Hybrid plasmids and microorganisms containing them

Abstract

New hybrid plasmids which are useful as vectors in recombinant DNA in which Acremonium chrysogenum or Saccharomyces cerevisiae is used as a host, and microorganisms bearing the hybrid plasmids, are disclosed. The disclosure herein is based on the cloning of autonomous replication sequences (ARS) of A. chrysogenum ATCC 11550 and introduction of the ARS into a shuttle vector of E. coli and Saccharomyces cerevisiae and construction of new types of plasmids based on the ARS.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates to new hybrid plasmids which are useful as vectors in recombinant DNA work in which Acremonium chrysogenum or Saccharomyces cerevisiae is used as a host, and to microorganisms bearing said hybrid plasmids.

2. Description of the Related Art

It is well known that Escherichia coli (E. coli) host-vector system is useful for recombinant DNA work.

However, the E. coli host-vector system is not satisfactory for production of substances which are produced by higher animals.

On the other hand, Acremonium chrysogenum ATCC 11550 (A. chrysogenum ATCC 11550) is used in the manufacture of many clinically important semi-synthetic cephalosporin antibiotics. Further, it is known that A. chrysogenum ATCC 11550 produces extracellularly an alkaline protease in large amounts (over 1 g/l) [J. Ferment. Technol. 50(9) 592-599 (1972)].

SUMMARY OF THE INVENTION

The inventors of the present invention, as a result of extensive study, have succeeded in cloning two autonomous replication sequences (ARS) of A. chrysogenum ATCC 11550 and in introducing the ARS into a shuttle vector of E. coli and Saccharomyces cerevisiae (S. cerevisiae), and then in constructing new types of plasmids which are useful as vectors in recombinant DNA work in which A. chrysogenum or S. cerevisiae is used as a host.

Accordingly, one object of the present invention is to provide new DNA fragments of A. chrysogenum ATCC 11550 which function as an autonomous replication sequence (ARS) in S. cerevisiae and A. chrysogenum.

Another object of the present invention is to provide new types of hybrid plasmids pLEU135, pLEU97, pCEP97 and pCYG97 which are useful as vectors in recombinant DNA work in which A. chrysogenum or S. cerevisiae is used as a host.

A further object of the present invention is to provide new microorganisms bearing said new plasmids.

BRIEF DESCRIPTION OF THE DRAWINGS

To facilitate understanding the present invention, the plasmids obtained according to the present invention are represented in the attached figures in which

FIG. 1 represents the construction scheme of pLEU135 and pLEU97.

FIG. 2 represents the construction scheme of pCEP97 and pCYG97.

FIG. 3 represents a restriction enzyme cleavage map for pLEU135.

FIG. 4 represents a restriction enzyme cleavage map for pLEU97.

FIG. 5 represents a restriction enzyme cleavage map for pCEP97.

FIG. 6 represents a restriction enzyme cleavage map for pCYG97.

FIG. 7 represents a restriction enzyme cleavage map for pBR-LEU.

FIG. 8 represents the DNA sequence of the ARS of the plasmid pCYG97.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

Plasmids pLEU135, pLEU97, pCEP97 and pCYG97 according to the present invention which are characterized by the restriction enzyme cleavage maps shown in FIGS. 3, 4, 5 and 6, respectively, are prepared by known techniques.

The following are general methods for preparations of pLEU135, pLEU97, pCEP97 and pCYG97.

(1) The nutrition marker, the gene LEU.sup.+ of plasmid YEp13 is introduced into the PstI site of plasmid pBR325 to give plasmid pBR-LEU, which is used as a vector for detecting autonomous replication sequences (ARS).

The well-known plasmid pBR 325 is used as a starting material.

The plasmid YEp13 is a known shuttle vector of E. coli and S. cerevisiae [J. R. Broach et al. Gene 8 (1979) 121].

The plasmids pBR325 and YEp13 are separately digested with restriction enzyme PstI and the resulting reaction mixtures are combined and then ligated with T4 DNA ligase.

The resulting ligated DNA was inserted into E. coli C600r.sup.- m.sup.- (ATCC 33525) and then Ap.sup.S Tc.sup.R Cm.sup.R Leu.sup.+ colonies are selected.

The plasmid thus constructed is named pBR-LEU which is characterized by the restriction enzyme map shown in FIG. 7.

(2) The chromosomal DNA of A. chrysogenum ATCC 11550 which is obtained by treating cells of the said microorganism with an enzyme capable of lysing a cell wall such as Zymolyase (Seikagaku Kogyo Co), and then treating the resulting protoplast with phenol and chloroform, is partially digested with the restriction enzyme Sau 3A and purified with sucrose density gradient ultra-centrifugation to give about 1-10 Kbp DNA fragments.

(3) The 1-10 Kbp DNA fragments are introduced into the BamHI site of the plasmid pBR-LEU (obtained in the above (1)) as follows:

The plasmid pBR-LEU is digested with restriction enzyme Bam HI and said 1-10 Kbp DNA fragments are added to the resulting digested mixture and then ligated with T4 DNA ligase.

The ligated DNA is inserted into E. coli C600r.sup.- m.sup.- (ATCC 33525) and then Tc.sup.S Cm.sup.R Leu.sup.+ colonies are selected by conventional methods.

The resulting Cm.sup.R Tc.sup.S Leu.sup.+ hybrid plasmid DNAs are inserted into S. cerevisiae SHY 3 (ATCC 44771) [Proc. Natl. Acad. Sci. U.S.A. 75 (1978) 1929].

The hybrid plasmids which give high-frequency Leu.sup.+ transformants, are selected to give two hybrid plasmid DNAs containing ARS of A. chrysogenum ATCC 11550.

The resulting two hybrid plasmids are named pLEU135 and pLEU97, respectively.

(4) The plasmid pLEU97, obtained in the above (3), is digested with a restriction enzyme PstI and the resulting digestion is ligated with T4 DNA ligase to give plasmid pCEP97 lacking the gene Leu.sup.+.

(5) PvuII Km.sup.R fragment of Tn903 is introduced into the plasmid pCEP97, obtained in the above (4), to give the plasmid pCYG97 as follows:

The PvuII fragment of Tn903 is a known Km.sup.R gene [A. Oka et al. J. Mol. Biol. 147 (1981) 217].

The pCEP97 DNA is partially digested with restriction enzyme PvuII and the resulting digested pCEP97 DNA and the PvuII Km.sup.R fragment are ligated with T4 DNA ligase.

The resulting ligated DNA is inserted into E. coli C600r.sup.- m.sup.- (ATCC 33525) and Ap.sup.R Km.sup.R Cm.sup.R clone is obtained according to a conventional manner and the resulting plasmid is named pCYG97.

The plasmid pCYG97, as shown in FIG. 6, contains ARS DNA of A. chrysogenum ATCC 11550 and the Kanamycin-resistant gene (Km.sup.R) of Tn903 of E. coli.

