Patent Application
20130029358
Tumor antigens, for example NY-ESO-1, are able to elicit immune responses in the autologous host. Accordingly, such tumor antigens are potentially useful for tumor therapy. Some therapeutic approaches employing such an anti-tumor immune responses include the identification of immunostimulatory tumor antigen epitopes. Once identified, a tumor antigen can be administered to a subject having a tumor expressing the antigen to elicit an immune response that specifically targets tumor cells. Translation of this therapeutic paradigm into clinical applications is hampered, however, because (i) only few epitopes of tumor antigens have been identified, and (ii) reliable methods and reagents for monitoring immune responses to tumor antigens are lacking.
Active elicitation or enhancement of a tumor-specific immune response through vaccination of a tumor-bearing subject is an attractive therapeutic paradigm that could be used in the therapy of hyperproliferative disease either alone or in combination with conventional therapeutic methods. Such an immune-response based therapeutic approach, ideally in combination with immunomodulation, is presently viewed as a strategy that could potentially treat, prevent disease recurrence or/and lead to stabilization of hyperproliferative disease, improving the long-term outcome of current treatment of such diseases, for example, of cancer. Such a vaccination approach generally involves the administration to a subject having a hyperproliferative disease an immunostimulatory epitope of a tumor antigen that is specifically expressed by neoplastic cells, e.g., cells of a tumor, in order to elicit or enhance an immune response specifically targeting the antigen-expressing neoplastic cells, but not directed towards non-expressing, healthy cells.
Sensitive methods to monitor the induction or enhancement of an immune response in a subject, for example in response to a tumor or to the administration of an immunostimulatory epitope of a tumor antigen, would be beneficial for tumor diagnostics and classification as well as for the development of therapeutic approaches involving the immune system of a subject carrying or suspected to carry a tumor. Such methods generally involve the analysis of T-cell populations mediating the immune response, for example, CD8+ T-cells, if the immunogenic epitope is presented by MHC class I molecules, and/or CD4+ T-cells, if the immunogenic epitope is presented by MHC class II molecules.
Sensitive detection and analysis of antigen-specific T-cell populations is typically carried out by staining a T-cell population with multimers of MHC molecules (either class I or class II) that are loaded with the antigenic peptide in question. Importantly, MHC class I and class II molecules differ significantly in their structure, the type of antigenic peptide that can be bound, and the stability of empty and peptide-loaded MHC molecule complexes. MHC class I molecules comprise one type α heavy chain that is divided into three domains (α1, α2, and α3) and associated with a (32 microglobulin molecule. The α1 and α2 domains fold to make up a closed-end groove that typically binds an antigenic peptide of 8-10 amino acid residues in length. In contrast, MHC class II molecules comprise one type α heavy chain and one type β heavy chain, both of which are divided into two domains (α1, and α2; and β1 and β2, respectively). The antigen-binding groove of MHC class II molecules is open at both ends and the antigens presented by MHC class II molecules are, accordingly, longer, typically between about 15 and about 24 amino acid residues in length. Based on their different structure, MHC class I and MHC class II molecules each present unique technical challenges in regard to the production of antigenic peptide-loaded MHC multimers and detection and analysis of antigen-specific T cells by MHC class II-peptide multimers (e.g., tetramers) lags behind MHC class I systems, which to a large extent is due to inadequate reagent quality.
Some aspects of this invention provide universally applicable methods for the preparation of isolated MHC II-peptide staining reagents. For example, some aspects of this invention provide methods for the isolation of MHC class II molecules that have stably bound a peptide of interest by using a tag conjugated to the peptide.
In contrast to recombinant peptide-loaded MHC class I molecules, which can be obtained by peptide driven refolding, recombinant MHC class II proteins typically require significant genetic engineering and more cost- and time-intensive methods of production. In most cases “empty” (without nominal peptide cargo) MHC class II molecules are isolated from insect cell culture supernatants and subsequently loaded with a peptide of interest. Peptide-loading is often inefficient, particularly for peptides of low binding strength, and the resulting complexes are of limited stability. Further, the staining of CD4+ T cells with MHC class II multimers is often weak, frequently rendering detection of low frequency CD4+ T cells inconclusive. Based on the significant differences in binding avidity of MHC class I and class II multimers to their target T cells, staining methods for both classes differ substantially, for example, in both time of exposure to staining multimers and in optimum temperature for staining.
Some aspects of this invention provide agents and methods for the generation of peptide-loaded MHC class II molecules. In some embodiments, molecularly defined monomers are produced, for example, MHC class II monomers that are loaded with the peptide of interest. In some embodiments, the peptide of interest is conjugated to a tag. In some embodiment, the tag is a peptide tag, for example, a peptide tag that is N-terminally or C-terminally fused to the antigenic peptide of interest, allowing for the isolation of correctly loaded MHC class II molecules by affinity chromatography. In some embodiments, the peptide tag is a polyhistidine tag. Accordingly, some aspects of this invention provide methods for the generation of peptide-loaded MHC class II molecules that include purification of MHC class II molecules loaded with a peptide conjugated to a tag by affinity chromatography, preferably under non-denaturing conditions. Some aspects of this invention provide methods for the generation of MHC class II multimers. In some embodiments, MHC class II multimers are generated from isolated, peptide-loaded MHC class II molecules, for example, peptide-loaded MHC class II molecules generated by methods described herein. In some embodiments, peptide-loaded MHC class II molecules are assembled into multimers by reaction with a multivalent binding molecule, for example, streptavidin.
Some aspects of this invention relate to improved methods for detection of CD4+ T cells by staining them with MHC class II multimers. In some embodiments, cells are contacted with an MHC class II multimer as described herein. Some aspects of this invention relate to the surprising discovery that desialylation of cells can improve MHC class II multimer staining several fold. Accordingly, improved MHC multimer staining methods including a desialylation step, for example, a step of enzymatic desialylation of the target cells.
Another important aspect in immune-response based therapeutic approaches is the identification of suitable tumor antigens and the determination of immunodominant epitopes within the amino acid sequences of such antigens. Among human tumor antigens (Cancer Immunity Peptide Database), cancer/testis antigens (CTA) are characterized by their expression pattern being restricted, in adult tissues, to testis and tumor tissues (1*). NY-ESO-1 (also referred to herein as ESO), a member of the CTA group, is expressed in a variety of tumors of different histological origin and displays significant spontaneous immunogenicity in patients bearing antigen-expressing tumors (2*). Candidate anti-cancer vaccines using various ESO-based immunogens are currently under trial (Cancer Vaccine Collaborative: www.cancerresearch.org).
Several studies have analyzed ESO-specific T cell responses in patients with natural anti-ESO immunity and reported the identification of regions of the ESO protein frequently recognized by T cells from different patients. For CD4+ T cells, two main immunodominant regions have been identified, ESO81-100, recognized by CD4+ T cells from about half of the patients with spontaneous immunity to ESO, and ESO119-143, recognized by CD4+ T cells from the large majority of the patients (3-7*). CD4+ T cell responses to a third region, ESO157-170, frequently recognized by ESO-specific CTL (2), were also initially reported to be immunodominant but have not been frequently reported in subsequent studies (8*).
In a recent vaccination trial using as immunogen rESO administered with Montanide ISA-51 and CpG ODN 7909 to patients with no detectable pre-existing immunity to ESO, we obtained induction of significant TH1 ESO-specific CD4+ T cell responses in all patients (9*). Analysis of the fine specificity of vaccine induced CD4+ T cells revealed that in all patients a sizable fraction of these responses were directed against ESO119-143. Starting from the analysis of one patient with the highest ex-vivo detectable CD8+ and CD4+ T cell responses, we demonstrate in this study that vaccination with the full-length recombinant protein induces ESO119-143-specific CD4+ T cells restricted by HLA-DR52b (DRB3*0202), an allele that is expressed by about half of the Caucasian population. Furthermore, we show that such responses can be detected in all vaccinated patients expressing DR52b, demonstrating the immunodominant nature of DR52b-restricted ESO119-143-specific CD4+ T cell responses after vaccination with rESO. Finally, we found significant conservation of TCR usage for ESO-specific DR52b-restricted CD4+ T cells from different individuals. *References 1-9 of this paragraph and the two paragraphs immediately above are given in Example 1.
Some aspects of this invention provide isolated immunogenic or immunostimulatory, NY-ESO-1 peptides. Some aspects of this invention provide MHC class II molecules bound by an immunogenic or immunostimulatory NY-ESO-1 peptide. Some aspects of this invention provide MHC class II molecules bound to a tagged peptide. Some aspects of this invention provide multimers of NY-ESO-1-loaded MHC class II molecules. Some aspects of this invention provide multimers of MHC class II molecules loaded with a tagged peptide. Some aspects of this invention provide methods for eliciting an immune response in a subject by administering an immunogenic or immunostimulatory NY-ESO-1 peptide to a subject. Some aspects of this invention provide methods to induce or enhance proliferation of cells, for example, specific T-cells, by contacting them with an immunogenic or immunostimulatory NY-ESO-1 peptide. Some aspects of this invention provide methods to detect cells binding NY-ESO-1 peptide-loaded MHC class II molecules, for example, specific T-cells, by contacting them with an NY-ESO-1 peptide-loaded MHC class II molecule or multimer and detecting the bound molecules or multimers. Some aspects of this invention provide methods for measuring an immune response using MHC class II multimers, for example, tetramers. Some aspects of this invention provide methods for the generation of MHC class II molecules loaded with tagged peptides. Some aspects of this invention provide methods for the generation of MHC class II multimers, for example, tetramers, comprising MHC class II molecules loaded with tagged peptides. Some aspects of this invention provide methods for determining or identifying an epitope of a protein antigen using MHC class II molecules or multimers. Some aspects of the invention provide kits including an isolated NY-ESO-1 peptide, and/or MHC class II molecules in multimeric form.
In some embodiments, an isolated NY-ESO-1 peptide-loaded MHC class II molecule is provided, comprising a beta chain encoded by a DRB1 allele or a DRB3 allele, and an NY-ESO-1 peptide, the peptide comprising 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1), and/or an amino acid sequence selected from the group consisting of peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1. In some embodiments, the MHC class II protein comprises a DR52b beta chain and/or is encoded by a DRB3*0202 allele. In some embodiments, the MHC class II protein comprises a DR1 beta chain and/or is encoded by a DRB1*0101 allele. In some embodiments, the NY-ESO-1 peptide comprises the sequence TVSGNILTI (SEQ ID NO: 59). In some embodiments, the NY-ESO-1 peptide comprises the sequence EFTVSGNILTI (SEQ ID NO: 60). In some embodiments, the MHC class II molecule is linked to a ligand of a multivalent binding molecule. In some embodiments, the MHC class II molecule is linked to the ligand by covalent linkage. In some embodiments, the covalent linkage is a peptide bond, such that the MHC class II molecule and the ligand are linked as a fusion protein. In some embodiments, the ligand binds to a multivalent binding molecule. In some embodiments, the multivalent binding molecule binds at least one additional MHC class II molecule, wherein each additional MHC class II molecule is optionally peptide-loaded. In some embodiments, the multivalent binding molecule binds three additional MHC class II molecules, each one optionally peptide-loaded. In some embodiments, the ligand is biotin and the multivalent binding molecule is streptavidin or avidin. In some embodiments, the MHC class II molecule is a HLA class II molecule. In some embodiments, the NY-ESO-1 peptide is fused to a tag. In some embodiments, the tag is a poly-Histidine tag. In some embodiments, the tag comprises between 3 and 12 contiguous Histidine residues. In some embodiments, the NY-ESO-1 peptide is a fragment of an NY-ESO-1 protein.
In some embodiments, an isolated peptide-loaded MHC class II molecule is provided, comprising an MHC class II alpha chain, an MHC class II beta chain, and a tagged MHC-class II binding peptide. In some embodiments, the MHC class II protein comprises a DR52b beta chain and/or is encoded by a DRB3*0202 allele. In some embodiments, the MHC class II protein comprises a DR1 beta chain and/or is encoded by a DRB1*0101 allele. In some embodiments, the tagged peptide is a tagged NY-ESO-1 peptide comprising an amino acid sequence chosen from the sequences provided in SEQ ID NOs 2-60, and/or comprising 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1), and/or an amino acid sequence selected from the group consisting of peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1. In some embodiments, the MHC class II alpha chain and/or the MHC class II beta chain is a DM chain, a DO chain, a DP chain, a DQ chain, a DQ chain, or a DR chain. In some embodiments, the MHC class II molecule is linked to a ligand of a multivalent binding molecule. In some embodiments, the MHC class II molecule is linked to the ligand by covalent linkage. In some embodiments, the covalent linkage is a peptide bond, such that the MHC class II molecule and the ligand are linked as a fusion protein. In some embodiments, the ligand binds to a multivalent binding molecule. In some embodiments, the multivalent binding molecule binds at least one additional MHC class II molecule, wherein each additional MHC class II molecule is optionally peptide-loaded. In some embodiments, the multivalent binding molecule binds three additional MHC class II molecules, each one optionally peptide-loaded. In some embodiments, the ligand is biotin and the multivalent binding molecule is streptavidin or avidin. In some embodiments, the MHC class II molecule is a HLA class II molecule. In some embodiments, the tagged MHC class II binding peptide comprises a tag that is fused to the peptide. In some embodiments, the tag is a poly-Histidine tag. In some embodiments, the tag comprises between 3 and 12 contiguous Histidine residues. In some embodiments, the NY-ESO-1 peptide is a fragment of an NY-ESO-1 protein.
In some embodiments, an isolated MHC class II multimer is provided, comprising a multivalent binding molecule, an isolated NY-ESO-1 peptide-loaded MHC class II molecule, comprising an MHC class II molecule, comprising a beta chain encoded by a DR1 allele or a DRB3 allele, and bound to a NY-ESO-1 peptide, the NY-ESO-1 peptide comprising 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1), and/or an amino acid sequence selected from the group consisting of peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1, wherein the MHC class II molecule is linked to a ligand of the multivalent binding molecule, and at least one additional MHC class II molecule linked to a ligand of the multivalent binding molecule, wherein each of the at least one additional MHC class II molecule is optionally peptide-loaded, and wherein the ligands bind to the multivalent binding molecule. In some embodiments, an isolated MHC class II tetramer is provided, comprising a multivalent binding molecule, an isolated, NY-ESO-1 peptide-loaded MHC class II molecule, comprising a beta chain encoded by a DRB1 or a DRB3 allele, the NY-ESO-1 peptide comprising 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1), and/or an amino acid sequence selected from the group consisting of peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1, wherein the MHC class II molecule is linked to a ligand of the multivalent binding molecule, and three additional MHC class II molecule linked to a ligand of the multivalent binding molecule, wherein each of the three additional MHC class II molecule is optionally peptide-loaded, and wherein the ligands bind to the multivalent binding molecule. In some embodiments, the ligand is biotin and the multivalent binding molecule is streptavidin or avidin. In some embodiments, a MHC class II molecule of the multimer or the tetramer is loaded with a NY-ESO-1 peptide comprising an amino acid sequence starting at residue 123 and ending at residue 137 of SEQ ID NO: 1. In some embodiments, a MHC class II molecule of the multimer or the tetramer is loaded with a NY-ESO-1 peptide comprising the sequence TVSGNILTI (SEQ ID NO: 59). In some embodiments, a MHC class II molecule of the multimer or the tetramer is loaded with a NY-ESO-1 peptide comprising the sequence EFTVSGNILTI (SEQ ID NO: 60). In some embodiments, the multimer or tetramer is labeled with a detectable label. In some embodiments, the detectable label is a fluorophore suitable for fluorescence activated cell sorting (FACS). In some embodiments, the MHC class II multimer comprises at least one HLA class II molecule. In some embodiments, the NY-ESO-1 peptide is fused to a tag. In some embodiments, the tag is a poly-Histidine tag. In some embodiments, the tag comprises between 3 and 12 contiguous Histidine residues. In some embodiments, the NY-ESO-1 peptide is a fragment of an NY-ESO-1 protein.
In some embodiments, an isolated MHC class II multimer is provided, comprising a multivalent binding molecule, an isolated peptide-loaded MHC class II molecule, comprising an MHC class II alpha chain, an MHC class II beta chain, and a tagged MHC-class II binding peptide, wherein the MHC class II molecule is linked to a ligand of the multivalent binding molecule, and at least one additional MHC class II molecule linked to a ligand of the multivalent binding molecule, wherein each of the at least one additional MHC class II molecule is optionally peptide-loaded, and wherein the ligands of the isolated peptide-loaded MHC class II molecule and of the at least one additional MHC class II molecule bind to the multivalent binding molecule. In some embodiments, an isolated MHC class II tetramer is provided, comprising a multivalent binding molecule, an isolated, peptide-loaded MHC class II molecule, comprising an MHC class II alpha chain, an MHC class II beta chain, and a tagged MHC-class II binding peptide. wherein the MHC class II molecule is linked to a ligand of the multivalent binding molecule, and three additional MHC class II molecule linked to a ligand of the multivalent binding molecule, wherein each of the three additional MHC class II molecule is optionally peptide-loaded, and wherein the ligands of the isolated peptide-loaded MHC class II molecule and of the three additional MHC class II molecules bind to the multivalent binding molecule. In some embodiments, the ligand is biotin and the multivalent binding molecule is streptavidin or avidin. In some embodiments, the tagged MHC class II binding peptide comprises an amino acid sequence chosen from the sequences provided in SEQ ID NOs 2-60, and/or comprises 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1), and/or an amino acid sequence selected from the group consisting of peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1. In some embodiments, the multimer or tetramer is labeled with a detectable label. In some embodiments, the detectable label is a fluorophore suitable for fluorescence activated cell sorting (FACS). In some embodiments, the MHC class II multimer comprises at least one HLA class II molecule. In some embodiments, the tagged MHC class II binding peptide comprises a tag that is fused to the peptide. In some embodiments, the tag is a poly-Histidine tag. In some embodiments, the tag comprises between 3 and 12 contiguous Histidine residues.
In some embodiments, a method is provided, comprising administering to a HLA-DRB3*0202 (DR52b)-positive subject an immunostimulatory NY-ESO-1 peptide that is able to specifically bind an HLA-DRB3*0202 (DR52b) protein, the NY-ESO-1 peptide comprising 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1), and/or an amino acid sequence chosen from a list comprising peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1 in an amount sufficient to elicit an immune response. In some embodiments, a method is provided, comprising administering to a HLA-DRB1*0101 (DR1)-positive subject an immunostimulatory NY-ESO-1 peptide that is able to specifically bind an HLA-DRB1*0101 (DR1) protein, the NY-ESO-1 peptide comprising 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1), and/or an amino acid sequence chosen from a list comprising peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1 in an amount sufficient to elicit an immune response. In some embodiments, a method is provided, comprising determining the presence and/or expression of a HLA-DRB3*0202 allele and/or the presence of HLA-DRB3*0202 (DR52b) restricted T cells in a subject, and, if the subject carries and/or expresses a HLA-DRB3*0202 allele and/or carries HLA-DRB3*0202 (DR52b) restricted T cells, administering to the subject an immunostimulatory NY-ESO-1 peptide that is able to specifically bind an HLA-DR133*0202 (DR52b) protein, the NY-ESO-1 peptide comprising 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1), and/or an amino acid sequence chosen from a list comprising peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1 in an amount sufficient to elicit an immune response; or if the subject does not carry and/or express a HLA-DRB3*0202 allele and/or carries HLA-DRB3*0202 (DR52b) restricted T cells, not administering to the subject an immunostimulatory NY-ESO-1 peptide that is able to specifically bind an HLA-DRB3*0202 (DR52b) protein. In some embodiments, a method is provided, comprising determining the presence and/or expression of a HLA-DRB1*0101 allele and/or the presence of HLA-DRB1*0101 (DR1) restricted T cells in a subject, and, if the subject carries and/or expresses a HLA-DRB1*0101 allele and/or carries HLA-DRB1*0101 (DR1) restricted T cells, administering to the subject an immunostimulatory NY-ESO-1 peptide that is able to specifically bind an HLA-DRB1*0101 (DR1) protein, the NY-ESO-1 peptide comprising 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1), and/or an amino acid sequence chosen from a list comprising peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1 in an amount sufficient to elicit an immune response; or if the subject does not carry and/or express a HLA-DRB1*0101 allele and/or carries HLA-DRB1*0101 (DR1) restricted T cells, not administering to the subject an immunostimulatory NY-ESO-1 peptide that is able to specifically bind an HLA-DRB1*0101 (DR1) protein. In some embodiments, the NY-ESO-1 peptide comprises the sequence TVSGNILTI (SEQ ID NO: 59). In some embodiments, the NY-ESO-1 peptide comprises the sequence EFTVSGNILTI (SEQ ID NO: 60). In some embodiments, the NY-ESO-1 peptide is bound by a HLA-DRB3*0202 (DR52b) restricted CD4+ T cell or a DRB1*0101 (DR1) restricted CD4+ cell. In some embodiments, the subject is diagnosed to have a tumor, a cell of which expresses NY-ESO-1. In some embodiments, the immune response is induction of HLA-DRB3*0202 (HLA-DR52b) restricted CD4+ T cells and/or of HLA-DRB1*0101 (HLA-DR1) restricted CD4+ T cells specific for the NY-ESO-1 peptide. In some embodiments, the immune response is increasing the rate of proliferation of HLA-DRB3*0202 (DR52b) and/or of HLA-DRB1*0101 (HLA-DR1) restricted CD4+ T cells restricted CD4+ T cells specific for the NY-ESO-1 peptide. In some embodiments, the immunostimulatory NY-ESO-1 peptide is administered to the subject based on the subject carrying and/or expressing a HLA-DRB3*0202 allele and/or a HLA-DRB1*0101 allele and/or the presence of HLA-DRB3*0202 (DR52b) restricted T cells and/or the presence of HLA-DRB1*0101 (HLA-DR1) restricted CD4+ T cells in the subject. In some embodiments, the immunostimulatory NY-ESO-1 peptide is a fragment of a NY-ESO-1 protein.
