Patent Application
20100129815
Muscle contraction depends on the ATP-driven sliding of highly organized arrays of actin filaments against arrays of myosin II filaments. Phosphorylation of both myosin heavy- and light-chains affects both motor activity and thick filament assembly (1).
In nonmuscle cells, myosin II probably exists in two different conformational states: a bent state (inactive state, 10S) in which the tail domain apparently interacts with the motor head and an extended state (active state, 6S) that is capable of forming bipolar filaments and exposing its actin-binding site. Phosphorylation of regulatory myosin light chain (MLC) by Ca2+/calmodulin-dependent myosin light chain kinase (MLCK) likely causes the myosin II to preferentially assume the extended state, which promotes its assembly into a bipolar filament leading to cell contraction (1). In smooth muscle cells, phosphorylation of MLC2 by smooth muscle-MLCK is thought to be responsible for the initiation of contraction (2). In skeletal and cardiac muscles, however, initiation of muscle contraction depends on voltage-gated L-type Ca2+ channels in the plasma membrane and T-tubules. Increased local Ca2+ concentrations allows the sarcoplasmic reticulum to release large amounts of Ca2+, which binds to troponin C followed by myosin-actin cross-bridge formation. During this process, MLCK potentiates peak tension in skeletal muscle (1,3), and the force and the rate of cross-bridge recruitment in cardiac myocytes (4,5).
To date, skeletal- and smooth muscle-MLCKs have been characterized (3). Mouse skeletal muscle-MLCK gene (mylk1) is located on chromosome 2, encodes 613 amino acids and is predominantly expressed in skeletal muscle, while mouse smooth muscle-MLCK gene (mylk2) is located on chromosome 16, encodes three different isoforms by alternative promoters, the long form has 1950 amino acids and the short form has 1031 amino acids, and they are expressed in several tissues (6,7). The shortest form lacking a catalytic domain, called telokin has also been characterized (3). Generally, MLCKs have preference for their MLC substrate isolated from the same tissue. For instance, the smooth muscle MLCK phosphorylates smooth muscle MLC2, but it does not preferentially phosphorylate skeletal MLC2 and cardiac MLC2v. The amino acid sequence of substrates appears to be critical for catalytic activity of smooth muscle MLCK, particularly an arginine residue located at the third position amino-terminal of the phosphorylated serine residue, which is present in smooth muscle MLC (Arg-Ala-Thr-Ser), but absent in skeletal MLC (Gly-Gly-Ser-Ser) as well as MLC2v (Gly-Gly-Thr-Ser) (8-10).
On the other hand, skeletal MLCK has little substrate specificity, which phosphorylates skeletal-, smooth muscle and cardiac MLCs (11,12). In addition, mutations in human skeletal MLCK on human chromosome 20 were mapped to a disease locus for familial cardiac hypertrophy (OMIM 606566), suggesting that the abnormal function of skeletal MLCK stimulates cardiac hypertrophy (13). However, the abundance of skeletal MLCK expression in the heart is controversial (13-15). Short-form (130 kDa) smooth-muscle MLCK is expressed in the heart at lower levels than those detected in smooth muscle-rich organs such as gut, uterus and lung (6,7). Gene targeted mice for skeletal MLCK as well as for smooth muscle MLCK appear to have normal cardiac function (15,16). These results suggest that an additional MLCK that is preferentially expressed in the heart is plausible because MLC2 phosphorylation in cardiac muscle is a key regulator of heart contraction (5). Indeed, several cardiac proteins contain MLCK-like domains including titin-kinase and obscurin-MLCK kinase. Although a substrate for obscurin-MLCK kinase remains to be identified, the substrate for titin-kinase is not MLC, but Z-disc localizing protein telethonin (titin-cap protein) (17).
In the process of identifying genes regulated by the cardiac homeobox transcription factor, NRx2-5, a gene product highly homologous to the previously characterized skeletal and smooth muscle MLCK was identified; however, this gene product is distinctly different in its amino-terminal domain. The sequence of this MLCK homologue has been available (NCBI UniGene No. Rn. 43838-rat, Mm32804-mouse (each of which is hereby incorporated by reference in its entirety), yet its tissue-specific expression pattern and function have not been studied. Limited information regarding this MLCK gene has sometimes confounded its identity with the previously characterized skeletal and smooth muscle MLCKs. In this application, the initial characterization of the MLCK homologue, including its cardiac-specific expression, intracellular localization, catalytic activity and potential functions in sarcomere organization and cardiac contraction are described and uses for the homologue are discussed.
The subject invention pertains to the association of a MLCK homologue with cardiac tissue and methods of identifying candidate compounds that can modulate the activity of this MLCK homologue and the expression of MLCK gene product. Additionally, methods of treating heart failure are also provided by the subject invention.
SEQ ID NO: 1 is the polypeptide sequence of murine cardiac MLCK.
SEQ ID NO: 2 is the polypeptide sequence of human MLCK.
SEQ ID NO: 3 is the polynucleotide sequence encoding murine cardiac MLCK.
SEQ ID NO: 4 is the polynucleotide sequence encoding human MLCK.
Host cells transformed by a vector comprising a nucleic acid encoding the MLCK polypeptide can be used for a variety of purposes, including the screening of candidate compounds for the ability to modulate MLCK expression or activity. In certain aspects of the invention, it is preferable to utilize eukaryotic cells, such as MLCK deficient or defective cardiomyocytes, as host cells for the expression of MLCK polypeptide. Exemplary nucleic acids in this aspect of the invention are SEQ ID NO: 3 (see also NCBI Accession No. NM—175441, which is hereby incorporated by reference in its entirety) or SEQ ID NO: 4 (see also NCBI Accession No. NM—182493, which is hereby incorporated by reference in its entirety).
