Patent Application
20100311955
The present invention relates to biotechnology, and in particular to an antibody, the preparation method and uses thereof.
Tranplantation of hematopoietic stem/progenitor cells (HSCs) has currently become well-recongnized as the only effective treatment method for certain malignant blood diseases and solid tumors. However, because of numerous T lymphocyte contained in the grafts, acute, severe graft versus-host disease (GVHD) occurs after grafting, which is one of the major cause that affect whether the heterologous genetic hematopoietic stem cells grafting can survival long or not. The primary problem of tranplantation of hematopoietic stem/progenitor cells is how to obtain great amount of purified hematopoietic stem cells to remove the interference of the impurity cells in grafts. Hence, to purge or enrich specific cells in the grafts is a problem concerned in present grafting field. Since HSCs have no definite morphological features, but mainly perform as lymphocyte-like mononuclear blast cells, they can only be indentified by some proteins on the cell surface. CD34, a transmembrane glycoprotein of 110 kDa, is the broadest and earliest antigen so far recognized as expressed on human HSC, and is a good marker to evaluate the quality and quantity of HSC. With the development of CD34 antibody-based positive selection technology, CD34+ hematopoietic stem cells exhibit to reconstitute of the hematopoietic function on experiment animals and human beings. [Andrews R G, Bryant E M, Bartelmez S H, Muirhead D T, Knitter G H, Bensinger W, Strong D M, Bernstien I D (1992) CD34+ marrow cells, devoid of T and B Lymphocytes, reconstitute stable lymphopoiesis and myelopoiesis in lethally irradiated baboons. Blood 80:1693] [Shpall E J, Jones R B, Franklin W, Bearman S, Stemmer S, Hami L, Petsche D, Taffs S, Myers S, Purdy M, Heimfeld S, Halligan Berenson R J (1994) Transplantation of autologous CD34+ hematopoietic progenitor cells into breast cancer patient following high-dose chemotherapy. J Clin Oncol 12:28], hence, they have become an optimal target cell for hematopoietic stem cells grafting due to their unique biological characteristics and function.
Currently, the mostly used methods for cell separation and purification included adhesion, differential centrifugation, discontinuous density gradient method and the like. Although these technologies have solved many practical problems, they hinder the progress of cell biology and the development and application of cell biotechnology product due to long operation period, low cell recovery rate, and high cost for separation and purification. Immunomagnetic cell sorting technology is a recently developed new cell separation technology, which has advantages of simple and easy to operate, high separation purity, and retaining the cell activity, etc. and can be used in separating and examining various marrow and blood cells, tumor cells, bacteria and other microorganisms, etc. Thus, it is favored by researchers of biomedical field. Recently, immunomegatic beads are developed gradually towards submicron size, which allows the magnetic beads to separate cells easily and rapidly at low gradient magnetic field, and to perform subsequent analysis and application directly without dissociation of the magnetic beads from cell surface, and the beads have no effect on the cell activities after separation. The principle of separation is: using magnetic nano particles as vector to conjugate the antibody on their surfaces, due to the specific affinity of antibody, the antibody on the magnetic nano particles binds the specific surface antigen on the cells to form cell-antibody-magnetic nano particles complex, under the oriented control of applied magnetic field, target cells can be isolated directly from original cell mixture in one step by the operation of affinity adsorption, washing and desorption, etc. Nano magnetic cells affinity separation has dual advantages, easily and conveniently magnetic separation and high selectivity of affinity separation.
With the coming out of immunomagnetic beads, use of immunomagnetic beads, which is prepared by the conjugation of CD34 monoclonal antibody to magnetic nano microspheres for sorting marrow hematopoietic stem cells has been applied to clinical hematopoietic stem cells transplantation. Owing to the fact that magnetic separation has advantages of easy and convenient operation, rapid and complete separation, and high cell purity, etc when sorting cells; HSC transplantation has become the first choice for certain malignant hematological diseases, severe immunodeficiency and low hematopoietic function resulted from radiotherapy and chemotherapy for tumors. During the course of hematopoietic stem cell transplantation, these antibodies that bind to the magnetic beads will inevitably enter into human body along hematopoietic stem cells. Murine-derived monoclonal antibody produced by hybridoma technology may cause human anti-mouse antibody response (HAMA) after entering human body [Winter G, Harris W J. Humanized antibodies. Immunol Today. 1993 June; 14(6):243-6]. Hence, it is an urgent problem for those skilled in the art to construct a low immunogenicity antibody which can reduce the murine component, and effectively reduce the incidence rate of HAMA by genetic engineering technology.