In some embodiments, a method, comprising obtaining a cell population from a subject, contacting the cell population with an immunostimulatory NY-ESO-1 peptide and/or a cell expressing an immunostimulatory NY-ESO-1 peptide comprising at least 9 contiguous amino acid residues of SEQ ID NO: 1, wherein the peptide is able to bind an MHC class II molecule that comprises a beta chain encoded by a DRB3*0202 allele or a DRB1*0101 allele, thus inducing or increasing proliferation of a DRB3*0202 (DR52b) restricted CD4+ T cell and/or a DRB1*0101 (DR1) restricted CD4+ T cell, respectively, specifically recognizing the immunostimulatory NY-ESO-1 peptide, optionally isolating a DRB3*0202 (MHC-DR52b) restricted CD4+ T cell or a DRB1*0101 (MHC-DR1) restricted CD4+ T cell specifically recognizing the immunostimulatory NY-ESO-1 peptide from the cell population, and optionally administering the DRB3*0202 (DR52b) restricted CD4+ T cell or the a DRB1*0101 (MHC-DR1) restricted CD4+ T cell specifically recognizing the immunostimulatory NY-ESO-1 peptide to the subject. In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1). In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises an amino acid sequence selected from the group consisting of peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1. In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises an amino acid sequence starting at residue 123 and ending at residue 137 of SEQ ID NO: 1. In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises the sequence TVSGNILTI (SEQ ID NO: 59). In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises the sequence EFTVSGNILTI (SEQ ID NO: 60). In some embodiments, the subject is diagnosed to have a tumor, a cell of which expresses NY-ESO-1. In some embodiments, the immunostimulatory NY-ESO-1 peptide is a fragment of a NY-ESO-1 protein. In some embodiments, the isolating a DRB3*0202 (MHC-DR52b) restricted CD4+ T cell or a DRB1*0101 (MHC-DR1) restricted CD4+ T cell specifically recognizing the immunostimulatory NY-ESO-1 peptide from the cell population comprises contacting the cell population with a peptide-loaded MHC class II molecule, multimer or tetramer as described herein and detecting the peptide-loaded MHC class II molecule, multimer or tetramer on the surface of the contacted cells, wherein, if the molecule, multimer, or tetramer is detected on the surface of a T-cell, the T-cell is determined to be a DRB3*0202 (MHC-DR52b) restricted CD4+ T cell or a DRB1*0101 (MHC-DR1) restricted CD4+ T cell, respectively, specifically recognizing the immunostimulatory NY-ESO-1 peptide, and is isolated from the cell population. In some embodiments, the DRB3*0202 (MHC-DR52b) restricted CD4+ T cell or the a DRB1*0101 (MHC-DR1) restricted CD4+ T cell specifically recognizing the immunostimulatory NY-ESO-1 peptide is isolated from the cell population by FACS. In some embodiments, the cell population is a peripheral blood cell population, a thymus cell population, a cord blood cell population, a lymph node cell population, a tumor infiltrating lymphocyte population, and/or a normal or inflamed tissue infiltrating lymphocyte population. In some embodiments, the cell population is a T-cell population.
In some embodiments, a method is provided, comprising contacting a cell with a MHC class II multimer or tetramer under conditions suitable for binding of the tetramer or multimer to a T cell receptor, wherein at least one of the MHC class II molecules of the multimer or tetramer is loaded with a NY-ESO-1 peptide comprising at least 9 contiguous amino acids of SEQ ID NO: 1, and wherein the tetramer or multimer is, optionally, labeled with a detection agent, and detecting whether the cell binds the multimer or tetramer. In some embodiments, the peptide-loaded MHC class II molecule comprises a beta chain encoded by a DRB3 allele or a DRB1 allele. In some embodiments, the DRB3 allele is a DRB3*0202 allele and/or encodes a DR52b protein. In some embodiments, the DRB1 allele is a DRB1*0101 allele and/or encodes a DR1 protein. In some embodiments, the NY-ESO-1 peptide binds to a DRB3*0202 (DR52b) restricted T cell or to a DRB1*0101 (DR1) restricted T cell, the NY-ESO-1 peptide comprising 9-25 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1). In some embodiments, a MHC class II molecule of the multimer or the tetramer is loaded with a NY-ESO-1 peptide that binds to a DRB3*0202 (DR52b) restricted T cell or to a to a DRB1*0101 (DR1) restricted T cell, comprising an amino acid sequence selected from peptides starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or peptides ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1. In some embodiments, the at least one MHC class II molecule of the multimer or the tetramer is loaded with a NY-ESO-1 peptide comprising an amino acid sequence starting at residue 123 and ending at residue 137 of SEQ ID NO: 1. In some embodiments, the method further comprises isolating a cell detected to bind the multimer or tetramer from a population of cells. In some embodiments, the population of cells is a population of blood cells or lymph node cells from a subject. In some embodiments, detecting and/or isolating are performed by fluorescence activated cell sorting (FACS). In some embodiments, the method further comprises quantifying the frequency of multimer-binding or tetramer-binding cells in a population of cells. In some embodiments, the method further comprises comparing the frequency of multimer-binding or tetramer-binding cells in a population of cells obtained from a subject to a control or reference frequency, and if the frequency in the population of cells from the subject is higher than the control or reference frequency, then the subject is indicated to have an immune response to a NY-ESO-1 epitope. In some embodiments, the population of cells is obtained from a subject after an agent or composition has been administered to the subject, the agent or composition comprising an immunostimulatory NY-ESO-1 peptide that is bound by a DRB3*0202 (DR52b) restricted T cell or by a DRB1*0101 (DR1) restricted T cell. In some embodiments, the reference frequency is the frequency observed before the agent or composition comprising an immunostimulatory NY-ESO-1 peptide had been administered to the subject. In some embodiments, the detection agent is a fluorophore suitable for fluorescence activated cell sorting (FACS). In some embodiments, the NY-ESO-1 peptide is fused to a tag. In some embodiments, the tag is a poly-Histidine tag. In some embodiments, the tag comprises between 3 and 12 contiguous histidine residues. In some embodiments, the tag consists of 6 contiguous histidine residues. In some embodiments, the NY-ESO-1 peptide is a fragment of an NY-ESO-1 protein. In some embodiments, the method further comprises obtaining the cell from the subject prior to contacting the cell with the MHC class II multimer or tetramer. In some embodiments, the subject has been administered an immunostimulatory NY-ESO-1 peptide prior to the cell being obtained from the subject. In some embodiments, the method further comprises contacting the cell with an antibody binding an antigen indicative of the differentiation status or cell type of the cell. In some embodiments, the antigen is a surface antigen. In some embodiments, the antigen is indicative of the differentiation status or cell type of a memory T-cell, a helper T cell, or a regulatory T-cell. In some embodiments, the antigen is chosen from the group of CD45RA, CD27, CD28, CCR4, CCR6, CCR7, CXCR3, CD69, CD25, CD127, CRTH2, FOXP3, t-bet, GATA-3, or ROR gamma t. In some embodiments, the antibody is labeled with a detection agent, and the detection agent that the antibody is labeled with is different from the detection agent, if any, that the multimer or tetramer is labeled with. In some embodiments, the antibody is labeled with a fluorophore and the multimer or tetramer is labeled with a fluorophore different from the fluorophore the antibody is labeled with. In some embodiments, the method further comprised detecting both fluorophores on the surface of a cell. In some embodiments, the method further comprised isolating a cell on the surface of which both fluorophores are detected. In some embodiments, the detecting is performed by FACS. In some embodiments, the method further comprises isolating the cell if it is indicated to be a memory T-cell, helper T-cell, or regulatory T-cell. In some embodiments, the method further comprises determining a cytokine profile of the isolated cell. In some embodiments, determining the cytokine profile comprises detecting one or more cytokines produced by the isolated cell. In some embodiments, the one or more cytokine is chosen from the group consisting of IFN-γ, TNF-α, TGF-β, IL-2, IL-4, IL-5, IL-8, IL-9, IL-10, IL-13, IL 17, IL21, IL-22, IP10, MIP-1alpha, MIP-1beta.
In some embodiments, a method of measuring an immune response, for example, an immune response to a vaccination, is provided, comprising obtaining a biological sample comprising a T-cell from a subject, wherein the subject has been administered a composition comprising an epitope of an antigen, contacting the T-cell with an MHC class II multimer, the MHC class II multimer comprising a plurality of MHC class II molecules, wherein at least one of the plurality of MHC class II molecules is loaded with a tagged peptide comprising an epitope of the antigen, and detecting binding of the MHC class II multimer to the T-cell. In some embodiments, the MHC class II multimer is labeled with a detection agent. In some embodiments, the detection agent is a fluorophore. In some embodiments, the method further comprises contacting the T-cell with an antibody binding to a marker indicative of T-cell differentiation status or cell type. In some embodiments, the antigen is chosen from the group of CD45RA, CD27, CD28, CCR4, CCR6, CCR7, CXCR3, CD69, CD25, CD127, CRTH2, FOXP3, t-bet, GATA-3, or ROR gamma t. In some embodiments, the frequency of effector cells (CCR7+), “reservoir” memory cells, including central memory (CCR7+) and transitional memory (CCR7−CD27+) T-cells, and/or CD25+CD127− Treg cells is determined. In some embodiments, the antibody is labeled with a detection agent, and wherein the detection agent that the antibody is labeled with is different from the detection agent, if any, that the multimer is labeled with. In some embodiments, the antibody is labeled with a fluorophore and the multimer is labeled with a fluorophore different from the fluorophore the antibody is labeled with. In some embodiments, the method further comprises detecting the fluorophores bound to the cell, for example, on the surface of a cell. In some embodiments, the method further comprising isolating a T-cell from the sample based on the detection of the MHC class II multimer binding to the T-cell and, optionally, the presence or absence of the antibody. In some embodiments, the detecting is performed by FACS. In some embodiments, the method further comprises determining a cytokine profile of the isolated T-cell. In some embodiments, determining the cytokine profile comprises detecting one or more cytokines produced by the isolated T-cell. In some embodiments, the one or more cytokine is chosen from the group consisting of IFN-γ, TNF-α, TGF-β, IL-2, IL-4, IL-5, IL-8, IL-9, IL-10, IL-13, IL 17, IL21, IL-22, IP10, MIP-1alpha, MIP-1 beta. In some embodiments, the frequency of IFN-γ+ IL-4lowIL-17lowIL-10−TH1 cells, and/or polyfunctional TNF-α+IL-2+ IFN-γ+ CD4+ T-cells is determined. In some embodiments, the T-cell is part of a population of cells comprised in the biological sample, and wherein the method further comprises quantifying the T-cells, and/or T-cell subtypes detected in the biological sample. In some embodiments, the method further comprises obtaining a biological sample from an additional subject that has been administered a composition comprising an epitope of the antigen, and comparing the quantities of the T-cells and/or T-cell subtypes detected in the sample from the additional subject to those detected in the sample from the subject. In some embodiments, the epitope administered to the additional subject has not been administered to the subject. In some embodiments, the method further comprises vaccinating further subjects with a composition comprising the epitope that elicited the highest quantities of T-cells or cells of a T-cell subtype among the subjects.
In some embodiments, an isolated immunostimulatory NY-ESO-1 peptide is provided that can specifically bind an MHC class II molecule, and that, when bound to a MHC class II molecule, can specifically bind to a DRB3*0202 (DR52b) restricted CD4+ T cell or to a DRB1*0101 (DR1) restricted T cell, the NY-ESO-1 peptide comprising at least 9 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1). In some embodiments, an isolated immunostimulatory NY-ESO-1 peptide is provided that can specifically bind an MHC class II molecule and that, when bound to a MHC class II molecule, can specifically bind to a DRB3*0202 (DR52b) restricted CD4+ T cell or to a DRB1*0101 (DR1) restricted T cell, the peptide comprising an amino acid sequence selected from the group consisting of peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1. In some embodiments, the NY-ESO-1 peptide comprises an amino acid sequence starting at residue 123 and ending at residue 137 of SEQ ID NO: 1. In some embodiments, the NY-ESO-1 peptide comprises the sequence TVSGNILTI (SEQ ID NO: 59). In some embodiments, the NY-ESO-1 peptide comprises the sequence EFTVSGNILTI (SEQ ID NO: 60). In some embodiments, an isolated peptide-loaded DRB3*0202 (DR52b) molecule comprising an immunostimulatory NY-ESO-1 peptide is provided that is bound to a DRB3*0202 (DR52b) molecule. In some embodiments, an isolated peptide-loaded DRB1*0101 (DR1) molecule comprising an immunostimulatory NY-ESO-1 peptide is provided that is bound to a DRB1*0101 (DR1) molecule. In some embodiments, an isolated peptide polytope is provided, comprising an NY-ESO-1 peptide, as described herein, and at least one additional DR52b or DR1 restricted tumor antigen epitope. In some embodiments, the at least one additional DR52b or DR1 restricted tumor antigen epitope is a NY-ESO-1, SSX-4 and/or a Melan-A epitope. In some embodiments, the NY-ESO-1 peptide and/or at least one additional DR52b or DR1 restricted tumor antigen epitope is fused to a tag. In some embodiments, the tag is a His tag. In some embodiments, the tag comprises between 3 and 12 contiguous Histidine residues. In some embodiments, the NY-ESO-1 peptide is a fragment of an NY-ESO-1 protein.
In some embodiments, a method is provided, comprising contacting an isolated MHC molecule with an isolated MHC molecule-binding peptide, wherein the MHC-binding peptide is fused to a tag, thus generating a peptide-loaded MHC molecule, and isolating the peptide-loaded MHC molecule. In some embodiments, the method further comprises linking the MHC molecule to a ligand of a multivalent binding molecule, and contacting the MHC molecule linked to the ligand with the multivalent binding molecule. In some embodiments, a method is provided, comprising contacting an isolated MHC molecule linked to a ligand of a multivalent binding molecule with an isolated MHC-binding peptide, wherein the MHC molecule-binding peptide is fused to a tag, thus generating a peptide-loaded MHC molecule, and isolating the peptide-loaded MHC molecule. In some embodiments, the method further comprises contacting the HLA molecule linked to the ligand with the multivalent binding molecule. In some embodiments, the tag is a peptide or protein tag. In some embodiments, the peptide or protein tag is a tag chosen from the group including a BCCP tag, a myc-tag, a calmodulin-tag, a FLAG-tag, a HA-tag, a His-tag, a maltose binding protein-tag, a nus-tag, a glutathione-S-transferase-tag, a green fluorescent protein-tag, a thioredoxin-tag, a S-tag, a Softag 1, a Softag 3, a strep-tag, a biotin ligase tag, a FlAsH tag, a V5 tag, or a SBP-tag. In some embodiments, the tag is a His tag. In some embodiments, the tag comprises between 3 and 12 contiguous histidine residues. In some embodiments, the His tag consists of 6 contiguous histidine residues. In some embodiments, isolating the complex comprising the MHC molecule bound to the MHC molecule-binding peptide is achieved by affinity chromatography. In some embodiments, the affinity chromatography is Ni2+ affinity chromatography. In some embodiments, isolating the MHC molecule contacted with the MHC-molecule binding peptide is achieved by gel filtration chromatography. In some embodiments, the resin employed in the gel filtration has a separation range (Mr) of about 10000 to about 600000. In some embodiments, the resin employed in the gel filtration chromatography is 5200 resin. In some embodiments, the isolated MHC molecule is a MHC class II molecule. In some embodiments, the isolated MHC-binding peptide is an immunostimulatory NY-ESO-1 peptide. In some embodiments, the immunostimulatory NY-ESO-1 peptide can specifically bind an MHC class II molecule, and, when bound to a MHC class II molecule, can specifically bind to a DRB3*0202 (DR52b) restricted CD4+ T cell or to a DRB1*0101 (DR1) restricted CD4+ T cell. In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises at least 9 contiguous amino acids of NY-ESO-1 (SEQ ID NO: 1). In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises an amino acid sequence selected from the group consisting of peptides of at least 9 amino acid residues starting at residue 119, 120, 121, 122, 123, 124, 125, 126, or 127 and/or ending at residue 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 of SEQ ID NO: 1. In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises an amino acid sequence starting at residue 123 and ending at residue 137 of SEQ ID NO: 1. In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises the sequence TVSGNILTI (SEQ ID NO: 59). In some embodiments, the immunostimulatory NY-ESO-1 peptide comprises the sequence EFTVSGNILTI (SEQ ID NO: 60). In some embodiments, the MHC molecule comprises a DRB3*0202 (DR52b) molecule or a DRB1*0101 (DR1) molecule.
In some embodiments, a method is provided, comprising obtaining a plurality of MHC class II molecules loaded with peptides of different sequences, wherein the peptide sequences comprise 9 contiguous amino acids of a protein antigen, contacting a T-cell or a T-cell receptor with the plurality of peptide-loaded MHC class II molecules, and detecting a binding event between the T-cell or T-cell receptor and a peptide-loaded MHC class II molecule comprised in the plurality of MHC class II molecules, wherein a peptide-loaded MHC class II molecule determined to bind the T-cell or T-cell receptor is identified as comprising an epitope of the antigen. In some embodiments, the method further comprises determining the amino acid sequence of the peptide comprised in the peptide-loaded MHC class II molecule determined to bind the T-cell or T-cell receptor. In some embodiments, the peptides are fused to a tag. In some embodiments, tag is a peptide or protein tag. In some embodiments, the peptide or protein tag is a tag chosen from the group including a BCCP tag, a myc-tag, a calmodulin-tag, a FLAG-tag, a HA-tag, a His-tag, a maltose binding protein-tag, a nus-tag, a glutathione-S-transferase-tag, a green fluorescent protein-tag, a thioredoxin-tag, a S-tag, a Softag 1, a Softag 3, a strep-tag, a biotin ligase tag, a FlAsH tag, a V5 tag, or a SBP-tag. In some embodiments, the tag is a His tag. In some embodiments, the tag comprises between 3 and 12 contiguous histidine residues. In some embodiments, the His tag consists of 6 contiguous histidine residues; In some embodiments, the MHC class II molecules are comprised in MHC class II multimers. In some embodiments, the MHC class II multimers are MHC class II tetramers. In some embodiments, each multimer or tetramer comprises peptides of the same sequence. In some embodiments, the T-cell receptor is expressed by a T-cell. In some embodiments, the T-cell is obtained from a subject. In some embodiments, the subject is diagnosed with having a tumor and the protein antigen is a protein antigen expressed by the tumor. In some embodiments, the T-cell is obtained from the subject after vaccination of the subject with the protein antigen, or a fragment thereof. In some embodiments, the contacting is performed in vivo, in vitro, or ex vivo. In some embodiments, the T-cell receptor is isolated prior to contacting. In some embodiments, the T-cell receptor or the plurality of MHC class II molecules is immobilized on a solid support. In some embodiments, the T-cell receptor is contacted with a composition comprising two or more of the plurality of MHC class II molecules. In some embodiments, the peptide-loaded MHC class II molecules are labeled with a detection agent in a manner allowing for the identification of the peptide comprised in a specific MHC class II molecule. In some embodiments, the T-cell receptor is contacted with a composition comprising one of the plurality of MHC class II molecules. In some embodiments, a plurality of steps of contacting the T-cell receptor with a composition comprising one of the plurality of MHC class II molecules is performed in parallel or sequentially. In some embodiments, the peptides comprise sequences of 20-40 contiguous amino acids. In some embodiments, the peptides comprise overlapping sequences of contiguous amino acid sequences of the antigen.