The term “modulate(s)” refers to the ability of a candidate compound to upregulate/increase or downregulate/decrease MLCK gene expression or MLCK polypeptide activity.
The term “biological sample” is used to refer to cardiomyocytes and/or cardiac fibers that are obtained from an individual or grown in culture from cell lines.
The terms “subject(s)” or “individual(s)” may be used interchangeably throughout this specification and include human and non-human animals.
The term “MLCK polypeptide” includes the murine and human form of cardiac specific MLCK polypeptides. The murine MLCK is identified in SEQ ID NO: 1 (see also NCBI Accession No. NP—780650, which is hereby incorporated by reference in its entirety). The human form of the MLCK polypeptide is identified in SEQ ID NO: 2 (see also NCBI Accession No. NP—872299, which is hereby incorporated by reference in its entirety). The term “MLCK polypeptide” can also include catalytically active fragments of a MLCK polypeptide (e.g., a polypeptide that retains kinase activity or the ability to phosphorylate substrate).
The term “cardiac sample” is used to identify biological samples obtained from a test or control subject that are to be tested for MLCK expression. A “cardiac sample” is any cardiac tissue, including individual cardiomyocytes, populations of cardiomyocytes and cardiac fibers obtained from a subject.
The phrases “MLCK gene product” or “MLCK expression” refers to nucleic acids (e.g., mRNA or cDNA) obtained from the expression of the MLCK gene in a subject or individual or a host cell as well as to polypeptides and fragments thereof arising from the translation of mRNA into protein (i.e., MLCK polypeptide). In certain aspects of the invention, methods of detecting an increase or decrease in mRNA levels or polypeptide levels in response to candidate compounds are preferred.
The subject invention provides for methods of identifying individuals or subjects at risk of developing heart failure. In this aspect of the invention, individuals at risk of developing heart failure are identified as those individuals having lower levels of MLCK polypeptide as compared to normal or control individuals. Methods of identifying such individuals are based upon Western blot formats or standard immunoassays known to the skilled artisan and utilize MLCK polypeptide derived from cardiac or heart tissue (e.g., cardiomyocytes). For example, antibody-based assays such as enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), lateral flow assays, reversible flow chromatographic binding assay (see, for example, U.S. Pat. No. 5,726,010, which is hereby incorporated by reference in its entirety), immunochromatographic strip assays, automated flow assays, and assays utilizing peptide-containing biosensors may be employed for the detection of MLCK polypeptides (or fragments thereof) in biological samples obtained from an individual or subject. Assays and methods for conducting the assays are well-known in the art and the methods may test biological samples (e.g., cardiac tissue samples) qualitatively (presence or absence of MLCK polypeptide) or quantitatively (comparison of a biological sample from a subject against a sample obtained from normal (control) subjects. These assays can detect the full length MLCK polypeptide or fragments of the MLCK polypeptide that are recognized/specifically bound by MLCK specific antibodies.
The antibody-based assays can be considered to be of four types: direct binding assays, sandwich assays, competition assays, and displacement assays. In a direct binding assay, either the antibody or antigen is labeled, and there is a means of measuring the number of complexes formed. In a sandwich assay, the formation of a complex of at least three components (e.g., antibody-antigen-antibody) is measured. In a competition assay, labeled antigen and unlabelled antigen compete for binding to the antibody, and either the bound or the free component is measured. In a displacement assay, the labeled antigen is pre-bound to the antibody, and a change in signal is measured as the unlabelled antigen displaces the bound, labeled antigen from the receptor.
Lateral flow assays can be conducted according to the teachings of U.S. Pat. No. 5,712,170 and the references cited therein. U.S. Pat. No. 5,712,170 and the references cited therein are hereby incorporated by reference in their entireties. Displacement assays and flow immunosensors useful for carrying out displacement assays are described in: Kusterbeck et al., (1990); Kusterbeck et al., (1990a); Ligler et al., (1992); Ogert et al., (1992), all of which are incorporated herein by reference in their entireties. Displacement assays and flow immunosensors are also described in U.S. Pat. No. 5,183,740, which is also incorporated herein by reference in its entirety. The displacement immunoassay, unlike most of the competitive immunoassays used to detect small molecules, can generate a positive signal with increasing antigen concentration.
The term “antibody” includes monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired biological activity, particularly neutralizing activity. “Antibody fragments” comprise a portion of a full length antibody, generally the antigen binding or variable region thereof. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multi-specific antibodies formed from antibody fragments.
The MLCK polypeptide can also be used in screening assays to identify candidate compounds suitable for the treatment of heart failure or myocardial infarction. In these assays, the MLCK polypeptide can be expressed in a host cell or cardiomyocytes containing the MLCK polypeptide can be used to for identifying candidate compounds that are able to modulate the activity of the MLCK polypeptide. For example, compound libraries can be screened of the ability to increase (agonize) or inhibit (antagonize) the level of expression of the MLCK gene or the activity of the MLCK polypeptide. Preferred compounds increase the expression of the naturally occurring MLCK gene or increase the activity of the MLCK polypeptide within cardiomyocytes or cardiac fibers.
