe Ile# 365- Asp Thr Thr Ser Lys Phe Gly His Gly Arg Ph - #e Gln Thr Val Glu Glu# 380- Lys Lys Ala Phe Met Gly Pro Leu Lys Lys As - #p Arg Ile Ala Lys Glu385 3 - #90 3 - #95 4 -#00- Glu Gly Ala- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 403 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:- Met Ser His Arg Lys Phe Ser Ala Pro Arg Hi - #s Gly Ser Leu Gly Phe# 15- Leu Pro Arg Lys Arg Ser Ser Arg His Arg Gl - #y Lys Val Lys Ser Phe# 30- Pro Lys Asp Asp Ala Ser Lys Pro Val His Le - #u Thr Ala Phe Leu Gly# 45- Tyr Lys Ala Gly Met Thr His Ile Val Arg Gl - #u Val Asp Arg Pro Gly# 60- Ser Lys Val Asn Lys Lys Glu Val Val Glu Al - #a Val Thr Ile Val Glu#80- Thr Pro Pro Met Val Val Val Gly Ile Val Gl - #y Tyr Val Glu Thr Pro# 95- Arg Gly Leu Arg Thr Phe Lys Thr Val Phe Al - #a Glu His Ile Ser Asp# 110- Glu Cys Lys Arg Arg Phe Tyr Lys Asn Trp Hi - #s Lys Ser Lys Lys Lys# 125- Ala Phe Thr Lys Tyr Cys Lys Lys Trp Gln As - #p Asp Thr Gly Lys Lys# 140- Gln Leu Glu Lys Asp Phe Asn Ser Met Lys Ly - #s Tyr Cys Gln Val Ile145 1 - #50 1 - #55 1 -#60- Arg Ile Ile Ala His Thr Gln Met Arg Leu Le - #u Pro Leu Arg Gln Lys# 175- Lys Ala His Leu Met Glu Ile Gln Val Asn Gl - #y Gly Thr Val Ala Glu# 190- Lys Leu Asp Trp Ala Arg Glu Arg Leu Glu Gl - #n Gln Val Pro Val Ser# 205- Gln Val Phe Gly Gln Asp Glu Met Ile Asp Va - #l Ile Gly Val Thr Lys# 220- Gly Lys Gly Tyr Lys Gly Val Thr Ser Arg Tr - #p His Thr Lys Lys Leu225 2 - #30 2 - #35 2 -#40- Pro Arg Lys Thr His Arg Gly Leu Arg Lys Va - #l Ala Cys Ile Gly Ala# 255- Trp His Pro Ala Arg Val Ala Phe Thr Val Al - #a Arg Ala Gly Gln Lys# 270- Gly Tyr His His Arg Thr Glu Ile Asn Lys Ly - #s Ile Tyr Lys Ile Gly# 285- Gln Gly Tyr Leu Ile Lys Asp Gly Lys Leu Il - #e Lys Asn Asn Ala Ser# 300- Thr Asp Tyr Asp Leu Ser Asp Lys Ser Ile As - #n Pro Leu Gly Gly Phe305 3 - #10 3 - #15 3 -#20- Val His Tyr Gly Glu Val Thr Asn Asp Phe Il - #e Met Leu Lys Gly Cys# 335- Val Val Gly Thr Lys Lys Arg Val Leu Thr Le - #u Arg Lys Ser Leu Leu# 350- Val Gln Thr Lys Arg Arg Ala Leu Glu Lys Il - #e Asp Leu Lys Phe Ile# 365- Asp Thr Thr Ser Lys Phe Gly His Gly Arg Ph - #e Gln Thr Met Glu Glu# 380- Lys Lys Ala Phe Met Gly Pro Leu Lys Lys As - #p Arg Ile Ala Lys Glu385 3 - #90 3 - #95 4 -#00- Glu Gly Ala- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 468 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..357- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:- CGG GAC ACC AAG TTT AGG GAG GAC TGC CCG CC - #G GAT CGC GAG GAA CTG 48Arg Asp Thr Lys Phe Arg Glu Asp Cys Pro Pr - #o Asp Arg Glu Glu Leu# 15- GGC CGC CAC AGC TGG GCT GTC CTC CAC ACC CT - #G GCC GCC TAC TAC CCC 96Gly Arg His Ser Trp Ala Val Leu His Thr Le - #u Ala Ala Tyr Tyr Pro# 30- GAC CTG CCC ACC CCA GAA CAG CAG CAA GAC AT - #G GCC CAG TTC ATA CAT 144Asp Leu Pro Thr Pro Glu Gln Gln Gln Asp Me - #t Ala Gln Phe Ile His# 45- TTA TTT TCT AAG TTT TAC CCC TGT GAG GAG TG - #T GCT GAA GAC CTA AGA 192Leu Phe Ser Lys Phe Tyr Pro Cys Glu Glu Cy - #s Ala Glu Asp Leu Arg# 60- AAA AGG CTG TGC AGG AAC CAC CCA GAC ACC CG - #C ACC CGG GCA TGC TTC 240Lys Arg Leu Cys Arg Asn His Pro Asp Thr Ar - #g Thr Arg Ala Cys Phe# 80- ACA CAG TGG CTG TGC CAC CTG CAC AAT GAA GT - #G AAC CGC AAG CTG GGC 288Thr Gln Trp Leu Cys His Leu His Asn Glu Va - #l Asn Arg Lys Leu Gly# 95- AAG CCT GAC TTC GAC TGC TCA AAA GTG GAT GA - #G CGC TGG CGC GAC GGC 336Lys Pro Asp Phe Asp Cys Ser Lys Val Asp Gl - #u Arg Trp Arg Asp Gly# 110- TGG AAG GAT GGC TCC TGT GAC TAGAGGGTGG TCAGCCAGA - #G CTCATGGGAC 387Trp Lys Asp Gly Ser Cys Asp 115- AGCTAGCCAG GCATGGTTGG ATAGGGGCAG GGCACTCATT AAAGTGCATC AC - #AGCCAGAA 447# 468AA A- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 119 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:- Arg Asp Thr Lys Phe Arg Glu Asp Cys Pro Pr - #o Asp Arg Glu Glu Leu# 15- Gly Arg His Ser Trp Ala Val Leu His Thr Le - #u Ala Ala Tyr Tyr Pro# 30- Asp Leu Pro Thr Pro Glu Gln Gln Gln Asp Me - #t Ala Gln Phe Ile His# 45- Leu Phe Ser Lys Phe Tyr Pro Cys Glu Glu Cy - #s Ala Glu Asp Leu Arg# 60- Lys Arg Leu Cys Arg Asn His Pro Asp Thr Ar - #g Thr Arg Ala Cys Phe# 80- Thr Gln Trp Leu Cys His Leu His Asn Glu Va - #l Asn Arg Lys Leu Gly# 95- Lys Pro Asp Phe Asp Cys Ser Lys Val Asp Gl - #u Arg Trp Arg Asp Gly# 110- Trp Lys Asp Gly Ser Cys Asp 115- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 125 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:- Met Arg Thr Gln Gln Lys Arg Asp Ile Lys Ph - #e Arg Glu Asp Cys Pro# 15- Gln Asp Arg Glu Glu Leu Gly Arg Asn Thr Tr - #p Ala Phe Leu His Thr# 30- Leu Ala Ala Tyr Tyr Pro Asp Met Pro Thr Pr - #o Glu Gln Gln Gln Asp# 45- Met Ala Gln Phe Ile His Ile Phe Ser Lys Ph - #e Tyr Pro Cys Glu Glu# 60- Cys Ala Glu Asp Ile Arg Lys Arg Ile Asp Ar - #g Ser Gln Pro Asp Thr#80- Ser Thr Arg Val Ser Phe Ser Gln Trp Leu Cy - #s Arg Leu His Asn Glu# 95- Val Asn Arg Lys Leu Gly Lys Pro Asp Phe As - #p Cys Ser Arg Val Asp# 110- Glu Arg Trp Arg Asp Gly Trp Lys Asp Gly Se - #r Cys Asp# 125- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:# 20 CAGT- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:# 20 TCCT- (2) INFORMATION FOR SEQ ID NO:38:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:# 20 CTAC- (2) INFORMATION FOR SEQ ID NO:39:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:# 20 AACA- (2) INFORMATION FOR SEQ ID NO:40:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:# 18 GT- (2) INFORMATION FOR SEQ ID NO:41:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:# 18 CA- (2) INFORMATION FOR SEQ ID NO:42:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:# 