In some embodiments, a kit is provided, comprising an isolated MHC class II molecule, multimer, or tetramer as described herein, and/or an isolated immunostimulatory NY-ESO-1 peptide as described herein. In some embodiments, the kit further comprises a detectable label, a labeling reagent, a detection reagent, and/or a buffering reagent. In some embodiments, the kit further comprised an antibody to a marker indicative of T-cell differentiation status and/or T-cell subtype.
Some aspects of this invention provide tagged MHC class II binding peptides or methods using such peptides. Such tags are useful for the isolation of the tagged peptide, either alone or when bound to an MHC class II molecule. Methods for isolating tagged peptides are well known to those of skill in the art and include, for example, affinity chromatography methods. In some embodiments, an MHC class II binding peptide is provided or used that is conjugated to a tag. In some embodiments, the tag is a peptide tag. In some embodiments, the tag is a poly-Histidine tag. In some embodiments, the tag comprises 3-12 histidine residues. In some embodiments, the tag consists of 6 contiguous histidine residues.
Some aspect of this invention relate to improved methods for detecting T cells specifically binding an antigenic peptide loaded onto an MHC molecule.
Some aspects of this invention provide an isolated DR MHC class II molecule. In some embodiments, the MHC class II molecule comprises a DR beta chain and a DR alpha chain. In some embodiments, the beta chain comprises an extracellular part of a DR52b protein fused to a leucine zipper sequence. In some embodiments, the alpha chain comprises an extracellular part of a DR MHC class II alpha chain fused to a leucine zipper sequence that binds to the leucine zipper sequence fused to the beta chain. In some embodiments, the MHC class II molecule comprises an alpha chain comprising the amino acid sequence provided in SEQ ID NO: 79. In some embodiments, the MHC class II molecule comprises a beta chain comprising the amino acid sequence provided in SEQ ID NO: 81. In some embodiments, the MHC class II molecule comprises an alpha chain comprising the amino acid sequence provided in SEQ ID NO: 79, and a beta chain comprising the amino acid sequence provided in SEQ ID NO: 81. In some embodiments, the leucine zipper fused to the DR alpha chain is an acidic leucine zipper. In some embodiments, the leucine zipper fused to the beta chain is a basic leucine zipper. In some embodiments, the leucine zipper is followed by an Avi-Tag (also called BSP sequence). In some embodiments, the leucine zippers are fused to the MHC class II alpha and/or beta chains via a glycine-serine linker. In some embodiments, the MHC class II molecule is not loaded with an antigenic peptide. In some embodiments, the MHC class II molecule is loaded with an antigenic peptide. In some embodiments, the MHC class II molecule is loaded with an NY-ESO-1 antigenic peptide, for example, an NY-ESO-1 antigenic peptide as described herein.
These and other aspects of the invention, as well as various advantages and utilities will be more apparent with reference to the drawings and detailed description of the invention.
Identification of immunodominant tumor antigen-derived CD4+ T cell epitopes restricted by frequently expressed MHC class II molecules is instrumental for the immunological monitoring of tumor antigen-based vaccine trials, allowing for assessment of correlates between immune responses and clinical outcomes. Whereas many CD4+ T cell epitopes restricted by MHC-DR molecules encoded by the highly polymorphic DRB1 gene have been characterized, only few epitopes restricted by molecules encoded by the less polymorphic DRB3, DRB4 or DRB5 genes have been identified thus far. Here, we have characterized CD4+ T cell responses induced by vaccination with a recombinant NY-ESO-1 (rESO) protein and identified an ESO-derived, DR52b (DRB3*0202)-restricted, CD4+ T cell epitope. The identified epitope is immunodominant, as specific responses were detectable in all vaccinated patients expressing DR52b, and is recognized by CD4+ T cells exhibiting conserved TCR usage in different individuals.
NY-ESO-1, also referred to herein as ESO, is a tumor-specific antigen with wide expression in human tumors of different histological types and remarkable spontaneous immunogenicity. We have previously shown that specific TH1 and antibody responses can be elicited in patients with no detectable pre-existing immune responses by vaccination with rESO administered with Montanide ISA-51 and CpG ODN 7909. The purpose of the present study was to characterize vaccine-induced ESO-specific CD4+ T cell responses.
We generated CD4+ T cell clones from patient C2, who had the highest CD4+ T cell response to the vaccine, and analyzed their fine specificity and MHC class II restriction to determine the recognized epitope. We then assessed the response to the identified epitope in all vaccinated patients expressing the corresponding MHC class II allele.
We found that ESO-specific CD4+ T cell clones from patient C2 recognize peptide ESO119-143 (core region 123-137) presented by HLA-DR52b (HLA-DRB3*0202), an MHC class II allele expressed by about half of Caucasians. Importantly, following vaccination, all patients expressing DR52b developed significant responses to the identified epitope, accounting for, in average, half of the total CD4+ T cell responses to the 119-143 immunodominant region. In addition, analysis of ESO-specific DR52b-restricted CD4+ T cells at the clonal level revealed significant conservation of TCR usage among different individuals.
The identification of a DR52b-restricted epitope from ESO that is immunodominant in the context of vaccine-elicited, immune responses is instrumental for the immunological monitoring of vaccination trials targeting this important tumor antigen. By assessing vaccine-induced CD4+ T cells, we have identified an immunodominant epitope (ESO119-143, core region ESO123-137) restricted by HLA-DR52b (DRB3*0202), an allele expressed by half of Caucasians. DRB3-DRB4- and DRB5-encoded molecules are less polymorphic than those encoded by DRB1 and are therefore attractive candidates for the development of generic MHC class II tetramers.
Soluble MHC-peptide tetramers, allowing the direct visualization, characterization and isolation of antigen-specific T cells, have become essential tools for T cell analysis. MHC class I tetramers incorporating short CTL peptide epitopes, originally developed by J. D. Altman and M. M. Davis have been generated for a large number of murine and human alleles incorporating a variety of peptides of microbial, tumor and self-antigen origin. The development of MHC class II tetramers, however, and particularly of those incorporating peptides from tumor and self-antigens, has been far less successful. One limiting factor is the high polymorphism of the human MHC class II molecules, especially those encoded by the DRB1 locus, the most frequently studied. Another one is the binding affinity of antigenic peptides derived from tumor and self-antigens, which is generally lower than that of peptides from pathogens.
The immunodominant epitope (ESO119-143, core region ESO123-137) is restricted by HLA-DR52b, a DRB3-encoded molecule. DRB3-DRB4- and DRB5-encoded molecules are less polymorphic than those encoded by DRB1 and are, therefore, attractive candidates for the development of generic MHC class II tetramers. The immunodominant epitope ESO119-143 is also restricted by HLA-DR1, a DRB1-encoded molecule. Accordingly, the immunodominant ESO119-443 epitope is useful for therapeutic and diagnostic methods in subjects expressing a DRB1 or DR52b allele.
Our initial attempts to construct DR52b/ESO tetramers using an approach previously described by Kwok et al., by peptide loading of class II molecules incorporating “leucine zipper” motifs, failed to generate efficient tetramers. We therefore designed a novel strategy using His-tagged peptides that allows isolation of folded MHC/peptide monomers by affinity purification prior to tetramerization. Tetramers generated according to this procedure avidly and stably bound to ESO-specific CD4+ T cells, allowing their direct ex vivo enumeration, phenotyping and isolation from circulating lymphocytes of vaccinated patients. The application of this novel strategy to other tumor and self-antigen derived peptides may significantly accelerate the development of reliable MHC class II tetramers to monitor antigen-specific CD4+ T cells.
Some aspects of this invention relate to the surprising discovery that MHC class II binding peptides bind MHC class II molecules in the presence of a tag covalently bound to the binding peptides (a “tagged peptide”), for example, a peptide tag, such as a His tag, with similar affinity to that of untagged peptides. Some aspects of this invention provide a method for generating a MHC class II monomer loaded with a tagged peptide. Some aspects of the invention provide a method for isolating and/or purifying a MHC class II monomer loaded with a tagged peptide. Some aspects of this invention provide a method for generating MHC class II multimers, for example, tetramers, by contacting a MHC class II monomer loaded with a tagged peptide, and linked to a ligand of a multivalent binding molecule, with the multivalent binding molecule.
In some embodiments, a MHC class II monomer loaded with a tagged peptide, for example, a His-tagged peptide, is generated by contacting a MHC class II molecule with a tagged, MHC class II molecule-binding peptide. In some embodiments, the MHC class II molecule loaded with a tagged peptide is isolated and/or purified. In some embodiments, the isolation and/or purification comprises a step of enriching for peptide-loaded MHC-class II molecules comprising the tag, for example, an affinity chromatography step, and/or a step enriching for molecules of a desired size or size range, for example, a size fractionation step.
The surprising discovery that a tag, for example, a peptide tag, does not significantly interfere with the binding of a tagged peptide to an MHC class II molecule, allows for the design of an isolation and/or purification strategy that selects for MHC class II monomers that are loaded with the tagged peptide. This is in contrast to conventional methods in which no tag is used or in which a tag is placed on the MHC molecule itself. While such methods allow for isolation and/or purification of “empty” MHC molecules (e.g., MHC molecules that are not peptide-loaded) by enriching for tag-bearing molecules of a desired size or size range, they typically do not allow a distinction between peptide-loaded and “empty” MHC molecules. Since, generally, only a fraction of MHC class II molecules bind an MHC class II binding peptide during the process of peptide-loading, such conventional methods yield mixtures of empty and peptide-loaded MHC class II molecules. The use of such mixtures, for example, in the preparation of MHC class II tetramers, results in decreased sensitivity, since only a fraction of the MHC class II molecules are peptide-loaded. One of the advantages of the methods provided by some aspects of this invention is that the use of tagged MHC class II binding peptides allows for selection of MHC class II molecules that have bound such a peptide, and, accordingly, for the exclusion of empty MHC class II molecules. In some embodiments, the MHC class II molecules to be loaded with MHC class II binding peptides comprise both correctly folded (“native”) and incorrectly folded (“denatured”) MHC class II molecules. In some embodiments, only the correctly folded MHC class II molecules efficiently bind the MHC class II binding peptides, while the incorrectly folded MHC class II molecules do not. In some embodiments, isolation of peptide-loaded MHC class II molecules from a mixture of incorrectly folded and correctly folded MHC class II molecules contacted with a tagged MHC class II binding peptide by enrichment/purification of molecule complexes comprising the tag and having a desired size or molecular weight allows for the exclusion of unbound peptide and incorrectly folded MHC class II molecules.
In some embodiments, isolated and/or purified MHC class II monomers comprise a ligand of a multivalent binding molecule or are linked to such a ligand after isolation and/or purification. In some embodiments, such MHC class II monomers are contacted with the multivalent binding molecule to generate peptide-loaded MHC class II multimers.
Some aspects of this invention relate to the surprising discovery that multimers, for example, tetramers, of MHC class II molecules loaded with tagged peptides avidly and stably bind target CD4+ T-cells. Accordingly, some aspects of this invention provide a method to contact a CD4+ T-cell with a MHC class II multimer, for example, a tetramer, and to detect the binding and/or identify the target CD4+ T-cell. In some embodiments, the MHC class II multimer (e.g. tetramer) is labeled with a detectable label and a cell to which the multimer binds is identified by detecting the label on the surface of the cell. Detectable labels and methods for the detection of such labels on the surface of cells are well known to those of skill in the art and examples of such labels include, but are not limited to fluorescein and its derivatives (e.g., fluorescein isothiocyanate (FITC)), phycoerythrin (PE), R-phycoerythrin (rPE) PE I, PE II, PE Texas Red, PE-Cy5, Peridinin chlorophyll protein (PerCP), propidium iodide (PI), PerCP/PI, PerCP-Cy5, PE-Cy7, allophycocyanin (APC), APC-Cy7, Alexa fluor 405, Alexa fluor 430, Alexa fluor 488, Alexa fluor 532, Alexa fluor 546, Alexa fluor 555, Alexa fluor 568, Alexa fluor 594, Alexa fluor 633, Alexa fluor 660, Alexa fluor 680, Pacific Blue, rhodamine, aminocoumarin, hydroxycoumarin, methoxycoumarin, HEX, TRITC, Tamara, 7-Aminoactinomycin D (7-AAD), fluorescent proteins (for example, GFP, YFP, BFP, RFP, also enhanced versions, such as eGFP. eYFP etc.), and Cyanine dyes, for example, Cy3 and Cy5. In some embodiments, the detection method is a flow cytometry method, for example a fluorescence-activated cell sorting (FACS) method. Flow cytometry methods and detectable labels for such methods are well known to a person skilled in the relevant art, and non-limiting examples for references disclosing such methods and labels are Zbigniew Darzynkiewicz, Cytometry (Methods in Cell Biology), Academic Press, 4th edition (October 2004), ISBN-10: 0124802834; John L. Carey et al., Flow Cytometry, American Society for Clinical Pathology, 4th edition (Oct. 8, 2007), ISBN-10: 0891895485; both of which are incorporated herein by reference for disclosure of flow cytometric methods and detectable labels.
In some embodiments, labeled, peptide-loaded MHC class II molecules, monomers, or multimers, are used to identify, detect, and/or isolate a CD4+ T-cell specifically binding the peptide loaded onto the MHC class II molecule, monomer, or multimer, from a cell population, for example, a cell population obtained from a patient. In some embodiments, the isolated T-cell is phenotypically and/or functionally characterized, for example, in regard to its cell subtype, in regard to differentiation, activation, adhesion or migration marker expression and/or in regard to its cytokine or chemokine expression or excretion profile. T-cell subtype markers (e.g., CD25, CD127, CRTH2), differentiation, adhesion, activation, and migration markers (e.g., CD45RA, CD27, CD28, CCR4, CCR6, CCR7, CXCR3, CD69), and lineage-specific transcription factors (e.g., FOXP3, t-bet, GATA-3, ROR gamma t) are well known to those of skill in the art. Cytokine and chemokine markers, detectable, for example, by antibodies in flow cytometry or other immunofluorescence-based assays (e.g., IFN-γ, TNF-α, TGF-β, IL-2, IL-4, IL-5, IL-8, IL-9, IL-10, IL-13, IL 17, IL21, IL-22, IP10, MIP-1alpha, MIP-1beta) are also well known to those of skill in the relevant arts.
The term “MHC” refers to the major histocompatibility complex. In humans, the term MHC is used interchangeably with the term “HLA” (human leukocyte antigen).
The term “NY-ESO-1” is interchangeably used with the terms “ESO” and “ESO-1” herein. NY-ESO-1 is also known as “cancer/testis antigen 1B”. A representative sequence of human NY-ESO-1 protein is given below:
In some embodiments, an isolated immunostimulatory NY-ESO-1 peptide is provided. In some embodiments, an isolated immunodominant NY-ESO-1 peptide is provided. In some embodiments, an NY-ESO-1 peptide is provided that is a fragment of a NY-ESO-1 protein, for example, human NY-ESO-1 protein. In some embodiments, an isolated MHC class II molecule bound to a NY-ESO-1 peptide, also referred to as a NY-ESO-1 peptide-loaded MHC class II molecule, is provided. In some embodiments, a complex of a NY-ESO-1 peptide-loaded MHC class II molecule with at least one additional MHC class II molecule, each one of the at least one additional MHC class II molecule optionally NY-ESO-1 peptide-loaded, is provided. In some embodiments, such a multimeric NY-ESO-1 peptide-loaded MHC class II complex comprises four NY-ESO-1 peptide loaded MHC class II molecules.
In some embodiments, an isolated protein, polypeptide, polypeptide complex, multimer, and/or tetramer is provided. The term “polypeptide” is used interchangeably with the terms “peptide” and “protein” herein and refers to a polymer molecule comprising at least two amino acids linked by a peptide bond. Amino acids comprised in the polypeptides provided herein may be naturally occurring amino acids or non-naturally occurring amino acids, as well as modified amino acids. Non-naturally occurring and modified amino acids are well known in the art. Polypeptides may also comprise one or more non-peptide bonds.
The term “isolated” as used herein, refers to a molecule or agent, for example a NY-ESO-1 peptide, that has been removed from its natural source, biological environment or milieu (for example by removing a protein from an intact cell source).
A “molecule” may be any chemical or biological molecule, whether naturally occurring or non-naturally occurring/synthetic, for example any molecule that can be made by chemical synthetic methods, recombinant methods or other method known in the art. A molecule can be, for example, a biomolecule, for example a protein, polypeptide or oligopeptide, a nucleic acid, for example an oligonucleotide or polynucleotide, a saccharide, a fatty acid, a sterol, an isoprenoid, a purine, a pyrimidine, a molecule in a complex of molecules, a chemical substance, for example a small organic compound (or molecule), whether naturally occurring or non-naturally occurring or synthetic. A derivative or structural analog of any of the above, or a combination thereof and the like. A small organic compound (molecule) is a chemical compound (or molecule) having a molecular weight of more than 50 yet less than about 2500, preferably less than about 1000 and, more preferably, less than about 500.
In some embodiments, an isolated NY-ESO-1 polypeptide is provided. In some embodiments, an isolated immunostimulatory NY-ESO-1 epitope is provided. The term “epitope”, as used herein, refers to a part of a macromolecule that is recognized by the immune system, for example, a macromolecule that can be specifically bound by, for example, an antibody, a B cell receptor, or a T cell receptor, a macrophage receptor, or a dendritic cell receptor. The epitope is also known as the antigenic determinant. Accordingly, a protein or polypeptide may comprise an epitope but not all proteins or polypeptides comprise an epitope. In some embodiments, a NY-ESO-1 epitope specifically binds to a MHC class II molecule. In some embodiments, a NY-ESO-1 epitope is specifically bound by or can specifically bind to a MHC-DRB1*0101 (MHC-DR1) restricted CD4+ T cell. In some embodiments, a NY-ESO-1 epitope is specifically bound by or can specifically bind to a MHC-DRB1*0101 (MHC-DR1) restricted CD4+ T cell.
In some embodiments, a NY-ESO-1 peptide-loaded MHC class II molecule is provided. The term “peptide-loaded” signifies a MHC class II molecule with a target peptide epitope bound in its antigen-binding groove. A target epitope is the epitope specifically recognized by the binding groove of the respective MHC class II molecule.
“Specific binding” or “specific recognition” are art recognized terms, used interchangeably herein, and refer to one or more qualities of the binding of two molecules, also referred to herein as binding partners. The specificity of an epitope-binding protein can be determined based on affinity and/or avidity. The affinity, represented by the equilibrium constant for the dissociation of an antigen with an antigen-binding protein, also called the dissociation constant, or KD, is a measure for the binding strength between two binding partners, for example between a NY-ESO-1 epitope and an MHC class II protein, or between a NY-ESO-1 peptide-loaded MHC class II molecule and a T-cell receptor. The lower the value of the KD, the stronger the binding strength between the binding partners. Typically, specific binding or specific recognition between two biomolecules, for example proteins, has a dissociation constant (KD) in the range of 10−4 to 10−12 moles/liter or less. A KD value greater than 10−4 mol/liter is generally considered to indicate non-specific binding. A binding affinity of less than 500 nM, less than 200 nM, less than 10 nM, and/or less than 500 μM is preferred. The KD can also be expressed as the ratio of the dissociation rate constant of a complex, denoted as koff, to the its association rate constant, denoted kon (so that KD=koff/kon). An on-rate indicative of specific binding between two molecules may vary between 102 M−1s−1 to about 107 M−1s−1. An off-rate indicative of specific binding may vary between 10−6 s−1 (near irreversible complex with a t1/2 of multiple days) to 1 s−1 (t1/2=0.69 s). The affinity of a NY-ESO-1 peptide to an MHC class II molecule, for example a DRB*0202 MHC class II molecule, may vary depending on the length and the sequence of the NY-ESO-1 peptide. Methods to determine the binding affinity or avidity for any given binding between two molecules, for example between two molecules provided herein (e.g., a NY-ESO-1 peptide and a MHC class II molecule, a NY-ESO-1 peptide-loaded MHC class II molecule and a T-cell receptor, or a NY-ESO-1 peptide-loaded MHC class II molecule multimer and a plurality of T-cell receptors) are well known in the art. Methods for predicting binding affinity of a given peptide to a given MHC class II molecule are also well known to those of skill in the art (see, e.g., Chang et al., Peptide length-based prediction of peptide-MHC class II binding, Structural Bioinformatics, 2006; and Salomon et al., Predicting Class II MHC-Peptide binding: a kernel based approach using similarity scores, BMC Bioinformatics, 2006). In some embodiments, specific binding between a NY-ESO-1 peptide and an MHC class II molecule is characterized by a KD value of less than 10−4 moles/liter. In some embodiments, specific binding between a NY-ESO-1 peptide and an MHC class II molecule is characterized by a KD value of less than 10−5 moles/liter. In some embodiments, specific binding between a NY-ESO-1 peptide and an MHC class II molecule is characterized by a KD value of less than 10−6 moles/liter. In some embodiments, specific binding between a NY-ESO-1 peptide and an MHC class II molecule is characterized by a KD value of less than 10−7 moles/liter. In some embodiments, specific binding between a NY-ESO-1 peptide and an MHC class II molecule is characterized by a KD value of less than 10−8 moles/liter. In some embodiments, specific binding between a NY-ESO-1 peptide and an MHC class II molecule is characterized by a KD value of less than 10−9 moles/liter. In some embodiments, specific binding between a NY-ESO-1 peptide and an MHC class II molecule is characterized by a KD value of less than 10−10 moles/liter. In some embodiments, specific binding between a NY-ESO-1 peptide and an MHC class II molecule is characterized by a KD value of less than 10−11 moles/liter. In some embodiments, specific binding between a NY-ESO-1 peptide and an MHC class II molecule is characterized by a KD value of less than 10−12 moles/liter.
