Ikaros isoforms and mutants

Information

  • Patent Application
  • 20040002096
  • Publication Number
    20040002096
  • Date Filed
    March 21, 2003
    23 years ago
  • Date Published
    January 01, 2004
    22 years ago
Abstract
Specific Ikaros mutations, as well as the correlation of the presence of the specific Ikaros mutations and other wild-type non-DNA binding Ikaros isoforms with lymphoid cell abnormality is provided in the in the invention. Methods for detecting and treating lymphoid cell abnormality, including hematologic malignancy, are also provided.
Description


FIELD OF THE INVENTION

[0001] This invention relates to wild-type isoforms and mutations of Ikaros, and to nucleic acid sequences encoding Ikaros, useful in the diagnosis and treatment of hematologic malignancy, particularly lymphoid malignancy, including stem cell leukemia and T-cell and B-cell acute lymphoblastic leukemia (ALL).



BACKGROUND OF THE INVENTION

[0002] Acute lymphoblastic leukemia (ALL) is the most common form of cancer in children. Leukemic clones in ALL patients are thought to originate from normal lymphocyte precursors arrested at various stages of T- or B-lymphocyte development hence, any critical regulatory network that controls normal lymphocyte development is a potential target for a leukemogenic event.


[0003] One such regulatory network vital for normal lymphopoiesis involves Ikaros, a member of the Kruppel family “zinc finger” DNA-binding proteins. Ikaros acts as an evolutionarily conserved “master switch” of hematopoiesis that dictates the transcriptional regulation of the earliest stages of lymphocyte ontogeny and differentiation.1 Programmed expression and function of the Ikaros gene is tightly controlled by alternative splicing of Ikaros pre-mRNA which results in production of eight different Ikaros isoforms. All eight Ikaros isoforms (Ik-1, Ik-2, Ik-3, Ik-4, Ik-5, Ik-6, Ik-7, and Ik-8) share a common carboxy(C)-terminal domain containing a transcription activation motif and two zinc finger motifs that are required for hetero- and homodimerization among the Ikaros isoforms and for interactions with other proteins. 1Georgopolous et al., 1994, Cell, 79:143-156; Georgopolous et al., 1992, Science, 258:808-812; Hahm et al. 1994, Mol. Cell Biol., 14:7111-7123; Molnar and Georgopolous, 1994, Mol. Cell Biol., 14: 8292-8303; Wang et al., 1996, Immunity, 5:537-549; Winandy et al., 1995, Cell, 83:289-299; Molnar et al., 1996, J. of Immunol., 592; Sun et al., 1996, EMBO J., 15:5358-5369; Hansen et al., 1997, Eur. J. Immunol., 27:3049-3058; Georgopolous et al., 1997, Ann. Rev. Immunol., 15:155-176; Brown et al., 1997, Cell, 91:845-854; and Klug et al., 1998, Proc. Natl. Acad. Sci. USA, 95:657-662.


[0004] Only three of the eight Ikaros isoforms (Ik-1, Ik-2, and Ik-3), however, contain the requisite three or more amino (N)-terminal zinc fingers that confer high affinity binding to a Ikaros-specific core DNA sequence motif in the promoters of target genes2. The formation of homo- and heterodimers among the DNA binding isoforms increases their affinity for DNA, whereas heterodimers between the DNA binding isoforms (Ik-1, Ik-2, and Ik-3) and non-DNA binding isoforms (Ik-4, Ik-5, Ik-6, Ik-7, and Ik-8) are unable to bind DNA. Therefore, non-DNA-binding Ikaros proteins with fewer than three N-terminal zinc fingers can interfere with the activity of Ikaros isoforms that can bind DNA3.


[0005] In mice, absence of the normal Ikaros gene results in an early and complete arrest in the development of all lymphoid lineages during both fetal and adult hematopoiesis4. Ikaros-deficient mice have a rudimentary thymus, lack peripheral lymph nodes and are characterized by a complete absence of lymphocyte progenitor cells as well as mature B-lymphocytes, T-lymphocytes, and natural killer cells. Ikaros also has a very important leukemia suppressor function which depends on its DNA binding ability: Mice heterozygous for a germline mutation which results in loss of critical DNA-binding zinc fingers of Ikaros develop a very aggressive form of lymphoblastic leukemia with a concomitant loss of heterozygosity between three and six months after birth5. Moreover, Ikaros has been localized to centromeric heterochromatin in immature lymphocyte precursors and it has been proposed that Ikaros might play an important role in recruitment and centromere-associated silencing of potentially “leukemogenic” growth regulatory genes.6


[0006] Specific molecular defects in the Ikaros gene and its encoded protein have not been previously identified, nor has Ikaros or any of its isoforms been implicated in human disease. Determination of such defects and the correlation of the specific defect to human leukemic disease would provide particularly useful diagnostic and therapeutic tools. 2Sun et al., 1996, EMBO J., 15:5358-5369 3Molnar et al., 1996, J. Immunol. 156:585-592; and Sun et al., 1996, EMBO J., 15:5358-5369 4Georgopolous et al., 1994, Cell, 79:143-156 5Winandy et al., 1995, Cell, 83:289-299 6Brown et al., 1997, Cell, 91:845-854; and Klug et al., 1998, Proc. Natl. Acad. Sci. USA, 95:657-662



SUMMARY OF THE INVENTION

[0007] The present invention provides diagnostic and therapeutic tools based on the discovery of a direct correlation of non-DNA-binding IKAROS isoforms and/or specific IKAROS gene mutations and mutant proteins with lymphoid disease, and particularly with cancer, such as leukemia. Specific Ikaros mutations resulting from splice variants which lead to an in-frame deletion of ten amino acids (ΔKSSMPQKFLG [SEQ ID NO: 13]) upstream of the transcription activation domain and adjacent to the carboxy-terminal zinc fingers have been identified in children and infants with acute lymphoblastic leukemia (ALL), expressing high levels of dysfunctional dominant-negative Ikaros isoforms. In addition, a second specific Ikaros mutation leading to an in-frame insertion of 20 amino acids TYGADDFRDFHAIIPKSFSR [SEQ ID NO: 11] has also been identified in leukemic cells.


[0008] The identification of these specific defects and their association with ALL, as well as the correlation of dominant-negative Ikaros isoforms with hematologic malignancy, provide useful tools for the diagnosis and monitoring of cancer, and particularly hematologic malignancy, including lymphoid malignancy and lymphoma. Such diagnostic tools correlate the abundance of dominant-negative Ikaros isoforms (non-DNA-binding isoforms) and/or the presence of specific Ikaros mutations with hematologic cell abnormality, including malignancies. The correlation of these defects in Ikaros expression in abnormal cells, such as leukemic cells, also provides therapeutic tools for repairing the defect and restoring normal hematologic cell function.


[0009] Accordingly, the present invention provides nucleic acid and protein sequences of specific Ikaros mutations. The invention further provides methods for the analysis of Ikaros proteins and for discriminating between wild type and mutant forms, as well as between DNA-binding and non-binding isoforms.


[0010] Diagnostic methods of the invention correlate the abundance of non-DNA-binding forms of Ikaros, for example, present in a ratio>1, with disease, particularly with cancer. An abundance of non-DNA-binding isoforms and/or mutants correlates with lymphoid disease, and most particularly with leukemias, including AML, ALL, and secondary leukemias. Ikaros proteins, including isoforms and mutants, and nucleic acid sequences encoding them, can be analyzed by one or more methods described in the detailed description and examples below.


[0011] The present invention also provides for the replacement of DNA-binding forms of Ikaros in the treatment of disease, for example in the treatment of cancer such as leukemia, where DNA-binding forms are diminished or absent.







BRIEF DESCRIPTION OF THE DRAWINGS

[0012] FIGS. 1A-1I are Western blots showing expression of Ikaros protein isoforms in normal and leukemia cells. FIGS. IA.1 and 1A.2 show Ikaros protein expressed in Jurkat T-lineage ALL cells and normal fetal liver-derived human lymphocyte precursor cell lines FL8.2+ and FL8.2. FIG. 1B shows Ikaros protein expressed in normal thymocytes (NTHY-5) and 6 different B-lineage ALL cell lines. FIG. 1C shows Ikaros proteins expressed in normal thymocytes (NTHY-4) and leukemic cells from 8 children with non-infant B-lineage ALL. FIG. 1D shows Ikaros proteins expressed in normal bone marrow cells (NBM-1), normal infant thymocytes (NTHY), and fetal thymocytes (FT). FIGS. 1E-1G show Ikaros proteins expressed in JK-E6-1 and MOLT-3 leukemic cell lines, normal bone marrow mononuclear cells (NBM-2), and leukemic cells from children with T-ALL. FIG. 1H shows expression in normal infant bone marrow cells (NBM-1), normal infant thymocytes (NTHY), and fetal thymocytes (FT). FIG. 1I shows expression in normal infant bone marrow mononuclear cells (NBM-2) and in six different infants newly diagnosed with ALL.


[0013] FIGS. 2A-2R are confocal images of leukemic cells showing expression and subcellular localization of Ikaros. FIGS. 2A-2J show leukemic cells from B-lineage ALL patients. FIGS. 2K and 2L show normal fetal liver-derived lymphocyte precursor cell lines FL8.2+ (Pro-B/T) and FL8.2 (Pro-B), respectively. FIG. 2M shows normal thymocytes. FIGS. 2N and 2O show leukemic T-cells MOLT-3 cells and JK-E6-1 cells, respectively. FIGS. 2P-2R show primary leukemic cells from T-ALL patients.


[0014]
FIGS. 3A and 3B show Ikaros-specific DNA binding activity of nuclear proteins extracted from normal thymocytes (NTHY) and leukemic T cells of T-ALL patients and the cell line MOLT-3.


[0015]
FIG. 4 is a schematic representation of Ikaros isoforms 1-8 with specific composition domains encoded by exons (E) 1-7 and the PCR primers noted.


[0016] FIGS. 5A-5C are representative ethiduim bromide stained gels showing PCR products amplified from fetal thymocytes (FT), normal bone marrow mononuclear cells (NBM-2), Molt-3 cells, Jurkat cells (JK-E6-1), and primary leukemic cells from patients with T-ALL (T-ALL) and B-ALL (INF).


