Patent Application
20120003655
Neurological disorders affect large portions of the human population each year. For example, amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative adult disease characterized by fatal paralysis in both the brain and spinal cord motor neurons. Parkinson's disease (PD) is the most prevalent movement disorder among people over 65 years old. The denervation of dopaminergic neurons in the substantia nigra (SN) results in severely debilitating motor symptoms such as bradykinesia, resting tremor and rigidity (Farrer, 2006; Fearnley and Lees, 1991). Currently, there are very few neuroprotective agents that effectively treat these disorders. For example, there is only one FDA-approved treatment for ALS, namely riluzole (Doble, 1996), and it only extends the course of the disease for 2 months (Miller and Moore, 2004).
Therefore, there is an urgent need for additional and improved treatments for neurological disorders such as ALS and PD. The methods provided herein solve these and other needs in the art.
Provided herein are methods for, inter alia, identifying new therapeutic agents using human cell-based models. In particular, pro-inflammatory human glial cells may be used in rapid drug screening tests. In addition, human co-culture models using pro-inflammatory human glial cells and human neuronal cells are also provided. Previous murine models have shown inefficacy in both pre-clinical and clinical human trials (DiBernardo and Cudkowicz, 2006; Scott et al., 2008). Therefore, the use of human co-culture models will critically impact the unveiling of complex metabolic pathways involved in neurological diseases.
In one aspect, a method is provided for determining whether a test agent is a neuroprotective agent. The method includes adding a test agent to a cellular culture. The cellular culture includes pro-inflammatory human glial cells. A level of pro-inflammatory activity of the pro-inflammatory human glial cells is determined in the presence of the test agent. The level of pro-inflammatory activity of the pro-inflammatory human glial cells in the presence of the test agent is compared to a control thereby determining whether the test agent is a neuroprotective agent. In some embodiments, a lower level of pro-inflammatory activity of the pro-inflammatory human glial cells in the presence of the test agent compared to a control is indicative of the test agent being a neuroprotective agent.
In another aspect, a method is provided for determining whether a test agent is a neuroprotective agent. The method includes adding a test agent to a cellular culture comprising pro-inflammatory human astrocyte cells. A level of pro-inflammatory activity of the pro-inflammatory human astrocyte cells in the presence of the test agent is determined. The level of pro-inflammatory activity of the pro-inflammatory human astrocyte cells in the presence of the test agent is compared to a control thereby determining whether the test agent is a neuroprotective agent.
In another aspect, a method is provided for treating a disease mediated by a human glial cell inflammatory response in a human subject in need thereof. The method includes administering to the human subject an effective amount of an anti-inflammatory agent.
The left panels show an overview over the SN on the injected and uninjected side in shCtrl-(upper left panel) and shNurr1- (lower left panel) injected mice. Regions indicated by a rectangle in the injected side of the brain are enlarged in the right panels. Scale bars: 200 μm, right panels and 50 μm, left panels. (
A “test agent,” as used herein, is a chemical or biological agent that is tested using the methods provided herein.
A “chemical or biological agent,” as used herein, refers to a chemical compound or biological molecule or agents that include a chemical compound component of biological compound component. Chemical compounds and biological molecules include, for example, synthetic small molecule modulators, peptides and proteins (e.g. antibodies and fragments thereof), saccharides and polysaccharides and derivatives thereof, nucleic acids, and the like.
The terms “treating” or “treatment” refers to any indicia of success in the treatment, prevention, or amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient's physical or mental well-being. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination, neuropsychiatric exams, and/or a psychiatric evaluation.
An “effective amount” is an amount of a kinase inhibitor sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, or to inhibit the activity or a protein kinase relative to the absence of the kinase inhibitor. Where recited in reference to a disease treatment, an “effective amount” may also be referred to as a “therapeutically effective amount.” A “reduction” of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) a disease, or reducing the likelihood of the onset (or reoccurrence) of a disease or its symptoms. The full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations.
“Nucleic acid” refers to deoxyribonucleotides or ribonucleotides and polymers thereof in single- or double-stranded form, or complements thereof. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs). Nucleic acids also include complementary nucleic acids.
“Polypeptide” refers to a polymer in which the monomers are amino acids and are joined together through amide bonds, alternatively referred to as a “peptide.” The terms “peptide” and “polypeptide” encompass proteins. Unnatural amino acids, for example, β-alanine, phenylglycine and homoarginine are also included under this definition. Amino acids that are not gene-encoded may also be used in the present invention. Furthermore, amino acids that have been modified to include reactive groups may also be used in the invention. All of the amino acids used in the present invention may be either the
It has been discovered that the pro-inflammatory activity of human glial cells results in damage to human neuron cells. Damage to human neuron cells are known to be linked with various disease states, such as Parkinson's disease (PD) and Amyotrophic Lateral Sclerosis (ALS). Provided herein are methods (e.g. assays, tests, screens) useful in identifying one or more neuroprotective agents. A “neuroprotective agent,” as used herein, refers to a chemical or biological agent capable of reducing the pro-inflammatory activity of pro-inflammatory human glial cells. “Pro-inflammatory activity” of a pro-inflammatory human glial cell, as used herein, refers to the activity of a human glial cell resulting in the production or expression of known members of a human glial cell inflammatory response process. Known members of the human glial cell inflammatory response process include, but not limited to, reactive species of oxygen (ROS), neurosecretory protein Chromogranin A, secretory cofactor cystatin C, NADPH oxidase, nitric oxide synthase enzymes (such as iNOS), TNFα, IL-1β, and NF-κB-dependent inflammatory response proteins.
In one aspect, a method is provided for determining whether a test agent is a neuroprotective agent (e.g. to identify neuroprotective agents, to assay for neuroprotective agents, to screen for neuroprotective agents, etc.). The method includes adding a test agent to a cellular culture (e.g. a plurality of pro-inflammatory human glial cells). The cellular culture includes pro-inflammatory human glial cells. A level of pro-inflammatory activity of the pro-inflammatory human glial cells is determined in the presence of the test agent. The level of pro-inflammatory activity of the pro-inflammatory human glial cells in the presence of the test agent is compared to a control thereby determining whether the test agent is a neuroprotective agent. In some embodiments, a lower level of pro-inflammatory activity of the pro-inflammatory human glial cells in the presence of the test agent compared to a control is indicative of the test agent being a neuroprotective agent.
In some embodiments, the methods provided herein further include contacting the pro-inflammatory human glial cell with an inflammation inducing agent. The purpose of the inflammation inducing agent is to elicit or induce an inflammatory response from the human glial cell in order to optimize test conditions. Any appropriate inflammation inducing agent may be employed, such as bacterial lipopolysaccharide (LPS), TNFα, rotenone, or expression of toxic proteins, such as mutated superoxide dismutase1 (SOD1) or mutated forms of α-synuclein.
Any appropriate control may be used to compare the level of pro-inflammatory activity of the pro-inflammatory human glial cells in the presence of the test agent. A person having ordinary skill in the art, using the guidance provided herein and the background knowledge in the art, would immediately understand what appropriate controls may be employed. The control is typically a level of pro-inflammatory activity of the pro-inflammatory human glial cells determined using all the same experimental elements used in determining the level pro-inflammatory activity in the presence of the test agent, with the exception that the test agent is not present. The test agent may be simply absent, or may be replaced with a control agent (i.e. an agent known to produce a particular level of pro-inflammatory activity or no pro-inflammatory activity). Thus, in some embodiments, the control is a level of pro-inflammatory activity of the pro-inflammatory human glial cells in the absence of the test agent.
The level of pro-inflammatory activity of the pro-inflammatory human glial cells may be determined using any appropriate technique, including those techniques described herein. For example, pro-inflammatory activity may be assessed by measuring the amount, production or expression of known members of the human glial cell inflammatory response process (e.g. reactive species of oxygen (ROS), neurosecretory protein Chromogranin A, secretory cofactor cystatin C, NADPH oxidase, nitric oxide synthase enzymes (such as iNOS), TNFα, IL-1β, and NF-κB-dependent). Moreover, it has been discovered herein that pro-inflammatory activity of human glial cells results in damage to human neuron cells. Consequently, pro-inflammatory activity may be assessed by measuring an amount of damage to human neuron cells in the presence of pro-inflammatory human glial cells (e.g. where the cellular culture further includes human neuron cells to from a cellular co-culture of human neuron cells and pro-inflammatory human glial cells).
Thus, in some embodiments, the level of pro-inflammatory activity of the pro-inflammatory human glial cells is determined by measuring an amount of soluble inflammatory factors produced by the pro-inflammatory human glial cells. The level of pro-inflammatory activity of the pro-inflammatory human glial cells may also be determined by measuring an amount of expression, an amount of activity, or the number of pro-inflammatory proteins expressed by the pro-inflammatory human glial cells. The level of pro-inflammatory activity of the pro-inflammatory human glial cells may also be determined by measuring an amount of transcription of a gene encoding a pro-inflammatory protein within the pro-inflammatory human glial cells (e.g. using quantitative PCR to determine the amount of mRNA).
