Imageable animal model of SARS infection

TECHNICAL FIELD

The invention relates to a model for coronavirus infection. More particularly, it concerns animals infected with coronavirus that has been labeled with fluorescent protein.

BACKGROUND ART

Recently, a worldwide outbreak of Severe Acute Respiratory Syndrome (SARS) has caused a substantial number of deaths, disrupted travel plans, and placed thousands of people under quarantine. In fairly short order, using clinical specimens from patients in six countries, it was established that the infection is caused by a coronavirus. See, for example, Ksiazek, T. G., et al., New England J. Med. (2003) 348:1947-1958.

The members of the coronavirus family contain positive-sense RNA genomes of about 30 kb that cause respiratory or intestinal infections in a number of different species. See, for example, de Haan, C. A. M., et al., Virology (2002) 296:177-189. Based on antigenic and genetic criteria, they have been divided into three groups. The common feature of coronaviruses are essential genes encoding replication and structural functions. Interspersed among these genes are group-specific open reading frames (ORFs) that are homologous within each group but that differ among the groups.

The predominant essential gene (ORF) occupies about two-thirds of the genome and is located at the 5′ end of the genome. This gene is a replicase gene that encodes two large precursors, which are cleaved into products for RNA replication and transcription. The other common essential genes code for the four basic structural proteins N, M, E, and S. The nucleocapsid (N) protein packages the viral RNA, forming the core of the virion. This nucleocapsid core structure is surrounded by a lipid envelope in which the membrane (M) protein is most abundant. The small envelope (E) protein and the spike (S) protein are associated with the M protein. The S protein forms the viral peplomers that are involved in virus-cell and cell-cell fusion. These genes are located in the 3′ third of the viral genome. The identities and the locations of the group-specific genes vary, and all their functions have not yet been established. Group 2 viruses, to which mouse hepatitis virus (MHV) belongs, have two group-specific genes, gene 2a and a hemagglutinin-esterase (HE) ORF between ORF 1b and the S gene. Two additional group 2-specific genes, genes 4 and 5a, reside between the S and E genes.

MHV has a single-stranded, positive-sense RNA genome of approximately 31 kb. See, Kim, K. H., et al., J. Virol. (1995) 69:2313-2321. The 5′ end of the MHV genomic RNA contains a 72- to 77-nucleotide-long leader sequence. Downstream of the leader sequence are the MHV-specific genes, each of which is separated by a special short stretch of intergenic sequence. MHV infected cells produce seven major species of virus-specific subgenomic mRNAs. The coronavirus mRNAs are structurally polycistronic, yet produce monocistronic proteins. The coronavirus mRNAs share 3′ ends in a nested-set structure wherein each mRNA is progressively one gene longer than its 3′-neighboring gene, and only the 5′-most gene of each mRNA is translated. These subgenomic mRNAs are named according to their decreasing order of size from 1 to 7. The mRNA sequences are fused with leader sequence at their 5′ ends.

Serial undiluted passage of MHV strain JHM in DBT cells results in generation of defective interfering (DI) RNAs that can be classified into two types. One requires helper virus infection for replication. The other DI type includes DIssA, which is nearly genomic in size, replicates by itself in the absence of helper virus infection, and is packaged into MHV particles Almost all MHV mRNA synthesis is strongly inhibited in DIssA-replicating cells, whereas synthesis of mRNA 7 and its product, N protein, are not inhibited. RNase T1 oligonucleotide fingerprinting analysis of DIssA demonstrate that gene 1 and gene 7 of DIssA are essentially intact, whereas multiple deletions are present from genes 2 to 6. mRNA 7 is synthesized from DIssA template RNA but not from helper virus template RNA, and the gene 1 products and N protein are sufficient for the MHV RNA synthesis.

Thus, it will be sufficient to monitor replication if the DI type DIssA can be labeled. This is the approach illustrated in the present invention.

Fluorescent proteins have been used as fluorescent labels for a number of years. The originally isolated protein emitted green wavelengths and came to be called green fluorescent protein (GFP). Because of this, green fluorescent protein became a generic label for such fluorescent proteins in general, although proteins of various colors including red fluorescent protein (RFP), blue fluorescent protein (BFP) and yellow fluorescent protein (YFP) among others have been prepared. The nature of these proteins is discussed in, for example, U.S. Pat. Nos. 6,232,523; 6,235,967; 6,235,968; and 6,251,384 all incorporated herein by reference. These patents describe the use of fluorescent proteins of various colors to monitor tumor growth and metastasis in transgenic rodents which are convenient tumor models. In addition, these fluorescent proteins have been used to monitor expression mediated by promoters in U.S. application Ser. No. 09/812,710; to monitor infection by bacteria in U.S. Ser. No. 10/192,740 and to monitor cell sorting in U.S. provisional application 60/425,776. The use of fluorescent proteins of different colors to label the nucleus and cytoplasm of cells is disclosed in U.S. provisional applications 60/404,005 and 60/427,604 and mice which are labeled in all tissues, and thus have a consistent fluorescence of the same color are described in U.S. provisional application 60/445,583. All of these documents are incorporated herein by reference.

DISCLOSURE OF THE INVENTION

The invention provides an animal model wherein fluorescent labeled coronavirus are used to infect susceptible animal subjects, preferably rodents or rabbits, wherein the progress of infection—i.e., the replication of the coronavirus can be followed by monitoring the fluorescence. In a preferred embodiment, the animal is a transgenic animal which comprises tissues that fluoresce in a first color against which the fluorescence of the replicating coronavirus can be readily visualized. The model can be used to determine the effectiveness of vaccines and drugs by viewing, directly, the progress of infection with and without treatment or vaccination. The invention is illustrated below using the DIssA specific sequence from MHV as a model.

Thus, in one aspect, the invention is directed to a coronavirus labeled with a fluorescent protein such as GFP or RFP. In another aspect, the invention is directed to an animal infected with the labeled virus. In still another aspect, the invention is directed to methods to monitor the progress of infection, to evaluate the effectiveness of antiviral drugs, and to evaluate the effects of the vaccines using the animal models of the invention.

MODES OF CARRYING OUT THE INVENTION

The tools useful in the present invention are described in the U.S. patents and patent applications incorporated by reference above. Whole body imaging, the nature of fluorescent proteins useful in the invention, and methods to label entire animals have been described in these documents.

The disclosed method applicable to coronavirus of the various groups in the coronavirus family. Although in the illustrative example the virus is labeled with RFP and is viewed against a background of a nude mouse expressing GFP in all its tissues, neither the choice of these particular colors nor the use of a labeled animal as a subject is required.

Recombinant Coronavirus

The disclosed invention uses recombinant coronaviruses that are engineered to express a marker, such as a fluorescent protein. By infecting a model organism with the described recombinant coronavirus, one of ordinary skill in the art can use the recombinant virus to study the progression of viral replication in the host animal. Furthermore, the recombinant coronavirus model system has utility as an assay for identifying antiviral agents that slow or inhibit coronavirus replication.

Work by Cornelis, et al. has demonstrated that coronaviruses can by recombinantly engineered to express foreign genes without severe effects on viral replication. Cornelis, et al., J. Virol. (2003) 77(21):11312-11323, which is hereby incorporated by reference in its entirety. The results of this study suggest that position of the foreign gene within the viral genome may impact the viral replication of the recombinant virus vector. Specifically, Cornelis and coworkers observed that expression levels of the foreign gene increased when the foreign gene was inserted closer to the 3′ end of the viral genome. As such, in preferred embodiments of the invention, placement of the fluorescent protein coding sequence occurs toward the 3′ end of the viral genome.

Cornelis and coworkers utilized a murine coronavirus model for their study. The sequence of this virus is well known in the art. At least one variant of the human SARS virus has been sequenced. Marra, M. A., et al., “The Genome sequence of the SARS-associated coronavirus” Science 300 (5624), 1399-1404 (2003). This sequence is publicly available as Accession: NC 004718. The genomic sequence of this SARS variant is provided herein as SEQ ID NO: XX of Table I.

