Patent Application
20110112135
This invention relates generally to imidazo[1,2-a]pyridine-based modulators of Liver X receptors (LXRs) and related methods.
Atherosclerosis is among the leading causes of death in developed countries. Some of the independent risk factors associated with atherosclerosis include the presence of relatively high levels of serum LDL cholesterol and relatively low levels of serum HDL cholesterol in affected patients. As such, some anti-atherosclerotic therapy regimens include the administration of agents (e.g., statins) to reduce elevated serum LDL cholesterol levels.
Agents that increase patient HDL cholesterol levels can also be useful in anti-atherosclerotic therapy regimens. HDL cholesterol is believed to play a major role in the transport of cholesterol from peripheral tissues to the liver for metabolism and excretion (this process is sometimes referred to as “reverse cholesterol transport”). ABCA1 is a transporter gene involved in HDL production and reverse cholesterol transport. Upregulation of ABCA1 can therefore result in increased reverse cholesterol transport as well as inhibition of cholesterol absorption in the gut. In addition, HDL is also believed to inhibit the oxidation of LDL cholesterol, reduce the inflammatory response of endothelial cells, inhibit the coagulation pathway, and promote the availability of nitric oxide.
Liver X receptors (LXRs), originally identified in the liver as orphan receptors, are members of the nuclear hormone receptor super family and are believed to be involved in the regulation of cholesterol and lipid metabolism. LXRs are ligand-activated transcription factors and bind to DNA as obligate heterodimers with retinoid X receptors. While LXRα is generally found in tissues such as liver, kidney, adipose tissue, intestine and macrophages, LXRβ displays a ubiquitous tissue distribution pattern. Activation of LXRs by oxysterols (endogenous ligands) in macrophages results in the expression of several genes involved in lipid metabolism and reverse cholesterol transport including the aforementioned ABCA1; ABCG1; and ApoE. See, e.g., Koldamova, et al., J. Biol. Chem. 2003, 278, 13244.
Studies have been conducted in LXRα knock-out (k/o), LXRβ k/o and double k/o mice to determine the physiological role of LXRs in lipid homeostasis and atherosclerosis. The data from these studies suggested that in double k/o mice on normal chow diet, increased cholesterol accumulation was observed in macrophages (foam cells) of the spleen, lung and arterial wall. The increased cholesterol accumulation was believed to be associated with the presence of reduced serum HDL cholesterol and increased LDL cholesterol, even though the total cholesterol levels in the mice were about normal. While LXRα k/o mice did not appear to show significant changes in hepatic gene expression, LXRβ k/o mice showed 58% decrease in hepatic ABCA1 expression and 208% increase in SREBP1c expression suggesting that LXRβ may be involved in the regulation of liver SREBP1c expression.
Data obtained from studies employing two different atherosclerotic mouse models (ApoE k/o and LDLR k/o) suggest that agonists of LXRα or β can be relatively effective in upregulating ABCA1 expression in macrophages. For example, inhibition of atherosclerotic lesions could be observed when ApoE k/o and LDLR k/o mice were treated with LXRα or β agonists for 12 weeks. The tested agonists were observed to have variable effects on serum cholesterol and lipoprotein levels and appeared to cause a relatively significant increase in serum HDL cholesterol and triglyceride levels. These in vivo data were found to be consistent with in vitro data obtained for the same agonists in macrophages.
In addition to the lipid and triglyceride effects described above, it is also believed that activation of LXRs results in the inhibition of inflammation and proinflammatory gene expression. This hypothesis is based on data obtained from studies employing three different models of inflammation (LPS-induced sepsis, acute contact dermatitis of the ear and chronic atherosclerotic inflammation of the artery wall). These data suggest that LXR modulators can mediate both the removal of cholesterol from the macrophages and the inhibition of vascular inflammation.
For a review of LXR biology and LXR modulators, see, e.g., Goodwin, et al., Current Topics in Medicinal Chemistry 2008, 8, 781; and Bennett, et al., Current Medicinal Chemistry 2008, 15, 195.
For studies related to atherosclerosis, see, e.g., Scott, J. N. Engl. J. Med. 2007, 357, 2195; Joseph, et al., PNAS 2002, 99, 7604; Tangirala, et. al., PNAS, 2002, 99, 11896; and Bradley, et al., Journal of Clinical Investigation 2007, 117, 2337-2346.
For studies related to inflammation, see, e.g., Fowler, et al., Journal of Investigative Dermatology 2003, 120, 246; and US 2004/0259948.
For studies related to Alzheimer's disease, see, e.g., Koldamova, et al., J. Biol. Chem. 2005, 280, 4079; Sun, et al., J. Biol. Chem. 2003, 278, 27688; and Riddell, et al., Mol. Cell Neurosci. 2007, 34, 621.
For studies related to diabetes, see, e.g., Kase, et al., Diabetologia 2007, 50, 2171; and Liu, et al., Endocrinology 2006, 147, 5061.
For studies related to skin aging, see, e.g., WO 2004/076418; WO 2004/103320; and US 2008/0070883.
For studies related to arthritis, see, e.g., Chintalacharuvu, et. al., Arthritis a& Rheumatism 2007, 56, 1365; and WO 2008/036239.
This invention relates generally to imidazo[1,2-a]pyridine-based modulators of Liver X receptors (LXRs) and related methods.
In one aspect, this invention features a compound having formula (I):
in which:
R1 is:
(i) hydrogen; or
(ii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iii) C2-C6 alkenyl or C2-C6 alkynyl, each of which is optionally substituted with from 1-10 Rb; or
(iv) C3-C10 cycloalkyl, C3-C10 cycloalkenyl, heterocyclyl including 3-10 atoms, heterocycloalkenyl including 3-10 atoms, C7-C11 aralkyl, or heteroaralkyl including 6-11 atoms, each of which is optionally substituted with from 1-10 Rc; or
(v) C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is optionally substituted with from 1-10 Rd; or
(vi) halo;
R2 is C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is:
(i) substituted with 1 R7, and
(ii) optionally substituted with from 1-5 Re; wherein:
R7 is WA, wherein:
W is a bond; —O—; —NR8—; C1-6 alkylene, C2-6 alkenylene, or C2-6 alkynylene; —W1(C1-6 alkylene)-; or —(C1-6 alkylene)W1—;
W1 is independently —O— or —NR8—;
R8 is hydrogen or C1-C6 alkyl;
A at each occurrence is, independently, C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is:
(i) substituted with 1 R9, and
(ii) optionally further substituted with from 1-5 Rg;
R9 is:
(i) —W2—S(O)nR10 or —W2—S(O)nNR11R12; or
(ii) —W2—C(O)OR13; or
(iii) —W2—C(O)NR11R12; or
(iv) C1-C12 alkyl or C1-C12 haloalkyl, each of which is:
or
(v) —NR14R15;
wherein:
W2 at each occurrence is, independently, a bond; C1-6 alkylene; C2-6 alkenylene; C2-6 alkynylene; C3-6 cycloalkylene; —O(C1-6 alkylene)-; or —NR8(C1-6 alkylene)-;
n at each occurrence is, independently, 1 or 2;
R10 at each occurrence is, independently:
(i) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-5 Ra; or
(ii) C2-C6 alkenyl or C2-C6 alkynyl, each of which is optionally substituted with from 1-5 Rb; or
(iii) C3-C10 cycloalkyl, C3-C10 cycloalkenyl, C7-C11 aralkyl, or heteroaralkyl including 6-11 atoms, each of which is optionally substituted with from 1-5 Rc; or
(iv) C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is optionally substituted with from 1-5 Rd;
R11 and R12 are each, independently:
(i) hydrogen; or
(ii)-(v) R10 (in which R10 is as defined above); or
(vi) heterocyclyl including 3-10 atoms or a heterocycloalkenyl including 3-10 atoms, each of which is optionally substituted with from 1-5 Rc; or
R11 and R12 together with the nitrogen atom to which they are attached form a heterocyclyl including 3-10 atoms or a heterocycloalkenyl including 3-10 atoms, each of which is optionally substituted with from 1-5 Rc;
R13 is:
(i) hydrogen;
(ii)-(v) R10 (in which R10 is as defined above);
one of R14 and R15 is hydrogen or C1-C3 alkyl; and the other of R14 and R15 is:
(i) —S(O)nR10; or
(ii) —C(O)OR13; or
(iii) —C(O)NR11R12; or
(iv) C1-C12 alkyl or C1-C12 haloalkyl, each of which is:
each of R3, R4, and R5 is, independently:
(i) hydrogen; or
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra;
R6 is:
(i) hydrogen; or
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) nitro; C1-C6 alkoxy; C1-C6 haloalkoxy; C1-C6 thioalkoxy; C1-C6 thiohaloalkoxy; or cyano;
Ra at each occurrence is, independently:
(i) NRmRn; hydroxy; C1-C6 alkoxy or C1-C6 haloalkoxy; C6-C10 aryloxy or heteroaryloxy including 5-10 atoms, each of which is optionally substituted with from 1-5 Rd; C7-C11 aralkoxy, heteroaralkoxy including 6-11 atoms, C3-C11 cycloalkoxy, C3-C11 cycloalkenyloxy, heterocyclyloxy including 3-10 atoms, or heterocycloalkenyloxy including 3-10 atoms, each of which is optionally substituted with from 1-5 Rc; or cyano; or
(ii) C3-C10 cycloalkyl, C3-C10 cycloalkenyl, heterocyclyl including 3-10 atoms, or heterocycloalkenyl including 3-10 atoms, each of which is optionally substituted with from 1-5 Rc;
Rb at each occurrence is, independently:
(i) halo; NRmRn; hydroxy; C1-C6 alkoxy or C1-C6 haloalkoxy; C6-C10 aryloxy or heteroaryloxy including 5-10 atoms, each of which is optionally substituted with from 1-5 Rd; C7-C11 aralkoxy, heteroaralkoxy including 6-11 atoms, C3-C10 cycloalkoxy, C3-C10 cycloalkenyloxy, heterocyclyloxy including 3-10 atoms, or heterocycloalkenyloxy including 3-10 atoms, each of which is optionally substituted with from 1-5 Rc;
(ii) C3-C10 cycloalkyl, C3-C10 cycloalkenyl, heterocyclyl including 3-10 atoms, or heterocycloalkenyl including 3-10 atoms, each of which is optionally substituted with from 1-5 Rc; or
(iii) C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is optionally substituted with from 1-5 Rd;
Rc at each occurrence is, independently:
(i) halo; NRmRn; hydroxy; C1-C6 alkoxy or C1-C6 haloalkoxy; or
(ii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-5 Ra; or
(iii) C2-C6 alkenyl or C2-C6 alkynyl, each of which is optionally substituted with from 1-5 Rb;
Rd at each occurrence is, independently:
(i) halo; NRmRn; hydroxy; C1-C6 alkoxy or C1-C6 haloalkoxy; or cyano; or
(ii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-5 Ra; or
(iii) C2-C6 alkenyl or C2-C6 alkynyl, each of which is optionally substituted with from 1-5 Rb;
Re at each occurrence is, independently, C1-C6 alkyl; C1-C6 haloalkyl; halo; hydroxyl; NRmRn; C1-C6 haloalkoxy; or cyano;
Rg at each occurrence is, independently:
(i) halo; NRmRn; hydroxy; C1-C6 alkoxy or C1-C6 haloalkoxy; cyano; or
(ii) C1-C6 alkyl or C1-C6 haloalkyl;
Rh at each occurrence is, independently, hydroxyl, C1-C6 alkoxy, or C1-C6 haloalkoxy; C3-C10 cycloalkoxy or C3-C10 cycloalkenyloxy, each of which is optionally substituted with from 1-5 Rc; or C6-C10 aryloxy or heteroaryloxy including 5-10 atoms, each of which is optionally substituted with from 1-5 Rd;
each of Rm and Rn at each occurrence is, independently, hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;
or an N-oxide and/or salt (e.g., a pharmaceutically acceptable salt) thereof.
In one aspect, this invention features a compound having formula (I), in which R1, R2, R3, R4, R5, R7, R8, R9, R10, R11, R12, R13, R14, R15, W, W1, W2, A, Ra, Rb, Rc, Rd, Re, Rg, Rh, Rm, Rn, and n, can be, independently, as defined anywhere herein, and
R6 is:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) nitro; C1-C6 alkoxy; C1-C6 haloalkoxy; C1-C6 thioalkoxy; C1-C6 thiohaloalkoxy; or cyano.
In certain embodiments, R1 is other than halo.
In one aspect, this invention features a compound having formula (I), in which R1, R2, R3, R4, R5, R6, R7, R8, R10, R11, R12, R13, R14, R15, W, W1, W2, A, Ra, Rb, Rc, Rd, Re, Rg, Rh, Rm, Rn, and n, can be, independently, as defined anywhere herein, and
R9 is:
(i) —W2—S(O)nR10 or —W2—S(O)nNR11R12; or
(iii) —W2—C(O)NR11R12; or
(iv) C1-C12 alkyl or C1-C12 haloalkyl, each of which is:
or
(v) —NR14R15.
In certain embodiments:
R6 is:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) nitro; C1-C6 alkoxy; C1-C6 haloalkoxy; C1-C6 thioalkoxy; C1-C6 thiohaloalkoxy; or cyano.
In certain embodiments, R1 is other than halo.
In one aspect, this invention features a compound having formula (I), in which R1, R2, R3, R4, R5, R6, R7, R8, R10, R11, R12, R13, R14, R15, W, W1, W2, A, Ra, Rb, Rc, Rd, Re, Rg, Rh, Rm, Rn, and n, can be, independently, as defined anywhere herein, and
R9 is:
(i) —W2—S(O)nR10 or —W2—S(O)nNR11R12.
In certain embodiments:
R6 is:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) nitro; C1-C6 alkoxy; C1-C6 haloalkoxy; C1-C6 thioalkoxy; C1-C6 thiohaloalkoxy; or cyano.
In certain embodiments, R1 is other than halo.
In another aspect, this invention features a compound having formula (I), in which R1, R2, R3, R4, R5, R6, R7, R8, R10, R11, R12, R13, R14, R15, W, W1, W2, A, Ra, Rb, Rc, Rd, Re, Rg, Rh, Rm, Rn, and n, can be, independently, as defined anywhere herein, and
R9 is:
(i)—W2—S(O)nR10 or—W2—(O)nNR11R12; or
(iv) C1-C12 alkyl or C1-C12 haloalkyl, each of which is:
or
(v) —NR14R15.
In certain embodiments:
R6 is:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) nitro; C1-C6 alkoxy; C1-C6 haloalkoxy; C1-C6 thioalkoxy; C1-C6 thiohaloalkoxy; or cyano.
In certain embodiments, R1 is other than halo.
In one aspect, this invention features a compound having formula (I), in which R1, R2, R3, R4, R5, R6, R7, R8, R10, R11, R12, R13, R14, R15, W, W1, W2, A, Ra, Rb, Rc, Rd, Re, Rg, Rh, Rm, Rn, and n, can be, independently, as defined anywhere herein, and
R9 is (ii) —W2—C(O)OR13.
In certain embodiments:
R6 is:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) nitro; C1-C6 alkoxy; C1-C6 haloalkoxy; C1-C6 thioalkoxy; C1-C6 thiohaloalkoxy; or cyano.
In certain embodiments, R1 is other than halo.
In another aspect, this invention features a compound having formula (I), in which R1, R2, R3, R4, R5, R6, R7, R8, R10, R11, R12, R13, R14, R15, W, W1, W2, A, Ra, Rb, Rc, Rd, Re, Rg, Rh, Rm, Rn, and n, can be, independently, as defined anywhere herein, and
R9 is (iii) —W2—C(O)NR11R12.
In certain embodiments:
R6 is:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) nitro; C1-C6 alkoxy; C1-C6 haloalkoxy; C1-C6 thioalkoxy; C1-C6 thiohaloalkoxy; or cyano.
In certain embodiments, R1 is other than halo.
In a further aspect, this invention features a compound having formula (I), in which R1, R2, R3, R4, R5, R6, R7, R8, R10, R11, R12, R13, R14, R15, W, W1, W2, A, Ra, Rb, Rc, Rd, Re, Rg, Rh, Rm, Rn, and n, can be, independently, as defined anywhere herein, and
R9 at each occurrence is, independently:
(iv) C1-C12 alkyl or C1-C12 haloalkyl, each of which is:
In certain embodiments:
R6 is:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) nitro; C1-C6 alkoxy; C1-C6 haloalkoxy; C1-C6 thioalkoxy; C1-C6 thiohaloalkoxy; or cyano.
In certain embodiments, R1 is other than halo.
In one aspect, this invention features a compound having formula (I), in which R1, R2, R3, R4, R5, R6, R7, R8, R10, R11, R12, R13, R14, R15, W, W1, W2, A, Ra, Rb, Rc, Rd, Re, Rg, Rh, Rm, Rn, and n, can be, independently, as defined anywhere herein, and
R9 is (v)—NR14R15.
In certain embodiments:
R6 is:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) nitro; C1-C6 alkoxy; C1-C6 haloalkoxy; C1-C6 thioalkoxy; C1-C6 thiohaloalkoxy; or cyano.
In certain embodiments, R1 is other than halo.
In one aspect, this invention relates to any subgenera of formula (I) described herein.
In one aspect, this invention relates to any of the specific imidazo[1,2-a]pyridine compounds delineated herein. In some embodiments, the compound of formula (I) can be selected from the title compounds of Examples 9-30 and 36-142; or a pharmaceutically acceptable salt and/or N-oxide thereof.
In one aspect, this invention features a composition (e.g., a pharmaceutical composition), which includes a compound of formula (I) (including any subgenera or specific compounds thereof) or a salt (e.g., a pharmaceutically acceptable salt) or a prodrug thereof and a pharmaceutically acceptable adjuvant, carrier or diluent. In some embodiments, the composition can include an effective amount of the compound or the salt thereof. In some embodiments, the composition can further include an additional therapeutic agent.
In one aspect, this invention features a dosage form, which includes from about 0.05 milligrams to about 2,000 milligrams (e.g., from about 0.1 milligrams to about 1,000 milligrams, from about 0.1 milligrams to about 500 milligrams, from about 0.1 milligrams to about 250 milligrams, from about 0.1 milligrams to about 100 milligrams, from about 0.1 milligrams to about 50 milligrams, or from about 0.1 milligrams to about 25 milligrams) of formula (I) (including any subgenera or specific compounds thereof), or a salt (e.g., a pharmaceutically acceptable salt), or an N-oxide, or a prodrug thereof. The dosage form can further include a pharmaceutically acceptable carrier and/or an additional therapeutic agent.
The invention also relates generally to modulating (e.g., activating) LXRs with the imidazo[1,2-a]pyridine compounds described herein. In some embodiments, the methods can include, e.g., contacting an LXR in a sample (e.g., a tissue, a cell free assay medium, a cell-based assay medium) with a compound of formula (I) (including any subgenera or specific compounds thereof). In other embodiments, the methods can include administering a compound of formula (I) (including any subgenera or specific compounds thereof) to a subject (e.g., a mammal, e.g., a human, e.g., a human having or at risk of having one or more of the diseases or disorders described herein).
In one aspect, this invention also relates generally to methods of treating (e.g., controlling, ameliorating, alleviating, slowing the progression of, delaying the onset of, or reducing the risk of developing) or preventing one or more LXR-mediated diseases or disorders in a subject (e.g., a subject in need thereof). The methods include administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. LXR-mediated diseases or disorders can include, e.g., cardiovascular diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, thyroiditis, skin aging or connective tissue diseases.
In another aspect, this invention relates to methods of modulating (e.g., increasing) serum HDL cholesterol levels in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of modulating (e.g., decreasing) serum LDL cholesterol levels in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of modulating (e.g., increasing) reverse cholesterol transport in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of modulating (e.g., decreasing or inhibiting) cholesterol absorption in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating a cardiovascular disease (e.g., acute coronary syndrome, restenosis, or coronary artery disease), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In one aspect, this invention relates to methods of preventing or treating atherosclerosis and/or atherosclerotic lesions, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating diabetes (e.g., type I diabetes or type II diabetes), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating Syndrome X, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In one aspect, this invention relates to methods of preventing or treating obesity, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating a lipid disorder (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and/or high LDL), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating a cognitive disorder (e.g., Alzheimer's disease or dementia), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In one aspect, this invention relates to methods of preventing or treating dementia, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating Alzheimer's disease, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. In a further aspect, this invention relates to methods of preventing or treating an inflammatory disease (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating rheumatoid arthritis, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating celiac, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating thyroiditis, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In one aspect, this invention relates to methods of treating a connective tissue disease (e.g., osteoarthritis or tendonitis), which includes administering to a subject (e.g., a mammal, e.g., a human) in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) cartilage degradation. In embodiments, the compound of formula (I) induces (e.g., increases or otherwise agments) cartilage regeneration. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) cartilage degradation and induces (e.g., increases or otherwise agments) cartilage regeneration. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) aggrecanase activity. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) elaboration of pro-inflammatory cytokines in osteoarthritic lesions.
In another aspect, this invention relates to methods of treating or preventing skin aging, the method comprising administering (e.g., topically administering) to a subject (e.g., a mammal, e.g., a human) in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. In embodiments, the skin aging can be derived from chronological aging, photoaging, steroid-induced skin thinning, or a combination thereof.
The term “skin aging” includes conditions derived from intrinsic chronological aging (for example, deepened expression lines, reduction of skin thickness, inelasticity, and/or unblemished smooth surface), those derived from photoaging (for example, deep wrinkles, yellow and leathery surface, hardening of the skin, elastosis, roughness, dyspigmentations (age spots) and/or blotchy skin), and those derived from steroid-induced skin thinning. Accordingly, another aspect is a method of counteracting UV photodamage, which includes contacting a skin cell exposed to UV light with an effective amount of a compound of formula (I).
In some embodiments, the compound of formula (I) (including any subgenera or specific compounds thereof) does not substantially increase serum and/or hepatic triglyceride levels of the subject.
In some embodiments, the administered compound of formula (I) (including any subgenera or specific compounds thereof) can be an LXR agonist (e.g., an LXRα agonist or an LXRβ agonist, e.g., an LXRβ agonist).
In some embodiments, the subject can be a subject in need thereof (e.g., a subject identified as being in need of such treatment). Identifying a subject in need of such treatment can be in the judgment of a subject or a health care professional and can be subjective (e.g. opinion) or objective (e.g. measurable by a test or diagnostic method). In some embodiments, the subject can be a mammal. In certain embodiments, the subject is a human.
In a further aspect, this invention also relates to methods of making compounds described herein. Alternatively, the method includes taking any one of the intermediate compounds described herein and reacting it with one or more chemical reagents in one or more steps to produce a compound described herein.
In one aspect, this invention relates to a packaged product. The packaged product includes a container, one of the aforementioned compounds in the container, and a legend (e.g., a label or an insert) associated with the container and indicating administration of the compound for treatment and control of the diseases or disorders described herein.
In embodiments, any compound, composition, or method can also include any one or more of the following features (alone or in combination) and/or any one or more of the features (alone or in combination) delineated in the detailed description and/or in the claims.
R1 can be hydrogen.
R1 can be C1-C6 alkyl or C1-C4 haloalkyl (e.g., CF3). For example, R1 can be CH3 (i.e., methyl), CH3CH2 (i.e., ethyl), or (CH3)2CH (i.e., isopropyl). As another example, R1 can be CH3, CH3CH2, (CH3)2CH, or (CH3)3C (i.e., tert-butyl).
R1 can be C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-10 Ra. In certain embodiments, R1 can be C1-C6 alkyl (e.g., CH3CH2 or (CH3)2CH). In other embodiments, R1 can be C1-C6 (e.g., C1-C3, C1) alkyl that is substituted with 1 Ra, in which Ra can be as defined anywhere herein. In certain embodiments, Ra can be NRmRn; C1-C6 alkoxy; or heterocyclyl including 5 or 6 ring atoms, which is which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1) Rc. For example, Ra can be heterocyclyl including 5 or 6 ring atoms, which is which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1) Rc. For example, Ra can be optionally substituted pyrrolidinyl or thiazolidinyl (e.g., thiazolidinyl).