The plasmid pCYG97 can transform S. cerevisiae YNN 27 [D. T. Stinchcomb et al. Proc. Natl. Acad. Sci. U.S.A. 77 (1980) 4559] and the resulting transformations are directly selected in the agar plate containing the aminoglycoside antibiotic G418.

The plasmid pLEU135 constructed as above is characterized by the restriction enzyme cleavage map as shown in FIG. 3.

The molecular size of the pLEU135, which is measured by agarose gel electrophoresis method, is about 14.9 Kbp.

The autonomous replication sequence (ARS) in the plasmid pLEU135 shows a unique restriction enzyme cleavage pattern and the molecular size, which is measured by agarose gel electrophoresis, is about 5.04 Kbp and is a new DNA. Accordingly, the plasmid pLEU135 containing said new ARS DNA is a new plasmid.

The plasmid pLEU97, constructed as above, is characterized by the restriction enzyme cleavage map as shown in FIG. 4.

The molecular size of the pLEU97, which is measured by agarose gel electrophoresis, is about 11.2 Kbp.

The autonomous replication sequence (ARS) in the plasmid pLEU97 (the same in plasmids pCEP97 and pCYG97) shows a unique restriction enzyme cleavage pattern. The molecular size, when measured by agarose gel and polyacrylamide gel electrophoresis methods, is about 1.39 Kbp and is a new DNA.

Accordingly, the plasmid pLEU97 containing said new ARS DNA is a new plasmid.

The plasmid pCEP97 which is obtained by digesting pLEU97 with restriction enzyme, PstI and by ligating the resulting digestion with T4 DNA ligase, is characterized by the restriction enzyme cleavage map as shown in FIG. 5.

The molecular size of pCEP97, which is measured by agarose gel and polyacrylamide gel electrophoresis methods, is about 7.38 Kbp.

The autonomous replication sequence (ARS) in the pCEP97 is the same as that in pLEU97.

Accordingly, the plasmid pCEP97 containing said new ARS is a new plasmid.

The plasmid pCYG97, constructed as above, is characterized by the restriction enzyme cleavage map as shown in FIG. 6.

The molecular size of the pCYG97, when measured by agarose gel and polyacrylamide gel electrophoresis methods, is about 9.08 Kbp.

The autonomous replication sequence (ARS) in the pCYG97 is the same as that in pLEU97.

Accordingly, the plasmid pCYG97 containing said ARS DNA and the kanamycin-resistant gene (Km.sup.R) of Tn903 of E. coli, is a new plasmid.

The hybrid plasmids pLEU135, pLEU97, pCEP97 and pCYG97 according to the present invention have the following utility.

The plasmid pLEU135 containing the specific ARS DNA of A. chrysogenum ATCC 11550 is useful as a vector in recombinant DNA work in which A. chrysogenum or S. cerevisiae is used as a host and leucine is used as a selection marker.

The plasmid pLEU97 containing the specific ARS DNA of A. chrysogenum ATCC 11550 is useful as a vector in recombinant DNA work in which A. chrysogenum or S. cerevisiae is used as a host and leucine is used as a selection marker.

The plasmid pCEP97 per se containing the specific ARS DNA of A. chrysogenum ATCC 11550 is useful as an intermediate for constructing the plasmid pCYG97 and is also useful as a vector in recombinant DNA work in which A. chrysogenum or S. cerevisiae is used as a host, (by further introducing a proper selection marker into this pCEP97.)

The plasmid pCYG97 containing the specific ARS DNA of A. chrysogenum ATCC 11550 is useful as a vector in recombinant DNA work in which A. chrysogenum or S. cerevisiae is used as a host and the aminoglycoside antibiotic G418 resistance is used as a selection marker, and further in addition to the antibiotic G418 kanamycin and neomycin are also used as a selection markers in A. chrysogenum.

Accordingly, the plasmids pLEU135, pLEU97 and pCYG97 of the present invention are useful for modifying the properties of strains of microorganisms (e.g. improvement of productivity of cephalosporin c), particularly yeasts such as S. cerevisiae and fungi such as A. chrysogenum ATCC 11550.

Further, as described previously, A. chrysogenum ATCC 11550 produces extracellularly an alkaline protease in large amount (over 1 g/l). Accordingly, the plasmids pLEU135, pLEU97 and pCYG97 are useful for intermediates for construction of expression vectors which are used for extracellular production of human active peptides such as Human Tissue Plasminogen Activator (HTPA) in S. cerevisiae or A. chrysogenum, by cloning the gene of said alkaline protease.

The plasmids pLEU135, pLEU97, pCEP97 and pCYG97 constructed according to the present invention are each inserted into E. coli C600r.sup.- m.sup.- (ATCC33525) and the following microorganisms are obtained.

Escherichia coli C600r.sup.- m.sup.- (pLEU135) Escherichia coli C600r.sup.- m.sup.- (pLEU97) Escherichia coli C600r.sup.- m.sup.- (pCEP97) Escherichia coli C600r.sup.- m.sup.- (pCYG97)

The following examples are illustrative of the present invention.

In the descriptions of the examples, the following abbreviations are used.

ATP: adenosine-5'-triphosphate DTT: dithiothreitol Tris: tris(hydroxymethyl)aminomethane EDTA: ethylenediaminetetraacetic acid SDS: sodium laurylsulfate PEG: polyethylene glycol bp: base pair Kbp: kilo-base pairs ARS: Autonomous Replication Sequence Ap.sup.R : ampicillin resistant in E. coli Ap.sup.S : ampicillin sensitive in E. coli Cm.sup.R : chloramphenicol resistant in E. coli Cm.sup.S : chloramphenicol sensitive in E. coli Tc.sup.R : tetracycline resistant in E. coli Tc.sup.S : tetracycline sensitive in E. coli Km.sup.R : kanamycin resistant in E. coli Nm.sup.R : neomycin resistant in E. coli Km.sup.S : kanamycin sensitive in E. coli G418.sup.R : G418 resistant in S. cerevisiae Leu.sup.+ : complementation of leucine auxotrophic mutants of E. coli leu B and S. cerevisiae leu 2

Buffer and Medium:

L; 20 mM Tris-HCl (pH 7.5) 10 mM MgCl.sub.2 6 mM 2-mercaptoethanol 100 .mu.g/ml Bovine Serum Albumin (BRL) M; L buffer containing 50 mM NaCl H; L buffer containing 100 mM NaCl S; L buffer containing 20 mM KCl TE buffer; 20 mM Tris-HCl (pH 7.5) 0.5 mM EDTA TPE buffer; 36 mM Tris 30 mM NaH.sub.2 PO.sub.4 1 mM EDTA pH 7.8 KP buffer; 74.56 g/l KCl 0.25 g/l K.sub.2 SO.sub.4 0.20 g/l MgCl.sub.2.6H.sub.2 O 0.05 g/l KH.sub.2 PO.sub.4 0.37 g/l CaCl.sub.2.2H.sub.2 O 25 mM Tris-HCl (pH 7.2) YP buffer; 1M KCl 10 mM Tris-HCl (pH 7.5) 2M sorbitol buffer; 2M sorbitol 10 mM Tris-HCl (pH 7.5) 10 mM CaCl.sub.2 LB agar; 10 g/l Bactotryptone (DIFCO) 5 g/l Yeast Extract (DIFCO) 5 g/l NaCl 15 g/l Agar (DIFCO) pH 7.2 MM agar; 10.5 g/l K.sub.2 HPO.sub.4 4.5 g/l KH.sub.2 PO.sub.4 1.0 g/l (NH.sub.4).sub.2 SO.sub.4 0.5 g/l Na.sub.3.Citrate.2H.sub.2 O 1.2 g/l MgSO.sub.4.7H.sub.2 O 2 g/l Glucose 15 g/l Agar (DIFCO) AC medium; 36 g/l Sucrose 27 g/l Glucose 3 g/l L-Methionine 7.5 g/l (NH.sub.4).sub.2 SO.sub.4 13.8 g/l KH.sub.2 PO.sub.4 14.0 g/l K.sub.2 HPO.sub.4 10 g/l Peptone (DIFCO) YEPD medium; 10 g/l Yeast Extract (DIFCO) 20 g/l Peptone (DIFCO) 20 g/l Glucose Supplemented MM medium (lacking leucine) for yeast: 10 g/l Glucose 6.7 g/l Yeast Nitrogen Base (DIFCO) 218 g/l Sorbitol 10 mg/l Adenine 10 mg/l Uracil 40 mg/l Histidine 40 mg/l Tryptophan Regeneration Agar; YEPD medium containing 1.2M sorbitol and 3% agar YEPD Base Plate; YEPD medium containing 1.2M sorbitol, 2% agar, 0.2% (W/V) potassium phosphate monobasic YEPD Agar; YEPD medium containing 1.2M sorbitol and 2% agar

For cleavage of various plasmids with restriction enzymes, the following combinations of restriction enzymes and buffers are employed as follows.

______________________________________Restriction enzyme Buffer______________________________________AvaI, ClaI, H bufferEcoRI, HincII,HindIII, MluI,PstI, PvuII, SalI,XhoIAatII, SphI M bufferAccI, BamHI, BglII, L bufferHpaI, KpnI, SacI, SacIISmaI S buffer______________________________________

Example 1

Construction of pLEU97 and pLEU135

(1) Construction of vector pBR-LEU

One .mu.g of vector pBR325 DNA which was obtained as commercial preparation from Bethesda Research Laboratories/(BRL) was digested with 3 units of PstI in 10 .mu.l of H buffer for an hour.

On the other hand, 1 .mu.g of vector YEp13 DNA which was prepared according to the method described in J. R. Broach et al. Gene 8 (1979) 121, (was digested with 3 units of PstI in 10 .mu.l of H buffer for an hour.) The above two reaction mixtures were combined and incubated in 0.5 units of T4 DNA ligase, 0.5 mM ATP and 10 mM DTT at 4.degree. C. for 20 hours.

The ligated DNA thus obtained was used to transform Escherichia coli C600r.sup.- m.sup.- (ATCC 33525) according to the method described in Molecular Cloning, page 250 (Cold Spring Harbor Laboratory, 1982).

The resulting transformed cells were plated on LB agar containing 5 .mu.g/ml of tetracycline and incubated at 37.degree. C. overnight. The tetracycline resistant colonies were transferred to LB agar containing 20 .mu.g/ml of chloramphenicol, to LB agar containing 50 .mu.g/ml of ampicillin and to MM agar containing 50 .mu.g/ml threonine (lacking leucine), respectively and cultured at 37.degree. C. overnight. The Ap.sup.S Tc.sup.R Cm.sup.R Leu.sup.+ colonies were obtained and the plasmid DNA was named pBR-LEU.

The pBR-LEU DNA was isolated according to the method described in Advanced Bacterial Genetics, page 116 (Cold Spring Harbor Laboratory, 1980).

(2) Cloning of ARS from Acremonium chrysogenum ATCC 11550 DNA

(1) Extraction of ATCC 11550 DNA

Sterile AC medium (100 ml) was inoculated with mycelium from an agar slant of A. chrysogenum ATCC 11550 and cultured for 3 days at 25.degree. C., 250 rpm in 500 ml shaking flask. Cells were harvested and washed with KP buffer. The cells were suspended in 20 ml of KP buffer containing 10 mM DTT and incubated for 30 minutes at 37.degree. C. Then 20 mg of Zymolyase 60,000 (Seikagaku Kogyo Co.) was added to the suspension and which was shaken for 2 hours at 37.degree. C. The cells were centrifuged at 1,000.times.g for 10 minutes. The precipitate was suspended in 10 ml of 50 mM Tris-HCl buffer (pH 7.5) containing 10 mM EDTA and 1% SDS, and then extracted twice with equal volume of phenol and chloroform. The DNA solution was treated with 10 .mu.g/ml of RNase A(Sigma) and then with 200 .mu.g/ml of Protease K(Meck). The DNA solution was extracted with equal volume of phenol and precipitated with two volumes of ethanol at -20.degree. C. for 2 hours. The precipitate was collected by centrifugation and resuspended in 0.5 ml of TE buffer. The DNA solution was extensively dialysed against the same buffer to give about 50 .mu.g DNA.

(2) Cloning of ATCC 11550 DNA to pBR-LEU BamHI site (FIG. 1).

About 10 .mu.g of ATCC 11550 DNA, prepared as described in the above (1), was digested with one unit of Sau3A(BRL) in 200 .mu.l of L buffer for 10 minutes. The reaction was terminated by heating at 65.degree. C. for 10 minutes. The digested DNA was purified to about 1-10 Kbp in size with sucrose density gradient ultra-centrifugation. The size-fractionated DNA was suspended in 10 .mu.l of TE buffer.

One .mu.g of pBR-LEU DNA, prepared as described in the above (1), was digested with one unit of BamHI (BRL) in 10 .mu.l of L buffer for an hour. The resulting digested sample and the size-fractionated DNA suspension in TE buffer prepared above were mixed. T4 DNA ligase (BRL) (0.5 unit), one .mu.l of 10.times.L buffer, and 2 .mu.l of 5 mM ATP and 100 mM DTT were added to the mixture. Subsequently, the resulting mixture was incubated at 4.degree. C. for 20 hours. The ligated DNA was used to transform E. coli C600r.sup.- m.sup.- (ATCC 33525) according to the method described in Molecular Cloning, page 250. The transformed cells were plated on LB agar containing 20 .mu.g/ml of chloramphenicol and incubated at 37.degree. C. overnight. The resulting chloramphenicol resistant colonies were transferred to LB agar containing 5 .mu.g/ml of tetracycline and to MM agar containing 50 .mu.g/ml of threonine (lacking leucine), respectively. Tc.sup.S Cm.sup.R Leu.sup.+ colonies were obtained (108 clones) and the plasmid DNAs were isolated according to the method described in Advanced Bacterial Genetics, page 116.