TABLE I(SEQ ID NO: XX)1atattaggtt tttacctacc caggaaaagc caaccaacctcgatctcttg tagatctgtt61ctctaaacga actttaaaat ctgtgtagct gtcgctcggctgcatgccta gtgcacctac121gcagtataaa caataataaa ttttactgtc gttgacaagaaacgagtaac tcgtccctct181tctgcagact gcttacggtt tcgtccgtgt tgcagtcgatcatcagcata cctaggtttc241gtccgggtgt gaccgaaagg taagatggag agccttgttcttggtgtcaa cgagaaaaca301cacgtccaac tcagtttgcc tgtccttcag gttagagacgtgctagtgcg tggcttcggg361gactctgtgg aagaggccct atcggaggca cgtgaacacctcaaaaatgg cacttgtggt421ctagtagagc tggaaaaagg cgtactgccc cagcttgaacagccctatgt gttcattaaa481cgttctgatg ccttaagcac caatcacggc cacaaggtcgttgagctggt tgcagaaatg541gacggcattc agtacggtcg tagcggtata acactgggagtactcgtgcc acatgtgggc601gaaaccccaa ttgcataccg caatgttctt cttcgtaagaacggtaataa gggagccggt661ggtcatagct atggcatcga tctaaagtct tatgacttaggtgacgagct tggcactgat721cccattgaag attatgaaca aaactggaac actaagcatggcagtggtgc actccgtgaa781ctcactcgtg agctcaatgg aggtgcagtc actcgctatgtcgacaacaa tttctgtggc841ccagatgggt accctcttga ttgcatcaaa gattttctcgcacgcgcggg caagtcaatg901tgcactcttt ccgaacaact tgattacatc gagtcgaagagaggtgtcta ctgctgccgt961gaccatgagc atgaaattgc ctggttcact gagcgctctgataagagcta cgagcaccag1021acacccttcg aaattaagag tgccaagaaa tttgacactttcaaagggga atgcccaaag1081tttgtgtttc ctcttaactc aaaagtcaaa gtcattcaaccacgtgttga aaagaaaaag1141actgagggtt tcatggggcg tatacgctct gtgtaccctgttgcatctcc acaggagtgt1201aacaatatgc acttgtctac cttgatgaaa tgtaatcattgcgatgaagt ttcatggcag1261acgtgcgact ttctgaaagc cacttgtgaa cattgtggcactgaaaattt agttattgaa1321ggacctacta catgtgggta cctacctact aatgctgtagtgaaaatgcc atgtcctgcc1381tgtcaagacc cagagattgg acctgagcat agtgttgcagattatcacaa ccactcaaac1441attgaaactc gactccgcaa gggaggtagg actagatgttttggaggctg tgtgtttgcc1501tatgttggct gctataataa gcgtgcctac tgggttcctcgtgctagtgc tgatattggc1561tcaggccata ctggcattac tggtgacaat gtggagaccttgaatgagga tctccttgag1621atactgagtc gtgaacgtgt taacattaac attgttggcgattttcattt gaatgaagag1681gttgccatca ttttggcatc tttctctgct tctacaagtgcctttattga cactataaag1741agtcttgatt acaagtcttt caaaaccatt gttgagtcctgcggtaacta taaagttacc1801aagggaaagc ccgtaaaagg tgcttggaac attggacaacagagatcagt tttaacacca1861ctgtgtggtt ttccctcaca ggctgctggt gttatcagatcaatttttgc gcgcacactt1921gatgcagcaa accactcaat tcctgatttg caaagagcagctgtcaccat acttgatggt1981atttctgaac agtcattacg tcttgtcgac gccatggtttatacttcaga cctgctcacc2041aacagtgtca ttattatggc atatgtaact ggtggtcttgtacaacagac ttctcagtgg2101ttgtctaatc ttttgggcac tactgttgaa aaactcaggcctatctttga atggattgag2161gcgaaactta gtgcaggagt tgaatttctc aaggatgcttgggagattct caaatttctc2221attacaggtg tttttgacat cgtcaagggt caaatacaggttgcttcaga taacatcaag2281gattgtgtaa aatgcttcat tgatgttgtt aacaaggcactcgaaatgtg cattgatcaa2341gtcactatcg ctggcgcaaa gttgcgatca ctcaacttaggtgaagtctt catcgctcaa2401agcaagggac tttaccgtca gtgtatacgt ggcaaggagcagctgcaact actcatgcct2461cttaaggcac caaaagaagt aacctttctt gaaggtgattcacatgacac agtacttacc2521tctgaggagg ttgttctcaa gaacggtgaa ctcgaagcactcgagacgcc cgttgatagc2581ttcacaaatg gagctatcgt tggcacacca gtctgtgtaaatggcctcat gctcttagag2641attaaggaca aagaacaata ctgcgcattg tctcctggtttactggctac aaacaatgtc2701tttcgcttaa aagggggtgc accaattaaa ggtgtaacctttggagaaga tactgtttgg2761gaagttcaag gttacaagaa tgtgagaatc acatttgagcttgatgaacg tgttgacaaa2821gtgcttaatg aaaagtgctc tgtctacact gttgaatccggtaccgaagt tactgagttt2881gcatgtgttg tagcagaggc tgttgtgaag actttacaaccagtttctga tctccttacc2941aacatgggta ttgatcttga tgagtggagt gtagctacattctacttatt tgatgatgct3001ggtgaagaaa acttttcatc acgtatgtat tgttccttttaccctccaga tgaggaagaa3061gaggacgatg cagagtgtga ggaagaagaa attgatgaaacctgtgaaca tgagtacggt3121acagaggatg attatcaagg tctccctctg gaatttggtgcctcagctga aacagttcga3181gttgaggaag aagaagagga agactggctg gatgatactactgagcaatc agagattgag3241ccagaaccag aacctacacc tgaagaacca gttaatcagtttactggtta tttaaaactt3301actgacaatg ttgccattaa atgtgttgac atcgttaaggaggcacaaag tgctaatcct3361atggtgattg taaatgctgc taacatacac ctgaaacatggtggtggtgt agcaggtgca3421ctcaacaagg caaccaatgg tgccatgcaa aaggagagtgatgattacat taagctaaat3481ggccctctta cagtaggagg gtcttgtttg ctttctggacataatcttgc taagaagtgt3541ctgcatgttg ttggacctaa cctaaatgca ggtgaggacatccagcttct taaggcagca3601tatgaaaatt tcaattcaca ggacatctta cttgcaccattgttgtcagc aggcatattt3661ggtgctaaac cacttcagtc tttacaagtg tgcgtgcagacggttcgtac acaggtttat3721attgcagtca atgacaaagc tctttatgag caggttgtcatggattatct tgataacctg3781aagcctagag tggaagcacc taaacaagag gagccaccaaacacagaaga ttccaaaact3841gaggagaaat ctgtcgtaca gaagcctgtc gatgtgaagccaaaaattaa ggcctgcatt3901gatgaggtta ccacaacact ggaagaaact aagtttcttaccaataagtt actcttgttt3961gctgatatca atggtaagct ttaccatgat tctcagaacatgcttagagg tgaagatatg4021tctttccttg agaaggatgc accttacatg gtaggtgatgttatcactag tggtgatatc4081acttgtgttg taataccctc caaaaaggct ggtggcactactgagatgct ctcaagagct4141ttgaagaaag tgccagttga tgagtatata accacgtaccctggacaagg atgtgctggt4201tatacacttg aggaagctaa gactgctctt aagaaatgcaaatctgcatt ttatgtacta4261ccttcagaag cacctaatgc taaggaagag attctaggaactgtatcctg gaatttgaga4321gaaatgcttg ctcatgctga agagacaaga aaattaatgcctatatgcat ggatgttaga4381gccataatgg caaccatcca acgtaagtat aaaggaattaaaattcaaga gggcatcgtt4441gactatggtg tccgattctt cttttatact agtaaagagcctgtagcttc tattattacg4501aagctgaact ctctaaatga gccgcttgtc acaatgccaattggttatgt gacacatggt4561tttaatcttg aagaggctgc gcgctgtatg cgttctcttaaagctcctgc cgtagtgtca4621gtatcatcac cagatgctgt tactacatat aatggatacctcacttcgtc atcaaagaca4681tctgaggagc actttgtaga aacagtttct ttggctggctcttacagaga ttggtcctat4741tcaggacagc gtacagagtt aggtgttgaa tttcttaagcgtggtgacaa aattgtgtac4801cacactctgg agagccccgt cgagtttcat cttgacggtgaggttctttc acttgacaaa4861ctaaagagtc tcttatccct gcgggaggtt aagactataaaagtgttcac aactgtggac4921aacactaatc tccacacaca gcttgtggat atgtctatgacatatggaca gcagtttggt4981ccaacatact tggatggtgc tgatgttaca aaaattaaacctcatgtaaa tcatgagggt5041aagactttct ttgtactacc tagtgatgac acactacgtagtgaagcttt cgagtactac5101catactcttg atgagagttt tcttggtagg tacatgtctgctttaaacca cacaaagaaa5161tggaaatttc ctcaagttgg tggtttaact tcaattaaatgggctgataa caattgttat5221ttgtctagtg ttttattagc acttcaacag cttgaagtcaaattcaatgc accagcactt5281caagaggctt attatagagc ccgtgctggt gatgctgctaacttttgtgc actcatactc5341gcttacagta ataaaactgt tggcgagctt ggtgatgtcagagaaactat gacccatctt5401ctacagcatg ctaatttgga atctgcaaag cgagttcttaatgtggtgtg taaacattgt5461ggtcagaaaa ctactacctt aacgggtgta gaagctgtgatgtatatggg tactctatct5521tatgataatc ttaagacagg tgtttccatt ccatgtgtgtgtggtcgtga tgctacacaa5581tatctagtac aacaagagtc ttcttttgtt atgatgtctgcaccacctgc tgagtataaa5641ttacagcaag gtacattctt atgtgcgaat gagtacactggtaactatca gtgtggtcat5701tacactcata taactgctaa ggagaccctc tatcgtattgacggagctca ccttacaaag5761atgtcagagt acaaaggacc agtgactgat gttttctacaaggaaacatc ttacactaca5821accatcaagc ctgtgtcgta taaactcgat ggagttacttacacagagat tgaaccaaaa5881ttggatgggt attataaaaa ggataatgct tactatacagagcagcctat agaccttgta5941ccaactcaac cattaccaaa tgcgagtttt gataatttcaaactcacatg ttctaacaca6001aaatttgctg