[0017]
FIG. 6 is a sequence tracing spanning the junction between exon 2 and exon 4 from a control clone (T-ALL#5) having wild-type Ik-2 coding sequence at exons 2-4 and from a T-ALL patient cells (T-ALL#14) showing the IK-2 insertion mutant. FIG. 6 shows the wild type Ik-2 cDNA sequence spanning the junction between exon 2 and exon 4 [SEQ ID NO: 27] and its corresponding derived amino acid sequence [SEQ ID NO: 28], as well as the Ik-2 insertion mutant cDNA sequence spanning the junction between exon 2 and exon 4 [SEQ ID NO: 29] and its corresponding derived amino acid sequence [SEQ ID NO: 30].


[0018]
FIG. 7 is a ribbon diagram illustrating the interaction of the first three zinc fingers (F2, F3, and F4) of Ik-2 interact with the major groove of a DNA duplex.


[0019] FIGS. 8A-8F are sequence tracings spanning the junction between exon 6 and exon 7 from leukemic cells expressing the wild-type Ikaros 2 isoform and those expressing the deletion mutant. FIGS. 8A-8C show sequence tracings of wild-type and deletion mutant Ikaros isoforms obtained from patients with T-ALL and the MOLT-3 cell line. FIGS. 8D-8F show sequence tracings of wild-type and deletion mutant Ikaros isoforms obtained from patients with B-ALL and the MOLT-3 cell line. Shown are the wild-type cDNA sequences spanning the junction between exon 6 and exon 7 for Ik-2 and deletion mutant, Ik-4, Ik-8, and Ik-7 and their corresponding derived amino acid sequences.


[0020]
FIGS. 9A and 9B show a single nucleotide polymorphism in Ikaros cDNA and demonstrate bi-allelic expression of normal and aberrant Ikaros isoforms. FIG. 9A is a schematic diagram of the Ikaros cDNA. Zinc fingers are labeled F1-F6; Ikaros exons are labeled E1-E7; and PCR primers (arrows) are labeled F1 and F2 (forward) and R1 and R2 (reverse). The location of the single nucleotide polymorphism site (C or A at position 1002) in the bipartite activation domain is shown.


[0021]
FIG. 9B shows sequencing data spanning the single nucleotide polymorphism site from seven RT-PCR clones in NALM-6 B-lineage ALL cells. The alternative A or C at position 1002 is underlined. Typing results and cDNA sequencing results are shown from two Ik4 (non-DNA binding isoform [WT]) clones, one Ik4+deletion (non-DNA binding isoform (ΔKSSMPQKFLG) clone, two Ik2 (DNA Binding isoform [WT]) clones and two Ik2+deletion (DNA binding isoform (ΔKSSMPQKFLG) clones. Also shown are the corresponding deduced amino acid sequences.


[0022] FIGS. 10A-10E show photographs of representative ethidium bromide stained gels revealing PCR products used to determine sequence covering the exon 6/7 splice junction as described in Example 4. FIG. 10A shows the nested PCR products generated by amplification of the exon 6 donor site region.


[0023]
FIG. 10B shows the nested PCR product surrounding the exon 7 slice acceptor site.


[0024]
FIG. 10C shows genomic PCR amplification products for the exon 6 donor site, using primer sets P1a and P4 or P1b and P4.


[0025]
FIG. 10D shows genomic PCR amplification products for the exon 6 donor site obtained from control cells and primary leukemic cells.


[0026]
FIG. 10E shows genomic PCR amplification products for the exon 7 acceptor site obtained from control cells and primary leukemic cells from patients. Negative control (Neg. Con.) was duplicate reactions without template (either library digest or genomic DNA sample). Positive control (Pos. Con.) was tissue-type plasminogen activator (tPA), nested primer set, AP2 and PCP2, with a predicted band at 1.5 kb.


[0027] FIGS. 11A-11B depict the genomic sequence of Ikaros exon 6 splice donor site in leukemic patients expressing the exon 6 deletion. FIG. 11A shows the wild-type sequence surrounding the exon 6 donor site and ending at an EcoRV site within the intron spanning exons 6 and 7. Location of PCR primers used to determine this sequence are indicated. Coding sequence is capitalized and the intronic sequence is in lower case. The two alternative splice donor sites (donor site 1 and donor site 2) are shown.


[0028]
FIG. 11B shows the sequence alignment and identity of the Ikaros exon 6 donor sites in a control EBV-transformed B-lymphoblastoid cell line (LCL), two T-cell ALL cell lines, JURKAT and MOLT-3, and leukemic cells from two ALL patients, UPN 1 and UPN 2.


[0029] FIGS. 12A-12B depict the genomic sequence of the Ikaros exon 6-7 splice acceptor site in leukemic cells expressing aberrant Ikaros isoforms having the 30 base pair deletion in exon 6. FIG. 12A shows the wild-type sequence surrounding the exon 6 splice acceptor site and ending at overlapping DraI and SspI sites. The location of PCR primers (P5, P6, and P7) used to determine this sequence are indicated. The coding sequence is capitalized and non-coding sequence is in lower case.


[0030]
FIG. 12B shows the sequence alignment and identity of the exon 6-7 splice acceptor sequence in a control EBV-transformed B-lymphoblastoid cell line, LCL, two T-cell ALL cell lines, JURKAT and MOLT-3, and leukemic cells from two ALL patients, UPN 1 and UPN 2.







DETAILED DESCRIPTION OF THE INVENTION

[0031] The instant invention relates to the discovery that expression of mutant and/or dominant-negative isoforms of Ikaros correlates with human disease, such as cancer and hematologic disorders, including lymphoid malignancies such as infant stem cell leukemia and T-ALL in children. Accordingly, determining the presence and/or relative amounts of the mutant and dominant-negative isoforms in a sample provides a diagnostic assay for the detection of disease, including cancer, as well as the detection of the presence of abnormal hematologic cells, particularly malignant lymphoid cells, and the like.


[0032] Ikaros, a zinc-finger DNA-binding protein, is a critical transcriptional regulator. Regulation of the Ikaros gene expression during lymphocyte development is in part, mediated by alternative pre-mRNA splicing. Specific Ik-isoforms Ik-1 to Ik-8 have been identified. These isoforms differ in their amino-terminal zinc finger composition and in their DNA binding and transcriptional activation properties.


[0033] Only three of the known 8 isoforms (Ik-1, Ik-2, and Ik-3) contain the 3 to 4 N-terminal zinc fingers needed to bind with high affinity to the Ikaros DNA-binding sequence, GGGAAT [SEQ ID NO: 1]. These DNA binding isoforms can localize to the nucleus for binding activity. The remaining isoforms (Ik-4 through Ik-8) contain fewer than the needed 3-4 zinc fingers, and localize to the cytoplasm of the cell.


[0034] C-terminal zinc fingers coordinate the formation of homo- and heterodimeric Ik complexes. The formation of homo- and heterodimers among the DNA binding isoforms, Ik-1, 2, and 3, increases their affinity for DNA, whereas heterodimers between the DNA binding isoforms and non-DNA binding isoforms, Ik-4 through 8, are unable to bind DNA.


[0035] The abundance of the dominant-negative isoforms (Ik-4 through 8) is correlated herein with hemotologic malignancy, for example, with lymphoid malignancy such as lymphoma and leukemia. The presence of these isoforms in the cytoplasm of lymphoid cells and the absence of the wild type DNA binding isoforms Ik-1, 2, and 3, appears to stabilize the cells against normal programmed cell death, or apoptosis. Furthermore, the presence of mutant isoforms is also correlated herein with hematologic malignancy.


[0036] Definitions:


[0037] All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified. As used in this application, the following words or phrases have the meanings specified.


[0038] As used herein, “mutation” means alterations in DNA, RNA, or polypeptides relative to the corresponding wild-type DNA, RNA, or polypeptides.


[0039] As used herein, “Ikaros isoforms” means alternative splice variants of the Ikaros gene resulting in Ikaros mRNA, cDNA, and protein having variable size and sequence.


[0040] As used herein, “mutant Ikaros isoforms” includes both DNA binding Ikaros isoforms (Ikaros 1-3) and non-DNA binding Ikaros isoforms (Ik 4-8) that have either an insertion at exon 2 or a deletion at the splice junction of exon 6-7.


[0041] As used herein, “dysfunctional” or “dominant negative” Ikaros isoforms means wild-type non-DNA binding Ikaros isoforms and mutant Ikaros isoforms that interfere with binding DNA at an Ikaros binding site and/or interfere with localization of Ikaros to the nucleus.


[0042] As used herein, “DNA binding Ikaros isoforms” include those isoforms having the three or more N-terminal fingers required for high affinity binding to an Ikaros DNA binding site, including Ik-1, Ik-2, and Ik-3.


[0043] As used herein, “non-DNA binding Ikaros isoforms” includes those isoforms lacking the one or more of the three N-terminal zinc fingers required for high affinity binding to an Ikaros DNA binding site, including Ik-4, -5, -6, -7, and -8.


[0044] As used herein, “treatment” means the prevention of disease induction or progression, and/or the lessening of disease symptoms, including, for example, the reduction of cancer or diseased cell numbers.


[0045] As used herein, “lymphoid abnormality” or “lymphoid disease” means a disease involving T-cells or B-cells, and includes malignancies or leukemias such as stem cell leukemia, T-cell or B-cell ALL, and secondary leukemia.