Candidate compounds (e.g., agonists or antagonists) may be isolated from, for example, cells, cell-free preparations, chemical libraries or natural product mixtures. These agonists or antagonists may be natural or modified substrates, ligands, enzymes, receptors or structural or functional mimetics. Additional candidate compounds include small organic molecules, peptides, polypeptides and antibodies that bind to the MLCK polypeptide and increase or decrease (inhibit) its kinase activity.
Where the MLCK polypeptide is employed in screening techniques, the polypeptide can be provided free in solution or attached to a solid support. Alternatively, the MLCK polypeptide can be expressed within a cell, expressed at the cell surface or provided as a natural expression product in cardiomyocytes. In general, screening procedures involve contacting a MLCK polypeptide with a candidate compound to observe binding or the stimulation or inhibition of a biological activity. The stimulation or inhibition of a biological activity is compared to a control preparation that is not contacted with the candidate compound.
One biological activity that can be used to identify candidate compounds that modulate the activity of MLCK is kinase activity. For example, a kinase activity assay can be performed in the presence and absence of a candidate compound and the effect of the candidate compound on MLCK activity (e.g., the ability to phosphorylate a suitable substrate) is determined. Assays for MLCK kinase activity are well-known in the art; see, for example, U.S. Pat. No. 5,906,819. Alternatively, the ability of a candidate compound to modulate MLCK activity can be assessed by a series of kinase activity assays that are carried out in the presence of varying concentrations of the candidate compound (including a control assay containing no candidate compound). The extent of phosphate incorporation into substrate is determined for each assay in the series. Other assays for assessing phosphate incorporation into substrates are disclosed in published U.S. Application Number: 20040126860, which is hereby incorporated by reference in its entirety. A preferred method for identifying a candidate (an agonist or antagonist) compound of the MLCK polypeptide comprises:
(a) contacting a MLCK polypeptide with a candidate compound; and
(b) determining whether the candidate compound modulates MLCK activity.
In certain of the embodiments, simple binding assays may be used to detect the binding of a candidate compound to a MLCK polypeptide. Such binding can be detected by means of a label directly or indirectly associated with the candidate compound or in an assay involving competition with a labeled competitor. In another embodiment, competitive drug screening assays can be used to identify candidate compounds that interact with the active site of MLCK. For example, antibodies specific for the MLCK active site can be used to specifically compete with a candidate compound for binding to the MLCK active site.
Screening assays may include the detection of an increase or a decrease in the production of mRNA encoding the MLCK polypeptide or detection of increased or decreased levels of MLCK mRNA in cells (e.g., cardiomyocytes or cardiac fibers). For example, an ELISA assay that measures cell-associated levels of polypeptide using monoclonal or polyclonal antibodies by can be used to identify compounds that may inhibit or enhance the production of the MLCK polypeptide in transformed host cells, cardiomyocytes or cardiac fibers. The formation of binding complexes between the polypeptide and the compound being tested may then be measured. Alternatively, hybridization assays for detecting the level of MLCK mRNA can be performed according to methods well known in the art.
Another aspect of the invention provides methods of screening candidate compounds that comprise (a) detecting MLCK gene product signals from cells expressing the MLCK gene product; (b) contacting the cells with a candidate compound; (c) detecting gene product signals from cells contacted with the candidate compound; (d) comparing gene product signals from the cells from cells before and after contact with the candidate compound to determine the responsiveness of the MLCK gene to increased or decreased expression arising from contact with the candidate compound. The MLCK gene product can be either the MLCK polypeptide or mRNA expressed by the cell after contact with the candidate compound.
Methods for the detection/identification of increased or decreased expression of genes, such as the MLCK gene, exist and any suitable method for detection is encompassed by the instant invention. Typical assay formats utilizing nucleic acid hybridization includes, and are not limited to, 1) nuclear run-on assay, 2) slot blot assay, 3) northern blot assay (Alwine, et al., Proc. Natl. Acad. Sci. 74:5350), 4) magnetic particle separation, 5) nucleic acid or DNA chips, 6) reverse Northern blot assay, 7) dot blot assay, 8) in situ hybridization, 9) RNase protection assay (Melton, et al., Nuc. Acids Res. 12:7035 and as described in the 1998 catalog of Ambion, Inc., Austin, Tex.), 10) ligase chain reaction, 11) polymerase chain reaction (PCR), 12) reverse transcriptase (RT)-PCR (Berchtold, et al., Nuc. Acids. Res. 17:453), 13) differential display RT-PCR (DDRT-PCR), 14) nested PCR, 15) quantitative PCR or other suitable combinations of techniques and assays. Labels suitable for use in these detection methodologies include, and are not limited to 1) radioactive labels, 2) enzyme labels, 3) chemiluminescent labels, 4) fluorescent labels, 5) magnetic labels, or other suitable labels, including those set forth below. The general methods of PCR are well known in the art and are thus not described in detail herein. For a review of PCR methods, protocols, and principles in designing primers, see, e.g., Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc. N.Y., 1990. PCR reagents and protocols are also available from commercial vendors, such as Roche Molecular Systems. Furthermore, labels useful in producing probes for use in the disclosed methods are well known in the art and widely available to the skilled artisan. Likewise, methods of incorporating labels into the nucleic acids are also well known to the skilled artisan. As would be apparent to one skilled in the art, primers can be designed, or obtained from vendors, using MLCK polynucleotide sequences such as those of SEQ ID NO: 3 or 4.