Humanized antibody is a new genetic engineering antibody developed to overcome the deficiency of murine derived monoclonal antibody. The first generation of humanized antibody is a chimeric antibody composed of a variable region of murine monoclonal antibody and a constant region of human antibody. Since the affinity between antibody and antigen is determined by its variable region, chimeric antibody keeps good affinity, meanwhile, the immunogenicity is reduced to a certain extent. The variable regions of antibody are composed of hypervariable regions (CDRs) and frame regions (FRs), wherein CDRs are highly variable regions which mediate directly the binding of antibody to antigen, FR regions are relative conserved, and are used as support to maintain the spatial position of CDR regions which are the main regions to produce immunogenicity in the variable regions. Since chimeric antibody retains the variable region of murine derived antibody, it may still cause strong HAMA reaction in clinical application. Therefore, in order to reduce the immunogenicity of chimeric antibody to the greatest extent, people consider grafting directly murine CDR region to FR region of human derived antibody variable region, yielding CDR graft antibody, namely humanized antibody. However, the transfer of murine CDRs alone usually results in a significant loss of antigen binding, because certain framework residues are critical for preserving the CDR conformations or are directly involved in antigen binding. In most cases, the successful design of humanized antibodies requires that these key murine residues be reintroduced into the human framework to restore affinity. Hence, it is critical for antibody humanization of how to determine the important residues that affect the antibody activity in FR.
An object of the present invention is to provide a humanized anti-human CD34 antibody, an antibody keeping good affinity obtained by grafting a murine CDR region into a humanized antibody framework region, and at the same time reshaping the amino acids of the humanized antibody framework region.
Accordingly, the present invention provides a humanized anti-human CD34 antibody, said antibody comprises at least one antigen binding site, said antigen binding site at least comprises:
The above first variable region and second variable region correspond to heavy chain variable region and light chain variable region of immunoglobulin, respectively, wherein, a hypervariable regions (CDR) of the first variable region sequentially comprises CDR1, CDR2 and CDR3, of which the amino acid sequences are CDR1: GYTFTNYGMN; CDR2: WINTNTGEPKYAEEFKG and CDR3: GYGNYARGAWLAY, respectively. Besides the above CDR regions, the first variable region further comprises a framework region (FR) derived from human immunoglobulin heavy chain variable region. In order to improve the affinity of the antibody, the amino acids of the framework region have been partially reshaped in the present invention, thereby obtaining the first variable region having the amino acid sequence of SEQ ID NO: 6, with SEQ ID NO: 5 being the corresponding nucleotide sequence encoding the same. Similarly, a hypervariable regions (CDR) of the second variable region sequentially comprises CDR1′, CDR2′ and CDR3′, of which the amino acid sequences are CDR1′: RSSQTIVHSNGNTYLE; CDR2′: QVSNRFS and CDR3′: FQGSHVPRT, respectively. Besides the above CDR regions, the second variable region further comprises a framework region (FR) derived from the human immunoglobulin light chain variable region. In order to improve the affinity of the antibody, the amino acids of the framework region have been partially reshaped in the present invention, thereby obtaining the second variable region having the amino acid sequence of SEQ ID NO: 8, with SEQ ID NO: 7 being the corresponding nucleotide sequence encoding the same.
Further, in the humanized anti-human CD34 antibody of the present invention, said antigen binding site comprises:
The human immunoglobulin constant region can be selected from various types of immunoglobulin, preferably, the human immunoglobulin heavy chain constant region or fragment thereof is type γ (IgG1) having the amino acid sequence as shown in SEQ ID NO: 2; the human light chain constant region or fragment thereof is type κ or type λ, a preferable amino acid sequence of the light chain constant region is shown in SEQ ID NO: 4.
Another object of the present invention is to provide a nucleotide molecule encoding the above-mentioned humanized human CD34 antibody, a host transformed by the nucleotide molecule is also included in the present invention.
The present invention further provides a preparation method for the above-mentioned humanized anti-CD34 antibody, comprising designing an amino acid sequence of a humanized antibody h4C8 based on computer-assisted molecular modeling, performing whole gene synthesis of the heavy chain and light chain variable region genes and splicing the same with human antibody heavy and light chain constant regions, respectively though genetic recombination, cloning into eukaryotic expression vectors to construct expression vectors for humanized antibody heavy and light chain, then co-transfecting the expression vectors of light and heavy chain into CHO cells by liposome method, and then screening, culturing and purifying to obtain the product.
A serial of experiments have been carried out in the present invention using the resultant antibody, the result of antigen-binding activities assay in vitro indicates that h4C8 can bind specifically to human myeloid leukemia cell KG-1a which highly expressed antigen CD34. The result of competitive inhibition experiment indicates that h4C8 retains the affinity and specificity of original murine-derived antibody. The antibody can be conjugated with nano magnetic materials to prepare immunomagnetic beads to screen marrow hemopoietic stem cells. It may effectively reduce the incidence rate of HAMA and improve the security of clinical transplantation of hematopoietic stem cells and can be used in the treatment of some malignant hematologic diseases and solid tumors.