In some embodiments, the cellular culture further comprises human neuron cells. Thus, the level of pro-inflammatory activity of the pro-inflammatory human glial cells may be determined by determining an amount of human neuron cells damaged by the pro-inflammatory activity of the pro-inflammatory human glial cell. Any appropriate method may be used to determine whether human neuron cells are damaged by the pro-inflammatory activity of the pro-inflammatory human glial cell. Appropriate methods include, for example, determining the number of viable (e.g. surviving, reproducing, growing, etc.) human neuron cells before and after exposure to the pro-inflammatory activity of the pro-inflammatory human glial cell. A decrease in the number of viable human neuron cells after exposure to the pro-inflammatory activity provides a quantitative measure of an amount of human neuron cells damaged by the pro-inflammatory activity. Thus, in some embodiments, the amount of human neuron cells damaged by the pro-inflammatory activity in the absence or presence of the test agent is determined by determining an amount of human neuron cells killed by the pro-inflammatory activity. And an amount of human neuron cells damaged by the pro-inflammatory activity in the absence or presence of the test agent may also be determined by determining an amount of human neuron cells surviving the pro-inflammatory activity. Other methods of determining whether human neuron cells are damaged by the pro-inflammatory activity may be used, such as detecting the presence (e.g. production, transcription, expression or secretion) or amount of cellular signals indicative of a damaged cell.
A pro-inflammatory human glial cell is a human glial that has been treated to have increased capacity for pro-inflammatory activity (e.g. greater pro-inflammatory activity than the same human glial that has not been treated). Any appropriate treatment may be employed, including treatment with a chemical or biological agent that inhibits (e.g. suppresses) the activity of an anti-inflammatory cellular component. Genetic engineering or cloning techniques may also be employed to form a human glial cell having a mutant gene encoding an anti-inflammatory cellular component that does not have anti-inflammatory activity (e.g. null mutant or knockout mutant). Likewise, a chemical or biological agent that increases the activity of an pro-inflammatory cellular components may also be employed, and genetic engineering or cloning techniques may be used to form a human glial cell having a mutant gene encoding a pro-inflammatory cellular component with increased pro-inflammatory activity. Typically, the treatment seeks to mimic a known disease state.
Thus, in some embodiments, the pro-inflammatory human glial cells include a nonfunctional anti-inflammatory gene. A “nonfunctional anti-inflammatory gene,” as used herein, refers to an anti-inflammatory gene that produces a reduced amount of a gene product or a gene product with reduced anti-inflammatory activity relative to the amount or activity found in a human glial cell that has not been treated to have an increased capacity for pro-inflammatory activity (i.e. a normal human glial cell). The nonfunctional anti-inflammatory gene may be a mutated anti-inflammatory gene (also referred to herein as a “nonfunctional mutated anti-inflammatory gene”). The nonfunctional anti-inflammatory gene may also be a silenced anti-inflammatory gene. A “silenced anti-inflammatory gene,” as used herein (also referred to herein as a nonfunctional silenced anti-inflammatory gene”), is an anti-inflammatory gene that expresses a reduced amount of anti-inflammatory gene product relative the amount of anti-inflammatory gene product expressed in a normal human glial cell. A silenced nonfunctional anti-inflammatory gene includes knockdowns, knockouts as well as incomplete shut-down of gene expression such as down regulation. In some embodiments, the silenced anti-inflammatory gene is silenced using an antisense nucleic acid. The antisense nucleic acid may be an RNA molecule, such as an interference RNA (RNAi) molecule. Thus, in some embodiments, the silenced anti-inflammatory gene is silenced using a microRNA (miRNA) molecule, small interfering RNA (siRNA) molecule or small hairpin RNA (shRNA) molecule.
In some embodiments, the nonfunctional anti-inflammatory gene is a nonfunctional gene encoding a member (e.g. a mutated member) of the nuclear receptor family of intracellular transcription factors such as the nuclear receptor (NR)4 family of orphan nuclear receptors. Nurr1 (NR4A2) belongs to the nuclear receptor (NR)4 family of orphan nuclear receptors and is known to function as a constitutively active transcription factor by binding to target genes as a monomer or homodimer or as a heterodimer with retinoid X receptors (RXRs) (Aarnisalo et al., 2002; Maira et al., 1999; Wang et al., 2003). In some embodiments, the nonfunctional anti-inflammatory gene is a nonfunctional gene encoding a member of the Nurr family of nuclear receptors (e.g. Nur77, Nor1 or Nurr1 (NR4A2). Thus, in some embodiments, the nonfunctional anti-inflammatory gene is a non-functional NURR gene (or homologue thereof). As discussed above, a non-functional NURR gene is a NURR gene that produces a reduced amount of a Nurr family nuclear receptor or a Nun family nuclear receptor with reduced anti-inflammatory activity relative to the amount or activity found in a normal human glial cell. In some embodiments, the non-functional NURR gene is a non-functional NURR1 gene (or homologue thereof). The non-functional NURR1 gene may be a silenced non-functional NURR1 gene. The silenced non-functional NURR1 gene may be silenced using an shRNA molecule.
In some embodiments, the nonfunctional anti-inflammatory gene is a nonfunctional gene encoding a human superoxide dismutase, such as human superoxide dismutase 1 (SOD1) or homologue thereof. Thus, in some embodiments, the nonfunctional anti-inflammatory gene is a nonfunctional SOD gene, such as a nonfunctional SOD1 gene. The nonfunctional SOD1 gene may be a mutated nonfunctional SOD1 gene. The mutated nonfunctional SOD1 gene may be one of the well known mutations linked to ALS, such as A4V, G37R, G85R or G93A. Thus, in some embodiments, the mutated nonfunctional SOD1 gene is SOD1A4V, SOD1G37R, SOD1G85R, or SOD1G93A. In certain embodiments, the mutated nonfunctional SOD1 gene is SOD1G37R.
In some embodiments, the pro-inflammatory human glial cells are pro-inflammatory human microglial cells or pro-inflammatory human astrocyte cells. In some related embodiments, the pro-inflammatory human microglial cells or pro-inflammatory human astrocyte cells include a nonfunctional anti-inflammatory gene. The anti-inflammatory gene may be a nonfunctional NURR gene (e.g. a nonfunctional NURR1 gene) or a nonfunctional SOD gene (e.g. a nonfunctional SOD1 gene). In certain embodiments, the pro-inflammatory human glial cells are pro-inflammatory human microglial cells and the nonfunctional anti-inflammatory gene is a nonfunctional NURR gene. In some embodiments, the pro-inflammatory human glial cells are pro-inflammatory human astrocyte cells and the nonfunctional anti-inflammatory gene is a nonfunctional SOD1 gene.
In some related embodiments (e.g. where the nonfunctional anti-inflammatory gene is a nonfunctional NURR gene), the level of pro-inflammatory activity of the pro-inflammatory human glial cells is determined by determining an amount of TNFα, induced nitric oxide enzyme (iNOS or NOS2A), or IL-1β produced by the human glial cell, or by determining an amount of expression or activity of an NF-κB-dependent inflammatory response protein. In some further related embodiments, the pro-inflammatory human glial cells are pro-inflammatory human microglial cells.
In other related embodiments, (e.g. where the nonfunctional anti-inflammatory gene is a nonfunctional SOD1 gene) the level of pro-inflammatory activity of the pro-inflammatory human glial cells is determined by determining an amount of reactive species of oxygen (ROS), a neurosecretory protein Chromogranin A (e.g. CHGA), or a secretory cofactor cystatin C (e.g. CC or CST3) produced by the pro-inflammatory human glial cell, or by determining an amount of activity or expression of an NADPH oxidase (e.g. NOX2/gp91phox or CYBB) or an induced nitric oxide synthase enzyme (e.g. iNOS or NOS2A) in the human glial cells. In some further related embodiments, the pro-inflammatory human glial cells are pro-inflammatory human astrocyte cells.
As discussed above, the cellular culture may further include human neuron cells. The human neuron cells may be derived from human embryonic stem cells. In certain embodiments, the human neuronal cells are human motor neuron cells or human dopaminergic neuron cells. Thus, in some embodiments, the level of pro-inflammatory activity of the pro-inflammatory human glial cells is determined by determining an amount of human neuron cells damaged by the pro-inflammatory activity of the pro-inflammatory human glial cell. In related embodiments, the control may be an amount of human neuron cells damaged by the pro-inflammatory activity of the pro-inflammatory human glial cell in the absence of the test agent. As discussed above, the amount of human neuron cells damaged by the pro-inflammatory activity in the absence or presence of the test agent may be determined by determining an amount of human neuron cells killed by the pro-inflammatory activity. And in certain embodiments, the amount of human neuron cells damaged by the pro-inflammatory activity in the absence or presence of the test agent is determined by determining an amount of human neuron cells surviving the pro-inflammatory activity.