(3) Transformation to Saccharomyces cerevisiae SHY3 (ATCC 44771) (FIG. 1)

S. cerevisiae SHY3 (ATCC 44771) was transformed according to the method of Hinnen et al. (Proc. Natl. Acad. Sci. USA 75 (1978) 1929). A sterile YEPD medium (50 ml) containing 10 .mu.g/ml of adenine and uracil was inoculated from an agar slant of S. cerevisiae SHY3 (ATCC 44771) and cultured at 30.degree. C. overnight in 250 ml shaking flask. Cells were harvested by centrifugation, suspended in 5 ml of 1.2M sorbitol solution containing 25 mM EDTA and 50 mM DTT, and gently shaken at 30.degree. C. for 10 minutes. Then the cells were harvested by centrifugation, washed with 1.2M sorbitol solution, suspended in 5 ml of 67 mM phosphate buffer (pH 7.5) containing 1.2M sorbitol, 10 mM EDTA and 200 .mu.g/ml Zymolyase 60,000 (Seikagaku Kogyo Co.), and gently shaken at 30.degree. C. for 60 minutes. The protoplasts were harvested by low speed centrifugation, washed with 1.2M sorbitol solution and suspended in 4 ml of 1.2M sorbitol solution containing 10 mM CaCl.sub.2.

The protoplast suspension (0.2 ml) and Cm.sup.R Tc.sup.S Leu.sup.+ hybrid plasmid DNA, prepared in the above 2), (20 .mu.l) (about 5 .mu.g) were mixed and incubated at room temperature for 20 minutes. Two ml of 20% PEG 4,000 solution containing 10 mM CaCl.sub.2 and 10 mM Tris-HCl (pH 7.5) was added to the suspension and the suspension was incubated at room temperature for 20 minutes. The transformed protoplasts were harvested by low speed centrifugation and suspended in 0.5 ml of 10 mM Tris-HCl buffer (ph 7.5) containing 1.2M sorbitol and 10 mM CaCl.sub.2. The transformed cells (0.1 ml) were diluted into 10 ml of supplemented MM medium containing 3% agar (lacking leucine) for yeast, poured on top of a base plate (20 ml) of the same medium containing 2% agar and incubated at 30.degree. C. for 4 days. About 500 colonies were obtained from two hybrid plasmid DNAs, but only one colony was obtained from other 106 hybrid plasmid DNAs and pBR-LEU DNA. The two hybrid plasmid DNAs containing ARS of A. chrysogenum ATCC 11550 were obtained from these results and named pLEU97 and pLEU135, respectively.

The effects of pLEU97 and pLEU135 DNA amounts on the frequency of transformation in S. cerevisiae SHY3 (ATCC 44771) are illustrated in Table 1-1 compared with pBR-LEU and YEp13 DNAs. YEp13 DNA contains the 2 .mu.m plasmid DNA for replication in S. cerevisiae.

TABLE 1-1______________________________________Dose Response of pLEU97 and pLEU135DNA Transformation in S. cerevisiaeSHY3 (ATCC 44771) DNA Amount LEU.sup.+ TransformantsDNA (mcg) (CFU.sup.1)______________________________________pLEU97 7.5 5.4 .times. 10.sup.3 3.0 1.6 .times. 10.sup.3 1.5 5.3 .times. 10.sup.2pLEU135 6.0 1.1 .times. 10.sup.3 2.4 4.7 .times. 10.sup.2 1.2 2.1 .times. 10.sup.2pBR-LEU 6.0 1 2.4 1 1.2 1YEp13 7.5 2.5 .times. 10.sup.3 3.0 1.1 .times. 10.sup.3 1.5 5.0 .times. 10.sup.2______________________________________ .sup.1 CFU; colony forming units.

(3) Agarose gel electrophoretic analysis of pBR-LEU, pLEU135 and pLEU97 DNAs.

(1) Determination of a restriction enzyme map for pBR-LEU DNA

Determination of a restriction enzyme map for pBR-LEU DNA, prepared as described above, was carried out by cleavage with various restriction enzymes as specified in Table 1-2. Said restriction enzymes were obtained as commercial preparations from Bethesda Research Laboratories, Takara Shuzo Co. and Toyobo Co. pBR-LEU DNA (0.5-1 .mu.g) and each of restriction enzymes (3-6 units) as specified in Table 1-2 were incubated in 20 .mu.l of H buffer or L buffer at 37.degree. C. for 60-180 minutes.

The digested samples were applied to 0.8% agarose gels and were electrophoresed for 2 to 3 hours at 80 V in TPE buffer in a vertical gel electrophoresis system (0.3.times.16.times.16 cm).

Detection of DNA bands in agarose gel was performed as described in Molecular Cloning, page 161 (1982). The molecular sizes of restriction DNA fragments were determined by comparing their relative mobilities in agarose gels with those of .lambda.-HindIII fragments [L. H. Robinson and A. Landy Gene 2 (1977) 1].

Results of agarose gel electrophoretic analysis of pBR-LEU DNA cleaved with restriction enzymes are summarized in Table 2. Molecular sizes of pBR-LEU DNA restriction fragments are shown in Table 1-2. The cleavage map for restriction enzymes for pBR-LEU DNA is shown in FIG. 7.

TABLE 1-2______________________________________Molecular Sizes.sup.1 of pBR-LEU DNARestriction Fragments.sup.2.RestrictionEnzyme A B Total______________________________________PstI 6.00 3.85 9.85SalI 5.72 4.13 9.85EcoRI 6.85 3.00 9.85BglII 7.20 2.65 9.85PvuII 6.46 3.39 9.85KpnI 7.45 2.40 9.85HpaI 7.75 2.10 9.85______________________________________ .sup.1 Fragment sizes are expressed in Kbp. .sup.2 Fragment of smaller size was not determined.

(2) Determination of the restriction enzyme map for pLEU135 and pLEU97 DNAs.

Cleavage of the pLEU135 and pLEU97 DNAs with various restriction enzymes, as specified in Table 2, and agarose gel electrophoresis were performed according to the same method as the pBR-LEU DNA above. The results of the agarose gel electrophoretic analysis of the pLEU135 and pLEU97 DNAs cleaved with 11 restriction enzymes are summarized in Table 2. The number of restriction enzyme target sites of ARS DNA fragment was determined by comparison with those of pLEU97 and pBR-LEU DNAs, and with those of pLEU135 and pBR-LEU DNAs.

The molecular sizes of pLEU135 and pLEU97 DNA restriction fragments are shown in Tables 3 and 4, respectively. The cleavage map for the restriction enzymes of the pLEU135 and pLEU97 DNA are shown in FIGS. 3 and 4, respectively.