A method of carbodiimide/N-Hydroxysuccinimide (EDC/NHS) is used to activate the carboxyl group on the surface of the magnetic beads, the activated carboxyl group then reacts with the amino group on the antibody, conjugates CD34 antibody, and prepares CD34+ immunomagnetic beads that can effectively isolate cells. A sorting model is prepared using CD34+ KG-1a cells and CD34− Raji cells, and CD34 monoclonal immunomangetic beads are used to sort CD34+ cells. Also, CD34+ immunomagnetic nano particles are used to sort umbilical cord blood stem cell, and the purity and yield of the cells obtained by sorting are analyzed.
Anti-CD34 monoclonal antibody binding to magnetic nano particles is used as antibody vector to binds CD34+ hematopoietic stem/progenitor cells and thus forms immunocomplex. Under the effect of applied magnetic field, the complex moves dynamically and isolates the hematopoietic stem/progenitor cells that specifically bind the antibody on the magnetic nano particles from other cells (tumor cells that do not express CD34 antigen). The purified hematopoietic stem cells are transfused back to patients to reconstruct the hematopoietic and immune systems and effectively reduce the recurrence of tumors.
The following examples are just further description of the present invention and should not be understood as the limitation to the present invention.
KG-1a (human leukaemia cell, ATCC, CCL-246.1)
Raji (human B lymphoma cell, ATCC, CCL-86)
In the present invention, 4C8 refers to that obtained by the method disclosed in the invention published as Chinese invention patent application No. 200710094456.9 on Aug. 20, 2008, entitled anti-human CD34 antibody, the preparation method and uses thereof, based on the application filed on Dec. 13, 2007 by the present applicant, the method of which will be described in details below.
Cloning of Genes Encoding Human Antibody Light and Heavy Chain Constant Region
Healthy human lymphoma cells were isolated from lymphoma cells separation solution (Dingguo Biotechnology Development Company, CHINA), total RNA was extracted using Trizol reagent (Invitrogen), the genes encoding antibody heavy chain and light chain constant region were amplified by RT-PCR reaction, with the primers designed according to the sequences reported in the reference (Cell, 1980, 22: 197-207) and reference (Nucleic Acids Research, 1982, 10: 4071-4079), respectively. The PCR products were purified by agarose gel electrophoresis and recovered and cloned into pGEM-T vector, correct clones were obtained by sequencing verification. SEQ ID NO:1 and SEQ ID NO:2 show the nucleotide sequence and amino acid sequence of the heavy chain constant regions (CH), respectively. SEQ ID. NO:3 and SEQ ID NO:4 show the nucleotide sequence and amino acid sequence of the light chain constant regions (CL), respectively. In this example, the correct clones were marked as pGEM-T/CH and pGEM-T/CL.
BALB/c mice (obtained from SHANGHAI LABORATORY ANIMAL CENTER) were immunized with KG-1a cells which highly express CD34 (KG-1a cell ATCC CCL-246.1), allowing the B lymphocytes cells in the spleen to produce anti-human CD34 antibody, the splenocytes from immunized mice were fused with NS-1 (BALB/c mice myeloma cells), selectively cultured by HAT, after culturing, the anti-human CD34 positive clones were selected and after cloning, the sub-clones were selected to ensure the antibody is produced by single cloning cell, then culture supernatants from each cloning cell were collected, and the anti-human CD34 monoclonal antibody 4C8 was obtained by Protein G column purification.
Cloning of Gene Encoding Anti-Human CD34 Monoclonal Antibody 4C8 Variable Region
Total RNA was extracted from 2×106 hybridoma cell 4C8 which secrets anti-human CD34 with “Trizol Reagent” reagent kit (Gibco BRL, USA) according to its instructions. Three gene specific primers GSP1, GSP2, GSP3 were designed respectively by selecting the proper positions of antibody (IgG1,κ) heavy chain and light chain constant regions, wherein, GSP1 is apart furthest from the variable region gene, and used for reverse transcription reaction, GSP2 is used for first run PCR amplification, GSP3 is used for nest amplification. The primers were synthesized by SHANGHAI SANGON BIOLOGICAL TECHNOLOGY & SERVICES CO., LTD, the sequences of which were as follows: GSP1-H, 5′-GTA GAG GTC AGA CTG CAG GAC-3′; GSP2-H, 5′-CTC AGG GAA ATA GCC CTT GAC-3′; GSP3-H, 5′-AGA TCC AGG GGC CAG TGG ATA GAC-3′. GSP1-L, 5′-TTG CTG TCC TGA TCA GTC CAA CT-3′; GSP2-L, 5′-TGT CGT TCA CTG CCA TCA ATC TT-3′; GSP3-L, 5′-TTG TTC AAG AAG CAC ACG ACT GA-3′.