In another aspect, a method is provided for determining whether a test agent is a neuroprotective agent. The method includes adding a test agent to a cellular culture comprising pro-inflammatory human astrocyte cells. A level of pro-inflammatory activity of the pro-inflammatory human astrocyte cells in the presence of the test agent is determined. The level of pro-inflammatory activity of the pro-inflammatory human astrocyte cells in the presence of the test agent is compared to a control thereby determining whether the test agent is a neuroprotective agent. The embodiments and description provided in the preceding paragraphs are equally applicable to the method set forth in this paragraph. For example, in some embodiments, the level of pro-inflammatory activity of the pro-inflammatory human astrocyte cells is determined by determining an amount of human motor neuron cells damaged by the pro-inflammatory activity of the pro-inflammatory human astrocyte cell. In certain embodiments, the control is an amount of human motor neuron cells damaged by the pro-inflammatory activity of the pro-inflammatory human astrocyte cell in the absence of the test agent. In some embodiments, the amount of human motor neuron cells damaged by the pro-inflammatory activity in the absence or presence of the test agent is determined by determining an amount of human motor neuron cells killed by the pro-inflammatory activity. The amount of human motor neuron cells damaged by the pro-inflammatory activity in the absence or presence of the test agent may also be determined by determining an amount of human motor neuron cells surviving the pro-inflammatory activity. In some embodiments, the neuroprotective agent is a an agent effective in treating Amyotrophic Lateral Sclerosis.
Any appropriate test agent may be employed in the methods provided herein. In some embodiments, the test agent is an anti-inflammatory agent. An “anti-inflammatory agent” is a chemical or biological agent known to decrease a human cellular inflammation response by decreasing the action of a cellular component that increases a cellular inflammation response or increasing the action of a cellular component that decreases a cellular inflammation response. In some embodiments, the anti-inflammatory agent decreases a human cellular inflammation response mediated by SOD, such as SOD1, or gene products thereof (also referred to herein as an SOD anti-inflammatory agent and SOD1 anti-inflammatory agent, respectively). In some embodiments, the SOD anti-inflammatory agent and SOD1 anti-inflammatory agent decreases a human cellular inflammation response mediated by NOX2. In other embodiments, the anti-inflammatory agent decreases a human cellular inflammation response mediated by NURR, such as NURR1, and gene products thereof (also referred to herein as a NURR anti-inflammatory agent and a NURR1 anti-inflammatory agent, respectively). In some embodiments, the NURR1 anti-inflammatory agent decreases a human cellular inflammation response mediated by CoREST co-repressor complexes to NF-κB target genes. In some embodiments, the test agent is a derivative of apocynin.
In certain embodiments, the test agent is an antioxidant (e.g. reduces the effect of reactive species of oxygen). In other embodiments, the test agent decreases the action or amount of TNFα, IL-1β, an NF-κB-dependent inflammatory response protein, a neurosecretory protein Chromogranin A, a secretory cofactor cystatin C, an NADPH oxidase (e.g. NOX2/gp91phox or CYBB) or an induced nitric oxide synthase enzyme (e.g. iNOS or NOS2A) relative to the absence of the test agent. The test agent may also be an Estrogen Receptor beta (ERβ) binder, such as indazol-estrogen-bromide, indazol-estrogen-chloride, or derivatives thereof.
In another aspect, a method is provided for treating a disease mediated by a human glial cell inflammatory response in a human subject in need thereof. The method includes administering to the human subject an effective amount of an anti-inflammatory agent. The anti-inflammatory agent may be an SOD anti-inflammatory agent such as an SOD1 anti-inflammatory agent. The anti-inflammatory agent may be a NURR anti-inflammatory agent such as a NURR1 anti-inflammatory agent. In certain embodiments, the anti-inflammatory agent is also an antioxidant. In other embodiments, the anti-inflammatory agent decreases the action of TNFα, IL-1β, an NF-κB-dependent inflammatory response protein, a neurosecretory protein Chromogranin A (e.g. CHGA), a secretory cofactor cystatin C (e.g. CC or CST3), an NADPH oxidase (e.g. NOX2/gp91phox or CYBB) or an induced nitric oxide synthase enzyme (e.g. iNOS or NOS2A). The anti-inflammatory agent may also be an Estrogen Receptor beta (ERβ) binder, such as indazol-estrogen-bromide, indazol-estrogen-chloride, or derivatives thereof. In some embodiments, the anti-inflammatory agent is apocynin or a derivative thereof.
The disease mediated by a human glial cell inflammatory response may be Parkinson's disease, schizophrenia, manic depression, rheumatoid arthritis, multiple sclerosis or ALS. In some embodiments, the disease mediated by a human glial cell inflammatory response is Parkinson's disease. In other embodiments, the disease mediated by a human glial cell inflammatory response is ALS. In other embodiments, the disease mediated by a human glial cell inflammatory response is Multiple Sclerosis.
Where the disease is Parkinson's disease, the anti-inflammatory agent may be a NURR anti-inflammatory agent such as a NURR1 anti-inflammatory agent. In some related embodiments, the anti-inflammatory agent decreases the activity or amount of TNFα, induced nitric oxide enzyme (iNOS or NOS2A), IL-1β, or an NF-κB-dependent inflammatory response protein.
Where the disease is ALS, the anti-inflammatory agent may be an SOD anti-inflammatory agent such as an SOD1 anti-inflammatory agent. In some related embodiments, the anti-inflammatory agent decreases the activity or amount of reactive species of oxygen (ROS), a neurosecretory protein Chromogranin A (e.g. CHGA), a secretory cofactor cystatin C (e.g. CC or CST3), an NADPH oxidase (e.g. NOX2/gp91phox or CYBB) or an induced nitric oxide synthase enzyme (e.g. iNOS or NOS2A) in the human glial cells.
The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the invention to the particular features or embodiments described. A person having ordinary skill in the art will understand that variations of the particular embodiments may be employed.
Culture conditions and differentiation of HESC. The HUES cells lines used in this study were HUES9 (Douglas Melton-WiCell) and Cythera 203 (Novocell Inc. San Diego, Calif.). The HESC were differentiated in vitro in motor neurons, adapting the protocol previously described elsewhere (Li et al., 2005). Briefly, the cells were manually dissociated to form embryoid bodies (EBs) and cultured in suspension for 5-6 days. The EBs were then plated in laminin/poli-ornithin coated plates in the presence of a neural induction medium consisting of F12/DMEM (Invitrogen, Carlsbad, Calif.), N2 supplement and 1 μM retinoic acid (RA). The cells started to organize into neural tube-like rosettes and, after 7-8 days in culture, sonic hedgehog (SHH, 500 ng/ml, R&D Systems) and cAMP (1 μM) were added to the culture media for 1 more week. The rosettes were then manually selected using a 10× magnifier (Zeiss) and gently dissociated (by pipetting up and down in a Hanks' enzyme free cell dissociation buffer-Invitrogene). After dissociation, rosettes were pelleted at 1,000 rpm and re-plated either on laminin/poli-ornithine coated coverslips (for direct differentiation) or on top of astrocyte feeder layers for the co-culture experiments. The media was changed for a differentiation medium that consisted of neurobasal medium (Invitrogen), N2 supplement, RA (1 μM), SHH (50 ng/ml) cAMP (1 μM), BDNF, GDNF and IGF (all at 10 ng/ml, Peprotech Inc.). The neurons were cultured in the differentiation media for 3-5 more weeks with or without the astrocyte feeder.
Co-culture of motor neurons and myocyte. C2C12 myoblasts were purchased from ATCC (American Type Culture Collection) and cultured according to the specifications of the manufacturer. After reaching a specific confluence, the myoblasts formed myotubes. The manually dissected rosettes (motor neuron progenitors) were plated on top of the myotubes and the medium was replaced with the differentiation medium (described previously). After 4-6 weeks in co-culture, the cells were fixed and the formation of neuromuscular junctions was observed by incorporation of α-Bungarotoxin conjugated with Alexa 568 (1:200, Molecular Probes, Invitrogen, Carlsbad, Calif.). A population of human neurons in vitro that expressed post-mitotic motor neuron markers, made neuro-muscular junctions, and fired action potentials was consistently generated. Subsequently, the human embryonic stem cell (HESC)-derived motor neurons were co-cultured with human primary astrocytes expressing either the wild type or the mutated form of SOD1 protein (SOD1WT or SOD1G37R, respectively).