atgatttaaa tcaaatgaca ggcttcacaaagccagcttc acgagagcta6061tctgtcacat tcttcccaga cttgaatggc gatgtagtggctattgacta tagacactat6121tcagcgagtt tcaagaaagg tgctaaatta ctgcataagccaattgtttg gcacattaac6181caggctacaa ccaagacaac gttcaaacca aacacttggtgtttacgttg tctttggagt6241acaaagccag tagatacttc aaattcattt gaagttctggcagtagaaga cacacaagga6301atggacaatc ttgcttgtga aagtcaacaa cccacctctgaagaagtagt ggaaaatcct6361accatacaga aggaagtcat agagtgtgac gtgaaaactaccgaagttgt aggcaatgtc6421atacttaaac catcagatga aggtgttaaa gtaacacaagagttaggtca tgaggatctt6481atggctgctt atgtggaaaa cacaagcatt accattaagaaacctaatga gctttcacta6541gccttaggtt taaaaacaat tgccactcat ggtattgctgcaattaatag tgttccttgg6601agtaaaattt tggcttatgt caaaccattc ttaggacaagcagcaattac aacatcaaat6661tgcgctaaga gattagcaca acgtgtgttt aacaattatatgccttatgt gtttacatta6721ttgttccaat tgtgtacttt tactaaaagt accaattctagaattagagc ttcactacct6781acaactattg ctaaaaatag tgttaagagt gttgctaaattatgtttgga tgccggcatt6841aattatgtga agtcacccaa attttctaaa ttgttcacaatcgctatgtg gctattgttg6901ttaagtattt gcttaggttc tctaatctgt gtaactgctgcttttggtgt actcttatct6961aattttggtg ctccttctta ttgtaatggc gttagagaattgtatcttaa ttcgtctaac7021gttactacta tggatttctg tgaaggttct tttccttgcagcatttgttt aagtggatta7081gactcccttg attcttatcc agctcttgaa accattcaggtgacgatttc atcgtacaag7141ctagacttga caattttagg tctggccgct gagtgggttttggcatatat gttgttcaca7201aaattctttt atttattagg tctttcagct ataatgcaggtgttctttgg ctattttgct7261agtcatttca tcagcaattc ttggctcatg tggtttatcattagtattgt acaaatggca7321cccgtttctg caatggttag gatgtacatc ttctttgcttctttctacta catatggaag7381agctatgttc atatcatgga tggttgcacc tcttcgacttgcatgatgtg ctataagcgc7441aatcgtgcca cacgcgttga gtgtacaact attgttaatggcatgaagag atctttctat7501gtctatgcaa atggaggccg tggcttctgc aagactcacaattggaattg tctcaattgt7561gacacatttt gcactggtag tacattcatt agtgatgaagttgctcgtga tttgtcactc7621cagtttaaaa gaccaatcaa ccctactgac cagtcatcgtatattgttga tagtgttgct7681gtgaaaaatg gcgcgcttca cctctacttt gacaaggctggtcaaaagac ctatgagaga7741catccgctct cccattttgt caatttagac aatttgagagctaacaacac taaaggttca7801ctgcctatta atgtcatagt ttttgatggc aagtccaaatgcgacgagtc tgcttctaag7861tctgcttctg tgtactacag tcagctgatg tgccaacctattctgttgct tgaccaagct7921cttgtatcag acgttggaga tagtactgaa gtttccgttaagatgtttga tgcttatgtc7981gacacctttt cagcaacttt tagtgttcct atggaaaaacttaaggcact tgttgctaca8041gctcacagcg agttagcaaa gggtgtagct ttagatggtgtcctttctac attcgtgtca8101gctgcccgac aaggtgttgt tgataccgat gttgacacaaaggatgttat tgaatgtctc8161aaactttcac atcactctga cttagaagtg acaggtgacagttgtaacaa tttcatgctc8221acctataata aggttgaaaa catgacgccc agagatcttggcgcatgtat tgactgtaat8281gcaaggcata tcaatgccca agtagcaaaa agtcacaatgtttcactcat ctggaatgta8341aaagactaca tgtctttatc tgaacagctg cgtaaacaaattcgtagtgc tgccaagaag8401aacaacatac cttttagact aacttgtgct acaactagacaggttgtcaa tgtcataact8461actaaaatct cactcaaggg tggtaagatt gttagtacttgttttaaact tatgcttaag8521gccacattat tgtgcgttct tgctgcattg gtttgttatatcgttatgcc agtacataca8581ttgtcaatcc atgatggtta cacaaatgaa atcattggttacaaagccat tcaggatggt8641gtcactcgtg acatcatttc tactgatgat tgttttgcaaataaacatgc tggttttgac8701gcatggttta gccagcgtgg tggttcatac aaaaatgacaaaagctgccc tgtagtagct8761gctatcatta caagagagat tggtttcata gtgcctggcttaccgggtac tgtgctgaga8821gcaatcaatg gtgacttctt gcattttcta cctcgtgtttttagtgctgt tggcaacatt8881tgctacacac cttccaaact cattgagtat agtgattttgctacctctgc ttgcgttctt8941gctgctgagt gtacaatttt taaggatgct atgggcaaacctgtgccata ttgttatgac9001actaatttgc tagagggttc tatttcttat agtgagcttcgtccagacac tcgttatgtg9061cttatggatg gttccatcat acagtttcct aacacttacctggagggttc tgttagagta9121gtaacaactt ttgatgctga gtactgtaga catggtacatgcgaaaggtc agaagtaggt9181atttgcctat ctaccagtgg tagatgggtt cttaataatgagcattacag agctctatca9241ggagttttct gtggtgttga tgcgatgaat ctcatagctaacatctttac tcctcttgtg9301caacctgtgg gtgctttaga tgtgtctgct tcagtagtggctggtggtat tattgccata9361ttggtgactt gtgctgccta ctactttatg aaattcagacgtgtttttgg tgagtacaac9421catgttgttg ctgctaatgc acttttgttt ttgatgtctttcactatact ctgtctggta9481ccagcttaca gctttctgcc gggagtctac tcagtcttttacttgtactt gacattctat9541ttcaccaatg atgtttcatt cttggctcac cttcaatggtttgccatgtt ttctcctatt9601gtgccttttt ggataacagc aatctatgta ttctgtatttctctgaagca ctgccattgg9661ttctttaaca actatcttag gaaaagagtc atgtttaatggagttacatt tagtaccttc9721gaggaggctg ctttgtgtac ctttttgctc aacaaggaaatgtacctaaa attgcgtagc9781gagacactgt tgccacttac acagtataac aggtatcttgctctatataa caagtacaag9841tatttcagtg gagccttaga tactaccagc tatcgtgaagcagcttgctg ccacttagca9901aaggctctaa atgactttag caactcaggt gctgatgttctctaccaacc accacagaca9961tcaatcactt ctgctgttct gcagagtggt tttaggaaaatggcattccc gtcaggcaaa10021gttgaagggt gcatggtaca agtaacctgt ggaactacaactcttaatgg attgtggttg10081gatgacacag tatactgtcc aagacatgtc atttgcacagcagaagacat gcttaatcct10141aactatgaag atctgctcat tcgcaaatcc aaccatagctttcttgttca ggctggcaat10201gttcaacttc gtgttattgg ccattctatg caaaattgtctgcttaggct taaagttgat10261acttctaacc ctaagacacc caagtataaa tttgtccgtatccaacctgg tcaaacattt10321tcagttctag catgctacaa tggttcacca tctggtgtttatcagtgtgc catgagacct10381aatcatacca ttaaaggttc tttccttaat ggatcatgtggtagtgttgg ttttaacatt10441gattatgatt gcgtgtcttt ctgctatatg catcatatggagcttccaac aggagtacac10501gctggtactg acttagaagg taaattctat ggtccatttgttgacagaca aactgcacag10561gctgcaggta cagacacaac cataacatta aatgttttggcatggctgta tgctgctgtt10621atcaatggtg ataggtggtt tcttaataga ttcaccactactttgaatga ctttaacctt10681gtggcaatga agtacaacta tgaacctttg acacaagatcatgttgacat attgggacct10741ctttctgctc aaacaggaat tgccgtctta gatatgtgtgctgctttgaa agagctgctg10801cagaatggta tgaatggtcg tactatcctt ggtagcactattttagaaga tgagtttaca10861ccatttgatg ttgttagaca atgctctggt gttaccttccaaggtaagtt caagaaaatt10921gttaagggca ctcatcattg gatgctttta actttcttgacatcactatt gattcttgtt10981caaagtacac agtggtcact gtttttcttt gtttacgagaatgctttctt gccatttact11041cttggtatta tggcaattgc tgcatgtgct atgctgcttgttaagcataa gcacgcattc11101ttgtgcttgt ttctgttacc ttctcttgca acagttgcttactttaatat ggtctacatg11161cctgctagct gggtgatgcg tatcatgaca tggcttgaattggctgacac tagcttgtct11221ggttataggc ttaaggattg tgttatgtat gcttcagctttagttttgct tattctcatg11281acagctcgca ctgtttatga tgatgctgct agacgtgtttggacactgat gaatgtcatt11341acacttgttt acaaagtcta ctatggtaat gctttagatcaagctatttc catgtgggcc11401ttagttattt ctgtaacctc taactattct ggtgtcgttacgactatcat gtttttagct11461agagctatag tgtttgtgtg tgttgagtat tacccattgttatttattac tggcaacacc11521ttacagtgta tcatgcttgt ttattgtttc ttaggctattgttgctgctg ctactttggc11581cttttctgtt tactcaaccg ttacttcagg cttactcttggtgtttatga ctacttggtc11641tctacacaag aatttaggta tatgaactcc caggggcttttgcctcctaa gagtagtatt11701gatgctttca agcttaacat taagttgttg ggtattggaggtaaaccatg tatcaaggtt11761gctactgtac agtctaaaat gtctgacgta aagtgcacatctgtggtact gctctcggtt11821cttcaacaac ttagagtaga gtcatcttct aaattgtgggcacaatgtgt acaactccac11881aatgatattc ttcttgcaaa agacacaact gaagctttcgagaagatggt ttctcttttg11941tctgttttgc tatccatgca gggtgctgta gacattaataggttgtgcga