Total RNA was reverse transcribed into cDNA using GSP1 as primer according to the instruction of 5′RACE reagent kit (Gibco BRL, US), then poly(C) tail was added to the 3′ end of first chain cDNA, after tailing, PCR amplification was carried out using GSP2 and AAP as primers, the amplification product was diluted 100 times and nest PCR amplification was carried out using AUAP and GSP3 as primer. Both PCR reactions were hot-start PCR, the reaction conditions were: 94□ for 5 minutes (min); 94□ for 45 seconds (sec), 60□ for 45 seconds, 72□ for 70 seconds, for 30 cycles; 72□ for 7 minutes. The products of nest PCR were separated by 1% agarose gel electrophoresis, then the fragment of interest was recovered and purified, and cloned into pGEM-T easy vector, the positive clones were selected and sequenced, and analysis was carried out to the sequencing results. Then the correct pGEM-T/VH confirmed by sequencing was taken as template to design the primers H sense AAG CTT GCC GCC ACC ATG GAT TGG CTG TGG AAC TTG and H antisense GCT AGC TGC AGA GAC AGT GAC CAG, VH chain variable region genes were amplified using Onestep RT-PCR reaction to make its 5′ end contain restriction enzyme site HindIII, and 3′ end contain restriction enzyme site Nhe I, the reaction conditions were: 50□ for 30 min; 95□ for 15 min; 94□ for 50 sec, 58□ for 50 sec, 72□ for 50 sec, for 30 cycles; 72□ for 10 min. The PCR products were purified by agarose gel electrophoresis and recovered and cloned into pGEM-T vector (Promega), the positive clones were selected and verified by sequencing, the result demonstrated that the sequence coincides completely with the sequence of 5′RACE. SEQ ID NO:9 and SEQ ID NO:10 show the nucleotide sequence and amino acid sequence of 4C8 heavy chain variable region, respectively. In this example, the correct clones were designated as pGEM-T/VH.
Taking the correct pGEM-T/VL verified by sequencing as template to design the primers H sense AAG CTT GCC GCC ACC ATG AAG TTG CCT GTT AGG CTG and L antisense GAC AGA TGG TGC AGC CAC AGT CCG TTT GAT TTC CAG CTT G, VL gene was amplified using Onestep RT-PCR reaction to make its 5′ end contain restriction enzyme site HindIII, and 3′ end contain the complementary sequence of 5′ end of human antibody light chain constant region, the reaction conditions were: 94□ for 5 min; 94□ for 50 sec, 58□ for 50 sec, 72□ for 1 min, for 30 cycles; 72□ for 10 min. The PCR products were purified by agarose gel electrophoresis and recovered and cloned into pGEM-T vector (Promega), the positive clones were selected and verified by sequencing, the result demonstrated that the sequence coincides completely with the sequence of 5′RACE. SEQ ID NO:11 and SEQ ID NO:12 show the nucleotide sequence and amino acid sequence of 4C8 light chain variable region, respectively. In this example, the correct clones were designated as pGEM-T/VL.
Construction of Chimeric Antibody c4C8
The above plasmid pGEM-T/VH which was sequenced as correct after Onestep RT-PCR was digested by HindIII and NheI, 430 bp digested fragment which was obtained after agarose gel electrophoresis purification and recovery was ligated to plasmid pGEM-T/CH which was also digested by the same enzymes, the correct clones were selected and digested by HindIII and EcoR I, after agarose gel electrophoresis purification, the fragment of interest was recovered and ligated to pcDNA3.1 (+) (Invitrogen, US) which was digested by the same enzyme using T4 DNA ligase (Invitrogen, US), to construct eukaryotic expression vector pcDNA3.1 (+) (VHCH).
The above plasmid pGEM-T/VL which was sequenced as correct after Onestep RT-PCR was fused directly to the light chain constant region of correct clone pGEM-T/VL using Overlapping PCR, the reaction conditions were: 50□ for 30 min; 95□ for 15 min; 94□ for 50 sec, 58□ for 50 sec, 72□ for 50 sec, for 30 cycles; 72□ for 10 min, yielding a PCR product VLCL, the 5′ end of which contains restriction enzyme site HindIII, and the 3′ end contains restriction enzyme site EcoR I. After agarose gel electrophoresis purification, the PCR product was recovered and cloned into pGEM-T vector (Promega), the positive clones were selected and sequenced. The VLCL gene which was sequenced as correct was cleaved from pGEM-T vector by HindIII and EcoR I and cloned into pcDNA3.1/ZEO(+) vector (Invitrogen, US) to construct eukaryotic expression vector pcDNA3.1/ZEO(+) (VLCL).