R1 can be C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1) Rd. In embodiments, R1 can be phenyl, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1) Rd.
R1 can be C7-C11 aralkyl, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1) Rc. R1 can be C7-C11 aralkyl or heteroaralkyl including 6-11 atoms, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1) Rc. For example, R1 can be benzyl, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1 or 2) Rc.
R1 can be C3-C8 cycloalkyl or heterocyclyl including 3-8 atoms, each of which is optionally substituted with from 1-3 Rc.
R2 can be C6-C10 aryl, which is (a) substituted with from 1 R7; and (b) optionally substituted with from 1-2 Re. R2 can be C6-C10 aryl, which is (a) substituted with 1 R7; and (b) optionally substituted with from 1-4 Re. In embodiments, R2 can be phenyl, which is (a) substituted with 1 R7; and (b) optionally substituted with from 1 Re. In other embodiments, R2 can be phenyl, which is substituted with 1 R7.
R2 can have formula (A-2):
In some embodiments, each of R22, R23, and R24 can be, independently, hydrogen or Re. In these and other embodiments related to formula (A-2), each of W, A, and Re can be as defined anywhere herein.
In some embodiments, (i) each of R22, R23, and R24 is hydrogen; or (ii) one of R22, R23, and R24 is Re, and the other two are hydrogen.
In certain embodiments, each of R22, R23, and R24 can be hydrogen. In other embodiments, one of R22, R23, and R24 can be Re, and the other two are hydrogen. For example, R22 can be Re (e.g., halo, e.g., chloro) and each of R23 and R24 can be hydrogen.
W can be —O—. W can be a bond. W can be —W1(C1-6 alkylene)-; in embodiments, W1 can be —O—, and W can be, for example, —OCH2—. W can be C1-6 alkylene (e.g., —CH2—).
A can be C6-C10 aryl, which is (a) substituted with from 1 R9; and (b) optionally substituted with from 1-4 Rg. In embodiments, A can be phenyl, which is (a) substituted with 1 R9; and (b) optionally substituted with from 1-4 Rg.
A can have formula (B-1):
in which:
one of RA3 and RA4 is R9, the other of RA3 and RA4 is hydrogen; and
each of RA2, RA5, and RA6 is, independently, hydrogen or Rg. In these and other embodiments related to formula (B-1), each of R9 and Rg can be, independently, as defined anywhere herein.
R9 can be —W2—S(O)nR10. W2 can be a bond. W2 can be a bond, and n can be 2. R10 can be: C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-2 Ra. In embodiments, R10 can be C1-C6 alkyl, optionally substituted with from 1-2 Ra. For example, R10 can be C1-C5 alkyl (e.g., CH3, CH3CH2, (CH3)2CH, e.g., CH3). As another example, R10 can be C2-C6 alkyl substituted with 1 Ra. In embodiments, Ra can be hydroxyl, C1-C3 alkoxy, or NRmRn.
R9 can be —W2—C(O)OR13.
R9 can be —W2—S(O)nNR11R12. W2 can be a bond, and n can be 2. Each of R11 and R12 can be, independently: (i) hydrogen; or (ii) C1-C6 alkyl; or (iii) C7-C11 aralkyl, optionally substituted with from 1-5 Rc.
In some embodiments:
R2 can be C6-C10 aryl, which is (a) substituted with 1 R7; and (b) optionally substituted with from 1-4 (e.g., 1-2) Re; and
A can be C6-C10 aryl, which is (a) substituted with from 1 Rg; and (b) optionally substituted with from 1-4 R9. In these embodiments, each of R7, R9, Re, and Rg can be, independently, as defined anywhere herein.
In certain embodiments:
R2 can be phenyl, which is (a) substituted with 1 R7 (i.e., WA); and (b) optionally substituted with from 1 Re; and
A can be phenyl, which is (a) substituted with 1 R9; and (b) optionally substituted with from 1-4 R9. In these embodiments, each of R7, R9, Re, and Rg can be, independently, as defined anywhere herein.
R2 can have formula (C-1):
In some embodiments:
each of R22, R23, and R24 can be, independently, hydrogen or Re;
and
one of RA2, RA3, RA4, RA5, and RA6 can be R9, and the others are each, independently, hydrogen or Rg.
In some embodiments:
(i) each of R22, R23, and R24 can be hydrogen; or
(ii) one of R22, R23, and R24 can be Re, and the other two are hydrogen;
and
one of RA2, RA3, RA4, RA5, and RA6 can be R9, and the others are each, independently, hydrogen or Rg.
In these and other embodiments related to formula (C-1), each of W, R9, Re and Rg can be, independently, as defined anywhere herein.
Embodiments can include, for example, one or more of the following features (and/or any one or more other features described anywhere herein).
In certain embodiments, each of R22, R23, and R24 can be hydrogen. In other embodiments, one of R22, R23, and R24 can be Re, and the other two are hydrogen. For example, R22 can be Re (e.g., halo, e.g., chloro) and each of R23 and R24 can be hydrogen.
W can be —O—. W can be a bond. W is —W1(C1-6 alkylene)-; in embodiments, W1 can be —O—, and W can be, for example, —OCH2—. W can be C1-6 alkylene (e.g., —CH2—). W can be a bond, C1-6 alkylene (e.g., —CH2—), or —W1(C1-6 alkylene)- (e.g., —OCH2—).
R9 can be —W2—S(O)nR10 or —W2—S(O)nNR11R12.
One of RA3 and RA4 can be R9, and the other of RA3 and RA4 can be hydrogen; and each of RA2, RA5, and RA6 can be, independently, hydrogen or Rg.
In certain embodiments, RA3 is —W2—S(O)nR10. Each of RA2, RA5, and RA6 can be hydrogen. W2 can be a bond. n can be 2. R10 can be C1-C6 alkyl, optionally substituted with from 1-2 Ra. In embodiments, R10 can be C1-C5 alkyl (e.g., CH3, CH3CH2, (CH3)2CH, e.g., CH3). R10 can be C2-C6 alkyl substituted with 1 Ra. In embodiments, Ra can be hydroxyl, C1-C3 alkoxy, or NRmRn. RA5 can be hydrogen or Rg (e.g., Rg), and each of RA2 and RA6 can be hydrogen.
In certain embodiments, RA4 can be —W2—C(O)OR13. R13 can be hydrogen. R13 can be C1-C3 alkyl. W2 can be C1-C3 alkylene (e.g., CH2). W2 can be a bond. Each of RA2, RA5, and RA6 can be hydrogen.
One of RA3 and RA4 can be R9, and the other of RA3 and RA4 can be hydrogen; and each of RA2, RA5, and RA6 can be, independently, hydrogen or Rg. Each of RA2, RA5, and RA6 can be hydrogen. RA5 can be Rg (e.g., halo, e.g., fluoro), and each of RA2 and RA6 can be hydrogen.
In certain embodiments, RA3 can be R9, and RA4 can be hydrogen. In embodiments, R9 can be —W2—S(O)nR10 or —W2—S(O)nNR11R12
For example, when RA3 is R9, R9 can be —W2—S(O)nR10. W2 can be a bond; n can be 2; and R10 can be C1-C6 alkyl, optionally substituted with from 1-2 Ra. In embodiments, R10 can be C1-C5 alkyl (e.g., CH3, CH3CH2, (CH3)2CH, e.g., CH3). R10 can be C2-C6 alkyl substituted with 1 Ra. In embodiments, Ra can be hydroxyl, C1-C3 alkoxy, or NRmRn. Ra can also be cyano. RA5 can be hydrogen or Rg (e.g., Rg), and each of RA2 and RA6 can be hydrogen.
As another example, when RA3 is R9, R9 can be —W2—S(O)nNR11R12. W2 can be a bond; n can be 2, and each of R11 and R12 is, independently: (i) hydrogen; or (ii) C1-C6 alkyl; or (iii) C7-C11 aralkyl, optionally substituted with from 1-5 Rc.
Each of R3, R4, and R5 can be, independently: (i) hydrogen; or (ii) halo. Each of R3, R4, and R5 can be hydrogen.
R6 can be: (ii) halo; or (iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Re; or (iv) cyano.
R6 can be C1-C6 haloalkyl. In certain embodiments, R6 can be C1-C3 perfluoroalkyl (e.g., CF3).
R6 can be halo (e.g., chloro).
R6 can be cyano.
One or more of R1, R3, R4, R5, and R6 (e.g., R1 and/or R6) can be a substituent other than hydrogen.
The compound can have formula (VI):
In some embodiments:
R1 is:
(i) hydrogen; or
(ii) C1-C3 alkyl or C1-C3 haloalkyl; or
(iii) phenyl or heteroaryl including 5-6 atoms, each of which is optionally substituted with from 1-5 Rd; or
(iv) C7-C11 aralkyl or heteroaralkyl including 6-11 atoms, each of which is optionally substituted with from 1-3 Rc;
R6 is:
(ii) halo; or
(iii) C1-C3 alkyl or C1-C3 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) cyano; and
each of R22, R23, and R24 is, independently, hydrogen or Re (as defined anywhere herein).
Embodiments can include one or more of the following features (and/or any one or more other features described anywhere herein).
R1 can be hydrogen. R1 can be CH3, CH3CH2 or (CH3)2CH. R1 can be phenyl, which is optionally substituted with from 1-5 Rd. R1 can be benzyl, which is optionally substituted with from 1-5 Rd.
W can be —O—. W can be a bond. W can be —OCH2—.
A can have formula (B-1), in which one of RA3 and RA4 is R9, and the other of RA3 and RA4 is hydrogen; and each of RA2, RA5, and RA6 is, independently, hydrogen or Rg. RA3 can be —W2—S(O)nR10, in which W2 can be a bond, and n can be 2. R10 can be C1-C6 alkyl, optionally substituted with from 1-2 Ra. R10 can be CH3, CH2CH3, or isopropyl. R10 can be C2-C8 alkyl substituted with 1 Ra. Ra can be hydroxyl or C1-C3 alkoxy. RA5 can be hydrogen or Rg, and each of RA2 and RA6 can be hydrogen. RA4 is —W2—C(O)OR13. R13 can be hydrogen or C1-C3 alkyl. W2 can be CH2. Each of RA2, RA5, and RA6 can be hydrogen. Each of R3, R4, and R5 can be hydrogen. Each of R22, R23, and R24 can be hydrogen. One of R22, R23, and R24 can be Re, and the other two are hydrogen. For example, R22 can be Re (e.g., halo, e.g., chloro) and each of R23 and R24 can be hydrogen. R6 can be CF3. R6 can be chloro.
In some embodiments, the following definitions can apply to compounds having formula (VI):
R1 is:
(i) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(ii) phenyl or heteroaryl including 5-6 atoms, each of which is optionally substituted with from 1-5 Rd; or
(iii) C7-C11 aralkyl or heteroaralkyl including 6-11 atoms, each of which is optionally substituted with from 1-3 Rc;
each of R3, R4, and R5 is hydrogen;
R6 is:
(ii) halo; or
(iii) C1-C3 alkyl or C1-C3 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) cyano;
each of R22, R23, and R24 is hydrogen; or one of R22, R23, and R24 is Re, and the other two are hydrogen;
W is a bond, —O—, —OCH2—, or —CH2—;
A has formula (B-1), wherein one of RA3 and RA4 is R9, and the other of RA3 and RA4 is hydrogen; and each of RA2, RA5, and RA6 is, independently, hydrogen or Rg; and
R9 is —W2—S(O)nR12 or —W2—S(O)nNR11R12.
Embodiments can include any one or more of the features described anywhere herein.
The term “mammal” includes organisms, which include mice, rats, cows, sheep, pigs, rabbits, goats, horses, monkeys, dogs, cats, and humans.
“An effective amount” refers to an amount of a compound that confers a therapeutic effect (e.g., treats, controls, ameliorates, prevents, delays the onset of, or reduces the risk of developing a disease, disorder, or condition or symptoms thereof) on the treated subject. The therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect). An effective amount of the compound described above may range from about 0.01 mg/Kg to about 1000 mg/Kg, (e.g., from about 0.1 mg/Kg to about 100 mg/Kg, from about 1 mg/Kg to about 100 mg/Kg). Effective doses will also vary depending on route of administration, as well as the possibility of co-usage with other agents.
The term “halo” or “halogen” refers to any radical of fluorine, chlorine, bromine or iodine.
In general, and unless otherwise indicated, substituent (radical) prefix names are derived from the parent hydride by either (i) replacing the “ane” in the parent hydride with the suffixes “yl,” “diyl,” “triyl,” “tetrayl,” etc.; or (ii) replacing the “e” in the parent hydride with the suffixes “yl,” “diyl,” “triyl,” “tetrayl,” etc. (here the atom(s) with the free valence, when specified, is (are) given numbers as low as is consistent with any established numbering of the parent hydride). Accepted contracted names, e.g., adamantyl, naphthyl, anthryl, phenanthryl, furyl, pyridyl, isoquinolyl, quinolyl, and piperidyl, and trivial names, e.g., vinyl, allyl, phenyl, and thienyl are also used herein throughout. Conventional numbering/lettering systems are also adhered to for substituent numbering and the nomenclature of fused, bicyclic, tricyclic, polycyclic rings.
The term “alkyl” refers to a saturated hydrocarbon chain that may be a straight chain or branched chain, containing the indicated number of carbon atoms. For example, C1-C20 alkyl indicates that the group may have from 1 to 20 (inclusive) carbon atoms in it. Any atom can be optionally substituted, e.g., by one or more substitutents. Examples of alkyl groups include without limitation methyl, ethyl, n-propyl, isopropyl, and tert-butyl.
The term “cycloalkyl” refers to saturated monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups. Any atom can be optionally substituted, e.g., by one or more substituents. A ring carbon serves as the point of attachment of a cycloalkyl group to another moiety. Cycloalkyl groups can contain fused rings. Fused rings are rings that share a common carbon atom. Cycloalkyl moieties can include, e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, adamantyl, and norbornyl (bicycle[2.2.1]heptyl).
The terms “alkylene,” “alkenylene,” “alkynylene,” and “cycloalkylene” refer to divalent straight chain or branched chain alkyl (e.g., —CH2—), alkenyl (e.g., —CH═CH—), alkynyl (e.g., —C≡C—); or cycloalkyl moieties, respectively.
The term “haloalkyl” refers to an alkyl group, in which at least one hydrogen atom is replaced by halo. In some embodiments, more than one hydrogen atom (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, etc. hydrogen atoms) on a alkyl group can be replaced by more than one halogen (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, etc. halogen atoms). In these embodiments, the hydrogen atoms can each be replaced by the same halogen (e.g., fluoro) or the hydrogen atoms can be replaced by a combination of different halogens (e.g., fluoro and chloro). “Haloalkyl” also includes alkyl moieties in which all hydrogens have been replaced by halo (e.g., perhaloalkyl, e.g., perfluoroalkyl, such as trifluoromethyl). Any atom can be optionally substituted, e.g., by one or more substituents.
The term “aralkyl” refers to an alkyl moiety in which an alkyl hydrogen atom is replaced by an aryl group. One of the carbons of the alkyl moiety serves as the point of attachment of the aralkyl group to another moiety. Aralkyl includes groups in which more than one hydrogen atom on an alkyl moiety has been replaced by an aryl group. Any ring or chain atom can be optionally substituted e.g., by one or more substituents. Non-limiting examples of “aralkyl” include benzyl, 2-phenylethyl, 3-phenylpropyl, benzhydryl (diphenylmethyl), and trityl (triphenylmethyl) groups.
The term “heteroaralkyl” refers to an alkyl moiety in which an alkyl hydrogen atom is replaced by a heteroaryl group. One of the carbons of the alkyl moiety serves as the point of attachment of the aralkyl group to another moiety. Heteroaralkyl includes groups in which more than one hydrogen atom on an alkyl moiety has been replaced by a heteroaryl group. Any ring or chain atom can be optionally substituted e.g., by one or more substituents. Heteroaralkyl can include, for example, 2-pyridylethyl.
The term “alkenyl” refers to a straight or branched hydrocarbon chain containing 2-20 carbon atoms and having one or more double bonds. Any atom can be optionally substituted, e.g., by one or more substituents. Alkenyl groups can include, e.g., allyl, 1-butenyl, 2-hexenyl and 3-octenyl groups. One of the double bond carbons can optionally be the point of attachment of the alkenyl substituent. The term “alkynyl” refers to a straight or branched hydrocarbon chain containing 2-20 carbon atoms and having one or more triple bonds. Any atom can be optionally substituted, e.g., by one or more substituents. Alkynyl groups can include, e.g., ethynyl, propargyl, and 3-hexynyl. One of the triple bond carbons can optionally be the point of attachment of the alkynyl substituent.
The term “alkoxy” refers to an —O-alkyl radical. The term “mercapto” refers to an SH radical. The term “thioalkoxy” refers to an —S-alkyl radical. The terms “aryloxy” and “heteroaryloxy” refer to an —O-aryl radical and —O-heteroaryl radical, respectively. The terms “thioaryloxy” and “thioheteroaryloxy” refer to an —S-aryl radical and —S-heteroaryl radical, respectively.
The terms “aralkoxy” and “heteroaralkoxy” refer to an —O-aralkyl radical and —O-heteroaralkyl radical, respectively. The terms “thioaralkoxy” and “thioheteroaralkoxy” refer to an —S-aralkyl radical and —S-heteroaralkyl radical, respectively. The term “cycloalkoxy” refers to an —O-cycloalkyl radical. The terms “cycloalkenyloxy” and “heterocycloalkenyloxy” refer to an —O-cycloalkenyl radical and —O-heterocycloalkenyl radical, respectively. The term “heterocyclyloxy” refers to an —O-heterocyclyl radical. The term “thiocycloalkoxy” refers to an —S-cycloalkyl radical. The terms “thiocycloalkenyloxy” and “thioheterocycloalkenyloxy” refer to an —S-cycloalkenyl radical and —S-heterocycloalkenyl radical, respectively. The term “thioheterocyclyloxy” refers to an —S-heterocyclyl radical.
The term “heterocyclyl” refers to a saturated monocyclic, bicyclic, tricyclic or other polycyclic ring system having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (and mono and dioxides thereof, e.g., N→O−, S(O), SO2). Thus, a heterocyclyl ring includes carbon atoms and 1-4, 1-8, or 1-10 heteroatoms selected from N, O, or S if monocyclic, bicyclic, or tricyclic, respectively. A ring heteroatom or ring carbon is the point of attachment of the heterocyclyl substituent to another moiety. Any atom can be optionally substituted, e.g., by one or more substituents. The heterocyclyl groups can contain fused rings. Fused rings are rings that share a common carbon or nitrogen atom. Heterocyclyl groups can include, e.g., tetrahydrofuryl, tetrahydropyranyl, piperidyl (piperidino), piperazinyl, morpholinyl (morpholino), pyrrolinyl, and pyrrolidinyl.
The term “cycloalkenyl” refers to partially unsaturated monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups. A ring carbon (e.g., saturated or unsaturated) is the point of attachment of the cycloalkenyl substituent. Any atom can be optionally substituted e.g., by one or more substituents. The cycloalkenyl groups can contain fused rings. Fused rings are rings that share a common carbon atom. Cycloalkenyl moieties can include, e.g., cyclohexenyl, cyclohexadienyl, or norbornenyl.
The term “heterocycloalkenyl” refers to partially unsaturated monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (and mono and dioxides thereof, e.g., N→O−, S(O), SO2) (e.g., carbon atoms and 1-4, 1-8, or 1-10 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively). A ring carbon (e.g., saturated or unsaturated) or heteroatom is the point of attachment of the heterocycloalkenyl substituent. Any atom can be optionally substituted, e.g., by one or more substituents. The heterocycloalkenyl groups can contain fused rings. Fused rings are rings that share a common carbon or nitrogen atom. Heterocycloalkenyl groups can include, e.g., tetrahydropyridyl, dihydropyranyl, 4,5-dihydrooxazolyl, 4,5-dihydro-1H-imidazolyl, 1,2,5,6-tetrahydro-pyrimidinyl, and 5,6-dihydro-2H-[1,3]oxazinyl.
The term “aryl” refers to a fully unsaturated, aromatic monocyclic, bicyclic, or tricyclic, hydrocarbon ring system, wherein any ring atom can be optionally substituted, e.g., by one or more substituents. Aryl groups can contain fused rings. Fused rings are rings that share a common carbon atom. Aryl moieties can include, e.g., phenyl, naphthyl, anthracenyl, and pyrenyl.
The term “heteroaryl” refers to a fully unsaturated, aromatic monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms independently selected from O, N, or S (and mono and dioxides thereof, e.g., N→O−, S(O), SO2) (e.g., carbon atoms and 1-4, 1-8, or 1-10 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively). Any atom can be optionally substituted, e.g., by one or more substituents. Heteroaryl groups can contain fused rings. Fused rings are rings that share a common carbon or nitrogen atom. Heteroaryl groups can include, e.g., pyridyl, thienyl, furyl (furanyl), imidazolyl, indolyl, isoquinolyl, quinolyl and pyrrolyl.
The descriptor C(O) refers to a carbon atom that is doubly bonded to oxygen.
The term “substituent” refers to a group “substituted” on, e.g., an alkyl, haloalkyl, cycloalkyl, alkenyl, alkynyl, aralkyl, heteroaralkyl, heterocyclyl, heterocycloalkenyl, cycloalkenyl, aryl, or heteroaryl group at any atom of that group. In one aspect, the substituent(s) (e.g., Rd) on a group are independently any one single, or any combination of two or more of the permissible atoms or groups of atoms delineated for that substituent. In another aspect, a substituent may itself be substituted with any one of the above substituents.
In general, when a definition for a particular variable includes both hydrogen and non-hydrogen (halo, alkyl, aryl, etc.) possibilities, the term “substituent(s) other than hydrogen” refers collectively to the non-hydrogen possibilities for that particular variable.
Descriptors such as “C1-C6 alkyl which is optionally substituted with from 1-2 Ra” (and the like) is intended to include as alternatives both unsubstituted C1-C6 alkyl and C1-C6 alkyl that is substituted with from 1-2 Ra. The use of a substituent (radical) prefix names such as alkyl without the modifier “optionally substituted” or “substituted” is understood to mean that the particular substituent is unsubstituted. However, the use of “haloalkyl” without the modifier “optionally substituted” or “substituted” is still understood to mean an alkyl group, in which at least one hydrogen atom is replaced by halo.
In some embodiments, the compounds have agonist activity for genes involved with HDL production and cholesterol efflux (e.g., ABCA1) and antagonist activity for genes involved with triglyceride synthesis (e.g., SREBP-1c).
The details of one or more embodiments of the invention are set forth in the description below. Other features and advantages of the invention will be apparent from the description and from the claims.
This invention relates generally to imidazo[1,2-a]pyridine-based modulators of Liver X receptors (LXRs) and related methods.
The imidazo[1,2-a]pyridine-based LXR modulators have the general formula (I):
in which R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, W, W1, W2, A, Ra, Rb, Rc, Rd, Re, Rg, Rh, Rm, Rn, and n, can be, independently, as defined anywhere herein.
For ease of exposition, it is understood that where in this specification (including the claims), a group is defined by “as defined anywhere herein” (or the like), the definitions for that particular group include the first occurring and broadest generic definition as well as any sub-generic and specific definitions delineated anywhere in this specification.
Variable R1
In some embodiments, R1 can be:
(1-i) hydrogen; or
(1-ii) C1-C6 (e.g., C1-C3) alkyl or C1-C6 (e.g., C1-C4 or C1-C3) haloalkyl, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-2, 1) Ra; or
(1-iv) C3-C10 (e.g., C3-C8 or C3-C6) cycloalkyl, C3-C10 (e.g., C3-Cs or C3-C6) cycloalkenyl, heterocyclyl including 3-10 (e.g., 3-8 or 3-6) atoms, heterocycloalkenyl including 3-10 (e.g., 3-8 or 3-6) atoms, C7-C11 (e.g., C7-C10) aralkyl, or heteroaralkyl including 6-11 (e.g., 6-10) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-2, 1) Rc; or
(1-v) C6-C10 (e.g., phenyl) aryl or heteroaryl including 5-10 (e.g., 5-6) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-2, 1) Rd.