ggaaatgctc12001gataaccgtg ctactcttca ggctattgct tcagaatttagttctttacc atcatatgcc12061gcttatgcca ctgcccagga ggcctatgag caggctgtagctaatggtga ttctgaagtc12121gttctcaaaa agttaaagaa atctttgaat gtggctaaatctgagtttga ccgtgatgct12181gccatgcaac gcaagttgga aaagatggca gatcaggctatgacccaaat gtacaaacag12241gcaagatctg aggacaagag ggcaaaagta actagtgctatgcaaacaat gctcttcact12301atgcttagga agcttgataa tgatgcactt aacaacattatcaacaatgc gcgtgatggt12361tgtgttccac tcaacatcat accattgact acagcagccaaactcatggt tgttgtccct12421gattatggta cctacaagaa cacttgtgat ggtaacacctttacatatgc atctgcactc12481tgggaaatcc agcaagttgt tgatgcggat agcaagattgttcaacttag tgaaattaac12541atggacaatt caccaaattt ggcttggcct cttattgttacagctctaag agccaactca12601gctgttaaac tacagaataa tgaactgagt ccagtagcactacgacagat gtcctgtgcg12661gctggtacca cacaaacagc ttgtactgat gacaatgcacttgcctacta taacaattcg12721aagggaggta ggtttgtgct ggcattacta tcagaccaccaagatctcaa atgggctaga12781ttccctaaga gtgatggtac aggtacaatt tacacagaactggaaccacc ttgtaggttt12841gttacagaca caccaaaagg gcctaaagtg aaatacttgtacttcatcaa aggcttaaac12901aacctaaata gaggtatggt gctgggcagt ttagctgctacagtacgtct tcaggctgga12961aatgctacag aagtacctgc caattcaact gtgctttccttctgtgcttt tgcagtagac13021cctgctaaag catataagga ttacctagca agtggaggacaaccaatcac caactgtgtg13081aagatgttgt gtacacacac tggtacagga caggcaattactgtaacacc agaagctaac13141atggaccaag agtcctttgg tggtgcttca tgttgtctgtattgtagatg ccacattgac13201catccaaatc ctaaaggatt ctgtgacttg aaaggtaagtacgtccaaat acctaccact13261tgtgctaatg acccagtggg ttttacactt agaaacacagtctgtaccgt ctgcggaatg13321tggaaaggtt atggctgtag ttgtgaccaa ctccgcgaacccttgatgca gtctgcggat13381gcatcaacgt ttttaaacgg gtttgcggtg taagtgcagcccgtcttaca ccgtgcggca13441caggcactag tactgatgtc gtctacaggg cttttgatatttacaacgaa aaagttgctg13501gttttgcaaa gttcctaaaa actaattgct gtcgcttccaggagaaggat gaggaaggca13561atttattaga ctcttacttt gtagttaaga ggcatactatgtctaactac caacatgaag13621agactattta taacttggtt aaagattgtc cagcggttgctgtccatgac tttttcaagt13681ttagagtaga tggtgacatg gtaccacata tatcacgtcagcgtctaact aaatacacaa13741tggctgattt agtctatgct ctacgtcatt ttgatgagggtaattgtgat acattaaaag13801aaatactcgt cacatacaat tgctgtgatg atgattatttcaataagaag gattggtatg13861acttcgtaga gaatcctgac atcttacgcg tatatgctaacttaggtgag cgtgtacgcc13921aatcattatt aaagactgta caattctgcg atgctatgcgtgatgcaggc attgtaggcg13981tactgacatt agataatcag gatcttaatg ggaactggtacgatttcggt gatttcgtac14041aagtagcacc aggctgcgga gttcctattg tggattcatattactcattg ctgatgccca14101tcctcacttt gactagggca ttggctgctg agtcccatatggatgctgat ctcgcaaaac14161cacttattaa gtgggatttg ctgaaatatg attttacggaagagagactt tgtctcttcg14221accgttattt taaatattgg gaccagacat accatcccaattgtattaac tgtttggatg14281ataggtgtat ccttcattgt gcaaacttta atgtgttattttctactgtg tttccaccta14341caagttttgg accactagta agaaaaatat ttgtagatggtgttcctttt gttgtttcaa14401ctggatacca ttttcgtgag ttaggagtcg tacataatcaggatgtaaac ttacatagct14461cgcgtctcag tttcaaggaa cttttagtgt atgctgctgatccagctatg catgcagctt14521ctggcaattt attgctagat aaacgcacta catgcttttcagtagctgca ctaacaaaca14581atgttgcttt tcaaactgtc aaacccggta attttaataaagacttttat gactttgctg14641tgtctaaagg tttctttaag gaaggaagtt ctgttgaactaaaacacttc ttctttgctc14701aggatggcaa cgctgctatc agtgattatg actattatcgttataatctg ccaacaatgt14761gtgatatcag acaactccta ttcgtagttg aagttgttgataaatacttt gattgttacg14821atggtggctg tattaatgcc aaccaagtaa tcgttaacaatctggataaa tcagctggtt14881tcccatttaa taaatggggt aaggctagac tttattatgactcaatgagt tatgaggatc14941aagatgcact tttcgcgtat actaagcgta atgtcatccctactataact caaatgaatc15001ttaagtatgc cattagtgca aagaatagag ctcgcaccgtagctggtgtc tctatctgta15061gtactatgac aaatagacag tttcatcaga aattattgaagtcaatagcc gccactagag15121gagctactgt ggtaattgga acaagcaagt tttacggtggctggcataat atgttaaaaa15181ctgtttacag tgatgtagaa actccacacc ttatgggttgggattatcca aaatgtgaca15241gagccatgcc taacatgctt aggataatgg cctctcttgttcttgctcgc aaacataaca15301cttgctgtaa cttatcacac cgtttctaca ggttagctaacgagtgtgcg caagtattaa15361gtgagatggt catgtgtggc ggctcactat atgttaaaccaggtggaaca tcatccggtg15421atgctacaac tgcttatgct aatagtgtct ttaacatttgtcaagctgtt acagccaatg15481taaatgcact tctttcaact gatggtaata agatagctgacaagtatgtc cgcaatctac15541aacacaggct ctatgagtgt ctctatagaa atagggatgttgatcatgaa ttcgtggatg15601agttttacgc ttacctgcgt aaacatttct ccatgatgattctttctgat gatgccgttg15661tgtgctataa cagtaactat gcggctcaag gtttagtagctagcattaag aactttaagg15721cagttcttta ttatcaaaat aatgtgttca tgtctgaggcaaaatgttgg actgagactg15781accttactaa aggacctcac gaattttgct cacagcatacaatgctagtt aaacaaggag15841atgattacgt gtacctgcct tacccagatc catcaagaatattaggcgca ggctgttttg15901tcgatgatat tgtcaaaaca gatggtacac ttatgattgaaaggttcgtg tcactggcta15961ttgatgctta cccacttaca aaacatccta atcaggagtatgctgatgtc tttcacttgt16021atttacaata cattagaaag ttacatgatg agcttactggccacatgttg gacatgtatt16081ccgtaatgct aactaatgat aacacctcac ggtactgggaacctgagttt tatgaggcta16141tgtacacacc acatacagtc ttgcaggctg taggtgcttgtgtattgtgc aattcacaga16201cttcacttcg ttgcggtgcc tgtattagga gaccattcctatgttgcaag tgctgctatg16261accatgtcat ttcaacatca cacaaattag tgttgtctgttaatccctat gtttgcaatg16321ccccaggttg tgatgtcact gatgtgacac aactgtatctaggaggtatg agctattatt16381gcaagtcaca taagcctccc attagttttc cattatgtgctaatggtcag gtttttggtt16441tatacaaaaa cacatgtgta ggcagtgaca atgtcactgacttcaatgcg atagcaacat16501gtgattggac taatgctggc gattacatac ttgccaacacttgtactgag agactcaagc16561ttttcgcagc agaaacgctc aaagccactg aggaaacatttaagctgtca tatggtattg16621ccactgtacg cgaagtactc tctgacagag aattgcatctttcatgggag gttggaaaac16681ctagaccacc attgaacaga aactatgtct ttactggttaccgtgtaact aaaaatagta16741aagtacagat tggagagtac acctttgaaa aaggtgactatggtgatgct gttgtgtaca16801gaggtactac gacatacaag ttgaatgttg gtgattactttgtgttgaca tctcacactg16861taatgccact tagtgcacct actctagtgc cacaagagcactatgtgaga attactggct16921tgtacccaac actcaacatc tcagatgagt tttctagcaatgttgcaaat tatcaaaagg16981tcggcatgca aaagtactct acactccaag gaccacctggtactggtaag agtcattttg17041ccatcggact tgctctctat tacccatctg ctcgcatagtgtatacggca tgctctcatg17101cagctgttga tgccctatgt gaaaaggcat taaaatatttgcccatagat aaatgtagta17161gaatcatacc tgcgcgtgcg cgcgtagagt gttttgataaattcaaagtg aattcaacac17221tagaacagta tgttttctgc actgtaaatg cattgccagaaacaactgct gacattgtag17281tctttgatga aatctctatg gctactaatt atgacttgagtgttgtcaat gctagacttc17341gtgcaaaaca ctacgtctat attggcgatc ctgctcaattaccagccccc cgcacattgc17401tgactaaagg cacactagaa ccagaatatt ttaattcagtgtgcagactt atgaaaacaa17461taggtccaga catgttcctt ggaacttgtc gccgttgtcctgctgaaatt gttgacactg17521tgagtgcttt agtttatgac aataagctaa aagcacacaaggataagtca gctcaatgct17581tcaaaatgtt ctacaaaggt gttattacac atgatgtttcatctgcaatc aacagacctc17641aaataggcgt tgtaagagaa tttcttacac gcaatcctgcttggagaaaa gctgttttta17701tctcacctta taattcacag aacgctgtag cttcaaaaatcttaggattg cctacgcaga17761ctgttgattc atcacagggt tctgaatatg actatgtcatattcacacaa actactgaaa17821cagcacactc ttgtaatgtc aaccgcttca atgtggctatcacaagggca aaaattggca17881ttttgtgcat aatgtctgat agagatcttt