3×105 CHO-K1 cells were inoculated to 3.5 cm tissue culture dishes, and transfected when the cells were cultured to 90-95% fusion: 10 μg plasmids (4 μg plasmid cDNA3.1(+)(VHCH), plasmid pcDNA3.1/ZEO(+) (VLCL)) and 20 μl Lipofectamine-2000 Reagent (Invitrogen) were dissolved in 500 μl serum-free DMEM medium, respectively, laid still at room temperature for 5 min, the above 2 liquids were mixed and incubated at room temperature for 20 min to form DNA-liposome complex. During this period, the serum containing medium in the culture dishes was replaced by 3 ml serum-free DMEM medium, then the formed DNA-liposome complex was added to a plate and cultured for 4 hours (h) in CO2 incubator, then 2 ml DMEM complete medium containing 10% serum was supplemented, and cultured in CO2 incubator continuously. 24 h after transfection, the cells were transferred to selection medium containing 600 μg/ml G418 and 250 μg/ml Zeocin to select resistant clones. Cell culture supernatants were taken to select highly expressed clones by ELISA: the goat anti-human IgG (Fc) were coated on ELISA plate, overnight at 4□, and blocked at 37□ for 2 h using 2% BSA-PBS, the resistant clone culture supernatants to be tested or standard sample (Human myeloma IgG1, κ) were added and warm incubated at 37□ for 2 h, HRP-goat anti-human IgG(κ) were added for combining reaction, warm incubated at 37□ for 1 h and TMB was added and effected at 37□ for 5 min, and finally H2SO4 was used to stop the reaction, A450 value was measured. The highly expressed clones obtained by selection were enlarged cultured using serum-free medium, the chimeric antibody c4C8 was isolated and purified by Protein A affinity column (GE company). The purified antibody was dialyzed using PBS, and ultraviolet absorption method was used for quantification.
Homology Modeling of the Three-dimensional Structure of Murine-Derived 4C8 Monoclonal Antibody Variable Region (Fv)
The three dimensional structure of murine-derived 4C8 monoclonal antibody variable region was built by Insight II software package from Accelrys company. Firstly, the template proteins for 4C8 heavy chain and light chain variable regions proteins were searched in Protein Data Bank (PDB) by BLAST program, respectively. An antibody 1A4J which has the highest homology is selected as modeling template for 4C8, for modeling the three dimensional structure of 4C8 using Insight II program, as shown in
Design and Construction of Humanized 4C8 Antibody
Genbank database was searched for human-derived templates that are most similar to 4C8 light chain and heavy chain variable regions using BLAST program. The human-derived antibody having the highest homology with 4C8 heavy chain variable region is human antibody AAC 18206 (GenBank No. AAC18206), with the similarity of 68%, and the human-derived antibody having the highest homology with 4C8 light chain variable region is BAC01734 (GenBank No. BAC01734), with the similarity of 80%. Accordingly, AAC18206 and BAC01734 were used as the humanized templates for 4C8 heavy chain and light chain, respectively. Firstly, 4C8 heavy chain and light chain CDR regions were grafted into humanized templates AAC18206 and BAC01734 respectively to form CDR grafted antibodies, h4C8Ha and h4C8La for heavy chain and light chain, respectively. The amino acid sequences for h4C8Ha and h4C8La variable regions are shown in
Humanized antibody light chain gene was synthesized by overlapping PCR using h4C8VLa gene and pGEM-T/CL vector as template, the reaction conditions were: 95□ for 15 min; 94□ for 50 sec, 58□ for 50 sec, 72□ for 50 sec, for 30 cycles; 72□ for 10 min. The PCR product thus obtained is h4C8VLaCL, the 5′ end of which contains restriction enzyme site HindIII and signal peptide gene sequence and 3′ end of which contains translation stop code TAA and restriction enzyme site EcoRI. The sequence of signal peptide is shown in SEQ ID NO: (ATGGATTTTCAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCAGTCATAATATC CAGAGGA). The clone with correct sequence was selected and digested by Hind III and EcoRI, after agarose gel electrophoresis, the humanized antibody light chain fragment H4C8VLaCL was recovered and ligated with plasmid pcDNA3.1(+) vector (Invitrogen, USA) digested also by HindIII and EcoRI, to construct humanized heavy chain eukaryotic expression vector pcDNA3.1/ZEO(+)(h4C8VLaCL).