In some embodiments, R1 can be:
(1-i) hydrogen; or
(1-ii) C1-C6 (e.g., C1-C3) alkyl or C1-C6 (e.g., C1-C4) haloalkyl, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-2, 1) Ra; or
(1-iv′) C7-C11 (e.g., C7-C10) aralkyl, or heteroaralkyl including 6-11 (e.g., 6-10) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-2, 1) Rc; or
(1-v) C6-C10 (e.g., phenyl) aryl or heteroaryl including 5-10 (e.g., 5-6) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-2, 1) Rd.
In some embodiments, R1 can be any one of: (1-i), (1-ii), (1-iv), (1-iv′), and (1-v). In certain embodiments, R1 can be hydrogen. In other embodiments, R1 can be a substituent other than hydrogen.
In some embodiments, R1 can be any two of: (1-i), (1-ii), (1-iv), (1-iv′), and (1-v). In certain embodiments, R1 can be hydrogen and any one of (1-ii), (1-iv), (1-iv′), and (1-v). In other embodiments, R1 can be any two of (1-ii), (1-iv), (1-iv′), and (1-v), e.g., R1 can be (1-ii) and (1-iv′).
In some embodiments, R1 can be any three of: (1-i), (1-ii), (1-iv), (1-iv′), and (1-v). In certain embodiments, R1 can be hydrogen and any two of (1-ii), (1-iv), (1-iv′), and (1-v), e.g., R1 can be (1-ii) and (1-iv′). In other embodiments, R1 can be any three of (1-11), (1-iv), (1-iv′), and (1-v), e.g., (1-ii), (1-iv′), and (1-v).
In embodiments, R1 can be C1-C6 (e.g., C1-C3) alkyl. For example, R1 can be methyl (CH3), ethyl (CH2CH3), or isopropyl (CH(CH3)2).
In embodiments, R1 can be C1-C6 (e.g., C1-C3, C1) alkyl that is substituted with 1 Ra, in which Ra can be as defined anywhere herein. In certain embodiments, Ra can be NRmRn; C1-C6 alkoxy; or heterocyclyl including 5 or 6 ring atoms, which is which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1) Rc. For example, Ra can be heterocyclyl including 5 or 6 ring atoms, which is which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1) Rc. For example, Ra can be optionally substituted pyrrolidinyl or thiazolidinyl (e.g., thiazolidinyl).
In embodiments, R1 can be C1-C6 (e.g., C1-C4 or C1-C3) haloalkyl (e.g., perhaloalkyl). For example, R1 can be CF3.
In embodiments, R1 can be C7-C11 (e.g., C7-C10) aralkyl, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc. For example, R1 can be benzyl or 2-phenylethyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc.
In embodiments, R1 can be heteroaralkyl including 6-10 atoms, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc. In certain embodiments, the alkyl portion can be C1-C2 alkylene, and the heteroaryl portion can be thienyl, furyl, pyrrolyl, or pyridinyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc.
In embodiments, R1 can be C6-C10 aryl, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rd. For example, R1 can be phenyl, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rd.
In embodiments, R1 can be heteroaryl including 5-10 (e.g., 5-6) atoms, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rd. For example, R1 can be thienyl, furyl, pyrrolyl, or pyridinyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rd.
In some embodiments, R1 can be halo (e.g., chloro).
In other embodiments, R1 can be other than halo.
Variable R2
In some embodiments, R2 can be C6-C10 (e.g., phenyl) aryl, which is (i) substituted with 1 R7 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) Re.
In some embodiments, when R2 is aryl and substituted with Re, each Re can be independently of one another: halo (e.g., chloro); C1-C3 alkyl; C1-C3 haloalkyl (e.g., C1-C3 fluoroalkyl, e.g., 1-5 fluorines can be present; or C1-C3 perfluoroalkyl); CN; hydroxyl; NRmRn (e.g., NH2, monoalkylamino, or dialkylamino); C1-C3 alkoxy; C1-C3 haloalkoxy.
In certain embodiments, when R2 is substituted with Re, each Re can be independently of one another: C1-C3 alkyl; C1-C3 haloalkyl, e.g., C1-C3 perfluoroalkyl; halo (e.g., chloro); or CN.
In certain embodiments, when R2 is substituted with Re, each Re can be independently of one another: C1-C3 alkyl; C1-C3 haloalkyl, e.g., C1-C3 perfluoroalkyl; halo (e.g., chloro).
In certain embodiments, when R2 is substituted with Re, each Re can be independently of one another halo (e.g., chloro).
In some embodiments, R2 can be C6-C10 aryl, which is (i) substituted with 1 R7 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) Re.
In some embodiments, R2 can be C6-C10 aryl, which is (i) substituted with 1 or 2 R7 and (ii) optionally substituted with 1 or 2 Re.
In certain embodiments, R2 can be phenyl, which is (i) substituted with 1 R7 and (ii) optionally substituted with 1 or 2 (e.g., 1) Re (e.g., halo, e.g., chloro). In other embodiments, R2 can be phenyl, which is substituted with 1 R7. In these embodiments, R2 can have formula (A), in which R7 (i.e., the moiety —WA) can be attached to a ring carbon that is ortho, meta, or para (e.g., meta) with respect to the ring carbon that connects the phenyl ring to the 3-position of the imidazo[1,2-a]pyridine ring, and Re, when present can be connected to ring carbons that are not occupied by WA. For example, R2 can have formula (A-1), in which R7 (WA) is attached to the ring carbon that is meta with respect to the ring carbon that connects the phenyl ring to the 3-position of the imidazo[1,2-a]pyridine ring in formula (I). As another example, R7 (WA) can be attached to the ring carbon that is para with respect to the ring carbon that connects the phenyl ring to the 3-position of the imidazo[1,2-a]pyridine ring in formula (I).
In certain embodiments, R2 can have formula (A-2):
in which each of R22, R23, and R24 can be, independently of one another, hydrogen or Re, in which Re can be as defined anywhere herein. In embodiments, each of R22, R23, and R24 can be hydrogen; or one of R22, R23, and R24 can be Re, and the other two are hydrogen. In these and other embodiments related to formula (A-2), each of W, A, and Re can be as defined anywhere herein.
In embodiments, each of R22, R23, and R24 can be hydrogen.
In other embodiments, each of R22, R23, and R24 can be a substituent other than hydrogen. In still other embodiments, one or two of R22, R23 and R24 can be Re, and the other(s) are hydrogen.
In certain embodiments, one of R22, R23, and R24 can be Re, and the other two are hydrogen. In embodiments, R22 can be Re, and each of R23 and R24 can be hydrogen. In certain embodiments, Re can be: halo (e.g., chloro); C1-C3 alkyl; or C1-C3 haloalkyl (e.g., C1-C3 fluoroalkyl, e.g., 1-5 fluorines can be present; or C1-C3 perfluoroalkyl). In certain embodiments, Re can be halo (e.g., chloro).
In some embodiments, R2 can be heteroaryl including 5-10 (e.g., 5-6) atoms, which is (i) substituted with 1 R7 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) Re.
In embodiments, when R2 is heteroaryl and substituted with Re, each Re can be independently as defined anywhere herein. For example, each Re can be independently of one another: C1-C3 alkyl; C1-C3 haloalkyl, e.g., C1-C3 perfluoroalkyl; halo (e.g., chloro); e.g., each Re can be halo (e.g., chloro).
In some embodiments, R2 can be heteroaryl including 5-10 atoms, which is (i) substituted with 1 R7 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) Re.
In some embodiments, R2 can be heteroaryl including 5-10 atoms, which is (i) substituted with 1 R7 and (ii) optionally substituted with 1 or 2 Re.
In some embodiments, R2 can be heteroaryl including 5-6 atoms, which is (i) substituted with 1 R7 and (ii) optionally substituted with 1 or 2 Re.
In some embodiments, R2 can be heteroaryl including 8-10 atoms, which is (i) substituted with 1 R7 and (ii) optionally substituted with 1 or 2 Re.
In certain embodiments, R2 can be pyridyl, pyrimidinyl, thienyl, furyl, quinolinyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, indolyl, benzo[1,3]-dioxolyl, benzo[1,2,5]-oxadiazolyl, isochromenyl-1-one, 3-H-isobenzofuranyl-1-one (e.g., pyridyl, thienyl, or indolyl, e.g., pyridyl), each of which is (i) substituted with 1 R7 and (ii) optionally substituted with 1 or 2 Re. For example, R2 can be pyridyl substituted with 1 R7.
Variable W
In some embodiments, W can be —O—.
In some embodiments, W can be a bond.
In other embodiments, W can be —W1(C1-6 alkylene)-. In certain embodiments, W1 can be —O—. For example, W can be —O(C1-3 alkylene)- (e.g., —OCH2—).
In some embodiments, W can be —NR8— (e.g., —NH—).
In some embodiments, W can be —(C1-6 alkylene)W1—. In certain embodiments, W1 is —NR9—, in which R9 can be hydrogen; or W1 can be —O—. In certain embodiments, W can be —(C1-3 alkylene)NH— (e.g., —CH2NH—). In certain embodiments, W can be —(C1-3 alkylene)O— (e.g., —CH2O—).
In still other embodiments, W can be C2-C4 alkenylene (e.g., —CH═CH—); C2-C4 alkynylene (e.g., —C≡C—); or C1-3 alkylene (e.g., CH2).
Variable A
In general, A is an aromatic or heteroaromatic ring system that is (a) substituted with one R9; and (b) optionally substituted with one or more Rg.
In some embodiments, A can be C6-C10 (e.g., phenyl) aryl, which is (a) substituted with 1 R9; and (b) optionally further substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1, e.g., 1-2) Rg, in which Rg can be as defined anywhere herein.
In embodiments, when A is aryl and substituted with one or more Rg, each Rg can be independently of one another:
(i) halo; C1-C6 (e.g., C1-C3) alkoxy or C1-C6 (e.g., C1-C3) haloalkoxy; or cyano; or
(ii) C1-C6 (e.g., C1-C3) alkyl or C1-C6 (e.g., C1-C3) haloalkyl.
In certain embodiments, Rg is other than cyano.
In embodiments, when A is aryl and substituted with one or more Rg, each Rg can be independently of one another:
In certain embodiments, Rg is other than cyano.
In some embodiments, A can be C6-C10 aryl, which is (i) substituted with 1 R9 and (ii) optionally substituted with from 1-5 (e.g., 1-5, 1-4, 1-3, 1-2, 1, e.g., 1-2) Rg.
In some embodiments, A can be phenyl, which is (i) substituted with 1 R9 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) Rg.
In these embodiments, R9 can be attached to a ring carbon that is ortho, meta, or para (e.g., meta or para) with respect to the ring carbon that connects the phenyl ring to W.
In certain embodiments, A can have formula (B-1):
in which one of RA3 and RA4 is R9, the other of RA3 and RA4 and each of RA2, RA5, and RA6 is, independently, hydrogen or Rg. In these and other embodiments related to formula (B-1), each of R9 and Rg can be, independently, as defined anywhere herein.
In embodiments, one of RA3 and RA4 can be R9, the other of RA3 and RA4 can be hydrogen; and each of RA2, RA5, and RA6 can be, independently, hydrogen or Rg.
In certain embodiments, RA3 can be R9. For example, RA3 can be R9, RA4 can be hydrogen, and each of RA2, RA5, and RA6 can be hydrogen. As another example, RA3 can be R9; RA4 can be hydrogen; one of RA2, RA5, and RA6 (e.g., RA5) can be Rg (e.g., halo) and the other two of RA2, RA5, and RA6 can be hydrogen.
In certain embodiments, RA4 can be R9. For example, RA4 can be R9, RA3 can be hydrogen, and each of RA2, RA5, and RA6 can be hydrogen. As another example, RA3 can be R9; RA4 can be hydrogen; one of RA2, RA5, and RA6 can be Rg (e.g., halo) and the other two of RA2, RA5, and RA6 can be hydrogen.
In some embodiments, A can be heteroaryl including 5-10 atoms, which is (a) substituted 1 R9; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Rg, in which R9 can be as defined anywhere herein.
In certain embodiments, A can be pyrrolyl, pyridyl, pyridyl-N-oxide, pyrazolyl, pyrimidinyl, thienyl, furyl, quinolinyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, indolyl, benzo[1,3]-dioxolyl, benzo[1,2,5]-oxadiazolyl, isochromenyl-1-one, 3-H-isobenzofuranyl-1-one (e.g., pyridyl, thienyl, or indolyl, e.g., pyridyl), which is (i) substituted with 1 R9 and (ii) optionally substituted with 1-3 (e.g., 1-2, 1) Rg.
In certain embodiments, A can be pyrrolyl, pyridyl, pyrimidinyl, pyrazolyl, thienyl, furyl, quinolyl, oxazolyl, thiazolyl, imidazolyl, or isoxazolyl, each of which is (a) substituted with 1 R9; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Rg.
In certain embodiments, A can be pyridyl, pyrimidinyl, thienyl, furyl, oxazolyl, thiazolyl, imidazolyl, or isoxazolyl, each of which is (a) substituted with 1 R9; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Rg.
In certain embodiments, A can be pyridyl in which W is attached to the 2- or 3-position of the pyridiyl ring. For example, A can be pyridyl in which W is attached to the 2-position of the pyridyl ring, and R9 is attached to the 4- or the 6-position of the pyridyl ring. Such rings can be further substituted with 1, 2 or 3 Rg (e.g., halo, e.g., chloro; or NRgRh, e.g., NH2).
Variable R9
R9 can be:
(9-i)—W2—S(O)nR10 or —W2—S(O)nNR11R12; or
(9-ii) —W2—C(O)OR13; or
(9-iii) —W2—C(O)NR11R12; or
(9-iv) C1-C12 alkyl or C1-C12 haloalkyl, each of which is:
or
(9-v)—NR14R15.
In some embodiments, R9 can be:
In some embodiments, R9 can be any one of: (9-i), (9-i′), (9-ii), (9-iii), (9-iv), or (9-v). In certain embodiments, R9 can be —W2—S(O)nR10 or—W2—S(O)nNR11R12 (e.g., —W2—S(O)nR10. In other embodiments, R9 can be —W2—C(O)OR13.
In some embodiments, R9 can be any two of: (9-i), (9-i′), (9-ii), (9-iii), (9-iv), or (9-v). In certain embodiments, R9 can be —W2—S(O)nR10 or —W2—S(O)nNR11R12 (e.g., W2—S(O)nR10 and any one of (9-ii), (9-iii), (9-iv), or (9-v). For example, R9 can be:
In other embodiments, R9 can be any two of (9-ii), (9-iii), (9-iv), or (9-v).
In some embodiments, R9 can be any three of: (9-i), (9-i′), (9-ii), (9-iii), (9-iv), or (9-v).
In certain embodiments, R9 can be —W2—S(O)nR10, —W2—S(O)nNR11R12, and —W2—C(O)OR13.
In certain embodiments, R9 can be:
In other embodiments, R9 can be (9-iii), (9-iv), or (9-v).
In some embodiments, R9 can be —W2—S(O)nR10 (e.g., —W2—S(O)2R10, in which n is 2). In embodiments, W2 can be a bond, i.e., R9 is connected to variable A by the sulfur (S) atom of the sulfinyl or the sulfonyl group.
In some embodiments, R10 can be C1-C6 (e.g., C1-C5) alkyl or C1-C6 (e.g., C1-C5 or C1-C3) haloalkyl, optionally substituted with from 1-2 Ra.
In certain embodiments, R10 can be C2-C6 alkyl, that is substituted with from 1-2 (e.g., 1) Ra.
In certain embodiments, R10 can be unsubstituted branched or unbranched C1-C6 (e.g., C1-C5, C2-C6, or C3-C6) alkyl. For example, R10 can be methyl (CH3). As another example, R10 can be ethyl (CH2CH3). As a further example, R10 can be isopropyl (CH(CH3)2).
In certain embodiments, R10 can be branched or unbranched C2-C6 (e.g., C3-C6 or C3-C5) alkyl, which is substituted with 1 Ra. In embodiments, Ra can be: hydroxyl; C1-C6 (e.g., C1-C3) alkoxy; C3-C7 cycloalkoxy or C6-C10 aryloxy, each of which can be optionally substituted with Rc and Rd, respectively; NRmRn; halo; or heterocyclyl including 3-8 atoms, which is optionally substituted with from 1-5 Rc. In other embodiments, Ra can also be cyano. For example, Ra can be hydroxyl, C1-C6 (e.g., C1-C3) alkoxy, or NRmRn. As another example, Ra can be cyano. In certain embodiments, Ra (e.g., hydroxyl) can be attached to a secondary or tertiary carbon atom of the alkyl group or a primary carbon of the alkyl group. In embodiments, R10 can be hydroxyl substituted C3-C6 (e.g., C3-C5) alkyl. In other embodiments, R10 can be C3-C6 (e.g., C3-C5) alkyl that is substituted with an amino group (NH2) or a secondary or tertiary amino group.
In certain embodiments, R10 can be C7-C11 aralkyl (e.g., benzyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rc.
In certain embodiments, R10 can be C6-C10 aryl, optionally substituted with from 1-2 Rd.
In some embodiments, R9 can be —W2—S(O)nNR11R12 (e.g., —W2—S(O)2NR11R12, in which n is 2). In embodiments, W2 can be a bond, i.e., R9 is connected to variable A by the sulfur (S) atom of the sulfinamide or sulfonamide group.
In certain embodiments, one or both of R11 and R12 can be hydrogen. In certain embodiments, R9 can be —S(O)2NH2.
In other embodiments, one of R11 and R12 can be hydrogen, and the other of R11 and R12 can be:
(i) C1-C6 (e.g., C1-C3) alkyl or C1-C6 (e.g., C1-C3) haloalkyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Ra (e.g., Ra can be: hydroxyl; C1-C6 (e.g., C1-C3) alkoxy; C3-C7 cycloalkoxy or C6-C10 aryloxy, each of which can be optionally substituted with Rc and Rd, respectively; NRmRn; or heterocyclyl including 3-8 atoms, which is optionally substituted with from 1-5 Rc); or
(iii) C7-C11 aralkyl, or heteroaralkyl including 6-11 atoms, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc; or
(iv) C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rd.
In certain embodiments, one of R11 and R12 can be hydrogen, and the other of R11 and R12 can be C1-C6 (e.g., C1-C3) alkyl or C1-C6 (e.g., C1-C3) haloalkyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Ra. For example, one of R11 and R12 can be hydrogen, and the other of R11 and R12 can be C1-C6 (e.g., C1-C3) alkyl, such as CH3.
In certain embodiments, R11 and R12 can each be, independently of one another:
(i) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-5 Ra; or
(ii) C2-C6 alkenyl or C2-C6 alkynyl, each of which is optionally substituted with from 1-5 Rb; or
(iii) C3-C10 cycloalkyl, C3-C10 cycloalkenyl, heterocyclyl including 3-10 atoms, heterocycloalkenyl including 3-10 atoms, C7-C11 aralkyl, or heteroaralkyl including 6-11 atoms, each of which is optionally substituted with from 1-5 Rc; or
(iv) C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is optionally substituted with from 1-5 Rd.
In certain embodiments, R11 and R12 can each be, independently of one another:
(i) C1-C6 (e.g., C1-C3) alkyl or C1-C6 (e.g., C1-C3) haloalkyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Ra (e.g., Ra can be: hydroxyl; C1-C6 (e.g., C1-C3) alkoxy; C3-C7 cycloalkoxy or C6-C10 aryloxy, each of which can be optionally substituted with Rc and Rd, respectively; NRmRn; or heterocyclyl including 3-8 atoms, which is optionally substituted with from 1-5 Rc); or
(iii) C7-C11 aralkyl, or heteroaralkyl including 6-11 atoms, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc; or
(iv) C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rd.
In certain embodiments, R11 and R12 can each be, independently of one another:
(i) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-5 Ra; or
C7-C11 aralkyl, or heteroaralkyl including 6-11 atoms, each of which is optionally substituted with from 1-5 Rc.
For example, R11 and R12 can each be, independently of one another C1-C6 alkyl or C7-C11 aralkyl, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc.
In certain embodiments, R11 and R12 together with the nitrogen atom to which they are attached can form a heterocyclyl including 3-10 (e.g., 3-8, or 3-6) atoms or a heterocycloalkenyl including 3-10 (e.g., 3-8, or 3-6) atoms, each of which is optionally substituted with from 1-5 (1-4, 1-3, 1-2, 1) Rc. In some embodiments, the heterocyclyl can further include one or more additional ring heteroatoms (e.g., N, O, or S).
In certain embodiments, R11 and R12 together with the nitrogen atom to which they are attached can form a heterocyclyl including 3-10 (e.g., 3-8, 3-6, or 5-6) atoms, which is optionally substituted with from 1-5 (1-4, 1-3, 1-2, 1) Rc. For example, R11 and R12 together with the nitrogen atom to which they are attached can form a morpholinyl, piperidyl, pyrrolidinyl, or piperazinyl ring, each of which is optionally substituted with from 1-5 (1-4, 1-3, 1-2, 1) Rc.
In some embodiments, R9 can be —W2—C(O)OR13. In some embodiments, W2 can be C1-C6 alkylene; or a bond. In certain embodiments, W2 can be C1-C6 alkylene. For example, W2 can be C1-C3 alkylene, such as CH2 or CH2CH2. In other embodiments, W2 can be a bond.
In some embodiments, R13 can be:
(i) hydrogen; or
(ii) C1-C6 (e.g., C1-C7) alkyl, which is optionally substituted with from 1-3 (e.g., 1-2, 1) Ra; or
(iii) C3-C7 cycloalkyl or C7-C11 aralkyl, each of which is optionally substituted with from 1-5 Rc; or
(iv) C6-C10 aryl or heteroaryl including 5-10 atoms, each of which is optionally substituted with from 1-5 Rd.
In certain embodiments, R13 can be hydrogen. In other embodiments, R13 can be a substituent other than hydrogen.
In some embodiments, R9 can be —W2—C(O)NR11R12.
Embodiments can include, for example, any one or more of the features described above in conjunction with —W2—S(O)nNR11R12 and/or —W2—C(O)OR13.
In some embodiments, R9 can be: C1-C6 alkyl or C1-C6 haloalkyl, each of which is (a) substituted with from 1 Rh, and (b) optionally further substituted with from 1 or 2 Ra (e.g., Ra can be C3-C7 cycloalkyl, which is optionally substituted with from 1-5 Rc); or
In certain embodiments, Rh at each occurrence can be, independently, hydroxyl, C1-C6 alkoxy, C1-C6 haloalkoxy; C3-C10 cycloalkoxy, which is optionally substituted with from 1-5 Rc; or C6-C10 aryloxy or heteroaryloxy including 5-10 atoms, each of which is optionally substituted with from 1-5 Rd.
In certain embodiments, R9 can have the following formula: —C(R91)(R92)(Rh), in which each of R91 and R92 is, independently, C1-C12 alkyl or C1-C12 haloalkyl, each of which is optionally further substituted with from 1 or 2 Ra (e.g., Ra can be C3-C7 cycloalkyl, which is optionally substituted with from 1-5 Rc); C3-C7 cycloalkyl, which is optionally substituted with from 1-5 Rc; or C6-C10 aryl, which is optionally substituted with from 1-5 Rd; and Rh can be as defined anywhere herein.
In some embodiments, R9 can be —NR14R15, one of R14 and R15 is hydrogen or C1-C3 alkyl (e.g., hydrogen); and the other of R14 and R15 can be:
(i) —S(O)nR10; or
(ii) —C(O)OR13; or
(iii) —C(O)NR11R12; or
(iv) C1-C12 alkyl or C1-C12 haloalkyl, each of which is:
In embodiments, each of n, R10, R11, R12, R13, Rh, Ra, and Rd can be, independently, as defined anywhere herein. In embodiments, R13 can be other than hydrogen.