17 C- (2) INFORMATION FOR SEQ ID NO:43:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:# 17 T- (2) INFORMATION FOR SEQ ID NO:44:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:# 20 ACTG- (2) INFORMATION FOR SEQ ID NO:45:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:# 20 GATT- (2) INFORMATION FOR SEQ ID NO:46:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:# 20 TCTG- (2) INFORMATION FOR SEQ ID NO:47:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:# 20 GACA- (2) INFORMATION FOR SEQ ID NO:48:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:# 17 C- (2) INFORMATION FOR SEQ ID NO:49:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:# 17 A- (2) INFORMATION FOR SEQ ID NO:50:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:# 20 TCTC- (2) INFORMATION FOR SEQ ID NO:51:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:# 20 ATAT- (2) INFORMATION FOR SEQ ID NO:52:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:# 19 GTG- (2) INFORMATION FOR SEQ ID NO:53:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:# 19 ATG- (2) INFORMATION FOR SEQ ID NO:54:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:# 18 CA- (2) INFORMATION FOR SEQ ID NO:55:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:# 17 C- (2) INFORMATION FOR SEQ ID NO:56:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:# 17 A- (2) INFORMATION FOR SEQ ID NO:57:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:# 17 C- (2) INFORMATION FOR SEQ ID NO:58:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:# 20 GCAT- (2) INFORMATION FOR SEQ ID NO:59:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:# 17 G- (2) INFORMATION FOR SEQ ID NO:60:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:# 17 A- (2) INFORMATION FOR SEQ ID NO:61:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:# 17 C- (2) INFORMATION FOR SEQ ID NO:62:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:# 17 G- (2) INFORMATION FOR SEQ ID NO:63:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:# 20 CTGC- (2) INFORMATION FOR SEQ ID NO:64:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:# 20 GCAT- (2) INFORMATION FOR SEQ ID NO:65:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:# 20 CCGC- (2) INFORMATION FOR SEQ ID NO:66:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:# 20 CCCA- (2) INFORMATION FOR SEQ ID NO:67:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67:# 18 CT- (2) INFORMATION FOR SEQ ID NO:68:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 base p - #airs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "Kozak Initiation Sequence"sc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:# 9- (2) INFORMATION FOR SEQ ID NO:69:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69:# 20 TTTA- (2) INFORMATION FOR SEQ ID NO:70:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:70:# 20 TGTG- (2) INFORMATION FOR SEQ ID NO:71:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 8 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71:- His Arg Asp Leu Lys Pro Glu Asn1 5- (2) INFORMATION FOR SEQ ID NO:72:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72:# 17 T- (2) INFORMATION FOR SEQ ID NO:73:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73:# 20 GAGG- (2) INFORMATION FOR SEQ ID NO:74:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 6525 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 573..5684- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74:- CACATAAAAT ACACCGCCCC GGCGCCCAGG CTCGGTGCTG GAGAGTCATG CC - #TGTGAGCC 60- CTGGGCACCT CCTGATGTCC TGCGAGGTCA CGGTGTTCCC AAACCTCAGG GT - #TGCCCTGC 120- CCCACTCCAG AGGCTCTCAG GCCCCACCCC GGAGCCCTCT GTGCGGAGCC GC - #CTCCTCCT 180- GGCCAGTTCC CCAGTAGTCC TGAAGGGAGA CCTGCTGTGT GGAGCCTCTT CT - #GGGACCCA 240- GCCATGAGTG TGGAGCTGAG CAACTGAACC TGAAACTCTT CCACTGTGAG TC - #AAGGAGGC 300- TTTTCCGCAC ATGAAGGACG CTGAGCGGGA AGGACTCCTC TCTGCCTGCA GT - #TGTAGCGA 360- GTGGACCAGC ACCAGGGGCT CTCTAGACTG CCCCTCCTCC ATCGCCTTCC CT - #GCCTCTCC 420- AGGACAGAGC AGCCACGTCT GCACACCTCG CCCTCTTTAC ACTCAGTTTT CA - #GAGCACGT 480- TTCTCCTATT TCCTGCGGGT TGCAGCGCCT ACTTGAACTT ACTCAGACCA CC - #TACTTCTC 540- TAGCAGCACT GGGCGTCCCT TTCAGCAAGA CG ATG GCT GTG CTC - # AGG CAG CTG 593#Met Ala Val Leu Arg Gln Leu# 1 5- GCG CTC CTC CTC TGG AAG AAC TAC ACC CTG CA - #G AAG CGG AAG GTC CTG 641Ala Leu Leu Leu Trp Lys Asn Tyr Thr Leu Gl - #n Lys Arg Lys Val Leu# 20- GTG ACG GTC CTG GAA CTC TTC CTG CCA TTG CT - #G TTT TCT GGG ATC CTC 689Val Thr Val Leu Glu Leu Phe Leu Pro Leu Le - #u Phe Ser Gly Ile Leu# 35- ATC TGG CTC CGC TTG AAG ATT CAG TCG GAA AA - #T GTG CCC AAC GCC ACC 737Ile Trp Leu Arg Leu Lys Ile Gln Ser Glu As - #n Val Pro Asn Ala Thr# 55- ATC TAC CCG GGC CAG TCC ATC CAG GAG CTG CC - #T CTG TTC TTC ACC TTC 785Ile Tyr Pro Gly Gln Ser Ile Gln Glu Leu Pr - #o Leu Phe Phe Thr Phe# 70- CCT CCG CCA GGA GAC ACC TGG GAG CTT GCC TA - #C ATC CCT TCT CAC AGT 833Pro Pro Pro Gly Asp Thr Trp Glu Leu Ala Ty - #r Ile Pro Ser His Ser# 85- GAC GCT GCC AAG GCC GTC ACT GAG ACA GTG CG - #C AGG GCA CTT GTG ATC 881Asp Ala Ala Lys Ala Val Thr Glu Thr Val Ar - #g Arg Ala Leu Val Ile# 100- AAC ATG CGA GTG CGC GGC TTT CCC TCC GAG AA - #G GAC TTT GAG GAC TAC 929Asn Met Arg Val Arg Gly Phe Pro Ser Glu Ly - #s Asp Phe Glu Asp Tyr# 115- ATT AGG TAC GAC AAC TGC TCG TCC AGC GTG CT - #G GCC GCC GTG GTC TTC 977Ile Arg Tyr Asp Asn Cys Ser Ser Ser Val Le - #u Ala Ala Val Val Phe120 1 - #25 1 - #30 1 -#35- GAG CAC CCC TTC AAC CAC AGC AAG GAG CCC CT - #G CCG CTG GCG GTG AAA1025Glu His Pro Phe Asn His Ser Lys Glu Pro Le - #u