Immunity generation

Information

  • Patent Grant
  • 11779611
  • Patent Number
    11,779,611
  • Date Filed
    Tuesday, July 9, 2019
    6 years ago
  • Date Issued
    Tuesday, October 10, 2023
    2 years ago
  • Inventors
  • Original Assignees
    • IMMUNE MACRO-BIOTIC TECHNOLOGY UK LIMITED
  • Examiners
    • Barker; Michael
    Agents
    • Ware, Fressola, Maguire & Barber LLP
  • CPC
  • Field of Search
    • US
    • NON E00000
  • International Classifications
    • A61K35/64
    • A61K35/63
    • Disclaimer
      This patent is subject to a terminal disclaimer.
      Term Extension
      305
Abstract
An improved method for the manufacture of a medicament, which method includes the use of tissues, larval forms or derivatives of insects that have been fed on a food containing pathogens.
Description
FIELD OF THE INVENTION

This invention relates to immunity generation.


In British Patent Specification No. 2 368 016 there is described a method for the manufacture of a medicament, which method includes the use of tissues, larval forms or derivatives of insects that have been fed on a food containing pathogens. This method is hereinafter referred to as “a method as defined” and results in the expression of anti-microbial peptides which are hereinafter referred to as AMPs.


It is an object of the present invention to provide improvements in the method as defined.


SUMMARY OF THE INVENTION

According to a first aspect of the present invention there is provided a method as defined in which the expression of AMPs is modulated (maximized) by selectively altering the number or nature of the pathogens that are used.


As applied to the feeding of larvae with bacteria, it has been found that different AMPs are stimulated maximally by different doses of bacteria. Thus, Diptericin expression is favoured by high doses, whereas Sapecin by low doses.


The optimal bacterial/larval combination that has been found to date is Lucilia serritica stimulated by Pseudomonas syringae, a bacterium which is not pathogenic to humans or other animals and is found in the environment.


Thus, according to a second aspect of the present invention, there is provided a method as defined which includes the stimulation of Lucilia serricata by Pseudomonas syringae.


Exposure of 4-day-old larvae to this bacterium for twelve hours has been found to increase AMP expression up to 30-fold as compared to unstimulated larvae. The larvae can be stimulated with live or dead bacteria without affecting larval feed consumption or final weight.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 shows the number of Camphylobacter in the caecum of birds fed diets supplemented with soya, unstimulated larvae (unstim) or stimulated larvae (stim). The bars indicate significant differences between groups,



FIG. 2 shows the numbers of lactic acid bacteria in the caecum of birds fed diets supplemented with soya, unstimulated larvae (unstim) or stimulated larvae (stim). No significant differences were seen between groups,



FIG. 3 shows the number of enterobacteria in the caecum of birds fed diets supplemented with soya, unstimulated larvae (unstim) or stimulated larvae (stim). No significant differences were seen between groups.



FIG. 4 shows median levels of Gallinacin11 expression in the caecal tonsil in birds fed either control or unstimulated larval or stimulated larval diets. The asterisk indicates significant differences using Dunn's post hoc test.





DESCRIPTION OF THE PREFERRED EMBODIMENTS

Day-old Ross broiler chicks were housed in biosecure facilities and fed commercial chick crumb supplements with 10% of either soya meal, crushed unstimulated Lucilia larvae or crushed unstimulated Lucilia larvae.


Insect larvae reared in a milk powder/sucrose/wheat germ/agar mixture for four days were removed from this medium and washed. They were then introduced into fresh growth medium without added bacteria (unstimulated) or containing approximately 5×107 Pseudomonas syringae per gram (stimulated). After 24 hours on this medium, the larvae were removed, washed to remove all traces of growth medium and freeze-dried. Once dry, they were crushed using a pestle and mortar to obtain a coarse powder for addition to the chick crumb.


At three days old, birds were infected orally with 105 cfu Campylobacter jejuni strain M1.


At eight days old, birds were euthanised and the caeca removed and examined for Campylobacter, lactic acid bacteria and enterobacteria by serial dilution and spread plating on mCCDA, MRS, and VRBG agars respectively. Differences in the level of bacteria found in the birds were analysed using a Kruskal-Wallis test with Dunn's post test with P<0.05 being regarded as significant.