[0046] Compositions and Methods of the Invention:


[0047] A. Nucleic Acid Sequences Encoding Mutant Ikaros Polypeptides


[0048] The present invention provides newly identified and isolated nucleic acid sequences encoding Ikaros isoforms, including of novel genomic Ikaros DNA sequence at the intron-exon splice site between exons 6 and 7. These include 254 base pairs of novel genomic sequence of the 5′ end of the intron adjacent exon 6 shown below and also in FIGS. 11A and 11B:
1[SEQ ID NO: 24]ATTAAATGAAATACAATAACATAATTAAACTAATCTTTGGTTCCCCTATTTATGTATTCATTTATCCAACAAAATCTCCTTAAGTGCTTATAATGGGTAGGTCCTGGCTCGGTGTCCCCTAGACAGACGCATGGGCCTTCCCCCAGCCCCTCAGTATGGTGCAGGTGTGATGTGTCCGCAGGTGTGTGTGTATGTGTGCAGGTGTGGGGTCCCCACGCGTGCTGGGCCCCCAGGCCGTGTTCCCCTTCCCCTCCCCGGTTGTAGATTTCAGCTGTTGCTGCCAGACCTGACCGGTTCCGGAGGTGGCCGCGCCCCACTCACTGTCGCCTGCTTTCCACAGGGGACAAGGGCCTGTCCGACACGCCCTACGACAGCAGCGCCAGCTACGAGAAGGAGAACGAAATGATGAAGTCCCACGTCATGGACCAAGCCATCAACAACGCCATCAACTACCTGGGGGCCGAGTC;


[0049] and 340 base pairs of novel genomic intron sequence adjacent to exon 7 shown below and also in FIGS. 12A and 12B:
2[SEQ ID NO: 25]TAAGCACAGTGAAATGGCAGAAGACCTGTGCAAGATAGGATCAGAGAGATCTCTCGTGCTGGACAGACTAGCAAGTAACGTCGCCAAACGTAAGAGCTCTATGCCTCAGAAATTTCTTGGTAAGAGTTAAATGTTTGCTGTCTCTTAAAAAAAAACTATGTGGGTGTTTTAGATGCAAGTAGAAATGAGTTGAGGGTGGAAGAAAGGGAAAAAAATCTTATTTTTTCAAAAGGAAAAATTGGTAAGCTTAACATTCCTTAAATATCTTAGAATTTTTTCCAATAAGTATCTTAAAAATAACAAACCTCCCATCAGTTTTTCCTAGATTTGATTTTGCAGCATCTGGGGCCTGCCCTGTGATCTGCCTGTGGAC.


[0050] Novel, mutant Ikaros cDNA molecules were also identified. The mutant Ikaros cDNA molecules include those having in-frame deletions at the exon 6-7 splice site, and those having an in-frame insertion at exon 2. Specific mutations are those having a deletion of 30 base pairs encoding a 10 amino acid sequence, KSSMPQKFLG [SEQ ID NO: 13], at exons 6-7 and/or those having a 60 base pair insertion encoding a 20 amino acid sequence, TYGADDFRDFHAIIPKSFSR [SEQ ID NO: 11], at exon 2.


[0051] B. Anti-Mutant Ikaros Antibodies


[0052] The present invention further provides anti-mutant Ikaros antibodies that specifically recognize and bind mutant Ikaros polypeptides. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies. Preferably, the antibodies of the invention are monoclonal antibodies. Also preferably, the antibody binds a mutant Ikaros polypeptide in the unique region of the mutation (e.g., either the insertion or the unique region generated by the deletion). Most preferably, the antibodies of the invention bind Ikaros polypeptides in a manner that permits detection of a particular mutation. The mutant Ikaros polypeptides, or portions thereof, can be used as antigens to produce antibodies that selectively bind mutant Ikaros isoforms.


[0053] Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, 1975, Nature, 256:495; by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567, or by other methods. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U.S. Pat. No. 4,816,567] or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide to create a chimeric antibody. The antibodies may be monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art.


[0054] The antibodies of the present invention can be used in diagnostic assays for mutant Ikaros, for example, detecting the expression or subcellular localization of mutant Ikaros isoforms in a sample of lymphoid cells.


[0055] C. Diagnostic Methods


[0056] Subcellular Localization of Ikaros


[0057] Mutant Ikaros nucleic acid sequences, mutant Ikaros polypeptides, and anti-Ikaros antibodies, including the anti-mutant Ikaros antibodies, provide useful diagnostic tools. For example, diagnostic methods identifying dominant-negative Ikaros isoforms by subcellular localization of Ikaros protein can be used to diagnose lymphoid abnormality. Nuclear compartmentalization of Ikaros protein correlates with the active, normal Ikaros DNA binding isoforms, such as Ik-1, 2 and 3. In contrast, cytoplasmic localization of Ikaros protein correlates with the abundance and presence of the non-DNA binding, dominant-negative isoforms such as Ik4-Ik8, and with disease such as cancer.


[0058] Diffuse, non-punctate nuclear localization, diffuse nuclear and/or cytoplasmic localization, and/or cytoplasmic localization of Ikaros protein correlates with cancer and with lymphoid disease, and in particular, with human hemotologic malignancy. Normal cells demonstrate punctate nuclear localization of Ikaros. This difference in subcellular localization of the Ikaros isoforms can thus be used to diagnose cancer and/or lymphoid disease.


[0059] Methods known for analysis of protein localization may be employed to determine the cellular localization of Ikaros in a patient sample. Immuno-assay employing immunofluorescence staining for the detection of Ikaros is preferred.


[0060] Immunoassay of Ikaros Expression


[0061] Specific Ikaros isoforms can be identified, for example, by Western blot analysis, and can also be used to diagnose cancer and lymphoid cell abnormalities. An abundance of dominant-negative isoforms, for example, of one or more of Ik 4-8, correlates with hemotologic cell abnormality. In general a ratio of non-DNA-binding isoforms to DNA-binding isoforms greater than 1 is indicative of lymphoid disease.


[0062] The identification of dominant negative Ikaros isoforms by Western blot analysis can also be achieved through determination of the relative sizes of the Ikaros isoforms present in the sample. The dominant negative isoforms, Ik-4-8, have an apparent molecular weight less than that of Ik-2 or Ik3, which is about 47 kDa. Thus, analysis of Ikaros protein in a Western blot analysis using a polyclonal antibody that recognizes all eight wild-type or mutant Ikaros isoforms can be used to determine the relative ratio of dominant negative isoforms (mw less than about 47 kDa) to the DNA-binding isoforms (mw about 47 kDa).


[0063] Specific antibodies that discriminate between the DNA-binding and non-DNA-binding isoforms can also be used. For example, reactivity with antibodies directed to an epitope lacking in Ik 4-8 can be used to screen for DNA-binding isoforms.


[0064] Nucleic Acid Analysis


[0065] Analysis of mutant Ikaros nucleic acid sequences can also be used in diagnostic methods to identify the presence of mutant Ikaros protein, cDNA, RNA, or gene encoding the mutant protein. Because mutant forms of Ikaros are correlated with disease, such as cancer and hemotologic cell abnormality, including human hematologic malignancy the presence of such mutant protein, cDNA, RNA, or genes is diagnostic. Direct sequencing, binding, or hybridization assays including PCR, RT-PCR, Northern blot, Southern blot, and RNAse protection can be used. For example, PCR amplification or RT-PCR amplification of a region of a known Ikaros nucleic acid mutation, such as exon 2 or exons 6-7, are used. The presence of a 21 amino acid insert at exon 2 correlates with hemotologic cell abnormality.


[0066] In another embodiment, reverse transcription reactions coupled with PCR amplification of the region at exons 6-7 known to identify the 10 amino acid deletion (30 nucleic acid deletion) can be used to assay for the presence of an Ikaros deletion mutation with hemotologic cell abnormality.


[0067] Similarly, reverse transcription reactions coupled with PCR amplification can be used to identify non-mutant non-DNA binding Ikaros isoform, Ik 4-8. The presence of non-mutant non-DNA binding Ikaros isoform, Ik 4-8, correlates with hemotologic cell abnormality, cancer, and particularly lymphoid disease.


[0068] Any of these diagnostic methods can be used to detect disease, monitor disease progression and/or regression, and to evaluate the effects of treatments.


[0069] D. Treatment Methods


[0070] Ikaros Replacement Therapy


[0071] An absence or lack of DNA-binding Ikaros isoforms is correlated with lymphoid disease. Therapeutic replacement of DNA binding Ikaros isoforms, Ik 1-3, preferably Ik-1 or Ik-2, is thus desirable. Such replacement can be accomplished by known methods, including administration of DNA-binding forms of IK protein directly; and/or by administration of nucleic acids encoding these proteins for in vivo production.


[0072] The invention may be better understood with references to the following, non-limiting examples.



EXAMPLE 1

[0073] Characterization of Ikaros Expression in Children with ALL


[0074] A. Patients and Cell Lines


[0075] The patient population included 64 children (<21 years of age) with newly diagnosed ALL who were enrolled on Children's Cancer Group (CCG) protocols CCG-1882 and CCG-1961 (for ALL patients of age 1-9 years with WBC≧50,000/μl or age≧10 years), CCG 1901 (for ALL patients with lymphomatous features, including T-ALL), or CCG-107, CCG-1883 and CCG-1953 (for infants with ALL). Fifteen patients had T-lineage ALL and 49 patients had B-lineage ALL. Except for 8 patients with B-lineage ALL, all other patients (87.5%) had high risk ALL according to the NCI risk classification (Smith et al., 1996, J. Clin. Oncol., 14:18-24). Five patients in first bone marrow relapse also were studied.


[0076] Each protocol was approved by the National Cancer Institute as well as the Institutional Review Boards of the participating CCG-affiliated institutions. Informed consent was obtained from parents, patients, or both, as deemed appropriate, for both treatment and laboratory studies, according to Department of Health and Human Services guidelines.


[0077] Diagnosis of ALL was based on morphological, biochemical, and immunological features of the leukemic cells, including lymphoblast morphology as determined by Wright-Giemsa staining, positive nuclear staining for terminal deoxynucleotidyl transferase, negative staining for myeloperoxidase, and reactivity with monoclonal antibodies to lymphoid differentiation antigens, as described previously (Uckun et al., 1996, Leuk. Lymphoma, 24:57-70; Uckun et al., 1997, Blood, 90:28-35; and Uckun et al., 1997, J. Clin. Oncol., 15:2214-2221). All T-lineage ALL were classified as T-lineage ALL because ≧30% of the isolated leukemic cells were positive for the pan-T cell marker CD7 and <30% were positive for the pan-B cell marker CD19. Similarly, all B-lineage ALL patients were classified as B-lineage ALL because ≧30% of their leukemic cells were positive for CD19 and <30% were positive for CD7. Surplus cells from diagnostic bone marrow specimens were used for molecular genetic studies. The presenting clinical features of the 64 newly diagnosed patients are shown in Table 1. Among the 15 newly diagnosed T-lineage ALL patients, all 15 had high risk ALL according to the NCI risk classification (Smith et al., 1996, J. Clin. Oncol., 14:18-24), 9 (60%) were male, 14 (97%) had high white blood cell counts, 12 (80%) had hepatosplenomegaly, and 11 (73%) had a mediastinal mass (Table 1). Among the 49 newly diagnosed B-lineage patients, 41 (30 infants and 11 children) (84%) had high risk ALL, 28 (57%) were male, 27 (55%) had high white blood cell counts, and 34 (69%) had hepatosplenomegaly.