Pro Leu Ala Val Lys# 150- TAT CAC CTA CGG TTC AGT TAC ACA CGG AGA AA - #T TAC ATG TGG ACC CAA1073Tyr His Leu Arg Phe Ser Tyr Thr Arg Arg As - #n Tyr Met Trp Thr Gln# 165- ACA GGC TCC TTT TTC CTG AAA GAG ACA GAA GG - #C TGG CAC ACT ACT TCC1121Thr Gly Ser Phe Phe Leu Lys Glu Thr Glu Gl - #y Trp His Thr Thr Ser# 180- CTT TTC CCG CTT TTC CCA AAC CCA GGA CCA AG - #G GAA CTA ACA TCC CCT1169Leu Phe Pro Leu Phe Pro Asn Pro Gly Pro Ar - #g Glu Leu Thr Ser Pro# 195- GAT GGC GGA GAA CCT GGG TAC ATC CGG GAA GG - #C TTC CTG GCC GTG CAG1217Asp Gly Gly Glu Pro Gly Tyr Ile Arg Glu Gl - #y Phe Leu Ala Val Gln200 2 - #05 2 - #10 2 -#15- CAT GCT GTG GAC CGG GCC ATC ATG GAG TAC CA - #T GCC GAT GCC GCC ACA1265His Ala Val Asp Arg Ala Ile Met Glu Tyr Hi - #s Ala Asp Ala Ala Thr# 230- CGC CAG CTG TTC CAG AGA CTG ACG GTG ACC AT - #C AAG AGG TTC CCG TAC1313Arg Gln Leu Phe Gln Arg Leu Thr Val Thr Il - #e Lys Arg Phe Pro Tyr# 245- CCG CCG TTC ATC GCA GAC CCC TTC CTC GTG GC - #C ATC CAG TAC CAG CTG1361Pro Pro Phe Ile Ala Asp Pro Phe Leu Val Al - #a Ile Gln Tyr Gln Leu# 260- CCC CTG CTG CTG CTG CTC AGC TTC ACC TAC AC - #C GCG CTC ACC ATT GCC1409Pro Leu Leu Leu Leu Leu Ser Phe Thr Tyr Th - #r Ala Leu Thr Ile Ala# 275- CGT GCT GTC GTG CAG GAG AAG GAA AGG AGG CT - #G AAG GAG TAC ATG CGC1457Arg Ala Val Val Gln Glu Lys Glu Arg Arg Le - #u Lys Glu Tyr Met Arg280 2 - #85 2 - #90 2 -#95- ATG ATG GGG CTC AGC AGC TGG CTG CAC TGG AG - #T GCC TGG TTC CTC TTG1505Met Met Gly Leu Ser Ser Trp Leu His Trp Se - #r Ala Trp Phe Leu Leu# 310- TTC TTC CTC TTC CTC CTC ATC GCC GCC TCC TT - #C ATG ACC CTG CTC TTC1553Phe Phe Leu Phe Leu Leu Ile Ala Ala Ser Ph - #e Met Thr Leu Leu Phe# 325- TGT GTC AAG GTG AAG CCA AAT GTA GCC GTG CT - #G TCC CGC AGC GAC CCC1601Cys Val Lys Val Lys Pro Asn Val Ala Val Le - #u Ser Arg Ser Asp Pro# 340- TCC CTG GTG CTC GCC TTC CTG CTG TGC TTC GC - #C ATC TCT ACC ATC TCC1649Ser Leu Val Leu Ala Phe Leu Leu Cys Phe Al - #a Ile Ser Thr Ile Ser# 355- TTC AGC TTC ATG GTC AGC ACC TTC TTC AGC AA - #A GCC AAC ATG GCA GCA1697Phe Ser Phe Met Val Ser Thr Phe Phe Ser Ly - #s Ala Asn Met Ala Ala360 3 - #65 3 - #70 3 -#75- GCC TTC GGA GGC TTC CTC TAC TTC TTC ACC TA - #C ATC CCC TAC TTC TTC1745Ala Phe Gly Gly Phe Leu Tyr Phe Phe Thr Ty - #r Ile Pro Tyr Phe Phe# 390- GTG GCC CCT CGG TAC AAC TGG ATG ACT CTG AG - #C CAG AAG CTC TGC TCC1793Val Ala Pro Arg Tyr Asn Trp Met Thr Leu Se - #r Gln Lys Leu Cys Ser# 405- TGC CTC CTG TCT AAT GTC GCC ATG GCA ATG GG - #A GCC CAG CTC ATT GGG1841Cys Leu Leu Ser Asn Val Ala Met Ala Met Gl - #y Ala Gln Leu Ile Gly# 420- AAA TTT GAG GCG AAA GGC ATG GGC ATC CAG TG - #G CGA GAC CTC CTG AGT1889Lys Phe Glu Ala Lys Gly Met Gly Ile Gln Tr - #p Arg Asp Leu Leu Ser# 435- CCC GTC AAC GTG GAC GAC GAC TTC TGC TTC GG - #G CAG GTG CTG GGG ATG1937Pro Val Asn Val Asp Asp Asp Phe Cys Phe Gl - #y Gln Val Leu Gly Met440 4 - #45 4 - #50 4 -#55- CTG CTG CTG GAC TCT GTG CTC TAT GGC CTG GT - #G ACC TGG TAC ATG GAG1985Leu Leu Leu Asp Ser Val Leu Tyr Gly Leu Va - #l Thr Trp Tyr Met Glu# 470- GCC GTC TTC CCA GGG CAG TTC GGC GTG CCT CA - #G CCC TGG TAC TTC TTC2033Ala Val Phe Pro Gly Gln Phe Gly Val Pro Gl - #n Pro Trp Tyr Phe Phe# 485- ATC ATG CCC TCC TAT TGG TGT GGG AAG CCA AG - #G GCG GTT GCA GGG AAG2081Ile Met Pro Ser Tyr Trp Cys Gly Lys Pro Ar - #g Ala Val Ala Gly Lys# 500- GAG GAA GAA GAC AGT GAC CCC GAG AAA GCA CT - #C AGA AAC GAG TAC TTT2129Glu Glu Glu Asp Ser Asp Pro Glu Lys Ala Le - #u Arg Asn Glu Tyr Phe# 515- GAA GCC GAG CCA GAG GAC CTG GTG GCG GGG AT - #C AAG ATC AAG CAC CTG2177Glu Ala Glu Pro Glu Asp Leu Val Ala Gly Il - #e Lys Ile Lys His Leu520 5 - #25 5 - #30 5 -#35- TCC AAG GTG TTC AGG GTG GGA AAT AAG GAC AG - #G GCG GCC GTC AGA GAC2225Ser Lys Val Phe Arg Val Gly Asn Lys Asp Ar - #g Ala Ala Val Arg Asp# 550- CTG AAC CTC AAC CTG TAC GAG GGA CAG ATC AC - #C GTC CTG CTG GGC CAC2273Leu Asn Leu Asn Leu Tyr Glu Gly Gln Ile Th - #r Val Leu Leu Gly His# 565- AAC GGT GCC GGG AAG ACC ACC ACC CTC TCC AT - #G CTC ACA GGT CTC TTT2321Asn Gly Ala Gly Lys Thr Thr Thr Leu Ser Me - #t Leu Thr Gly Leu Phe# 580- CCC CCC ACC AGT GGA CGG GCA TAC ATC AGC GG - #G TAT GAA ATT TCC CAG2369Pro Pro Thr Ser Gly Arg Ala Tyr Ile Ser Gl - #y Tyr Glu Ile Ser Gln# 595- GAC ATG GTT CAG ATC CGG AAG AGC CTG GGC CT - #G TGC CCG CAG CAC GAC2417Asp Met Val Gln Ile Arg Lys Ser Leu Gly Le - #u Cys Pro Gln His Asp600 6 - #05 6 - #10 6 -#15- ATC CTG TTT GAC AAC TTG ACA GTC GCA GAG CA - #C CTT TAT TTC TAC GCC2465Ile Leu Phe Asp Asn Leu Thr Val Ala Glu Hi - #s Leu Tyr Phe Tyr Ala# 630- CAG CTG AAG GGC CTG TCA CGT CAG AAG TGC CC - #T GAA GAA GTC AAG CAG2513Gln Leu Lys Gly Leu Ser Arg Gln Lys Cys Pr - #o Glu Glu Val Lys Gln# 645- ATG CTG CAC ATC ATC GGC CTG GAG GAC AAG TG - #G AAC TCA CGG AGC CGC2561Met Leu His Ile Ile Gly Leu Glu Asp Lys Tr - #p Asn Ser Arg Ser Arg# 660- TTC CTG AGC GGG GGC ATG AGG CGC AAG CTC TC - #C ATC GGC ATC GCC CTC2609Phe Leu Ser Gly Gly Met Arg Arg Lys Leu Se - #r Ile Gly Ile Ala Leu# 675- ATC GCA GGC TCC AAG GTG CTG ATA CTG GAC GA - #G CCC ACC TCG GGC ATG2657Ile Ala Gly Ser Lys Val Leu Ile Leu Asp Gl - #u Pro Thr Ser Gly Met680 6 - #85 6 - #90 6 -#95- GAC GCC ATC TCC AGG AGG GCC ATC TGG GAT CT - #T CTT CAG CGG CAG AAA2705Asp Ala Ile Ser Arg Arg Ala Ile Trp Asp Le - #u Leu Gln Arg Gln Lys# 710- AGT GAC CGC ACC ATC GTG CTG ACC ACC CAC TT - #C ATG GAC GAG GCT GAC2753Ser Asp Arg Thr Ile Val Leu Thr Thr His Ph - #e Met Asp Glu Ala Asp# 725- CTG CTG GGA GAC CGC ATC GCC ATC ATG GCC AA - #G GGG GAG CTG CAG TGC2801Leu Leu Gly Asp Arg Ile Ala Ile Met Ala Ly - #s Gly Glu Leu Gln Cys# 740- TGC GGG