TABLE 2______________________________________Restriction Enzyme Target Sites ofpLEU97 and pLEU135 DNA Number of Restriction EnzymeRestriction Target Sites.sup.1Enzyme Sequence pLEU97 pLEU135 pBR-LEU______________________________________BamHI G.sup..dwnarw. GATCC 0 (0).sup.2 1 (1).sup.2 1BglII A.sup..dwnarw. GATCT 2 (0) 3 (1) 2EcoRI G.sup..dwnarw. AATTC 2 (0) 3 (1) 2HindIII A.sup..dwnarw. AGCTT 1 (0) 3 (2) 1HpaI GTT.sup..dwnarw. AAC 2 (0) 3 (1) 2KpnI GGTAC.sup..dwnarw. C 2 (0) 2 (0) 2PstI CTCGA.sup..dwnarw. G 2 (0) 5 (3) 2PvuII CAG.sup..dwnarw. CTG 2 (0) 4 (2) 2SacI GAGCT.sup..dwnarw. C 2 (1) 2 (1) 1SalI G.sup..dwnarw. TCGAC 2 (0) 2 (0) 2SmaI CCC.sup..dwnarw. GGG 2 (1) 1 (0) 1______________________________________

(1) Restriction enzyme target sites were determined with 0.8% agarose gel electrophoresis. Fragments of smaller size was not examined.

(2) (); Number of restriction enzyme target sites of ARS DNA fragment.

TABLE 3______________________________________Molecular Sizes.sup.1 of pLEU135 DNARestriction Fragments.sup.2.RestrictionEnzyme A B C D E Total______________________________________BglII 7.63 4.62 2.65 14.9EcoRI 9.83 2.99 2.08 14.9HindIII 10.8 2.55 1.56 14.9KpnI 12.5 2.40 14.9PstI 5.71 3.85 3.10 1.75 0.49 14.9SacI 10.9 3.96 14.9SalI 9.19 5.71 14.9______________________________________ .sup.1 Fragment sizes are expressed in Kbp. .sup.2 Fragments of smaller size was not determined. TABLE 4______________________________________Molecular Sizes.sup.1 of pLEU97 DNARestriction Fragments.sup.2.RestrictionEnzyme A B Total______________________________________BglII 8.58 2.65 11.2EcoRI 8.23 3.00 11.2HpaI 9.13 2.10 11.2KpnI 8.83 2.40 11.2PstI 7.38 3.85 11.2PvuII 6.46 4.77 11.2SacI 6.82 4.42 11.2SalI 5.72 5.51 11.2SmaI 6.75 4.49 11.2______________________________________ .sup.1 Fragment sizes are expressed in Kbp. .sup.2 Fragments of smaller size was not determined.

Example 2

Construction of pCYG97 and pCEP97

(I) Construction of pCEP97.

(1) Construction of pCEP97 from pLEU97 (FIG. 2).

pLEU97 DNA (3 .mu.g), prepared as described in Example 1, was digested with 10 units of PstI in 20 .mu.l of H buffer for 3 hours. Subsequently, 0.5 unit of T4 DNA ligase (BRL), and 2 .mu.l of 5 mM ATP and 100 mM DTT were added to the reaction mixture. The resulting mixture was incubated at 4.degree. C. for 20 hours. The ligated DNA was used to transform E. coli C600r.sup.- m.sup.- (ATCC 33525) according to the method described in Molecular Cloning, page 250. The transformed cells were plated on LB agar containing 20 .mu.g/ml of ampicillin and incubated at 37.degree. C. overnight. About 500 ampicillin resistant colonies were obtained and named pCEP97. pCEP97 DNA was isolated according to the method described in Advanced Bacterial Genetics, page 116.

(2) Determination of a restriction enzyme map for pCEP97 DNA.

Determination of a restriction enzyme map for pCEP97 DNA, prepared as described in the above (1), was carried out by cleavage with various restriction enzymes as specified in Table 5. Said restriction enzymes were obtained as commercial preparation from Bethesda Research Laboratories, Takara Shuzo Co. and Toyobo Co.

pCEP97 DNA (0.5-1 .mu.g) and each of said restriction enzymes were incubated in 20 .mu.l of H buffer, M buffer, L buffer or S buffer at 37.degree. C. for 60-180 minutes.

The digested samples were applied to 0.8% agarose gels and electrophoresed for 2 to 3 hours at 80 V in TPE buffer by a vertical gel electrophoresis system (0.3.times.16.times.16 cm). Detection of DNA bands in agarose gel was performed as described in Molecular Cloning, page 161 (1982).

The molecular sizes of restriction DNA fragments were determined by comparing their relative mobilities in agarose gels with those of .lambda.-HindIII and cleaved pBR325 DNA fragments [Fragment sizes were determined from the DNA sequence of pBR325 [P. Prentki et al. Gene 14 (1981) 289]].

On the other hand, pCEP97 DNA, prepared in the above (1), was digested further with SalI and HindIII, and the small DNA fragment was electroeluted according to the method described in Molecular Cloning, page 164 (1982). Cleavage of that DNA fragment (2-3 .mu.g) with restriction enzymes (AvaI, SmaI, ClaI, SacI and SacII) was performed as described above. Polyacrylamide gel electrophoresis (5% concentration) was performed as described in Molecular Cloning, page 173 (1982). The detection of DNA bands in poly-acrylamide gel was performed as described in Molecular cloning, page 161 (1982). The molecular sizes of DNA fragments were estimated by comparing their relative mobilities in polyacrylamide slab gel with those of pBR322-HaeIII [Sutcliffe, J. G. et al. Cold Spring Harbor Symp. Quant. Biol. 43 (1979) 77].

The results of agarose and polyacrylamide gel electrophoretic analysis of pCEP97 DNA cleaved with 20 restriction enzymes are summarized in Table 5. The number of restriction enzyme target sites of the ARS DNA fragment was determined by comparison with restriction digests of pCEP97 and pBR325 DNAs. The cleavage map for restriction enzymes and the fragment sizes for pCEP97 are shown in FIG. 5. Fragment sizes are expressed in Kbp.

(II) Construction of pCYG97.

(1) Cloning of Km.sup.R -PvuII DNA fragment of Tn903 to pCEP97 DNA (Ap.sup.R Km.sup.S) (FIG. 2).