Another technique for screening candidate compounds having suitable binding affinity for the MLCK polypeptide is high throughput screening (see International patent application WO84/03564). In this method, large numbers of different small test compounds are synthesized on a solid substrate and then be reacted with the MLCK polypeptide and washed. MLCK polypeptides bound to the candidate compounds may then be detected using methods that are well known in the art (e.g., detection with MLCK specific antibodies). Purified polypeptide can also be coated directly onto plates for use in the aforementioned drug screening techniques.
Yet another aspect of the invention pertains to methods of treating heart failure. In this aspect of the invention, candidate compound is administered to a subject in a therapeutically effective amount to activate the MLCK polypeptide.
Another aspect of the invention provides methods of treating heart failure in a subject via gene therapy. In this aspect of the invention, cardiomyocytes are targeted for increased expression of MLCK. Gene therapy can be performed in vivo or ex vivo. Ex vivo gene therapy requires the isolation and purification of patient cardiomyocytes, the introduction of a therapeutic gene and introduction of the genetically altered cardiomyocytes into the patient. In contrast, in vivo gene therapy does not require isolation and purification of a patient's cells.
For in vivo gene therapy, a MLCK gene (for example an autologous MLCK gene isolated from cardiomyocytes the subject or individual or a synthetic MLCK gene obtained from a vendor or other synthesis method) is “packaged” for administration to a subject/individual. Gene delivery vehicles may be non-viral, such as liposomes, or replication-deficient viruses, such as adenovirus as described by Berkner, K. L., in Curr. Top. Microbiol. Immunol., 158, 39-66 (1992) or recombinant adeno-associated virus (rAAV) vectors as described by Muzyczka, N., in Curr. Top. Microbiol. Immunol., 158, 97-129 (1992), Aikawa et al., J. Biol. Chem., 277, 18979-18989 (2002) and U.S. Pat. No. 5,252,479 each of which is hereby incorporated by reference in its entirety. For example, a nucleic acid molecule encoding a MLCK polypeptide can be engineered for expression in a replication-defective retroviral vector or a rAAV vector. The replication-defective retroviral construct may then be isolated and introduced into a packaging cell transduced with a retroviral plasmid vector containing RNA encoding the polypeptide, such that the packaging cell now produces infectious viral particles containing the gene of interest. These producer cells may be administered to a subject for engineering cells in vivo and expression of the polypeptide in vivo. Alternatively, rAAV vectors comprising the nucleic acid encoding MLCK can be directly introduced into the heart or cardiac tissue in order to effect MLCK expression. Another approach is the administration of “naked DNA” into cardiomyocytes, cardiac fibers or cardiac tissue.
All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
Following are examples which illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
Cloning of Cardiac and Skeletal MLCK and Plasmid Construct—RNA isolated from neonatal mouse hearts and skeletal muscle were subjected to reverse transcription using random priming followed by PCR using four sets of specific primers to amplify partial cardiac MLCK cDNA: (fragment 1; F, 5′-CCTTCCAGATGTTAGCACCAAAGTG-3′ R, 5′-TGCCGCACAGCCCTCACCAG-3′), (fragment 2; F, 5′-TGGCAGCACTCCCCCAACC-3′ R, 5′-CCAAACCGACCCCCTCCTAAG-3′), (fragment 3; F, 5′-AAGAGGAGCAGCAACAATGGTG-3′ R, 5′-TTTCAGGCACTGTGTGGCG-3′), (fragment 4; F, 5′-AGTTGGATGTGGTCTTGTTCACG-3′ R, 5′-AAAAGGAAGGGTGCGGGG-3′). Fragments 1-4 were used for cloning of the full length of MLCK cDNA using PCR. Two sets of specific primers were used for amplifying partial skeletal MLCK cDNA: (fragment 1; F, 5′-GACTACAGAAAACGGAGCAGTTGAG-3′ R, 5′-TGCCGCACAGCCCTCACCAG-3′), (fragment 2; F, 5′-AGACACCCAAGGACAAGGAAATG-3′ R, 5′-GGCGGTAGCGAGATGGATTC-3′). HA-tagged partial skeletal MLCK was amplified from fragment 1 with the specific primer set (F, GGGTACCATGTACCCATACGATGTTCCAGATTACGCTACTACAGAAAACGGAGC AGTT, R, 5′-TGCCGCACAGCCCTCACCAG-3′), followed by insertion of fragment 2 into the appropriate restriction sites to construct full length HA-tagged skeletal MLCK.
HA-tagged full length cardiac MLCK was amplified by PCR (F, 5′-GGGTACCATGTACCCATACGATGTTCCAGATTACGCTTCAGGAGTTTCAGAGGAG GA-3′, R, 5′-AAAAGGAAGGGTGCGGGG-3′) and cloned into TOPO-blunt PCR vector. SacI-blunt/KpnI fragment was subcloned into the EcoRI-blunt/KpnI sites of pAdlox shuttle vector (18) to generate pAdlox-cardiac MLCK. KpnI/BamHI-blunt fragment of HA-tagged full length skeletal MLCK was subcloned into the BamHI-blunt/KpnI sites of pAdlox shuttle vector to generate pAdlox-skeletal MLCK.