Purification and culture of rat primary motor neurons. Primary rat motor neurons were purified following previously published procedures (Arce et al., 1999; Henderson et al., 1993), with some modifications. Briefly, spinal cords were dissected from E14 rat embryos, treated with trypsin (2.5% w/v; final concentration 0.05%) for 10 min at 37° C., and then dissociated. The largest cells were isolated by centrifugation for 15 min at 830 g over a 5.2% Optiprep cushion (Sigma, St Louis, Mo., USA), followed by centrifugation for 10 min at 470 g through a 4% BSA cushion. Purified motor neurons were plated inside 35-mm Petri dishes on 12-mm coverslips previously coated with polyornithine/laminin, and grown 7-10 days in L15 medium with sodium bicarbonate (625 μg/ml), glucose (20 mm), progesterone (2×10−8 m), sodium selenite, putricine (10−4 m), insulin (5 μml−1) and penicillin-streptomycin. BDNF (1 ng ml−1), and 2% horse serum were also added to the medium.
Primary astrocyte culture. Human primary astrocytes (HA1800) were obtained from ScienCell Research Laboratories™ (Carlsbad, Calif.) and were cultured according to the providers' guidelines. Briefly, the astrocytes were isolated from fetal human brain (cerebral cortex) and cultured for no more than 15 passages in astrocyte media (AM 1801). The infections were performed in 80% confluent T75 flasks followed by incubation with the lentivirus expressing either the wild type of SOD1 (LV-SOD1wT) or the mutated form of SOD1 (LV-SOD1G37R).
For the co-culture experiments, the astrocytes were plated on laminin/poly-ornithine (Invitrogen and Sigma-Aldrich, St. Louis, Mo.; respectively) coated cover slips 1 day prior to the co-culture. The rosettes were then cultured on top of the astrocytes feeder layer (see Culture Conditions and Differentiation for HESC). Co-cultures were held for 3 weeks.
Immunofluorescence. Astrocyte monolayers or astrocyte and motor neuron co-cultures were fixed for 15 minutes with 4% paraformaldehyde in PBS, and immunofluorescence was performed as described previously (Muotri et al., 2005). Briefly, slides were washed with PBS and permeabilized with 0.1% Triton X-100 for 30 minutes and incubated for 2 hours at room temperature in blocking solution (0.1% Triton X-100, 5% donkey serum in PBS). The samples were incubated overnight at 4° C. with primary antibodies diluted in blocking solution, washed in PBS and further incubated for 1 hour at room temperature with secondary antibodies (rabbit, mouse or goat Alexa fluor conjugated antibodies, Molecular Probes-Invitrogen, Carlsbad, Calif.) diluted in blocking solution. The slides were then washed with PBS and mounted. The primary antibodies used were anti-Pax6, anti-Islet 1 and anti-Hb9 (all used at 1:100 and acquired from Developmental Studies Hybridoma Bank, DSHB Iowa City, Iowa), anti-human Nestin (1:200), anti-Olig2 (1:200), anti-ChAt (1:100) and anti-A2B5 (1:500) (all from Chemicon, Temecula, Calif.), anti-TuJ1 and anti-HoxC8 (both 1:200 from Covance Research Products, CA), anti-GFP (Molecular Probes-Invitrogen, CA), anti-GFAP (1:500 from DAKO Carpinteria, Calif.), anti GAD65 (1:200 from Sigma-Aldrich, Mo.)
Lentiviral vectors. The viral vectors used in this research were Lenti-SOD1WT, Lenti-SOD1G37R, Lenti-Hb9::GFP, and Lenti-Hb9::RFP (for electrophysiological recordings). Concentrated lentiviral stocks were produced as described (Consiglio et al., 2004). Assessment of virus tittering of Lenti-SOD1WT and Lenti-SOD1G37R was performed in rat neural stem cells (NSC) using an antibody that specifically recognizes human SOD1 protein (1:500, Sigma-Aldrich, St Louis, Mo.; see
Electrophysiology. Whole-cell perforated patch recordings were performed from cultured Hb9::RFP-expressing cells that had differentiated for at least 8 weeks. The recording micropipettes (tip resistance 4-8 MΩ) were tip-filled with internal solution (115 mM K-gluconate, 4 mM NaCl, 1.5 mM MgCl2, 20 mM HEPES and 0.5 mM EGTA, pH 7.3) and then back-filled with internal solution containing amphotericin B (200 μg/ml). Recordings were made using an Axopatch 200B amplifier (Axon Instruments). Signals were filtered at 2 kHz and sampled at 10 kHz. The whole-cell capacitance was fully compensated, whereas the series resistance was uncompensated but monitored during the experiment by the amplitude of the capacitive current in response to a 5-mV pulse. The bath was constantly perfused with fresh HEPES-buffered saline (115 mM NaCl, 2 mM KCl, 10 mM HEPES, 3 mM CaCl2, 10 mM glucose and 1.5 mM MgCl2, pH 7.4). For current-clamp recordings, cells were clamped at −60˜−80 mV. For voltage-clamp recordings, cells were clamped at −70 mV. All recordings were performed at room temperature. Amphotericin B was purchased from Calbiochem. All other chemicals were from Sigma.
RNA isolation and RT-PCR. Total cellular RNA was extracted from ˜5×106 cells using the RNeasy Protect Mini kit (Qiagen, Valencia, Calif.), according to the manufacturer's instructions, and reverse transcribed using the SuperScript III First-Strand Synthesis System RT-PCR from Invitrogen. The cDNA was amplified by PCR using Taq polymerase (Promega, San Luis Obispo, Calif.), and the primer sequences were: hNanog-Fw: 5′ cctatgcctgtgatttgtgg 3′ (SEQ ID NO:1), hNanog-Rv: 5′ ctgggaccttgtcttccttt 3′ (SEQ ID NO:2), hHB9-Fw: 5′ cctaagatgcccgacttcaa 3′ (SEQ ID NO:3), hHB9-Rv: 5′ ttctgtttctccgcttcctg 3′ (SEQ ID NO:4), hChAT-Fw: 5′ actccattcccactgactgtgc 3′ (SEQ ID NO:5), hChAT-Rv: 5′ tccaggcatacaaggcagatg 3′ (SEQ ID NO:6), hGAPDH-Fw: 5′ accacagtccatgccatcac 3′ (SEQ ID NO:7), hGAPDH-Rv: 5′ tccaccaccctgttgctgta 3′ (SEQ ID NO:8). PCR products were separated by electrophoresis on a 2% agarose gel, stained with ethidium bromide and visualized by UV illumination. Product specificity was determined by sequencing the amplified fragments excised from the gel.
Cell Death detection. Cell death was quantified by flow cytometry using 5 μg/mL of propidium iodide (PI) in astrocytes cultures that had been previously infected with LentiSOD1WT or LentiSOD1G37R.
Detection of ROS production. Detection of total cellular ROS was performed using the Image-iT LIVE Green reactive Oxygen Species Detection Kit, according to the manufacturer's directions (Molecular Probes, Invitrogen). Briefly, this assay is based on the principle that the live cell permeable compound, carboxy-H2DCFDA, emits a bright green fluorescence when it is oxidized in the presence of ROS. The quantification of the ROS production was addressed in 2 ways: 1) counting the number of fluorescent cells and 2) measuring the intensity of the fluorescence emitted by the cells. The relative fluorescence intensity (arbitrary units ranging from 0 to 255, or black to white) was measured in randomly selected fields for each treatment and was analyzed and quantified using ImageProPlus software.
Anti-oxidants treatment. Anti-oxidants stock solutions were diluted in astrocyte media and directly applied to astrocyte monolayers. The cultures were treated for 48 hours prior to reactive species of oxygen (ROS) detection. The compounds used in the experiment were epicatechin (E4018 Sigma Aldrich, 10 μM), luteolin (L9283 Sigma-Aldrich, 5 μM), resveratrol (R5010Sigma-Aldrich, 5 μM), apocynin (178385 Calbiochem, 300 μM), alpha lipoic acid (T5625, Sigma-Aldrich, 50 μg/mL). For neuronal co-cultures, the astrocytes were pre-treated for 48 hours with apocynin and the rosettes were plated on top of them. The co-cultures were carried for 3 more weeks and the medium containing apocynin was replaced three more times during the co-culture period.
Western blotting. Western blotting was carried out using standard protocols. Briefly, total proteins were extracted from astrocyte cultures using 1×RIPA buffer (Upstate, Temecula, Calif.). Protein samples (20 μg) were then separated in 12.5% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were then probed with the following antibodies: mouse anti-actin (1:10,000 Ambion Austin, Tex.), rabbit anti-iNOS (1:1,000), mouse anti-chromogranin A (1:1,000), rabbit anti-cystatin C (1:1,000) and rabbit anti-NOX2 (1:200) all from Abcam (Cambrige, Mass.). Immunoreactive proteins were detected using enhanced chemiluminescence (ECL; Amersham-GE Healthcare, Piscataway, N.J.) and were exposed to X-ray film. All secondary antibodies were purchased from GE Healthcare.