[0078] Normal bone marrow specimens were obtained from two children who were bone marrow donors in the context of sibling bone marrow transplantation. Normal thymuses were obtained from 5 children undergoing thoracic surgery for a cardiac defect. One fetal thymus was obtained from a prostaglandin-induced human abortus of 21 weeks gestational age. These tissues were used according to the guidelines of the Hughes Institute Committee on the Use of Human Subjects. In addition, the human T-ALL cell lines MOLT-3 and JK-E6-1 (ATCC TIB-152), as well as the B-lineage ALL cell lines LC1;19 (E2A-PBX1+), KM-3, HPB-NULL, NALM-6, ALL-1 (BCR-ABL+), and RS4;11 (MLL-AF4+) were also included in the analyses. Also included were the fetal liver derived immature lymphocyte precursor cell lines FL8.2+ (a CD2+, CD19+, CD10+, CD34+ pro-B/T cell line with germline IgH and TCRα/β genes coexpressing the B-lineage surface antigen CD19 as well as the T-lineage surface antigen CD2) and FL8.2 (a CD2CD19+CD10+CD34+sIg pro-B cell line with germline IgH genes). These normal lymphocyte precursor cell lines were established and characterized as reported in Uckun et al., 1989, Blood, 73: 1000-1015; and Uckun et al., 1991, Proc. Natl. Acad. Sci. USA, 88:3589-3593.
3TABLE 1Patient CharacteristicsCharacteristicValuePatient SubgroupCategorical VariablesNo. of Patients (%)T-Lineage All (N = 15)*High risk15 (100)Male sex9 (60)WBC > 50 × 109/L14 (97)Hepatosplenomegaly12 (80)Mediastinal mass11 (73)Continuous variablesmean ± SE (Range)Age - yr8.1 ± 1.0 (1.8-19.0)WBC - × 109/L389 ± 65 (7-819)B-Lineage All (N = 49)†High risk††41 (84)Male sex28 (57)WBC > 50 × 109/L27 (55)Hepatosplenomegaly34 (69)Continuous variablesmean ± SE (Range)Age - yr3.4 ± 0.7 (0.1-18.8)WBC - × 109/L203 ± 40 (3-1,000)*In addition to these 15 newly diagnosed patients, 3 patients in first bone marrow relapse were also studied. †In addition to these 49 newly diagnosed patients, 2 patients in first bone marrow relapse were also studied. ††The high risk B-lineage All subgroup included 30 infants (>12 months of age) with all and 11 children with risk ALL.


[0079]
* In addition to these 15 newly diagnosed patients, 3 patients in first bone marrow relapse were also studied.
† In addition to these 49 newly diagnosed patients, 2 patients in first bone marrow relapse were also studied.
†† The high risk B-lineage All subgroup included 30 infants (<12 months of age) with all and 11 children with high risk ALL.


[0080] B. Cytogenetic Analysis


[0081] Cytogenetic analysis of leukemic cells was performed by local institutions prior to initiation of therapy. Banded chromosomes were prepared from unstimulated peripheral blood or direct and 24-hour cultured preparations of fresh bone marrow, as described by Heerema et al., 1985, Cancer, Genet, Cytogenet., 17:165-179). Chromosome abnormalities were designated using the 1995 International System for Human Cytogenetics Nomenclature (Mitelman, 1995, IN: ISCN: An International System for Human Cytogenetic Nomenclature, (Karger)). Abnormal clones were defined as 2 or more metaphase cells with identical structural chromosomal abnormalities or extra chromosomes, or 3 or more metaphase cells with identical missing chromosomes.


[0082] C. Analysis of Ikaros Protein Expression by Western Blot


[0083] Ikaros expression was studied in 8 different ALL cell lines, normal tissues, and primary leukemic cells from 59 children with ALL by Western blot analysis of proteins contained in whole cell lysates using polyclonal anti-Ikaros antibody that recognizes all eight Ikaros isoforms.


[0084] Methods:


[0085] Whole cell lysates were prepared using a 1% Nonidet-P40 lysis buffer, as described by Uckun et al., 1996, Science, 273:1096-1100; and Sun et al., 1999, Proc. Natl. Acad. Sci. USA, 96(2):680-685. Western blot analysis of whole cell lysates for Ikaros expression was performed using a polyclonal anti-Ikaros antibody, described in Sun et al., 1996, EMBO J., 15:5358-5369, reactive with all eight Ikaros isoforms as described by Uckun et al., 1996, Science, 273:1096-1100; and Sun et al., 1999, Proc. Natl. Acad. Sci. USA, 96(2):680-685. In brief, 30 μg samples of whole cell lysates were loaded on a 12% SDS-PAGE gel and the size-fractionated proteins were transferred onto a PVDF membrane (Millipore). The membrane was blocked in 5% milk for at least one hour at room temperature and then incubated with a polyclonal anti-Ikaros antibody (1:1000 dilution) (Sun et al., 1996, EMBO J., 15:5358-5369) in PBS with 5% milk over night at 4° C. The membrane was washed three times with PBST (150 mM NaCl, 16 mM Na2HPO4, 4 mM NaH2PO4, 0.1% Tween, pH 7.3) at room temperature and incubated with a peroxidase-conjugated goat anti-rabbit IgG (1:2000 dilution) (Jackson Lab.) for two hours at room temperature. Immunoreactive proteins were detected by the enhanced chemiluminescence (ECL) system (Amersham), as described by Uckun et al., 1996, Science, 273:1096-1100; and Sun et al., 1999, Proc. Natl. Acad. Sci USA, 96(2):680-685.


[0086] Results:


[0087] Results of this study are shown in FIGS. 1A-1I and in Table 2. Normal fetal liver-derived human lymphocyte precursor cell lines FL8.2+ (pro-B/T) and FL8.2 (pro-B) (FIG. 1A) as well as normal bone marrow cells and thymocytes (FIGS. 1B, C, D and H, Table 2) expressed a 57 kDa immunoreactive protein corresponding in size to Ik-1, and a 47 kDa immunoreactive protein corresponding to either Ik-2 or Ik-3. In contrast, the T-lineage ALL cell lines MOLT-3 cells and JK-E6-1 (FIG. 1E, Table 2 legend), B-lineage ALL cell lines LC1;19, KM-3, HPB-NULL, NALM-6, ALL-1, and RS4;1 1 (FIG. 1B), and primary leukemic cells from 16 of 17 (94%) T-lineage ALL patients (FIGS. 1E -1D, Table 2) and 42 of 42 (100%) B-lineage ALL patients (Table 2, FIGS. 1C and 1I) primarily expressed a smaller immunoreactive protein band of approximately 37-40 kDa, corresponding in size and electrophoretic mobility to one or more of the small non-DNA binding Ikaros isoforms Ik-4, Ik-5, Ik-6, Ik-7, and/or Ik-8.


[0088] In summary, normal cells expressed the large (about 47 kD or greater), DNA-binding Ikaros isoforms, Ik 1-3, whereas leukemic cells of T and B cell lineage expressed an abundance of the smaller (<47 KD), non-DNA-binding isoforms (Ik 4-8).


[0089] Abnormal Subcellular Compartmentalization


[0090] The subcellular compartmentalization of Ikaros proteins in normal and fetal tissues was compared to that in primary leukemic cells from 49 children with ALL (11 T-lineage and 38 B-lineage ALL patients), 2 ALL cell lines, and 2 normal fetal liver lymphocyte precursor cell lines (FL8.2+ and FL8.2) by confocal laser scanning microscopy.


[0091] Methods:


[0092] The subcellular localization of Ikaros protein(s) was examined by immunofluorescence and confocal laser scanning microscopy, as described by Uckun et al., 1996, Science, 273:1096-1100; and Sun et al., 1999, Proc. Natl. Acad. Sci. USA, 96(2):680-685. Cells (200×103) were attached to poly-L-lysine-coated glass coverslips by a 30 minutes incubation at room temperature, washed twice with PBS, and fixed in ice cold (−20° C.) methanol for 15 minutes. In order to permeabilize the cells and block the non-specific antibody binding sites, cells were treated with 0.1% Triton X-100 and 10% goat serum in PBS for 30 minutes.


[0093] To detect the Ikaros protein, cells were incubated with an affinity-purified polyclonal rabbit anti-Ikaros antibody, described in Sun et al., 1996, EMBO J., 15:5358-5369; and Sun et al., 1999, Proc. Natl. Acad. Sci. USA, 96(2):680-685, (1:300 dilution) for 1 hour at room temperature. Cells were washed with PBS and incubated with a FITC-conjugated goat anti-rabbit IgG (Amersham Corp., Arlington Heights, Ill.) ( 1:40 final dilution) for 1 hour. Cells were washed with PBS, counterstained with the DNA-specific nuclear dye toto-3 (Molecular Probes, Inc.; 1:1000 dilution) for 10 minutes at room temperature, and washed again with PBS. The coverslips were inverted, mounted onto slides in Vectashield (Vector Labs, Burlingame, Calif.) to prevent photobleaching and sealed with nail varnish as described by Sun et al., 1999, Proc. Natl. Acad. Sci. USA, 96(2):680-685. Slides were examined using a Bio-Rad MRC 1024 Laser Scanning Confocal Microscope mounted on an Nikon Eclipse E-800 upright microscope equipped for epifluorescence with high numerical aperture objectives as in Uckun et al., 1996, Science, 273:1096-1100; and Sun et al., 1999, Proc. Natl. Acad Sci. USA, 96(2):680-685. Optical sections were obtained and turned into stereomicrographs using Lasersharp software (Bio-Rad, Hercules, Calif.). Representative digital images were processed using Adobe Photoshop software (Adobe Systems, Mountain View, Calif.). Images were printed with a Fuji Pictography thermal transfer printer (Fuji Photo, Elmsford, N.Y.).