atgacaaactgcaatttaca agtctagaaa17941taccacgtcg caatgtggct acattacaag cagaaaatgtaactggactt tttaaggact18001gtagtaagat cattactggt cttcatccta cacaggcacctacacacctc agcgttgata18061taaagttcaa gactgaagga ttatgtgttg acataccaggcataccaaag gacatgacct18121accgtagact catctctatg atgggtttca aaatgaattaccaagtcaat ggttacccta18181atatgtttat cacccgcgaa gaagctattc gtcacgttcgtgcgtggatt ggctttgatg18241tagagggctg tcatgcaact agagatgctg tgggtactaacctacctctc cagctaggat18301tttctacagg tgttaactta gtagctgtac cgactggttatgttgacact gaaaataaca18361cagaattcac cagagttaat gcaaaacctc caccaggtgaccagtttaaa catcttatac18421cactcatgta taaaggcttg ccctggaatg tagtgcgtattaagatagta caaatgctca18481gtgatacact gaaaggattg tcagacagag tcgtgttcgtcctttgggcg catggctttg18541agcttacatc aatgaagtac tttgtcaaga ttggacctgaaagaacgtgt tgtctgtgtg18601acaaacgtgc aacttgcttt tctacttcat cagatacttatgcctgctgg aatcattctg18661tgggttttga ctatgtctat aacccattta tgattgatgttcagcagtgg ggctttacgg18721gtaaccttca gagtaaccat gaccaacatt gccaggtacatggaaatgca catgtggcta18781gttgtgatgc tatcatgact agatgtttag cagtccatgagtgctttgtt aagcgcgttg18841attggtctgt tgaataccct attataggag atgaactgagggttaattct gcttgcagaa18901aagtacaaca catggttgtg aagtctgcat tgcttgctgataagtttcca gttcttcatg18961acattggaaa tccaaaggct atcaagtgtg tgcctcaggctgaagtagaa tggaagttct19021acgatgctca gccatgtagt gacaaagctt acaaaatagaggaactcttc tattcttatg19081ctacacatca cgataaattc actgatggtg tttgtttgttttggaattgt aacgttgatc19141gttacccagc caatgcaatt gtgtgtaggt ttgacacaagagtcttgtca aacttgaact19201taccaggctg tgatggtggt agtttgtatg tgaataagcatgcattccac actccagctt19261tcgataaaag tgcatttact aatttaaagc aattgcctttcttttactat tctgatagtc19321cttgtgagtc tcatggcaaa caagtagtgt cggatattgattatgttcca ctcaaatctg19381ctacgtgtat tacacgatgc aatttaggtg gtgctgtttgcagacaccat gcaaatgagt19441accgacagta cttggatgca tataatatga tgatttctgctggatttagc ctatggattt19501acaaacaatt tgatacttat aacctgtgga atacatttaccaggttacag agtttagaaa19561atgtggctta taatgttgtt aataaaggac actttgatggacacgccggc gaagcacctg19621tttccatcat taataatgct gtttacacaa aggtagatggtattgatgtg gagatctttg19681aaaataagac aacacttcct gttaatgttg catttgagctttgggctaag cgtaacatta19741aaccagtgcc agagattaag atactcaata atttgggtgttgatatcgct gctaatactg19801taatctggga ctacaaaaga gaagccccag cacatgtatctacaataggt gtctgcacaa19861tgactgacat tgccaagaaa cctactgaga gtgcttgttcttcacttact gtcttgtttg19921atggtagagt ggaaggacag gtagaccttt ttagaaacgcccgtaatggt gttttaataa19981cagaaggttc agtcaaaggt ctaacacctt caaagggaccagcacaagct agcgtcaatg20041gagtcacatt aattggagaa tcagtaaaaa cacagtttaactactttaag aaagtagacg20101gcattattca acagttgcct gaaacctact ttactcagagcagagactta gaggatttta20161agcccagatc acaaatggaa actgactttc tcgagctcgctatggatgaa ttcatacagc20221gatataagct cgagggctat gccttcgaac acatcgtttatggagatttc agtcatggac20281aacttggcgg tcttcattta atgataggct tagccaagcgctcacaagat tcaccactta20341aattagagga ttttatccct atggacagca cagtgaaaaattacttcata acagatgcgc20401aaacaggttc atcaaaatgt gtgtgttctg tgattgatcttttacttgat gactttgtcg20461agataataaa gtcacaagat ttgtcagtga tttcaaaagtggtcaaggtt acaattgact20521atgctgaaat ttcattcatg ctttggtgta aggatggacatgttgaaacc ttctacccaa20581aactacaagc aagtcaagcg tggcaaccag gtgttgcgatgcctaacttg tacaagatgc20641aaagaatgct tcttgaaaag tgtgaccttc agaattatggtgaaaatgct gttataccaa20701aaggaataat gatgaatgtc gcaaagtata ctcaactgtgtcaatactta aatacactta20761ctttagctgt accctacaac atgagagtta ttcactttggtgctggctct gataaaggag20821ttgcaccagg tacagctgtg ctcagacaat ggttgccaactggcacacta cttgtcgatt20881cagatcttaa tgacttcgtc tccgacgcag attctactttaattggagac tgtgcaacag20941tacatacggc taataaatgg gaccttatta ttagcgatatgtatgaccct aggaccaaac21001atgtgacaaa agagaatgac tctaaagaag ggtttttcacttatctgtgt ggatttataa21061agcaaaaact agccctgggt ggttctatag ctgtaaagataacagagcat tcttggaatg21121ctgaccttta caagcttatg ggccatttct catggtggacagcttttgtt acaaatgtaa21181atgcatcatc atcggaagca tttttaattg gggctaactatcttggcaag ccgaaggaac21241aaattgatgg ctataccatg catgctaact acattttctggaggaacaca aatcctatcc21301agttgtcttc ctattcactc tttgacatga gcaaatttcctcttaaatta agaggaactg21361ctgtaatgtc tcttaaggag aatcaaatca atgatatgatttattctctt ctggaaaaag21421gtaggcttat cattagagaa aacaacagag ttgtggtttcaagtgatatt cttgttaaca21481actaaacgaa catgtttatt ttcttattat ttcttactctcactagtggt agtgaccttg21541accggtgcac cacttttgat gatgttcaag ctcctaattacactcaacat acttcatcta21601tgaggggggt ttactatcct gatgaaattt ttagatcagacactctttat ttaactcagg21661atttatttct tccattttat tctaatgtta cagggtttcatactattaat catacgtttg21721gcaaccctgt catacctttt aaggatggta tttattttgctgccacagag aaatcaaatg21781ttgtccgtgg ttgggttttt ggttctacca tgaacaacaagtcacagtcg gtgattatta21841ttaacaattc tactaatgtt gttatacgag catgtaactttgaattgtgt gacaaccctt21901tctttgctgt ttctaaaccc atgggtacac agacacatactatgatattc gataatgcat21961ttaattgcac tttcgagtac atatctgatg ccttttcgcttgatgtttca gaaaagtcag22021gtaattttaa acacttacga gagtttgtgt ttaaaaataaagatgggttt ctctatgttt22081ataagggcta tcaacctata gatgtagttc gtgatctaccttctggtttt aacactttga22141aacctatttt taagttgcct cttggtatta acattacaaattttagagcc attcttacag22201ccttttcacc tgctcaagac atttggggca cgtcagctgcagcctatttt gttggctatt22261taaagccaac tacatttatg ctcaagtatg atgaaaatggtacaatcaca gatgctgttg22321attgttctca aaatccactt gctgaactca aatgctctgttaagagcttt gagattgaca22381aaggaattta ccagacctct aatttcaggg ttgttccctcaggagatgtt gtgagattcc22441ctaatattac aaacttgtgt ccttttggag aggtttttaatgctactaaa ttcccttctg22501tctatgcatg ggagagaaaa aaaatttcta attgtgttgctgattactct gtgctctaca22561actcaacatt tttttcaacc tttaagtgct atggcgtttctgccactaag ttgaatgatc22621tttgcttctc caatgtctat gcagattctt ttgtagtcaagggagatgat gtaagacaaa22681tagcgccagg acaaactggt gttattgctg attataattataaattgcca gatgatttca22741tgggttgtgt ccttgcttgg aatactagga acattgatgctacttcaact ggtaattata22801attataaata taggtatctt agacatggca agcttaggccctttgagaga gacatatcta22861atgtgccttt ctcccctgat ggcaaacctt gcaccccacctgctcttaat tgttattggc22921cattaaatga ttatggtttt tacaccacta ctggcattggctaccaacct tacagagttg22981tagtactttc ttttgaactt ttaaatgcac cggccacggtttgtggacca aaattatcca23041ctgaccttat taagaaccag tgtgtcaatt ttaattttaatggactcact ggtactggtg23101tgttaactcc ttcttcaaag agatttcaac catttcaacaatttggccgt gatgtttctg23161atttcactga ttccgttcga gatcctaaaa catctgaaatattagacatt tcaccttgcg23221cttttggggg tgtaagtgta attacacctg gaacaaatgcttcatctgaa gttgctgttc23281tatatcaaga tgttaactgc actgatgttt ctacagcaattcatgcagat caactcacac23341cagcttggcg catatattct actggaaaca atgtattccagactcaagca ggctgtctta23401taggagctga gcatgtcgac acttcttatg agtgcgacattcctattgga gctggcattt23461gtgctagtta ccatacagtt tctttattac gtagtactagccaaaaatct attgtggctt23521atactatgtc tttaggtgct gatagttcaa ttgcttactctaataacacc attgctatac23581ctactaactt ttcaattagc attactacag aagtaatgcctgtttctatg gctaaaacct23641ccgtagattg taatatgtac atctgcggag attctactgaatgtgctaat ttgcttctcc23701aatatggtag cttttgcaca caactaaatc gtgcactctcaggtattgct gctgaacagg23761atcgcaacac acgtgaagtg ttcgctcaag tcaaacaaatgtacaaaacc ccaactttga23821aatattttgg