TCC TCG CTG TTC CTC AAG CAG AAA TA - #C GGT GCC GGC TAT CAC2849Cys Gly Ser Ser Leu Phe Leu Lys Gln Lys Ty - #r Gly Ala Gly Tyr His# 755- ATG ACG CTG GTG AAG GAG CCG CAC TGC AAC CC - #G GAA GAC ATC TCC CAG2897Met Thr Leu Val Lys Glu Pro His Cys Asn Pr - #o Glu Asp Ile Ser Gln760 7 - #65 7 - #70 7 -#75- CTG GTC CAC CAC CAC GTG CCC AAC GCC ACG CT - #G GAG AGC AGC GCT GGG2945Leu Val His His His Val Pro Asn Ala Thr Le - #u Glu Ser Ser Ala Gly# 790- GCC GAG CTG TCT TTC ATC CTT CCC AGA GAG AG - #C ACG CAC AGG TTT GAA2993Ala Glu Leu Ser Phe Ile Leu Pro Arg Glu Se - #r Thr His Arg Phe Glu# 805- GGT CTC TTT GCT AAA CTG GAG AAG AAG CAG AA - #A GAG CTG GGC ATT GCC3041Gly Leu Phe Ala Lys Leu Glu Lys Lys Gln Ly - #s Glu Leu Gly Ile Ala# 820- AGC TTT GGG GCA TCC ATC ACC ACC ATG GAG GA - #A GTC TTC CTT CGG GTC3089Ser Phe Gly Ala Ser Ile Thr Thr Met Glu Gl - #u Val Phe Leu Arg Val# 835- GGG AAG CTG GTG GAC AGC AGT ATG GAC ATC CA - #G GCC ATC CAG CTC CCT3137Gly Lys Leu Val Asp Ser Ser Met Asp Ile Gl - #n Ala Ile Gln Leu Pro840 8 - #45 8 - #50 8 -#55- GCC CTG CAG TAC CAG CAC GAG AGG CGC GCC AG - #C GAC TGG GCT GTG GAC3185Ala Leu Gln Tyr Gln His Glu Arg Arg Ala Se - #r Asp Trp Ala Val Asp# 870- AGC AAC CTC TGT GGG GCC ATG GAC CCC TCC GA - #C GGC ATT GGA GCC CTC3233Ser Asn Leu Cys Gly Ala Met Asp Pro Ser As - #p Gly Ile Gly Ala Leu# 885- ATC GAG GAG GAG CGC ACC GCT GTC AAG CTC AA - #C ACT GGG CTC GCC CTG3281Ile Glu Glu Glu Arg Thr Ala Val Lys Leu As - #n Thr Gly Leu Ala Leu# 900- CAC TGC CAG CAA TTC TGG GCC ATG TTC CTG AA - #G AAG GCC GCA TAC AGC3329His Cys Gln Gln Phe Trp Ala Met Phe Leu Ly - #s Lys Ala Ala Tyr Ser# 915- TGG CGC GAG TGG AAA ATG GTG GCG GCA CAG GT - #C CTG GTG CCT CTG ACC3377Trp Arg Glu Trp Lys Met Val Ala Ala Gln Va - #l Leu Val Pro Leu Thr920 9 - #25 9 - #30 9 -#35- TGC GTC ACC CTG GCC CTC CTG GCC ATC AAC TA - #C TCC TCG GAG CTC TTC3425Cys Val Thr Leu Ala Leu Leu Ala Ile Asn Ty - #r Ser Ser Glu Leu Phe# 950- GAC GAC CCC ATG CTG AGG CTG ACC TTG GGC GA - #G TAC GGC AGA ACC GTC3473Asp Asp Pro Met Leu Arg Leu Thr Leu Gly Gl - #u Tyr Gly Arg Thr Val# 965- GTG CCC TTC TCA GTT CCC GGG ACC TCC CAG CT - #G GGT CAG CAG CTG TCA3521Val Pro Phe Ser Val Pro Gly Thr Ser Gln Le - #u Gly Gln Gln Leu Ser# 980- GAG CAT CTG AAA GAC GCA CTG CAG GCT GAG GG - #A CAG GAG CCC CGC GAG3569Glu His Leu Lys Asp Ala Leu Gln Ala Glu Gl - #y Gln Glu Pro Arg Glu# 995- GTG CTC GGT GAC CTG GAG GAG TTC TTG ATC TT - #C AGG GCT TCT GTG GAG3617Val Leu Gly Asp Leu Glu Glu Phe Leu Ile Ph - #e Arg Ala Ser Val Glu# 10151005 - # 1010- GGG GGC GGC TTT AAT GAG CGG TGC CTT GTG GC - #A GCG TCC TTC AGA GAT3665Gly Gly Gly Phe Asn Glu Arg Cys Leu Val Al - #a Ala Ser Phe Arg Asp# 10305- GTG GGA GAG CGC ACG GTC GTC AAC GCC TTG TT - #C AAC AAC CAG GCG TAC3713Val Gly Glu Arg Thr Val Val Asn Ala Leu Ph - #e Asn Asn Gln Ala Tyr# 10450- CAC TCT CCA GCC ACT GCC CTG GCC GTC GTG GA - #C AAC CTT CTG TTC AAG3761His Ser Pro Ala Thr Ala Leu Ala Val Val As - #p Asn Leu Leu Phe Lys# 10605- CTG CTG TGC GGG CCT CAC GCC TCC ATT GTG GT - #C TCC AAC TTC CCC CAG3809Leu Leu Cys Gly Pro His Ala Ser Ile Val Va - #l Ser Asn Phe Pro Gln# 10750- CCC CGG AGC GCC CTG CAG GCT GCC AAG GAC CA - #G TTT AAC GAG GGC CGG3857Pro Arg Ser Ala Leu Gln Ala Ala Lys Asp Gl - #n Phe Asn Glu Gly Arg# 10951085 - # 1090- AAG GGA TTC GAC ATT GCC CTC AAC CTG CTC TT - #C GCC ATG GCA TTC TTG3905Lys Gly Phe Asp Ile Ala Leu Asn Leu Leu Ph - #e Ala Met Ala Phe Leu# 11105- GCC AGC ACG TTC TCC ATC CTG GCG GTC AGC GA - #G AGG GCC GTG CAG GCC3953Ala Ser Thr Phe Ser Ile Leu Ala Val Ser Gl - #u Arg Ala Val Gln Ala# 11250- AAG CAT GTG CAG TTT GTG AGT GGA GTC CAC GT - #G GCC AGT TTC TGG CTC4001Lys His Val Gln Phe Val Ser Gly Val His Va - #l Ala Ser Phe Trp Leu# 11405- TCT GCT CTG CTG TGG GAC CTC ATC TCC TTC CT - #C ATC CCC AGT CTG CTG4049Ser Ala Leu Leu Trp Asp Leu Ile Ser Phe Le - #u Ile Pro Ser Leu Leu# 11550- CTG CTG GTG GTG TTT AAG GCC TTC GAC GTG CG - #T GCC TTC ACG CGG GAC4097Leu Leu Val Val Phe Lys Ala Phe Asp Val Ar - #g Ala Phe Thr Arg Asp# 11751165 - # 1170- GGC CAC ATG GCT GAC ACC CTG CTG CTG CTC CT - #G CTC TAC GGC TGG GCC4145Gly His Met Ala Asp Thr Leu Leu Leu Leu Le - #u Leu Tyr Gly Trp Ala# 11905- ATC ATC CCC CTC ATG TAC CTG ATG AAC TTC TT - #C TTC TTG GGG GCG GCC4193Ile Ile Pro Leu Met Tyr Leu Met Asn Phe Ph - #e Phe Leu Gly Ala Ala# 12050- ACT GCC TAC ACG AGG CTG ACC ATC TTC AAC AT - #C CTG TCA GGC ATC GCC4241Thr Ala Tyr Thr Arg Leu Thr Ile Phe Asn Il - #e Leu Ser Gly Ile Ala# 12205- ACC TTC CTG ATG GTC ACC ATC ATG CGC ATC CC - #A GCT GTA AAA CTG GAA4289Thr Phe Leu Met Val Thr Ile Met Arg Ile Pr - #o Ala Val Lys Leu Glu# 12350- GAA CTT TCC AAA ACC CTG GAT CAC GTG TTC CT - #G GTG CTG CCC AAC CAC4337Glu Leu Ser Lys Thr Leu Asp His Val Phe Le - #u Val Leu Pro Asn His# 12551245 - # 1250- TGT CTG GGG ATG GCA GTC AGC AGT TTC TAC GA - #G AAC TAC GAG ACG CGG4385Cys Leu Gly Met Ala Val Ser Ser Phe Tyr Gl - #u Asn Tyr Glu Thr Arg# 12705- AGG TAC TGC ACC TCC TCC GAG GTC GCC GCC CA - #C TAC TGC AAG AAA TAT4433Arg Tyr Cys Thr Ser Ser Glu Val Ala Ala Hi - #s Tyr Cys Lys Lys Tyr# 12850- AAC ATC CAG TAC CAG GAG AAC TTC TAT GCC TG - #G AGC GCC CCG GGG GTC4481Asn Ile Gln Tyr Gln Glu Asn Phe Tyr Ala Tr - #p Ser Ala Pro Gly Val# 13005- GGC CGG TTT GTG GCC TCC ATG GCC GCC TCA GG - #G TGC GCC TAC CTC ATC4529Gly Arg Phe Val Ala Ser Met Ala Ala Ser Gl - #y Cys Ala Tyr Leu Ile# 13150- CTG CTC TTC CTC ATC GAG ACC AAC CTG CTT CA - #G AGA CTC AGG GGC ATC4577Leu Leu Phe Leu Ile Glu Thr Asn Leu Leu Gl - #n Arg Leu Arg Gly Ile# 13351325 - # 1330- CTC TGC GCC CTC CGG AGG