Quantification of nitrite concentration. The concentration of nitrite in the culture medium was determined by the colorimetric Griess reaction (Grisham et al., 1996), 7 days after changing the media of the astrocytes, using the Griess detection kit for nitrite determination (Molecular Probes-Invitrogen). The assays were performed in triplicates and the experiment was repeated 3 times.
Data Analysis. Statistical analysis was performed using student's t-test and is reported as mean±S.D. Significant t-test values were p<0.05 (*) and p<0.01 (**).
HESC-derived rosettes expressed motor neuron progenitor markers such as Pax6, Nestin, Olig2 and Islet1 after 2-3 weeks of differentiation (
A population of human neurons were consistently generated in vitro that expressed post-mitotic motor neuron markers, made neuro-muscular junctions, and fired action potentials. Subsequently, the human embryonic stem cell (HESC)-derived motor neurons were co-cultured with human primary astrocytes expressing either the wild type or the mutated form of SOD1 protein (SOD1WT or SOD1G37R, respectively).
In the co-cultures, a specific decrease in the number of motor neuron markers were detected in the presence of SOD1-mutated astrocytes, with no detectable effect on other subtypes of neurons. Furthermore, the toxicity conferred by the SOD1-mutated astrocytes was shown to be generated in part by an increase in astrocyte activation and production of ROS. The physiological changes observed in SOD1G37R human astrocytes were well correlated with intensification of the pro-inflammatory activity of the induced nitric oxide enzyme (iNOS or NOS2A), neurosecretory protein chromogranin A (CHGA), secretory cofactor cystatin C(CC or CST3) and NADPH oxidase (NOX2/gp91phox or CYBB) overexpression. Activation of NOX2 and production of oxygen radicals had already been demonstrated to be mediators of microglial toxicity in familial ALS mouse models (Barbeito et al., 2004; Wu et al., 2006).
The effects of astrocytes expressing either a wild type (SOD1WT) or mutated (SOD1G37R) form of the human SOD1 protein were examined on the survival of HESC-derived motor neurons upon co-culture. Primary human astrocytes were transduced with a lentivirus vector expressing either SOD1WT or SOD1G37R (Figure S1A,B). The Hb9::GFP motor neurons were co-cultured with SODWT− or SOD1G37R-expressing astrocytes (
This model consists of co-culturing healthy human motor neurons with human astrocytes carrying either the wild type or mutated SOD1 cDNA. These experiments confirm the role of astrocytes in ALS disease, as motor neuron numbers decreased about 50% in the presence of mutant SOD1-expressing astrocytes. Moreover, the toxicity seemed to be restricted to the motor neuron subpopulation, with no effects on other neuronal subtypes.
The possible causes of the astrocytic toxicity conferred by the mutated SOD1 to HESC-derived motor neurons was investigated by analyzing the behavior of the mutated astrocytes in culture. Primary astrocytes usually respond to inflammation by activation. Activated astrocytes increase the assembly of their intermediate filaments (produced by glial fibrillary acidic protein; GFAP) and the number and size of the processes extended from the cell body. An=increase of more than 2.5 times the number of activated (GFAP-positive) astrocytes was detected when SOD1G37R was present in comparison to control astrocytes (
In addition, an increase in the expression of pro-inflammatory factors such as iNOS was observed, an overexpression of the neurosecretory protein known to interact specifically with mutated SOD1, chromogranin A (Urushitani et al., 2006), induction of a superoxide producer enzyme NOX2 (gp91phox subunit) and an increase of cysteine protease inhibitor Cystatin C expression (
The mechanism of astrocyte-specific motor neuron toxicity involves both secretory and inflammatory pathways. Cystatin C (CC), a secretory cofactor involved with inhibition of cysteine proteinases and neurogenesis, has been identified in cerebral spinal fluid (CSF) proteomic profiles as a potential biomarker for ALS (Pasinetti et al., 2006; Taupin et al., 2000). CC is one of the two proteins that immunostain the so-called Bunina bodies, small intraneuronal inclusions that are the only specific pathological ALS hallmark (Okamoto et al., 1993).
These findings suggest that the secretion of mutant SOD1 represents one of the neurotoxic pathways for the non-cell-autonomous nature of ALS.
A total of five compounds and their respective vehicles (ethanol (EtOH) or DMSO) were tested in SODG37R mutated astrocyte cultures to address their anti-oxidant potential (
The compound apocynin was chosen for further verification in a co-culture assay using HESC-derived motor neurons and either SDO1WT or SODG37R astrocytes. Apocynin treatment rescued the motor neuron survival in the presence of SOD1G37R (
This data shows that anti-oxidant apocynin decreased the ROS production in SOD1-mutant expressing astrocytes, likely by inhibition of NADPH oxidase (NOX2), and in turn restored motor neuron survival. Thus, SOD1-mutant astrocytes may be used as a rapid drug screening test for oxidative damage to identify the best candidates for a following long-term co-culture experiment (
Mice and isolation of primary cells. C57BL/6 mice were purchased from Charles River and housed according to UCSD protocol. Mouse primary microglia cells and astrocytes from P0 pups were isolated from the standard mixed cortical culture method. After 10-14 days of the culture, microglia cells were isolated from astrocytes by the magnetic sorting using anti-mouse CD11b beads (Miltenyi). Purity of each population was over 98%, as determined by FACS. For the stereotaxic injections, C57BL/6 mice were purchased from Harlan and housed at The Salk Institute following the institutional protocol.
Cell Culture. Primary mouse microglia, mouse astrocyte, Neuro2A (mouse neuroblastoma), 293T, NIH3T3 and Hela cells were cultured in DMEM (Cellgro) supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin (Invitrogen). Murine microglial cell line BV2 cells (kindly provided by Katerina Akassoglou) and macrophage RAW264.7 were maintained with DMEM supplemented with 10% FBS (low endotoxin, Hyclone) and penicillin/streptomycin. SK—N—SH (human neuroblastoma) cells were maintained in aMEM supplemented with 10% FBS and antibiotics. PC12 (rat pheochromocytoma) cells were cultured with 10% horse serum (Hyclone), 5% FBS and antibiotics. SK—N—SH and PC12 cells were differentiated following ATCC protocol. Mouse neuronal stem cells (NSCs) from ventral mesencephalon were cultured and differentiated following the manufacturer's protocol (StemCell Technologies). Primary human microglia cells were purchased from Clonexpress and primary human astrocytes were obtained from ScienCell and maintained following the manufacturer's protocol.
Luciferase assay. The RAW264.7 mouse macrophage cell line was transiently transfected with iNOS- or TNFα-promoters directing luciferase expression, as previously described (Ghisletti et al., 2007; Pascual et al., 2005). For siRNA experiments, RAW264.7 cells were co-transfected with siRNAs (40 nM) using Transmessenger reagent (Qiagen) for 48 h before activation with LPS. In all transfections, cells were stimulated with 0.1 μg/ml LPS (Sigma) and assayed for luciferase activity 6 h later for TNFα and 8 h later for iNOS. Transfection experiments evaluated each experimental condition in triplicate and results are shown as fold induction compare to unstimulated samples and LPS-stimulated samples and standard deviation. In all promoter assays, fold induction represents LPS-stimulated promoter activity divided by promoter activity in unstimulated cells. Error bars represent standard deviations (SD).
Chromatin immunoprecipitation (ChIP) assays. ChIP assays were performed as previously described (Ghisletti et al., 2007; Pascual et al., 2005).
RNA isolation and quantitative PCR. Total RNA was isolated by RNAeasy kit (Qiagen) from cells or SN samples microdissected from the brain. One microgram of total RNA was used for cDNA synthesis using Superscript III (Invitrogen), and quantitative PCR was performed with SYBR-GreenER (Invitrogen) detected by 7300 Real Time PCR System (ABI). The sequences of qPCR primers used for mRNA quantification in this study were obtained from PrimerBank (Wang and Seed, 2003).
Statistical analyses. Standard deviation, Chi-square and two-tail Student's t-test were performed with the Prism 4 program. p<0.01 was considered significant. For IHC and IF analyses, Bonferroni was used for post hoc analysis when a significant difference was found with ANOVA. Unpaired two-tailed t test was used for other comparisons, including comparisons between control and injected sides within one group. All data are presented as mean±SD.