Variables R3, R4, and R5
In some embodiments, each of R3, R4, and R5 can be, independently:
(i) hydrogen; or
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
In certain embodiments, each of R3, R4, and R5 can be, independently:
(i) hydrogen; or
(ii) halo; or
(iii) C1-C3 alkyl or C1-C3 haloalkyl (e.g., perhaloalkyl, e.g., perfluoroalkyl), each of which is optionally substituted with from 1-3 Ra.
In certain embodiments, each of R3, R4, and R5 can be, independently, hydrogen or halo (e.g., fluoro).
In certain embodiments, each of R3, R4, and R5 can be hydrogen.
In certain embodiments, each of R3, R4, and R5 can be a substituent other than hydrogen (e.g., halo, e.g., fluoro).
In certain embodiments, one or two of R3, R4, and R5 can be hydrogen, and the other(s) can be:
(ii) halo; or
(iii) C1-C6 (e.g., C1-C3) alkyl or C1-C6 (e.g., C1-C3) haloalkyl (e.g., perhaloalkyl, e.g., perfluoroalkyl), each of which is optionally substituted with from 1-3 Ra.
In certain embodiments, when any of R3, R4, and R5 is alkyl that is substituted with one or more Ra, then the alkyl group is not directly substituted with an oxygen atom (e.g., Ra is other than hydroxyl, alkoxy, etc.).
Variable R6
In some embodiments, R6 can be:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Re; or
(iv) cyano.
In some embodiments, R6 can be halo, cyano, C1-C6 (e.g., C1-C3) alkyl, or C1-C6 (e.g., C1-C3) haloalkyl.
In some embodiments, R6 can be chloro or bromo (e.g., chloro), cyano, C1-C6 (e.g., C1-C3) alkyl, or C1-C6 (e.g., C1-C3) haloalkyl.
In some embodiments, R6 can be halo, C1-C6 (e.g., C1-C3) alkyl, or C1-C6 (e.g., C1-C3) haloalkyl.
In some embodiments, R6 can be chloro or bromo (e.g., chloro), C1-C6 (e.g., C1-C3) alkyl, or C1-C6 (e.g., C1-C3) haloalkyl.
In some embodiments, R6 can be halo (e.g., chloro) or C1-C6 (e.g., C1-C3) haloalkyl (e.g., CF3).
In some embodiments, R6 can be chloro or bromo (e.g., chloro) or C1-C6 (e.g., C1-C3) haloalkyl.
In certain embodiments, R6 can be chloro, cyano, CH3, or CF3. In certain embodiments, R6 can be chloro, CH3, or CF3. In certain embodiments, R6 can be chloro or CF3.
In some embodiments, R6 can be hydrogen.
In some embodiments, R6 can be hydrogen, halo, cyano, C1-C6 (e.g., C1-C3) alkyl, or C1-C6 (e.g., C1-C3) haloalkyl.
In some embodiments, R6 can be hydrogen, chloro or bromo (e.g., chloro), cyano, C1-C6 (e.g., C1-C3) alkyl, or C1-C6 (e.g., C1-C3) haloalkyl.
In some embodiments, R6 can be hydrogen, halo, C1-C6 (e.g., C1-C3) alkyl, or C1-C6 (e.g., C1-C3) haloalkyl.
In some embodiments, R6 can be hydrogen, chloro or bromo (e.g., chloro), C1-C6 (e.g., C1-C3) alkyl, or C1-C6 (e.g., C1-C3) haloalkyl.
In some embodiments, R6 can be hydrogen, halo (e.g., chloro), or C1-C6 (e.g., C1-C3) haloalkyl (e.g., CF3).
In some embodiments, R6 can be hydrogen, chloro or bromo (e.g., chloro), or C1-C6 (e.g., C1-C3) haloalkyl.
In certain embodiments, R6 can be hydrogen, chloro, cyano, CH3, or CF3. In certain embodiments, R6 can be hydrogen, chloro, CH3, or CF3. In certain embodiments, R6 can be hydrogen, chloro, or CF3.
In some embodiments, R6 can be C1-C6 (e.g., C1-C3) haloalkyl (e.g., perfluoroalkyl, e.g., CF3).
In some embodiments, R6 can be halo (e.g., chloro).
In some embodiments, R6 can be C1-C6 (e.g., C1-C3) alkyl (e.g., CH3).
In some embodiments, R6 can be cyano.
In some embodiments, when R9 is —W2—S(O)nR10 or —W2—S(O)nNR11R12, then R6 can be hydrogen or hydrogen and any one or more of the permissible non-hydrogen substitutents delineated above for R6.
In some embodiments, when R9 is other than —W2—S(O)nR10 or —W2—S(O)nNR11R12, then R6 can be other than hydrogen.
A subset of compounds includes those in which:
R2 can be C6-C10 aryl, which is (a) substituted with 1 R7; and (b) optionally substituted with from 1-4 (e.g., 1-2) Re; and
A can be C6-C10 aryl, which is (a) substituted with from 1 R9; and (b) optionally substituted with from 1-4 Rg. In these embodiments, each of R7, R9, Re, and Rg can be, independently, as defined anywhere herein.
In certain embodiments:
R2 can be phenyl, which is (a) substituted with 1 R7 (i.e., WA); and (b) optionally substituted with from 1 Re; and
A can be phenyl, which is (a) substituted with 1 R9; and (b) optionally substituted with from 1-4 Rg. In these embodiments, each of R7, R9, Re, and Rg can be, independently, as defined anywhere herein.
A subset of compounds includes those in which R2 has formula (C-1):
in which each of R22, R23, and R24 is, independently, hydrogen or Re; and
one of RA2, RA3, RA4, RA5, and RA6 is R9, and the others are each, independently, hydrogen or Rg; and
W can be as defined anywhere herein.
In some embodiments:
(i) each of R22, R23, and R24 can be hydrogen; or
(ii) one of R22, R23, and R24 can be Re, and the other two are hydrogen;
and
one of RA2, RA3, RA4, RA5, and RA6 can be R9, and the others are each, independently, hydrogen or Rg; and
W can be as defined anywhere herein.
Embodiments can include one or more of the following features.
W can be —O—, a bond, —OCH2—, or —NH— (e.g., —O—, a bond, or —OCH2—).
Re, R9, and Rg can each be, independently, as defined anywhere herein.
Each of R22, R23, and R24 can be hydrogen; or each of R22, R23, and R24 can be a substituent other than hydrogen; or one or two of R22, R23, and R24 can be Re, and the other(s) can be hydrogen.
One of R22, R23, and R24 can be Re, and the other two can be hydrogen. For example, R22 can be Re, and each of R23 and R24 can be hydrogen. In embodiments, Re can be: halo (e.g., chloro); C1-C3 alkyl; or C1-C3 haloalkyl (e.g., C1-C3 fluoroalkyl, e.g., 1-5 fluorines can be present; or C1-C3 perfluoroalkyl). In certain embodiments, Re can be halo (e.g., chloro).
One of RA3 and RA4 can be R9, the other of RA3 and RA4 can be hydrogen; and each of RA2, RA5, and RA6 can be, independently, hydrogen or Rg.
RA3 can be R9, RA4 can be hydrogen, and each of RA2, RA5, and RA6 can be hydrogen; or RA3 can be R9; RA4 can be hydrogen; one of RA2, RA5, and RA6 (e.g., RA5) can be Rg (e.g., halo, e.g., fluoro) and the other two of RA2, RA5, and RA6 can be hydrogen.
RA4 can be R9, RA3 can be hydrogen, and each of RA2, RA5, and RA6 can be hydrogen. RA3 can be R9; RA4 can be hydrogen; one of RA2, RA5, and RA6 can be Rg (e.g., halo) and the other two of RA2, RA5, and RA6 can be hydrogen.
R9 can be —W2—S(O)nR10, in which n is 2, and each of W2 and R10 can be as defined anywhere herein. For example, W2 can be a bond. As another example, R10 can be C1-C6 alkyl, optionally substituted with from 1-2 Ra. In embodiments, R10 can be CH3, CH2CH3, or isopropyl.
By way of example, RA3 can be —W2—S(O)nR10. n can be 2. W2 can be a bond. R10 can be C1-C6 alkyl, optionally substituted with from 1-2 Ra. R10 can be C1-C3 alkyl (e.g., CH3). R10 can be C2-C6 alkyl substituted with 1 Ra (e.g., Ra can be hydroxyl or C1-C3 alkoxy). Each of RA2, RA4, RA5, and RA6 can be hydrogen. RA5 can be Rg, and each of RA2, RA4, and RA6 can be hydrogen.
R9 can be —W2—S(O)nNR11R12. W2 can be a bond, and n can be 2. Each of R11 and R12 can be, independently, as defined anywhere herein. For example, each of R11 and R12 can be, independently: (i) hydrogen; or (ii) C1-C6 alkyl; or (iii) C7-C11 aralkyl, optionally substituted with from 1-5 Rc.
By way of example, RA3 can be —W2—S(O)nNR11R12. W2 can be a bond; n can be 2, and each of R11 and R12 is, independently, as defined anywhere herein. For example, each of R11 and R12 can be, independently: (i) hydrogen; or (ii) C1-C6 alkyl; or (iii) C7-C11 aralkyl, optionally substituted with from 1-5 Rc. Each of RA2, RA4, RA5, and RA6 can be hydrogen.
R9 can be —W2—C(O)OR13. Each of W2 and R10 can be as defined anywhere herein. For example, W2 can be a bond or C1-C6 alkylene. As another example, R13 can be hydrogen or C1-C6 alkyl.
By way of example, RA4 can be —W2—C(O)OR13. W2 can be a bond or C1-C6 alkylene (e.g., CH2). R13 can be hydrogen or C1-C3 alkyl. Each of RA2, RA3, RA5, and RA6 can be hydrogen.
Other embodiments can include one of more other features described herein and present in combination with the features delineated above.
In some embodiments, the compounds can have formula (II):
in which each of R1, R2, R3, R4, and R5 can be, independently, as defined anywhere herein (generically, subgenerically, or specifically).
In some embodiments, the compounds can have formula (III):
in which each of R1, R2, and R6 can be, independently, as defined anywhere herein (generically, subgenerically, or specifically).
In some embodiments, the compounds can have formula (IV):
in which each of R1 and R2 can be, independently, as defined anywhere herein (generically, subgenerically, or specifically).
In some embodiments, the compounds can have formula (V):
in which each of R1, R3, R4, R5, R6, Re, W, and A can be, independently, as defined anywhere herein (generically, subgenerically, or specifically).
In some embodiments, the compounds can have formula (VI):
in which each of R1, R3, R4, R5, R6, R22, R23, R24, W, and A can be, independently, as defined anywhere herein (generically, subgenerically, or specifically).
In some embodiments, the compounds can have formula (VII):
in which each of R1, R3, R4, R5, R6, R22, R23, R24, RA2, RA3, RA4, RA5, RA6, W, and A can be, independently, as defined anywhere herein (generically, subgenerically, or specifically).
In embodiments, the compounds of formulas (II), (III), (IV), (V), (VI), and (VII) can include any one or more of the following features.
R1 can be:
(i) hydrogen; or
(ii) C1-C6 (e.g., C1-C3 or C1-C2) alkyl or C1-C6 (e.g., C1-C3 or C1-C2) haloalkyl; or
(iii) C6-C10 (e.g., phenyl) or heteroaryl including 5-10 (e.g., 5-6 atoms), each of which is optionally substituted with from 1-5 Rd; or
(iv) C7-C11 (e.g., C7-C10) aralkyl, or heteroaralkyl including 6-11 (e.g., 6-10) atoms, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc.
R1 can be hydrogen.
R1 can be:
(ii) C1-C6 (e.g., C1-C3 or C1-C2) alkyl or C1-C6 (e.g., C1-C3 or C1-C2) haloalkyl; or
(iii) C6-C10 (e.g., phenyl), which is optionally substituted with from 1-5 Rd; or
(iv) C7-C11 (e.g., C7-C10) aralkyl, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc.
R1 can be:
(iii) heteroaryl including 5-10 (e.g., 5-6 atoms), which is optionally substituted with from 1-5 Rd; or
(iv) heteroaralkyl including 6-11 (e.g., 6-10) atoms, which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rc.
R1 can be: H; CH3, CH2CH3, or CH(CH3)2; CF3; phenyl, which is optionally substituted with from 1-5 Rd; or benzyl, which is optionally substituted with from 1-5 Rc.
R2 can have formula (A), (A-1), (A-2), or (C-1) as defined anywhere herein.
W can be —O—.
W can be a bond.
W can be —W1(C1-6 alkylene)-. In certain embodiments, W1 can be —O—. For example, W can be —O(C1-3 alkylene)- (e.g., —OCH2—).
W can be —(C1-6 alkylene)W1—. In certain embodiments, W1 is —NR8—, in which R8 can be hydrogen; or W1 can be —O—. In certain embodiments, W can be —(C1-3 alkylene)NH— (e.g., —CH2NH—). In certain embodiments, W can be —(C1-3 alkylene)O— (e.g., —CH2O—).
W can be —NR8—, (e.g., —NH—).
In some embodiments, A can be phenyl, which is (i) substituted with 1 R9 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) Rg, in which Rg can be as defined anywhere herein.
A can have formula (B-1). In embodiments, one of RA3 and RA4 is R9, and the other of RA3 and RA4 is hydrogen; and each of RA2, RA5, and RA6 is, independently, hydrogen or Rg, in which R9 and Rg can be as defined anywhere herein.
A can be heteroaryl including 5-10 atoms, which is (a) substituted with 1 R9; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Rg, in which Rg can be as defined anywhere herein.
Each of Re, R9, and Rg can be, independently, as defined anywhere herein.
R9 can be:
Each of R10, R11, R12, and R13 can be, independently, as defined anywhere herein (e.g., as defined in conjunction with formula (C-1)).
W2, n, R22, R23, R24, RA2, RA3, RA4, RA5, and RA6 can be as defined in conjunction with formula (C-1).
Each of R3, R4, and R5 can be hydrogen.
R6 can be:
(ii) halo; or
(iii) C1-C6 alkyl or C1-C6 haloalkyl, each of which is optionally substituted with from 1-3 Ra; or
(iv) cyano.
R6 can be halo (e.g., chloro) or C1-C6 (e.g., C1-C3) haloalkyl (e.g., CF3).
One or more (e.g., 1, 2, or 3) of R1, R3, R4, R5, and R6 (e.g., R1 and/or R6) can be a substituent other than hydrogen.
It is understood that the actual electronic structure of some chemical entities cannot be adequately represented by only one canonical form (i.e. Lewis structure). While not wishing to be bound by theory, the actual structure can instead be some hybrid or weighted average of two or more canonical forms, known collectively as resonance forms or structures. Resonance structures are not discrete chemical entities and exist only on paper. They differ from one another only in the placement or “localization” of the bonding and nonbonding electrons for a particular chemical entity. It can be possible for one resonance structure to contribute to a greater extent to the hybrid than the others. Thus, the written and graphical descriptions of the embodiments of the present invention are made in terms of what the art recognizes as the predominant resonance form for a particular species.
The compounds described herein can be synthesized according to methods described herein (or variations thereof) and/or conventional, organic chemical synthesis methods from commercially available starting materials and reagents or from starting materials and reagents that can be prepared according to conventional organic chemical synthesis methods. The compounds described herein can be separated from a reaction mixture and further purified by a method such as column chromatography, high-pressure liquid chromatography, or recrystallization. As can be appreciated by the skilled artisan, further methods of synthesizing the compounds of the formulae herein will be evident to those of ordinary skill in the art. Additionally, the various synthetic steps may be performed in an alternate sequence or order to give the desired compounds. Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the compounds described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.
In some embodiments, compounds of formula (I) can be prepared according to Scheme 1.
According to Scheme 1, the compounds of formula (I) can be prepared by reacting 2-aminopyridines (1) with alpha-halo-ketone (2), typically in the presence of a base (e.g., sodium bicarbonate) in a solvent such as ethanol at elevated temperatures, (e.g., 80-90° C.), for 16 to 24 h. Reaction of the resulting imidazo[1,2-a]pyridine (3) with a bromoarene or an iodoarene (4) in the presence of palladium catalyst (e.g., palladium(II)acetate), a base (e.g., cesium carbonate), and a ligand (e.g., triphenylphosphine) in a solvent such as 1,4-dioxane at elevated temperatures, (e.g., 100° C.), results in formation of compound (5). Alternatively, compounds (5) can be prepared by reaction of arene (4) in the presence of a palladium catalyst (e.g., 20% palladium hydroxide on carbon) and a base (e.g., potassium acetate) in a polar solvent (e.g., N,N-dimethylacetamide) at elevated temperatures, typically 145° C., for 12-18 h.
In some embodiments, the compounds of formula (I) can be prepared from intermediate compounds of formula (6). See Scheme 2 below. In these embodiments, Y in compound (4) is a halogen or protected hydroxyl group (e.g., methoxy or benzyloxy) and Z in compound (6) is a halogen or a hydroxyl group.
In certain embodiments, when Y in compound (4) is a protected hydroxyl group, the resultant O-protected coupling product can be deprotected according to conventional procedures to provide compounds of formula (6) in which Z is hydroxyl. As a non-limiting example, when Z is methoxy, deprotection can be carried out using pyridine hydrochloride at 200° C. for 0.5-2 h, or BBr3 in dichloromethane.
In certain embodiments, compounds of formula (I) can be prepared according to Scheme 3.
In embodiments, compounds of formula (6) in which Z is OH can be alkylated with an alkylating agent (7) and a suitable base to provide compounds of formula (G-1). The leaving group in compound (7) (i.e., LG) can be, e.g., a halogen or a sulfonate group (e.g., triflate). Suitable bases includes potassium carbonate, sodium carbonate, and cesium carbonate.
In other embodiments, compounds of formula (6) in which Z is OH can be treated with a halogenated compound (8) (wherein Hal in compound (8) is F, Cl, Br or I) to provide biarylether compounds of formula (G-2). In some embodiments, when the halogen is a fluorine or chlorine atom, biarylether formation can be accomplished using a polar solvent such as dimethylformamide or dimethylsulfoxide at elevated temperatures, (e.g., 100° C. to 150° C. for several hours by treatment) in the presence of a base, such as potassium carbonate. In other embodiments, when the halogen is a bromine or iodine, biarylether formation can be accomplished, e.g., via a metal-catalyzed coupling reaction using, e.g., a copper salt, such as CuI, or a palladium salt, in the presence of a base and a solvent, such as 1,4-dioxane, at elevated temperatures.
Still referring to Scheme 3, compounds of formula (G-3) can be prepared from compounds of formula (6), in which Z is OH or Hal (wherein Hal is Cl, Br or I). In some embodiments, when Z is OH, compounds of formula (6) are typically first converted into the corresponding sulfonate (e.g., triflate) under conventional sulfonating conditions, e.g., triflic anhydride and a tertiary amine such as triethylamine. Compounds of formula (6) in which Z is a sulfonate (e.g., OSO2CF3) or halide (e.g., Br or I) can then be coupled to an aryl boronic acid of formula (9), e.g., under Suzuki conditions to provide the compounds of formula (G-3).
In general, when R9 of the compounds of formula (G-1), (G-2) or (G-3) is or contains a carboxylic acid ester moiety, the ester can be converted to a carboxylic acid upon treatment with aqueous base (e.g., lithium hydroxide, sodium hydroxide or potassium hydroxide) in a suitable organic solvent. If the R9 group contains a haloalkyl group (e.g., CH2X′ where X′ is a halogen, e.g., Br or Cl), then treatment with sodium cyanide in a suitable organic solvent can provide the corresponding cyanoalkyl compound (e.g., CH2CN).
In some embodiments, compounds of formula (I) can be prepared according to Scheme 4.
Referring to Scheme 4, a compound of formula (6, in which Z is OH, can be converted to biarylethers of formula (G-2), for example, by Cu(OAc)2 mediated coupling of boronic acid (9) in the presence of base (e.g., pyridine) in a halogenated solvent (e.g., dichloromethane).
In some embodiments, compounds of formula (I) can be prepared according to Scheme 5.
Referring to Scheme 5, compounds of formula (G-4) can be prepared from compounds (6), in which Z is NH2, and compounds of formula (10), in which LG is a suitable leaving group (e.g., halide, triflate or boronic acid), under conventional coupling or displacement conditions.
In some embodiments, compounds of formula (I) can be prepared according to Scheme 6.
According to Scheme 6, compounds of formula (6), in which Z is a halogen (e.g., Br or I) can be converted to borolane (11) (e.g., R is H or alkyl) under conventional Suzuki conditions. Borolane (11) can then be coupled under conditions described above with aryl halide (8) (e.g., Hal is Br or I) to afford compounds of formula (G-3).
In some embodiments, compounds (7), (8), (9), or (10) can include a protected sulfonamide or amide moiety (i.e., R9 is —W2—SO2NR11R12 or—W2—C(O)NR11R12, and one or both of R11 and R12 is a conventional protecting group). In some embodiments, R11 can be an aralkyl group, e.g., 4-MeOPhCH2—; and R12 can be an aralkyl group, e.g., 4-MeOPhCH2— or an alkyl group.
In some embodiments, when R9 in compounds (8) or (10) is an electron withdrawing group (e.g., wherein R9 is —W2—SO2NR11R12 or—W2—C(O)NR11R12, and W2 is a bond) and Hal or LG is a fluorine or chlorine atom located at a position that is para or ortho with respect to the R9 group, the fluorine or chlorine atom can typically be displaced by compounds bearing an amino or hydroxyl group in the presence of a base (see, e.g., Schemes 3 and 5). When Hal or LG in compounds (8) or (10) is a bromine, iodine, or sulfonate (e.g., triflate), such compounds can be coupled, e.g., to a boronic acid using a metal such as copper or palladium (see, e.g., Scheme 6).
Compounds of formula (I) in which R9 is a protected sulfonamide group (e.g., wherein R9 is —W2—SO2N(4-MeOPhCH2)R12) can be converted to the corresponding primary sulfonamide (R9 is —W2—SO2NH2 when R12=4-MeOPhCH2) or secondary sulfonamide (X=SO2NHR12 when R12 is other than 4-MeOPhCH2), e.g., by treatment with trifluoroacetic acid in a halogenated solvent (e.g., dichloromethane) at ambient temperatures for several hours (e.g., 18 h). Compounds of formula (I) in which R9 is a protected amide (e.g., when R9 is —W2—C(O)N(4-MeOPhCH2)R12) can be converted to the primary amides (R9 is —W2—C(O)NH2 when R12=4-MeOPhCH2) or secondary sulfonamide (R9 is —W2—C(O)NHR12 when R12 is other than 4-MeOPhCH2) under similar conditions.
In some embodiments, compounds of formula (I) can be prepared according to Scheme 7.
According to Scheme 7, compounds of formula (17) can be prepared by reacting 2-aminopyridines (1) with arylglyoxals (12) by refluxing in a solvent such as dichloromethane for 1-2 h, then removing the first solvent followed by heating at reflux in carbon tetrachloride in the presence of thionyl chloride for 0.5 h to provide (13). In certain embodiments when Z is methoxy, deprotection can be carried out using boron trifluoride-dimethylsulfide in dichloromethane to provide phenols (14). Conversion of phenol (14) into the biarylether can be accomplished as described in Scheme 3 to provide (15). Lastly, the chloro group can be reacted with aryl boronic acids (16) under Suzuki-type conditions to yield compounds of formula (17).
In some embodiments, the substituent corresponding to R2 in formula (I) can be introduced by reacting compound (3) with the biaryl halide (24) to provide compound (5).
In some embodiments, compounds of formula (I) can be prepared according to Scheme 9.