AGG CGG ACA CTG AC - #A GAA TTA TAC ACC CGG4625Leu Cys Ala Leu Arg Arg Arg Arg Thr Leu Th - #r Glu Leu Tyr Thr Arg# 13505- ATG CCT GTG CTT CCT GAG GAC CAA GAT GTA GC - #G GAC GAG AGG ACC CGC4673Met Pro Val Leu Pro Glu Asp Gln Asp Val Al - #a Asp Glu Arg Thr Arg# 13650- ATC CTG GCC CCC AGC CCG GAC TCC CTG CTC CA - #C ACA CCT CTG ATT ATC4721Ile Leu Ala Pro Ser Pro Asp Ser Leu Leu Hi - #s Thr Pro Leu Ile Ile# 13805- AAG GAG CTC TCC AAG GTG TAC GAG CAG CGG GT - #G CCC CTC CTG GCC GTG4769Lys Glu Leu Ser Lys Val Tyr Glu Gln Arg Va - #l Pro Leu Leu Ala Val# 13950- GAC AGG CTC TCC CTC GCG GTG CAG AAA GGG GA - #G TGC TTC GGC CTG CTG4817Asp Arg Leu Ser Leu Ala Val Gln Lys Gly Gl - #u Cys Phe Gly Leu Leu# 14151405 - # 1410- GGC TTC AAT GGA GCC GGG AAG ACC ACG ACT TT - #C AAA ATG CTG ACC GGG4865Gly Phe Asn Gly Ala Gly Lys Thr Thr Thr Ph - #e Lys Met Leu Thr Gly# 14305- GAG GAG AGC CTC ACT TCT GGG GAT GCC TTT GT - #C GGG GGT CAC AGA ATC4913Glu Glu Ser Leu Thr Ser Gly Asp Ala Phe Va - #l Gly Gly His Arg Ile# 14450- AGC TCT GAT GTC GGA AAG GTG CGG CAG CGG AT - #C GGC TAC TGC CCG CAG4961Ser Ser Asp Val Gly Lys Val Arg Gln Arg Il - #e Gly Tyr Cys Pro Gln# 14605- TTT GAT GCC TTG CTG GAC CAC ATG ACA GGC CG - #G GAG ATG CTG GTC ATG5009Phe Asp Ala Leu Leu Asp His Met Thr Gly Ar - #g Glu Met Leu Val Met# 14750- TAC GCT CGG CTC CGG GGC ATC CCT GAG CGC CA - #C ATC GGG GCC TGC GTG5057Tyr Ala Arg Leu Arg Gly Ile Pro Glu Arg Hi - #s Ile Gly Ala Cys Val# 14951485 - # 1490- GAG AAC ACT CTG CGG GGC CTG CTG CTG GAG CC - #A CAT GCC AAC AAG CTG5105Glu Asn Thr Leu Arg Gly Leu Leu Leu Glu Pr - #o His Ala Asn Lys Leu# 15105- GTC AGG ACG TAC AGT GGT GGT AAC AAG CGG AA - #G CTG AGC ACC GGC ATC5153Val Arg Thr Tyr Ser Gly Gly Asn Lys Arg Ly - #s Leu Ser Thr Gly Ile# 15250- GCC CTG ATC GGA GAG CCT GCT GTC ATC TTC CT - #G GAC GAG CCG TCC ACT5201Ala Leu Ile Gly Glu Pro Ala Val Ile Phe Le - #u Asp Glu Pro Ser Thr# 15405- GGC ATG GAC CCC GTG GCC CGG CGC CTG CTT TG - #G GAC ACC GTG GCA CGA5249Gly Met Asp Pro Val Ala Arg Arg Leu Leu Tr - #p Asp Thr Val Ala Arg# 15550- GCC CGA GAG TCT GGC AAG GCC ATC ATC ATC AC - #C TCC CAC AGC ATG GAG5297Ala Arg Glu Ser Gly Lys Ala Ile Ile Ile Th - #r Ser His Ser Met Glu# 15751565 - # 1570- GAG TGT GAG GCC CTG TGC ACC CGG CTG GCC AT - #C ATG GTG CAG GGG CAG5345Glu Cys Glu Ala Leu Cys Thr Arg Leu Ala Il - #e Met Val Gln Gly Gln# 15905- TTC AAG TGC CTG GGC AGC CCC CAG CAC CTC AA - #G AGC AAG TTC GGC AGC5393Phe Lys Cys Leu Gly Ser Pro Gln His Leu Ly - #s Ser Lys Phe Gly Ser# 16050- GGC TAC TCC CTG CGG GCC AAG GTG CAG AGT GA - #A GGG CAA CAG GAG GCG5441Gly Tyr Ser Leu Arg Ala Lys Val Gln Ser Gl - #u Gly Gln Gln Glu Ala# 16205- CTG GAG GAG TTC AAG GCC TTC GTG GAC CTG AC - #C TTT CCA GGC AGC GTC5489Leu Glu Glu Phe Lys Ala Phe Val Asp Leu Th - #r Phe Pro Gly Ser Val# 16350- CTG GAA GAT GAG CAC CAA GGC ATG GTC CAT TA - #C CAC CTG CCG GGC CGT5537Leu Glu Asp Glu His Gln Gly Met Val His Ty - #r His Leu Pro Gly Arg# 16551645 - # 1650- GAC CTC AGC TGG GCG AAG GTT TTC GGT ATT CT - #G GAG AAA GCC AAG GAA5585Asp Leu Ser Trp Ala Lys Val Phe Gly Ile Le - #u Glu Lys Ala Lys Glu# 16705- AAG TAC GGC GTG GAC GAC TAC TCC GTG AGC CA - #G ATC TCG CTG GAA CAG5633Lys Tyr Gly Val Asp Asp Tyr Ser Val Ser Gl - #n Ile Ser Leu Glu Gln# 16850- GTC TTC CTG AGC TTC GCC CAC CTG CAG CCG CC - #C ACC GCA GAG GAG GGG5681Val Phe Leu Ser Phe Ala His Leu Gln Pro Pr - #o Thr Ala Glu Glu Gly# 17005- CGA TGAGGGGTGG CGGCTGTCTC GCCATCAGGC AGGGACAGGA CGGGCAAGC - #A5734Arg- GGGCCCATCT TACATCCTCT CTCTCCAAGT TTATCTCATC CTTTATTTTT AA - #TCACTTTT5794- TTCTATGATG GATATGAAAA ATTCAAGGCA GTATGCACAG AATGGACGAG TG - #CAGCCCAG5854- CCCTCATGCC CAGGATCAGC ATGCGCATCT CCATGTCTGC ATACTCTGGA GT - #TCACTTTC5914- CCAGAGCTGG GGCAGGCCGG GCAGTCTGCG GGCAAGCTCC GGGGTCTCTG GG - #TGGAGAGC5974- TGACCCAGGA AGGGCTGCAG CTGAGCTGGG GGTTGAATTT CTCCAGGCAC TC - #CCTGGAGA6034- GAGGACCCAG TGACTTGTCC AAGTTTACAC ACGACACTAA TCTCCCCTGG GG - #AGGAAGCG6094- GGAAGCCAGC CAGGTTGAAC TGTAGCGAGG CCCCCAGGCC GCCAGGAATG GA - #CCATGCAG6154- ATCACTGTCA GTGGAGGGAA GCTGCTGACT GTGATTAGGT GCTGGGGTCT TA - #GCGTCCAG6214- CGCAGCCCGG GGGCATCCTG GAGGCTCTGC TCCTTAGGGC ATGGTAGTCA CC - #GCGAAGCC6274- GGGCACCGTC CCACAGCATC TCCTAGAAGC AGCCGGCACA GGAGGGAAGG TG - #GCCAGGCT6334- CGAAGCAGTC TCTGTTTCCA GCACTGCACC CTCAGGAAGT CGCCCGCCCC AG - #GACACGCA6394- GGGACCACCC TAAGGGCTGG GTGGCTGTCT CAAGGACACA TTGAATACGT TG - #TGACCATC6454- CAGAAAATAA ATGCTGAGGG GACACAAAAA AAAAAAAAAA AAAAAAAAAA AA - #AAAAAAAA6514# 6525- (2) INFORMATION FOR SEQ ID NO:75:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1704 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:75:- Met Ala Val Leu Arg Gln Leu Ala Leu Leu Le - #u Trp Lys Asn Tyr Thr# 15- Leu Gln Lys Arg Lys Val Leu Val Thr Val Le - #u Glu Leu Phe Leu Pro# 30- Leu Leu Phe Ser Gly Ile Leu Ile Trp Leu Ar - #g Leu Lys Ile Gln Ser# 45- Glu Asn Val Pro Asn Ala Thr Ile Tyr Pro Gl - #y Gln Ser Ile Gln Glu# 60- Leu Pro Leu Phe Phe Thr Phe Pro Pro Pro Gl - #y Asp Thr Trp Glu Leu# 80- Ala Tyr Ile Pro Ser His Ser Asp Ala Ala Ly - #s Ala Val Thr Glu Thr# 95- Val Arg Arg Ala Leu Val Ile Asn Met Arg Va - #l Arg Gly Phe Pro Ser# 110- Glu Lys Asp Phe Glu Asp Tyr Ile Arg Tyr As - #p Asn Cys Ser Ser Ser# 125- Val Leu Ala Ala Val Val Phe Glu His Pro Ph - #e Asn His Ser Lys Glu# 140- Pro Leu Pro Leu Ala Val Lys Tyr His Leu Ar - #g Phe Ser Tyr Thr Arg145 1 - #50 1 - #55 1 -#60- Arg Asn Tyr Met Trp Thr Gln Thr Gly Ser Ph - #e Phe Leu Lys Glu Thr# 175- Glu Gly Trp His Thr Thr Ser Leu Phe Pro Le - #u Phe Pro Asn Pro Gly# 190- Pro Arg Glu Leu Thr Ser Pro Asp Gly Gly