Stereotaxic injection of lentivirus and LPS in the mouse SN in vivo. Preparation of lentivirus is described in the section of plasmids and reagents. Groups were defined by lentiviral type (shCtrl, shNurr1-1 and shNurr1-2). Mice were anesthetized using a mixture of ketamine/xylazine (100 mg/kg, 10 mg/kg) and immobilized in a stereotaxic apparatus. The stereotaxic injection site into the right SN was AP −3.3 mm, ML −1.2 mm, DV −4.6 mm from bregma (Franklin and Paxinos, 2008). A stainless steel cannula (5 μl Hamilton syringe) was inserted and one deposit of 1.5 μl of lentivirus was slowly injected over a 2-minute period. Five minutes passed before the needle was removed to minimize retrograde flow along the needle track. Two days after the lentivirus injection, a single 1-1 μl injection of 5 μg of LPS (Sigma) or 1 μl of PBS was delivered over a 2-minute period into the same coordinates. An additional group received LPS/PBS control injections without preceding lentiviral injections. For A30P a-Synuclein injection, the same technique was applied to the paradigm described in
Microdissection of SN. Mice (n=4 per group) were euthanized 6 h after the LPS injection. The brains were removed, the injected SN was dissected under a dissection microscope and the tissue was processed for qPCR.
Immunohistochemistry (IHC) and immunofluorescence (IF). Experimental animals were anesthetized and perfused transcardially with 0.9% saline followed by 4% paraformaldehyde. The brain samples were postfixed with 4% paraformaldehyde overnight and equilibrated in 30% sucrose. Coronal sections of 40 μm an were prepared with a sliding microtome and stored in cryoprotectant (ethylene glycol, glycerol, 0.1 M phosphate buffer pH 7.4, 1:1:2 by volume) at −20° C. IHC and colabeling IF for free-floating sections were performed with the following primary antibodies: rabbit anti-Ibal (1:500, Wako Chemicals), mouse anti-tyrosine hydroxylase (1:250, Chemicon), guinea pig anti GFAP (1:1000, Advanced Immuno) and rabbit anti Caspase 3 (1:500, Cell Signaling). For IHC, sections were stained with donkey anti-mouse biotinylated, antibody (1:500, Jackson Immuno Research), followed by the avidin-biotin-peroxidase complex 1:100 (Vectastain Elite). The peroxidase activity of immune complexes was revealed with a solution of TBS containing 0.25 mg/ml 3,3′-diaminobenzidine (Vector Laboratories, Burlingame, USA), 0.01% H2O2, and 0.04% NiCl2. For IF, tRHOX-tagged donkey anti-mouse and FITC-tagged donkey anti-rabbit antibodies were used. 4,6-Diamidino-2-phenylindole (DAPI, 1:1000, Roche) was used to reveal nuclei.
Stereology and confocal microscopy. To determine cell numbers of TH-immunoreactive neurons in the SN, an unbiased stereological method according to the optical fractionator principle was used (Gundersen et al., 1988). Every fourth section (120 μm interval) was selected from each animal and processed for immunostainings for TH. The reference volume was determined by tracing the areas using a semi-automatic stereology system (Stereoinvestigator, MicroBrightField). No counting frames were used here, but these regions were exhaustively counted on each section. In the lentivirus-treated groups, a number of TH-positive cells had pathological morphology, indicating a degenerative process on the side of the injection, as shown in
For analyzing the interplay between Iba-1 and TH+ cells, a confocal laser microscope (Nikon) equipped with a 40×PL APO oil objective was used. All animals were coded in this study, and a blinded analysis was used for quantitative comparisons.
Conditioned media (CM) assays. Primary mouse microglia and astrocytes were infected with lentivirus directing expression of non-targeting control or Nurr1-specific shRNAs. BV2 cells were infected with shCtrl- or shNurr1-lentivirus or transfected with siRNAs against Nurr1 or components of the CoREST complex. Cells were then treated with 0.1 μg/ml LPS for 24 h. For primary mouse microglia and astrocytes, cells were infected with lentivirus carrying shRNA against Nurr1 or control. Cells were stimulated with 0.1 μg/ml LPS for 2 h and washed with PBS extensively to avoid carry over of LPS to the next step. CMs were filtered through 0.45 μm filters and frozen at −80° C. Target cells were cultured with CMs for 24 h and TUNEL assays were performed with Cell Death Detection ELISAplus kit (Roche) following the manufacturer's protocol. For in vitro differentiated cells from mouse NSC, In Situ Cell death detection kit (Roche) was used for TUNEL assay. NSC-derived cells were stained with anti-Tyrosine hydroxylase (TH-16, Sigma), anti-GABA (GB-69, Sigma) and anti-GFAP (131-17719, Molecular Probes) and visualized by goat-anti mouse IgG-Alexa-488 (Molecular Probes). Nuclei were visualized by DAPI (Invitrogen) staining.
Plasmids and lentivirus production. Flag-tagged full-length (FL) mouse Nurr1 was cloned into p3XFLAG-CMV-7.1 vector (Sigma). Mutant constructs of Nurr1 were generated with the Quick-change site-direct mutagenesis kit (Stratagene). HA-tagged mouse CoREST-FL was cloned into pcDNA3 expression vector (Invitrogen). DBD from Nurr1 was cloned into pCMV-Myc vector (Invitrogen). Various mutants with non targeting Nurr1 used for the reconstitution of shNurr1-BV2 cells were cloned into pHAGE lentivirus vector kindly provided from Jeng-Shin Lee and Richard Mulligan. All smart-pool siRNAs were purchased from Dharmacon. Retrovirus pSM2c carrying two independent shRNAs directed against mouse Nurr1 (shNurr1-1 and shNurr1-2) were purchased from Openbiosystems. Retrovirus production and infection into BV2 cells were performed according to the manufacturer's protocol. Fragments containing U6 promoter, miR30 and shRNA were isolated from pSM2c and subcloned into the lentivirus vector p156RRLsinPPTCMV-GFP-PREU3Nhe (kindly provided by Inder Verma). Lentivirus encoding A30P mutant of α-Synuclein was kindly provided by Roberto Jappelli and Roland Riek. Lentivirus packaging was done using Virapower (Invitrogen) and 293T cells as a packaging cell line according to the manufacturer's protocol. pGIPZ-lentivirus carrying shRNAs were purchased from Openbiosystems and virus production was performed following the manufacturer's protocol. Validation of siRNA or shRNA used in this study was performed by either qPCR or Western blotting shown in
ChIP assay. For each experimental condition, 2×107 BV2 cells or 6×106 mouse primary astrocytes were used. Cells were stimulated with 1 μg/ml LPS for BV2 cells and 10 ng/ml IL1β for astrocytes for the indicated time before crosslinking for 10 minutes with 1% formaldehyde. For in vivo ChIP, single cell suspensions were made from microdissected SN samples using cell strainers (BD Falcon) in prior to the crosslinking Anti-Nurr1 (E-20, Santa Cruz Biotechnology) anti-p65 (C-20, Santa Cruz Biotechnology), anti-CoREST (Millipore) or control rabbit IgG (Santa Cruz Biotechnology) were used for IP. A 150-bp region of the iNOS promoter was amplified spanning the most proximal NF-κB site to the start of transcription as described before (Ghisletti et al., 2007; Pascual et al., 2005). A 150-bp region of the mouse proximal TNFα promoter was amplified spanning the NF-κB site. Quantitative PCR (qPCR) was performed with SYBR-GREEN PCR master Mix (ABI) or SYBR-GreenER (Invitrogen) and analyzed on a 7200 real time PCR system (ABI).
SUMOylation assays. In vivo SUMOylation experiments were performed as described before (Ghisletti et al., 2007; Pascual et al., 2005). Briefly, whole cell extract was prepared in the presence of N-Ethylmaleimide (Calbiochem) from HeLa and NIH3T3 cells transfected with Flag-tagged wild type Nurr1 or lysine mutants and SUMO-1, SUMO-2 or SUMO-3, Ubc9 and PIAS4 expression vectors or the indicated siRNAs. Extracts were resolved by SDS-PAGE and immunoblotted using anti-Flag antibody (Sigma).
Co-immunoprecipitations and Western blotting. Hela cells or NIH3T3 cells were transfected using Lipofectamine 2000 reagent (Invitrogen) following manufacturer's protocol. Transfected cells were stimulated by 10 ng/ml recombinant human or mouse mIL1β (R & D system) for the indicated times prior to harvesting. BV2 cells were treated with 1 μg/ml LPS and mouse primary astrocytes were stimulated with 10 ng/ml IL1β for the indicated times. Cells were lysed with hypotonic buffer (10 mM HEPES pH7.4, 320 mM Sucrose, 5 mM MgCl2, 1% Triton X-100) supplemented with proteinase inhibitor cocktail (Sigma), 2 mM Na3VO4 (Sigma) and 50 nM Calyculin A (Calbiochem) using a Dounce homogenizer. After centrifugation, nuclei were washed twice with hypotonic buffer without Triton X-100. Then cells were resuspended in hypertonic buffer (50 mM Tris pH8.0, 500 mM NaCl, 1 mM EDTA, 10% Glycerol) with proteinase and phosphatase inhibitors as described before and sonicated briefly. For endogenous co-IP experiments, anti-Nurr1 (E-20, Santa Cruz), anti-CoREST (E-15, Santa Cruz and Millipore) and anti-p65 (C-20, Santa Cruz) were used for IP and Western blotting. For immunoprecipitation of tagged protein, M2 anti-Flag-agarose (Sigma) and HA-agarose (Covance) beads were used for Flag and HA tagged proteins, respectively. For the loading control of whole cell lysate samples, anti-actin antibody (Oncogene) was used.