COS-1 cells (ATCC CRL 1650) at 0.8×105/well were inoculated to 24-well tissue culture plate, and cultured to 90-95% fusion using 10% FCS containing RPMI1640/DMEM mixed medium (16/DM medium) to perform transfection: 1 μg plasmid (0.6 μm light chain expression vector; 0.4 μg heavy chain expression vector) and 2 μl Lipofectamine2000 Reagent were dissolved in 50 μl serum-free 16/DM medium, respectively, laid still at room temperature for 5 min, the above-mentioned 2 liquids were mixed and incubated at room temperature for 20 min to form DNA-liposome complex. During this period, the serum containing medium in the 24-well culture plate was replaced by 0.5 ml serum-free 16/DM medium, then the formed DNA-liposome complex was added to the well and cultured in CO2 incubator for 4 hours (h), then 0.5 ml 16/DM medium containing 20% FCS was supplemented, and cultured in CO2 incubator continuously. After 72 h, the culture supernatants were taken for analysis, the content of antibody in the culture supernatants was determined by ELISA: the goat anti-human IgG (Fc) were coated in ELISA plate, overnight at 4□, and blocked at 37□ for 2 h using 2% BSA-PBS, the culture supernatants to be tested and standard sample (Human myeloma IgG1,κ) were added and incubated at 37□ for 2 h, HRP-goat anti-humanκ were added for combining reaction, incubated at 37□ for 1 h and TMB was added and effected at 37□ for 5 min, and finally H2SO4 was used to stop the reaction, the OD450 value was measured.
Human KG-1a cells were re-suspended in 2% FCS-PBS to 1×106 cells/ml, adding COS cells culture supernatants transfecting humanized antibody with different dilution degree, respectively, they were incubated at 4□ for 60 min, then cells were washed twice with 2% FCS-PBS, and then FITC-goat anti-human IgG (H+L) was added to the cells and incubated at 4□ for 60 min, after washing, cells were analyzed by Flow Cytometry (FCM) and calculated for fluorescence intensity. The result shows that to compared with c4C8 chimeric antibody, the humanized antibody composed of h4C8Ha and h4C8La (h4C8Ha/h4C8La) almost loses its activity completely (
By analyzing the three-dimensional structure of the modeled 4C8 monoclonal antibody variable region, we have discovered nine framework residues, L3Leu, L4Leu, L46Leu, H211e, H46Lys, H68Ala, H69Leu, H82aAsn, and H91Phe within 5 A° around the CDR regions might affect the CDR conformation of the original antibody while differ from the corresponding position of humanized template. Remaining these murine-derived amino acid residues in the constructed CDR grafted antibody can yield humanized antibody (h4C8Hb/h4C8Lb). The amino acid sequences for the variable regions of h4C8Hb and h4C8Lb are shown in
3×105 CHO-K1 cells (ATCC CRL-9618) were inoculated to 3.5 cm tissue culture dishes, and transfected when the cells were cultured to 90-95% fusion: 10 μg plasmids (4 μg plasmid pcDNA3.1(+)(Vh4C8HbCH), 6 μg plasmid pcDNA3.1/ZEO(+) (Vh4C8LbCL)) and 20 μl Lipofectamine2000 Reagent (Invitrogen) were dissolved in 500 μl serum-free DMEM medium, respectively, laid still at room temperature for 5 min, the above-mentioned two liquids were mixed and incubated at room temperature for 20 min to form DNA-liposome complex. During this period, the serum containing medium in the culture dishes was replaced by 3 ml serum-free DMEM medium, then the formed DNA-liposome complex was added to a plate and cultured for 4 hours (h) in CO2 incubator, then 2 ml DMEM complete medium containing 10% serum was supplemented, and cultured in CO2 incubator continuously. 24 h after transfection, the cell were transferred to selection medium containing 600 μg/ml G418 and 250 μg/ml Zeocin to select resistant clones. Cell culture supernatants were taken to select highly expressed clones: the goat anti-human IgG (Fc) were coated on ELISA plate, overnight at 4□, and blocked at 37□ for 2 h using 2% BSA-PBS, the culture supernatant of resistant clones to be tested or standard sample (Human myeloma IgG1, κ) were added and warm incubated at 37□ for 2 h, HRP-goat anti-human IgG(κ) were added for combining reaction, warm-incubated at 37□ for 1 h and TMB was added and effected at 37□ for 5 min, and finally H2SO4 was used to stop the reaction, A450 value was measured. The highly expressed clones obtained by selection was enlarged cultured using serum-free medium, the humanized antibody h4C8 was isolated and purified by Protein A affinity column (GE company). The purified antibody was dialyzed using PBS, and ultraviolet absorption method was used for quantification.