In some embodiments, a NY-ESO-1 peptide-loaded MHC class II molecule is provided, wherein the NY-ESO-1 peptide comprises at least 9 contiguous amino acid residues of the NY-ESO-1 polypeptide (SEQ ID NO: 1). In some embodiments, a NY-ESO-1 peptide-loaded MHC class II molecule is provided, wherein the NY-ESO-1 peptide comprises 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 5, 26, 27, 28, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 contiguous amino acid residues of the NY-ESO-1 polypeptide (SEQ ID NO: 1). In some embodiments, a NY-ESO-1 peptide-loaded MHC class II molecule is provided, wherein the NY-ESO-1 peptide comprises more than 40 contiguous amino acid residues of the NY-ESO-1 polypeptide (SEQ ID NO: 1). In some embodiments, the NY-ESO-1 peptide of the NY-ESO-1 peptide-loaded MHC class II molecule provided comprises or consists of a NY-ESO-1 peptide of 9-25 contiguous amino acids of SEQ ID NO: 1. In some embodiments, the NY-ESO-1 peptide of the NY-ESO-1 peptide-loaded MHC class II molecule comprises or consists of amino acid residues 123-137 of SEQ ID NO: 1. In some embodiments, the NY-ESO-1 peptide comprises or consists of one of the following amino acid sequences:
It will be appreciated by those of skill in the art that substitution of an amino acid residue in an amino acid sequence of a polypeptide with a residue of similar structure may result in a polypeptide of similar or even the same function as the original polypeptide. In particular, NY-ESO-1 amino acid residues that are not part of a NY-ESO-1 epitope may be substituted for similar or dissimilar residues and residues that are involved in binding of a NY-ESO-1 epitope by a MHC class II molecule may be substituted with highly similar residues, for example residues that share certain parameters, such as size, charge. Such so-called “conservative” or “functional” amino acid substitutions can generally be described as amino acid substitutions in which an amino acid residue is replaced with another amino acid residue of similar chemical structure and which has little or essentially no influence on the function, activity or other biological properties of the polypeptide. Such conservative amino acid substitutions are well known in the art, for example from WO 04/037999, GB-A-3 357 768, WO 98/49185, WO 00/46383 and WO 01/09300; and types and/or combinations of such substitutions may be selected on the basis of the pertinent teachings from WO 04/037999 as well as WO 98/49185 and from the further references cited therein. “Conservative” and “functional” substitutions are known to those of skill in the art and are encompassed within the scope of the embodiments described herein.
Conservative substitutions preferably are substitutions in which one amino acid within the following groups (a)-(e) is substituted by another amino acid residue within the same group: (a) small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro and Gly; (b) polar, negatively charged residues and their (uncharged) amides: Asp, Asn, Glu and Gln; (c) polar, positively charged residues: H is, Arg and Lys; (d) large aliphatic, nonpolar residues: Met, Leu, Ile, Val and Cys; and (e) aromatic residues: Phe, Tyr and Trp.
Particularly preferred conservative substitutions are as follows: Ala to Gly or to Ser; Arg to Lys; Asn to Gln or to H is; Asp to Glu; Cys to Ser; Gln to Asn; Glu to Asp; Gly to Ala or to Pro; H is to Asn or to Gln; Ile to Leu or to Val; Leu to Ile or to Val; Lys to Arg, to Gln or to Glu; Met to Leu, to Tyr or to Ile; Phe to Met, to Leu or to Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp; and/or Phe to Val, to Ile or to Leu.
Any amino acid substitutions applied to the polypeptides described herein may also be based on the analysis of the frequencies of amino acid variations between homologous proteins of different species developed by Schulz et al., Principles of Protein Structure, Springer-Verlag, 1978, on the analyses of structure forming potentials developed by Chou and Fasman, Biochemistry 13: 211, 1974 and Adv. Enzymol., 47: 45-149, 1978, and on the analysis of hydrophobicity patterns in proteins developed by Eisenberg et al., Proc. Nat. Acad. Sci. USA 81: 140-144, 1984; Kyte & Doolittle; J. Molec. Biol. 157: 105-132, 1981, and Goldman et al., Ann. Rev. Biophys. Chem. 15: 321-353, 1986, all incorporated herein in their entirety by reference.
In silico methods for designing peptides and proteins equivalent in structure to the NY-ESO-1 peptides provided herein are well known in the art. Methods to predict with high accuracy which amino acid residues in a given peptide or protein may be substituted may include the use of computational strategies for protein engineering, such as combinatorial protein design strategies. Combinatorial protein design strategies allow for the identification of substitutable amino acid residues within a peptide or protein and amino acids for substitution of a given residue by sequence alignment, for example of different peptide or protein amino acid sequences of functionally equivalent proteins found in one species, or across a number of species. As an example, if an alignment of human NY-ESO-1 proteins shows amino acid sequence variability at a certain position of the aligned sequences, the residue at the respective position is indicated to be substitutable with any of the amino acids found at that position within the aligned proteins. Further, any conservative amino acid substitution at that position is highly likely to result in a functional protein or peptide. Similarly, alignment of NY-ESO-1 protein sequences with equivalent or similar structure and/or function from different species can be used to identify substitutable amino acid residues and amino acids for substitution at an identified position.
Methods to determine whether an envisioned sequence modification will result in a functional or non-functional protein or peptide are well known in the art. For example, functional, substituted NY-ESO-1 proteins, protein fragments, or peptides, may be identified by analysing the structure or function of a given modified NY-ESO-1 sequence in silico, for example using methods of in silico prediction of protein structure from a given amino acid sequence, modelling of protein folding, modelling of protein-protein docking, modelling of protein-protein, peptide-protein, or peptide-peptide binding. The in silico results for a modified NY-ESO-1 sequence can be compared to a native NY-ESO-1 sequence, for example, in order to determine whether the modified NY-ESO-1 sequence binds to a MHC-DRB3*0202 (DRb52) protein or a DRB1*0101 protein with similar affinity as compared to the native sequence.
In silico methods suitable for the design of substituted and/or modified NY-ESO-1 sequences with equivalent function to the original sequences, are well known in the art and described in more detail, for example in Lutz and Bornscheuer, Protein Engineering Handbook, Wiley-VCH, (2009), ISBN: 978-3527318506; Mueller and Arndt, Protein Engineering Methods (Methods in Molecular Biology), Humana Press, (1), 2006, ISBN: 978-1588290724; Zaki and Bystroff, Protein Structure Prediction (Methods in Molecular Biology), Humana Press, (2), 2007, ISBN: 978-1588297525; Xu et al., Computational Methods for Protein Structure Prediction and Modeling: Volume 2: Structure Prediction (Biological and Medical Physics, Biomedical Engineering), Springer; (1), 2006, ISBN: 978-0387333212; and Kukol, Molecular Modeling of Proteins (Methods in Molecular Biology), Humana Press, 2008, ISBN: 978-1588298645; all of which are incorporated herein by reference.
In some embodiments, the β-chain of a MHC class II molecule is encoded by the DRB3 gene locus. In some embodiments, the β-chain of a MHC class II molecule is encoded by the DRB3*0202 gene locus. In some embodiments, the β-chain of a MHC class II molecule is a DR52b protein. In some embodiments, the β-chain of a MHC class II molecule is a polypeptide comprising an amino acid sequence sharing more than 70%, more than 80%, more than 90%, more than 95%, more than 98%, more than 99%, or more than 99.9% sequence identity with the amino acid sequence of a human DR52b protein. In some embodiments, the MHC class II molecule is NY-ESO-1 peptide-loaded.
In some embodiments, the β-chain of a MHC class II molecule is encoded by the DRB1 gene locus. In some embodiments, the β-chain of a MHC class II molecule is encoded by the DRB1*0101 gene locus. In some embodiments, the β-chain of a MHC class II molecule is a DR1 protein. In some embodiments, the β-chain of a MHC class II molecule is a polypeptide comprising an amino acid sequence sharing more than 70%, more than 80%, more than 90%, more than 95%, more than 98%, more than 99%, or more than 99.9% sequence identity with the amino acid sequence of a human DR1 protein. In some embodiments, the MHC class II molecule is NY-ESO-1 peptide-loaded.
In some embodiments, a MHC class II molecule is provided that is linked to a ligand. In some embodiments, the ligand is a ligand of a binding molecule, for example a monovalent binding molecule or a multivalent binding molecule. In some embodiments, the MHC class II molecule is covalently linked to the ligand, for example, by peptide bond. The term “covalent bond” is art-recognized and refers to a bond between two atoms where electrons are attracted electrostatically to both nuclei of the two atoms, and the net effect of increased electron density between the nuclei counterbalances the internuclear repulsion. The term “covalent bond” further includes coordinate bonds when the bond is with a metal ion. In some embodiments, the ligand is a peptide. In some embodiments, the ligand and one of the polypeptide chains, for example the α-chain or the β-chain, of the MHC class II molecule are encoded by the same nucleic acid sequence. In some embodiments, the ligand is biotin or a functional equivalent and the multivalent binding molecule is streptavidin or avidin or a functional equivalent of any of these. In some embodiments, a biotinylated MHC class II molecule is provided, wherein the MHC molecule and the biotin residue are linked, for example, via primary amine biotinylation, sulfhydryl biotinylation, carboxyl biotinylation, glycoprotein biotinylation, or non-specific biotinylation. In some embodiments, the binding molecule is a soluble molecule. In some embodiments, the binding molecule is attached to a solid support, for example by covalent bond or by non-covalent bond or interaction. Other mono-, bi-, tri-, tetra-, and multivalent binding molecules are well known in the art.
In some embodiments, MHC class II multimers are provided. In some embodiments, such MHC class II multimers comprise a multivalent binding molecule binding a plurality of MHC class II molecules linked to a ligand of the multivalent binding molecule. At least one of the MHC class II molecules in a NY-ESO-1 peptide-loaded MHC class II multimer, as provided by some embodiments, is loaded with a NY-ESO-1 peptide. In some embodiments, all MHC class II molecules in a MHC class II multimer are peptide-loaded. For example, a NY-ESO-1 peptide-loaded MHC class II tetramer comprises four MHC class II molecules, of which one, two three, or all four may be NY-ESO-1 peptide-loaded. In some embodiments, a multivalent binding molecule, for example streptavidin or avidin, binds to a plurality of ligand-linked, and optionally NY-ESO-1 peptide-loaded MHC class II molecules as provided herein such that a multimer is formed. In some embodiments, the MHC class II multimer is a MHC class II tetramer.
Some embodiments provide methods for producing a peptide-loaded MHC molecule multimer, for example an NY-ESO-1 peptide-loaded MHC class II tetramer. In some embodiments, an MHC molecule is contacted with an MHC molecule-binding peptide. MHC molecule-binding peptides are well known in the art. Further examples of MHC molecule-binding peptides include the MHC molecule binding NY-ESO-1 peptides provided herein and the peptides disclosed in Table 2. In some embodiments, the MHC molecule is a MHC class II molecule. In some embodiments, the MHC molecule is linked to a ligand. In some embodiments, the MHC molecule is linked to a ligand prior to being contacted with the MHC molecule-binding peptide. In some embodiments, the MHC molecule is linked to a ligand after being contacted with the MHC molecule-binding peptide.
In some embodiments, the MHC molecule is contacted with a MHC molecule-binding peptide that is conjugated to a tag. In some embodiments, the tag is a peptide tag. A protein or peptide may be fused to a peptide tag by methods well known to those in the art. For example, expression vectors allowing for the in-frame fusion of a peptide of interest, for example, an MHC molecule-binding peptide, and a peptide tag encoded by the vector are known to skilled persons and are commercially available. For another example, a nucleic acid encoding a peptide tag fused to a peptide or protein may be generated by PCR-amplification of a coding region of the peptide or protein of interest with a primer comprising a nucleic acid sequence encoding the peptide tag. In some embodiments, a nucleic acid encoding a peptide or protein fused to a peptide tag may be synthesized de novo. In some embodiments, a peptide or protein, for example, an MHC molecule-binding peptide, may be fused directly to a peptide tag. In some embodiments, a spacer or linker, for example, a peptide spacer or linker, may connect the peptide and the peptide tag. In some embodiment, a tag is fused to the N-terminus of the peptide. In some embodiments, a tag is fused to the C-terminus of the peptide. In some embodiments, both the C— and the N-terminus of the peptide are tagged, for example, with the same tag on each terminus, or with different tags.
Peptide tags are well known to those of skill in the art and examples of peptide tags include, but are not limited to, biotin carboxylase carrier protein (BCCP) tags, myc-tags, calmodulin-tags, FLAG-tags, hemagglutinin (HA)-tags, polyhistidine tags, also referred to as histidine tags or His-tags, maltose binding protein (MBP)-tags, nus-tags, glutathione-S-transferase (GST)-tags, green fluorescent protein (GFP)-tags, thioredoxin-tags, S-tags, Softags (e.g., Softag 1, Softag 3), strep-tags, biotin ligase tags, FlAsH tags, V5 tags, and SBP-tags. Sequences of peptide tags useful in some embodiments of this invention, for example, the tags described herein, are well known to those of skill in the art and exemplary sequences and references describing such sequences, as summarized, for example, in Kimple, M. E., and Sondek, J. Overview of affinity tags for protein purification. Curr Protoc Protein Sci. 2004 September; Chapter 9:Unit 9.9, incorporated in its entirety herein for disclosure of peptide tags, are listed in Table 1:
Staphylococcal
Staphylococcal
The table 1 references listed above are incorporated in their entirety herein for disclosure of peptide tags and methods of using such tags.
For further references providing an overview of useful peptide tags and methods for the purification of tagged peptides or proteins, see, e.g., Weiss E, Chatellier J, Orfanoudakis G., In vivo biotinylated recombinant antibodies: construction, characterization, and application of a bifunctional Fab-BCCP fusion protein produced in Escherichia coli. Protein Expr Purif. 1994 October; 5(5):509-17; Funakoshi M, Hochstrasser M., Small epitope-linker modules for PCR-based C-terminal tagging in Saccharomyces cerevisiae. Yeast. 2009 March; 26(3):185-92; Moqtaderi Z, Struhl K., Expanding the repertoire of plasmids for PCR-mediated epitope tagging in yeast. Yeast. 2008 April; 25(4):287-92; Tagwerker C, Zhang H, Wang X, Larsen L S, Lathrop R H, Hatfield G W, Auer B, Huang L, Kaiser P., HB tag modules for PCR-based gene tagging and tandem affinity purification in Saccharomyces cerevisiae. Yeast. 2006 June; 23(8):623-32; Kobayashi T, Morone N, Kashiyama T, Oyamada H, Kurebayashi N, Murayama T.; Engineering a novel multifunctional green fluorescent protein tag for a wide variety of protein research. PLoS One. 2008; 3(12):e3822. Epub 2008 Dec. 2; Lichty J J, Malecki J L, Agnew H D, Michelson-Horowitz D J, Tan S., Comparison of affinity tags for protein purification. Protein Expr Purif. 2005 May; 41(1):98-105.; 18.1. Nag B, Mukku P V, Arimilli S, Kendrick T, Deshpande S V, Sharma S, Separation of complexes of major histocompatibility class II molecules and known antigenic peptide by metal chelate affinity chromatography, J Immunol Methods 1994; 169:273-285; Cabanne C, Pezzini J, Joucla G, Hocquellet A, Barbot C, Garbay B, Santarelli X. Efficient purification of recombinant proteins fused to maltose-binding protein by mixed-mode chromatography. J Chromatogr A. 2009 May 15; 1216(20):4451-6. Epub 2009 Mar. 20. All listed references are incorporated in their entirety herein for disclosure of peptide and protein tags and methods for purification of tagged proteins.
In some embodiments, the MHC molecule-binding peptide is tagged with a histidine (His) tag. A histidine tag, a tag well known to those of skill in the art, comprises a sequence of contiguous histidine residues and can be fused to the N- or the C-terminus of a peptide or protein or inserted into the protein sequence. In some embodiments, the His tag is fused to the N-terminus of the MHC molecule-binding peptide, for example, an MHC class II binding NY-ESO-1 peptide as provided herein. In some embodiments, the His tag is fused to the C-terminus of the MHC molecule-binding peptide, for example, an MHC class II binding NY-ESO-0.1 peptide as provided herein. In some embodiments, the His tag comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 contiguous histidine residues. In some embodiments, the His tag consists of 6 contiguous histidine residues. In some embodiments, a MHC class II molecule is contacted with a MHC class II binding NY-ESO-1 peptide, as provided herein, that is tagged with a His tag.
In some embodiments, contacting of a MHC molecule with a tagged MHC molecule-binding peptide results in the formation of a complex comprising the MHC molecule bound to the tagged MHC molecule-binding peptide. In some embodiments, a complex comprising the MHC molecule bound to the tagged MHC molecule-binding peptide is isolated using a method suitable for the purification of peptides or proteins carrying the respective tag. Methods for the purification of tagged proteins are well known to those in the art (see, e.g., references cited in relation to protein tags) and the method used in a given embodiment will depend on the nature of the tag employed. In some embodiments, a complex comprising the MHC molecule bound to the tagged MHC molecule-binding peptide is isolated by affinity chromatography. In some embodiments, a ligand specifically binding the tag with high affinity is immobilized on a solid support, for example, a resin or membrane, and contacted with a complex comprising the MHC molecule bound to the tagged MHC molecule-binding peptide. In some embodiments, complex bound by the ligand is separated from non-bound molecules, washed, and subsequently eluted from the ligand. In some embodiments, a complex comprising an MHC class II molecule bound to a His-tagged NY-ESO-1 peptide as provided herein is isolated using affinity chromatography employing an Ni2+ resin (see, e.g., Crowe J, Masone B S, Ribbe J. One-step purification of recombinant proteins with the 6×His tag and Ni-NTA resin. Mol. Biotechnol. 1995 December; 4(3):247-58; and The QIAexpressionist™, A handbook for high-level expression and purification of 6×His-tagged proteins, Fifth Edition, June 2003, published by QIAGEN, Inc. (www.qiagen.com), both of which are incorporated herein by reference for disclosure of His-tag peptide expression and isolation/purification, for example, by affinity chromatography).
In some embodiments, a complex comprising the MHC molecule bound to the tagged MHC molecule-binding peptide is isolated by size fractionation. Methods for size fractionation of proteins, peptides, and complexes comprising such molecules are well known in the art and examples of such methods include, but are not limited to size exclusion chromatography (e.g., gel filtration), gradient centrifugation, and dialysis. In some embodiments, a complex comprising the MHC molecule bound to the tagged MHC molecule-binding peptide is isolated by collecting a specific fraction comprising molecules of a specific size and/or molecular weight. In some embodiments, a complex bound by the ligand is isolated in a procedure comprising a step employing affinity chromatography of the peptide tag and a step of size fractionation. In some embodiments, a complex comprising an MHC class II molecule bound to a His-tagged NY-ESO-1 peptide as provided herein is isolated using affinity chromatography employing an Ni2+ resin and subsequently using a gel filtration procedure. In some embodiments, the gel filtration procedure employs a resin that has a separation range (Mr) of about 10000 to about 600000. In some embodiments, the resin employed in the gel filtration chromatography is a S200 resin. Methods and resins for gel filtration an size exclusion chromatography are well known to those of skill in the art.
Other methods of producing peptide-loaded MHC multimers are known in the art (for example, see Altman et al., Science 274:94 96, 1996; Dunbar et al., Curr. Biol. 8:413 416, 1998; Crawford et al., Immunity 8:675 682, 1998).