Adenoviral short-hairpin (sh) RNA was generated according to our standard methods (19). Briefly, the target sites for RNAi of rat cardiac MLCK were designed using the web sites (QIAGEN— http://siRNA.qiagen.com/Index.jsp., and Ambion-http://www.ambion.com/techlib/misc/siRNA_finder.html.m1.). Three specific sites for rat MLCK-RNAi are: (1) CTTAATGTGCTGACTGAGA, (2) CAGATGCAGAGACCATGAA, (3) ATATATGGCTCAGCGTAAA. Rat NRx2-5-RNAi target sequence is GGCGGTGGAGCTGGACAAA. Scrambled sequences with no homology to known genes were used for control RNAi.
GST-MLCK (28 to 463 aa) vector was generated by insertion of NcoI/XbaI fragment of MLCK cDNA into NcoI/XbaI site of pGEX-CD vector. GST-MLC2V vector was generated by insertion of the BamHI/EcoRI fragment of pcDNA3-rat MLC2V into BamHI/EcoRI site of pGEX-CD vector. GST-MLC2A vector was generated by insertion of the HindIII/SalI digested fragment of the PCR products using two specific primers for mouse MLC2A (F′ 5′-GAAGCTTCATGGCCAGTAGGAAGGCTGGG-3′; R, 5′-CGTCGACCTACTCCTCTTTCTCATCCCCGTG-3′) amplified from the cDNA (IMAGE Consortium CloneID 30300846, OPEN BIOSYSTEMS) (20).
Cardiomyocyte Preparation, Adenovirus Infection and Measurement of Cell Shortening and Simultaneous Intracellular Free calcium—Neonatal rat ventricular cardiomyocytes were isolated from hearts of 2-day-old Sprague Dawley rats by trypsin digestion followed by Percoll gradient purification according to a protocol described previously with some modifications (21). Infection of adenovirus-shRNA (for MLCK and NRx2-5, 100 moi) was performed in suspension immediately after purification for 2 hrs followed by plating on plates or laminin-coated glass coverslips for 48 to 96 hrs in medium (DMEM F-12, 5% new born calf serum, 0.5% of Insulin-Transferrin-Selenium) (Gibco-Invitrogen). Adenovirus Adlox-MLCK (10 and 50 moi) and control Adlox-beta-galactosidase (50 moi) were infected for 2 hrs 48 hrs after plating followed by an additional 24 to 48 hr incubation.
Measurement of cell shortening and simultaneous intracellular free calcium were performed according to methods described previously with some modifications (22). In brief, myocytes were loaded with the acetoxymethyl ester of fura-2 (0.1 μmol/L, Molecular Probes/Invitrogen) in Tyrode's solution (mmol/L: NaCl 137, KCl 3.7, NaH2PO4 1.2, CaCl2 1.2, HEPES 20, MgSO4 1.2, glucose 15; and 0.0005% Pluronic F-127) for 10 minutes at room temperature. Myocytes were rinsed with Tyrode's solution and maintained for 20 minutes at room temperature to allow for de-esterification of the dye, followed by superfusion with modified Tyrode's solution (mmol/L: NaCl 137, KCl 3.7, NaH2PO4 1.2, CaCl2 1.2, HEPES 4, MgCl2 0.5, glucose 15, probenesid 1.0, pH 7.4) on a temperature-controlled chamber (32° C.) mounted on an Olympus inverted microscope. When studied at two Ca2+ concentrations, myocytes were sequentially superfused with 1.2 mM Ca2+ followed by 2.5 mM for 30 minutes before measurement. A dual excitation spectrofluorometer was used to record fluorescence emissions (505 nm) elicited from exciting wavelengths at 340 and 380 nm. Myocytes were imaged with a CCD video camera attached to the microscope and motion was quantified by a video motion detector system (IonOptix). To provide high-contrast spots for tracking cell motion of neonatal cardiomyocytes, glass beads 2±0.5 μm (Duke Scientific Corp) were added as described previously (23). Results between groups were compared using ANOVA and Fisher PLSD post-hoc test. Statistical tests were performed using StatView version 5.01; p<0.05 was considered significant.
Animal Models—Floxed-NRx2-5 mice (24) were bred with transgenic mice carrying the Cre-ER™ gene under CMV promoter (25). Matings generated mice homozygous or heterozygous for the floxed-NRx2-5 gene with or without being heterozygous for Cre-ER™ transgene. Female mice homozygous or heterozygous for floxed-NRx2-5/Cre-ER™ (−) were bred with male mice homozygous or heterozygous for floxed-NRx2-5/Cre-ER™ (+) to generate floxed/floxed/Cre-ER™ (+), floxed/floxed/Cre-ER™ (−) or wild/wild/Cre-ER™ (+). To delete the floxed-NRx2-5 gene, tamoxifen (0.5-1 mg/g body weight, ip) was injected into pregnant mice within 24 hr before delivery. All animal care protocols fully conformed to the Association for the Assessment and Accreditation of Laboratory Animal Care, with approvals from the University of Florida Institutional Animal Care and Use Committees. Upper-septum of the hearts isolated from post-myocardial infarction mice previously described (26) was utilized for Western blotting to examine cardiac MLCK and GAPDA expression.
GST Fusion Protein and MLCK Antibody Production—GST fusion proteins were expressed in E. coli BL21(DE3) (Stratagene) with 1 mM of IPTG for 4 hr at 37 C. Bacteria were lysed by sonication in lysis buffer [20 mM HEPES, pH7.5, 100 mM NaCl, 10 mM MgC1, 1% Triton x-100, proteinase inhibitor cocktail (complete, Roche)]. Lysates were incubated with Glutathione Sepharose (Amersham) and washed with lysis buffer 5 times. For in vitro kinase assays, GST proteins bound to Glutathione Sepharose were further washed with kinase buffer (25 mM HEPES, pH7.6, 200 mM NaCl, 10 mM MgCl2) three times. GST-fusion proteins were eluted with 10 mM of reduced Glutathione (Sigma) in the kinase buffer.