tggttttaat ttttcacaaa tattacctgaccctctaaag ccaactaaga23881ggtcttttat tgaggacttg ctctttaata aggtgacactcgctgatgct ggcttcatga23941agcaatatgg cgaatgccta ggtgatatta atgctagagatctcatttgt gcgcagaagt24001tcaatggact tacagtgttg ccacctctgc tcactgatgatatgattgct gcctacactg24061ctgctctagt tagtggtact gccactgctg gatggacatttggtgctggc gctgctcttc24121aaataccttt tgctatgcaa atggcatata ggttcaatggcattggagtt acccaaaatg24181ttctctatga gaaccaaaaa caaatcgcca accaatttaacaaggcgatt agtcaaattc24241aagaatcact tacaacaaca tcaactgcat tgggcaagctgcaagacgtt gttaaccaga24301atgctcaagc attaaacaca cttgttaaac aacttagctctaattttggt gcaatttcaa24361gtgtgctaaa tgatatcctt tcgcgacttg ataaagtcgaggcggaggta caaattgaca24421ggttaattac aggcagactt caaagccttc aaacctatgtaacacaacaa ctaatcaggg24481ctgctgaaat cagggcttct gctaatcttg ctgctactaaaatgtctgag tgtgttcttg24541gacaatcaaa aagagttgac ttttgtggaa agggctaccaccttatgtcc ttcccacaag24601cagccccgca tggtgttgtc ttcctacatg tcacgtatgtgccatcccag gagaggaact24661tcaccacagc gccagcaatt tgtcatgaag gcaaagcatacttccctcgt gaaggtgttt24721ttgtgtttaa tggcacttct tggtttatta cacagaggaacttcttttct ccacaaataa24781ttactacaga caatacattt gtctcaggaa attgtgatgtcgttattggc atcattaaca24841acacagttta tgatcctctg caacctgagc ttgactcattcaaagaagag ctggacaagt24901acttcaaaaa tcatacatca ccagatgttg atcttggcgacatttcaggc attaacgctt24961ctgtcgtcaa cattcaaaaa gaaattgacc gcctcaatgaggtcgctaaa aatttaaatg25021aatcactcat tgaccttcaa gaattgggaa aatatgagcaatatattaaa tggccttggt25081atgtttggct cggcttcatt gctggactaa ttgccatcgtcatggttaca atcttgcttt25141gttgcatgac tagttgttgc agttgcctca agggtgcatgctcttgtggt tcttgctgca25201agtttgatga ggatgactct gagccagttc tcaagggtgtcaaattacat tacacataaa25261cgaacttatg gatttgttta tgagattttt tactcttagatcaattactg cacagccagt25321aaaaattgac aatgcttctc ctgcaagtac tgttcatgctacagcaacga taccgctaca25381agcctcactc cctttcggat ggcttgttat tggcgttgcatttcttgctg tttttcagag25441cgctaccaaa ataattgcgc tcaataaaag atggcagctagccctttata agggcttcca25501gttcatttgc aatttactgc tgctatttgt tacdatctattcacatcttt tgcttgtcgc25561tgcaggtatg gaggcgcaat ttttgtacct ctatgccttgatatattttc tacaatgcat25621caacgcatgt agaattatta tgagatgttg gctttgttggaagtgcaaat ccaagaaccc25681attactttat gatgccaact actttgtttg ctggcacacacataactatg actactgtat25741accatataac agtgtcacag atacaattgt cgttactgaaggtgacggca tttcaacacc25801aaaactcaaa gaagactacc aaattggtgg ttattctgaggataggcact caggtgttaa25861agactatgtc gttgtacatg gctatttcac cgaagtttactaccagcttg agtctacaca25921aattactaca gacactggta ttgaaaatgc tacattcttcatctttaaca agcttgttaa25981agacccaccg aatgtgcaaa tacacacaat cgacggctcttcaggagttg ctaatccagc26041aatggatcca atttatgatg agccgacgac gactactagcgtgcctttgt aagcacaaga26101aagtgagtac gaacttatgt actcattcgt ttcggaagaaacaggtacgt taatagttaa26161tagcgtactt ctttttcttg ctttcgtggt attcttgctagtcacactag ccatccttac26221tgcgcttcga ttgtgtgcgt actgctgcaa tattgttaacgtgagtttag taaaaccaac26281ggtttacgtc tactcgcgtg ttaaaaatct gaactcttctgaaggagttc ctgatcttct26341ggtctaaacg aactaactat tattattatt ctgtttggaactttaacatt gcttatcatg26401gcagacaacg gtactattac cgttgaggag cttaaacaactcctggaaca atggaaccta26461gtaataggtt tcctattcct agcctggatt atgttactacaatttgccta ttctaatcgg26521aacaggtttt tgtacataat aaagcttgtt ttcctctggctcttgtggcc agtaacactt26581gcttgttttg tgcttgctgc tgtctacaga attaattgggtgactggcgg gattgcgatt26641gcaatggctt gtattgtagg cttgatgtgg cttagctacttcgttgcttc cttcaggctg26701tttgctcgta cccgctcaat gtggtcattc aacccagaaacaaacattct tctcaatgtg26761cctctccggg ggacaattgt gaccagaccg ctcatggaaagtgaacttgt cattggtgct26821gtgatcattc gtggtcactt gcgaatggcc ggacactccctagggcgctg tgacattaag26881gacctgccaa aagagatcac tgtggctaca tcacgaacgctttcttatta caaattagga26941gcgtcgcagc gtgtaggcac tgattcaggt tttgctgcatacaaccgcta ccgtattgga27001aactataaat taaatacaga ccacgccggt agcaacgacaatattgcttt gctagtacag27061taagtgacaa cagatgtttc atcttgttga cttccaggttacaatagcag agatattgat27121tatcattatg aggactttca ggattgctat ttggaatcttgacgttataa taagttcaat27181agtgagacaa ttatttaagc ctctaactaa gaagaattattcggagttag atgatgaaga27241acctatggag ttagattatc cataaaacga acatgaaaattattctcttc ctgacattga27301ttgtatttac atcttgcgag ctatatcact atcaggagtgtgttagaggt acgactgtac27361tactaaaaga accttgccca tcaggaacat acgagggcaattcaccattt caccctcttg27421ctgacaataa atttgcacta acttgcacta gcacacactttgcttttgct tgtgctgacg27481gtactcgaca tacctatcag ctgcgtgcaa gatcagtttcaccaaaactt ttcatcagac27541aagaggaggt tcaacaagag ctctactcgc cactttttctcattgttgct gctctagtat27601ttttaatact ttgcttcacc attaagagaa agacagaatgaatgagctca ctttaattga27661cttctatttg tgctttttag cctttctgct attccttgttttaataatgc ttattatatt27721ttggttttca ctcgaaatcc aggatctaga agaaccttgtaccaaagtct aaacgaacat27781gaaacttctc attgttttga cttgtatttc tctatgcagttgcatatgca ctgtagtaca27841gcgctgtgca tctaataaac ctcatgtgct tgaagatccttgtaaggtac aacactaggg27901gtaatactta tagcactgct tggctttgtg ctctaggaaaggttttacct tttcatagat27961ggcacactat ggttcaaaca tgcacaccta atgttactatcaactgtcaa gatccagctg28021gtggtgcgct tatagctagg tgttggtacc ttcatgaaggtcaccaaact gctgcattta28081gagacgtact tgttgtttta aataaacgaa caaattaaaatgtctgataa tggaccccaa28141tcaaaccaac gtagtgcccc ccgcattaca tttggtggacccacagattc aactgacaat28201aaccagaatg gaggacgcaa tggggcaagg ccaaaacagcgccgacccca aggtttaccc28261aataatactg cgtcttggtt cacagctctc actcagcatggcaaggagga acttagattc28321cctcgaggcc agggcgttcc aatcaacacc aatagtggtccagatgacca aattggctac28381taccgaagag ctacccgacg agttcgtggt ggtgacggcaaaatgaaaga gctcagcccc28441agatggtact tctattacct aggaactggc ccagaagcttcacttcccta cggcgctaac28501aaagaaggca tcgtatgggt tgcaactgag ggagccttgaatacacccaa agaccacatt28561ggcacccgca atcctaataa caatgctgcc accgtgctacaacttcctca aggaacaaca28621ttgccaaaag gcttctacgc agagggaagc agaggcggcagtcaagcctc ttctcgctcc28681tcatcacgta gtcgcggtaa ttcaagaaat tcaactcctggcagcagtag gggaaattct28741cctgctcgaa tggctagcgg aggtggtgaa actgccctcgcgctattgct gctagacaga28801ttgaaccagc ttgagagcaa agtttctggt aaaggccaacaacaacaagg ccaaactgtc28861actaagaaat ctgctgctga ggcatctaaa aagcctcgccaaaaacgtac tgccacaaaa28921cagtacaacg tcactcaagc atttgggaga cgtggtccagaacaaaccca aggaaatttc28981ggggaccaag acctaatcag acaaggaact gattacaaacattggccgca aattgcacaa29041tttgctccaa gtgcctctgc attctttgga atgtcacgcattggcatgga agtcacacct29101tcgggaacat ggctgactta tcatggagcc attaaattggatgacaaaga tccacaattc29161aaagacaacg tcatactgct gaacaagcac attgacgcatacaaaacatt cccaccaaca29221gagcctaaaa aggacaaaaa gaaaaagact gatgaagctcagcctttgcc gcagagacaa29281aagaagcagc ccactgtgac tcttcttcct gcggctgacatggatgattt ctccagacaa29341cttcaaaatt ccatgagtgg agcttctgct gattcaactcaggcataaac actcatgatg29401accacacaag gcagatgggc tatgtaaacg ttttcgcaattccgtttacg atacatagtc29461tactcttgtg cagaatgaat tctcgtaact aaacagcacaagtaggttta gttaacttta29521atctcacata gcaatcttta atcaatgtgt aacattagggaggacttgaa agagccacca29581cattttcatc gaggccacgc ggagtacgat cgagggtacagtgaataatg ctagggagag29641ctgcctatat ggaagagccc taatgtgtaa aattaattttagtagtgcta tccccatgtg29701attttaatag cttcttagga gaatgacaaa aaaaaaaaaaaaaaaaaaaa a