Gl - #u Pro Gly Tyr Ile Arg# 205- Glu Gly Phe Leu Ala Val Gln His Ala Val As - #p Arg Ala Ile Met Glu# 220- Tyr His Ala Asp Ala Ala Thr Arg Gln Leu Ph - #e Gln Arg Leu Thr Val225 2 - #30 2 - #35 2 -#40- Thr Ile Lys Arg Phe Pro Tyr Pro Pro Phe Il - #e Ala Asp Pro Phe Leu# 255- Val Ala Ile Gln Tyr Gln Leu Pro Leu Leu Le - #u Leu Leu Ser Phe Thr# 270- Tyr Thr Ala Leu Thr Ile Ala Arg Ala Val Va - #l Gln Glu Lys Glu Arg# 285- Arg Leu Lys Glu Tyr Met Arg Met Met Gly Le - #u Ser Ser Trp Leu His# 300- Trp Ser Ala Trp Phe Leu Leu Phe Phe Leu Ph - #e Leu Leu Ile Ala Ala305 3 - #10 3 - #15 3 -#20- Ser Phe Met Thr Leu Leu Phe Cys Val Lys Va - #l Lys Pro Asn Val Ala# 335- Val Leu Ser Arg Ser Asp Pro Ser Leu Val Le - #u Ala Phe Leu Leu Cys# 350- Phe Ala Ile Ser Thr Ile Ser Phe Ser Phe Me - #t Val Ser Thr Phe Phe# 365- Ser Lys Ala Asn Met Ala Ala Ala Phe Gly Gl - #y Phe Leu Tyr Phe Phe# 380- Thr Tyr Ile Pro Tyr Phe Phe Val Ala Pro Ar - #g Tyr Asn Trp Met Thr385 3 - #90 3 - #95 4 -#00- Leu Ser Gln Lys Leu Cys Ser Cys Leu Leu Se - #r Asn Val Ala Met Ala# 415- Met Gly Ala Gln Leu Ile Gly Lys Phe Glu Al - #a Lys Gly Met Gly Ile# 430- Gln Trp Arg Asp Leu Leu Ser Pro Val Asn Va - #l Asp Asp Asp Phe Cys# 445- Phe Gly Gln Val Leu Gly Met Leu Leu Leu As - #p Ser Val Leu Tyr Gly# 460- Leu Val Thr Trp Tyr Met Glu Ala Val Phe Pr - #o Gly Gln Phe Gly Val465 4 - #70 4 - #75 4 -#80- Pro Gln Pro Trp Tyr Phe Phe Ile Met Pro Se - #r Tyr Trp Cys Gly Lys# 495- Pro Arg Ala Val Ala Gly Lys Glu Glu Glu As - #p Ser Asp Pro Glu Lys# 510- Ala Leu Arg Asn Glu Tyr Phe Glu Ala Glu Pr - #o Glu Asp Leu Val Ala# 525- Gly Ile Lys Ile Lys His Leu Ser Lys Val Ph - #e Arg Val Gly Asn Lys# 540- Asp Arg Ala Ala Val Arg Asp Leu Asn Leu As - #n Leu Tyr Glu Gly Gln545 5 - #50 5 - #55 5 -#60- Ile Thr Val Leu Leu Gly His Asn Gly Ala Gl - #y Lys Thr Thr Thr Leu# 575- Ser Met Leu Thr Gly Leu Phe Pro Pro Thr Se - #r Gly Arg Ala Tyr Ile# 590- Ser Gly Tyr Glu Ile Ser Gln Asp Met Val Gl - #n Ile Arg Lys Ser Leu# 605- Gly Leu Cys Pro Gln His Asp Ile Leu Phe As - #p Asn Leu Thr Val Ala# 620- Glu His Leu Tyr Phe Tyr Ala Gln Leu Lys Gl - #y Leu Ser Arg Gln Lys625 6 - #30 6 - #35 6 -#40- Cys Pro Glu Glu Val Lys Gln Met Leu His Il - #e Ile Gly Leu Glu Asp# 655- Lys Trp Asn Ser Arg Ser Arg Phe Leu Ser Gl - #y Gly Met Arg Arg Lys# 670- Leu Ser Ile Gly Ile Ala Leu Ile Ala Gly Se - #r Lys Val Leu Ile Leu# 685- Asp Glu Pro Thr Ser Gly Met Asp Ala Ile Se - #r Arg Arg Ala Ile Trp# 700- Asp Leu Leu Gln Arg Gln Lys Ser Asp Arg Th - #r Ile Val Leu Thr Thr705 7 - #10 7 - #15 7 -#20- His Phe Met Asp Glu Ala Asp Leu Leu Gly As - #p Arg Ile Ala Ile Met# 735- Ala Lys Gly Glu Leu Gln Cys Cys Gly Ser Se - #r Leu Phe Leu Lys Gln# 750- Lys Tyr Gly Ala Gly Tyr His Met Thr Leu Va - #l Lys Glu Pro His Cys# 765- Asn Pro Glu Asp Ile Ser Gln Leu Val His Hi - #s His Val Pro Asn Ala# 780- Thr Leu Glu Ser Ser Ala Gly Ala Glu Leu Se - #r Phe Ile Leu Pro Arg785 7 - #90 7 - #95 8 -#00- Glu Ser Thr His Arg Phe Glu Gly Leu Phe Al - #a Lys Leu Glu Lys Lys# 815- Gln Lys Glu Leu Gly Ile Ala Ser Phe Gly Al - #a Ser Ile Thr Thr Met# 830- Glu Glu Val Phe Leu Arg Val Gly Lys Leu Va - #l Asp Ser Ser Met Asp# 845- Ile Gln Ala Ile Gln Leu Pro Ala Leu Gln Ty - #r Gln His Glu Arg Arg# 860- Ala Ser Asp Trp Ala Val Asp Ser Asn Leu Cy - #s Gly Ala Met Asp Pro865 8 - #70 8 - #75 8 -#80- Ser Asp Gly Ile Gly Ala Leu Ile Glu Glu Gl - #u Arg Thr Ala Val Lys# 895- Leu Asn Thr Gly Leu Ala Leu His Cys Gln Gl - #n Phe Trp Ala Met Phe# 910- Leu Lys Lys Ala Ala Tyr Ser Trp Arg Glu Tr - #p Lys Met Val Ala Ala# 925- Gln Val Leu Val Pro Leu Thr Cys Val Thr Le - #u Ala Leu Leu Ala Ile# 940- Asn Tyr Ser Ser Glu Leu Phe Asp Asp Pro Me - #t Leu Arg Leu Thr Leu945 9 - #50 9 - #55 9 -#60- Gly Glu Tyr Gly Arg Thr Val Val Pro Phe Se - #r Val Pro Gly Thr Ser# 975- Gln Leu Gly Gln Gln Leu Ser Glu His Leu Ly - #s Asp Ala Leu Gln Ala# 990- Glu Gly Gln Glu Pro Arg Glu Val Leu Gly As - #p Leu Glu Glu Phe Leu# 10050- Ile Phe Arg Ala Ser Val Glu Gly Gly Gly Ph - #e Asn Glu Arg Cys Leu# 10205- Val Ala Ala Ser Phe Arg Asp Val Gly Glu Ar - #g Thr Val Val Asn Ala# 10401030 - # 1035- Leu Phe Asn Asn Gln Ala Tyr His Ser Pro Al - #a Thr Ala Leu Ala Val# 10550- Val Asp Asn Leu Leu Phe Lys Leu Leu Cys Gl - #y Pro His Ala Ser Ile# 10705- Val Val Ser Asn Phe Pro Gln Pro Arg Ser Al - #a Leu Gln Ala Ala Lys# 10850- Asp Gln Phe Asn Glu Gly Arg Lys Gly Phe As - #p Ile Ala Leu Asn Leu# 11005- Leu Phe Ala Met Ala Phe Leu Ala Ser Thr Ph - #e Ser Ile Leu Ala Val# 11201110 - # 1115- Ser Glu Arg Ala Val Gln Ala Lys His Val Gl - #n Phe Val Ser Gly Val# 11350- His Val Ala Ser Phe Trp Leu Ser Ala Leu Le - #u Trp Asp Leu Ile Ser# 11505- Phe Leu Ile Pro Ser Leu Leu Leu Leu Val Va - #l Phe Lys Ala Phe Asp# 11650- Val Arg Ala Phe Thr Arg Asp Gly His Met Al - #a Asp Thr Leu Leu Leu# 11805- Leu Leu Leu Tyr Gly Trp Ala Ile Ile Pro Le - #u Met Tyr Leu Met Asn# 12001190 - # 1195- Phe Phe Phe Leu Gly Ala Ala Thr Ala Tyr Th - #r Arg Leu Thr Ile Phe# 12150- Asn Ile Leu Ser Gly Ile Ala Thr Phe Leu Me - #t Val Thr Ile Met Arg# 12305- Ile Pro Ala Val Lys Leu Glu Glu Leu Ser Ly - #s Thr Leu Asp His Val# 12450- Phe Leu Val Leu Pro Asn His Cys Leu Gly Me - #t Ala Val Ser Ser Phe# 12605- Tyr Glu Asn Tyr Glu Thr Arg Arg Tyr Cys Th - #r Ser Ser Glu Val Ala# 12801270 - # 1275- Ala His Tyr Cys Lys Lys Tyr Asn Ile Gln Ty - #r Gln Glu Asn Phe Tyr# 12950- Ala Trp Ser Ala Pro Gly Val Gly Arg Phe Va - #l Ala Ser Met Ala Ala# 13105- Ser Gly Cys Ala Tyr Leu Ile Leu Leu Phe Le - #u Ile Glu Thr Asn Leu# 13250- Leu Gln Arg Leu Arg Gly Ile Leu