According to Scheme 9, compounds of formula (28) can be prepared by directly arylating imidazo[1,2-a]pyridines (3) with a halopyridine (25) to produce (26). Copper(0)-mediated coupling of compounds (26) in the presence of a base such as cesium carbonate in a polar solvent such as DMF can afford compound (28). Reaction of (26) with arylboronic acid (9) under Suzuki-type coupling conditions can provide compound (29).
According to Scheme 10, compounds (32) can be synthesized via reacting 2-methylimidazo[1,2-a]pyridines (30) with a halogenating agent such as N-bromosuccinimide (NBS) with an initiator such as 2,2′-azobisisobutyronitrile (AIBN), in a polar solvent such as acetonitrile, at elevated temperatures, typically 85° C., for several hours to produce 2-(bromomethyl)imidazo[1,2-a]pyridines (31). Compounds (31) can then be reacted with amines in a polar solvent such as EtOH at ambient temperature to produce compounds (32).
The compounds of this invention may contain one or more asymmetric centers and thus occur as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such isomeric forms of these compounds are expressly included in the present invention. The compounds of this invention may also contain linkages (e.g., carbon-carbon bonds, carbon-nitrogen bonds such as amide bonds) wherein bond rotation is restricted about that particular linkage, e.g. restriction resulting from the presence of a ring or double bond. Accordingly, all cis/trans and E/Z isomers and rotational isomers are expressly included in the present invention. The compounds of this invention may also be represented in multiple tautomeric forms, in such instances, the invention expressly includes all tautomeric forms of the compounds described herein, even though only a single tautomeric form may be represented (e.g., alkylation of a ring system may result in alkylation at multiple sites, the invention expressly includes all such reaction products). All such isomeric forms of such compounds are expressly included in the present invention.
The compounds of this invention include the compounds themselves, as well as their salts and their prodrugs, if applicable. A salt, for example, can be formed between an anion and a positively charged substituent (e.g., amino) on a compound described herein. Suitable anions include chloride, bromide, iodide, sulfate, nitrate, phosphate, citrate, methanesulfonate, trifluoroacetate, and acetate Likewise, a salt can also be formed between a cation and a negatively charged substituent (e.g., carboxylate) on a compound described herein. Suitable cations include sodium ion, potassium ion, magnesium ion, calcium ion, and an ammonium cation such as tetramethylammonium ion. Examples of prodrugs include esters and other pharmaceutically acceptable derivatives, which, upon administration to a subject, are capable of providing active compounds.
Pharmaceutically acceptable salts of the compounds of this invention include those derived from pharmaceutically acceptable inorganic and organic acids and bases. Examples of suitable acid salts include acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycolate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, palmoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, salicylate, succinate, sulfate, tartrate, thiocyanate, tosylate and undecanoate. Other acids, such as oxalic, while not in themselves pharmaceutically acceptable, may be employed in the preparation of salts useful as intermediates in obtaining the compounds of the invention and their pharmaceutically acceptable acid addition salts. Salts derived from appropriate bases include alkali metal (e.g., sodium), alkaline earth metal (e.g., magnesium), ammonium and N-(alkyl)4+ salts. This invention also envisions the quaternization of any basic nitrogen-containing groups of the compounds disclosed herein. Water or oil-soluble or dispersible products may be obtained by such quaternization. Salt forms of the compounds of any of the formulae herein can be amino acid salts of carboxy groups (e.g. L-arginine, -lysine, -histidine salts).
The term “pharmaceutically acceptable carrier or adjuvant” refers to a carrier or adjuvant that may be administered to a subject (e.g., a patient), together with a compound of this invention, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the compound.
Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the compositions of this invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, self-emulsifying drug delivery systems (SEDDS) such as d-α-tocopherol polyethyleneglycol 1000 succinate, surfactants used in pharmaceutical dosage forms such as Tweens or other similar polymeric delivery matrices, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat. Cyclodextrins such as α-, β-, and γ-cyclodextrin, or chemically modified derivatives such as hydroxyalkylcyclodextrins, including 2- and 3-hydroxypropyl-β-cyclodextrins, or other solubilized derivatives may also be advantageously used to enhance delivery of compounds of the formulae described herein.
In general, the compounds described herein can be used for treating (e.g., controlling, ameliorating, alleviating, slowing the progression of, delaying the onset of, or reducing the risk of developing) or preventing one or more diseases, disorders, conditions or symptoms mediated by LXRs (e.g., cardiovascular diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, thyroiditis, skin aging (e.g., skin aging is derived from chronological aging, photoaging, steroid-induced skin thinning, or a combination thereof), or connective tissue disease (e.g., osteoarthritis or tendonitis).
A disorder or physiological condition that is mediated by LXR refers to a disorder or condition wherein LXR can trigger the onset of the condition, or where inhibition of a particular LXR can affect signaling in such a way so as to treat, control, ameliorate, alleviate, prevent, delay the onset of, slow the progression of, or reduce the risk of developing the disorder or condition. Examples of such disorders include, but are not limited to cardiovascular diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, thyroiditis, skin aging (e.g., skin aging is derived from chronological aging, photoaging, steroid-induced skin thinning, or a combination thereof), or connective tissue disease (e.g., osteoarthritis or tendonitis).
While not wishing to be bound by theory, it is believed that LXR modulators that activate cholesterol efflux (e.g., upregulate ABCA1), but do not substantially increase SREBP-1c expression and triglyceride synthesis in liver, can both reduce atherosclerotic risk and minimize the likelihood of concommitantly increasing serum and hepatic triglyceride levels. Candidate compounds having differential activity for regulating ABCA1 (ABCG1) vs. SREBP-1c can be can be evaluated using conventional pharmacological test procedures, which measure the affinity of a candidate compound to bind to LXR and to upregulate the gene ABCA1.
In some embodiments, LXR ligands can be identified initially in cell-free LXR beta and LXR alpha competition binding assays. LXR ligands can be further characterized by gene expression profiling for tissue selective gene regulation.
In some embodiments, the compounds described herein have agonist activity for ABCA1 transactivation but do not substantially affect (e.g., inhibit) SREBP-1c gene expression in differentiated THP-1 macrophages. Gene expression analysis in an antagonist mode can be used to further delineate differential regulation of ABCA1 and SREBP-1c gene expression. In certain embodiments, the compounds described herein preferentially antagonize SREBP-1c activation (a marker for genes involved in cholesterol and fatty acid homeostasis) but do not substantially affect (e.g., have relatively minimal or additive effects) on ABCA1 gene expression or genes known to enhance HDL biogenesis (based on a competition assay with known potent synthetic LXR agonists). Cell type or tissue specificity may be further evaluated in additional cell lines, intestinal, CaCo2 or liver, HepG2 and Huh-7 cells where ABCA1 activity is believed to influence net cholesterol absorption and reverse cholesterol transport. The test procedures performed, and results obtained therefrom are described in the Examples section.
In some embodiments, the compounds described herein have agonist activity for ABCA1 and antagonist activity for SREBP-1c (e.g., as determined by gene specific modulation in cell based assays). In certain embodiments, the compounds described herein (in the agonist mode) have at least about 20% efficacy for ABCA1 activation by LXR and do not substantially agonize SREBP-1c (at most about 25% efficacy relative to a reference compound N-(2,2,2-trifluoro-ethyl)-N-[4-(2,2,2-trifluoro-1-hydroxy-1-trifluoromethyl-ethyl)-phenyl]-benzenesulfonamide (Schultz, Joshua R., Genes & Development (2000), 14(22), 2831-2838)). In certain embodiments, the compounds described herein (in the antagonist mode) do not substantially antagonize ABCA1 gene expression. While not wishing to be bound by theory, it is believed that there may be an additive effect on ABCA1 gene expression relative to the reference compound at their EC50 concentration. In certain embodiments, the compounds described herein (in the antagonist mode) inhibited agonist-mediated SREBP-1c gene expression in a dose dependent fashion.
In some embodiments, to study the effect of the compounds of formula (I) on skin aging, for example, in a clinical trial, cells can be isolated and RNA prepared and analyzed for the levels of expression of TIMP1, ABCA12, decorin, TNFα, MMP1, MMP3, and/or IL-8. The levels of gene expression (i.e., a gene expression pattern) can be quantified, for example, by Northern blot analysis or RT-PCR, by measuring the amount of protein produced, or by measuring the levels of activity of TIMP1, ABCA12, decorin, TNFα, MMP1, MMP3, and/or IL-8, all by methods known to those of ordinary skill in the art. In this way, the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the compounds of formula (I). Accordingly, this response state may be determined before, and at various points during, treatment of the individual with the compounds of formula (I).
In one embodiment, expression levels of cytokines and metalloproteases described herein can be used to facilitate design and/or identification of compounds that treat skin aging through an LXR-based mechanism. Accordingly, the invention provides methods (also referred to herein as “screening assays”) for identifying modulators, i.e., LXR modulators, that have a stimulatory or inhibitory effect on, for example, TIMP1, ABCA12, decorin, TNFα, MMP1, MMP3, and/or IL-8 expression.
An exemplary screening assay is a cell-based assay in which a cell that expresses LXR is contacted with a test compound, and the ability of the test compound to modulate TIMP1, ABCA12, decorin, TNFα, MMP1, MMP3, and/or IL-8 expression through an LXR-based mechanism. Determining the ability of the test compound to modulate TIMP1, ABCA12, decorin, TNFα, MMP1, MMP3, and/or IL-8 expression can be accomplished by monitoring, for example, DNA, mRNA, or protein levels, or by measuring the levels of activity of TIMP1, ABCA12, decorin, TNFα, MMP1, MMP3, and/or IL-8, all by methods known to those of ordinary skill in the art. The cell, for example, can be of mammalian origin, e.g., human.
In some embodiments, to study the effect of the compounds of formula (I) on osteoarthritis, for example, in a clinical trial, cells can be isolated and RNA prepared and analyzed for the levels of expression of ApoD and other genes implicated in osteoarthritis (for example, TNFα). The levels of gene expression (i.e., a gene expression pattern) can be quantified by Northern blot analysis or RT-PCR, by measuring the amount of protein produced, or by measuring the levels of activity of ApoD or other genes, all by methods known to those of ordinary skill in the art. In this way, the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the LXR modulator. Accordingly, this response state may be determined before, and at various points during, treatment of the individual with the LXR modulator.
An exemplary screening assay is a cell-based assay in which a cell that expresses LXR is contacted with a test compound, and the ability of the test compound to modulate ApoD expression and/or aggrecanase activity and/or cytokine elaboration through an LXR-based mechanism. Determining the ability of the test compound to modulate ApoD expression and/or aggrecanase activity and/or cytokine elaboration can be accomplished by monitoring, for example, DNA, mRNA, or protein levels, or by measuring the levels of activity of ApoD, aggrecanase, and/or TNFα, all by methods known to those of ordinary skill in the art. The cell, for example, can be of mammalian origin, e.g., human.
In some embodiments, the compounds described herein can be coadministered with one or more other therapeutic agents. In certain embodiments, the additional agents may be administered separately, as part of a multiple dose regimen, from the compounds of this invention (e.g., sequentially, e.g., on different overlapping schedules with the administration of one or more compounds of formula (I) (including any subgenera or specific compounds thereof)). In other embodiments, these agents may be part of a single dosage form, mixed together with the compounds of this invention in a single composition. In still another embodiment, these agents can be given as a separate dose that is administered at about the same time that one or more compounds of formula (I) (including any subgenera or specific compounds thereof) are administered (e.g., simultaneously with the administration of one or more compounds of formula (I) (including any subgenera or specific compounds thereof)). When the compositions of this invention include a combination of a compound of the formulae described herein and one or more additional therapeutic or prophylactic agents, both the compound and the additional agent can be present at dosage levels of between about 1 to 100%, and more preferably between about 5 to 95% of the dosage normally administered in a monotherapy regimen.
The compounds and compositions described herein can, for example, be administered orally, parenterally (e.g., subcutaneously, intracutaneously, intravenously, intramuscularly, intraarticularly, intraarterially, intrasynovially, intrasternally, intrathecally, intralesionally and by intracranial injection or infusion techniques), by inhalation spray, topically, rectally, nasally, buccally, vaginally, via an implanted reservoir, by injection, subdermally, intraperitoneally, transmucosally, or in an ophthalmic preparation, with a dosage ranging from about 0.01 mg/Kg to about 1000 mg/Kg, (e.g., from about 0.01 to about 100 mg/kg, from about 0.1 to about 100 mg/Kg, from about 1 to about 100 mg/Kg, from about 1 to about 10 mg/kg) every 4 to 120 hours, or according to the requirements of the particular drug. The interrelationship of dosages for animals and humans (based on milligrams per meter squared of body surface) is described by Freireich et al., Cancer Chemother. Rep. 50, 219 (1966). Body surface area may be approximately determined from height and weight of the patient. See, e.g., Scientific Tables, Geigy Pharmaceuticals, Ardsley, N.Y., 537 (1970). In certain embodiments, the compositions are administered by oral administration or administration by injection. The methods herein contemplate administration of an effective amount of compound or compound composition to achieve the desired or stated effect. Typically, the pharmaceutical compositions of this invention will be administered from about 1 to about 6 times per day or alternatively, as a continuous infusion. Such administration can be used as a chronic or acute therapy. The amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. A typical preparation will contain from about 5% to about 95% active compound (w/w). Alternatively, such preparations contain from about 20% to about 80% active compound.
Lower or higher doses than those recited above may be required. Specific dosage and treatment regimens for any particular patient will depend upon a variety of factors, including the activity of the specific compound employed, the age, body weight, general health status, sex, diet, time of administration, rate of excretion, drug combination, the severity and course of the disease, condition or symptoms, the patient's disposition to the disease, condition or symptoms, and the judgment of the treating physician.
Upon improvement of a patient's condition, a maintenance dose of a compound, composition or combination of this invention may be administered, if necessary. Subsequently, the dosage or frequency of administration, or both, may be reduced, as a function of the symptoms, to a level at which the improved condition is retained when the symptoms have been alleviated to the desired level. Patients may, however, require intermittent treatment on a long-term basis upon any recurrence of disease symptoms.
The compositions of this invention may contain any conventional non-toxic pharmaceutically-acceptable carriers, adjuvants or vehicles. In some cases, the pH of the formulation may be adjusted with pharmaceutically acceptable acids, bases or buffers to enhance the stability of the formulated compound or its delivery form.
The compositions may be in the form of a sterile injectable preparation, for example, as a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as, for example, Tween 80) and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, or carboxymethyl cellulose or similar dispersing agents which are commonly used in the formulation of pharmaceutically acceptable dosage forms such as emulsions and or suspensions. Other commonly used surfactants such as Tweens or Spans and/or other similar emulsifying agents or bioavailability enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for the purposes of formulation.
The compositions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, emulsions and aqueous suspensions, dispersions and solutions. In the case of tablets for oral use, carriers which are commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions and/or emulsions are administered orally, the active ingredient may be suspended or dissolved in an oily phase is combined with emulsifying and/or suspending agents. If desired, certain sweetening and/or flavoring and/or coloring agents may be added.
The compositions of this invention may also be administered in the form of suppositories for rectal administration. These compositions can be prepared by mixing a compound of this invention with a suitable non-irritating excipient which is solid at room temperature but liquid at the rectal temperature and therefore will melt in the rectum to release the active components. Such materials include, but are not limited to, cocoa butter, beeswax and polyethylene glycols.
Topical administration of the compositions of this invention is useful when the desired treatment involves areas or organs readily accessible by topical application. For application topically to the skin, the composition should be formulated with a suitable ointment containing the active components suspended or dissolved in a carrier. Carriers for topical administration of the compounds of this invention include, but are not limited to, mineral oil, liquid petroleum, white petroleum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, the composition can be formulated with a suitable lotion or cream containing the active compound suspended or dissolved in a carrier with suitable emulsifying agents. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water. The compositions of this invention may also be topically applied to the lower intestinal tract by rectal suppository formulation or in a suitable enema formulation.
In some embodiments, topical administration of the compounds and compositions described herein may be presented in the form of an aerosol, a semi-solid pharmaceutical composition, a powder, or a solution. By the term “a semi-solid composition” is meant an ointment, cream, salve, jelly, or other pharmaceutical composition of substantially similar consistency suitable for application to the skin. Examples of semi-solid compositions are given in Chapter 17 of The Theory and Practice of Industrial Pharmacy, Lachman, Lieberman and Kanig, published by Lea and Febiger (1970) and in Remington: The Science and Practice of Pharmacy by University of the Sciences in Philadelphia (Editor); Publisher: Lippincott Williams & Wilkins; Twenty first Edition (May 1, 2005), which is incorporated herein by reference in its entirety.
Topically-transdermal patches are also included in this invention. Also within the invention is a patch to deliver active chemotherapeutic combinations herein. A patch includes a material layer (e.g., polymeric, cloth, gauze, bandage) and the compound of the formulae herein as delineated herein. One side of the material layer can have a protective layer adhered to it to resist passage of the compounds or compositions. The patch can additionally include an adhesive to hold the patch in place on a subject. An adhesive is a composition, including those of either natural or synthetic origin, that when contacted with the skin of a subject, temporarily adheres to the skin. It can be water resistant. The adhesive can be placed on the patch to hold it in contact with the skin of the subject for an extended period of time. The adhesive can be made of a tackiness, or adhesive strength, such that it holds the device in place subject to incidental contact, however, upon an affirmative act (e.g., ripping, peeling, or other intentional removal) the adhesive gives way to the external pressure placed on the device or the adhesive itself, and allows for breaking of the adhesion contact. The adhesive can be pressure sensitive, that is, it can allow for positioning of the adhesive (and the device to be adhered to the skin) against the skin by the application of pressure (e.g., pushing, rubbing,) on the adhesive or device.
The compositions of this invention may be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents known in the art.
A composition having the compound of the formulae herein and an additional agent (e.g., a therapeutic agent) can be administered using any of the routes of administration described herein. In some embodiments, a composition having the compound of the formulae herein and an additional agent (e.g., a therapeutic agent) can be administered using an implantable device. Implantable devices and related technology are known in the art and are useful as delivery systems where a continuous, or timed-release delivery of compounds or compositions delineated herein is desired. Additionally, the implantable device delivery system is useful for targeting specific points of compound or composition delivery (e.g., localized sites, organs). Negrin et al., Biomaterials, 22(6):563 (2001). Timed-release technology involving alternate delivery methods can also be used in this invention. For example, timed-release formulations based on polymer technologies, sustained-release techniques and encapsulation techniques (e.g., polymeric, liposomal) can also be used for delivery of the compounds and compositions delineated herein.
The invention will be further described in the following examples. It should be understood that these examples are for illustrative purposes only and are not to be construed as limiting this invention in any manner.
The following describes the preparation of representative compounds of this invention. Compounds described as homogeneous are determined to be of 90% or greater purity (exclusive of enantiomers) by analytical reverse phase chromatographic analysis with 254 nM UV detection. Melting points are reported as uncorrected in degrees centigrade. Mass spectral data is reported as the mass-to-charge ratio, m/z; and for high resolution mass spectral data, the calculated and experimentally found masses, [M+H]+, for the neutral formulae M are reported. All reactions are stirred and run under a nitrogen atmosphere unless otherwise noted. Eluents for chromatography are indicated by E for ethyl acetate and H for hexanes. Thus, for example, the expression “30:70 E:H” refers to a mixture of 30% ethyl acetate and 70% hexanes by volume.
A mixture of 3-(trifluoromethyl)pyridin-2-amine (1.00 g, 6.17 mmol), 1-chloropropan-2-one (0.685 g, 7.40 mmol), sodium bicarbonate (1.036 g, 12.34 mmol) and sodium iodide (0.277 g, 1.85 mmol) in ethanol (15 mL) was heated at reflux overnight. The cooled reaction mixture was partitioned between ethyl acetate and water. The layers were separated and the organic layer was washed with water and brine, dried over MgSO4 and concentrated in vacuo. The resulting material was chromatographed using a 0:100 to 50:50 E:H gradient to afford the title compound as a yellow solid (0.625 g, 51%). MS (ES) m/z 201.
A mixture of 3-(trifluoromethyl)pyridin-2-amine (3.00 g, 18.5 mmol), 1-bromobutan-2-one (3.76 g, 24.9 mmol), sodium hydrogencarbonate (3.11 g, 37.0 mmol) and sodium iodide (0.832 g, 5.55 mmol) in ethanol (37 mL) was refluxed overnight. The ethanol was removed in vacuo and the resulting material was treated with water and extracted with ethyl acetate. The combined organics were dried over MgSO4 and concentrated. The product was chromatographed using a 0:100 to 50:50 E:H gradient to afford the title compound as a white solid (2.92, 74%). MS (ES) m/z 215.1
The title compound was prepared in a manner similar to that described in Example 2 except that 1-bromo-3-methylbutan-2-one was used in place of 1-bromo-2-butanone. MS (ES) m/z 229.
The title compound was prepared in a manner similar to that described in Example 2 except that 1-bromo-3-phenylpropan-2-one was used in place of 1-bromo-2-butanone. MS (ES) m/z 277.
A mixture of 2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (1.10 g, 5.50 mmol), 3-iodophenol (1.45 g, 6.59 mmol), cesium carbonate (1.79 g, 5.50 mmol), triphenylphosphine (0.058 g, 0.22 mmol) and diacetoxypalladium (0.025 g, 0.110 mmol) in dioxane (25 mL) was heated at reflux overnight. The cooled reaction was then treated with water, neutralized with dilute hydrochloric acid, and extracted with several portions of ethyl acetate. The combined organics were dried over MgSO4 and concentrated onto Celite. The product was chromatographed using a 0:100 to 30:70 E:H gradient to afford the title compound as a tan solid (1.26 g, 78%). MS (ES) m/z 292.6; HRMS: calcd for C15H11F3N2O+H+, 293.08962. found (ESI, [M+H]+), 293.0883.
The title compound was prepared in a manner similar to that described in Example 5 except that 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine was used in place of 2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine. MS (ES) m/z 307.
The title compound was prepared in a manner similar to that described in Example 5 except that 2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine was used in place of 2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine. MS (ES) m/z 320.
The title compound was prepared in a manner similar to that described in Example 5 except that 2-benzyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine was used in place of 2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine. MS (ES) m/z 369.
A mixture of 3-(2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol (0.100 g, 0.342 mmol), 1-fluoro-3-(methylsulfonyl)benzene (0.119 g, 0.684 mmol) and potassium carbonate (0.095 g, 0.684 mmol) in DMF (3 mL) was heated at 150° C. overnight. The reaction mixture was cooled, diluted with water and extracted with several portions of ethyl acetate. The combined organics were washed with half-saturated brine and dried over MgSO4. The extracts were concentrated in vacuo and chromatographed using a 0:100 to 25:75 E:H gradient to afford the title compound as a white solid (0.096 g, 63%). MS (ES) m/z 447.2; HRMS: calcd for C22H17F3N2O3S+H+, 447.09847. found (ESI, [M+H]+), 447.0981.
The title compound was prepared in a manner similar to that described in Example 9 except that 1-fluoro-3-(ethylsulfonyl)benzene was used in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 460.9; HRMS: calcd for C23H19F3N2O3S+H+, 461.11412. found (ESI, [M+H]+), 461.1146.
The title compound was prepared in a manner similar to that described in Example 9 except that 1-fluoro-3-(propylsulfonyl)benzene was used in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 475.2; HRMS: calcd for C24H21F3N2O3S+H+, 475.12977. found (ESI, [M+H]+), 475.1299.
The title compound was prepared in a manner similar to that described in Example 9 except that 1-fluoro-3-(isopropylsulfonyl)benzene was used in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 474.9; HRMS: calcd for C24H21F3N2O3S+H+, 475.12977. found (ESI, [M+H]+), 475.1289.
The title compound was prepared in a manner similar to that described in Example 9 except that 3-(3-fluorophenylsulfonyl)propan-1-ol was used in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 491.0; HRMS: calcd for C24H21F3N2O4S+H+, 491.12469. found (ESI, [M+H]+), 491.1235.