Km.sup.R gene (PvuII 1696 bp fragment) of Tn903 was purified from PvuII digested pAO43 DNA [A. Oka et al. J. Mol. Biol. 147 (1981) 217]. pCEP97 DNA, prepared in the above (I)-(1), (5 .mu.g) was partially digested with PvuII (10 units) in 20 .mu.l of H buffer at 37.degree. C. for 60 minutes. Km.sup.R -PvuII DNA fragment (1 .mu.g) and the resulting PvuII partial digested pCEP97 DNA (5 .mu.g) were ligated at 4.degree. C. for 2 days in 40 .mu.l of L buffer containing 0.5 mM ATP and 10 mM DTT, and T4 DNA ligase (BRL) (4 units). Then the ligated DNA was transformed to E. coli C600r.sup.- m.sup.- (ATCC 33525) according to the method described in Molecular Cloning, page 250. The transformed cells were plated on LB agar containing 20 .mu.g/ml of ampicillin and incubated at 37.degree. C. overnight. The ampicillin resistant colonies were transferred to LB agar containing 50 .mu.g/ml of Kanamycin and LB agar containing 40 .mu.g/ml of chloramphenicol. Ap.sup.R Km.sup.R Cm.sup.R (one) and Ap.sup.R Km.sup.R Cm.sup.S (239) colonies were obtained and the Ap.sup.R Km.sup.R Cm.sup.R clone was named pCYG97. pCYG97 DNA was isolated according to the method described in Advanced Bacterial Genetics, page 116.

(2) Determination of restriction enzyme map for pCYG97 DNA.

According to the same methods as those of the above (I)-(2) of Example 2, cleavage of pCYG97 DNA (0.5-1 .mu.g), prepared as described above, with various restriction enzymes as specified in Table 5 (3-6 units) and agarose gel electrophoresis at 0.8% agarose and estimation of molecular sizes of DNA fragments were performed.

On the other hand, pCYG97 DNA, prepared in the above (1), was digested with SalI and EcoRI, and the small DNA fragment was purified according to the same method as described in (I)-(2) of Example 2. Cleavage of the resulting DNA fragment (2-3 .mu.g) with restriction enzymes (HindIII, AvaI, SmaI, ClaI, SacI and SacII) was performed as described above. Polyacrylamide gel electrophoresis (5% concentration) and estimation of molecular sizes of DNA fragments were performed according to the method described in Sutclaffe, J. G. et al. Cold Spring Harbor Symp. Quant. Biol. 43 (1979) 77.

Results of agarose and polyacrylamide gel electrophoretic analysis of pCYG97 DNA cleaved with 20 restriction enzymes are summarized in Table 5. Number of restriction enzyme target sites of ARS DNA fragment was determined by comparison with those of pCYG97, pCEP97 and Km.sup.R -PvuII DNA fragment (Fragment sizes were determined from DNA sequence for Tn903 {A. Oka et al. J. Mol. Biol. 147 (1981) 217}). The cleavage map for restriction enzymes and those fragment sizes for pCYG97 DNA are shown in FIG. 6. Fragment sizes are expressed in Kbp.

TABLE 5______________________________________Restriction Enzyme Target Sites ofpCYG97 and pCEP97 DNAs. Number of RestrictionRestriction Enzyme Target SitesEnzyme Sequence.sup.1 pCYG97 pCEP97______________________________________AatII GACGT.sup..dwnarw. C 1 (0).sup.2 1 (0).sup.2AccI GT.sup..dwnarw. QRAC 2 (0) 2 (0)AvaI C.sup..dwnarw. YCGUG 4 (1) 2 (1)BalI.sup.3 TGG.sup..dwnarw. CCA 2 (0) 2 (0)BamHI G.sup..dwnarw. GATCC 0 (0) 0 (0)BclI.sup.3 T.sup..dwnarw. GATCA 2 (1) 2 (1)BglII A.sup..dwnarw. GATCT 0 (0) 0 (0)ClaI AT.sup..dwnarw. CGAT 3 (1) 2 (1)EcoRI G.sup..dwnarw. AATTC 1 (0) 1 (0)EcoRV.sup.3 GAT.sup..dwnarw. ATC 1 (0) 1 (0)HincII GTYUAC 2 (0) 2 (0)HindIII A.sup..dwnarw. AGCTT 2 (0) 1 (0)HpaI GTT.sup..dwnarw. AAC 0 (0) 0 (0)KpnI GGTAC.sup..dwnarw. C 0 (0) 0 (0)MluI A.sup..dwnarw. CGCGT 2 (0) 0 (0)PstI CTGCA.sup..dwnarw. G 1 (0) 1 (0)PvuII CAG.sup..dwnarw. CTG 3 (0) 2 (0)SacI GAGCT.sup..dwnarw. C 1 (1) 1 (1)SacII CCGC.sup..dwnarw. GG 2 (2) 2 (2)SalI G.sup..dwnarw. TCGAC 1 (0) 1 (0)ScaI.sup.3 AGT.sup..dwnarw. ACT 2 (0) 2 (0)SmaI CCC.sup..dwnarw. GGG 2 (1) 1 (1)SphI GCATG.sup..dwnarw. C 1 (0) 1 (0)StuI.sup.3 AGG.sup..dwnarw. CCT 2 (0) 0 (0)XbaI.sup.3 T.sup..dwnarw. CTAGA 0 (0) 0 (0)XhoI C.sup..dwnarw. TCGAG 1 (0) 0 (0)XmaIII.sup.3 C.sup..dwnarw. GGCCG 3 (1) 3 (1)______________________________________ .sup.1 Q: A or C, R: G or T, Y: Py, U: Pu. .sup.2 (): Number of restriction enzyme target sites of ARS DNA fragment. .sup.3 Restriction enzyme target sites were determined from DNA sequence. TABLE 6______________________________________Dose Response in pCYG97 DNA Transformationto S. cerevisiae YNN27 DNA Amount G418.sup.R TransformantsDNA (mcg) (CFU.sup.1)______________________________________pCYG97 0.50 1.1 .times. 10.sup.4 0.050 3.0 .times. 10.sup.3 0.005 2.2 .times. 10.sup.2pBR322 5.0 1______________________________________ .sup.1 CFU; colony forming units.

(III) Transformation of pCYG97 DNA to S. cerevisiae YNN 27. (.alpha., trp 1-289, ura 3-52, gal 2) [D. T. Stinchcomb et al. Proc. Natl. Acad. Sci. USA 77 (1980) 4559].

(1) Yeast transformation

Sterile YEPD medium (20 ml) containing 10 .mu.g/ml of uracil and 40 .mu.g/ml of tryptophan was inoculated from an agar slant of S. cerevisiae YNN27 and cultured for 6 hours at 30.degree. C. Then 1.times.10.sup.6 cells were transferred to 100 ml of sterile YEPD medium supplemented uracil and tryptophan, and cultured overnight at 30.degree. C. in 500 ml shaking flask. Cells were harvested by low speed centrifugation, suspended in 100 ml of new medium indicating above and cultured for 3 hours at 30.degree. C.

Cells were harvested by centrifugation, washed twice with 50 ml of YP buffer, suspended in 50 ml of YP buffer containing 55 mM 2-mercaptoethanol and gently shaken at 30.degree. C. for 30 minutes. Then the cells were harvested, suspended in 19 ml of YP buffer containing 75 mM 2-mercaptoethanol and 210 .mu.g/ml of Zymolyase 5,000 (Seikagaku Kogyo Co.), and gently shaken at 30.degree. C. for 10 minutes. The protoplasts were harvested by low speed centrifugation, washed twice with YP buffer and suspended in 0.6 ml of 2M sorbitol buffer.