Cys Ala Le - #u Arg Arg Arg Arg Thr# 13405- Leu Thr Glu Leu Tyr Thr Arg Met Pro Val Le - #u Pro Glu Asp Gln Asp# 13601350 - # 1355- Val Ala Asp Glu Arg Thr Arg Ile Leu Ala Pr - #o Ser Pro Asp Ser Leu# 13750- Leu His Thr Pro Leu Ile Ile Lys Glu Leu Se - #r Lys Val Tyr Glu Gln# 13905- Arg Val Pro Leu Leu Ala Val Asp Arg Leu Se - #r Leu Ala Val Gln Lys# 14050- Gly Glu Cys Phe Gly Leu Leu Gly Phe Asn Gl - #y Ala Gly Lys Thr Thr# 14205- Thr Phe Lys Met Leu Thr Gly Glu Glu Ser Le - #u Thr Ser Gly Asp Ala# 14401430 - # 1435- Phe Val Gly Gly His Arg Ile Ser Ser Asp Va - #l Gly Lys Val Arg Gln# 14550- Arg Ile Gly Tyr Cys Pro Gln Phe Asp Ala Le - #u Leu Asp His Met Thr# 14705- Gly Arg Glu Met Leu Val Met Tyr Ala Arg Le - #u Arg Gly Ile Pro Glu# 14850- Arg His Ile Gly Ala Cys Val Glu Asn Thr Le - #u Arg Gly Leu Leu Leu# 15005- Glu Pro His Ala Asn Lys Leu Val Arg Thr Ty - #r Ser Gly Gly Asn Lys# 15201510 - # 1515- Arg Lys Leu Ser Thr Gly Ile Ala Leu Ile Gl - #y Glu Pro Ala Val Ile# 15350- Phe Leu Asp Glu Pro Ser Thr Gly Met Asp Pr - #o Val Ala Arg Arg Leu# 15505- Leu Trp Asp Thr Val Ala Arg Ala Arg Glu Se - #r Gly Lys Ala Ile Ile# 15650- Ile Thr Ser His Ser Met Glu Glu Cys Glu Al - #a Leu Cys Thr Arg Leu# 15805- Ala Ile Met Val Gln Gly Gln Phe Lys Cys Le - #u Gly Ser Pro Gln His# 16001590 - # 1595- Leu Lys Ser Lys Phe Gly Ser Gly Tyr Ser Le - #u Arg Ala Lys Val Gln# 16150- Ser Glu Gly Gln Gln Glu Ala Leu Glu Glu Ph - #e Lys Ala Phe Val Asp# 16305- Leu Thr Phe Pro Gly Ser Val Leu Glu Asp Gl - #u His Gln Gly Met Val# 16450- His Tyr His Leu Pro Gly Arg Asp Leu Ser Tr - #p Ala Lys Val Phe Gly# 16605- Ile Leu Glu Lys Ala Lys Glu Lys Tyr Gly Va - #l Asp Asp Tyr Ser Val# 16801670 - # 1675- Ser Gln Ile Ser Leu Glu Gln Val Phe Leu Se - #r Phe Ala His Leu Gln# 16950- Pro Pro Thr Ala Glu Glu Gly Arg 1700- (2) INFORMATION FOR SEQ ID NO:76:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "Oligonucleotide primer"/desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:# 18 CT- (2) INFORMATION FOR SEQ ID NO:77:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 349 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:77:- Gly Gln Leu Leu Gly His Asn Gly Ala Gly Ly - #s Thr Thr Ser Ile Gly# 15- Arg Pro Thr Gly Ile Gly Tyr Asp Arg Gly Cy - #s Pro Gln Leu Asp Leu# 30- Thr Val Glu His Leu Leu Lys Gly Lys Leu Le - #u Lys Asn Leu Ser Gly# 45- Gly Met Arg Lys Leu Gly Leu Asp Glu Pro Th - #r Ala Gly Met Asp Arg# 60- Leu Arg Lys Arg Thr Ile Leu Thr Thr His Me - #t Asp Glu Ala Leu Gly#80- Asp Ile Met His Gly Leu Gly Leu Lys Gln Ly - #s Gly Gly Tyr Thr Val# 95- Glu Gln Pro Ala Arg Phe Leu Leu Ser Phe Gl - #y Ser Thr Glu Val Phe# 110- Ile Gly Asp His Arg Gly Ala Gln Phe Lys Ly - #s Tyr Ser Arg Trp Gln# 125- Val Leu Pro Leu Asp Leu Thr Glu Val Phe Pr - #o Leu Pro Gly Ala Leu# 140- Phe Asn Tyr His Thr Ser Val Ser Gln Ala Le - #u Ala Ser Thr Phe Glu145 1 - #50 1 - #55 1 -#60- Arg Gln Ala His Gln Phe Gly Phe Leu Asp Il - #e Ser Leu Leu Phe Asp# 175- His Ala Leu Leu Tyr Ser Pro Tyr Phe Phe Al - #a Leu Ile Ala Leu Val# 190- Glu Leu Leu Phe Leu Pro Gly Ala Asn Trp Gl - #y Phe Leu Arg Met Leu# 205- Pro Val Glu Arg Arg Asn Leu Ile Lys Leu Ly - #s Ala Val Leu Leu Ala# 220- Val Glu Cys Phe Gly Leu Leu Gly Asn Gly Al - #a Gly Lys Thr Thr Thr225 2 - #30 2 - #35 2 -#40- Phe Leu Thr Gly Ser Ser Gly Ala Gly Gly As - #p Val Ile Gly Tyr Cys# 255- Pro Gln Phe Asp Ala Leu Thr Gly Arg Glu Le - #u Ala Gly Ala Glu Leu# 270- His Ala Lys Leu Val Arg Tyr Ser Gly Gly Ly - #s Arg Lys Ser Gly Ala# 285- Leu Leu Pro Gln Ile Leu Asp Glu Pro Gly As - #p Pro Ala Arg Arg Trp# 300- Glu Ser Ala Thr Ser His Ser Met Glu Cys Gl - #u Ala Leu Cys Arg Ala305 3 - #10 3 - #15 3 -#20- Gly Gly Ser Gln Leu Lys Ser Gly Tyr Val Pr - #o Ser Val Leu Leu Pro# 335- Trp Phe Gly Val Asp Gln Ser Leu Glu Phe Le - #u Ala Leu# 345- (2) INFORMATION FOR SEQ ID NO:78:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1974 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:78:- CAGCGGGAGG ACGCGCCAAC ATCCCCGCTG CTGTGCTGGG CCCGGGGCGT GC - #CCGCCGCT 60- GCTCCCACCT CTGGGCCGGG CTGGGGCCGC CCGGGGGCCC TGTTCCTCGG CA - #TTGCGGGC 120- CTGGTGGGCA GAACCGCGGA GAGGGCTTCT TTTCCCCAAG GGCAGCGTCT TG - #GGGCCCGG 180- CCACTGGCTG ACCCGCAGCG GCTCCGGCCA TGCCTGGCTG GCCCTGGGGG CT - #GCTGCTGA 240- CGGCAGGCAC GCTCTTCGCC GCCCTGAGTC CTGGGCCGCC GGCGCCCGCC GA - #CCCCTGCC 300- ACGATGAGGG GGGTGCGCCC CGCGGCTGCG TGCCAGGACT GGTGAACGCC GC - #CCTGGGCC 360- GCGAGGTGCT GGCTTCCAGC ACGTGCGGGC GGCCGGCCAC TCGGGCCTGC GA - #CGCCTCCG 420- ACCCGCGACG GGCACACTCC CCCGCCCTCC TTACTTCCCC AGGGGGCACG GC - #CAGCCCTC 480- TGTGCTGGCG CTCGGAGTCC CTGCCTCGGG CGCCCCTCAA CGTGACTCTC AC - #GGTGCCCC 540- TGGGCAAGGC TTTTGAGCTG GTCTTCGTGA GCCTGCGCTT CTGCTCAGCT CC - #CCCAGCCT 600- CCGTGGCCCT GCTCAAGTCT CAGGACCATG GCCGCAGCTG GGCCCCGCTG GG - #CTTCTTCT 660- CCTCCCACTG TGACCTGGAC TATGGCCGTC TGCCTGCCCC TGCCAATGGC CC - #AGCTGGCC 720- CAGGGCCTGA GGCCCTGTGC TTCCCCGCAC CCCTGGCCCA GCCTGATGGC AG - #CGGCCTTC 780- TGGCCTTCAG CATGCAGGAC AGCAGCCCCC CAGGCCTGGA CCTGGACAGC AG - #CCCAGTGC 840- TCCAAGACTG GGTGACCGCC ACCGACGTCC GTGTAGTGCT CACAAGGCCT AG - #CACGGCAG 900- GTGACCCCAG GGACATGGAG GCCGTCGTCC CTTACTCCTA CGCAGCCACC GA - #CCTCCAGG 960- TGGGCGGGCG CTGCAAGTGC AATGGACATG CCTCACGGTG CCTGCTGGAC AC - #ACAGGGCC1020- ACCTGATCTG CGACTGTCGG CATGGCACCG AGGGCCCTGA CTGCGGCCGC TG - #CAAGCCCT1080- TCTACTGCGA CAGGCCATGG CAGCGGGCCA CTGCCCGGGA ATCCCACGCC TG - #CCTCGCTT1140- GCTCCTGCAA CGGCCATGCC CGCCGCTGCC GCTTCAACAT GGAGCTGTAC CG - #ACTGTCCG1200- GCCGCCGCAG CGGGGGTGTC TGTCTCAACT GCCGGCACAA CACCGCCGGC CG - #CCACTGCC1260- ACTACTGCCG