[0094] Results:


[0095] The nuclei (but not the cytoplasm) of FL8.2+ and FL8.2 cell lines (FIGS. 2K&L), fetal thymocytes, normal thymocytes (FIG. 2M) and normal bone marrow mononuclear cells (Table 2) were stained brightly by the anti-Ikaros antibody with discrete foci of high level expression, as evidenced by a distinct punctate green fluorescent staining pattern in toto-3 labeled blue nuclei.


[0096] In contrast, Ikaros proteins were expressed predominantly in the cytoplasm of leukemic cells from 7 of 11 children (64%) with T-lineage ALL (FIGS. 2P-R), 20 of 38 children (53%) with B-lineage ALL (FIGS. 2A-J) as well as the ALL cell lines JK-E6-1 (FIG. 2-O) and MOLT-3 (FIG. 2N), as evidenced by a bright green fluorescent rim surrounding the toto-3 labeled blue nuclei. In leukemic cells from 4 of 11 (36%) T-lineage ALL patients and 18 of 38 (47%) B-lineage ALL patients, an abnormal diffuse, “patchy” nuclear staining with or without cytoplasmic staining was found (Table 2).


[0097] In summary, the data show nuclear localization of Ikaros protein in normal cells, but diffuse and/or cytoplasmic staining of Ikaros protein in leukemic cells.


[0098] E. Loss of Ikaros-Specific DNA Binding Activity in Leukemic T-Cells


[0099] The ability of nuclear extract proteins from normal thymocytes and leukemic T-cells to exhibit Ikaros-specific high affinity DNA binding activity was assessed in gel mobility shift assays (EMSA) using the Ik-BS1 oligonucleotide probe that contains a single high affinity Ikaros binding site. The data are shown in FIG. 3.


[0100] Methods:


[0101] Nuclear extracts were prepared by the method of Dignam et. al., 1983, Nucleic Acid Res., 11:1475-1489. The Ik-BS1 oligonucleotide is shown here with the Ikaros binding site in bold.


[0102] 5′TCAGCTTTTGGGAATACCCTGTCA3′ [SEQ ID NO: 2]


[0103] The probe was end-labeled with 32P using T4 polynucleotide kinase and γ32P-ATP (3,000 Ci/mmol) and purified using a Nuctrap probe purification column (Stratagene). Prior to addition of labeled probe, the nuclear extracts (3 μg) were preincubated for 10 minutes at room temperature in a 20 μl reaction mixture containing 10 mM HEPES, pH 7.9, 50 mM KCl, 2 mM DTT, 0.2 mM EDTA, 10% glycerol and 2 ng poly dI-dC/dI-dC. Labeled probe (1 ng; 1×105 cpm/ng) was added and the mixture was incubated for an additional 20 minutes at room temperature. Reactions were terminated by the addition of gel loading buffer. For competition reactions, 60-fold excess unlabeled specific or nonspecific probes were added prior to the preincubation. The Ik-BS1 oligonucleotide was used as the specific competitor and the Ik-BS1M oligonucleotide. This oligonucleotide contains a 2-base pair mutation at the Ikaros binding site.


[0104] 5′TCAGCTTTTGGGggTACCCTGTCA3′ [SEQ ID NO: 3]


[0105] Electrophoresis was carried out using 7% acrylamide:bisacrylamide (37.5:1)(pH 8.3) Tris-Glycine-EDTA gel containing 4% glycerol. Gels were pre-run at 150 V for 2 hours at 4° C. Reaction mixtures (15 μl) were loaded and electrophoresed for an additional 4 hours. Following electrophoresis, gels were dried and subjected to autoradiography on film.


[0106] Results:


[0107] The results of the mobility shift assay are shown in FIGS. 3A and 3B. Nuclear proteins from normal thymocytes (NTHY) revealed mobility shifts consistent with significant Ikaros-specific DNA-binding activity (FIG. 3A): Three major shifted bands, which correspond to protein-DNA complexes containing Ikaros monomers, dimers, and higher order multimeric complexes, were detected. This triplet binding pattern was specific, since 60-fold excess of the unlabeled wildtype Ik-BS1 oligonucleotide was able to inhibit the mobility shift, but not the mutant Ik-BSM oligonucleotide probe with a two base pair mutation at the Ikaros binding site (lanes 3 vs. 4, respectively).


[0108] In contrast to extracts from normal thymocytes, nuclear extracts from MOLT-3 cell line or leukemic T-cells of T-ALL patients revealed no detectable mobility shifts of the Ik-BS1 probe (FIG. 3B).


[0109] These results provide unprecedented evidence that nuclear proteins from leukemic cells lack Ikaros-specific high affinity DNA binding activity. These results are consistent with the confocal images of leukemic cells showing Ikaros expression in the cytoplasm, but not in the nucleus, of leukemic cells. Additionally, the absence of Ikaros activity in leukemic cells with an abnormal patchy-diffuse (instead of punctate or speckled) nuclear Ikaros staining pattern indicates altered DNA binding properties of Ikaros-containing complexes in some of the ALL patients.
4TABEL 2Ikaros Expression Profile of Leukemic Cellsfrom Children with Acute Lymphoblastic LeukemiaNo. of cases (%)Predominant Pattern ofNormal Thymus/Ikaros ExpressionT-lineageB-LineageBone MarrowConfocal Imaging ofLocationCytoplasmic7/11 (64)20/38 (53)0/7 (0)Nuclear, diffuse5/11 (36)18/38 (47)0/7 (0)Nuclear, focal (normal)0/11 (0)0/38 (0)7/7 (100)Western Blot AnalysisSmall isoforms16/17 (94)42/42 (100)0/9 (0)(Ik4→Ik8)Large isoforms1/17 (6)0/42 (0)9/9 (100)(Ik1→Ik3)PCR Cloning &SequencingWild-type DNA Binding0/10 (0)0/11(0)2/2 (100)**IsoformsMutant DNA Binding10/10 (100)11/11 (100)0/2 (0)Isoforms and/orDominant-NegativeIsoforms smaller thanIk-2Ik-2 (ins)†1/10 (10)0/11 (0)0/2 (0)Ik-4 or Ik4 (del)††8/10 (80)5/11 (45)0/2 (0)Δ KSSMPQKFLG6/10 (60)9/11 (82)0/2 (0)IK-6†††0/10 (0)1/11 (9)0/2 (0)Ik-7 or Ik-7 (del)0/10 (10)2/11 (18)0/2 (0)Ik-8 (del)6/10 (60)3/11 (27)0/2 (0)*Because of rounding, the percentages do not always total 100. **A wild-type Ik-1 was found in 10 of 10 PCR clones from fetal thymocytes and a wild-type Ik-2 was found in 3 of 3 PCR clones from normal bone marrow cells of a healthy child. †Leukemic cells from T-ALL#14 expressed aberrant Ik-2 isoforms with a 60 bp insertion at the 5′ end of exon 3 either alone (5 of 6 PCR clones) or together with a 30 bp deletion at the 3′ end of exon 6 (1 of 6 PCR clones). The same aberrant Ik-2 isoform [Ik-2(ins)] was also found in 6 of 10 PCR clones from thje T-All cell line MOLT-3. The remaining 4 PCR clones for MOLT-3 were Ik-8. ††An aberrant form of Ik-4 with a 30 bp deletion at the 3′ end of exon 6 was found in leukemic cells from 9 children. The same deletion was also found in aberrant Ik-2, Ik-7, or Ik-8 isoforms from 6 additional children. †††A wild-type Ik-6 was found in 5 of 5 PCR clones from leukemic cells of a standard risk B-lineage ALL patient.



EXAMPLE 2

[0110] Molecular Characterization of Ikaros Transcripts in Leukemic Cells


[0111] Nested RT-PCR and nucleotide sequencing were used to examine normal thymocytes, normal bone marrow cells, and leukemic cells from children with ALL for the expression of PCR amplifiable Ikaros transcripts. Purified PCR products were characterized by nucleotide sequencing. FIG. 4 is a schematic diagram showing Ikaros isoforms 1-8, and particularly showing the composition of domains encoded by exons (E) 1-7 as well as the location of PCR primers.


[0112] Methods:


[0113] All RT-PCR assays for Ikaros mRNA expression were performed centrally in the CCG ALL Biology Reference Laboratory, with all due precautions to avoid false positive results, as described in detail by Uckun et al., 1998, Blood, 92:810-821. Briefly, total cellular RNA was extracted from cells using the RNeasy™ total RNA isolation kit (Qiagen, Santa Clarita, Calif.), and 20% of the total RNA sample was used for cDNA synthesis with Moloney murine leukemia virus (MMLV) reverse transcriptase (GIBCO-BRL, Gaithersburg, Md.) in the presence of dNTPs. Products were amplified with Amplitaq DNA polymerase (Perkin Elmer Cetus Corp., Norwalk, Conn.) and subjected to 35 cycles in a DNA thermal cycler as described. For enhanced sensitivity, the PCR products were amplified further by nested PCR. Primers for amplification of Ikaros (Ik) cDNAs were:
5[SEQ ID NO: 4]F1:5′ATGGATGCTGACGAGGGTCAAGAC3′; and[SEQ ID NO: 5]R1:5′TTAGCTCATGTGGAAGCGGTGCTC3′.


[0114] Primers for nested PCR were:
6F2:5′CTCATCAGGGAAGGAAAGCC3′; and[SEQ ID NO: 6]R2:5′GGTGTACATGACGTGATCCAGG3′.[SEQ ID NO: 7]


[0115] The location of the 5′ ends of the primers relative to the start site based on Ik1 cDNA are +1 for F, +32 for F2, +1570 for R1 and +1444 for R2, respectively. The predicted sizes of the PCR products are 1.5 Kb for Ik1, 1.28 Kb for Ik2 and Ik3, 1.17 Kb for Ik4, 1.1 Kb for Ik5, 0.86 Kb for Ik6, 1.1 Kb for Ik7, and 1.0 Kb for Ik8, respectively.