The title compound was prepared in a manner similar to that described in Example 9 except that 4-(3-fluorophenylsulfonyl)-2-methylbutan-2-ol was used in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 519.1; HRMS: calcd for C26H25F3N2O4S+H+, 519.15599. found (ESI, [M+H]+), 519.1552.
The title compound was prepared in a manner similar to that described in Example 9 except using 1,3-difluoro-5-(methylsulfonyl)benzene in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 465.1; HRMS: calcd for C22H16F4N2O3S+H+, 465.08905. found (ESI, [M+H]+), 465.0902.
The title compound was prepared in a manner similar to that described in Example 9 except that 1-fluoro-4-(sec-butylsulfonyl)benzene was used in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 489.2; HRMS: calcd for C25H23F3N2O3S+H+, 489.14542. found (ESI, [M+H]+), 489.1474.
A mixture of 3-(2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol (0.100 g, 0.326 mmol), 1-fluoro-3-(methylsulfonyl)benzene (0.114 g, 0.653 mmol) and potassium carbonate (0.090 g, 0.653 mmol) in DMF (3 mL) was heated at 150° C. overnight. The reaction mixture was cooled, diluted with water and extracted with several portions of ethyl acetate. The combined organics were washed with half-saturated brine and dried over MgSO4. The extracts were concentrated onto Celite and chromatographed, typically using a 0:100 to 40:60 E:H gradient to afford the title compound as a white solid (0.163 g, 50%). HRMS: calcd for C23H19F3N2O3S+H+, 461.11412. found (ESI, [M+H]+), 461.1149.
The title compound was prepared in a manner similar to that described in Example 17 except that 1-fluoro-3-(ethylsulfonyl)benzene was used in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 475.1; HRMS: calcd for C24H21F3N2O3S+H+, 475.12977. found (ESI, [M+H]+), 475.1306.
The title compound was prepared in a manner similar to that described in Example 17 except that 1-fluoro-3-(propylsulfonyl)benzene was used in place of 1-fluoro-3-(methylsulfonyl)benzene. HRMS: calcd for C25H23F3N2O3S+H+, 489.14542. found (ESI, [M+H]+), 489.1459.
The title compound was prepared in a manner similar to that described in Example 17 except that 1-fluoro-3-(isopropylsulfonyl)benzene was used in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 489.1; HRMS: calcd for C25H23F3N2O3S+H+, 489.14542. found (ESI, [M+H]+), 489.1458.
The title compound was prepared in a manner similar to that described in Example 17 except that 3-(3-fluorophenylsulfonyl)propan-1-ol was used in place of 1-fluoro-3-(methylsulfonyl)benzene. MS (ES) m/z 505.1; HRMS: calcd for C25H23F3N2O4S+H+, 505.14034. found (ESI, [M+H]+), 505.141.
The title compound was prepared in a manner similar to that described in Example 17 except that 4-(3-fluorophenylsulfonyl)-2-methylbutan-2-ol was used in place of 1-fluoro-3-(methylsulfonyl)benzene. HRMS: calcd for C27H27F3N2O4S+H+, 533.17164. found (ESI, [M+H]+), 533.1737.
The title compound was prepared in a manner similar to that described in Example 17 except that 5-(3-fluorophenylsulfonyl)pentan-1-ol was used in place of 1-fluoro-3-(methylsulfonyl)benzene. HRMS: calcd for C27H27F3N2O4S+H+, 533.17164. found (ESI, [M+H]+), 533.1734.
The title compound was prepared in a manner similar to that described in Example 17 except that 1,3-difluoro-5-(methylsulfonyl)benzene was used in place of 1-fluoro-3-(methylsulfonyl)benzene. HRMS: calcd for C23H18F4N2O3S+H+, 479.10470. found (ESI, [M+H]+), 479.1048.
A mixture of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol (0.064 g, 0.20 mmol), 1-bromo-3-(methylsulfonyl)benzene (0.094 g, 0.40 mmol), copper(I) iodide (3.8 mg, 0.020 mmol), cesium carbonate (0.195 g, 0.599 mmol) and N,N-dimethylglycine hydrochloride (10.5 mg, 0.075 mmol) in dioxane (3 mL) was heated at reflux overnight. The reaction was cooled, diluted with water and extracted with several portions of ethyl acetate. The combined organics were washed with half-saturated brine and dried over MgSO4. The extracts were concentrated in vacuo and chromatographed using a 0:100 to 30:70 E:H gradient to afford the title compound as a white solid (0.060 g, 63%). MS (ES) m/z 474.9.
The title compound was prepared in a manner similar to that described in Example 25 except that 1-bromo-3-(ethylsulfonyl)benzene was used in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 489.0.
The title compound was prepared in a manner similar to that described in Example 25 except that 1-bromo-3-(isopropylsulfonyl)benzene was used in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 502.9.
A mixture of 3-(2-benzyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol (0.100 g, 0.27 mmol), 3-(methylsulfonyl)phenylboronic acid (0.109 g, 0.543 mmol), diacetoxycopper (0.049 g, 0.27 mmol), pyridine (0.066 mL, 0.81 mmol) and 4A molecular sieves (0.250 g) in dichloromethane (7 mL) was stirred open to the air overnight at room temperature. The reaction was filtered through Celite and concentrated in vacuo. The product was chromatographed using a 0:100 to 25:75 E:H gradient to afford impure compound. Therefore, further purification via reverse phase chromatography using a 0:100 to 100:0 acetonitrile:water gradient gave the title compound as a white solid (0.052 g, 37%). MS (ES) m/z 522.9; HRMS: calcd for C28H21F3N2O3S+H+, 523.12977. found (ESI, [M+H]+), 523.1299.
The title compound was prepared in a manner similar to that described in Example 28 except that 3-(ethylsulfonyl)phenylboronic acid was used in place of 3-(methylsulfonyl)phenylboronic acid. MS (ES) m/z 536.9; HRMS: calcd for C29H23F3N2O3S+H+, 537.14542. found (ESI, [M+H]+), 537.1454.
A mixture of 3-(2-benzyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol (0.100 g, 0.271 mmol), 1-bromo-3-(isopropylsulfonyl)benzene (0.143 g, 0.54 mmol), copper(I) iodide (5.2 mg, 0.027 mmol), cesium carbonate (0.265 g, 0.814 mmol) and N,N-dimethylglycine hydrochloride (0.014 g, 0.10 mmol) in dioxane (3 mL) was heated at reflux overnight. The cooled reaction was diluted with water and extracted with several portions of ethyl acetate. The extracts were dried over MgSO4, concentrated in vacuo, and chromatographed using a 0:100 to 30:70 E:H gradient to afford the title compound as a white solid (0.035 g, 23%). MS (ES) m/z 550.9.
A stirred mixture of 3-bromobenzenesulfonyl chloride (5.11 g, 20.0 mmol) and triethylamine (3.07 mL, 22.0 mmol) in dichloromethane (100 mL) was treated with 4-methoxybenzylamine (2.85 mL, 22.0 mmol) over 5 min. After 2 h at ambient temperature, the reaction was treated with saturated aqueous NaHCO3 (100 mL) and extracted with dichloromethane (2×50 mL). The combined extracts were dried (MgSO4) and concentrated in vacuo to a solid. Chromatography eluting with a 30:70 to 50:50 E:H gradient afforded the title compound as a white solid (6.18 g, Rf ˜0.4 in 50:50 E:H).
A solution of 3-bromo-N-(4-methoxybenzyl)benzenesulfonamide (3.56 g, 10.0 mmol) in DMF (20 mL) was treated with 60% NaH in oil (440 mg, 11.0 mmol). Gas evolved. After 20 min, 4-methoxybenzyl chloride (1.63 mL, 12.0 mmol) was added and the reaction is stirred at ambient temperature for 5 h. The reaction was poured into water (60 mL) resulting in a white precipitate. The precipitate was filtered off, washed with water, and dried in vacuo to afford the title compound as a white solid (4.92 g, Rf ˜0.5 in E:H).
A solution of 3-bromo-N-(4-methoxybenzyl)benzenesulfonamide (2.49 g, 7.00 mmol) in DMF (20 mL) was treated with 60% NaH in oil (336 mg, 8.4 mmol). Gas evolved. After 10 min, methyl iodide (0.66 mL, 10.5 mmol) was added and the reaction is stirred at ambient temperature overnight. The reaction was poured into water (60 mL) and extracted with ethyl acetate (2×40 mL). The extracts are was dried (MgSO4), concentrated in vacuo, and chromatographed using a 20:80 to 50:50 E:H gradient to afford the title compound as a white solid (2.21 g, Rf ˜0.5 in 50:50 E:H).
The title compound was prepared in a manner similar to that described in Example 31 except that 4-fluorobenzenesulfonyl chloride was used in place of 3-bromobenzenesulfonyl chloride, isolating a white solid.
A solution of 4-fluoro-N-(4-methoxybenzyl)benzenesulfonamide (2.95 g, 10.0 mmol) in DMF (20 mL) was treated with 60% NaH in oil (440 mg, 11.0 mmol). Gas evolved. After 20 min, 4-methoxybenzyl chloride (1.63 mL, 12.0 mmol) was added and the reaction was stirred at ambient temperature for 5 h. The reaction was treated with water (60 mL) producing a white precipitate. The material was chromatographed using a 20:80 to 40:60 E:H gradient to afford the title compound as a white solid (3.08 g).
A mixture of 3-(2-isopropyl-8-chloro-imidazo[1,2-a]pyridin-3-yl)phenol (143 mg, 0.50 mmol), 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide (357 mg, 0.75 mmol), CuI (40 mg, 0.20 mmol), Me2NCH2CO2H hydrochloride (53 mg, 0.375 mmol), and cesium carbonate (489 mg, 150 mmol) in 1,4-dioxane (8.0 mL) was heated at 105° C. under nitrogen. After 18 h, the reaction was treated with water (20 mL) and extracted with ethyl acetate (3×10 mL). The extracts were dried (MgSO4), concentrated in vacuo, and chromatographed on silica gel using a 15:85 to 50:50 E:H gradient and then by reverse phase chromatography using a 0:100 to 100:0 acetonitrile:water gradient to afford the title compound as a white solid (215 mg, Rf ˜0.15 in 35:65 E:H).
A mixture of 3-(2-isopropyl-8-chloro-imidazo[1,2-a]pyridin-3-yl)phenol (143 mg, 0.50 mmol), 4-fluoro-N,N-bis(4-methoxybenzyl)benzenesulfonamide (249 mg, 0.60 mmol), and 138 mg (1.00 mmol) in DMF (5.0 mL) was heated at 130° C. under nitrogen for 18 h. The reaction was cooled, treated with water (20 mL), and extracted with ethyl acetate (3×10 mL). The dried (MgSO4) extracts were concentrated in vacuo and chromatographed on silica gel using a 20:80 to 50:50 E:H gradient to afford the title compound as a white solid (326 mg, Rf ˜0.15 in 35:65 E:H).
3-(3-(8-Chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenoxy)-N,N-bis(4-methoxybenzyl)benzenesulfonamide (182 mg, mmol) in dichloromethane (2.0 mL) was treated with trifluoroacetic acid (2.0 mL) and stirred at ambient temperature for 18 h, then concentrated in vacuo. The residue was treated with saturated aqueous NaHCO3 (10 mL) and extracted with dichloromethane (3×10 mL). The extracts were dried (MgSO4) and concentrated in vacuo. The residue was purified by chromatography eluting with an E:H gradient to afford the title compound as a white solid.
The title compound was prepared in a manner similar to that described in Example 38 except that 4-(3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenoxy)-N,N-bis(4-methoxybenzyl)benzenesulfonamide (279 mg) was used as the substrate.
In essentially the same manner as Example 36 but using 3-(2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 3-bromo-N-(4-methoxybenzyl)-N-methylbenzenesulfonamide as starting materials was prepared the title compound as a colorless oil. MS (ES) m/z 595.8. HRMS: calcd for C31H28F3N3O4S+H+, 596.18254. found (ESI, [M+H]+ Obs'd), 596.1827.
In essentially the same manner as Example 36 but using 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide as starting materials was prepared the title compound as a colorless oil. MS (ES) m/z 715.8. HRMS: calcd for C39H36F3N3O5S+H+, 716.24005. found (ESI, [M+H]+ Obs'd), 716.2397.
In essentially the same manner as Example 36 but using 3-(8-chloro-2-ethylimidazo[1,2-a]pyridin-3-yl)phenol and 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide as starting materials was prepared the title compound as a pale yellow solid. MS (ES) m/z 667.7. HRMS: calcd for C37H34ClN3O5S+H+, 668.19805. found (ESI, [M+H]+ Obs'd), 668.1986.
In essentially the same manner as Example 36 but using 3-(2-ethyl-8-chloroimidazo[1,2-a]pyridin-3-yl)phenol and 3-bromo-N-(4-methoxybenzyl)-N-methylbenzenesulfonamide as starting materials was prepared the title compound as an off-white solid. MS (ES) m/z 561.7; HRMS: calcd for C30H28ClN3O4S+H+, 562.15618. found (ESI, [M+H]+ Obs'd), 562.1559.
In essentially the same manner as Example 36 but using 3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenol and 3-bromo-N-(4-methoxybenzyl)-N-methylbenzenesulfonamide as starting materials was prepared the title compound as a white solid from a foam. MS (ES) m/z 575.7. HRMS: calcd for C31H30ClN3O4S+H+, 576.17183. found (ESI, [M+H]+ Obs'd), 576.1720.
In essentially the same manner as Example 36 but using 3-(8-cyano-2-ethylimidazo[1,2-a]pyridin-3-yl)phenol and 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide as starting materials was prepared the title compound as a light yellow solid. MS (ESI) m/z 659. HRMS: calcd for C38H34N4O5S+H+, 659.23227. found (ESI, [M+H]+ Obs'd), 659.2323.
In essentially the same manner as Example 36 but using 3-(8-cyano-2-ethylimidazo[1,2-a]pyridin-3-yl)phenol and 3-bromo-N-(4-methoxybenzyl)-N-methylbenzenesulfonamide as starting materials was prepared the title compound as a light yellow solid. MS (ES) m/z 552.7. HRMS: calcd for C31H28N4O4S+H+, 553.19040. found (ESI, [M+H]+ Obs'd), 553.1903.
In essentially the same manner as Example 38 but using 3-[3-(8-chloro-2-ethylimidazo[1,2-a]pyridin-3-yl)phenoxy]-N,N-bis(4-methoxybenzyl)benzenesulfonamide as starting material was prepared the title compound as a white solid. MS (ES) m/z 427.7; HRMS: calcd for C21H18ClN3O3S+H+, 428.08301. found (ESI, [M+H]+ Obs'd), 428.0835.
In essentially the same manner as Example 38 but using 3-[3-(8-chloro-2-ethylimidazo[1,2-a]pyridin-3-yl)phenoxy]-N-(4-methoxybenzyl)-N-methylbenzenesulfonamide as starting material was prepared the title compound as a white solid. MS (ES) m/z 441.6. HRMS: calcd for C22H20ClN3O3S+H+, 442.09866. found (ESI, [M+H]+ Obs'd), 442.0992.
In essentially the same manner as Example 38 but using 3-[3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenoxy]-N-(4-methoxybenzyl)-N-methylbenzenesulfonamide as starting material was prepared the title compound as an off-white solid. MS (ES) m/z 455.6; HRMS: calcd for C23H22ClN3O3S+H+, 456.11431. found (ESI, [M+H]+ Obs'd), 456.1145.
In essentially the same manner as Example 38 but using 3-[3-(8-cyano-2-ethylimidazo[1,2-a]pyridin-3-yl)phenoxy]-N,N-bis(4-methoxybenzyl)benzenesulfonamide as starting material was prepared the title compound as a pale yellow solid. MS (ES) m/z 418.7. HRMS: calcd for C22H18N4O3S+H+, 419.11724. found (ESI, [M+H]+ Obs'd), 419.1174.
In essentially the same manner as Example 38 but using 3-[3-(8-cyano-2-ethylimidazo[1,2-a]pyridin-3-yl)phenoxy]-N-(4-methoxybenzyl)-N-methylbenzenesulfonamide as starting material was prepared the title compound as a light yellow solid. MS (ES) m/z 432.7. HRMS: calcd for C23H20N4O3S+H+, 433.13289. found (ESI, [M+H]+ Obs'd), 433.1335.
A mixture of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol (96 mg, 0.30 mmol), 1-(bromomethyl)-3-(methylsulfonyl)benzene (90 mg, 0.36 mmol), and cesium carbonate (137 mg, 0.42 mmol) in DMF (2.0 mL) was heated at 40° C. under nitrogen. After 18 h, the reaction was treated with water (8 mL) and brine (2 mL). The mixture was extracted with ethyl acetate (2×10 mL). The extracts were dried (MgSO4), concentrated in vacuo, and chromatographed on silica gel using a 30:70 to 80:20 E:H gradient to afford the title compound as an off-white solid (145 mg). MS (ES) m/z 489.1. HRMS: calcd for C25H23F3N2O3S+H+, 489.14542. found (ESI, [M+H]+ Obs'd), 489.1461.
In essentially the same manner as Example 52 but using 3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenol and 1-(bromomethyl)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as an off-white solid. MS (ES) m/z 455.0. HRMS: calcd for C24H23ClN2O3S+H+, 455.11907. found (ESI, [M+H]+ Obs'd), 455.1197.
In essentially the same manner as Example 52 but using 3-(8-cyano-2-ethylimidazo[1,2-a]pyridin-3-yl)phenol and 1-(bromomethyl)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ES) m/z 432.0. HRMS: calcd for C24H21N3O3S+H+, 432.13764. found (ESI, [M+H]+ Obs'd), 432.1383.
In essentially the same manner as Example 52 but using 3-(8-cyano-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenol and 1-(bromomethyl)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ES) m/z 446.1. HRMS: calcd for C25H23N3O3S+H+, 446.15329. found (ESI, [M+H]+ Obs'd), 446.1545.
In essentially the same manner as Example 52 but using 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-(chloromethyl)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a white solid. MS (ES) m/z 489.1. HRMS: calcd for C25H23F3N2O3S+Na+, 511.12736. found (ESI, [M+Na]+ Obs'd), 511.1280.
In essentially the same manner as Example 52 but using 3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenol and 1-(chloromethyl)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as an off-white solid. MS (ES) m/z 455.0. HRMS: calcd for C24H23ClN2O3S+H+, 455.11907. found (ESI, [M+H]+ Obs'd), 455.1195.
In essentially the same manner as Example 52 but using 3-(8-cyano-2-ethylimidazo[1,2-a]pyridin-3-yl)phenol and 1-(chloromethyl)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ES) m/z 432.1. HRMS: calcd for C24H21N3O3S+H+, 432.13764. found (ESI, [M+H]+ Obs'd), 432.1383.
In essentially the same manner as Example 52 but using 3-(8-cyano-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenol and 1-(chloromethyl)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ES) m/z 446.1. HRMS: calcd for C25H23N3O3S+H+, 446.15329. found (ESI, [M+H]+ Obs'd), 446.1543.
A mixture of 3-fluorobenzene-1-sulfonyl chloride (5.00 g, 25.7 mmol), 18-crown-6 (0.170 g, 0.642 mmol) and potassium fluoride (7.46 g, 128 mmol) in acetonitrile (51 mL) was stirred for 4 h. Saturated NaHCO3 (200 mL) was added and the mixture was extracted with ethyl acetate. The combined organics were washed with saturated NaHCO3 (200 mL) and dried over MgSO4 and concentrated to yield the title intermediate as a yellow oil that was used without purification in the next step (4.20 g, 92%).
3-Fluorobenzenesulfonyl fluoride (4.20 g, 23.6 mmol) and tris(dimethylamino)sulfur(trimethylsilyl)difluoride (0.649 g, 2.36 mmol) was taken into THF (24 mL). (Trifluoromethyl)trimethylsilane (7.06 mL, 47.1 mmol) in THF (24 mL) was added dropwise over 15 min. The reaction was allowed to stir overnight at room temperature. Water was added and then the mixture was extracted with ethyl acetate. The combined extracts were washed several times with water, then by half-saturated brine, dried over MgSO4 and concentrated. The crude product was purified by column chromatography using a 0:100 to 20:80 E:H gradient to provide the title intermediate as a yellow liquid (3.32 g, 62%).
A mixture of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol (0.100 g, 0.312 mmol), 1-fluoro-3-(trifluoromethylsulfonyl)benzene (0.142 g, 0.624 mmol) and potassium carbonate (0.086 g, 0.62 mmol) in DMF (3 mL) was heated at 100° C. overnight. The mixture was cooled, then diluted with water. The mixture was extracted with ethyl acetate and the combined organics were washed with half-saturated brine and dried over MgSO4. Purification by column chromatography using a 0:100 to 20:80 E:H gradient afforded the title compound as a white solid (0.121 g, 73%). HRMS: calcd for C24H18F6N2O3S+H+, 529.10151. found (ESI, [M+H]+ Obs'd), 529.1020.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(3-bromophenylsulfonyl)propan-1-ol in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 519.1. HRMS: calcd for C26H25F3N2O4S+H+, 519.15599. found (ESI, [M+H]+ Obs'd), 519.1566.
3-(3-(3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenoxy)phenylsulfonyl)propan-1-ol (0.431 g, 0.83 mmol) and triethylamine (0.23 mL, 1.66 mmol) in dichloromethane (5 mL) was cooled to 0° C. Methanesulfonyl chloride (0.129 mL, 1.66 mmol) was added dropwise and the reaction stirred overnight at room temperature. Saturated aqueous NaHCO3 was added and the mixture extracted with dichloromethane and concentrated to afford the title intermediate used in the next step without purification (0.571 g).
A mixture of 3-(3-(3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenoxy)phenylsulfonyl)propyl methanesulfonate (0.250 g, 0.419 mmol) and 2.0 M methylamine in MeOH (2.09 mL, 4.19 mmol) in THF (5 mL) was heated at 60° C. overnight. The reaction mixture was concentrated and purified via column chromatography using a 0:100 to 15:85 MeOH:DCM gradient to provide impure product that was further purified via reverse phase chromatography using a 0:100 to 100:0 acetonitrile:water gradient to afford the title compound as an off-white solid (0.100 g, 45%). MS (ES) m/z 531.8. MS (ES) m/z 531.8; HRMS: calcd for C27H28F3N3O3S+H+, 532.18762. found (ESI, [M+H]+ Obs'd), 532.1879.
A mixture of 3-chloropyridin-2-amine (3.00 g, 23.3 mmol), 1-bromobutan-2-one (2.62 mL, 25.7 mmol) and sodium bicarbonate (3.92 g, 46.7 mmol) in ethanol (50 mL) was refluxed overnight. The ethanol was removed and the resulting material was taken into ethyl acetate and water and the layers separated. The aqueous layer was extracted with ethyl acetate and the combined organics were dried over MgSO4 and concentrated. Purification by column chromatography using a 5:95 to 40:60 E:H gradient afforded the title intermediate (3.56 g, 84%).
A mixture of 8-chloro-2-ethylimidazo[1,2-a]pyridine (1.00 g, 5.54 mmol), 3-iodophenol (1.34 g, 6.09 mmol), potassium acetate (1.63 g, 16.6 mmol) and 20% palladium hydroxide on carbon powder (0.389 g, 0.554 mmol) in N,N-dimethylacetamide (30 mL) was heated at 145° C. overnight. The reaction was cooled and filtered through Celite®. The filtrate was treated water and extracted with ethyl acetate. The combined extracts were washed with half-saturated brine and dried over MgSO4. Purification via column chromatography eluting with a 0:100 to 50:50 E:H gradient afforded the title intermediate (0.97 g, 64%).