The use of feed containing stimulated larvae resulted in a reduction of campylobacter in the caecum (FIG. 1); no effect was seen on numbers of lactic bacteria or enterobacteria (FIGS. 2 and 3).


In terms of colonization, 13% of soya fed birds were negative for campylobacter in the caecum after eight days, 18% of birds fed unstimulated larvae and 41% of birds fed stimulated larvae. The feed containing stimulated larvae resulted in a significant reduction (P<0.05) in the number of birds colonized with campylobacter in the caecum as compared to the soya-supplemented control.


Larvae of Lucilia serricata, Calliphora vacciniae and Musca domestica were assessed for their expression of antimicrobial peptides (AMPs) following stimulation with three different species of bacteria. As bacterial simulation was found to increase AMP expression, experiments have been carried out to investigate the optimal parameters for stimulation of the larvae.


The optimal bacterial/larval combination has been found to be Lucilia serricata stimulated by Pseudomonas syringe, a bacterium which is not pathogenic to animals or humans. Exposure of four-day old larvae to this bacterium for twelve hours has been found to increase AMP expression by up to thirty-fold over unstimulated larvae.


Larvae can be stimulated with live or dead bacteria and this does not affect larval feed consumption or final weight. There is also evidence of an interaction between pathogenicity of the bacterium, time and dose in affecting AMP expression.


In vitro experiments have been carried out using powder prepared from Lucilia serricata larvae stimulated by Pseudomonas syringae testing its effectiveness as an antibacterial agent against Campylobacter jejuni, with powder from unstimulated larvae used as a control.


Over a three-hour time period, Campylobacter bacteria incubated with powder from unstimulated larvae were able to grow whereas the bacterial cultures exposed to 1% w/v powder from larvae stimulated with Pseudomonas syringae showed significant bacterial death (P=0.0015).



Lucilia serricata larvae challenged with Pseudomonas syringae were fed to broiler chicks. The chicks were then infected orally to test their immunity.


Adult Lucilia serricata were allowed to lay eggs in a 1:1:1 mixture of wheat germ, yeast and milk powder that had been solidified with agar. This mixture containing eggs was split into portions and at hatch larvae were either challenged with Pseudomonas syringae or left unchallenged. After 4 days larvae were harvested, washed to remove feed and freeze dried to a moisture content of 15%. Larvae were then ground to a fine powder in a chilled pestle and mortar.


Groups of 18 day-old Ross broiler chicks were housed in biosecure facilities and fed commercial chick crumb supplemented with 10% w/w of either soya meal (to balance protein levels with feed containing larvae), 10% w/w crushed unstimulated Lucilia larvae or 10% w/w crushed stimulated Lucilia larvae.


At 3 days old birds were infected orally with 105 cfu Campylobacter jejuni strain M1.


At 8 days old birds were euthanised and the caecal tonsil immediately placed into RNAlater. mRNA was extracted using a Qiagen kit and examined for Gallinacin 11 expression by quantitative RT-PCR using the primers D11F cagaattgcagaaagccaca and D11R ttctacgtgtgcgtgtgtga with chicken beta actin as a housekeeping gene. Expression of Gallinacin 11 was expressed relative to beta actin expression.


Differences between groups of birds were examined for significance using a Kruskal-Wallis test with Dunn's post hoc test as data were not normally distributed.


The results of the test are shown in FIG. 4 of the accompanying drawings. Drawing A is a box and whiskers plot where each box represents the first to third quartile with the median as the line inside the box. The whiskers show the range of data. Drawing B is a histogram showing the median level of expression.


Gallinacin 11 was chosen as this has been shown to be expressed in the intestine by others (Hong at al. Poult. Sci. (2012) 1082).


Diet had a significant effect on Gallinacin 11 expression (P=0.0007). In birds fed a diet containing stimulated larvae relative levels of Gallinacin 11 expression in the caecum were significantly higher than in birds fed a diet containing unstimulated larvae. This shows that feeding of stimulated larvae, which contain higher amounts of insect AMPs, stimulates host AMP expression. This would give an added stimulation of antibacterial activity in the intestine over and above the provision of fly AMPs in the feed itself.