In all embodiments, non-denaturing conditions are preferred during isolation of empty and peptide-loaded MHC class II molecules.
Empty MHC class II molecules generated and/or isolated by methods provided herein and/or using reagents described herein can subsequently be loaded with MHC class II binding peptides. Suitable MHC class II binding peptides for specific MHC class II molecules are well known in the art. Exemplary peptides are described in Table 2 and it will be appreciated that the invention is not limited in this respect.
It will further be appreciated by those of skill in the art that the methods and reagents useful for the preparation of MHC molecules, either “empty” or peptide-loaded, are universally applicable to MHC molecules and MHC molecule-binding antigenic peptides. Specific MHC molecule/peptide pairs are well known to those of skill in the art and have been described, for example in Guillaume P, Dojcinovic D, Luescher I F, Soluble MHC-peptide complexes: tools for the monitoring of T cell responses in clinical trials and basic research. Cancer Immun. 2009 Sep. 25; 9:7.PMID: 19777993; incorporated herein in its entirety for disclosure of the Ludwig Institute for Cancer Research tetramer collection, MHC multimer staining methods and reagents. Further, collections of MHC multimer staining reagents have been generated that disclose suitable MHC/peptide combinations, for example, the Ludwig Institute for Cancer Research tetramer collection, accessible at www.cancerimmunity.org/tetramers/index.htm, the entire contents of which are incorporated herein by reference.
Exemplary MHC/peptide pairs include, but are not limited to
In some embodiments, soluble MHC molecules are produced, for example, according to methods provided herein or known in the art. In some embodiments, a peptide which binds the MHC molecule, for example an immunodominant NY-ESO-1 epitope comprising peptide, is contacted with a soluble MHC molecule under conditions suitable for the MHC molecule to bind the peptide. In some embodiments, the isolated MHC/peptide complex is then linked to a ligand of a binding molecule. In some embodiments, the ligand is biotin. In some embodiments, peptide-loaded and ligand-linked MHC molecules are then contacted with a binding molecule. In some embodiments, the binding molecule is a multivalent binding molecule that binds a plurality of ligand-linked MHC molecules. In some embodiments, the multivalent binding molecule is streptavidin or avidin. In some embodiments, the multivalent binding molecule is labeled with a detectable label, for example, phycoerythrin. In some embodiments, the multivalent binding molecule binds four MHC molecules, resulting in the formation of a tetrameric MHC molecule complex, also referred to herein as a MHC tetramer. In some embodiments, the MHC molecule is a MHC class II molecule. In some embodiments, the MHC class II molecule is a DRB3*0202 encoded DR52b molecule. In some embodiments, the MHC class II molecule is a DRB1*0101 encoded DR1 molecule. In some embodiments, all MHC molecules of a tetramer are loaded with a NY-ESO-1 peptide. In some embodiments, the multimeric or tetrameric MHC complex is labeled with a detectable label, for example a fluorophore, a radioactive label, an enzyme, a tag, a binding molecule, an antibody or antigen-binding fragment thereof.
In some embodiments, a multimeric MHC molecule complex, comprising at least one NY-ESO-1 peptide-loaded MHC class II molecule, is contacted with a cell of the immune system or a population of cells comprising such a cell, for example, blood cells or cells obtained from a lymph node, under conditions suitable for the peptide-loaded MHC class II molecules to bind a T-cell receptor on the surface of a T-cell receptor expressing cell, for example a DRB3*0202 restricted CD4+ T-cell or a DRB1*0101 restricted CD4+ T-cell in a population of cells. Suitable conditions are well known to those of skill in the art. In some embodiments, suitable conditions are physiological conditions. Buffers and reagents to generate suitable, for example physiological conditions, are well known in the art. Cells bound by the multimeric MHC complex can be identified and isolated by various methods known in the art, for example flow cytometry, fluorescence activated cell sorting (FACS), fluorescence microscopy, and others. The isolated cells can then be expanded in vitro for uses as described herein. In some embodiments, a cell bound by multimeric NY-ESO-1 peptide-loaded MHC class II molecule complexes is expanded as an isolated, clonal cell population. Accordingly, in some embodiments, a method for the isolation and clonal expansion of DRB3*0202 restricted CD4+ T-cells or DRB1*0101 restricted CD4+ T-cell recognizing NY-ESO-1 peptide-loaded MHC class II molecules is provided. In some embodiments, a population of DRB3*0202 restricted CD4+ T-cells or of a DRB1*0101 restricted CD4+ T-cell recognizing NY-ESO-1 is administered to a recipient after isolation from a donor and, optionally, expansion in vitro. In some embodiments, the donor and the recipient are the same subject. In some embodiments, the donor and the recipient are different subjects, for example, at least partially genetically matched subjects.
In some embodiments, multimeric NY-ESO-1 peptide-loaded MHC class II tetramers are used to monitor DRB3*0202 restricted CD4+ T-cell or DRB1*0101 restricted CD4+ T-cell responses to vaccination protocols, for example to administration of an immunostimulatory NY-ESO-1 peptide or a composition comprising such a peptide. In some embodiments, a cell population is obtained from a subject suspected or diagnosed to have a tumor. In some embodiments, the cell population is then contacted with a NY-ESO-1 peptide-loaded MHC class II molecule or multimer and the binding of the NY-ESO-1 peptide-loaded MHC class II molecule or multimer to a DRB3*0202 restricted CD4+ T cell or a DRB1*0101 restricted CD4+ T cell recognizing NY-ESO-1 peptide-loaded MHC-class II molecules is detected. In some embodiments, the results from the detection are then used to determine the presence, quantity, and/or frequency of DRB3*0202 restricted CD4+ T cells or of DRB1*0101 restricted CD4+ T cells recognizing NY-ESO-1 peptide-loaded MHC-class II molecules in the subject. This procedure may be performed before, during and/or after administration of an immunostimulatory NY-ESO-1 peptide, fragment, and/or vaccine to the subject. In some embodiments, monitoring of a DRB3*0202 or DRB1*0101 restricted CD4+ T cell population recognizing NY-ESO-1 peptide-loaded MHC-class II molecules in a subject diagnosed with or having a tumor is used to analyze an immune response to an immunostimulatory NY-ESO-1 peptide in the subject, as detailed below. In some embodiments, the results from methods determining whether DRB3*0202 or DRB1*0101 restricted CD4+ T cells recognizing NY-ESO-1 peptide-loaded MHC-class II molecules are present in a subject having a tumor are used to classify the tumor, to stage the disease, to determine a prognosis of disease development, and/or to chose a treatment, for example a vaccination approach, a chemotherapeutic approach, and/or a radiation therapy approach.
Methods to isolate a suitable cell source or cell population from a subject are known in the art. In some embodiments, a cell population is obtained from a subject. In some embodiments, the cell population is a blood cell population, for example, a peripheral blood cell population. In some embodiments, a subpopulation of cells, for example a peripheral blood mononuclear cell (PBMCs) population, a B-cell population, or a T-cell population, is isolated from a peripheral blood sample from a subject by methods known in the art, for example by selective lysis, FACS or MACS for specific antigens, such as CD4 or CD8, etc. In some embodiments, cells are isolated from a lymph node, for example from a lymph node biopsy.
In some embodiments, the detection and quantification methods described herein may be used to determine an amount of a therapeutic agent or composition, for example, an amount of an immunostimulatory NY-ESO-1 peptide, sufficient to induce or enhance an immune response in a subject. In some embodiments, the amount of an administered agent, for example the amount of an immunostimulatory NY-ESO-1 peptide, may be adjusted based on the results of the detection and quantification methods described herein. For example, the amount of an administered agent may be increased, for example by additional administration (e.g. of the same dose, a higher dose or a lower dose) or by repeated administration, until a desired effect on the quantity, frequency, and/or proliferation rate of a certain cell population is detected. Alternatively, the amount of an administered agent may be decreased to the lowest amount at which a desired effect on the quantity, frequency, and/or proliferation rate of a certain cell population is detected.
An immune response induced or enhanced in a subject, for example, by administration of an immunogenic NY-ESO-1 epitope comprising peptide, can be monitored by various methods known in the art. For example, the presence of T cells specific for a given antigen or epitope can be detected by direct labeling of T cell receptors with labeled MHC molecules or multimers, which present the antigenic peptide. NY-ESO-1 peptide-loaded MHC class II multimers, for example tetramers, bind specific T-cell receptors with appropriate specificity and affinity, allowing for the specific labeling of certain subtypes of T-cells, for example DRB3*0202-restricted or DRB1*0101-restricted CD4+ T-cells that can bind NY-ESO-1 peptide-loaded MHC class II molecules containing a DR52b polypeptide or a DR1 polypeptide, respectively.
In some embodiments, a polypeptide and/or polypeptide complex provided herein, for example a NY-ESO-1 epitope, a MHC class II molecule, a MHC class II molecule complex, etc., is labeled with or coupled to or conjugated with a detectable label or detectable group. In some embodiments, a particular label is chosen that does not significantly interfere with the specific binding of the polypeptide or MHC class II multimer or other molecule used in any of the methods provided herein. A detectable label or group can be any material having a detectable physical or chemical property. Such detectable labels are well known in the art. The particular label chosen in any given embodiment will, of course, depend on the assay or method of detection to be employed. In general, almost any label useful in known assays or methods of detection can be applied to the methods of the present invention. Thus, a label is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, radiological or chemical means. Useful labels in the present invention include but are not limited to magnetic beads (e.g. Dynabeads™), fluorescent dyes (e.g. fluorescein isothiocyanate, Texas red, rhodamine, Cy3, Cy5, Cy5.5, Alexa 647 and derivatives), radiolabels (e.g. 3H, 112H, 35S, 14C, 32P or 99mTc), enzymes (e.g. horseradish peroxidase, alkaline phosphatase and others commonly used in an ELISA), tags, binding molecules, for example antibodies or antigen-binding fragments thereof, and colorimetric labels such as colloidal gold, colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads.
As used herein, the terms “labeled with” and “conjugated with” are intended to refer to, but not to be limited to, two or more molecules, bound to each other by one or more of the following: one or more covalent bonds, one or more ionic-bonds, one or more permanent dipole bonds, one or more instantaneous dipole to induced dipole bonds (e.g., van der Waals). The label may be coupled directly or indirectly to a polypeptide, for example a MHC class II polypeptide, or any other molecule, for example a binding molecule, provided by the invention according to methods well known in the art.
As indicated above, a wide variety of labels may be used, with the choice of label depending on the sensitivity required, the ease of conjugation with the compound, stability requirements, the available instrumentation and disposal provisions. Non-radioactive labels are often attached by indirect means. A detectable label may be detected by methods known in the art, either directly, for example by direct detection methods, or indirectly, for example by indirect detection methods. Direct and indirect detection methods are well known in the art.
Examples of detection methods include, but are not limited to, fluorescence activated cell sorting (FACS), flow cytometry, immunologically based assay methods from the list of immunohistochemistry, western blotting assay, enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), lateral flow test assay, enzyme immunoassay (EIA), fluorescent polarization immunoassay (FPIA), chemiluminescent immunoassay (CLIA), antibody sandwich capture assay.
Examples of fluorophores suitable for use in some embodiments, for example in some embodiments comprising detection by FACS, are fluorescein derivatives (e.g., fluorescein isothiocyanate (FITC)), phycoerythrin (PE), R-phycoerythrin (rPE) PE I, PE II, PE Texas Red, PE-Cy5, Peridinin chlorophyll protein (PerCP), propidium iodide (PI), PerCP/PI, PerCP-Cy5, PE-Cy7, allophycocyanin (APC), APC-Cy7, Alexa fluor 405, Alexa fluor 430, Alexa fluor 488, Alexa fluor 532, Alexa fluor 546, Alexa fluor 555, Alexa fluor 568, Alexa fluor 594, Alexa fluor 633, Alexa fluor 660, Alexa fluor 680, Pacific Blue, rhodamine, aminocoumarin, hydroxycoumarin, methoxycoumarin, HEX, TRITC, Tamara, 7-Aminoactinomycin D (7-AAD), fluorescent proteins (for example, GFP, YFP, BFP, RFP, also enhanced versions, such as eGFP. eYFP etc.). Other suitable fluorophores will be known to those of skill in the relevant art. Where the label is a fluorescent label, it may be detected by exciting the fluorophore with the appropriate wavelength of light and detecting the resulting fluorescence. The fluorescence may be detected visually, by means of a photographic film, by the use of electronic detectors such as charge coupled devices (CCDs) or photomultipliers and the like.
In embodiments where the label is a radioactive label, means for detection include a scintillation counter, a phosphor detector such as a phosphorimager, or photographic film as in autoradiography.
Detectable labels or entities as provided by some embodiments of the invention can be used to facilitate detection and/or separation of, for example, a cell expressing NY-ESO-1 (e.g. a malignant cell), a cell able to bind a NY-ESO-1 epitope, or a cell able to bind a specific NY-ESO-1 peptide-loaded MHC class II molecule (e.g., a MHC-DRB3*0202 (MHC-DR52b) or MHC-DRB1*0101 (DR1) restricted CD4+ T cell), for example isolation or separation from other cells of a cell population, or from a biological sample. Such a cell can be isolated by a variety of methods known in the art, for example, by fluorescence-activated cell sorting (FACS) or magnetic activated cell sorting (MACS).
In some embodiments, detection methods described herein or known in the art may be used to quantify the occurrence of a specific cell type in a subject, for example to quantify the frequency or amount of MHC-DRB3*0202 (MHC-DR52b) or DRB1*0101 (DR1) restricted CD4+ T cells able to bind a NY-ESO-1 epitope in a subject. In some embodiments, quantifying may comprise determining cell quantity, frequency, size, proliferation rate, and/or any other quantitative cell parameter known to those of skill in the art. In some embodiments, the detection methods provided herein may be used to monitor a change in a quantitative parameter, for example cell quantity, frequency, and/or proliferation rate, of a specific cell type in a subject over time. In some embodiments, a quantitative parameter, for example, the quantity, frequency, and/or proliferation rate, of a certain cell type, for example, MHC-DRB3*0202 (MHC-DR52b) or DRB1*0101 (DR1) restricted CD4+ T cells able to bind a NY-ESO-1 epitope, is monitored in a subject before, during, and/or after the administration of an immunostimulatory composition or peptide, for example a composition comprising an immunostimulatory NY-ESO-1 peptide, for example, NY-ESO-123-137. In some embodiments, a value determined for any quantitative parameter in the subject is compared to a reference, control, or baseline value.
In some embodiments, a CD4+ T-cell specifically binding a peptide-loaded MHC class II molecule is isolated from a cell population, for example, by flow cytometry or by an immunoassay. In some embodiments, the isolated CD4+ T-cell is further characterized, for example, in regard to its phenotype or its function. Assays and reagents as well as biomarkers for phenotypic and/or functional characterization of T-cells are well known to those of skill in the art. Biomarkers for such characterizations include, but are not limited to, T-cell subtype markers (e.g., CD25, CD127, CRTH2), differentiation, adhesion, activation, and migration markers (e.g., CD45RA, CD27, CD28, CCR4, CCR6, CCR7, CXCR3, CD69), and lineage-specific transcription factors (e.g., FOXP3, t-bet, GATA-3, ROR gamma t), as well as cytokine and chemokine markers (e.g., IFN-γ, TNF-α, TGF-β, IL-2, IL-4, IL-5, IL-8, IL-9, IL-10, IL-13, IL 17, IL21, IL-22, IP10, MIP-1alpha, MIP-1beta). An abundance of such markers and marker combinations for phenotypic and/or functional characterization of T-cells are known in the art and include, but are not limited to T-cell migration and/or adhesion markers, for example, ALCAM/CD166, B220/CD45R, CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CD2AP, CD2F-10/SLAMF9, CD31/PECAM-1, CD43, CD45, CD6, CD81, CD83, CRTH-2, CX3CR1, CXCR1/IL-8 RA, CXCR2/IL-8 RB, CXCR3, CXCR4, CXCR5, CXCR6, Cytohesin-1, DNAM-1, EMMPRIN/CD147, ICAM-1/CD54, ICAM-2/CD102, IGSF8, Integrin alpha 4 beta 1, Integrin alpha 4 beta 7/LPAM-1, Integrin alpha 4/CD49d, Integrin alpha E beta 7, Integrin alpha E/CD 103, Integrin alpha M/CD11b, Integrin alpha X beta 2, Integrin alpha X/CD11c, Integrin beta 2/CD 18, LAIR 1, Leukotriene B4 R1, L-Selectin/CD62L, NCAM-L1, Neprilysin/CD10, PSGL-1, RaplA/B, SIRP gamma/CD172g, Talin1, and TRA-1-85; regulatory T-cell (T reg) markers, for example, 4-1BB/TNFRSF9/CD137, 5′-Nucleotidase/CD73, B220/CD45R, B7-1/CD80, B7-2/CD86, CCR2, CCR4, CCR6, CCR7, CCR8, CD27/TNFRSF7, CD28, CD3, CD3 epsilon, CD30/TNFRSF8, CD38, CD39/ENTPD1, CD4, CD40 Ligand/TNFSF5, CD44, CD45, CD5, CD69, CD8, CD83, Common gamma Chain/IL-2 R gamma, CTLA-4, CXCR3, CXCR4, Fas/TNFRSF6/CD95, FoxP3, Galectin-1, GITR/TNFRSF18, Granzyme A, Granzyme B, HLA-DR, ICAM-1/CD54, IFN-gamma, IGSF2/CD101, IL-10, IL-12/IL-35 p35, IL-2, IL-2 R alpha, IL-2 R beta, IL-4, IL-7 R alpha/CD127, Integrin alpha E beta 7, Integrin alpha E/CD 103, Integrin alpha L/CD11a, Integrin beta 2/CD 18, LAG-3, L-Selectin/CD62L, Neuropilin-1/BDCA4, OX40 Ligand/TNFSF4, OX40/TNFRSF4, PD-1, PDCD6, PRAT4B, P-Selectin/CD62P, RANK/TNFRSF11A, Regulatory T Cells, SLAM/CD150, TGF-beta 1, TLR4, TLR4/MD-2 Complex, TLR7, TRANCE/TNFSF11/RANK L; and T-cell antigen recognition markers, for example, B220/CD45R, B7-1/CD80, B7-2/CD86, CD160, CD1c, CD1d1, CD28, CD3, CD3 epsilon, CD4+/45RA−, CD4+/45RO−, CD4+/CD62L−/CD44, CD4+/CD62L+/CD44, CD45, CD68/SR-D1, CD8, CD8+/45RA−, CD8+/45RO−, Dectin-1/CLEC7A, ILT2/CD85j, ILT3/CD85k, ILT4/CD85d, ILT5/CD85a, ILT6/CD85e, LAG-3, LAX1, Lck, PRAT4B, SIT1, T Cell Receptor alpha Chain-V alpha 24-J alpha Q, TLR1, TLR3, TLR4, TLR4/MD-2 Complex, TRIM, Common gamma Chain/IL-2 R gamma, GM-CSF, GM-CSF R alpha, gp130, IFN-gamma, IFN-gamma R1/CD119, IFN-gamma R2, IL-1 alpha/IL-1F1, IL-1 beta/IL-1F2, IL-1 R1, IL-10, IL-12, IL-12 p70, IL-12 R beta 1, IL-12 R beta 2, IL-12/IL-35 p35, IL-13, IL-13 R alpha 1, IL-17/IL-17A, IL-17A/F Heterodimer, IL-17F, IL-18 R alpha/IL-1 R5, IL-18 R beta/IL-1 R7, IL-18/IL-1F4, IL-2, IL-2 R alpha, IL-23, IL-23 R, IL-24, IL-3, IL-3 R alpha, IL-3 R beta, IL-32, IL-32 alpha, IL-32 gamma, IL-33, IL-4, IL-4 R alpha, IL-5, IL-5 R alpha/CD125, IL-6, IL-6 R alpha, IL-7 R alpha/CD127, NFATC1, NFATC3, Regulatory T Cells, T-bet/TBX21, TCCR/WSX-1, TGF-beta, TGF-beta RI/ALK-5, TGF-beta RII, TGF-beta RIIb, TGF-beta RIII, TNF R1/TNFRSF1A, TNF RII/TNFRSF1B, TNF-alpha/TNFSF1A, TNF-beta/TNFSF1B, TSLP R, and ZAP70.
For an exemplary publication disclosing the use of markers and marker profiles to determine T-cell phenotype and function, see Lee et al., Gene expression profiles during human CD4+ T cell differentiation. Int Immunol. 2004 August; 16(8):1109-24, incorporated herein by reference for disclosure of markers and marker combinations useful for phenotypic and functional T-cell characterization.