The title compound was prepared in a similar manner to that of Example 25 except using 3-(8-chloro-2-ethylimidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol. MS (ES) m/z 426.9. HRMS: calcd for C22H19ClN2O3S+H+, 427.08777. found (ESI, [M+H]+ Obs'd), 427.0878.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(8-chloro-2-ethylimidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(ethylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 440.9. HRMS: calcd for C23H21ClN2O3S+H+, 441.10342. found (ESI, [M+H]+ Obs'd), 441.1049.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(8-chloro-2-ethylimidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(isopropylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 454.9. HRMS: calcd for C24H23ClN2O3S+H+, 455.11907. found (ESI, [M+H]+ Obs'd), 455.1196.
A mixture of 3-chloropyridin-2-amine (3.00 g, 23.34 mmol), 1-bromo-3-methylbutan-2-one (4.24 g, 25.7 mmol) and sodium bicarbonate (3.92 g, 46.7 mmol) in ethanol (75 mL) was heated at reflux overnight. The ethanol was removed and the resulting material was taken into ethyl acetate and water and the layers were separated. The aqueous layer was extracted with additional ethyl acetate. The combined organics were dried over MgSO4 and concentrated. Purification via column chromatography using 0:100 to 40:60 E:H gradient afforded 2.82 g (62%) of the title intermediate.
A mixture of 8-chloro-2-isopropylimidazo[1,2-a]pyridine (2.74 g, 14.1 mmol), 3-iodophenol (3.41 g, 15.5 mmol), potassium acetate (4.14 g, 42.2 mmol) and 20% palladium hydroxide on carbon powder (0.988 g, 1.41 mmol) in N,N-dimethylacetamide (70 mL) was heated at 145° C. overnight. The reaction was cooled filtered through Celite®. Ethyl acetate and water were added and the layers were separated. The aqueous layer was extracted with additional ethyl acetate. The combined extracts were washed with half-saturated brine, dried over MgSO4, and concentrated. Purification via column chromatography using E:H afforded 3.48 g (86%) of the title intermediate as an off-white solid. MS (ES) m/z 287.0. HRMS: calcd for C16H15ClN2O+H+, 287.09457. found (ESI, [M+H]+ Obs'd), 287.0938.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol. MS (ES) m/z 441.2. MS (ES) m/z 441.2; HRMS: calcd for C23H21ClN2O3S+H+, 441.10342. found (ESI, [M+H]+ Obs'd), 441.1048.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(ethylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 454.9. HRMS: calcd for C24H23ClN2O3S+H+, 455.11907. found (ESI, [M+H]+ Obs'd), 455.1197.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(isopropylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 468.6. HRMS: calcd for C25H25ClN2O3S+H+, 469.13472. found (ESI, [M+H]+ Obs'd), 469.1351.
A mixture 2-aminonicotinonitrile (5.00 g, 42.0 mmol), 1-bromobutan-2-one (4.71 mL, 46.2 mmol) and sodium bicarbonate (7.05 g, 84.0 mmol) in ethanol (100 mL) was heated at reflux overnight. The ethanol was removed in vacuo and the resulting material was taken into water and ethyl acetate. The layers were separated and the aqueous layer was extracted several times with ethyl acetate. The combined extracts were dried over MgSO4 and concentrated. Purification via column chromatography eluting with a 10:90 to 100:0 E:H gradient afforded 4.62 g (64%) of the title intermediate as a white solid.
A mixture of 2-ethylimidazo[1,2-a]pyridine-8-carbonitrile (1.79 g, 10.5 mmol), 3-iodophenol (2.53 g, 11.5 mmol), potassium acetate (3.08 g, 31.4 mmol) and 20% palladium hydroxide (0.147 g, 1.046 mmol) in N,N-dimethylacetamide (50 mL) was heated at 145° C. overnight. The reaction was cooled and filtered through Celite®. The filtrate was partitioned between ethyl acetate and water and the layers separated. The aqueous layer was extracted with ethyl acetate. The combined extracts were washed with half-saturated brine, dried over MgSO4, and concentrated. Purification via column chromatography eluting with a 5:95 to 45:55 E:H gradient afforded the title intermediate (2.47 g, 90%) as a tan solid.
The title compound was prepared in a similar manner to that of Example 25 except using 2-ethyl-3-(3-hydroxyphenyl)imidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol MS (ES) m/z 418.0. HRMS: calcd for C23H19N3O3S+H+, 418.12199. found (ESI, [M+H]+ Obs'd), 418.1218.
The title compound was prepared in a similar manner to that of Example 25 except using 2-ethyl-3-(3-hydroxyphenyl)imidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(ethylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 432.1. HRMS: calcd for C24H21N3O3S+H+, 432.13764. found (ESI, [M+H]+ Obs'd), 432.1389.
The title compound was prepared in a similar manner to that of Example 25 except using 2-ethyl-3-(3-hydroxyphenyl)imidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(isopropylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 445.9. HRMS: calcd for C25H23N3O3S+H+, 446.15329. found (ESI, [M+H]+ Obs'd), 446.1539.
A mixture of 2-aminonicotinonitrile (5.51 g, 46.3 mmol), 1-bromo-3-methylbutan-2-one (9.16 g, 55.5 mmol) and sodium bicarbonate (7.77 g, 93 mmol) in ethanol (150 mL) was refluxed for 65 h. The ethanol was removed and the resulting material was taken into water and ethyl acetate. The layers were separated and the aqueous layer was extracted with ethyl acetate. The combined organic extracts were dried over MgSO4 and concentrated. Purification via column chromatography eluting with a 10:90 to 100:0 E:H gradient afforded 3.33 g (39%) of the title intermediate.
A mixture of 2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile (1.70 g, 9.18 mmol), 3-iodophenol (2.22 g, 10.1 mmol), potassium acetate (2.70 g, 27.5 mmol) and 20% palladium hydroxide on carbon (0.644 g, 0.918 mmol) in N,N-dimethylacetamide (46 mL) was heated at 145° C. overnight. The reaction was cooled and filtered through Celite®. The filtrate was partitioned between ethyl acetate and water and the layers separated. The aqueous layer was extracted with ethyl acetate. The combined organic extracts were washed with half-saturated brine and dried over MgSO4. Purification via column chromatography eluting with a 5:95 to 45:55 E:H gradient afforded the title intermediate (1.93 g, 76%).
The title compound was prepared in a similar manner to that of Example 25 except using 3-(3-hydroxyphenyl)-2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol. MS (ES) m/z 432.2. HRMS: calcd for C24H21N3O3S+H+, 432.13764. found (ESI, [M+H]+ Obs'd), 432.1381.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(3-hydroxyphenyl)-2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(ethylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 446.1. HRMS: calcd for C25H23N3O3S+H+, 446.15329. found (ESI, [M+H]+ Obs'd), 446.1532.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(3-hydroxyphenyl)-2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(isopropylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 459.9. HRMS: calcd for C26H25N3O3S+H+, 460.16894. found (ESI, [M+H]+ Obs'd), 460.1697.
A mixture of 3-(trifluoromethyl)pyridin-2-amine (1.50 g, 9.25 mmol), 1-bromo-3,3-dimethylbutan-2-one (1.25 mL, 9.25 mmol) and sodium bicarbonate (1.56 g, 18.5 mmol) in ethanol (31 mL) was refluxed for 88 h. The ethanol was removed and to the resulting material was added water. The mixture was extracted with DCM and dried over MgSO4. Purification via column chromatography using a 0:100 to 20:80 E:H gradient afforded the title intermediate (0.59 g, 26%) as an off-white solid.
A mixture of 2-tert-butyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.100 g, 0.413 mmol), 1-iodo-3-(3-(methylsulfonyl)phenoxy)benzene (0.170 g, 0.454 mmol), potassium acetate (0.122 g, 1.24 mmol) and 20% palladium hydroxide on carbon (0.029 g, 0.041 mmol) in N,N-dimethylacetamide (2 mL) was heated at 145° C. overnight. The reaction was cooled and filtered through Celite®. The resulting material was partitioned between ethyl acetate and water and the layers were separated. The organic layer was washed several times with water then with a solution of half-saturated brine. The combined extracts were dried over MgSO4 and concentrated. Purification via column chromatography eluting with a 0:100 to 25:75 E:H gradient afforded the title compound (0.144 g, 71%) as a white solid. MS (ES) m/z 488.9. HRMS: calcd for C25H23F3N2O3S+H+, 489.14542. found (ESI, [M+H]+ Obs'd), 489.1448.
A mixture of 2-tert-butyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.399 g, 1.65 mmol), 3-iodophenol (0.399 g, 1.81 mmol), potassium acetate (0.485 g, 4.94 mmol) and 20% palladium hydroxide on carbon (0.116 g, 0.165 mmol) in N,N-dimethylacetamide (20 mL) was heated at 145° C. overnight. The reaction was cooled and filtered through Celite®. The resulting material was partitioned between ethyl acetate and water and the layers were separated. The organic layer was washed several times with water then with a solution of half-saturated brine. The combined extracts were dried over MgSO4 and concentrated. Purification via column chromatography eluting with a 0:100 to 30:70 E:H gradient afforded the title intermediate (0.372 g, 68%).
The title compound was prepared in a similar manner to that of Example 25 except using 3-(2-tert-butyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(ethylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 503.1. HRMS: calcd for C26H25F3N2O3S+H+, 503.16107. found (ESI, [M+H]+ Obs'd), 503.1615.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(2-tert-butyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(isopropylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene.
1H NMR (400 MHz, DMSO-d6) δ 1.13 (d, 6H), 1.25 (s, 9H), 3.4 (m, 1H), 6.9 (t, 1H), 7.25-7.55 (m, 5H), 7.6-7.75 (m, 4H), 7.95 (d, 1H).
The title compound was prepared in a similar manner to that of Example 25 except using 3-(2-tert-butyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 3-(3-bromophenylsulfonyl)propan-1-ol in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 533.0. HRMS: calcd for C27H27F3N2O4S+H+, 533.17164. found (ESI, [M+H]+ Obs'd), 533.1724.
A mixture of 2-aminonicotinonitrile (3.00 g, 25.2 mmol) and 1-bromo-3,3-dimethylbutan-2-one (4.07 mL, 30.2 mmol) in ethanol (84 mL) was refluxed overnight. The ethanol was removed. The resulting material was partitioned between water and ethyl acetate. The layers were separated and the aqueous layer extract with additional ethyl acetate. The combined extracts were dried over MgSO4 and concentrated. Purification via column chromatography using E:H gradient afforded an off-white solid 1.66 g (33%).
A mixture of 2-tert-butylimidazo[1,2-a]pyridine-8-carbonitrile (1.60 g, 8.03 mmol), 3-iodophenol (1.943 g, 8.83 mmol), potassium acetate (2.364 g, 24.09 mmol) and 20% palladium hydroxide on carbon powder (0.564 g, 0.803 mmol) in N,N-dimethylacetamide (40 mL) was heated at 145° C. overnight. The reaction was cooled then filtered through Celite® using ethyl acetate to transfer. The mother liquor was further diluted with ethyl acetate and washed with water twice, then with brine. The organic layer was dried over MgSO4 and concentrated. Purification via column chromatography using a 0:100 to 70:30 E:H gradient produced the title intermediate as a light yellow solid.
The title compound was prepared in a similar manner to that of Example 25 except using 2-tert-butyl-3-(3-hydroxyphenyl)imidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(ethylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 460.1. HRMS: calcd for C26H25N3O3S+H+, 460.16894. found (ESI, [M+H]+ Obs'd), 460.1691.
The title compound was prepared in a similar manner to that of Example 25 except using 2-tert-butyl-3-(3-hydroxyphenyl)imidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(isopropylsulfonyl)benzene was used in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 474.1. HRMS: calcd for C27H27N3O3S+H+, 474.18459. found (ESI, [M+H]+ Obs'd), 474.1848.
The title compound was prepared in a similar manner to that of Example 25 except using 2-tert-butyl-3-(3-hydroxyphenyl)imidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 3-(3-bromophenylsulfonyl)propan-1-ol in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 490.1. HRMS: calcd for C27H27N3O4S+H+, 490.17950. found (ESI, [M+H]+ Obs'd), 490.1799.
A mixture of 2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile (0.700 g, 3.78 mmol), 3-bromo-4-chlorophenol (1.18 g, 5.67 mmol), potassium acetate (1.113 g, 11.3 mmol) and 20% palladium hydroxide on carbon powder (0.265 g, 0.378 mmol) in N,N-dimethylacetamide (20 mL) was heated at 155° C. for 65 h. The reaction was cooled and filtered through Celite®. Ethyl acetate and water were added and the layers were separated. The aqueous layer was extracted with additional ethyl acetate. The combined extracts were washed with half-saturated brine, dried over MgSO4, and concentrated. Purification via column chromatography using an E:H gradient produced the title intermediate.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(2-chloro-5-hydroxyphenyl)-2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol. MS (ESI) m/z 466. HRMS: calcd for C24H20ClN3O3S+H+, 466.09866. found (ESI, [M+H]+ Obs'd), 466.0995.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(2-chloro-5-hydroxyphenyl)-2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(ethylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ESI) m/z 480. HRMS: calcd for C25H22ClN3O3S+H+, 480.11431. found (ESI, [M+H]+ Obs'd), 480.1148.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(2-chloro-5-hydroxyphenyl)-2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-(isopropylsulfonyl)benzene in place of 1-bromo-3-(methylsulfonyl)benzene. MS (ES) m/z 494.1. HRMS: calcd for C26H24ClN3O3S+H+, 494.12996. found (ESI, [M+H]+ Obs'd), 494.1305.
A mixture of 3-(trifluoromethyl)pyridin-2-amine (2.00 g, 12.3 mmol) and 3-methoxyphenylglyoxal hydrate (2.25 g, 12.3 mmol) in dichloromethane (25 mL) was refluxed for 1 h. The solvent was removed and the resulting material was taken into carbon tetrachloride (25 mL) along with thionyl chloride (80 mL). This mixture was refluxed for 0.5 h. The solvent was removed and the resulting material was carefully neutralized with aqueous K2CO3. Extraction with ethyl acetate followed by drying over MgSO4 and concentration afforded the crude product. Purification via column chromatography using 0:100 to 30:70 E:H gradient afforded 2.24 g (56%) of the title intermediate.
A mixture of 2-chloro-3-(3-methoxyphenyl)-8-(trifluoromethyl)imidazo[1,2-a]pyridine (2.13 g, 6.52 mmol) in dichloromethane (65 mL) was cooled to 0° C. Boron trifluoride-methyl sulfide complex (4.12 mL, 39.1 mmol) was added dropwise. The reaction was then allowed to stir at room temperature overnight. Water and methanol were added. A stream of nitrogen was passed over the mixture for 1 h to remove Me2S. The reaction was extract with ethyl acetate and the extracts drier over MgSO4. Purification via column chromatography using 0:100 to 40:60 E:H gradient afforded 1.04 g (51%) of the title intermediate.
The title compound was prepared in a similar manner to that of Example 25 except using 3-(2-chloro-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol. MS (ES) m/z 466.6. HRMS: calcd for C21H14ClF3N2O3S+H+, 467.04385. found (ESI, [M+H]+ Obs'd), 467.0441.
A mixture of 2-chloro-3-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.202 g, 0.433 mmol), phenylboronic acid (0.106 g, 0.865 mmol), (tetrakistriphenyl)phosphine palladium (0.050 g, 0.043 mmol) and potassium carbonate (0.239 g, 1.73 mmol) in 1,4-dioxane (4.5 mL) and water (1.5 mL) was heated at 100° C. overnight. The reaction was cooled and diluted with water and extracted with ethyl acetate. The combined organics were dried over MgSO4 and concentrated. Purification via column chromatography using E:H, followed by reverse phase chromatography (0:100 to 100:0 acetonitrile:water) produced the title intermediate as a white solid. HRMS: calcd for C27H19F3N2O3S+H+, 509.11412. found (ESI, [M+H]+ Obs'd), 509.1152.
A mixture of 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.214 g, 1.00 mmol), 2,6-dibromopyridine (0.237 g, 1.00 mmol) and cesium carbonate (0.325 g, 1.00 mmol) in DMA (2 mL) containing a catalytic amounts of palladium(II) diacetate (5 mg, 2 mol %) and triphenylphosphine (11 mg, 4 mol %) was degassed and heated at 80° C. for 1 hr. The mixture was partitioned with ethyl acetate and H2O. Countercurrent extraction of the aqueous layer provided 0.20 g of product as a brown oil. Purified by HPLC chromatography (silica gel, methylene chloride-acetonitrile 100:0 gradient to 85:15) provided 0.119 g of the title intermediate as a white solid. MS (ES) m/z 369.6; HRMS: calcd for C15H11BrF3N3+H+, 370.01612. found (ESI, [M+H]+ Obs'd), 370.0158.
Prepared in the same manner as outlined in Example 87, step 1, from 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.214 g, 1.00 mmol) and 2,5-dibromopyridine (0.237 g, 1.00 mmol) to give the title intermediate as a white solid (0.055 g). MS (ES) m/z 369.5. HRMS: calcd for C15H11BrF3N3+H+, 370.01612. found (ESI, [M+H]+), 370.0157.
A mixture of 3-(6-bromopyridin-3-yl)-2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.050 g, 0.135 mmol), 3-(methylsulfonyl)phenylboronic acid (0.028 g, 0.14 mmol), 1.0 M aqueous sodium carbonate (0.28 mL) and tetrakis-(triphenylphosphine)palladium(0) (3.0 mg) in diglyme (2 mL) was degassed and heated at 80° C. overnight. The mixture was partitioned with ethyl acetate and H2O to provide a brown oil. Purification by HPLC chromatography (silica gel, using a 95:5 to 85:15 gradient of methylene chloride:acetonitrile) provided the title compound as a white solid (0.010 g). NMR (400 MHz, acetone d6) δ 1.30 (t, 3H), 2.79 (q, 2H), 3.20 (s, 3H), 7.03 (t, 1H), 7.69 (d, 1H), 7.81 (t, 1H), 8.03 (dd, 1H), 8.16 (dd, 1H), 8.30 (dd, 1H), 8.53 (d, 1H), 8.78 (m, 1H), 8.90 (m, 1H).
A mixture of 3-(6-bromopyridin-2-yl)-2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.105 g, 0.28 mmol), 3-(methylsulfonyl)phenol (0.72 g, 0.042 mmol), cesium carbonate (0.295 g, 0.84 mmol) and copper powder (2 mg) in DMF (100 mL) was heated overnight at 100° C. The reaction mixture was partitioned with ethyl acetate and H2O. The organic phase was concentrated in vacuo and the residue purified by prep HPLC (silica gel, eluting with a 100:0 to 80:20 gradient of methylene chloride:acetonitrile) to provide the title compound as a white solid (0.072 g). MS (ES) m/z 462.0. HRMS: calcd for C22H18F3N3O3S+H+, 462.10937. found (ESI, [M+H]+ Obs'd), 462.1098.
The title intermediate was prepared in the same manner as in Example 87 except using 2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.14 g, 0.61 mmol) and 2,6-dibromopyridine (0.426 g, 1.80 mmol) to give the title intermediate as a white solid (0.028 g). MS (ESI) m/z 384; HRMS: calcd for C16H13BrF3N3+H+, 384.03177. found (ESI, [M+H]+ Obs'd), 384.0325.
The title compound was prepared in the same manner as in Example 88 except using 3-(6-bromopyridin-2-yl)-2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.050 g, 0.13 mmol) and 3-(methylsulfonyl)phenol (0.080 g, 0.46 mmol) to give the title compound as an off-white solid (0.030 g). MS (ES) m/z 476.0; HRMS: calcd for C23H20F3N3O3S+H+, 476.12502. found (ESI, [M+H]+ Obs'd), 476.1253.
A mixture of 3-(4-bromophenyl)-2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.050 g, 0.13 mmol), 3-(methylsulfonyl)phenylboronic acid (0.040 g, 0.17 mmol), 1.0 M aqueous sodium carbonate (0.30 mL, 0.30 mmol), and tetrakis(triphenylphosphine)-palladium(0) (0.020 g, 0.020 mmol) in diglyme (2 mL) was heated at 80° C. overnight. The cooled reaction was filtered through Celite®, and chromatographed using 50:50 E:H to afford the title compound as an off-white solid. (0.034 g, 53%). MS (ES) m/z 459.1; HRMS: calcd for C24H21F3N2O2S+H+, 459.1349. found (ESI, [M+H]+ Obs'd), 459.1346.
The title compound was prepared in a manner similar to that described in Example 90 except 4-(isopropylsulfonyl)phenylboronic acid was used in place of 3-(methylsulfonyl)phenylboronic acid. MS (ES) m/z 486.8; HRMS: calcd for C26H25F3N2O2S+H+, 487.1662. found (ESI, [M+H]+ Obs'd), 487.1657.
A mixture of 3-(4-bromophenyl)-2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.050 g, 0.14 mmol), 4-(isopropylsulfonyl)phenylboronic acid (0.040 g, 0.17 mmol), 1.0 M aqueous sodium carbonate (0.30 mL, 0.30 mmol), and tetrakis(triphenylphosphine)-palladium(0) (0.020 g, 0.020 mmol) in diglyme (2 mL) was heated at 80° C. overnight. The cooled reaction was filtered through Celite® and chromatographed using 50:50 E:H to afford the title compound as an off-white solid. (0.036 g, 54%). MS (ES) m/z 473.1; HRMS: calcd for C25H23F3N2O2S+H+, 473.1505. found (ESI, [M+H]+ Obs'd), 473.1502.
The title intermediate was prepared in a similar manner to that described in Example 87 except using 1-bromo-4-iodobenzene in place of 2,6-dibromopyridine. MS (ES) m/z 368.7.
The title compound was prepared in a manner similar to that described in Example 92 except using 4-(methylsulfonyl)phenylboronic acid in place of 4-(isopropylsulfonyl)phenylboronic acid. MS (ES) m/z 445.0; 1H NMR (400 MHz, DMSO-d6) δ 1.29 (t, 3H), 2.80 (q, 2H), 3.16 (s, 3H), 7.00 (t, 1H), 7.65 (d, 1H), 7.72 (d, 2H), 7.99 (d, 2H), 8.01 (d, 2H), 8.06 (d, 2H), 8.49 (d, 1H).
The title intermediate was prepared in a similar manner to that described in Example 87 except using 2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine in place of 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-bromo-4-iodobenzene in place of 2,6-dibromopyridine. MS (ES) m/z 382.5.
The title compound was prepared in a manner similar to that described in Example 90 except using 4-(methylsulfonyl)phenylboronic acid in place of 3-(methylsulfonyl)phenylboronic acid. MS (ES) m/z 459.1; HRMS: calcd for C24H21F3N2O2S+H+, 459.1349. found (ESI, [M+H]+ Obs'd), 459.1347.
The title compound was prepared in a manner similar to that described in Example 92 except using 3-(methylsulfonyl)phenylboronic acid in place of 4-(isopropylsulfonyl)phenylboronic acid. MS (ES) m/z 445.0; HRMS: calcd for C23H19F3N2O2S+H+, 445.1192. found (ESI, [M+H]+ Obs'd), 445.1189.
In essentially the same manner as Example 37 but using 3-(2-isopropyl-8-chloro-imidazo[1,2-a]pyridin-3-yl)phenol and 4-fluoro-N,N-bis(4-methoxybenzyl)benzenesulfonamide as starting materials was prepared the title compound as an off-white solid. MS (ES) m/z 681.8; HRMS: calcd for C38H36ClN3O5S+H+, 682.21370. found (ESI, [M+H]+ Obs'd), 682.2136.
In essentially the same manner as Example 36 but using 3-(2-isopropyl-8-chloro-imidazo[1,2-a]pyridin-3-yl)phenol and 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide as starting materials was prepared the title compound as an off-white solid. MS (ES) m/z 681.8; HRMS: calcd for C38H36ClN3O5S+H+, 682.21370. found (ESI, [M+H]+ Obs'd), 682.2138.
In essentially the same manner as Example 38 but using 3-[3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenoxy]-N,N-bis(4-methoxybenzyl)benzenesulfonamide as starting material was prepared the title compound as a white solid. MS (ES) m/z 441.7; HRMS: calcd for C22H20ClN3O3S+H+, 442.09866. found (ESI, [M+H]+ Obs'd), 442.0994.