Claims
  • 1. A method for the manufacture of a medicament, which method includes exposing larval forms of insects to food containing pathogens, wherein the expression of different anti-microbial peptides are stimulated maximally by different doses of the pathogens.
  • 2. The method according to claim 1, characterized in that different patterns of anti-microbial peptides are produced by selectively altering the species of pathogens that are used.
  • 3. The method according to claim 1, wherein the pathogen is Pseudomonas syringae.
  • 4. The method according to claim 1, wherein the larvae are Lucilia sericata.
  • 5. The method according to claim 1, wherein the pathogens are alive.
  • 6. A method for the manufacture of a medicament to treat a Campylobacter infection comprising: exposing larval forms of an insect to food containing pathogens, andwherein the expression of different anti-microbial peptides are stimulated maximally by different doses of the pathogens.
  • 7. A method for the manufacture of a medicament to stimulate anti-microbial expression in an ingesting recipient comprising: exposing larval forms of an insect to food containing pathogens, andwherein the expression of different larval anti-microbial peptides are stimulated maximally by different doses of the pathogens.
  • 8. Treating a Campylobacter infection and stimulating an anti-microbial expression in an ingesting recipient, by feeding said recipient a medicament produced by exposing larval forms of insects to food containing pathogens, wherein the expression of different anti-microbial peptides are stimulated maximally by different doses of the pathogens.
  • 9. The method of claim 1, further comprising altering the time of exposure to the pathogens.
  • 10. The method according to claim 1, wherein the pathogens are dead.
  • 11. Treating a Campylobacter infection and stimulating an anti-microbial expression, by feeding said recipient a medicament produced by exposing larval forms of insects to food containing pathogens, wherein the expression of different anti-microbial peptides are stimulated maximally by different doses of the pathogens, wherein the pathogen is Pseudomonas syringae.
  • 12. Treating a Campylobacter infection and stimulating an anti-microbial expression, by feeding said recipient a medicament produced by exposing larval forms of insects to food containing pathogens, wherein the expression of different anti-microbial peptides are stimulated maximally by different doses of the pathogens, wherein the pathogen is Lucilia sericata.
  • 13. Treating a Campylobacter infection according to claim 8, wherein the larval forms of insects are incorporated into feed that is fed to the ingesting recipient.
Priority Claims (2)
Number Date Country Kind
1420515 Nov 2014 GB national
1519523 Nov 2015 GB national
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation of U.S. patent application Ser. No. 15/527,376 which is the U.S. National Stage of International Application PCT/GB2015/000302 filed on Nov. 19, 2015, which application claims priority under 35 USC § 119 to British Patent Application No. 1420515.7 filed on Nov. 19, 2014 and British Patent Application 1519523.3 filed on Nov. 5, 2015. All of these applications are hereby incorporated by reference in their entirety.

US Referenced Citations (2)
Number Name Date Kind
10383899 Leonard Aug 2019 B2
20050277578 Leonard Dec 2005 A1
Non-Patent Literature Citations (6)
Entry
Kawabata, et al., Medical and Veterinary Entomology, 24:375. (Year: 2010).
Office Action in Chinese Patent Application 201580062814.0 dated Jan. 17, 2020 (10 pages).
Office Action in Chinese Patent Application 201580062814.0 dated Aug. 24, 2020 (12 pages).
“Insect Biochemistry”; Wang Yin-chang et al., China Agricultural Publishing House, Feb. 28, 2001 (6 pages).
“Antibacterial Activity Analysis of Tenebrio molitor Antimicrobial Peptides Extracts from Different Bacterial Sources against 26 Pathogens,” Xie Xiansheng et al., Anhui Agricultural Science, vol. 39, No. 9, pp. 5290-5293, Mar. 20, 2011 (4 pages).
“Study on antibacterial activity and mechanism of housefly antimicrobial peptide”; Zhou Yi-Wen et al., May 29, 2004 (3 pages).
Related Publications (1)
Number Date Country
20190328796 A1 Oct 2019 US
Continuations (1)
Number Date Country
Parent 15527376 US
Child 16505867 US