In some embodiments, the quantity of a T-cell subtype detected in a cell population is determined, for example, by flow cytometry, and quantitative measures of specific T-cell subtypes are compared to a reference or control level or sample, or to a different sample, for example, a sample from a different subject, or a sample from the same subject, but taken at a different time point. In some embodiments, the further characterization of T-cell populations, and/or of T-cells specifically binding an MHC class II molecule loaded with a peptide of interest are used to determine the reaction of the subject the cell sample is taken from to an administration of an immunostimulatory agent, for example, an immunostimulatory peptide. In some embodiments, a biological sample is obtained from a subject prior to administration of an immunostimulatory peptide to the subject and compared to a sample obtained from the subject after administration of such a peptide. In some embodiments, a biological sample is obtained from a subject diagnosed with or suspected of having a tumor and a T-cell subtype quantity determined in such a sample is compared to a quantity determined in or representative of an equivalent sample obtained from a subject not diagnosed with or suspected to have such a tumor.
In some embodiments, a detection and/or quantification method described herein or known in the art may be used to monitor the induction or enhancement of an immune response in a subject, for example effected by administration of an immunostimulatory NY-ESO-1 peptide or epitope. In some embodiments, an increase in the quantity, frequency, and/or proliferation rate of a certain cell type, for example, MHC-DRB3*0202 (MHC-DR52b) or DRB1*0101 (DR I) restricted CD4+ T cells able to bind a NY-ESO-1 epitope, as compared to a reference, control or baseline value, is indicative of induction or enhancement of an immune response, for example, effected by administration of an immunostimulatory NY-ESO-1 peptide.
As used herein, a “subject” may be a human, non-human primate, or other mammal, for example a cow, horse, pig, sheep, goat, dog, cat or rodent.
In some embodiments, the subject is diagnosed to have a tumor or a cancer. In some embodiments, the subject is diagnosed to have a tumor or a cancer expressing NY-ESO-1. In some embodiments, the subject is diagnosed to have, for example, a melanoma, a fibroadenoma, breast cancer, bladder cancer, a sarcoma, ovarian cancer, or a tumor or cancer of a different type. In some embodiments, the subject is diagnosed to carry a type of tumor or a type of cancer known to be associated with NY-ESO-1 expression in a malignant cell or cell type. Methods to diagnose a tumor in a subject are well known in the art. Methods to determine whether a tumor expresses NY-ESO-1 are also well known in the art. In some embodiments, NY-ESO-1 expression may be assessed directly, for example in cases where malignant cells are available from the subject, for example in cases where a tumor biopsy can be or has been obtained. Examples for methods useful for direct assaying NY-ESO-1 expression in malignant cells include, but are not limited to RT-PCR, northern blot, western blot, immunohistochemistry. In some embodiments, indirect assays, for example assays for determining whether a subject has an immune response to NY-ESO-1, may be employed to determine whether a tumor or a malignant cell or cell type expresses NY-ESO-1. Some methods for assaying an immune response to NY-ESO-1 are described herein.
Reference, control, or baseline values can be determined using methods well known to those in the art. For example, a reference, control, or baseline value may be a value from an actual measurement, for example a measurement in the same subject in the absence of or prior to administration of an immunostimulatory epitope of NY-ESO-1, a historical value, an average value obtained from a healthy, non-treated control group of subjects, an empirically determined value, or an arbitrary value.
In some embodiments, a diagnostic method is provided related to the detection of a NY-ESO-1 specific immune response, for example in response to a NY-ESO-1 expressing tumor, in a subject. In some embodiments, the method comprises detecting an immune response against NY-ESO-1 in a subject diagnosed, indicated, or suspected to have a tumor. In some embodiments, the method comprises obtaining a cell population, for example a peripheral blood cell population, from the subject and determining whether NY-ESO-1 specific, DRB3*0202 (DR52b) or DRB1*0101 (DR1) restricted CD4+ T-cells are present, wherein if such cells are present in the subject, the subject is indicated to have an immune response against NY-ESO-1. In some embodiments, the subject is a subject known to have a tumor, for example a melanoma, a fibroadenoma, breast cancer, bladder cancer, a sarcoma, ovarian cancer, or a tumor or cancer of a different type known to express NY-ESO-1, and, if an anti-NY-ESO-1 immune response is detected in the subject, the subject is indicated to have a tumor expressing NY-ESO-1.
The invention involves the use of various materials disclosed herein to induce or enhance an immune response in subjects. As used herein, “inducing or enhancing an immune response” means increasing or activating an immune response against an antigen. It does not require elimination or eradication of a condition but rather contemplates the clinically favorable enhancement of an immune response toward an antigen. Generally accepted animal models, can be used for testing of immunization approaches against cancer using a NY-ESO-1 molecule of the invention. For example, human cancer cells can be introduced into a mouse to create a tumor, and one or more NY-ESO-1 molecules of the invention can be delivered by the methods described herein. The effect on the cancer cells (e.g., reduction of tumor size) can be assessed as a measure of the effectiveness of the NY-ESO-1 molecule administration. Of course, testing of the foregoing animal model using more conventional methods for inducing an immune response include the administration of one or more NY-ESO-1 polypeptides or fragments derived therefrom, optionally combined with one or more adjuvants and/or cytokines to boost the immune response.
Methods for inducing an immune response, including formulation of an immunizing composition and selection of doses, route of administration and the schedule of administration (e.g. primary and one or more booster doses), are well known in the art. The tests also can be performed in humans, where the end point is to test for the presence of enhanced levels of circulating CTLs against cells bearing the antigen, to test for levels of circulating antibodies against the antigen, to test for the presence of cells expressing the antigen and so forth.
As part of the immune response-inducing or enhancing compositions of the invention, one or more substances that potentiate an immune response may be administered along with the peptides described herein. Such substances include adjuvants and cytokines. An adjuvant is a substance incorporated into or administered with antigen that potentiates the immune response. Adjuvants may enhance the immunological response by providing a reservoir of antigen (extracellularly or within macrophages), activating macrophages and stimulating specific sets of lymphocytes. Adjuvants of many kinds are well known in the art. Specific examples of adjuvants include Montanide, ISA51, CpG 7909 (9), immunostimulatory nucleic acid molecules, e.g. CpG oligonucleotides (see e.g. Kreig et al., Nature 374:546-9, 1995); monophosphoryl lipid A (MPL, SmithKline Beecham), a congener obtained after purification and acid hydrolysis of Salmonella minnesota Re 595 lipopolysaccharide; saponins including QS21 (SmithKline Beecham), described in PCT application WO96/33739 (SmithKline Beecham), ISCOM (CSL Ltd., Parkville, Victoria, Australia) derived from the bark of the Quillaia saponaria molina tree, QS-7, QS-17, QS-18, and QS-L1 (So et al., Mol. Cells. 7:178-186, 1997); incomplete Freund's adjuvant; complete Freund's adjuvant; alum; various water-in-oil emulsions prepared from biodegradable oils such as squalene and/or tocopherol; and factors that are taken up by the so-called ‘toll-like receptor 7’ on certain immune cells that are found in the outside part of the skin, such as imiquimod (3M, St. Paul, Minn.). Preferably, the antigens are administered mixed with a combination of DQS21/MPL. The ratio of DQS21 to MPL typically will be about 1:10 to 10:1, preferably about 1:5 to 5:1 and more preferably about 1:1. Typically for human administration, DQS21 and MPL will be present in a vaccine formulation in the range of about 1 μg to about 100 μg. Other adjuvants are known in the art and can be used in the invention (see, e.g. Goding, Monoclonal Antibodies: Principles and Practice, 2nd Ed., 1986). Methods for the preparation of mixtures or emulsions of polypeptide and adjuvant are well known to those of skill in the art of inducing and/or enhancing an immune response and the art of vaccination.
Other agents which may aid in inducing or enhancing an immune response of may also be administered to the subject. For example, other cytokines are also useful in vaccination protocols as a result of their lymphocyte regulatory properties. Many other cytokines useful for such purposes will be known to one of ordinary skill in the art, including interleukin-12 (IL-12) which has been shown to enhance the protective effects of vaccines (see, e.g., Science 268: 1432-1434, 1995), GM-CSF and IL-18. Thus cytokines can be administered in conjunction with antigens and adjuvants to increase the immune response to the antigens. There are a number of additional immune response potentiating compounds that can be used in vaccination protocols. These include costimulatory molecules provided in either protein or nucleic acid form. Such costimulatory molecules include the B7-1 and B7-2 (CD80 and CD86 respectively) molecules which are expressed on dendritic cells (DC) and interact with the CD28 molecule expressed on the T cell. This interaction provides costimulation (signal 2) to an antigen/MHC/TCR stimulated (signal 1) T cell, increasing T cell proliferation and effector function. B7 also interacts with CTLA4 (CD152) on T cells and studies involving CTLA4 and B7 ligands indicate that the B7-CTLA4 interaction can enhance antitumor immunity and CTL proliferation (Zheng et al., Proc. Nat'l Acad. Sci. USA 95:6284-6289, 1998).
B7 typically is not expressed on tumor cells so they are not efficient antigen presenting cells (APCs) for T cells. Induction of B7 expression would enable the tumor cells to stimulate more efficiently CTL proliferation and effector function. A combination of B7/IL-6/IL-12 costimulation has been shown to induce IFN-gamma and a Th1 cytokine profile in the T cell population leading to further enhanced T cell activity (Gajewski et al., J. Immunol. 154:5637-5648, 1995). Tumor cell transfection with B7 has been discussed in relation to in vitro CTL expansion for adoptive transfer immunotherapy by Wang et al. (J. Immunother. 19:1-8, 1996). Other delivery mechanisms for the B7 molecule would include nucleic acid (naked DNA) immunization (Kim et al., Nature Biotechnol. 15:7:641-646, 1997) and recombinant viruses such as adeno and pox (Wendtner et al., Gene Ther. 4:726-735, 1997). These systems are all amenable to the construction and use of expression cassettes for the coexpression of B7 with other molecules of choice such as the antigens or fragment(s) of antigens discussed herein (including polytopes) or cytokines. These delivery systems can be used for induction of the appropriate molecules in vitro and for in vivo vaccination situations. Anti-CD28 antibodies to directly stimulate T cells in vitro and in vivo could also be used. Similarly, the inducible co-stimulatory molecule ICOS which induces T cell responses to foreign antigen could be modulated, for example, by use of anti-ICOS antibodies (Hutloff et al., Nature 397:263-266, 1999).
Lymphocyte function associated antigen-3 (LFA-3) is expressed on APCs and some tumor cells and interacts with CD2 expressed on T cells. This interaction induces T cell IL-2 and IFN-gamma production and can thus complement but not substitute, the B7/CD28 costimulatory interaction (Parra et al., J. Immunol., 158:637-642, 1997; Fenton et al., J. Immunother., 21:95-108, 1998).
Lymphocyte function associated antigen-1 (LFA-1) is expressed on leukocytes and interacts with ICAM-1 expressed on APCs and some tumor cells. This interaction induces T cell IL-2 and IFN-gamma production and can thus complement but not substitute, the B7/CD28 costimulatory interaction (Fenton et al., 1998). LFA-1 is thus a further example of a costimulatory molecule that could be provided in a vaccination protocol in the various ways discussed above for B7.
Complete CTL activation and effector function requires Th cell help through the interaction between the Th cell CD40L (CD40 ligand) molecule and the CD40 molecule expressed by DCs (Ridge et al., Nature 393:474, 1998; Bennett et al., Nature 393:478, 1998; Schoenberger et al., Nature 393:480, 1998). This mechanism of this costimulatory signal is likely to involve upregulation of B7 and associated IL-6/IL-12 production by the DC (APC). The CD40-CD40L interaction thus complements the signal 1 (antigen/MHC-TCR) and signal 2 (B7-CD28) interactions.
The use of anti-CD40 antibodies to stimulate DC cells directly, would be expected to enhance a response to tumor associated antigens which are normally encountered outside of an inflammatory context or are presented by non-professional APCs (tumor cells). Other methods for inducing maturation of dendritic cells, e.g., by increasing CD40-CD40L interaction, or by contacting DCs with CpG-containing oligodeoxynucleotides or stimulatory sugar moieties from extracellular matrix, are known in the art. In these situations Th help and B7 costimulation signals are not provided. This mechanism might be used in the context of antigen pulsed DC based therapies or in situations where Th epitopes have not been defined within known tumor associated antigen precursors.
When administered, the therapeutic compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines and optionally other therapeutic agents.
In some embodiments, a composition containing the agents provided herein is provided. The composition may comprise any of the peptides, epitopes, optionally peptide-loaded MHC class II molecules, MHC class II monomers, multimers, and/or tetramers, ligands, binding molecules, and/or detectable labels provided herein. For example, a composition may comprise a diagnostic and/or therapeutic agent, for example an immunostimulatory NY-ESO-1 epitope, and/or a peptide-loaded MHC class II molecule, in an optional pharmaceutically acceptable carrier. In some embodiments, a method for forming a medicament that involves placing a therapeutically effective amount of a therapeutic agent in a pharmaceutically acceptable carrier to form one or more doses is provided. The effectiveness of a treatment or prevention method of the invention can be determined using standard diagnostic methods described herein.
Therapeutic compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines, and optionally other therapeutic agents.
As used herein, the term “pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. The term “physiologically acceptable” refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism. The characteristics of the carrier will depend on the route of administration. Examples of physiologically and pharmaceutically acceptable carriers include, without being limited to, diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials which are well known in the art. The term “carrier” denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
Therapeutics according to some embodiments of the invention can be administered by any conventional route, for example injection or gradual infusion over time. The administration may, for example, be oral, intravenous, intratumoral, intraperitoneal, intramuscular, intracavity, subcutaneous, or transdermal.
The compositions of some embodiments of the invention are administered in effective amounts. An “effective amount” is that amount of a composition that alone, or together with further doses, produces a desired response, for example, an increase in the number, frequency and/or proliferation rate of MHC-DRB3*0202 (MHC-DR52b) or DRB1*0101 (DR1) restricted CD4+ T cells able to bind a NY-ESO-1 epitope in a subject, for example a subject diagnosed with a tumor expressing NY-ESO-1, or a reduction in size or growth or inhibition of proliferation of a tumor or malignant cells, for example a tumor or malignant cells expressing NY-ESO-1, in a subject. In some cases of treating a particular disease or condition characterized by the presence of cells expressing NY-ESO-1, the desired response is inhibiting the progression of the disease. This may involve slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. In some cases, the desired response to treatment is a permanent effect, for example a return to a state comparable to those found in healthy individuals. In some cases, the desired response to treatment can be delaying or preventing the manifestation of clinical symptoms characteristic for the disease or condition.
The effect of treatment can be monitored by routine methods or can be monitored according to a diagnostic method of the invention discussed herein, for example a method using NY-ESO-1 peptide-loaded MHC class II multimers to detect and/or quantify MHC-DRB3*0202 (MHC-DR52b) or DRB1*0101 (DR1) restricted CD4+ T cells able to bind a NY-ESO-1 epitope in a subject.
The effective amount may depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
Pharmaceutical compositions according to some embodiments of this invention preferably are sterile and contain an effective amount of one or more therapeutic agents as described herein for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by determining any of the quantitative parameters described herein. Other parameters and suitable assays to determine the response will be evident to those of skill in the art.
The doses of one or more therapeutic agents as described herein (e.g., polypeptide, peptide-loaded MHC class II molecule, multimer, tetramer, etc.) administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
Administration of polypeptide compositions to mammals other than humans, e.g. for testing purposes or veterinary therapeutic purposes, is carried out under substantially the same conditions as described above.
The pharmaceutical compositions may contain suitable buffering agents, for example acetic acid in a salt, citric acid in a salt, boric acid in a salt, and/or phosphoric acid in a salt.
The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride, chlorobutanol, parabens and/or thimerosal.
The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy.
All methods may include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other examples of compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion. Examples of compositions for parenteral administration include, without being limited to, sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Examples of aqueous carriers are water, alcoholic/aqueous solutions, emulsions or suspensions, for example saline and buffered media. Examples of parenteral vehicles are sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, and lactated Ringer's or fixed oils. Examples for intravenous vehicles are fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases, and the like.
The pharmaceutical agents of some embodiments of the invention may be administered alone, in combination with each other, and/or in combination with other drug therapies and/or treatments. Examples of therapies and/or treatments may include, but are not limited to: surgical intervention, chemotherapy, radiotherapy, and adjuvant systemic therapies.
In some embodiments, the invention also provides one or more kits comprising one or more containers comprising one or more of the pharmaceutical compounds or agents of the invention. In some embodiments, a diagnostic kit is provided that includes an isolated immunostimulatory NY-ESO-1 peptide, and/or an isolated MHC class II multimer or tetramer, optionally loaded with a NY-ESO-1 peptide. In some embodiments, a kit is provided that further includes other reagents necessary or useful for performing a method described herein. Examples for such reagents are a detectable label, a labeling reagent, a detection reagent, and a buffering reagent. Diagnostic kits provided herein are, for example, useful for determining the presence and/or expression of a MHC DRB3*0202 or a DRB1*0101 allele and/or the presence of MHC DRB3*0202 (DR52b) or DRB1*0101 (DR1) restricted T cells in a subject. This information can be used as the basis for a clinical diagnosis, the selection of a clinical course of action, and/or for basic research purposes.
Additional materials may be included in any or all kits of the invention, and such materials may include, but are not limited to, for example, buffers, water, enzymes, tubes, control molecules, etc. One or more kits may also include instructions for the use of the one or more pharmaceutical compounds or agents of the invention, for example for the treatment of a tumor or a cancer, or the diagnostic methods described herein.
While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all methods, reagents, and configurations described herein are meant to be exemplary and that the actual methods, reagents, and configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the embodiments described herein are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, reagent, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, reagents, kits, and/or methods are not mutually inconsistent, is included within the scope of the present invention.
All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
The indefinite articles “a” and “an”, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without A (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of”, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently, “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one act, the order of the acts of the method is not necessarily limited to the order in which the acts of the method are recited.
Patients Samples, Cells and Tissue Culture.
Peripheral blood samples were collected from cancer patients enrolled in a clinical trial of vaccination with recombinant ESO protein, Montanide ISA51 and CpG 7909 (9) upon informed consent and approval by the Institutional Review Boards of Columbia University and New York University medical centers. Study patients received 4 subcutaneous injections of rESO/Montanide/CpG vaccine at 3-week intervals. Patients enrolled had histological diagnosis of cancer types known to express ESO. Of the 18 patients enrolled in the clinical trial, 11 were diagnosed with melanoma, 3 with breast cancer, 3 with sarcoma and 1 with ovarian cancer. At study entry 1 sarcoma patient had a lung metastasis and all other patients had no evidence of disease. With the exception of 1 melanoma patient, none of the patients had detectable ESO-specific immune responses prior to vaccination, but they all developed specific antibody and CD4+ T cell responses following vaccination, as reported previously (9). Peripheral blood samples from healthy donors were obtained from the Etablissement Francais du Sang Pays de la Loire (Nantes, France). MHC class II alleles were determined by high resolution molecular typing. Melanoma cell lines were kindly provided by Dr. D. Rimoldi (Ludwig Institute for Cancer Research, Lausanne, Switzerland) and Prof. F. Jotereau (INSERM U892, Nantes, France). Monocyte-derived dendritic cells (moDC) were generated from enriched CD14+ cells, isolated from PBMC using magnetic sorting (Miltenyi Biotech Inc., Bergisch Gladbach, Germany), by culture in the presence of 1000 U/ml rhGM-CSF and 1000 U/ml rhIL-4 (R&D Systems, Minneapolis, Minn.) for 5 days.
Assessment of ESO-Specific CD4+ T Cell Responses and Generation of Specific Clones.