GST-MLCK proteins bound to Glutathione Sepharose were washed with PBS, followed by cleavage of GST protein using thrombin (20 U/ml) for 3 hrs. After addition of Tris-HCl (final concentration 50 mM) and NaCl (final concentration 0.5 M) thrombin was removed by Benzamidine Sepharose (Amersham). MLCK proteins were further purified by SDS-PAGE followed by electro-elution. The purified proteins (150 μg) were emulsified either with complete Freund's adjuvant (day 1) or incomplete Freund's adjuvant (days 14, 28, and 42) to immunize New Zealand White rabbits for polyclonal antibody production. Affinity purification of antibodies was performed using GST-MLCK fusion protein (28-463 aa) covalently bound to agarose beads using AminoLink Plus Immobilization Kit (PIERCE). Northern and Western Blotting and Immunostaining—Northern blot analyses were performed using the following probes: cardiac MLCK RT-PCR product (1266 bp, F: 5′-TGGCAGCACTCCCCCAACC-3′, R: 5′-CCAAACCGACCCCCTCCTAAG-3′); mouse skeletal MLCK RT-PCR product (552 bp, F: 5′-GACTACAGAAAACGGAGCAGTTGAG-3′, R: 5′-GGGTCAGGGGTCACAGACACC-3′); NRx2-5 probe, PflMI-EcoRI fragment of mouse NRx2-5 cDNA.
Western blot analyses and immunostaining were performed with the following primary antibodies: anti-HA (clone 3F10, Roche), anti-MLC2 (F109.3E1, BioCytex, Marseille, France), anti-MLCK pAb described above, anti-phospho-serine (29675, AnaSpec), anti-phospho-tyrosine (4G10, Upstate) and anti-troponin T (T6277, SIGMA). Rhallodin-TRITC (77418, Sigma) was utilized for detecting polymeric F-actin. Fluorescent microscopic images were obtained usings ZEISS Axiovert200M with or without Apotome.
Phosphorylation Assays—Phosphorylation assays were performed according to protocols described previously with some modifications (27). Briefly, in vitro phosphorylation reactions were performed using recombinant HA-tagged full-length MLCK proteins expressed by adenovirus in 293 cells. Immunoprecipitated MLCK proteins using anti-HA antibody (3F10, Roche) bound to protein G sepharose (Sigma) were washed three times with kinase buffer, mixed with GST, GST-MLC2v or GST-MLC2a fusion protein (approximately 2 μg) in the presence of 1 μl of [γ-32P]ATP (0.25 mCi/ml) in 20 μl of kinase buffer at 37° C. for 30 min. Immunoprecipitants without anti-HA antibodies were used as negative controls. 10 μl of each samples were boiled in SDS-PAGE sample buffer and subjected to SDS-PAGE. Kinase activity was measured as the rate of 32P incorporation into GST-MLC2v fusion protein. HA tagged-cardiac MLCK and HA-tagged skeletal MLCK expressed in 293 cells were purified by HA-affinity columns and eluted with HA-peptides (Roche). GST-MLC2v and HA-tagged cardiac and skeletal MLCK proteins were dialyzed against protein lysis buffer (25 mM HEPES, PH7.6, 100 mM NaCl, 5 mM MgCl2, 1 mM DTT, 1% triton, 10% glycerol, protease inhibitor cocktail). A 1:10 dilution of these proteins were utilized in the kinase reaction (approximately cardiac MLCK 0.15 μg/ml, 1.7 nM, skeletal MLCK 0.15 μg/ml, 2 nM, GST-MLC2v 0.14 mg/ml, 3 mM with 2 fold serial dilution) in 25 μl of kinase buffer (final concentration 25 mM HEPES pH7.6, 10 mM MgCl2, 5 mM DTT, 20 mM NaCl, 0.2% triton, 2% glycerol, 0.5 mg/ml BSA, 0.5 mM [γ-32P]ATP at 267 cpm/pmol) at 30° C. for 15 min. Either 1 mM Ca2+ and 1 μM calmodulin (Sigma P2277) or 5 mM EGTA were added in the kinase reaction to examine Ca2+/calmodulin dependence. After termination of the kinase reaction by the addition of SDS-sample buffer, the samples were separated by 15% SDS-PAGE gel, stained with Coomassie blue and autoradiographed. Phosphorylated MLC2v proteins were excised from the gel and their radioactivity was measured using a liquid scintillation counter. Km and Vmax of cardiac MLCK were determined using Lineweaver-Burk analysis (Prism 4, GraphPad Software, Inc. San Diego, Calif.)