While placement of the fluorescent protein within the coronavirus genome is preferred, additional preferred embodiments of the invention provide for the construction of virus-fluorescent fusion proteins that permit one of ordinary skill in the art to follow viral reproduction in an animal model. Either viral structural proteins or non-structural proteins can be used as fusion protein partners. Preferred structural proteins for use as fusion protein partners include but are not limited to a nucleocapsid phosphoprotein, a spike glycoprotein, a membrane glycoprotein, a small envelope protein, or a hemagglutinin-esterase glycoprotein. Sequences for each of these proteins have been disclosed in the art for a variety of coronaviruses, including the murine and SARS strains.

Model

The label used in the various aspects of the invention is a fluorescent protein. The native gene encoding the seminal protein in this class, green fluorescent protein (GFP) has been cloned from the bioluminescent jellyfish Aequorea victoria (Morin, J., et al., J. Cell Physiol (1972) 77:313-318). The availability of the gene has made it possible to use GFP as a marker for gene expression. The original GFP itself is a 283 amino acid protein with a molecular weight of 27 kD. It requires no additional proteins from its native source nor does it require substrates or cofactors available only in its native source in order to fluoresce. (Prasher, D. C., et al., Gene (1992) 111:229-233; Yang, F., et al., Nature Biotechnol (1996) 14:1252-1256; Cody, C. W., et al., Biochemistry (1993) 32:1212-1218.) Mutants of the original GFP gene have been found useful to enhance expression and to modify excitation and fluorescence, so that “GFP” in various colors, including reds and blues has been obtained. GFP-S65T (wherein serine at 65 is replaced with threonine) is particularly useful in the present invention method and has a single excitation peak at 490 nm. (Heim, R., et al., Nature (1995) 373:663-664); U.S. Pat. No. 5,625,048. Other mutants have also been disclosed by Delagrade, S., et al., Biotechnology (1995) 13:151-154; Cormack, B., et al., Gene (1996) 173:33-38 and Cramer, A., et al., Nature Biotechnol (1996) 14:315-319. Additional mutants are also disclosed in U.S. Pat. No. 5,625,048. By suitable modification, the spectrum of light emitted by the GFP can be altered. Thus, although the term “GFP” is often used in the present application, the proteins included within this definition are not necessarily green in appearance. Various forms of GFP exhibit colors other than green and these, too, are included within the definition of “GFP” and are useful in the methods and materials of the invention. In addition, it is noted that green fluorescent proteins falling within the definition of “GFP” herein have been isolated from other organisms, such as the sea pansy, Renilla reniformis. Any suitable and convenient form of GFP can be used to modify the infectious agents useful in the invention, both native and mutated forms.

In order to avoid confusion, the simple term “fluorescent protein” will be used; in general, this is understood to refer to the fluorescent proteins which are produced by various organisms, such as Renilla and Aequorea as well as modified forms of these native fluorescent proteins which may fluoresce in various visible colors, such as red, yellow, and cobalt, which are exhibited by red fluorescent protein (RFP), yellow fluorescent protein (YFP) or cobalt fluorescent protein (CFP), respectively. In general, the terms “fluorescent protein” and “GFP” or “RFP” are used interchangeably.

Because fluorescent proteins are available in a variety of colors, imaging with respect to more than a single color can be done simultaneously. For example, two different infective agents or three different infective agents each expressing a characteristic fluorescence can be administered to the organism and differential effects of proposed treatments evaluated. In addition, a single infectious organism could be labeled constitutively with a single color and a different color used to produce a fusion with a gene product either intracellular or that is secreted. Thus, the nucleotide sequence encoding a fluorescent protein having a color different from that used to label the organism per se can be inserted at a locus to be studied or as a fusion protein in a vector with a protein to be studied. Two-color imaging will be used to visualize targeting of the virus to particular sites in the model, such as the lungs. Further, one or more infective agents can each be labeled with a single color, a gene of interest with another color, and the host model tissue with a third color. For example, fluorescence-expressing coronavirus models will enable visualization of viral reproduction by whole body imaging.

The method of the disclosed invention can be used, to monitor the replication of the recombinant coronaviruses discussed above and the affect various antiviral agents such as chemotherapeutic agents and antiviral vaccines have on coronavirus reproduction.

The methods of the invention utilize infectious agents which have been modified to express the nucleotide sequence encoding a fluorescent protein, preferably of sufficient fluorescence intensity that the fluorescence can be seen in the subject without the necessity of any invasive technique. While whole body imaging is preferred because of the possibility of real-time observation, endoscopic techniques, for example, can also be employed or, if desired, tissues or organs excised for direct or histochemical observation.

The nucleotide sequence encoding the fluorescent protein may be introduced into the infectious agent by direct modification, such as modification of a viral genome to locate the fluorescent protein encoding sequence in a suitable position under the control sequences endogenous to the virus, or may be introduced into microbial systems using appropriate expression vectors.

The appropriately modified infectious agent is then administered to the subject in a manner which mimics, if desired, the route of infection believed used by the agent or by an arbitrary route. Administration may be by injection, gavage, oral, by aerosol into the respiratory system, by suppository, by contact with a mucosal surface in general, or by any suitable means known in the art to introduce infectious agents.

Although endoscopy can be used as well as excision of individual tissues, it is particularly convenient to visualize the migration of infective agent and infected cells in the intact animal through fluorescent imaging. This permits real-time observation and monitoring of progression of infection on a continuous basis, in particular, in model systems, in evaluation of potential anti-infective drugs and protocols. Thus, the inhibition of infection observed directly in test animals administered a candidate drug or protocol in comparison to controls which have not been administered the drug or protocol indicates the efficacy of the candidate and its potential as a treatment. In subjects being treated for infection, the availability of fluorescent imaging permits those devising treatment protocols to be informed on a continuous basis of the advisability of modifying or not modifying the protocol. In one embodiment, to screen for effective antiviral agents, recombinant coronaviruses that express fluorescently-labeled viral proteins are injected into a murine model to follow viral reproduction. Sites of viral infection are highly fluorescent and readily visualized by blue light excitation in a light box with a CCD camera and a GFP filter.

Suitable vertebrate subjects for use as models are preferably mammalian subjects, most preferably convenient laboratory animals such as rabbits, rats, mice, and the like. For closer analogy to human subjects, primates could also be used. Any appropriate vertebrate subject can be used, the choice being dictated mainly by convenience and similarity to the system of ultimate interest. Ultimately, the vertebrate subjects can be humans.

The following examples are offered to illustrate but not to limit the invention.

EXAMPLE 1

A. Background

A dual-color fluorescence imaging model of tumor-host interaction based on an RFP-expressing tumor growing in GFP transgenic mice, enabling dual-color visualization of the tumor-stroma interaction including tumor angiogenesis and infiltration of lymphocytes in the tumor has been described. Transgenic mice expressing the GFP under the control of a chicken beta-actin promoter and cytomegalovirus enhancer were used as the host (Okabe, M., et al., FEBS Lett (1997) 407:315-319). All of the tissues from this transgenic line fluoresce green under blue excitation light. RFP-expressing B16F0 (B16F0-RFP) mouse melanoma cells were transduced with the pLNCX₂-DsRed-2-RFP plasmid. The B16F0-RFP tumor and GFP-expressing host cells could be clearly imaged simultaneously. High-resolution dual-color images enabled resolution of the tumor cells and the host tissues down to the single cell level. Host cells including fibroblasts, tumor infiltrating lymphocytes, dendritic cells, blood vessels and capillaries that express GFP, could be readily distinguished from the RFP-expressing tumor cells. This dual-color fluorescence imaging system should facilitate studies for understanding tumor-host interaction during tumor growth and tumor angiogenesis. The dual-colored chimeric system also provides a powerful tool to analyze and isolate tumor infiltrating lymphocytes and other host stromal cells interacting with the tumor for therapeutic and diagnostic/analytic purposes. The principles of this model are used in the dual-color imageable RFP-MHV-GFP-host infectious model of the invention.

B. Methods

Viruses and cells: The methods of de Haan, et al., Virol. (2002) 296:177-189 are followed. The MHV-A59 temperature-sensitive (ts) mutant LA16, the plaque-cloned MHV-JHM, and virus sample obtained after 19 undiluted passages of original plaque-cloned MHV-JHM (JHM19th) are employed. Mouse DBT cells are used for RNA transfection and propagation of viruses.

The methods of Kim, K. H., J. Virol. (1995) 69:2313-2321 are followed, in the following sections:

Preparation of virus-specific intracellular RNA and Northern (RNA) blotting: Virus-specific RNAs are extracted from virus-infected cells. 1.5 mg of intracellular RNA is denatured and electrophoresed through a 1% agarose gel containing formaldehyde. The separated RNA was blotted onto nylon filters. The RNA on the filters is hybridized with ³²P-labeled probes specific for the various regions of MHV RNA.

RNA transcription and transfection: Plasmids are linearized by XbaI digestion and transcribed in vitro with T7 RNA polymerase. Lipofection is used for RNA transfection.