For ex-vivo assessment, cryopreserved total PBMC were thawed, rested overnight, and stimulated for 7 hours in the absence or presence of a pool of 20 to 24 amino acid long overlapping peptides (NeoMPS Inc., San Diego, Calif.) spanning the full length ESO sequence. Brefeldin A was added 2 hours after the beginning of the incubation. Cells were then stained with antibodies directed against surface markers (CD3, CD4 and CD8 (BD Biosciences, San Josa, Calif.)), fixed, permeabilized and stained with anti-IFN-γ, —IL-4, IL-10 (BD Biosciences) or -IL17 mAb (eBiosciences, San Diego, Calif.), as previously described (9). For assessment of CD4+ T cell responses following in vitro stimulation, CD4+ cells were enriched from PBMC by magnetic cell sorting (Miltenyi Biotec Inc.) and stimulated with irradiated autologous APC in the presence of the NY-ESO-1 peptide pool or the indicated NY-ESO-1 peptides (2 μM each, NeoMPS Inc.), rhIL-2 (10 IU/ml) and rhIL-7 (10 ng/ml). At day 8 cultures were tested for intracellular IFN-γ secretion following stimulation, during 4 hours, in the absence or presence of the ESO peptide pool or of individual peptides. Where indicated, CD4+ T cell cultures were pre-incubated during 1 h with anti-HLA-DRw52 mAb (clone 7.3.19.1, Monosan, Uden, The Netherlands) prior to peptide stimulation. ESO119-143-specific CD4+ T cells were isolated, following 4 h stimulation, using the IFN-γ secretion assay—cell detection kit (Miltenyi Biotech Inc.) and flow cytometry cell sorting and cloned by limiting dilution cultures in the presence of phytohemagglutinin, allogeneic irradiated PBMC and rhIL-2 (100 U/ml). Clones were subsequently expanded by periodic stimulation (every 3-4 weeks) under the same conditions.
Antigen Recognition Assays and TCR BV Analysis.
CD4+ T cell clones were stimulated in the absence or presence of peptides, at the indicated concentration, and IFN-γ production was assessed either in a 4 h intracellular cytokine staining assay as described above or by measurement of IFN-γ in 24 h culture supernatant by ELISA as previously described (7). Where indicated, EBV-B cell lines or PBMC from healthy donors were pre-incubated in the absence or presence of peptide ESO119-143, washed and used to stimulate CD4+ T cell clones. Blocking experiments were performed by pre-incubating CD4+ T cells with anti-HLA-DR (clone G46-6, BD Biosciences), —HLA-DP (clone B7/21, Abcam, Cambridge, United Kingdom), -DQ (clone SPVL3, Immunotech, Marseille, France) or -DRw52 mAb, prior to peptide stimulation. For assessment of reactivity to naturally processed full-length ESO, tumor cell lines or moDC were either incubated during 16 h with recombinant ESO or Melan-A proteins or transfected by electroporation with ESO-encoding pcDNA3.1 vector (Amaxa Inc., Walkersville, Md.) and used to stimulate CD4+ T cell clones. TCR variable β chain (BV) usage was determined by flow cytometry using anti-BV mAb (Immunotech) and by molecular analysis as described previously (10) using a panel of previously validated primers (11) and nomenclature according to Arden B. et al. (12).
Isolation of ESO119-143-Specific Vaccine-Induced TH1 Clones.
Following vaccination with rESO, all patients developed a specific CD4+ T cell response (9). For patient C2, vaccine-induced IFN-γ-producing CD4+ T cells were detected in post-immune but not in pre-immune PBMC in response to stimulation with a pool of overlapping peptides covering ESO (
Peptide ESO119-143 is Recognized by Vaccine-Induced CD4+ T Cells in the Context of HLA-DR52b.
To determine the HLA-restriction of vaccine-induced ESO119-143-specific clones from patient C2, we first assessed inhibition of antigen recognition using blocking mAb against HLA-DR, -DP and -DQ. For all clones, antigen recognition was inhibited in the presence of anti-DR but not of anti-DP and -DQ mAb (
ESO123-137 is the Minimal Optimal Peptide Recognized by DR52b-Restricted CD4+ T Cell Clones.
To define the DR52b epitope within the ESO119-143 region, we used the MHC class II peptide prediction algorithm RankPep (imed.med.ucm.es/Tools/rankpep.html) to identify ESO sequences with significant predicted binding capacity to DRB3*0202. Only two 9-mer core sequences were identified (Table 3). In particular, peptide ESO127-135 was predicted to bind DR52b with an affinity only 3 folds inferior to that of the consensus sequence. Based on the identification of ESO127-135 as the putative core region, we designed truncated peptides by sequential removal of amino acids at either the N- or C-terminus of the original 24-mer and assessed their relative recognition efficiency by peptide titration (
DR52b-Restricted CD4+ T Cell Clones Recognize Natural ESO Antigen Exogenously Processed by APC.
To assess the recognition of natural ESO antigen by DR52b-restricted CD4+ T cells, we tested their ability to recognize rESO processed by professional APC (DR52b+ monocyte-derived dendritic cells, moDC (
ESO119-143-Specific DR52b-Restricted CD4+ T Cell Responses are Immunodominant Following Vaccination with ESO Protein.
To evaluate the prevalence of ESO-specific DR52b-restricted CD4+ T cell responses in patients vaccinated with rESO, we isolated CD4+ T cells from post-immune samples of 15 patients and stimulated them during 10 days with the pool of ESO peptides. We then assessed the presence of specific CD4+ T cells by intracellular IFN-γ staining after stimulation with peptide ESO119-143. To determine the proportion of DR52-restricted CD4+ T cells in the cultures, we performed the assay in the absence or presence of anti-DR52 specific antibody. Six of the analyzed patients expressed DR52b and 9 were negative. Significant proportions of CD4+ T cells specifically producing IFN-γ in response to ESO119-143 were detected in post-vaccine samples from all patients (
Conserved TCR Usage of ESO119-143-Specific DR52b-Restricted CD4+ T Cell Clones.
T cell clones recognizing defined MHC/peptide complexes can display conserved structural features. To assess TCR usage of clones recognizing peptide ESO119-143 in the context of DR52b, we derived a panel of ESO119-143-specific clones from vaccinated patients expressing DR52b. We obtained 62 clones from 4 different patients (50 clones from patient C2, 8 from patients N13, 3 from C5 and 1 from patient N10). Of those, 33 (53%) were DR52b-restricted, as determined by using molecularly typed APC (data not shown). Because the CD4+ T cell clones initially obtained from patient C2 used BV2, we assessed BV2 expression by all other clones using specific mAb. This analysis revealed that over 70% of the DR52b-restricted clones (including clones from 3 patients) expressed BV2. To further assess the structural features of DR52b-restricted TCR, we sequenced the TCR β chains of the BV2-expressing clones. We identified 13 distinct clonotypes (Table 4), 5 of which used the same BJ (2.1) whereas the remaining 8 used 6 other BJ. In addition, the 13 distinct CDR3 regions were variable both in terms of length (10-13 amino acids) and amino acid composition. Some conservation was nevertheless noticeable, such as the presence of A at position 1 of the CDR3 of 11 of the 13 clonotypes and R at position 2 for 7 of them.
DNA Constructs for DR52b Beta Chain and DR Alpha Chain.
All constructs were prepared on the basis of the pMT\BiP\V5-His A vector (Invitrogen). The extracellular parts of MHC class II chains were cloned between the BglII and EcoRI sites, joined by the acidic/basic leucine zipper between EcoRI and EcoRV sites. The stop codon preceded the EcoRV site. The DR alpha chain carries the acidic zipper and the beta chain the basic, followed by an Avi-Tag (also called BSP sequence) (Avidity). A flexible glycine-serine linkers (e.g. G-[SG]2) were used to connect the MHC class II extracellular part to the leucine zippers and the basic leucine zipper to the Avi-Tag.
The extracellular part of DR52b beta was amplified from cDNA prepared from DR52b+ EBVB cells using the following primers: DR4beta forward BglII: CTTTAGATCTCGACCACGTTTCTTGGAGC (SEQ ID NO: 74); DR4beta reverse EcoRI: CTTTGAATTCCTTGCTCTGTGCAGATTCAG (SEQ ID NO: 75).
DR alpha was amplified from a plasmid containing the cloned full length chain in pCR3 plasmid (Roetzschke/Falk lab) using following primers: DR alpha forward BglII: CTTTAGATCTatcaaagaagaacatgtgATC (SEQ ID NO: 76); DR alpha reverse EcoRI: CTTCGAATTCGTTCTCTGTAGTCTCTGGG (SEQ ID NO: 77).
The DNA and protein sequences of the complete constructs are as follows:
Expression of Soluble Recombinant DR52b Monomers.
A million D.Mel-2 cells in 500 μl of Sf900 II SFM medium in 24-well plates were transfected with 2 μg of pMT chain DNA (1 μg each chain) and 0.2 μg pBS-PURO (Karjalainen lab) mixed with 20 μl of Cellfectin (Invitrogen) in 200 μl of Sf900 II SFM (Invitrogen). After 48 hours, puromycin was added (10 μg/ml) and cultured for 2-3 weeks to produce a stably transfected cell line.
Cells were expanded in 850 cm2 (Falcon) roller bottles at ambient temperature using Sf900 II SFM medium up 5-10×106 cells/ml. Protein secretion was induced with 1 mM CuSO4 (Sigma) for 5 days. The supernatants were harvested, filtered through 0.22 micron filters, supplemented with 0.05% sodium azide and 0.1% iodoacetamide.
Affinity Purification.
Empty DR52b molecules were purified by affinity chromatography on a L243 Sepharose column (L243 mouse anti-pan HLA-DR IgG2a monoclonal antibody) using for elution 50 mM glycine pH 11.5 and immediate neutralization with 2 M Tris-HCl pH 6.9. After exchange in PBS (pH 7.4), isolated DR52b was concentrated to 1-2 mg/ml.
Peptide Loading.
Peptide loading was performed in PBS, pH 7.4 or 50 mM sodium citrate, 100 mM sodium chloride, pH 5.2, depending on the peptide's solubility and features. Empty DR52b (0.1 mg/me and a peptide of interest were incubated with N-octyl-glucoside (0.2% final), EDTA (5 mM) and complete protease inhibitor tablets (Roche) according to manufacturer (1 tablet to 10.5 ml). Peptide loading was performed at 0.37° C. for at least 24 hours.
After loading, the solution containing the complexes was concentrated to 6-7 ml and buffer exchanged in BirA buffer (50 mM bicine pH 8.3, 10 mM MgOAc) and biotinylated with the BirA enzyme (Avidity) overnight at room temperature with agitation according to manufacturers' instructions.
The biotinylated complexes were exchanged into PBS (pH 7.4), concentrated to about 0.5 ml and subjected to gel filtration chromatography using a Superdex 5200 column. Fractions containing the monomer were pooled, concentrated to 1-2 mg/ml and flash frozen in liquid nitrogen (aliquots of 25-50 μg Aliquots are stored at −80° C. until use.
Biotinylation was measured by densitometry of SDS-PAGE-based avidin shift assay. Tetramer were prepared by calculating the amount of streptavidin-phycoerythrin (SA-PE) (Caltag) that has to be added to biotinylated monomers in molar ratio 1:4. The volume of SA-PE was divided in 10 aliquots and added in 5 min intervals on ice accompanied under vigorous mixing. The final concentration of the reagents was calculated as follows: (mass of biotinylated monomers+mass of SA-PE)/sum of monomer and SA-PE volumes.
Here, we have reported the identification of an ESO-derived DR52b-restricted epitope recognized by CD4+ T cells induced by vaccination with a rESO vaccine administered with the immunological adjuvants Montanide ISA-51 and CpG ODN 7909, a formulation that predominantly elicits TH1 responses. Previous studies from us and others have identified ESO119-143 as an immunodominant region, recognized by CD4+ T cells from virtually all patients with spontaneous or vaccine-induced immunity to ESO (3, 5-7, 9, 15). Several overlapping epitopes contained within the ESO119-143 region and restricted by multiple HLA-DR alleles have been identified (3, 4) (summarized in Cancer Immunity Peptide Database: www.cancerimmunity.org). Surprisingly, the DR52b-restricted epitope identified in this study has not been reported thus far. Our group, however, has previously reported the identification of two other DR52b-restricted epitopes from the tumor antigens SSX-4 and Melan-A (16, 17).
At variance with the β chain of the mouse I-E molecule (homolog to human HLA-DR), encoded by a single gene, the β chain of human HLA-DR is encoded by multiple genes. In addition to the DRB1 gene, encoding the prevalent chain of the DR isotype, additional genes code for other β chains, namely DRB3 (DR52), DRB4 (DR53) and DRB5 (DR51). They are less polymorphic than DRB1 and generally expressed at lower levels, but code for DR molecules that are fully functional with respect to antigen presentation (18, 19). These genes have strong linkage disequilibrium with defined DRB1 alleles. In particular, DR52 is very frequently expressed in the population, as DRB3 alleles are associated through linkage disequilibrium to some of the most common DRB1 alleles (20). Lower expression and linkage disequilibrium with DRB1 alleles may account for the fact that T cell epitopes restricted by these alternate DR molecules have been described less frequently than those restricted by DRB1 encoded molecules, or have been reported as restricted by the associated DRB1 allele.
In general, alternate DR molecules have been less well investigated as compared to those encoded by DRB1. However, expression of several DRB3-encoded molecules has been recently reported to associate with different autoimmune diseases, which has resulted in an increased interest in investigating their structure and peptide binding specificity. Expression of DRB3*0202 (DR52b), one of the main DRB3 alleles, has been associated with Grave's disease, multiple sclerosis and essential hypertension caused by infection with Chlamydia pneumoniae (21-23).
Using truncated overlapping peptides, we defined the minimal optimal sequence recognized by ESO DR52b-restricted CD4+ T cells as the 15-mer 123-137. Within this sequence, a screening of the entire ESO sequence, using the MHC class II peptide binding prediction algorithm RankPep (imed.med.ucm.es/Tools/rankpep.html), identified a sequence with high predicted binding capacity to DR52b, corresponding to peptide 127-135 (TVSGNILTI), SEQ ID NO: 59. Although the crystal structure of DR52b has not been yet resolved, some structural consideration on the potential contribution of single amino acids in the identified peptide to binding can be drawn based on previous analyses of natural peptides isolated from DR52 molecules and on the recently reported structure of the highly homologous DR52c molecule bound to a self-peptide derived from the Tu elongation factor (24, 25). The most salient feature of the identified peptide is the amino acid N located in the central part of the sequence. Together with DR52c, and at variance with most other DR molecules, DR52b has a Q at position P74, that together with other residues in the P4 pocket, limit the amino acids binding at this position to N or D, whereas the P1 and P6 pockets are expected to be rather permissive and can accommodate many different residues.
DR52b is expressed by about half of Caucasians, which is similar to the frequency of expression of the most investigated human MHC class I molecule: HLA-A*0201. The frequent expression of HLA-A*0201 has allowed extensive analysis, including assessment of ex-vivo frequency and phenotype of tumor antigen-specific HLA-A*0201-restricted CTL (including Melan-A and ESO-specific) using HLA-A*0201/peptide fluorescent tetramers (2, 26, 27). The identification of the ESO DR52b-restricted epitope may allow the development of a similar approach using MHC class II/peptide tetramers to assess CD4+ T cell responses to ESO. This is particularly relevant taking into account the immunodominant character of ESO-specific DR52b-restricted CD4+ T cell responses, following vaccination. Indeed, by assessing the quantitative contribution of DR52b-restricted responses to the overall response to the immunodominant 119-143 region, following vaccination, we demonstrate that, although variable among different individuals, these represented in average about 50% of total specific CD4+ T cells. The prevalence of DR52b-restricted CD4+ T cells in patients with spontaneous responses to ESO, however, might be different and remains to be determined.
ESO-specific DR52b-restricted CD4+ T cell clones isolated in this study efficiently recognized the natural exogenous ESO antigen after processing and presentation by APC but failed to recognize endogenously expressed ESO. We have previously obtained similar results with CD4+ T cell clones specific for another CTA, SSX-4 (16) whereas we have observed recognition of both exogenous and endogenously expressed antigen using Melan-A specific CD4+ T cells (17). The ability of CD4+ T cells to recognize endogenously expressed tumor antigens may be epitope dependent (28, 29) and can significantly vary for different tumor antigens, depending on their intracellular localization. At variance with CTAs, melanocyte differentiation antigens such as Melan-A have a natural access to the endogenous MHC class II processing and presentation pathway, as they are localized in melanosomes, or, in their absence, in lysosomes (30). Generation of ESO-specific CD4+ T cells prevalently recognizing exogenously processed antigen is expected following vaccination with recombinant ESO protein. However, as direct recognition of tumor cells is most likely not the dominant mechanism through which tumor antigen-specific CD4+ T cells contribute to tumor rejection (31-33), lack of recognition of endogenous ESO antigen by CD4+ T cells does not necessarily imply a decreased importance of this epitope in the effector phase of anti-tumor immune response to ESO expressing tumors. To assess this point, it would be of interest to assess the presence of specific DR52b-restricted CD4+ T cells among tumor infiltrating lymphocytes from patients with spontaneous immunity to ESO.
By assessing the TCR of ESO119-143-specific DR52b-restricted CD4+ T clones from different individuals, we could demonstrate conserved TCR usage, with frequent usage of BV2 often in association with BJ 2.1. The CDR3 region of the different clonotypes identified, however, was variable, both in terms of length and amino acid composition, which could indicate a certain degree of heterogeneity in the fine specificity and/or avidity of antigen recognition among different clones. We have previously reported conserved but distinct TCR usage for ESO-specific HLA-A*0201-restricted CTL that occur naturally or are induced through peptide vaccination (34), which was associated with their ability to recognize or not the naturally processed antigen. This is, however, in our knowledge, the first study assessing TCR usage by ESO-specific CD4+ T cells. It will therefore be of interest to compare the TCR usage of ESO119-143-specific DR52b-restricted CD4+ T cells elicited by vaccination with that of CD4+ T cells naturally occurring in patients with spontaneous immunity to ESO. Interestingly, Kudela P. et al. have recently reported the existence of promiscuous clonal CD4+ T cells able to recognize peptide ESO119-143 in the context of several distinct MHC class II molecules (35). Although the CD4+ T cell clones isolated in the present study did not display promiscuous antigen recognition (data not shown), it will be clearly of great interest, in future studies, to compare their TCR usage to those of monogamous or promiscuous CD4+ T clones recognizing other epitopes in the 119-143 region.
The entire contents of all of the references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference for the purposes or subject matter referenced herein.
Generation of HLA-DR52b/ESO Peptide Tetramers.
The extracellular domain of the DR52b beta chain was amplified from total cDNA (Qiagen AG) obtained from the DR52b+ EBV-immortalized B cell line EBV-B14 using ctttagatctcgaccacgtttcttggagc (SEQ ID NO: 83) as the 5′ primer and ctttgaattccttgctctgtgeagattcag (SEQ ID NO: 84) as the 3′ primer and cloned in the pMT A vector (Invitrogen AG)-derived cassette containing sequences coding for a C-terminal basic leucine zipper followed by an AviTag (Avidity) as previously described (32). D. mel-2 cells (Invitrogen) were transfected with constructs encoding the DR alpha and DR52b beta chains together with the pBS-PURO (gift from Dr. K. Karjalainen, Nanyang Technological University, School of Biological Sciences, Singapore) in a 10:1 ratio with Cellfectin (Invitrogen). After selection in Sf900 II SFM medium (Invitrogen) containing 10 μg/ml puromycin (Sigma Aldrich), cells were cloned by limiting dilution and clones with the highest expression of soluble DR52b protein were used for large scale production in roller bottles. Protein expression was induced by addition of 1 mM CuSO4 for 3 to 5 days and soluble DR52b was purified from supernatants with anti-DR (clone L243) affinity chromatography. Yields of >2 mg/L were routinely obtained. The DR52b eluate was immediately brought to optimal peptide loading pH of 6.0 with 100 mM citric acid, loaded at a peptide to protein molar ratio of 50:1, at 28° C. for 24 hrs in the presence of protease inhibitor cocktail (Roche) and 0.2% octyl 13-D-glucopyranoside (Sigma) and then biotinylated using the BirA enzyme (Avidity). When DR52b molecules were loaded with untagged ESO peptides, pMHC complexes were directly purified by gel filtration in PBS pH 7.4, 100 mM NaCl on a Superdex S200 column (GE Healthcare Life Sciences) and the fractions corresponding to the monomeric pMHC complexes were pooled and concentrated. Alternatively, ESO peptides were extended at the N-terminus by a sequence containing 6 His residues and a linker (Ser-Gly-Ser-Gly). DR52b/His-tag-ESO peptide complexes were purified using the H isTrap HP 1 ml column (GE Healthcare Life Sciences) prior to purification by gel filtration (
Patients Samples, Cells, Tissue Culture, Tetramer Staining and Flow Cytometry Analysis and Sorting.