For detection of 32P-labeled MLC2v, neonatal ventricular cardiomyocytes (2×105 cells/3 cm plate) infected with adenovirus were labeled with [32P]-orthophosphate at 0.1 mCi/ml in phosphate-free DMEM containing 10% dialyzed FBS (GIBCO/Invitrogen) for 1 hr. Cells were lysed with 0.6 ml of RIPA buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.1% SDS, 1% NP40, 2 mM EDTA, 1% deoxycholate, protease inhibitor cocktail, 10 mM NaF, 2 mM Na3VO4). 0.25 ml of the lysates was pre-cleared with protein G, and then immunoprecipitated with anti-MLC2 antibody coupled to protein G. Immunoprecipitants without anti-MLC2 antibodies were used as negative controls. After washing with RIPA buffer (5 times), the samples were transferred to PVDF membrane (Millipore) after SDS-PAGE and detected with autography. The membrane was then immunoblotted with anti-MLC2 antibody for detection of the total MLC2v proteins. The relative amount of phosphorylated and total MLC2v was determined by densitometric analyses.
Identification of a Cardiac-Specific MLCK as a Downstream Target of Cardiac Homeobox Protein, NRx2-5—In the process of identifying downstream targets of the cardiac homeobox transcription factor, NRx2-5 in postnatal hearts, a gene product homologous to skeletal and smooth muscle MLCK (NCBI UniGene No. Rn.43838-rat and Mm32804-mouse) was identified. In NRx2-5 knocked-down neonatal rat cardiomyocytes (
The cardiac MLCK gene encodes 795 amino acids with a predicted MW of 86 kDa excluding post-translational modifications. The protein consists of a conserved kinase domain at the carboxyl-terminus with a 58% identity with skeletal MLCK and 44% identity with smooth muscle MLCK. However the amino-terminal domain is quite unique with no significant homology to other known proteins including skeletal MLCK (
Cardiac MLCK Protein Expression—Affinity-purified antibody against the unique amino-terminus domain of cardiac MLCK(28-463 aa) (
To examine the intracellular localization of MLCK, HA-tagged MLCK was expressed by adenovirus delivery and detected ectopic MLCK using anti-HA (red,
Cardiac MLCK Phosphorylates MLC2 in Vitro and in Vivo as Well as Potentially MLCK Itself—The ability of cardiac MLCK to phosphorylate its putative substrate MLC2 was also examined. In vitro kinase assays using HA-tagged cardiac MLCK expressed in 293 cells promotes incorporation of 32P to GST-MLC2v and GST-MLC2a fusion proteins (
Next, an assay was performed to determine whether cardiac MLCK affects the level of MLC2v phosphorylation in cultured ventricular cardiomyocytes. Overexpression of cardiac MLCK increases MLC2v phosphorylation nearly 2.1 fold in a dose-dependent manner (
Catalytic activities of smooth muscle and skeletal MLCKs are known be regulated by phosphorylation predominantly by upstream kinases (32). Cardiac MLCK also appears to be phosphorylated at serine residue(s) but not at tyrosine residues (
Cardiac MLCK Promotes Sarcomere Organization and Increases Cardiomyocyte Contractility—It was observed that cardiomyocytes in which cardiac MLCK was overexpressed displayed organized sarcomere structures characterized by straight, thick, striated actin bundles detected by phalloidin (
Experiments that examined whether cardiac contraction is affected by increased or decreased MLCK expression by measuring cardiomyocyte cell shortening and simultaneous intracellular Ca2+ transients were performed. These experiments showed that adenoviral-mediated overexpression of MLCK resulted in significantly increased cardiomyocyte contraction amplitude, and kinetics of contraction and relaxation without a significant change in intracellular Ca2+ transients (
On the other hand, MLCK knockdown did not significantly affect cardiomyocyte contraction at the standard Ca2+ superfusate concentration (1.2 mM) (
In summary, overexpression of cardiac MLCK potentiates cardiomyocyte contraction, but reduced expression of cardiac MLCK does not affect cardiac contraction at the basal Ca2+ concentration. Reduction of cardiac MLCK affects cardiomyocyte contraction when extracellular Ca2+ concentration was increased, when greater MLCK activity might be required to achieve higher level of cardiac contraction.
Cardiac MLCK Expression in Post-myocardial Infarction Heart Failure Mouse Model—To investigate whether cardiac MLCK protein expression is altered in heart failure, cardiac tissue from mice with heart failure due to coronary artery ligation was examined. Cardiac MLCK expression in the non-infarcted upper ventricular septum was significantly downregulated in mice with severe heart failure compared with sham-operated mice (
Cardiac MLCK Expression and MLC2v Phosphorylation in Mice with NRx2-5 Knockout, Aging and Post-Myocardial Infarction Heart Failure.
To examine catalytic activities of cardiac MLCK in vivo, we first examined cardiac MLCK expression and MLC2v phosphorylation levels in NRx2-5 knockout hearts at postnatal day 12 when expression of cardiac MLCK mRNA (
Cardiac MLCK mRNA increased during development from neonatal to adult stages and persisted in the aged hearts (
We next examined cardiac MLCK expression in a post-myocardial infarction mouse model of heart failure three weeks after coronary artery ligation. At the mRNA level, cardiac MLCK expression in non-infarcted upper ventricular septal tissue was similar to tissue from sham-operated age-matched mice (
Skeletal and smooth muscle MLCKs are known to preferentially phosphorylate their tissue-specific MLC2 substrates. For instance, smooth muscle MLCK has a high affinity to smooth muscle MLC, but not to skeletal- and cardiac MLC2v (8-10). Although MLC2 phosphorylation is critical for the regulation of cardiomyocyte contraction (5), a cardiac-specific MLCK has not yet been demonstrated. In this study, a homologue of skeletal and smooth muscle MLCK that is preferentially expressed in the heart, herein named cardiac MLCK, was isolated and localized to cardiac tissue. Despite the availability of sequence data of this cardiac MLCK in the public domain, this gene and its protein have not been characterized. Expression of cardiac MLCK mRNA is markedly downregulated shortly after reduction of NRx2-5 expression by NRx2-5 knockdown and inducible NRx2-5 knockout. NRx2-5 expression is nearly restricted to the heart in the postnatal stage (28-30), and its downstream target gene cardiac MLCK expression is detected only in the heart using multi-tissue Northern blotting. A recent study showed that genes regulated in both heart failure patients and in murine models of heart failure, contain significantly more putative NRx2-5 binding sites in their 5 kb promoter region (33). Thus, our data may shed light on one potential NRx2-5-dependent regulatory pathway through regulation of cardiac MLCK expression in heart failure. Either direct- or indirect-effects of NRx2-5 on cardiac MLCK transcription remain to be elucidated.