Isolation of clones containing the DIssA-specific sequence: For the amplification of a DIssA-related subgenomic RNA, cDNA is first synthesized from intracellular RNA, using as a primer oligonucleotide 1116 (5′-CTGAAACTCTTTTCCCT-3′)(SEQ ID NO: XX), which binds to positive-strand MHV mRNA 7 at nucleotides 250 to 267 from the 5′ end of mRNA 7. MHV-specific cDNA is then incubated with oligonucleotide 78 (5′-AGCTTTACGTACCCTCTCTACTATAAAACTCTTGTAGTTT-3′)(SEQ ID NO: XX), which binds to antileader sequence of MHV RNA, in PCR buffer (0.05 M KCl, 0.01 M Tris hydrochloride [pH 8.3], 0.0025 M MgCl2, 0.01% gelatin, 0.17 mM of each deoxynucleoside triphosphate, 5 U of Taq polymerase [Promega]) at 93.8° C. for 30 s, 37.8° C. for 45 s, and 72.8° C. for 100 s for 25 cycles DIssA subgenomic RNA were separated by agarose gelelectrophoresis and hybridized with a probe which corresponds to 1.5 to 1.7 kb from the 3′ end of MHV genomic RNA. This probe hybridizes with all MHV mRNAs. The DIssA subgenomic RNA-specific RT-PCR product is eluted from the gel and cloned into the TA cloning vector (Invitrogen). Clones containing DIssA-specific sequence are isolated by colony hybridization using the probe that was used for Southern blot analysis. For amplification of DIssA RNA, cDNA is first synthesized from gel-purified DIssA RNA by using oligonucleotide 1116 as a primer. DIssA-specific cDNA is then incubated with oligonucleotide 10121 (5′-GAAGGGTTGTATGTGTTG-3′)(SEQ ID NO: XX), which binds to negative strand MHV RNA at nucleotides 798 to 815 from the 5′ end of gene 2, in PCR buffer under the PCR conditions described above. The DIssA-specific RT-PCR product is eluted from the preparative gel and cloned into the TA cloning vector. Clones containing DIssA-specific sequences are isolated by colony hybridization using the probe which hybridizes at MHV gene 2-1.

Construction of Mouse Hepatitis Full-Length cDNA linked to RFP: DIssA is a naturally occurring self-replicating DI RNA with nearly intact genes 1 and 7 of the MHV as noted above. We will flank gene 1 and gene 7 of the cDNA of MHV, plus the RFP gene in bacterial artificial chromosome (BAC) pBeloBACII, at its 5′ end by the CMV immediate-early promoter and at its 3′ end followed by poly(A) tail in turn followed by the hepatitis delta virus ribozyme and the bovine GH termination and polyadenylation sequences pBAC-MHV-RFP (see, Almazan, F., et al, PNAS (2000) 97:5516-5521).

Transfection and Recovery of an Infectious Virus from a cDNA Clone: The methods of Almazan, F., et al., PNAS (2000) 97:5516-5521 are used in this procedure. The mouse DBT cells are used for transfected by pBAC-MHV-RFP. After an incubation period of 2 days, the cell supernatant was harvested and passaged six times on fresh DBT cells. Virus present in the cell supernatant was analyzed by plaque tritation and RT-PCR.

RFP Expression Vectors (See, Yang, M., Proc. Natl. Acad. Sci. USA (2002) 99:3824-3829). The pLNCX₂vectors is purchased from CLONTECH Laboratories, Inc. (Palo Alto, Cailf.). The pLNCX₂vector contains the neomycin resistance gene for antibiotic selection in eukaryotic cells. The red fluorescent protein (RFP), (DsRed2, CLONTECH Laboratories, Inc., Palo Alto, Cailf.), is inserted in the pLNCX₂vector at the Egl II and Not I sites.

RFP vector production (See, Yang, M., Proc. Natl. Acad. Sci. USA (2002) 99:3824-3829). For retroviral transduction, PT67, an NIH3T3-derived packaging cell line, expressing the 10 Al viral envelope, is purchased from CLONTECH Laboratories, Inc. PT67 cells are cultured in DME (Irvine Scientific, Santa Ana, Calif.) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gemini Bio-products, Calabasas, Calif.). For vector production, packaging cells (PT67), at 70% confluence, are incubated with a precipitated mixture of DOTAP™ reagent (Boehringer Mannheim), and saturating amounts of pLEIN-GFP or pLNCX₂-DsRed-2-RFP plasmid for 18 hours. Fresh medium is replenished at this time. The cells are examined by fluorescence microscopy 48 hours post-transfection. For selection, the cells are cultured in the presence of 500 μg/ml- 2000 μg/ml of G418 increased in a step-wise manner (Life Technologies, Grand Island, N.Y.) for seven days.

Dual-color imaging of virus-host interaction: After infection of recombinant coronavirus to the GFP transgenic mice, the fresh tissues are cut into ˜1 mm³pieces. The tissues are digested with trypsin/EDTA at 37 C.° for 10 minutes before examination. After trypsinization, tissues are put on precleaned microscope slides (Fisher Scientific, Pittsburgh, Pa.) and covered with a cover slip (Fisher Scientific). The tissues are pressed to become thin enough by pushing the cover slip to display the intact vasculature on the slides. The GFP-fluorescing host cells that are infected with the coronavirus can be readily observed under fluorescence microscopy. Laser-based systems will be used for whole-body dual-color imaging of the chimeric system (please see below). All fluorescence results will be confirmed by standard immunohistochemical techniques to identify host all types infected by the RFP-MHV.

Fluorescence imaging (See, Yang, M., Proc. Natl. Acad. Sci. USA (2002) 99:3824-3829). A Leica fluorescence stereo microscope model LZ12 equipped with a mercury 50W lamp power supply is used for initial lower resolution imaging. For visualization of both GFP and RFP fluorescence simultaneously, excitation is produced through a D425/60 band pass filter and 470 DCXR dichroic mirror. Emitted fluorescence is collected through a long pass filter GG475 (Chroma Technology, Brattleboro, Vt.). Macroimaging is carried out in a light box (Lightools Research, Encinitas, Calif.). Fluorescence excitation of both GFP and RFP tumors is produced in the lightbox through an interference filter (440+/−20 nm) using slit fiber optics. Fluorescence is observed through a 520 nm long pass filter. Images from the microscope and light box are captured on a Hamamatsu C5810 3-chip cool color CCR camera (Hamamatsu Photonics Systems, Bridgewater, N.J.). Laser-based imaging is carried out with the Spectra Physics model 3941-M1BB dual photon laser, Photon Technology Intl. model GL-3300 nitrogen laser and the Photon Technology Intl. model GL-302 dye laser. Images are processed for contrast and brightness and analyzed with the use of Image Pro Plus 4.0 software (Media Cybernetics, Silver Springs, Md.). High resolution images of 1024×724 pixels are captured directly on an IBM PC or continuously through video output on a high resolution Sony VCR model SLV-R1000 (Sony Corp., Tokyo Japan).

Multiphoton confocal microscopy (Wang, W., et al., Cancer Research (2002) 6278-6288). The dual photon laser (Spectra-Physics model 3941-M1BB) is also used with the Radiance 2000 multiphoton system (Bio-Rad, Hercules, Calif.) at 960 nm, the optimal wavelength for GFP fluorescence. The images are collected using Bio-Rad's Lasersharp 2000 software. Excitation is confmed only to the optical section being observed. No excitation of the fluorophore will occur at 960 run wavelength not in the plane of focus. The Millenia, Tsunami Ti:Sapphire laser, an accessory for the Spectra Physics model 3941-M1BB dual photon laser, has long wavelength optics (beyond 1,000 nm) for RFP multiphoton imaging. Images are processed with Image Pro Plus 4.0 software.

Spectral resolution. Spectral imaging, is the generation of images containing a high-resolution optical spectrum at every pixel, to “unmix” the viral RFP signal from that of the GFP-labeled host. The standard GFP-mouse imaging system (long-pass emission filter) is modified by replacing the usual color camera with the cooled monochrome camera (Roper Scientific CCD thermo-cooled digital camera) and a liquid crystal tunable filter (CRI, Inc., Woburn, Mass.) positioned in front of a conventional macro-lens. Typically, a series of images is taken every 10 nm from 500 to 650 nm and assembled automatically in memory into a spectral “stack.” Using pre-defined GFP or RFP and autofluorescence spectra, the image can be resolved into different images using a linear combination chemometrics-based algorithm that generates images containing only the autofluorescence signals or only the GFP or RFP signals, now visible against essentially a black background. Using spectral autofluorescence subtraction, sensitivity is enhanced due to improvements in signal to noise ratio. The advantages provided by the GFP- or RFP-labeled tumor models, which allow noninvasive, and highly selective imaging, are further enhanced by using wavelength-selective imaging techniques and analysis to image tumors on deep organs such as the lung (personal communication, Richard Levenson, CRI, Inc., Woburn, Mass.).

Depth of imaging: External visualization of single cells or microscopic colonies of viral infected cells on internal organs is one goal of this application. Imaging of this power requires reducing scatter of excitation and emission light. Multiphoton and single photon lasers will be used for deeper penetration in the living animal. Confocal microscopy will also be used in conjunction with the multiphoton laser. The relatively high wave length of the excitation light, about 470 nm (960 nm for GFP dual photon and about 1,220 nm for RFP dual photon), will not damage tissue. The multiphoton confocal system will highly limit the irradiation area further protecting the host tissues. Skin-flaps also greatly reduce scatter which we have already shown to enable external single-cell imaging. Use of the long wave length Ds-Red-2-RFP also reduces scatter.

C. Results

The infected mice are treated with various drug regimens and evaluated for replication of the virus with and without the presence of the drug. Drugs that succeed in reducing viral replication are identified as successful candidates as therapeutic agents.

Similarly, mice subjected to immunization procedures to be tested are challenged after immunization with infectious levels of MHV coronavirus. The ability of the subject to resist infection after exposure is then evaluated.

Imageable animal model of SARS infection

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

RELATED APPLICATION

Provisional Applications (1)