GGAGGGCTTC TATCGAGACC CTGGCCGTGC CCTGAGTGAC CG - #TCGGGCTT1320- GCAGGGCCTG CGACTGTCAC CCGGTTGGTG CTGCTGGCAA GACCTGCAAC CA - #GACCACAG1380- GCCAGTGTCC CTGCAAGGAT GGCGTCACTG GCCTCACCTG CAACCGCTGC GC - #GCCTGGCT1440- TCCAGCAAAG CCGCTCCCCA GTGGCGCCCT GTGTTAAGAC CCCTATCCCT GG - #ACCCACTG1500- AGGACAGCAG CCCTGTGCAG CCCCAGGACT GTGACTCGCA CTGCAAACCT GC - #CCGTGGCA1560- GCTACCGCAT CAGCCTAAAG AAGTTCTGCA AGAAGGACTA TGCGGTGCAG GT - #GGCGGTGG1620- GTGCGCGCGG CGAGGCGCGC GGCGCGTGGA CACGCTTCCC GGTGGCGGTG CT - #CGCCGTGT1680- TCCGGAGCGG AGAGGAGCGC GCGCGGCGCG GGAGTAGCGC GCTGTGGGTG CC - #CGCCGGGG1740- ATGCGGCCTG CGGCTGCCCG CGCCTGCTCC CCGGCCGCCG CTACCTCCTG CT - #GGGGGGCG1800- GGCCTGGAGC CGCGGCTGGG GGCGCGGGGG GCCGGGGGCC CGGGCTCATC GC - #CGCCCGCG1860- GAAGCCTCGT GCTACCCTGG AGGGACGCGT GGACGCGGCG CCTGCGGAGG CT - #GCAGCGAC1920- GCGAACGGCG GGGGCGCTGC AGCGCCGCCT GAGCCCGCCG GCTGGGCAAG GC - #GC1974- (2) INFORMATION FOR SEQ ID NO:79:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 612 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: unknown- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79:- Met Ile Thr Ser Val Leu Arg Tyr Val Leu Al - #a Leu Tyr Phe Cys Met# 15- Gly Ile Ala His Gly Ala Tyr Phe Ser Gln Ph - #e Ser Met Arg Ala Pro# 30- Asp His Asp Pro Cys His Asp His Thr Gly Ar - #g Pro Val Arg Cys Val# 45- Pro Glu Phe Ile Asn Ala Ala Phe Gly Lys Pr - #o Val Ile Ala Ser Asp# 60- Thr Cys Gly Thr Asn Arg Pro Asp Lys Tyr Cy - #s Thr Val Lys Glu Gly#80- Pro Asp Gly Ile Ile Arg Glu Gln Cys Asp Th - #r Cys Asp Ala Arg Asn# 95- His Phe Gln Ser His Pro Ala Ser Leu Leu Th - #r Asp Leu Asn Ser Ile# 110- Gly Asn Met Thr Cys Trp Val Ser Thr Pro Se - #r Leu Ser Pro Gln Asn# 125- Val Ser Leu Thr Leu Ser Leu Gly Lys Lys Ph - #e Glu Leu Thr Tyr Val# 140- Ser Met His Phe Cys Ser Arg Leu Pro Asp Se - #r Met Ala Leu Tyr Lys145 1 - #50 1 - #55 1 -#60- Ser Ala Asp Phe Gly Lys Thr Trp Thr Pro Ph - #e Gln Phe Tyr Ser Ser# 175- Glu Cys Arg Arg Ile Phe Gly Arg Asp Pro As - #p Val Ser Ile Thr Lys# 190- Ser Asn Glu Gln Glu Ala Val Cys Thr Ala Se - #r His Ile Met Gly Pro# 205- Gly Gly Asn Arg Val Ala Phe Pro Phe Leu Gl - #u Asn Arg Pro Ser Ala# 220- Gln Asn Phe Glu Asn Ser Pro Val Leu Gln As - #p Trp Val Thr Ala Thr225 2 - #30 2 - #35 2 -#40- Asp Ile Lys Val Val Phe Ser Arg Leu Ser Pr - #o Asp Gln Ala Glu Leu# 255- Tyr Gly Leu Ser Asn Asp Val Asn Ser Tyr Gl - #y Asn Glu Thr Asp Asp# 270- Glu Val Lys Gln Arg Tyr Phe Tyr Ser Met Gl - #y Glu Leu Ala Val Gly# 285- Gly Arg Cys Lys Cys Asn Gly His Ala Ser Ar - #g Cys Ile Phe Asp Lys# 300- Met Gly Arg Tyr Thr Cys Asp Cys Lys His As - #n Thr Ala Gly Thr Glu305 3 - #10 3 - #15 3 -#20- Cys Glu Met Cys Lys Pro Phe His Tyr Asp Ar - #g Pro Trp Gly Arg Ala# 335- Thr Ala Asn Ser Ala Asn Ser Cys Val Ala Cy - #s Asn Cys Asn Gln His# 350- Ala Lys Arg Cys Arg Phe Asp Ala Glu Leu Ph - #e Arg Leu Ser Gly Asn# 365- Arg Ser Gly Gly Val Cys Leu Asn Cys Arg Hi - #s Asn Thr Ala Gly Arg# 380- Asn Cys His Leu Cys Lys Pro Gly Phe Val Ar - #g Asp Thr Ser Leu Pro385 3 - #90 3 - #95 4 -#00- Met Thr His Arg Arg Ala Cys Lys Ser Cys Gl - #y Cys His Pro Val Gly# 415- Ser Leu Gly Lys Ser Cys Asn Gln Ser Ser Gl - #y Gln Cys Val Cys Lys# 430- Pro Gly Val Thr Gly Thr Thr Cys Asn Arg Cy - #s Ala Lys Gly Tyr Gln# 445- Gln Ser Arg Ser Thr Val Thr Pro Cys Ile Ly - #s Ile Pro Thr Lys Ala# 460- Asp Phe Ile Gly Ser Ser His Ser Glu Glu Gl - #n Asp Gln Cys Ser Lys465 4 - #70 4 - #75 4 -#80- Cys Arg Ile Val Pro Lys Arg Leu Asn Gln Ly - #s Lys Phe Cys Lys Arg# 495- Asp His Ala Val Gln Met Val Val Val Ser Ar - #g Glu Met Val Asp Gly# 510- Trp Ala Lys Tyr Lys Ile Val Val Glu Ser Va - #l Phe Lys Arg Thr Glu# 525- Asn Met Gln Arg Arg Gly Glu Thr Ser Leu Tr - #p Ile Ser Pro Gln Gly# 540- Val Ile Cys Lys Cys Pro Lys Leu Arg Val Gl - #y Arg Arg Tyr Leu Leu545 5 - #50 5 - #55 5 -#60- Leu Gly Lys Asn Asp Ser Asp His Glu Arg As - #p Gly Leu Met Val Asn# 575- Pro Gln Thr Val Leu Val Glu Trp Glu Asp As - #p Ile Met Asp Lys Val# 590- Leu Arg Phe Ser Lys Lys Asp Lys Leu Gly Gl - #n Cys Pro Glu Ile Thr# 605- Ser His Arg Tyr 610- (2) INFORMATION FOR SEQ ID NO:80:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "Oligonucleotide primer /desc sense str - #and"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80:# 17 C- (2) INFORMATION FOR SEQ ID NO:81:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "Oligonucleotide primer /desc#strand" antisense- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:81:# 17 C- (2) INFORMATION FOR SEQ ID NO:82:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "Oligonucleotide primer /desc sense str - #and"- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:82:# 17 G- (2) INFORMATION FOR SEQ ID NO:83:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "Oligonucleotide primer /desc#strand" antisense- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83:# 17 G__________________________________________________________________________

Number	Name	Date
4675285	Ckark et al.	Jun 1987
5252475	Reth	Oct 1993
5550037	Francavilla et al.	Aug 1996
5565331	Tessier-Lavigore et al.	Oct 1996

Number	Date	Country
0 668 291 A2	Aug 1995	EPX
40 21 458	Aug 1991	DEX
WO 9213071	Aug 1992	WOX
WO 9513367	May 1995	WOX
WO 9702346	Jan 1997	WOX

Human chromosome 16 genes, compositions, methods of making and using same

Information

Patent Number

Date Filed

Date Issued

Inventors

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

Government Interests

US Referenced Citations (4)

Foreign Referenced Citations (5)

Non-Patent Literature Citations (95)

Continuation in Parts (1)