A fixed subsaturating concentration of fluorescently labeled antibody FITC-4C8 and serial dilution of unlabeled purified antibodies were mixed respectively and then added into target KG-1a cells (1×106/ml), and incubated at 4° C. for 60 min, the cells were washed twice with 1% FCS-PBS and examined by FCM using Cellquest software for analysis. Humanized anti-CD3 monoclonal antibody hu12F6 (preparation see to Li B H, Wang H, Dai J X, Ji J J, Qian W Z, Zhang D P, Hou S, Guo Y J. Construction and characterization of a humanized anti-human CD3 monoclonal antibody 12F6 with effective immunoregulation functions. Immunology 2005, 116(4):487-98) was used as control. Triplicate tubes were set for each concentration of the competitive antibody. The IC50 values were calculated, with the maximum fluorescence intensity indicating the average fluorescence intensity obtained in the absence of competitive antibody.
The experimental result is shown in
Activation: 0.01 mol/L NaH2PO4 Tween (0.05% Tween-20) solution, pH6.0 was taken as activated buffer solution, 2 mg carboxyl-beads (Bangs laboratories, BioMag Carboxyl (BM570), USA) was put into 2 ml centrifuge tube, and 500 μl activated buffer solution was added to mix homogeneously on the vortex mixer, then the centrifuge tube was laid on a Magnetic Separation Rack, after the magnetic beads were completely adsorbed, the supernatant was extracted by mini vacuum pump; 500 μl activated buffer solution was added to rewash the magnetic beads twice, then 485 μl activated buffer solution was added to the magnetic beads, and 2.5 mg carbodiimide (EDC, original concernation of 0.5 g/ml) and N-Hydroxysuccinimide (NHS, original concernation of 0.25 g/ml) were added respectively and mixed homogeneously on the vortex mixer to activate the 2 mg carboxyl group on the surface of magnetic beads for 30 min at room temperature.
Conjugation: 500 μl, pH7.4, 0.01 mol/L phosphate Tween (PBST, 0.05% Tween-20) solution was used as conjugated buffer, 500 μl activated buffer solution was added to rewash the activated magnetic beads 3 times, then 500 μl conjugated buffer was added to wash the magnetic beads twice; 475 μl conjugated buffer was added to re-suspend the washed magnetic beads, and 25 μl 6 mg/ml anti-CD34 antibody was added, allowing the activated carboxyl group on the magnetic beads to react with the amino group of the anti-CD34 antibody at room temperature for 3 h, then the antibody was conjugated to the surface of the magnetic beads, yielding the immunomagnetic beads.
Block: the conjugated magnetic beads were washed by 500 μl conjugated buffer twice, and 500 μl conjugated buffer containing 1% bovine serum albumin (BSA) was added to block the magnetic beads for 30 min.
Storage: the conjugated magnetic beads were washed by 500 μl conjugated buffer twice, and the magnetic beads were re-suspended in 500 μl pH7.4, 0.01 mol/L phosphate Tween (0.05% Tween-20) solution containing 0.02% NaN3, 0.1% BSA, and then stored in refrigerator at 4□ for use.
Mixing CD34+ KG-1a (human leukaemia cell) and CD34− Raji (human B lymphoma cell) in vitro, in the ratio of 1:10, to imitate human umbilical cord blood mononuclear cell (or mobilized peripheral blood mononuclear cell).
Preparing 0.1M PBS solution: NaCl 8 g, KCl 0.2 g, Na2HPO4-12H2O 3.488 g, KH2PO4 0.2 g, adding Milli-Q water to 1000 ml, adjusting to pH 7.4, sterilizing using 0.22 μm filter, storing at 4□.
Preparing immunomagnetic beads sorting buffer: 0.1M PBS solution containing 2 mM EDTA and 0.5% BSA.
Adding sorting buffer in the ratio of 90 μl/107 cells to re-suspend the above-mentioned mixed cells;
Adding CD34 immunomagnetic beads into the above-mentioned cell suspension in the ratio of 10 μl/107 cells, mixing and incubating at 4-8□ for 15 min;
Adding the sorting buffer in the ratio of 1000 μl/107 cells (1000 μl is also applicable for cells less than 107) to re-suspend the cells; laying the centrifuge tube in the magnetic field, and removing the supernatants;
Repeating the above-mentioned steps twice;
Re-suspending the cell precipitates using 500 μl sorting buffer, yielding CD34+ KG-1a cells.
The cells were stained with CD34-FITC (8G12, BD Bioscience, 340668, having no competitive effect with sorting antibody), the purity of the cells obtained by sorting were identified as more than 95%; the sorting cells were counted, with the yield of sorting CD34+ cells of more than 90%; the result is shown in
CD34+ blood stem cells were sorted from human umbilical cord blood.