In essentially the same manner as Example 38 but using 4-[3-(8-chloro-2-isopropylimidazo[1,2-a]pyridin-3-yl)phenoxy]-N,N-bis(4-methoxybenzyl)benzenesulfonamide as starting material was prepared the title compound as a white solid. MS (ES) m/z 441.7; HRMS: calcd for C22H20ClN3O3S+H+, 442.09866. found (ESI, [M+H]+ Obs'd), 442.0986.
In essentially the same manner as Example 63, step 2 but using 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-bromo-3-[3-(methylsulfonyl)benzyl]benzene as starting materials was prepared the title compound as a light yellow solid. MS (ESI) m/z 459.2; HRMS: calcd for C24H21F3N2O2S+H+, 459.13486. found (ESI, [M+H]+ Obs'd), 459.1366.
In essentially the same manner as Example 63, step 2 but using 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-bromo-4-[3-(methylsulfonyl)benzyl]benzene as starting materials was prepared the title compound as a light yellow solid. MS (ESI) m/z 459.2; HRMS: calcd for C24H21F3N2O2S+H+, 459.13486. found (ESI, [M+H]+ Obs'd), 459.1361.
In essentially the same manner as Example 63, step 2 but using 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 461.1; HRMS: calcd for C23H19F3N2O3S+H+, 461.11412. found (ESI, [M+H]+ Obs'd), 461.1148.
In essentially the same manner as Example 63, step 2 but using 8-chloro-2-ethyl-imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a pale yellow solid. MS (ESI) m/z 427.1; HRMS: calcd for C22H19ClN2O3S+H+, 427.08777. found (ESI, [M+H]+ Obs'd), 427.0887.
In essentially the same manner as Example 63, step 2 but using 2-ethylimidazo[1,2-a]pyridine-8-carbonitrile and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 418.1; HRMS: calcd for C23H19N3O3S+H+, 418.12199. found (ESI, [M+H]+ Obs'd), 418.1233.
In essentially the same manner as Example 63, step 2 but using 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(ethylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 475.2; HRMS: calcd for C24H21F3N2O3S+H+, 475.12977. found (ESI, [M+H]+ Obs'd), 475.1306.
In essentially the same manner as Example 63, step 2 but using 8-chloro-2-ethyl-imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(ethylsulfonyl)benzene as starting materials was prepared the title compound as an off-white solid. MS (ESI) m/z 441.1; HRMS: calcd for C23H21ClN2O3S+H+, 441.10342. found (ESI, [M+H]+ Obs'd), 441.1044.
In essentially the same manner as Example 63, step 2 but using 2-ethylimidazo[1,2-a]pyridine-8-carbonitrile and 1-(4-bromophenoxy)-3-(ethylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 432.1; HRMS: calcd for C24H21N3O3S+H+, 432.13764. found (ESI, [M+H]+ Obs'd), 432.1384.
In essentially the same manner as Example 63, step 2 but using 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-bromo-3-{[3-(methylsulfonyl)phenoxy]methyl}benzene as starting materials was prepared the title compound as an off-white solid. MS (ESI) m/z 475.1; HRMS: calcd for C24H21F3N2O3S+H+, 475.12977. found (ESI, [M+H]+ Obs'd), 475.1309.
In essentially the same manner as Example 63, step 2 but using 8-chloro-2-ethyl-imidazo[1,2-a]pyridine and 1-bromo-3-{[3-(methylsulfonyl)phenoxy]methyl}benzene as starting materials was prepared the title compound as a white solid. MS (ESI) m/z 441.1; HRMS: calcd for C23H21ClN2O3S+H+, 441.10342. found (ESI, [M+H]+ Obs'd), 441.1042.
In essentially the same manner as Example 63, step 2 but using 2-ethylimidazo[1,2-a]pyridine-8-carbonitrile and 1-bromo-3-{[3-(methylsulfonyl)phenoxy]methyl}benzene as starting materials was prepared the title compound as a pale yellow solid. MS (ESI) m/z 432.2; HRMS: calcd for C24H21N3O3S+H+, 432.13764. found (ESI, [M+H]+ Obs'd), 432.1390.
In essentially the same manner as Example 63, step 2 but using 2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-bromo-4-{[3-(methylsulfonyl)phenoxy]methyl}benzene as starting materials was prepared the title compound as an off-white solid. MS (ESI) m/z 475.2; HRMS: calcd for C24H21F3N2O3S+H+, 475.12977. found (ESI, [M+H]+ Obs'd), 475.1305.
In essentially the same manner as Example 63, step 2 but using 8-chloro-2-ethyl-imidazo[1,2-a]pyridine and 1-bromo-4-{[3-(methylsulfonyl)phenoxy]methyl}benzene as starting materials was prepared the title compound as an off-white solid. MS (ESI) m/z 441.1; HRMS: calcd for C23H21ClN2O3S+H+, 441.10342. found (ESI, [M+H]+ Obs'd), 441.1044.
In essentially the same manner as Example 63, step 2 but using 2-ethylimidazo[1,2-a]pyridine-8-carbonitrile and 1-bromo-4-{[3-(methylsulfonyl)phenoxy]methyl}benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 432.2; HRMS: calcd for C24H21N3O3S+H+, 432.13764. found (ESI, [M+H]+ Obs'd), 432.1385.
In essentially the same manner as Example 36 but using 3-[2-isopropyl-8-(trifluoromethyl)-imidazo[1,2-a]pyridin-3-yl]phenol and 1-bromo-3-[methylsulfonyl)methyl]benzene as starting materials was prepared the title compound as a fiberous white solid. MS (ESI) m/z 489.2; HRMS: calcd for C25H23F3N2O3S+H+, 489.14542. found (ESI, [M+H]+ Obs'd), 489.1462.
In essentially the same manner as Example 36 but using 3-(3-hydroxyphenyl)-2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile and 1-bromo-3-[methylsulfonyl)methyl]benzene as starting materials was prepared the title compound as a pale yellow solid. MS (ESI) m/z 446.2; HRMS: calcd for C25H23N3O3S+H+, 446.15329. found (ESI, [M+H]+ Obs'd), 446.1537.
In essentially the same manner as Example 36 but using 2-tert-butyl-3-(3-hydroxyphenyl)imidazo[1,2-a]pyridine-8-carbonitrile and 1-bromo-3-[methylsulfonyl)methyl]benzene as starting materials was prepared the title compound as a yellow solid from a foam. MS (ESI) m/z 460.2; HRMS: calcd for C26H25N3O3S+H+, 460.16894. found (ESI, [M+H]+ Obs'd), 460.1694.
In essentially the same manner as Example 36 but using 3-(2-isopropyl-8-chloro-imidazo[1,2-a]pyridin-3-yl)phenol and 1-bromo-3-[methylsulfonyl)methyl]benzene as starting materials was prepared the title compound as an off-white solid from foam. MS (ESI) m/z 455.1; HRMS: calcd for C24H23ClN2O3S+H+, 455.11907. found (ESI, [M+H]+ Obs'd), 455.1197.
In essentially the same manner as Example 36 but using 2-ethyl-3-(3-hydroxyphenyl)imidazo[1,2-a]pyridine-8-carbonitrile and 1-bromo-3-[methylsulfonyl)methyl]benzene as starting materials was prepared the title compound as a pale yellow solid. MS (ESI) m/z 432.2; HRMS: calcd for C24H21N3O3S+H+, 432.13764. found (ESI, [M+H]+ Obs'd), 432.1381.
In essentially the same manner as Example 75, step 2 but using 2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 475.2; HRMS: calcd for C24H21F3N2O3S+H+, 475.12977. found (ESI, [M+H]+ Obs'd), 475.1299.
In essentially the same manner as Example 75, step 2 but using 2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(ethylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 489.2; HRMS: calcd for C25H23F3N2O3S+H+, 489.14542. found (ESI, [M+H]+ Obs'd), 489.1458.
In essentially the same manner as Example 75, step 2 but using 2-isopropyl-8-chloroimidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as an off white solid. MS (ESI) m/z 441.1; HRMS: calcd for C23H21ClN2O3S+H+, 441.10342. found (ESI, [M+H]+ Obs'd), 441.1036.
In essentially the same manner as Example 75, step 2 but using 2-isopropyl-8-chloroimidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(ethylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 455.1; HRMS: calcd for C24H23ClN2O3S+H+, 455.11907. found (ESI, [M+H]+ Obs'd), 455.1196.
In essentially the same manner as Example 75, step 2 but using 2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as an off-white solid. MS (ESI) m/z 432.2; HRMS: calcd for C24H21N3O3S+H+, 432.13764. found (ESI, [M+H]+ Obs'd), 432.1377.
In essentially the same manner as Example 75, step 2 but using 2-isopropylimidazo[1,2-a]pyridine-8-carbonitrile and 1-(4-bromophenoxy)-3-(ethylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 446.2; HRMS: calcd for C25H23N3O3S+H+, 446.15329. found (ESI, [M+H]+ Obs'd), 446.1534.
In essentially the same manner as Example 75, step 2 but using 2,8-bis(trifluoromethyl)imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 501.1; HRMS: calcd for C22H14F6N2O3S+H+, 501.07021. found (ESI, [M+H]+ Obs'd), 501.0707.
In essentially the same manner as Example 75, step 2 but using 2-(2-methoxyphenyl)-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 539.2; HRMS: calcd for C28H21F3N2O4S+H+, 539.12469. found (ESI, [M+H]+ Obs'd), 539.1258.
In essentially the same manner as Example 75, step 2 but using 2-(thiophen-3-yl)-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow solid. MS (ESI) m/z 515.1; HRMS: calcd for C25H17F3N2O3S2+H+, 515.07054. found (ESI, [M+H]+ Obs'd), 515.0706.
In essentially the same manner as Example 75, step 2 but using 2-(butoxymethyl)-8-(trifluoromethyl)imidazo[1,2-a]pyridine and 1-(4-bromophenoxy)-3-(methylsulfonyl)benzene as starting materials was prepared the title compound as a yellow glassy solid. MS (ESI) m/z 519.2; HRMS: calcd for C26H25F3N2O4S+H+, 519.15599. found (ESI, [M+H]+ Obs'd), 519.1575.
A mixture of 2-methyl-3-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)imidazo[1,2-a]pyridine (1.65 g, 3.70 mmol), N-bromosuccinimide (0.724 g, 4.07 mmol) and α,α-azobisisobutyronitrile (0.061 g, 0.370 mmol) in acetonitrile (20 mL) was refluxed for 3 h. The solvent was removed and the resulting material was partitioned between dichloromethane and water. The layers were separated and the aqueous layer was further extracted with dichloromethane. The combined dichloromethane layers were concentrated. Purification via column chromatography using a 0:100 to 55:45 E:H gradient afforded the title compound as a yellow foam solid (1.54 g, 79%).
A mixture of 2-(bromomethyl)-3-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.100 g, 0.190 mmol), 1H-imidazole (0.039 g, 0.571 mmol) and potassium carbonate (0.053 g, 0.381 mmol) in DMSO (3 mL) was stirred for 1 h. Water was added, then the mixture was extracted with dichloromethane. The combined organics were washed with water then concentrated. Purification via column chromatography using a 0:100 to 5:95 MeOH:CH2Cl2 gradient yielded the title compounds as a white foam solid (0.058 g, 60%). MS (ESI) m/z 513.1; HRMS: calcd for C25H19F3N4O3S+H+, 513.12027. found (ESI, [M+H]+ Obs'd), 513.1205.
In essentially the same manner as Example 129 but using 2-methyl-1H-imidazole in place of 1H-imidazole was prepared the title compound as a yellow foam solid. MS (ESI) m/z 527.2; HRMS: calcd for C26H21F3N4O3S+H+, 527.13592. found (ESI, [M+H]+ Obs'd), 527.1363.
A mixture of 2-(bromomethyl)-3-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)imidazo[1,2-a]pyridine (0.100 g, 0.190 mmol) and piperidine (0.081 g, 0.952 mmol) in ethanol (3 mL) was stirred overnight. The mixture was concentrated. To the resulting material was added dichloromethane and water. The solution was made basic by addition of solid potassium carbonate. The layers were separated. The aqueous layer was extracted once more with dichloromethane and the combined organic layers were concentrated. Purification via column chromatography using an ISCO amine column with a 0:100 to 60:40 E:H gradient afforded the title compound as an off-white solid (0.069 g, 68%). MS (ESI) m/z 530.2; HRMS: calcd for C27H26F3N3O3S+H+, 530.17197. found (ESI, [M+H]+ Obs'd), 530.1721.
In essentially the same manner as Example 131 but using 1-methylpiperazine in place of piperidine afforded the title compound as an off-white solid. MS (ESI) m/z 545.2; HRMS: calcd for C27H27F3N4O3S+H+, 545.18287. found (ESI, [M+H]+ Obs'd), 545.1830.
In essentially the same manner as Example 131 but using thiazolidine in place of piperidine afforded the title compound as an off-white solid. MS (ESI) m/z 534.1; HRMS: calcd for C25H22F3N3O3S2+H+, 534.11274. found (ESI, [M+H]+ Obs'd), 534.1132.
In essentially the same manner as Example 131 but using methylamine in place of piperidine afforded the title compound as an off-white solid. MS (ESI) m/z 476.2.
In essentially the same manner as Example 131 but using ethylamine in place of piperidine afforded the title compound as a white solid. MS (ESI) m/z 490.2; HRMS: calcd for C24H22F3N3O3S+H+, 490.14067. found (ESI, [M+H]+ Obs'd), 490.1410.
N-{[3-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)imidazo[1,2-a]pyridin-2-yl]methyl}propan-2-amine
In essentially the same manner as Example 131 but using isopropylamine in place of piperidine afforded the title compound as an off-white solid. MS (ESI) m/z 504.2; HRMS: calcd for C25H24F3N3O3S+H+, 504.15632. found (ESI, [M+H]+ Obs'd), 504.1565.
In essentially the same manner as Example 131 but using dimethylamine in place of piperidine afforded the title compound as a yellow solid. MS (ESI) m/z 490.2; HRMS: calcd for C24H22F3N3O3S+H+, 490.14067. found (ESI, [M+H]+ Obs'd), 490.1407.
In essentially the same manner as Example 131 but using diethylamine in place of piperidine afforded the title compound as a yellow glassy solid. MS (ESI) m/z 518.2; HRMS: calcd for C26H26F3N3O3S+H+, 518.17197. found (ESI, [M+H]+ Obs'd), 518.1722.
In essentially the same manner as Example 131 but using pyrrolidine in place of piperidine afforded the title compound as a tan solid. MS (ESI) m/z 516.2; HRMS: calcd for C26H24F3N3O3S+H+, 516.15632. found (ESI, [M+H]+ Obs'd), 516.1571.
The title compound was prepared in a manner similar to that described in Example 25 except using 3-(2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol in place of 3-(2-isopropyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl)phenol and 4-[(3-bromophenyl)sulfonyl]butanenitrile in place of 1-bromo-3-(methylsulfonyl)benzene. It was isolated as a white powder from a foam. MS (ESI) m/z 514.1; HRMS: calcd for C26H22F3N3O3S+H+, 514.14067. found (ESI, [M+H]+ Obs'd), 514.1407.
The title compound was prepared in a manner similar to that described in Example 9 except using 3-{2-ethyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl}phenol in place of 3-{(2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl}phenol and 4-fluoro-2-(methylsulfonyl)benzonitrile in place of 1-fluoro-3-(methylsulfonyl)benzene. The reaction temperature was 50° C. The compound was isolated as a white solid. MS (ESI) m/z 486.1; HRMS: calcd for C24H18F3N3O3S+H+, 486.10937. found (ESI, [M+H]+ Obs'd), 486.1100.
The title compound was prepared in a manner similar to that described in Example 9 except using 4-fluoro-2-(methylsulfonyl)benzonitrile in place of 1-fluoro-3-(methylsulfonyl)benzene. The reaction temperature was 50° C. The compound was isolated as a white solid. MS (ESI) m/z 472.1; HRMS: calcd for C23H16F3N3O3S+H+, 472.09372. found (ESI, [M+H]+ Obs'd), 472.0942.
The structures of the title compounds of Examples 1-142 are set forth below.
Representative compounds of this invention were evaluated in conventional pharmacological test procedures which measured their affinity to bind to LXR and to upregulate the gene ABCA1, which causes cholesterol efflux from atherogenic cells, such as macrophages.
LXR activation can be critical for maintaining cholesterol homeostasis, but its coincident regulation of fatty acid metabolism may lead to increased serum and hepatic triglyceride levels. Selective LXR modulators that activate cholesterol efflux with minimal impact on SREBP-1c expression and triglyceride synthesis in liver would be expected to reduce atherosclerotic risk with an improved therapeutic index and minimize the potential for deleterious effects on metabolic balance.
The test procedures performed, and results obtained, are briefly described in the following sections:
I. Ligand-Binding Test Procedure for Human LXRβ
II. Ligand-Binding Test Procedure for Human LXRα
III. Quantitative Analysis of ABCA1 Gene Regulation in THP-1 Cells
IV. Results
Ligand-binding to the human LXRβ was demonstrated for representative compounds of this invention by the following procedure.
Buffer: 100 mM KCl, 100 mM TRIS (pH 7.4 at +4° C.), 8.6% glycerol, 0.1 mM PMSF*, 2 mM MTG*, 0.2% CHAPS (* not used in wash buffer)
Receptor source: E. coli extract from cells expressing biotinylated hLXRβ. Extract was made in a similar buffer as above, but with 50 mM TRIS.
Washed streptavidin and coated flash plates with wash buffer.
Diluted receptor extract to give Bmax ˜4000 cpm and add to the wells.
Wrapped the plates in aluminum foil and stored them at +4° C. over night.
Made a dilution series in DMSO of the test ligands.
Made a 5 nM solution of the radioactive tracer in buffer.
Mixed 250 μl diluted tracer with 5 μl of the test ligand from each concentration of the dilution series.
Washed the receptor-coated flash plates.
Added 200 μl per well of the ligand/radiolabel mixture to the receptor-coated flash plates.
Wrapped the plates in aluminum foil and incubate at +4° C. over night.
Aspirated wells, and wash the flashed plates. Sealed the plate.
Measured the remaining radioactivity in the plate.
Ligand-binding to the human LXRα was demonstrated for representative compounds of this invention by the following procedure.
Buffer: 100 mM KCl, 100 mM TRIS (pH 7.4 at +4° C.), 8.6% glycerol, 0.1 mM PMSF*, 2 mM MTG*, 0.2% CHAPS (* not used in wash buffer)
Receptor source: E. coli extract from cells expressing biotinylated hLXRα. Extract was made in a similar buffer as above, but with 50 mM TRIS.
Washed streptavidin and coated flash plates with wash buffer.
Diluted receptor extract to give Bmax ˜4000 cpm and add to the wells.
Wrapped the plates in aluminum foil and stored them at +4° C. over night.
Made a dilution series in DMSO of the test ligands.
Made a 5 nM solution of the radioactive tracer in buffer.
Mixed 250 μl diluted tracer with 5 μl of the test ligand from each concentration of the dilution series.
Washed the receptor-coated flash plates.
Added 200 μl per well of the ligand/radiolabel mixture to the receptor-coated flash plates.
Wrapped the plates in aluminum foil and incubate at +4° C. over night.
Aspirated wells, and wash the flashed plates. Sealed the plate.
Measured the remaining radioactivity in the plate.
The compounds of formula (I) effect on the regulation of the ABCA1 gene was evaluated using the following procedure.
Cell culture: The THP-1 monocytic cell line (ATCC #TIB-202) was obtained from American Type Culture Collection (Manassas, Va.) and cultured in RPMI 1640 medium (Gibco, Carlsbad, Calif.) containing 10% FBS, 2 mM L-glutamine, and 55 uM beta-Mercaptoethanol (BME). Cells were plated in 96-well format at a density of 7.5×104 in complete medium containing 50-100 ng/ml phorbal 12,13-dibutyrate (Sigma, St. Louis, Mo.) for three days to induce differentiation into adherent macrophages. Differentiated THP-1 cells were treated with test compounds or ligands dissolved in DMSO (Sigma, D-8779) in culture medium lacking phorbal ester. Final concentrations of DMSO did not exceed 0.3% of the media volume. Dose response effects were measured in duplicate, in the range of 0.001 to 30 micromolar concentrations and treated cells were incubated for an additional 18 hrs prior to RNA isolation. Unstimulated cells treated with vehicle were included as negative controls on each plate. An LXR agonist reference, N-(2,2,2-trifluoro-ethyl)-N-[4-(2,2,2-trifluoro-1-hydroxy-1-trifluoromethyl-ethyl)-phenyl]-benzenesulfonamide (Schultz, Joshua R., Genes & Development (2000), 14(22), 2831-2838), was dosed at 1.0 uM and served as a positive control. In antagonist mode, the compound under study is analyzed in the presence of 150 nM GW3965, trifluoromethyl-benzyl)-(2,2-diphenyl-ethyl)-amino]-propoxy]-phenyl)-acetic acid (Collins, J. L., J. Med. Chem. (2000), 45:1963-1966.). Results of antagonist analysis are expressed as % antagonism and IC50 (in μM).
RNA isolation and quantitation: Total cellular RNA was isolated from treated cells cultured in 96-well plates using PrepStation 6100 (Applied Biosystems, Foster City, Calif.), according to the manufacturer's recommendations. RNA was resuspended in ribonuclease-free water and stored at −70° C. prior to analysis. RNA concentrations were quantitated with RiboGreen test procedure, #R-11490 (Molecular Probes, Eugene, Oreg.).
Gene expression analysis: Gene-specific mRNA quantitation was performed by real-time PCR with the Perkin Elmer Corp. chemistry on an ABI Prism 7700 Sequence detection system (Applied Biosystems, Foster City, Calif.) according to the manufacturer's instructions. Samples (50-100 ng) of total RNA were assayed in duplicate or triplicate in 50 ul reactions using one-step RT-PCR and the standard curve method to estimate specific mRNA concentrations. Sequences of gene-specific primer and probe sets were designed with Primer Express Software (Applied Biosystems, Foster City, Calif.). The human ABCA1 primer and probe sequences are: forward, CAACATGAATGCCATTTTCCAA, reverse, ATAATCCCCTGAACCCAAGGA, and probe, 6FAM-TAAAGCCATGCCCTCTGCAGGAACA-TAMRA. RT and PCR reactions were performed according to PE Applied Biosystem's protocol for Taqman Gold RT-PCR or Qiagen's protocol for Quantitect probe RT-PCR. Relative levels of ABCA1 mRNA are normalized using GAPDH mRNA or 18S rRNA probe/primer sets purchased commercially (Applied Biosystems, Foster City, Calif.).
Mean, standard deviation and statistical significance of duplicate evaluations of RNA samples were assessed using ANOVA, one-way analysis of variance using SAS analysis.
Qiagen Quantitect probe RT-PCR 204443.
Based on the results obtained in the standard pharmacological test procedures, the compounds of this invention can be useful in treating or inhibiting LXR mediated diseases. In particular, the compounds of this invention can be useful in the treatment and inhibition of atherosclerosis and atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL cholesterol levels, increasing reverse cholesterol transport, inhibiting cholesterol absorption, treatment or inhibition of cardiovascular diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, thyroiditis, skin aging (e.g., skin aging is derived from chronological aging, photoaging, steroid-induced skin thinning, or a combination thereof), or connective tissue disease (e.g., osteoarthritis or tendonitis).
A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are in the claims.
This application is the U.S. National Phase filing under 35 U.S.C. §371 of PCT/US2008/087708 filed Dec. 19, 2008 which claims the benefit of U.S. 61/015,850, filed Dec. 21, 2007, the entire contents of which is incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US08/87708 | 12/19/2008 | WO | 00 | 11/4/2010 |
| Number | Date | Country | |
|---|---|---|---|
| 61015850 | Dec 2007 | US |