Increased expression of cardiac MLCK induces organized sarcomere structure in neonatal cardiomyocytes characterized by straight, thick, striated actin bundles as seen by overexpression of skeletal MLCK (12). Ser19 phosphorylation of MLC2 leading to potentiation of the force and speed of contraction has been well studied in smooth muscle and skeletal muscle (3,32). Our experiments also demonstrated that overexpression of cardiac MLCK enhances cardiomyocyte contraction, likely due to a combination of increased MLC2 phosphorylation and organized sarcomere structure stably formed within 36-48 hr after MLCK adenovirus infection. Of note, cultured neonatal cardiomyocytes are used frequently because of their unique rapid modification of sarcomere organization and overall cellular morphology (34).
On the other hand, decreased expression of cardiac MLCK did not markedly disturb sarcomere organization within 96 hrs. Consistent with the subtle morphological changes, myocytes in which MLCK was knocked-down did not show an apparent reduction in contractile function in single cardiomyocytes superfused with buffer containing basal Ca2+ concentration (1.2 mM). In normal cardiomyocytes, increased Ca2+ concentration (2.5 mM) enhanced cardiomyocyte contraction (
Although MLCK was knocked-down successfully using adenoviral-mediated RNAi (see
Cardiac MLCK has a similar overall structure to the known skeletal and smooth muscle MLCKs, including a conserved catalytic- and adjacent putative Ca2+/calmodulin binding domains at the carboxyl-terminus. However, its catalytic activity was not observed to be regulated by Ca+/calmodulin or EGTA (5 mM) in our vitro kinase assay. It is possible that, in cardiomyocytes, cardiac MLCK forms a protein complex with other factors which may regulate its catalytic activity Ca2+/calmodulin-dependently. It is well known that under physiological conditions, the level of MLC2v phosphorylation in the myocardium is maintained relatively constant by well-balanced MLCK induced phosphorylation and phosphatase-induced dephosphorylation (31). In addition, elevation of cytoplasmic Ca2+ induced by infusion of Ca2+ or positive inotropic agents did not consistently increase MLC2v phosphorylation (39-41). These previous observations may be explained by Ca2+/calmodulin-independent cardiac MLCK's activity which has a high Km, but relatively low Km. Perhaps this could reflect a functional requirement for this kinase in the heart or cardiomyocyte that contracts and relaxes constantly.
The amino-terminus of cardiac MLCK has no homologies to known proteins, suggesting that the unique amino-terminus may have additional functions, including regulation of kinase activity, localization of proteins, or interaction with other proteins. Cardiac MLCK was predominantly distributed diffusely throughout the cytoplasm. Occasionally, MLCK showed a striated expression pattern but was not overlapping with MLC2v in A bands, instead it was overlapping with actin in I bands. This finding may be interpreted that the interaction between MLCK and its substrate, MLC2v may be transient. It is also possible that cardiac MLCK may have additional functions including phosphorylation of other proteins. Previous studies demonstrated that intracellular localization of smooth muscle MLCK (long-form) depends on the actin-binding sequence consisting of repeat motifs (DFRXXL) located in the amino terminus (32,42). Although cardiac MLCK and actin are occasionally co-localized, cardiac MLCK does not have conservation in the actin-binding sequences. Thus, different domains in cardiac MLCK may regulate its intracellular localization.
Previous studies demonstrated that phosphorylation of MLCKs appears to be important for regulating MLCK activities. With smooth muscle MLCK, the most well-studied effect of MLCK phosphorylation occurs upon phosphorylation of one of two serine residues in the carboxyl-terminus of the Ca2+/calmodulin-binding sequence by protein kinase A, protein kinase C, CaMKII and PAK (3). Although cardiac MLCK is phosphorylated at serine residue(s), these two serine residues are not conserved in cardiac MLCK (789R, 790K in
It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application. In addition, any elements or limitations of any invention or embodiment thereof disclosed herein can be combined with any and/or all other elements or limitations (individually or in any combination) or any other invention or embodiment thereof disclosed herein, and all such combinations are contemplated with the scope of the invention without limitation thereto.
This application claims the benefit of U.S. Provisional Application Ser. No. 60/911,770, filed Apr. 13, 2007, the disclosure of which is hereby incorporated by reference in its entirety, including all figures, tables and amino acid or nucleic acid sequences.
This invention was made with government support under NHLBI, National Institutes of Health, contract number IR01 HL081577. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US08/60201 | 4/14/2008 | WO | 00 | 10/7/2009 |
| Number | Date | Country | |
|---|---|---|---|
| 60911770 | Apr 2007 | US |