[0116] RNA integrity was confirmed by PCR amplification of the cABL mRNA, which is expressed ubiquitously in human hematopoietic cells, using the primers:
75′-TTCAGCGGCCAGTAGCATCTGACTT-3′; and[SEQ ID NO: 8]5′-TGTGATTATAGCCTAAGACCCGGAG-3′.[SEQ ID NO: 9]


[0117] Reactions conducted with RNA isolated from normal fetal thymocytes/infant bone marrow mononuclear cells were used as positive controls for Ikaros transcripts. Negative controls included PCR products from an RNA-free cDNA synthesis and amplification reaction and a DNA polymerase-free reaction.


[0118] Purified Ikaros cDNA (QIAquick™ PCR purification kit; Qiagen, Santa Clarita, Calif.) from the nested RT-PCR reaction mixtures was cloned into the pCR II vector using the TA Cloning kit (Invitrogen, San Diego, Calif.). The cloned PCR products were purified with a Qiagen plasmid isolation kit and sequenced automatically with the Thermosequenase sequencing kit (Amersham, Arlington Heights, Ill.) and the ALF Sequencer (Pharmacia, LKB Biotech, Piscataway, N.J.) (Uckun et al., 1991, Proc. Natl. Acad. Sci. USA, 88:3589-3593). Manual sequencing by the dideoxynucleotide chain termination method was performed using the T7 Sequenase Quick-denature Plasmid Sequencing kit (Amersham) according to the manufacturer's instructions. The sequences were compared with the published human Ikaros cDNA sequence obtained through GenBank (Accession codes S80876 and U40462).


[0119] Results:


[0120] As results of the PCR amplification and sequencing, are shown in FIGS. 5-8. A single PCR amplification product of approximately 1.4 Kb was observed in normal fetal thymocytes and 10/10 different PCR clones had the coding sequence of wildtype Ik-1 (FIG. 5A, Table 2). Similarly, a single PCR product of approximately 1.2 Kb was detected in normal bone marrow cells from a healthy child (NBM-2) and 3/3 different PCR clones had the coding sequence of wildtype Ik-2 (FIG. 5A, Table 2). By comparison, the predominant PCR amplification products in leukemic cells from 20 of 21 children with ALL were smaller than Ik-2 (FIGS. 5B & 5C, Table 2).


[0121] Sequence analysis was successful in all 21 cases. Leukemic cells from one (a T-ALL patient) of the 21 ALL patients, as well as from the T-ALL cell lines, MOLT-3 and JK-E6-1, expressed aberrant Ik-2 isoforms (Ik-2(ins)) having a 20 amino acid insertion (exon 2a) due to a 60-base pair insertion immediately upstream of exon 4 at the exon 2/exon 4 junction (FIG. 6). These cells expressed the insertion mutant either alone, or together with an in-frame 10 amino acid deletion due to a 30-base pair deletion at the 3′ end of exon 6 (FIGS. 8A-8C; Table 2).
8Insert:GTT ACA TAT GGG GCT GAT GAG TTT AGG GAT TTC CAT GCA ATA[SEQ ID NO: 10] V   T    Y   G   A  D   D    F   R   D  F   H   A   I[SEQ ID NO: 11]ATT CCC AAA TCT TTC TCT CGA I   P   K   S   F   S   RDeletion:T AAG AGC TCT ATG CCT CAG AAA TTT CTT GG[SEQ ID NO: 12]   K   S   S   M   P   Q   K   F   L   G[SEQ ID NO: 13]


[0122] As shown in FIGS. 8A-8C, the resulting deletion mutant exhibited the following mutant sequence:
9Deletion Mutant:CTC GCC AAA CGG GAC AAG GGC CTG[SEQ ID NO: 26] V   A   K   R   D   K   G   L[SEQ ID NO: 27]


[0123] Leukemic cells from 8 of 10 (80%) T-lineage ALL patients and 5 of 11 (45%) B-lineage ALL patients that were analyzed expressed the non-DNA binding Ikaros isoform Ik-4 (Table 2). Two T-lineage ALL patients expressed only wild-type Ik-4. Two other T-lineage ALL patients expressed wild-type Ik-4 along with wild-type IK2 or the aberrant in-frame 10 amino acid deletion. One T-lineage ALL patient expressed only aberrant Ik-4, having the same 30 bp (10 amino acid) deletion at the 3′ end of exon 6, whereas another T-lineage ALL patient and four B-lineage ALL patients expressed this deletion mutant as well as wild-type Ik-1 and/or Ik-2. Two T-lineage ALL patients and one B-lineage ALL patient expressed both wild-type and deletion forms of Ik-4, along with wild-type Ik-1 and/or Ik-2.


[0124] In contrast to Ik-4, other dominant-negative isoforms of Ikaros were not frequently expressed in primary leukemic cells from children with ALL: Ik-6 was found in wild-type form in 5 of 5 PCR clones from a single B-lineage ALL patient (Table 2). Ik-7 was found in wild-type form in 2 of 2 PCR clones from a single B-lineage ALL patient and in aberrant form with the exon 2 deletion in at least half of the PCR clones from one T-lineage ALL patient and one B-lineage ALL patient. Ik-8 was found in PCR clones from 3 of 11 B-lineage ALL patients but none of the 10 T-lineage ALL patients (Table 2).


[0125] Thus, RT-PCR and sequencing extended the results obtained with confocal microscopy and Western blot analyses, confirming that primary leukemic cells from each child with ALL express small, non-DNA binding wild-type and/or aberrant isoforms of Ikaros. Among 21 cases analyzed, 19 (90.5%) expressed dominant negative Ikaros isoforms, including Ik-4 (12 of 21 patients), Ik-6 (1 of 21 patients), Ik-7 (3 of 21 patients), and Ik-8 (3 of 21 patients). Furthermore, in 15 of 21 cases (71.4%), the PCR clones with coding sequences of Ik-2, Ik-4, Ik-7, and Ik-8 had an identical 30 base pair deletion at the 3′ end of exon 6. The observed N-terminal insertions and C-terminal deletions did not cause a frame shift, and therefore did not change the downstream amino acid sequences.


[0126] In summary, the expression of non-DNA-binding forms of Ikaros, including isoforms IK 4-8 and mutant forms, such as the 30 amino acid insertion and the 10 amino acid deletion, correlates with lymphoid disease, particularly leukemia.



EXAMPLE 3

[0127] Bi-Allic and Polymorphic Expression of Ikaros


[0128] Expression of aberrant Ikaros isoforms in leukemic cells could result in cis from sequence alterations or from leukemia-associated alterations in trans-acting factors. While cis activation of aberrant expression would cause mono-allelic expression of the aberrant isoforms, transactivation would be more likely to cause bi-allelic expression. The sequence of 128 Ikaros RT-PCR clones from 25 ALL cases were carefully examined for the presence of polymorphic sequence variations by RT-PCR and nucleotide sequence analysis, as described above, to determine whether the aberrant isoforms with the Δ KSSMPQKFLG deletion were mono- or bi-allelically expressed.


[0129] Results:


[0130] A single nucleotide polymorphism (SNP) within the Ikaros clones at nucleotide position 1002 (numbering from the translational start site of Ik-1-Genbank #U40462 Human Ikaros/LYF-1 homolog (hIK-1) mRNA) was identified as a silent variation affecting the third base of the triplet codon for a proline (CCC or CCA) within exon 7 in the highly conserved bipartite activation region (FIG. 9A). This region is conserved in the various Ikaros splice variants, thereby allowing typing of all Ikaros isoforms. The C allele was observed to be most prevalent (FIG. 9B, Table 3). Similar expression levels of the two polymorphic variant forms (C or A) of Ikaros was observed in 8 of 25 cases, whereas only a single allelic variant (either C, N=15 or A, N=2) was observed in the remaining 17 cases.


[0131] Overall, the expression frequencies were 77% (99/128 clones) for the 1002C allele and 23% (29/128 clones) for the 1002A allele. Both allelic variants were observed among wild-type and aberrant Δ KSSMPQKFLG DNA IK 1-3 isoforms as well as in wild-type and aberrant Δ KSSMPQKFLG IK 4-8 isoforms (FIG. 9B, Table 3). This bi-allelic expression pattern of the various Ikaros isoforms suggest that trans-acting factor(s), possibly affecting splice site recognition, are involved in the generation of the non-DNA binding isoforms (IK 4-8) as well as aberrant (IK (del)) ΔKSSMPQKFLG Ikaros isoforms. Bi-allelic expression was observed during the sequence analysis of aberrant Ikaros Δ KSSMPQKFLG RT-PCR clones from individual patients expressing only the IK-(del) mutants and from patients expressing both IK-(del) mutants and wild-type forms of Ikaros (FIG. 9B). This finding makes it unlikely that the observed deletions could be due to a cis-acting mutation within or surrounding the Ikaros gene. However, an excess of expression of aberrant non-DNA binding isoforms (Δ KSSMPQKFLG) (IK 4-8 (del)) (91% C/9% A) on the C allele, as well as an excess of clones expressing the aberrant DNA binding isoforms (IK 1-3 (del)) on the A allele (42% C/58% A) was observed, suggesting a subtle cis-acting influence on splice site recognition.
10TABLE 3Expression Frequency of Ikaros 1002A and Ikaros 1002C Alleles1002 AllelePCR CloneCAIk-1, Ik-2, or[WT]26/33(79) 7/33(21)Ik-3Ik-1, Ik-2, or[Δ KSSMPQKFLG] 8/19(42)11/19(58)Ik-3Ik-4, Ik-5, Ik-6,[WT]22/29(76) 7/29(24)Ik-7, Ik-8Ik-4, Ik-5, Ik-6,[Δ KSSMPQKFLG]43/47(91) 4/47(9)Ik-7, Ik-8All Clones99/128(77)29/128(23)



EXAMPLE 4

[0132] Genomic Sequence Analysis of Splice Donor and Acceptor Site Regions


[0133] The 10 amino acids involved in the Δ KSSMPQKFLG deletion are encoded at the 3′ end of exon 6, upstream of the transcription activation domain. To examine the integrity of the splice donor and acceptor regions in leukemic cells overexpressing the Δ KSSMPQKFLG alternative splice variants of Ikaros, genome walking across the intron-exon junctions between exons 6 and 7 was performed.