GST-pull down. Wild-type full-length mouse Nurr1 or CoREST were cloned in pGEX-6P vector (GE healthcare). pGEX-6P vectors were transformed into BL21 or ArcticExpress E. Coli (Stratagene) and GST-fusion proteins were purified by Glutathione Sepharose 4 Fast Flow (GE healthcare) following the manufacturer's protocol. 35S-labeled CoREST and Nurr1 were generated using TNT-T7 in vitro transcription/translation kit (Promega). GST-pull down assays were performed as described before (Ogawa et al., 2005). In the case of GST-Nurr1 and TNT-p65, the GSK3β kinase reaction was performed prior to the binding reaction using purified GSK3β following the manufacturer's protocol (Millipore).
Nurr1 protects TH+ neurons from LPS-induced inflammation in vivo. Analysis of Nurr1 protein and mRNA levels in primary human and mouse microglia, primary human astrocytes, and the BV2 microglia cell line demonstrated significant protein expression under basal conditions and induction of Nurr1 mRNA in microglia in response to LPS (
Loss of TH+ neurons following LPS injection normally takes 2-3 weeks (Meredith et al., 2008). However, stereological analysis revealed a significant decrease in TH+ neurons in the SN of shNurr1 lentivirus-injected mice compared to shCtrl-injected animals after only 7 days of LPS treatment (
Based on recent findings that transgenic expression of wild-type or mutant forms of α-Synuclein potentiates LPS-mediated loss of TH+ neurons (Gao et al., 2008), we examined whether Nurr1 exerted neuro-protective effects in the situation of overexpression of an α-Synuclein mutant (A30P) associated with familial PD. We again employed stereotaxic injection of shNurr1- or shCtrl-lentivirus in combination with lentivirus encoding mutant α-Synuclein (A30P). A30P expression alone caused weak inflammation in the SN, whereas reduction of Nurr1 expression in the context of A30P expression resulted in a dramatic increase in expression of numerous inflammatory response genes, including TNF and IL1β, and significant loss of TH+ neurons (
Glia-mediated inflammation contributes to the death of TH+ neurons. To define the cell types responsible for LPS-mediated inflammation in the SN, we evaluated the responses of human and mouse microglia, astrocytes and neurons to LPS. These experiments demonstrated that microglia are orders of magnitude more responsive than astrocytes or neurons, exemplified by the pattern of TNFα induction in primary mouse microglia and astrocytes and the neuronal Neuro 2A (mouse neuroblastoma) cell line (
Based on these results, we evaluated the consequences of reducing Nurr1 expression in microglia on LPS responses. Knockdown of Nurr1 expression in BV2 microglia using specific lentivirus-encoded shRNAs led to significant increases in LPS-dependent expression of inflammatory mediators, including TNFα iNOS and IL-1β (
Experiments using neuron and glia co-culture in vitro suggest that activation of innate immunity in the CNS can trigger neuronal death (Lehnardt et al., 2003). Since NSC-derived neurons always co-exist with astrocytes, it is possible that astrocytes contributed to the neurotoxic effect of the microglia CM. To explore this possibility, we performed sequential CM experiments employing isolated primary microglia and astrocytes and using Neuro2A cells as a read-out for neurotoxicity. Primary murine astrocytes and microglia were infected with shCtrl- and shNurr1-lentivirus as used for the injection into the SN. Cells were then stimulated with LPS and CM was harvested as described in
Nurr1-mediated transrepression requires GSK3n-dependent recruitment of Nurr1 monomers to p65. Chromatin immunoprecipitation experiments indicated that Nurr1 was recruited to LPS-responsive promoters following LPS treatment, exemplified by the TNFα promoter (
Since transrepression requires the tethering of NRs to other transcription factors, we tested whether Nurr1 could bind to transcription factors involved in inflammation, such as NF-κB. Co-immunoprecipitation (Co-IP) assays of Nurr1 in BV2 cells showed interaction with NF-κB-p65 that was significantly enhanced by LPS treatment and independent of changes in Nurr1 protein levels (
The CoREST-repressor complex is required for Nurr1-mediated transcriptional repression. Transcriptional repression requires the recruitment of enzymatically active multiprotein complexes assembled on central scaffolding proteins referred to as co-repressors. Therefore, we sought to identify the co-repressors required for Nurr1-mediated transrepression. We used siRNAs against various candidate corepressors in the iNOS-luciferase reporter assay and identified CoREST as being essential for Nurr1-mediated repression (
Since Nurr1 can be phosphorylated by serine/threonine kinases (Nordzell et al., 2004), we speculated that signal-dependent phosphorylation might contribute to the Nurr1-CoREST interaction. Nemo-like kinase (NLK) received our attention because NLK is known to be involved in the repression of various transcription factors (Yasuda et al., 2004). NLK cooperates with TGFβ-activating kinase 1 (TAK1) and homeodomain-interacting kinase 2 (HIPK2) in Wnt signaling (Kanei-Ishii et al., 2004). Therefore, we first evaluated the consequences of knockdown of TAK1, HIPK2 and NLK in RAW264.7 cells with respect to Nurr1-mediated transrepression. Knockdown of NLK abolished the repression of iNOS-promoter activity, whereas HIPK2 knockdown was much less effective and TAK1 had no effect (
To confirm whether CoREST was indeed localized to NF-κB target gene promoters in association with p65 and Nurr1, we performed ChIP assays of the iNOS- and TNFα-promoters in BV2 cells. The occupancy of NF-κB-p65, Nurr1 and CoREST on both the TNFα- and iNOS-promoters by all three proteins was strongly increased upon LPS stimulation (
Nurr1 represses the production of neurotoxic factors in astrocytes. The observation that astrocytes could amplify the neurotoxic effects initiated by microglia (
The Nurr1/CoREST transrepression pathway functions in astrocytes. Finally, we asked whether the mechanism of transcriptional repression by Nurr1 in astrocytes is similar to that in microglia. As shown in
Nurr1 exerts neuroprotective effects by suppressing inflammatory responses in glia. Here, we demonstrate that Nurr1 plays a previously unexpected role in protecting TH+ neurons from inflammation-induced neurotoxicity. Several lines of evidence suggest that this role is due to its function as an inhibitor of inflammatory gene expression in microglia and astrocytes (
Experiments employing sequential transfer of cell culture media from microglia to astrocytes or vice versa indicate that astrocytes can act as amplifiers of microglia-derived mediators in the production of neurotoxic factors. Collectively, our data are consistent with a model in which LPS-induced expression of factors such as IL1β and TNFα by microglia results in paracrine activation of astrocytes. This activation in turn leads to production of toxic mediators by astrocytes that would be predicted to include NO and ROS. These factors are suggested to act additively or synergistically with neurotoxic factors produced by microglia (
The present findings suggest that Nurr1 protects the CNS from amplification of inflammatory signaling by microglia-astrocyte communication.
A Nurr1/CoREST transrepression pathway mediates feedback regulation of inflammatory responses. The present studies demonstrate a potent anti-inflammatory activity of Nurr1 in microglia and astrocytes. We propose that this anti-inflammatory activity is mediated by a Nurr1/CoREST transrepression pathway that operates in a feedback manner to restore transcription of NF-κB target genes to a basal state (
Cell culture. Primary human microglia cells were purchased from Clonexpress and primary human astrocytes were obtained from ScienCell and maintained following the manufacturer's protocol.
Lentivirus production and the stimulation of the cells. All GIPZ lentivirus shRNAmir were purchased from Open Biosystems, and the lentivirus packaging was performed using Trans-Lentiviral packaging mix and Arrest-In transfection reagent following the manufacturer's protocol (Open Biosystems). Cells were co-cultured with virus containing supernatants for 24 hours and virus containing media were replaced with fresh culture media kept for another 24 hours. LPS E. coli 0111:B4 (Sigma) used at 0.1 μg/ml final, and human IL1β used at 10 ng/ml final was obtained from R&D system.
RNA isolation and quantitative PCR. Total RNA was isolated by RNAeasy kit (Qiagen) from cells or SN samples microdissected from the brain. One microgram of total RNA was used for cDNA synthesis using Superscript III (Invitrogen), and quantitative PCR was performed with SYBR-GreenER (Invitrogen) detected by 7300 Real Time PCR System (ABI). The sequences of qPCR primers used for mRNA quantification in this study were obtained from PrimerBank.