DNA solution (10 .mu.l) (each amount as specified in Table 6 of pCYG97 DNA, prepared in the above (II)-(1), and 5 .mu.g of carrier pBR322 DNA) and 2M sorbitol buffer (20 .mu.l) were mixed. The mixed DNA solution (30 .mu.l) and the protoplast suspension (60 .mu.l) were mixed, and incubated at room temperature for 10 minutes. Then one ml of 20% PEG 4,000 solution containing 10 mM Tris-HCl (pH 7.5) and 10 mM CaCl.sub.2 was added to the reaction mixture, and incubated at room temperature for 20 minutes. The resulting transformed protoplasts were harvested by low speed centrifugation and suspended in 0.4 ml of 2M sorbitol buffer.

(2) Selection of the antibiotic G418-resistant transformants.

Selection of G418.sup.R transformants were performed according to the method of Webster and Dickson (Gene 26 (1983) 243). Transformed cells, prepared in the above (III)-(1), (0.2 ml) were diluted into 8 ml of regeneration agar and poured on top of a YEPD base plate (15 ml) supplemented 10 .mu.g/ml uracil and 40 .mu.g/ml of tryptophan. After solidification, an additional 8 ml of YEPD agar was poured onto the plate and incubated overnight at 30.degree. C. Antibiotic G418 (GIBCO Lab.) was then administered by spreading 10 mg from a stock 100 mg/ml solution on top of each plate. Transformants appeared within 3-4 days at 30.degree. C.

The effect of pCYG97 DNA amounts on the frequency of transformation to S. cerevisiae YNN27 is shown in Table 6 compared with pBR322 DNA. pCYG97 DNA was efficiently transformed to G418 resistance for S. cerevisiae YNN27.

(IV) Determination of DNA Sequence of ARS of pCYG97.

DNA sequence of ARS of pCYG97 was determined according to Maxam-Gilbert method [A. M. Maxam and W. Gilbert, Methods in Enzymology, 65, 499 (1980], and dideoxy sequencing method using M13mp10 and M13mp11 vectors [J. Messing, Methods in Enzymology, 101, 78 (1983)].

The DNA sequence of ARS of pCYG97 is shown in FIG. 8.

(V) Transformation of pCYG97 DNA to Acremonium chrysogenum ATCC11550

1. Buffer and Medium.

______________________________________CORN STEEP MEDIUM CSL 30 g/1 Glucose 10 g/l Starch 30 g/l pH 6.8 CaCO.sub.3 5 g/lYPS MEDIUM Sucrose 20 g/l Polypeptone 10 g/l Yeast Extract 5 g/l K.sub.2 HPO.sub.4 1 g/l MgSO.sub.4 7H.sub.2 O 1 g/l pH 7.0PROTOPLAST BUFFER KCl 0.6 M MgCl.sub.2 10 mM CaCl.sub.2 25 mMBRM (Regeneration Medium)A: NaNO.sub.3 2 g/900 ml KH.sub.2 PO.sub.4 1 g/900 ml Sucrose 275 g/900 ml Casamino Acids 10 g/900 ml Agar 7.5 g/900 ml pH 6.0B: Glucose 200 g/l MgCl.sub.2 20 mM CaCl.sub.2 50 mM______________________________________ A, B: separately autoclaved 900 ml of A and 100 ml of B were mixed.

2. Methods and Results.

(1) Protoplast Formation.

A sterile corn steep medium (50 ml) was inoculated with mycelium from agar slant of A. chrysogenum ATCC11550 and cultured at 30.degree. C. for 96 hours in 250 ml shaking flask. Five ml of this preculture in corn steep medium was transferred to 50 ml of sterile YPS medium and cultured at 25.degree. C. for 24 hours as described above. Mycelium was harvested by centrifugation, washed with sterile water, suspended in 15 ml of 10 mM dithiothreitol solution and gently shaken at 30.degree. C. for 1 hour. Then the mycelium was centrifuged, washed and resuspended in 20 ml of protoplast buffer containing 20 mg of Zymolyase 20T (Seikagaku Kogyo). After gently shaken at 30.degree. C. for 2 hours, the protoplasts were harvested by low speed centrifugation, washed with protoplast buffer and resuspended in 0.5 ml of protoplast buffer.

(2) Transformation.

The protoplast suspension (100 .mu.l) and plasmid DNA pCYG97 (10 .mu.l, about 5 .mu.g DNA) were mixed and incubated at room temperature for 10 minutes. Then 1 ml of 20% polyethyleneglycol (PEG) 4000 solution containing 25 mM CaCl.sub.2 (pH 6.3) was added to the mixture. After 20 minutes at room temperature, the resulting transformed protoplasts were centrifuged and resuspended in 0.9 ml of protoplast buffer.

(3) Selection of the antibiotic G418 resistant transformants.

The transformed cells (0.2 ml) were poured on regeneration agar (15 ml of BRM) plates. Then 5 ml of BRM was poured. After incubation at 30.degree. C. overnight, aliquots (0.2 ml of antibiotic G418, GIBCO Lab.) were spreaded on each plate. Plates were incubated at 30.degree. C. for a week. The transformation frequency of pCYG97 DNA to A. chrysogenum ATCC11550 is shown in Table 7.

TABLE 7______________________________________Transformation Frequency of pCYG97 DNA toAcremonium chrysogenum ATCC11550.sup.1. DNA AmountG418 Concentration 1 .mu.g( .mu.g/ml ) pCYG97 DNA 0 .mu.g DNA______________________________________300 3 0100 130 17______________________________________ .sup.1 100 .mu.l protoplast solutions of about 10.sup.10 per ml were transformed. About 10.sup.9 protoplasts per plate were plated.

Example 3

Plasmids pLEU135, pLEU97, pCEP97 and pCYG97 were each transformed into E. coli C600r.sup.- m.sup.- (ATCC33525) by a conventional method to obtain the following microorganisms:

Escherichia coli C600r.sup.- m.sup.- (pLEU135) Escherichia coli C600r.sup.- m.sup.- (pLEU97) Escherichia coli C600r.sup.- m.sup.- (pCEP97) Escherichia coli C600r.sup.- m.sup.- (pCYG97)

Claims

1. A DNA fragment which functions as an autonomous replication sequence (ARS) in Saccharomyces cerevisiae and Acremonium chrysogenum, characterized as follows:

(a) said ARS is prepared by digesting partially a chromosomal DNA of the Acremonium chrysogenum ATCC 11550 with restriction enzyme Sau 3A,

(b) the molecular size of said ARS is about 1.39 Kbp, and

(c) the DNA sequence of said ARS is as follows:

______________________________________10 20 30GATCTCGGCG AGCGGGTGAC GGACGGGTTGCTAGAGCCGC TCGCCCACTG CCTGCCCAAC40 50 60CTAGCGTTTA CCAAGCCGGG TCACACGCCGGATCGCAAAT GGTTCGGCCC AGTGTGCGGC70 80 90CGGCTTGGCA GGEAGCAGCC ACTGTTACTAGCCGAACCGT CCETCGTCGG TGACAATGAT100 110 120CTTGCATGTG GGCTGATTGA AAATCCCGGAGAACGTACAC CCGACTAACT TTTAGGGCCT130 140 150ACCGATGGAT GCTTCCCCCG GGGATGCCGCTGGCTACCTA CGAAGGGGGC CCCTACGGCG160 170 180TTCTTTCTCT CTCTCGGCCG CGGGAAGGTAAAGAAAGAGA GAGAGCCGGC GCCCTTCCAT190 200 210TGCGTTGCCC CCGGCCATAA TAGTCGTCAAACGCAACGGG GGCCGGTATT ATCAGCAGTT220 230 240GCGGAAGGCC AGCATTTGAT CAGTAAAAATCGCCTTCCGG TCGTAAACTA GTCATTTTTA250 260 270ATCGGAATGA TAAGTAATAG ATTTTAAATTTAGCCTTACT ATTCATTATC TAAAATTTAA280 290 300TACTATATTA TATTGTATTT TTTTCCCTATATGATATAAT ATAACATAAA AAAAGGGATA310 320 330TATTAGTTCT AATAAATAGG TCAATTTAGAATAATCAAGA TTATTTATCC AGTTAAATCT340 350 360TAATAATCTT ACTTTATTAA ATTTAAATTGATTATTAGAA TGAAATAATT TAAATTTAAC370 380 390ATTTAAAGAA TATAACAAAC TATATTTTCTTAAATTTCTT ATATTGTTTG ATATAAAAGA400 410 420CAAATAATTA AAATATTTCC CTGATTCATTGTTTATTAAT TTTATAAAGG GACTAAGTAA430 440 450TTTAATTAAT TCATTCCACA TTTTTTTCAAAAATTAATTA AGTAAGGTGT AAAAAAAGTT460 470 480AATAAGATGA TTTAATTTTA AAAATGTATTTTATTCTACT AAATTAAAAT TTTTACATAA490 500 510TAAGTATTTA AAAGTATAAT TAATGTATTTATTCATAAAT TTTCATATTA ATTACATAAA520 530 540TCTTTTTTTT ATAAAATCTT TTACAAAAAAAGAAAAAAAA TATTTTAGAA AATGTTTTTT550 560 570ATACTCATCA TACATTTTAT ATTTTTTATATATGAGTAGT ATGTAAAATA TAAAAAATAT580 590 600TAAAAGAGAA TAAATATTTT TTATATAATTATTTTCTCTT ATTTATAAAA AATATATTAA610 620 630ATTGTACAAA GAAGTATAAT TCTTAAACAATAACATGTTT CTTCATATTA AGAATTTGTT640 650 660GTTATAAGTT ATTCTCATAT TTAATAGATGCAATATTCAA TAAGAGTATA AATTATCTAC670 680 690ATATTTTCTT TTTAATGCTT TTTTTTCTTTTATAAAAGAA AAATTACGAA AAAAAAGAAA700 710 720ATTTATAGTA AATAGTGTTA TTTTTGCTTTTAAATATCAT TTATCACAAT AAAAACGAAA730 740 750ACTATTTGTA TATTTTATAT TAGCATCACTTGATAAACAT ATAAAATATA ATCGTAGTGA760 770 780TACAAAAATT CTTCTTAAAA AATTACGTCTATGTTTTTAA GAAGAATTTT TTAATGCAGA790 800 810TTTTTTTAGA TATATAAATT TAGTTTTACCAAAAAAATCT ATATATTTAA ATCAAAATGG820 830 840TAAAAATTGA CGGTTTTTAA AAAATAAATTATTTTTAACT GCCAAAAATT TTTTATTTAA850 860 870AAAATAACTT TTAATTATTT TATTTATATTTTTTATTGAA AATTAATAAA ATAAATATAA880 890 900TACAGTATTA GCTGGTATAT TTTTCATATTATGTCATAAT CGACCATATA AAAAGTATAA910 920 930ATTTTTATTA AAAGAATATA TAACATTTTTTAAAAATAAT TTTCTTATAT ATTGTAAAAA940 950 960TCATTCTTTT GAAAAAGCAG GTAAATATTTAGTAAGAAAA CTTTTTCGTC CATTTATAAA970 980 990CATATTATTT ATAACAGTTA ATTTAGGTTTGTATAATAAA TATTGTCAAT TAAATCCAAA1000 1010 1020TAAACCAGAA GTTCTGATAT TTTTATTTAAATTTGGTCTT CAAGACTATA AAAATAAATT1030 1040 1050ATTATTCTTA AAAATTTTCA TTTTTATTTATAATAAGAAT TTTTAAAAGT AAAAATAAAT1060 1070 1080TTATTTATTT CTTTTTATTT CTTTTTATATAATAAATAAA GAAAAATAAA GAAAAATATA1090 1100 1110GCTTATTATA GCTTTAACCT ATAGCCATAACGAATAATAT CGAAATTGGA TATCGGTATT1120 1130 1140AAATGTTGGG TAGTTTAAAA GGATTATCATTTTACAACCC ATCAAATTTT CCTAATAGTA1150 1160 1170GTATTGCATA ACATTCACCT TATAGTCGTTCATAACGTAT TATAAGTGGA ATATCAGCAA1180 1190 1200GAACGTTTTT ATTTTATAAC ATATGCTAAACTTGCAAAAA TAAAATATTG TATACGATTT1210 1220 1230ATAAATTCCG CTTCAAATTT ACTATCTTAATATTTAAGGC GAAGTTTAAA TGATAGAATT1240 1250 1260GTAATTTTJG AAATTTACCC AATTTATATCCATTAAAAKC TTTAAATGGG TTAAATATAG1270 1280 1290AATTATTTTA AGAGCTCTTA GCTCAAATAATTAATAAAAT TCTCGAGAAT CGAGTTTATT1300 1310 1320AATATTAAAG GACAAACATC CCTAGCGTAGTTATAATTTC CTGTTTGTAG GGATCGCATC1330 1340 1350CTTTTCCAAT AATCCAAGAT CCGTTAAATTGAAAAGGTTA TTAGGTTCTA GGCAATTTAA1360 1370 1380ATCGATGCTA TTTATACCTT AACAAGTGCTTAGCTACGAT AAATATGGAA TTGTTCACGA1390 1400CTGTTACGAG ATCGACAATGCTC TAG.______________________________________

2. Hybrid plasmid pLEU97.

3. Hybrid plasmid pCEP97.

4. Hybrid plasmid pCYG97.

5. Escherichia coli C600r.sup.- m.sup.- (pLEU97).

6. Escherichia coli C600r.sup.- m.sup.- (pCEP97).

7. Escherichia coli C600r.sup.- m.sup.- (pCYG97).