[0134] Methods:


[0135] Genomic DNA was isolated from both patient cells and cell lines using the Puregene® DNA isolation kit (Gentra Systems, Inc., Plymouth, Minn.), according to the manufacturer's instructions. The genomic sequence surrounding the predominant splice donor and acceptor sites at the exon-intron splice junction of Ikaros exon 6 was characterized through the use of a GenomeWalker™ Kit (Clontech, Palo Alto, Calif.). This kit utilizes very high-quality human placenta genomic DNA which is digested with individual restriction enzymes and then ligated to specifically designed adapters to produce five separate digested DNA “libraries”. Amplification of genomic sequence with one unknown end is then possible using one gene-specific primer (P1) and one adapter-specific primer (AP1). Nested PCR amplification with a second gene-specific primer (P2) and a second adapter-specific primer (AP2) followed to produce adequate quantities of region-specific product for use in cloning and sequence analysis. Adaptor-specific primers were provided by the manufacturer. In the first amplification round, the gene-specific PCR primer (P1) from Ikaros exon 6 corresponded to Ikaros sequence +732-+759:


[0136] P1a: 5′-TAA TCA CAG TGA ATG GCA GAA GAC CTG-3′ [SEQ ID NO: 14];


[0137] In the second amplification round, the nested gene-specific Ikaros primer corresponded to Ikaros sequence +747-+774:


[0138] P2: 5′-GGC AGA AGA CCT GTG CAA GAT AGG ATC A-3′ [SEQ ID NO: 15].


[0139] The PCR protocol was performed as recommended in the GenomeWalker™ manual. Briefly, long-range PCR was accomplished with the AdvanTAge® genomic PCR polymerase mix, which is a formulation containing a primary polymerase, Tth; a secondary, proofreading polymerase with 3′→5′ exonuclease activity; and TthStart™ antibody, which effectively generates a hot-start PCR. For the first amplification round, the two-step cycling parameters were as follows: 94° C., 25 seconds, 72° C., 4 minutes for 7 cycles; then 94° C., 25 seconds, 67° C. 4 minutes for 32 cycles; followed by a final extension at 67° C. for 4 minutes. In the nested amplification reaction, the cycling parameters were as follows: 94° C. 25 seconds, 72° C. 4 minutes for 5 cycles; 94° C. 25 seconds, 67° C., 4 minutes for 20 cycles; followed by a final extension at 67° C. for 4 minutes.


[0140] In the amplification of the 3′ splice site, the AdvanTAge® PCR mix was replaced by the Expand™ Long Template PCR system (Roche Molecular Biochemicals), which contains a combination of Taq polymerase and Pwo polymerase, as the proofreading enzyme, along with precise reagent buffer formulations, according to the manufacturer's protocol. Buffer 3, which is formulated for difficult templates and contains detergents, was used at the recommended dilution. In the first amplification round, the gene-specific PCR primer from Ikaros exon 7 (+989−973) was:


[0141] P7: 5′-AGC GGG CGC AGG GAC TC-3′ [SEQ ID NO: 16];


[0142] The second round, nested primer (+977−957) was:


[0143] P6: 5′-GAC TCG GCC CCC AGG TAG TTG-3′ [SEQ ID NO: 17].


[0144] Adapter specific primer AP1 and AP2, provided by the manufacturer, were used as above. AP1 was used in the first round of PCR amplification, and primer AP2, described above, was used in the second round of nested PCR amplification.


[0145] The PCR protocol was performed essentially as recommended in the GenomeWalker™ manual and as described above. Human tissue-type plasminogen activator (tPA) PCR primers were the positive control primers (PCP1, PCP2) and were provided with the GenomeWalker kit. The tPA control cycling parameters were as described in the manufacturer's protocol using the genomic library digest, PvuII.


[0146] Nested PCR products were cloned using the TOPO™ TA Cloning® Kit (Invitrogen, Carlsbad, Calif.). Plasmid minipreps of the cloned DNA were performed using the High Pure™ Plasmid Isolation Kit (Roche Molecular Biochemicals, Indianapolis, Ind.). Clones containing insert were sequenced using a Thermo Sequenase™ primer cycle sequencing kit (Amersham Pharmacia Biotech, Piscataway, N.J.) and the ALFexpress automated DNA sequencer (Amersham Pharmacia). In the amplification of the 3′ splice junction, DMSO was added to the cycle sequencing reactions at a final concentration of 5% v/v. Ikaros cDNAs of GenBank accession nos. HSU40462 (human Ikaros mRNA, hIk-1 [SEQ ID NO: 18]) and S80876 (human Ikaros mRNA, alternatively spliced form, Jurkat [SEQ ID NO: 19]) were used in sequence comparisons and mapping.


[0147] Sequence obtained using the GenomeWalker™ kit was used to design primers to directly amplify the region surrounding the 5′ splice junction of Ikaros exons 6 and 7 from the patient and cell line genomic DNA. For the 5′ splice site, PCR was carried out using two primer sets which differ in the placement of the intronic (anti-sense) primer to amplify fragments of 342 bp and 211 bp. The sense primers from exon 6 used to amplify both products were:
11[SEQ ID NO: 14]P1a:5′-TAA TCA CAG TGA ATG GCA GAA GAC CTG-3′(+732-759); or[SEQ ID NO: 20]P1b:5′-TAA GCA CAG TGA AAT GGC AGA AGA CCT G-3′(+732-759).


[0148] The sequence of the anti-sense primers used to amplify two fragments of different lengths, 342 and 211 bp, were:
12[SEQ ID NO: 21]P4:5′-ATG CTG CAA AAT CAA ATC TAG GAA AAA C-3′(+223-196); and[SEQ ID NO: 22]P3:5′-TTT CCC TTT CTT CCA CCC TCA ACT CAT-3′(+92-65), respectively.


[0149] PCR was performed using 500 ng of genomic DNA in a 50 μl reaction volume using the Expand™ Long Template PCR system (Roche Molecular Biochemicals) with buffer and component concentrations, as recommended by the GenomeWalker™ kit manufacturer, using buffer system 3 for difficult templates. The long-range PCR cycling parameters were as follows: 95° C. for 2 minutes (complete denaturation) which is followed by 10 cycles at 94° C. for 25 seconds, 65° C. for 30 seconds, extension at 68° C. for 2 minutes; with an additional 20 cycles of 94° C. for 25 seconds, 65° C. for 30 seconds, 68° C. for 2 minutes (extension) in which 20 seconds is added per cycle to the extension step, and then a final extension at 68° C. for 10 minutes.


[0150] The resulting products were cloned using the TOPO™ TA Cloning® Kit (Invitrogen). Plasmid minipreps of the cloned DNA were performed using the High Pure™ Plasmid Isolation Kit (Roche Molecular Biochemicals, Indianapolis, Ind.). Clones containing insert were sequenced using the Thermo Sequenase™ primer cycle sequencing kit (Amersham Pharmacia, Piscataway, N.J.) and an ALFexpress automated sequencer (Amersham Pharmacia).


[0151] For the 3′ splice site, genomic PCR was performed as above with the Expand™ Long Template PCR system (Roche Molecular Biochemicals), but using buffer system 1 and 5% v/v DMSO. The sense primer for the 3′ splice site was P5, having an intronic position of −244 to −223 from the splice acceptor site, and the anti-sense primer was P6, having a cDNA position of +977 to +957.


[0152] P5: 5′-GTA GGT CCT GGC TCG GTG TCC C-3′ [SEQ ID NO: 23] (intronic position −244 to −223 from the splice acceptor site); and


[0153] P6: 5′-GAC TCG GCC CCC AGG TAG TTG-3′ [SEQ ID NO: 17] (position in cDNA +977−957).


[0154] In this case, the long-range PCR cycling parameters were 1×95° C., 3 minutes; 10×95° C., 30 seconds, 66° C., 45 seconds, 68° C., 2 minutes, 68° C., 2 minutes; 20×95° C., 30 seconds, 66° C., 45 seconds, 68° C., 2 minutes +10 seconds/cycle; 1×68° C., 5 minutes. For this 3′ fragment analysis, DMSO was added to both the genomic PCR and the cycle sequencing reactions at a final concentration of 5% v/v.


[0155] Results:


[0156] Genome walking across the intron-exon junctions between exons 6 and 7 yielded the wild-type sequence. For analysis of the 5′ splice site, single bands were successfully obtained as a result of nested PCR from two out of five genomic DNA libraries (EcoRV and SspI) provided with the GenomeWalker™ kit (FIG. 10A). Four clones from each of these libraries were chosen for sequence analysis. Results from this initial sequence comparison (FIG. 11A) showed a complete match to the 3′ end of exon 6 from the Ikaros mRNA (accession no. U40462, 100% consensus).


[0157] FIGS. 10A-10E show photographs of representative ethidium bromide stained gels revealing PCR products used to determine sequence covering the exon 6/7 splice junction. FIG. 10A shows the nested PCR products generated by amplification of the exon 6 donor site region with the GenomeWalker™ kit using the gene-specific primer, P2, and the GenomeWalker™ adapter primer, AP2, to amplify restriction enzyme (EcoRV or SspI) digested, adapter-ligated genomic DNA.


[0158]
FIG. 10B shows the nested PCR product surrounding the exon 7 slice acceptor site obtained by amplification of DraI or SspI digested adapter-ligated genomic DNA with the AP2 and gene-specific primer 6, P6.


[0159]
FIG. 10C shows genomic PCR amplification products, using primer sets [P1a and P4] or [P1b and P4], for the exon 6 donor site obtained from control cells (LCL, EBV-transformed B-lymphoblastoid control cell line), leukemic cell lines (Jurkat, Molt-3), and- primary leukemic cells from patients (UPN 1 and UPN 2).


[0160]
FIG. 10D shows genomic PCR amplification products for the exon 6 donor site obtained from control cells and primary leukemic cells from patients, amplified using primer set P1b and P3.