Using the above methods, human primary microglia cells were infected with lentivirus encoding shRNA against Nurr1 (shNurr1) or scramble control (shCtrl). Two days after the infection, cells were stimulated with 0.1 μg/ml LPS for 6 hours (black column) or untreated (white column) and normalized mRNA expression against HPRT of TNFα (
Multiple Sclerosis is a heterogeneous autoimmune disease that is characterized by inflammation, demyelination and axon degeneration in the central nervous system (CNS). The manifestations of Multiple Sclerosis (MS) can include defects in sensation, motor, autonomic, visual and cognitive functions and currently effective treatment is under the development.
Estrogen, a commonly used medication for MS patients and, now, phase 2 study for Alzheimer's disease, binds to two related estrogen receptors, Estrogen receptor (ER)α and ERβ. Both are members of the nuclear receptor (NR) super-family of transcription factors. ERα mediates many of the classical reproductive functions of estrogens, while the functions of ERβ remain poorly understood. In the CNS, ERβ is expressed more widely than ERα, but the lack of ERβ-specific ligands has made it difficult to study possible unique roles of ERβ. We have obtained newly-developed ERβ-specific ligands and tested their effects on microglia/Th-17-mediated immune responses as well as astrocyte-mediated inflammatory responses in vitro.
Primary human microglia and astrocytes were treated with 1 μM Indazol-Estrogen-Bromide (Br), 1 μM Indazol-Estrogen-Chloride (C1), 1 μM17β-Estradiol (E2) or vehicle (ethanol:EtOH) for 1 hour as a final concentration. Then microglia cells were stimulated with 0.1 μg/ml LPS and astrocytes were stimulated with 10 ng/ml IL1b for 6 hours. mRNA were purified and cDNA were generated by reverse transcriptase reaction. To determine the effect of ERβ-specific ligands in microglia and astrocytes-mediated inflammation, the activation of several genes induced by LPS in microglia or by IL1b in astrocytes were determined by QPCR normalized against HPRT.
IL1β and TGFβ provided by antigen presenting cells are required for the differentiation of pro-inflammatory Th17 T cells and IL23 is essential for the activation and the maintenance of Th17 T cells. In contrast, regulatory T cells are anti-inflammatory T cells and work as counter-regulators of Th17 T cells. TGFβ is also required to differentiate Tregcells. In microglia cells, ERb-specific ligands, Indazol-Br and Indazol-C1 repress the induction of IL1β and IL23 but they do not repress TGFβ (
The references provided herein are incorporated in their entirety for all purposes.
Almer et al. (1999). J Neurochem 72, 2415-2425; Anneser, J. (2000). Neurol Sci 21, S913-918; Arce, V., Garces, et al. (1999). J Neurosci Res 55, 119-126; Barbeito, L. H., et al. (2004). Brain Res Brain Res Rev 47, 263-274; Barber, S. C., et al. (2006). Biochim Biophys Acta 1762, 1051-1067; Boillee, S., et al. (2006). Neuron 52, 39-59; Clement, A. M., et al. (2003). Science 302, 113-117; Consiglio, A., et al. (2004). Proc Natl Acad Sci USA 101, 14835-14840; Deng, H. X., et al. (1993). Science 261, 1047-1051; Di Giorgio, F. P., et al. (2007). Nat Neurosci 10, 608-614; DiBernardo, A. B., et al. (2006). Biochim Biophys Acta 1762, 1139-1149; Doble, A. (1996). Neurology 47, S233-241; Grisham, M. B., et al. (1996). Methods Enzymol 268, 237-246; Gundersen, H. J., et al. (1988). Apmis 96, 857-881; Harraz, M. M., et al. (2008). J Clin Invest 118, 659-670; Henderson, C. E., et al. (1993). Neuromuscul Disord 3, 455-458; Lee, S. K., et al. (2004). Development 131, 3295-3306; Li, X. J., et al. (2005). Nat Biotechnol 23, 215-221; Lobsiger, C. S., et al. Nat Neurosci 10, 1355-1360; Marden, J. J., et al. J Clin Invest 117, 2913-2919; Miller, R. G., et al. Amyotroph Lateral Scler Other Motor Neuron Disord 5 Suppl 1, 52-54; Muotri, A. R., et al. Proc Natl Acad Sci USA 102, 18644-18648; Nagai, M., et al. Nat Neurosci 10, 615-622; Okamoto, K., et al. Neurosci Lett 162, 125-128; Ogawa, S., et al. Cell 122, 707-721; Pasinetti, G. M., et al. Neurology 66, 1218-1222; Pawate, S., et al. J Neurosci Res 77, 540-551; Rosen, D. R., et al. Nature 362, 59-62; Scott, S., et al. Amyotroph Lateral Scler 9, 4-15; Taupin, P., et al. Neuron 28, 385-397; Urushitani, M., et al. Nat Neurosci 9, 108-118; Watanabe, M., et al. Brain Res 1073-1074, 20-24; Wu, D. C., et al. Proc Natl Acad Sci USA 103, 12132-12137; Yamanaka, K., et al. Nat Neurosci 11, 251-253; Aarnisalo, P., et al. J Biol Chem 277, 35118-35123.; Akira, S., et al. Cell 124, 783-801; Ashburner, B. P., et al. Mol Cell Biol 21, 7065-7077; Atkinson, T. J., Int Rev Immunol 27, 255-281; Ballas, N., et al. Cell 121, 645-657; Barish, G. D., et al. Mol Endocrinol 19, 2466-2477; Block, M. L., et al. Nat Rev Neurosci 8, 57-69; Bonta, P. I., et al. Arterioscler Thromb Vasc Biol 26, 2288-2294; Brown, G. C., Biochem Soc Trans 35, 1119-1121; Brundin, P., et al. Nat Rev Neurosci 9, 741-745; Buss, H., et al. J Biol Chem 279, 49571-49574; Di Virgilio, F., Trends Pharmacol Sci 28, 465-472; Doi, Y., et al. Proc Natl Acad Sci USA 105, 8381-8386; Farrer, M. J., Nat Rev Genet. 7, 306-318; Fearnley, J. M., et al. Brain 114 (Pt 5), 2283-2301; Frank-Cannon, T. C., et al. J Neurosci 28, 10825-10834; Galleguillos, D., et al. J Biol Chem 279, 2005-2011; Gao, H. M., et al. J Neurosci 28, 7687-7698; Ghisletti, S., et al. Mol Cell 25, 57-70; Glass, C. K., et al. Nat Rev Immunol 6, 44-55; Hartmann, A., et al. Exp Neurol 184, 561-564; Hay, R. T., Mol Cell 18, 1-12; Kanei-Ishii, C., et al. Genes Dev 18, 816-829 Kawai, T., et al. Semin Immunol 19, 24-32; Le, W. D., et al. Nat Genet. 33, 85-89; Lee, M. S., et al. Mol Cells 23, 1-10; Lehnardt, S., et al. Proc Natl Acad Sci USA 100, 8514-8519; Lehnardt, S., et al. J Neurosci 28, 2320-2331; Maira, M., et al. Mol Cell Biol 19, 7549-7557; Martin, M., et al. Nat Immunol 6, 777-784; McGeer, P. L., et al. Parkinsonism Relat Disord 10 Suppl 1, S3-7; McGeer, P. L., et al. Mov Disord 23, 474-483; Medzhitov, R., Nature 449, 819-826; Meredith, G. E., et al. Acta Neuropathol 115, 385-398; Moore, D. J., et al. Annu Rev Neurosci 28, 57-87; Nagatsu, T., et al. Curr Pharm Des 11, 999-1016; Nordzell, M., et al. Biochem Biophys Res Commun 313, 205-211; Pascual, G., et al. Nature 437, 759-763; Pei, L., et al. J Biol Chem 280, 29256-29262; Pei, L., et al. Mol Endocrinol 20, 786-794; Sakurada, K., et al. Development 126, 4017-4026; Shi, Y., et al. Nature 422, 735-738; St-Pierre, J., et al. Cell 127, 397-408; Tansey, M. G., et al. Exp Neurol 208, 1-25; Teismann, P., et al. Cell Tissue Res 318, 149-161 Thery, C., et al. J Neurochem 59, 1183-1186; Verstrepen, L., et al. Cell Mol Life Sci; Wang, X., et al. Nucleic Acids Res 31, e154; Wang, Z., et al. Nature 423, 555-560; Whitton, P. S., Br J Pharmacol 150, 963-976; Yasuda, J., et al. Cancer Sci 95, 52-57; Zetterstrom, R. H., et al. Science 276, 248-250.
This patent application is a National Stage of PCT/US2009/066641, filed Dec. 3, 2009, and claims the benefit of Unites Stated Provisional Patent Application No. 61/119,700, filed Dec. 3, 2008, the contents of which are hereby incorporated by reference in their entireties and for all purposes.
This invention was made with government support under CA52599 awarded by the National Institutes of Health. The Government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US09/66641 | 12/3/2009 | WO | 00 | 9/19/2011 |
| Number | Date | Country | |
|---|---|---|---|
| 61119700 | Dec 2008 | US |