Preparing 0.1M PBS solution: NaCl 8 g, KCl 0.2 g, Na2HPO4-12H2O 3.488 g, KH2PO4 0.2 g, adding Milli-Q water to 1000 ml, adjusting to pH 7.4, sterilizing using 0.24 μm filter, storing at 4□.
Preparing immunomagnetic beads sorting buffer: 0.1M PBS solution containing 2 mM EDTA and 0.5% BSA.
Isolating mononuclear cell from healthy maternal umbilical cord blood using Ficoll.
Adding sorting buffer in the ratio of 90 μl/107 cells to re-suspend the mononuclear cell;
Adding CD34 immunomagnetic beads into the above-mentioned cell suspension in the ratio of 10 μl/107 cells, mixing and incubating at 4-8□ for 15 min;
Adding the sorting buffer in the ratio of 1000 μl/107 cells (1000 μl is also applicable for cells less then 107) to re-suspend cells; laying the centrifuge tube in the magnetic field, and removing the supernatants;
Repeating the above-mentioned steps twice;
Re-suspending the cell precipitates using 500 μl sorting buffer, yielding CD34+ blood stem cells.
The cells were stained by CD34-FITC (8G12, BD Bioscience, 340668, having no competitive effect with sorting antibody), the purity of the cells obtained by sorting were identified as more than 95%; the sorting cells were counted, with the yield of sorting CD34+ cells of more than 90%; the result is shown in
The results indicate the purity and yield obtained by sorting the umbilical cord blood stem cells using the CD34 immunomagnetic beads we prepared has meet the requirement of clinical application, and is expected to be used in clinical transplantation of marrow blood stem cells.
A subsaturating concentration of FITC-CD34 (My10) (BD, 348053) and serial dilution of unlabeled purified antibodies h4C8 and unlabeled My10 (mouse anti-human CD34 hybridoma cells (ATCC, HB8483, anti-My10 clone), were cultured by serum-free medium Hybridoma-SFM (GIBCO, 12045). After purification by rProteinA affinity chromatography (GE), the culture supernatants were mixed respectively and then added into target cells KG-1a (1×106/ml), and incubated at 4□ for 60 min, the cells were washed twice with 1% FCS-PBS and examined by FCM using Cellquest software for analysis. Humanized anti-CD3 monoclonal antibody hu12F6 (preparation see to Li B H, Wang H, Dai J X, Ji J J, Qian W Z, Zhang D P, Hou S, Guo Y J. Construction and characterization of a humanized anti-human CD3 monoclonal antibody 12F6 with effective immunoregulation functions. Immunology. 2005, 116(4):487-98) was used as control. Triplicate tubes were set for each concentration of the competitive antibody. The IC50 values were calculated, with the maximum fluorescence intensity indicating the average fluorescence intensity obtained in the absence of competitive antibody. Repeating this test for 3 times, and gaining statistical the result, see to Table 2.
The test result is shown in
The mouse anti-human CD34 hybridoma cells (ATCC, HB8483, anti-My10 clone) were cultured using serum-free medium Hybridoma-SFM (GIBCO, 12045). The culture supernatants were purified by rProteinA affinity chromatography (GE), yielding anti-CD34 monoclonal antibody (My10) that meets the requirement of magnetic beads preparing conditions.
My10 and h4C8 were conjugated with magnetic beads according to the method of Example 6, to prepare CD34 nano immunomagnetic beads.
Human umbilical cord blood stem cells were sorted by My10 and h4C8 nano immunomagnetic beads according to the method of Example 8. The positive cells obtained by sorting were counted by blood counting plate, and the yield of the cells obtained by sorting by the two magnetic beads were calculated; the positive cells obtained by sorting were stained by FITC-anti-CD34 (BD, 348053, 8G12), and the purity of the cells obtained by sorting by the two magnetic beads were identified, with the stained results shown in
The result of comparative test was shown in Table 3.
The present humanized anti-CD34 antibody retains the affinity and specificity of original murine-derived antibody. The antibody can be conjugated with nano magnetic materials to prepare immunomagnetic beads to sort marrow hemopoietic stem cells. It can effectively reduce the incidence rate of HAMA and improve the security of clinical transplantation of hemopoietic stem cells and can be used in treatment of some malignant hematologic diseases and solid tumors. The present humanized anti-CD34 antibody is obtained by genetic engineering technology.
| Number | Date | Country | Kind |
|---|---|---|---|
| 200710094456.9 | Dec 2007 | CN | national |
| 200810043016.5 | Jan 2008 | CN | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/CN08/01963 | 12/3/2008 | WO | 00 | 6/9/2010 |