[0161]
FIG. 10E shows genomic PCR amplification products for the exon 7 acceptor site obtained from control cells and primary leukemic cells from patients, amplified using primer set P5 (SEQ ID NO: 23) and P6 (SEQ ID NO: 17). Molecular weight markers (M): 1 kb DNA ladder. Negative control (Neg. Con.) was duplicate reactions without template (either library digest or genomic DNA sample). Positive control (Pos. Con.) was tissue-type plasminogen activator (tPA), nested primer set, AP2 and PCP2, with a predicted band at 1.5 kb. Two hundred fifty four base pairs of novel genomic sequence into the intron adjacent to the 5′ end of exon 6 were characterized [SEQ ID NO: 24].


[0162] For the 3′ splice site, two out of five genomic DNA libraries (DraI and SspI) provided with the GenomeWalker™ kit successfully produced single bands (503 bp from both libraries) as a result of nested PCR (FIG. 10B). An average of four clones from each library were chosen for sequence analysis. Again, a complete match was obtained to the Ikaros mRNA (accession no. U40462) across exon 7 sequence (FIG. 12A). For this region, 340 base pairs of novel intron sequence upstream from exon 7 was characterized [SEQ ID NO: 25]. This sequence was then used to develop primers to directly amplify this region of the splice junction and intronic sequence from genomic DNA of patients and cell lines.


[0163] Subsequent amplification and genomic sequence analysis of the corresponding exon 6-exon 7 splice junction regions from leukemic patients and cell lines expressing the deletion variant demonstrated no mutation in the region spanning the cryptic splice site, as well as at the predominant 5′ (donor) or 3′ (acceptor) splice sites. Bands of the predicted sizes were obtained by genomic PCR of DNA from the patients and cell lines of those samples expressing the alternative splice variant. FIGS. 10C and 10D show data for the 5′ splice site. FIG. 10E shows data for the 3′ splice site. No size differences were detected by restriction analysis of numerous cloned isolates covering both the 5′ and 3′ splice sites.


[0164] A minimum of six clones from each sample were sequenced for mutational analysis. Sequencing results confirmed the presence of the region between the alternative splice sites in all genomic DNAs examined. There was no mutation within a 284 base pair sequence at the normal splice donor site or the region directly surrounding the deleted sequence, i.e., near the cryptic splice donor site (FIGS. 11A and 11B). Similarly, no mutations were found within a 328 base pair sequence at the 3′ splice acceptor site (FIG. 12).


[0165] In summary, these data demonstrate conservation and integrity of the splice donor and acceptor regions across the intron-exon junctions between exons 6 and 7 in leukemic cells expressing the IK-deletion alternative splice variants.


[0166] All publications and patent applications recited in this specification are indicative of the level of ordinary skill in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated by the reference.
13ID NO:SEQUENCE1.GGGAAT2.TCAGCTTTTGGGAATACCCTGTCA3.TCAGCTTTTGGGggTACCCTGTGA4.ATGGATGGTGACGAGGGTCAAGAC5.TTAGCTCATGTGGAAGCGGTGCTC6.CTCATCAGGGAAGGAAAGCC7.GGTGTACATGACGTGATCCAGG8.TTCAGCGGCCAGTAGCATCTGACTT9.TGTGATTATAGCCTAAGACCCGGAG10.GTT ACA TAT GGG GCT GAT GAC TTT AGG GAT TTCCAT GCA ATA ATT CCC AAA TCT TTC TCT CGA11.V T Y G A D D F R D F H A I I P K S F S R12.T AAG AGC TCT ATG CCT CAG AAA TTT CTT GG13.K S S M P Q K F L G14.TAA TCA CAG TGA ATG GCA GAA GAC CTG15.GGC AGA AGA CCT GTG CAA GAT AGG ATC A16.AGC GGG CGC AGG GAC TC17.GAC TCG GCC CCC AGG TAG TTG18.HSU4046219.S8087620.TAA GCA CAG TGA AAT GGC AGA AGA CCT G21.ATG CTG CAA AAT CAA ATC TAG GAA AAA C22.TTT CCC TTT CTT CCA CCC TCA ACT CAT23.GTA GGT CCT GGC TCG GTG TCC C24.ATTAAATGAAATACAATAACATAATTAAACTAATCTTTGGTTCCCCTATTTATGTATTCATTTATCCAACAAAATCTCCTTAAGTGCTTATAATGGGTAGGTCCTGGCTCGGTGTCCCCTAGACAGACGCATGGGCCTTCCCCCAGCCCGTCAGTATGGTGCAGGTGTGATGTGTCCGCAGGTGTGTGTGTATGTGTGCAGGTGTGGGGTCCGCAGGCGTGCTGGGCCCCCAGGCCGTGTTCCCCTTCCCCTCCCCGGTTCTAGATTTCAGCTGTTGCTGCCAGACCTGACCGGTTCCGGAGGTGGCCGCGCCCCACTCACTGTCGCCTGCTTTCCACAGGGGACAAGGGCCTGTCCGACACGCCCTACGACAGCAGCGCCAGCTACGAGAAGGAGAACGAAATGATGAAGTCCCACGTGATGGACCAAGCCATCAACAACGCCATCAACTACCTGGGGGCCGAGTC25.TAAGCACAGTGAAATGGCAGAAGACCTGTGCAAGATAGCATCAGAGAGATCTCTCGTGCTGGACAGACTAGCAAGTAACGTCGCCAAACGTAAGAGCTCTATGCCTCAGAAATTTCTTGGTAAGAGTTAAATGTTTGCTGTCTCTTAAAAAAAAACTATGTCGGTGTTTTAGATGCAAGTAGAAATGAGTTGAGGGTGGAAGAAAGGGAAAAAAATCTTATTTTTTCAAAAGGAAAAATTGGTAAGCTTAACATTCCTTAAATATCTTAGAATTTTTTCCAATAAGTATCTTAAAAATAACAAACCTCCCATCAGTTTTTCCTAGATTTGATTTTGCAGCATCTCGGGCCTGCCCTGTGATCTGCCTGTGGAC26.CTC GCC AAA CGG GAC AAG GGC CTG27.V A K R D K G L


[0167]


Claims
  • 1. A nucleic acid sequence encoding at least a portion of an Ikaros protein and comprising the sequence of one or more of SEQ ID NO: 24, SEQ ID NO: 25; SEQ ID NO: 10, and SEQ ID NO: 26.
  • 2. An Ikaros peptide produced by expression of the nucleic acid sequence of claim 1.
  • 3. A method for the detection of abnormal lymphohematopoietic cells, comprising analyzing a sample of lymphoid cells for the presence of aberrantly spliced Ikaros isoforms.
  • 4. The method of claim 3, comprising analyzing said cells for Ikaros isoforms having a molecular weight of less than about 47 kDa.
  • 5. The method of claim 3, comprising analyzing said cells for Ikaros isoforms encoded at least in part by exons 6-7 and lacking the following Ikaros amino acid sequence: KSSMPQKFLG.
  • 6. The method of claim 3, comprising analyzing said cells for Ikaros isoforms having an insertion of the following amino acid sequence: VTVGADDFRDFHAIIPKSFSR.
  • 7. The method of claim 3, wherein said lymphohematopoietic cells are malignant cells.
  • 8. The method of claim 3, wherein said analyzing is by Western blot detection, and wherein an abundance of small isoforms, less than about 42 kDa, is diagnostic of lymphohematopoietic cell abnormality.
  • 9. The method of claim 3, wherein said analyzing is by confocal light microscopy, and wherein a diffuse, cytoplasmic localization of Ikaros protein is diagnostic of lymphohematopoietic cell abnormality.
  • 10. The method of claim 3, wherein said cells are analyzed for expression of Ikaros isoforms, and wherein an abundance of dominant negative isoforms is diagnostic of lymphohematopoietic cell abnormality.
  • 11. The method of claim 10, wherein expression of Ikaros isoforms Ik-4, Ik-6, Ik-7, Ik-8, or a combination thereof, is correlated with lymphohematopoietic cell abnormality.
  • 12. The method of claim 3, wherein said analyzing comprises amplification of Ikaros coding sequences.
  • 13. The method of claim 3, wherein said analyzing comprises immunoreaction with anti-Ikaros antibodies.
  • 14. The method of claim 3, wherein said abnormality is leukemia or lymphoma.
  • 15. A method for the detection of hematologic malignancy, the method comprising: analyzing a sample of hematologic cells for expression of Ikaros protein isoforms; and correlating the expression of dominant negative Ikaros isoforms with hematologic malignancy.
  • 16. The method of claim 15, wherein said malignancy is lymphoma.
  • 17. The method of claim 15, wherein said malignancy is non-Hodgkin's lymphoma.
  • 18. The method of claim 15, wherein said malignancy is Hodgkin's lymphoma.
  • 19. The method of claim 15, wherein said malignancy is selected from common ALL, T-ALL, infant-ALL, or AML.
  • 20. A method for the treatment of hematologic malignancy, said method comprising expressing in hematologic cells an increased amount of Ik-1 or Ik-2, said expression increased as compared with a non-treated control.
  • 21. A method for the diagnosis of cancer cells, comprising analyzing a cell sample for expression of non-DNA binding Ikaros protein isoforms; and correlating the expression of non-DNA binding Ikaros isoforms with hematologic malignancy.
  • 22. (New) A method of treating a hematological cell having a lymphoid disease characterized by a reduced amount of Ikaros-1, Ikaros-2, Ikaros-3, or some combination thereof in the hematological cell as compared with a normal hematological cell comprising administering Ikaros-1, Ikaros-2, Ikaros-3, or some combination thereof to the hematological cell.
  • 23. (New) The method of claim 22, wherein the lymphoid disease involves T-cells or B-cells.
  • 24. (New) The method of claim 22, wherein the lymphoid disease is stem cell leukemia, T-cell acute lymphoblastic leukemia, B-cell acute lymphoblastic leukemia, or secondary leukemia.
  • 25. The method of claim 22, wherein said step of administering comprises administering Ikaros-1, Ikaros-2, or some combination thereof.
Provisional Applications (1)
Number Date Country
60107229 Nov 1998 US
Divisions (1)
Number Date Country
Parent 09435327 Nov 1999 US
Child 10395011 Mar 2003 US