Peripheral blood samples were collected from cancer patients enrolled in a clinical trial of vaccination with recombinant ESO protein, Montanide ISA 51 and CpG 7909 (8) upon informed consent and approval by the Institutional Review Boards. Peripheral blood samples from healthy donors were obtained from the Etablissement Francais du Sang Pays de la Loire (Nantes, France). MHC class II alleles were determined by high resolution molecular typing (9). ESO119-143-specific DR52b-restricted CD4+ T cell clonal populations were obtained from post-vaccine samples as previously described (9). For assessment of specific CD4+ T cell responses following in vitro stimulation, CD4+ cells were enriched from PBMC by magnetic cell sorting (Miltenyi Biotec Inc.), stimulated with irradiated autologous APC in the presence of a pool of overlapping long peptides spanning the ESO sequence, rhIL-2 and rhIL-7 as previously described (9) and maintained in culture during 10-15 days prior to tetramer staining. Peptide stimulated cultures and clonal populations were incubated with tetramers at a final concentration of 3 μg/ml for 1 hr at 37° C., unless otherwise indicated, in complete IMDM medium, washed and then stained with CD4 (BD Biosciences) or TCR Vβ (Beckman Coulter) specific mAb in PBS, 5% FCS for 15 minutes at 4° C. and analyzed by flow cytometry (FACSAria, BD Biosciences). In order to generate specific polyclonal T cell populations, tetramer+ cells within peptide-stimulated cultures were sorted by flow cytometry (FACSAria, BD Biosciences) and expanded by stimulation with PHA and irradiated allogeneic PBMC in the presence of rhIL-2 (33). For ex vivo enumeration and phenotyping of specific cells, CD4+ cells enriched from PBMC were rested overnight, incubated with tetramers (3 μg/ml) for 2 hours at 37° C. and then stained with CD45RA, CCR7, CD25, CD27, CD28 and CD127 specific mAb, as indicated, and analyzed by flow cytometry.
Antigen Recognition Assays.
DR52b+ ESO-specific CD4+ T cell clones or polyclonal cultures were stimulated in the absence or presence of ESO peptides (2 μM) or PMA (100 ng/ml) and ionomycin (1 μg/ml), as indicated, and cytokine production was assessed in a standard 4 hrs intracellular cytokine staining assay using mAb specific for IFN-γ, TNF-α, IL-2, IL-4, IL-10 (BD Biosciences) and IL-17 (eBiosciences), as previously described (9, 34). In other experiments, specific polyclonal cultures were incubated for 24 hrs with either DR52b+ EBV-B cells and serial dilutions of ESO peptides or monocyte derived dendritic cells pre-incubated overnight with serial dilutions of rESO, and IFN-γ was measured by ELISA (Invitrogen) in 24 hrs culture supernatants, as previously described (8, 9).
Generation of Molecularly Defined MHC Class II Tetramers Using His-tag-Peptides and their Validation.
We initially attempted to generate DR52b tetramers incorporating peptide ESO123-137 using a strategy previously described by Kwok et al. (10). The tetramers synthesized according to this procedure, however, failed to significantly stain ESO-specific DR52b-restricted CD4+ T cell clones (
To assess the capacity of the tetramers to identify specific CD4+ T cells within polyclonal populations, we stained peptide-stimulated cultures from DR52b+ and DR52b cancer patients immunized with the rESO vaccine (8). After 1 hr incubation at 37° C., DR52b/ESO tetramers stained a significant proportion of CD4+ T cells in the cultures from DR52b+ but not from DR52b− patients (
Whereas peptide ESO123-137 was the minimal peptide optimally recognized by clonal CD4+ T cells, the ESO peptide originally used to identify the DR52b-restricted epitope was significantly longer, corresponding to the 25mer ESO119-143 (9). We therefore synthesized DR52b/ESO119-143 tetramers and assessed them on specific and control clonal populations. Similar to ESO123-137 tetramers, tetramers prepared with untagged ESCO119-143 failed to stain ESO-specific clones (not shown). In contrast, DR52b/ESO119-143 tetramers prepared using a His-tag ESO119-143 peptide and purified monomeric complexes stained specific clonal populations with a slightly increased efficiency as compared to DR52b/ESO123-137 tetramers and displayed similar low background on control clones (
Because our new approach involves the addition of a His-tag to the ESO peptides, it was important to address the effect of this modification on peptide binding to class II molecules and recognition by specific CD4+ T cells. With this aim we assessed the relative efficiency of untagged and His-tagged ESO peptides to bind to DR52b using a previously described competition assay (13). As shown in
Molecularly Defined DR52b/ESO Tetramers Allow Direct Ex Vivo Enumeration and Phenotyping of CD4+ T Cells Induced by the rESO Vaccine.
The high efficiency and specificity of staining obtained with the molecularly defined DR52b/ESO tetramers prompted us to assess their capacity to detect vaccine-induced CD4+ T cells ex vivo. With this aim, we isolated CD4+ T cells from PBMC of DR52b+ healthy donors and patients using magnetic cell sorting; and stained them with the tetramers during 2 hrs at 37° C. in combination with CD45RA-specific antibodies. As shown in
MHC Class II Tetramer-Guided Isolation and Functional Characterization of ESO-Specific CD4+ T Cells.
To assess vaccine-induced CD4+ T cells functionally, we isolated them by tetramer-guided flow cytometry cell sorting and expanded them in vitro (
We have previously reported that more than 50% of ESO-specific DR52b-restricted CD4+ T cell clones isolated from vaccinated patients use Vβ2, suggesting a highly restricted TCR repertoire for T cells recognizing this epitope (9). To directly assess Vβ2 usage by tetramer+ cells, we co-stained the cultures with tetramers and anti-Vβ2 specific antibodies. To minimize inhibition of tetramer binding by anti-Vβ antibodies, we first incubated the cultures with tetramers during 1 hr at 37° C., washed them, and then incubated them with anti-Vβ2 antibodies. Under these conditions, we detected a proportion of tetramer+ Vβ2+ T cells in the cultures comprised between 25-65% (
Because of the popularity of MHC class I/peptide tetramers, originally described in 1996 and used since in thousands of studies, attempts to generate efficient MHC class II/peptide tetramers have been pursued during the last decade, yet have met only modest success. Fundamental structural differences between MHC class I and class II molecules have required significantly different approaches for their design. For class I molecules, refolding of the single heavy chain in the presence of peptides and β2-microglobulin yields folded stable monomeric complexes (19). Class II molecules, however, are noncovalent dimers of cc and p chains that display variable stability in solution (20). To reliably generate stable class II molecules in soluble form, the group of Kwok has constructed class II molecules incorporating leucine zipper motifs that replace the transmembrane and cytoplasmic portions of the molecules (10, 21). The advantage of this approach, with respect to others involving the synthesis of covalent single chain class II/peptide molecules (22), is that empty class II molecules can be loaded with any selected peptide, increasing tremendously the number of epitopes that can be studied. The disadvantage, however, is that, as the α and β chains complex is formed irrespective of the antigenic peptide, the proportion of folded class II/peptide complexes in the preparation can be highly variable for different peptides. Thus, whereas this approach has been successfully used in some cases, it has not been generally applicable for the study of a large variety of antigenic peptides, particularly those derived from tumor and self-antigens, that often bind class II molecules with lower affinity than those derived from pathogens (2-5).
Another problem in generating class II tetramers for generic use is the extensive polymorphism in humans, particularly in the case of the DRB1 gene encoding the prevalent β chain of the DR isotype. At variance with the β chain of the mouse I-E molecule (homolog to HLA-DR) that is encoded by a single gene, in humans several additional genes encode other β chains, namely DRB3 (DR52), DRB4 (DR53) and DRB5 (DR51). Whereas DRB1 is present in all individuals, DRB3, DRB4 and DRB5 are only present in part of them, and are in strong linkage disequilibrium with defined DRB1 alleles. These alternate DR molecules are generally expressed at lower levels as compared to those encoded by DRB1, but are fully functional with respect to antigen presentation (13, 23, 24). They are less polymorphic than DRB1-encoded molecules and represent therefore ideal candidates for the generation of generic class II tetramers (25). In particular DR52b, encoded by one of the main DRB3 alleles, is expressed by half of Caucasians. In the last years, an increasing number of studies have concentrated on alternate DR molecules, describing their structure and binding characteristics and peptide binding motifs have been defined for several of them (13, 26).
Because of the failure of our initial attempts to generate efficient DR52b/ESO tetramers by peptide loading of DR52b molecules incorporating leucine zipper motifs as previously described by Kwok et al. (10, 21), we designed a new strategy that uses His-tagged peptides, enabling the isolation of folded class II/peptide monomers by affinity purification prior to tetramer formation. Together, the data reported in this study clearly show that molecularly defined DR52b/ESO tetramers are reliable reagents for the detection, characterization and isolation of ESO-specific CD4+ T cells. We obtained efficient staining of clonal and polyclonal ESO-specific DR52b-restricted CD4+ T cell populations using concentrations of molecularly defined class II tetramers similar to those generally used for class I/peptide tetramers (1-10 μg/ml) (11, 12). Consistent with other reports (27, 28), and at variance with most class I/peptide tetramers that efficiently stain specific CD8+ T cells at 4° C. or at 23° C., efficient staining with class II tetramers was optimally achieved upon incubation at 37° C. The molecular basis for this difference, that might be in relation with a lower functional avidity of CD4+ T cells and/or with a higher need for TCR clustering, remains to be fully elucidated. Importantly, we obtained efficient staining not only using tetramers incorporating the previously defined minimal peptide required for optimal T cell recognition (15 amino acids long, ESO123-137), but also using a His-tagged 25 amino acid long peptide, ESO119-143, extended at both the N- and C-terminal ends of the core region. This indicates that there are no major limitations in the length of peptides that can be incorporated into DR52b molecules and implies that the use of molecularly defined DR52b tetramers incorporating long peptides from defined protein regions, possibly pre-selected on the basis of the presence of binding motifs or through functional binding assays, may be an efficient strategy allowing the rapid identification of immunodominant DR52b epitopes from a large number of antigens.
For example, in some embodiments, a set of overlapping peptides covering the entire sequence, or a specific fragment, of a protein antigen of interest are generated. In some embodiments, the peptides are tagged, for example, with a His-tag. In some embodiments, the peptides each comprise a sequence of about 20 to about 40 contiguous amino acids of the antigen. In some embodiments, the peptides each comprise a sequence of about 25 to about 30 contiguous amino acids. In some embodiments, MHC class II molecules, for example, DR52b molecules, are loaded with such peptides, for example, by contacting a MHC class II molecule with a specific tagged peptide for peptide loading in order to avoid competition for binding between the different peptides. In some embodiments, peptide-loaded MHC class II monomers are generated in this manner. In some embodiments, peptide-loaded MHC class II monomers are further assembled into peptide-loaded MHC class II multimers, for example, tetramers. Accordingly, in some embodiments, a set of peptide-loaded MHC class II monomers and/or multimers, for example, tetramers, is generated for a protein antigen of interest comprising monomers or multimers loaded with overlapping peptides covering the whole sequence, or a fragment thereof, of a protein antigen of interest. In some embodiments, different peptide-loaded MHC class II molecules or multimers from a set of such molecules covering the whole sequence, or a fragment thereof, of a protein antigen are combined. In some embodiments, such mixtures of sets of MHC class II monomers or multimers, for example, tetramers, are used to screen CD4+ T cells. In some embodiments, if reactivity of CD4+ T cells to a mixture of peptide-loaded MHC class II monomers or multimers is detected, MHC class II molecules loaded with individual peptides are tested separately to identify an epitope of the protein antigen and/or to isolate CD4+ T cells specifically binding an epitope. Such epitope mapping methods based on peptide-loaded MHC class II molecules, as provided by some aspects of this invention, depend on the expression of the antigen-specific T cell receptor and are, in contrast to conventional mapping and isolation methods, not dependent on the function of the targeted T cells (e.g., on cytokine secretion, upregulation of activation markers, etc.), which can be highly variable for different T cells.
These findings are also compatible with the fact that, in contrast to the strict length requirement of class I bound peptides (8-10 mers) that need to perfectly fit a groove that is closed at both ends, often by adopting a kinked conformation, the class II binding groove, open at both ends, can easily accommodate long peptides (15-25 mers) that bind in an extended form (29, 30). Because of the high quality of the molecularly defined tetramers, we could identify, enumerate and phenotype ex vivo ESO-specific CD4+ T cells induced by immunization of cancer patients with a rESO vaccine that is presently under trial for cancer immunotherapy. This allowed us to address some important issues regarding the nature of CD4+ T cell responses elicited by the vaccine. We could unambiguously show that, whereas DR52b/ESO tetramer+ T cells were below detection limits in healthy donors as well as in patients prior to vaccination, they were clearly induced in remarkably similar proportions among different individuals following vaccination. Combination of staining with tetramers and antibodies directed against activation/differentiation markers allowed us to demonstrate that vaccine-induced CD4+ T cells were mostly composed of central and transitional memory cells, a phenotype that has been associated with protective memory responses to viruses (14, 15). In addition and importantly, we could demonstrate that most vaccine-induced CD4+ T cells were T helper polyfunctional cells of type I (18) and not suppressive Treg. Together, these results illustrate of the usefulness of molecularly defined class II/peptide tetramers to monitor tumor antigen-specific CD4 T cells, a crucial aspect in the development of anti-cancer vaccines. It is noteworthy that whereas DR52b/ESO tetramers allowed us to monitor vaccine-induced CD4+ T cells in 50% of vaccinated patients, the remaining 50% express another alternate DR molecule, DRB4*0101-0103, that has been also reported to present ESO-derived peptides (31), suggesting that the use of only two tetramers might be sufficient to monitor ESO-specific CD4+ T cells in the large majority of individuals.
In sum, the combination of a technical advance in the synthesis of class II/peptide tetramers (use of his-tagged peptides and affinity purification of peptide-loaded monomers prior to tetramerization) together with the use of frequently expressed alternate DR molecules, has the potential to significantly accelerate the development of reliable MHC class II/peptide tetramers, allowing the monitoring of CD4+ T cells specific for many other antigens in a variety of pathological conditions as well as in the course of immune interventions.
The entire contents of all of the references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference for the purposes or subject matter referenced herein.
Active elicitation of immune responses to tumor-specific antigens through vaccination is currently explored as a strategy that could complement standard cancer therapy to stabilize disease and prevent recurrence (1-3). One promising approach is to use molecularly defined synthetic vaccines incorporating well-characterized recombinant tumor antigens administered with strong adjuvants (4, 5). These vaccines can elicit integrated antibody and cellular immune responses, but their ability to eradicate cancer cells, particularly in the case of intracellular tumor antigens, relies on the elicitation of antigen specific T cells. Although cytotoxic CD8 T cells (CTL) are considered the main anti-tumor effector cells, CD4 T cell responses are key to the development of efficient anti-tumor immunity, both by providing help for the development of CTL and by directly exerting different effector functions (6-10). A rapid and hopefully successful development of anti-cancer vaccines is therefore dependent on the availability of methods that allow the efficient and reliable monitoring of vaccine induced tumor antigen-specific T cells. In this context, the development of soluble fluorescent MHC-peptide oligomers (commonly referred to as tetramers), allowing the direct visualization, enumeration and characterization of antigen specific T cells, has represented a major advance (11, 12). Hundreds of tetramers corresponding to different MHC class I alleles incorporating peptides from pathogen and self-antigens, including tumor antigens, have been generated and widely used in recent years (12-14). The development of MHC class II-peptide tetramers, instead, has been much more limited, and has been successful only in a minority of cases (12, 15-17).
NY-ESO-1 (ESO), a tumor-specific antigen of the cancer/testis group frequently expressed in tumors of different histological types but not in normal somatic tissues is an important candidate for the development of generic anti-cancer vaccines (18, 19). Several candidate anti-cancer vaccines using ESO-based immunogens are currently under trial (cancer Vaccine Collaborative: www.cancerresearch.org) (4, 20). Following vaccination with a recombinant ESO protein (rESO) administered with Montanide ISA-51 and CpG ODN 7909, we have obtained induction of CD4 T cell responses in 17/18 vaccinated patients (4). The majority of vaccine-induced CD4 T cells were directed against two immunodominant regions of ESO, corresponding to peptides 81-100 and 119-143. ESO119-143 has been previously reported to bind to multiple MHC class II molecules (21, 22) and epitopes located in the ESO119-143 region and recognized by specific CD4 T cells in the context of several HLA-DR molecules have been identified (21, 23, 24). We have generated tetramers of ESO119-143 presented in the context of DR52b (DRB3*0202), an alternate DR molecule frequently expressed by Caucasians (25). Whereas the use of DR52b chains containing leucine zipper motifs was not sufficient, alone, for the successful generation of DR52b/ESO tetramers, we have shown that the use of ESO peptides bearing an amino-terminal His-tag, that allows the isolation of folded monomers by affinity purification, allows the generation of efficient tetramers (25).
In this study, we generated tetramers of DRB1*0101 (DR1) incorporating peptide ESO119-143, using this strategy. We initially validated the DR1/ESO119-143 tetramers on specific and control clones. We then assessed peptide-stimulated cultures from vaccinated patients expressing DR1, isolated DR1/ESO119-143 tetramer+ cells by cell sorting and further characterized them functionally. Finally, we used the DR1/ESO119-143 tetramers to assess vaccine-induced CD4 T cells ex vivo and characterize them phenotypically.
Generation of Fluorescent HLA-DR1/ESO Peptide Tetramers.
Soluble DR1 molecules were produced in D. mel-2 cells and purified by anti-HLA-DR (clone L243) immuno-affinity chromatography as previously described (25). The DR1 eluate was brought to the optimal peptide loading pH of 6.0 with 100 mM citric acid, loaded at a peptide to protein molar ratio of 50:1, at 28° C. for 24 hrs in the presence of a protease inhibitor cocktail (Roche) and 0.2% octyl β-D-glucopyranoside (Sigma) and then biotinylated using the BirA enzyme (Avidity). When DR1 molecules were loaded with untagged ESO peptides, complexes were directly purified by gel filtration in PBS pH 7.4, 100 mM NaCl on a Superdex S200 column (GE Healthcare Life Sciences) and the fractions corresponding to the monomeric pMHC complexes were pooled and concentrated. Alternatively, ESO peptides were extended at the N-terminus by a sequence containing 6 His residues and a linker (Ser-Gly-Ser-Gly, SEQ ID NO: 119). DR1/His tag-ESO peptide complexes were purified using a H isTrap HP 1 ml column (GE Healthcare Life Sciences) prior to purification by gel filtration. Finally, biotinylation and purity, as assessed by SDS-PAGE in an avidin shift assay, were >90%. Biotinylated DR1/peptide monomers were multimerized by mixing with small aliquots of streptavidin-PE (Invitrogen) up to the calculated 4:1 stoichiometry.
Patients Samples, Cells and Tissue Culture.
Peripheral blood samples were collected from cancer patients enrolled in a clinical trial of vaccination with rESO, Montanide ISA-51 and CpG 7909 (4) upon informed consent and approval by the Institutional Review Boards. MHC class II alleles were determined by high resolution molecular typing (24). L.DR1, DR1-transfected mouse cells kindly provided by Dr. Hassane M. Zarour (Department of Medicine and Melanoma Center, University of Pittsburgh Cancer Institute, Pittsburgh, Pa., USA), were maintained in complete RPMI medium containing gentamicin (Invitrogen) and periodically typed for HLA-DR1 expression. ESO119-143-specific DR1-restricted CD4 T cell clones were obtained from post-vaccine samples from DR1+ patients as previously described (24). Clones were expanded by periodic (every 3-4 wk) stimulation with phytohemagglutinin (PHA, OXOID) and allogeneic irradiated PBMC and cultured in complete IMDM medium in the presence of rhIL-2 (100 IU/mL).
Assessment of ESO-Specific CD4 T Cells, Tetramer Staining and Flow Cytometric Analysis and Sorting.
For assessment of specific CD4 T cell responses following in vitro stimulation, CD4+ cells were enriched from PBMC by magnetic cell sorting (Miltenyi Biotec Inc.), stimulated with irradiated autologous APC in the presence of ESO peptides, as indicated, rhIL-2 and rhIL-7 as previously described (24) and maintained in culture during 10-15 days prior to tetramer staining. Peptide stimulated cultures and specific monoclonal and polyclonal populations were incubated with tetramers at a final concentration of 3 μg/ml for 1 hr at 37° C., unless otherwise indicated, in complete IMDM medium, washed and then stained with CD4 (BD Biosciences) or TCR V13 (Beckman Coulter) specific mAb in PBS, 5% FCS for 15 minutes at 4° C. and analyzed by flow cytometry (FACSAria, BD Biosciences). In order to generate specific polyclonal T cell populations, tetramer+ cells within peptide-stimulated cultures were sorted by flow cytometry (FACSAria, BD Biosciences) and expanded by stimulation with PHA and irradiated allogeneic PBMC in the presence of rhIL-2 (26). For ex vivo enumeration and phenotyping of specific cells, CD4+ cells enriched from PBMC were rested overnight, incubated with tetramers (3 μg/ml) for 2 hrs at 37° C. and then stained with CD4−, CD45RA− (BD Biosciences) and CCR7− (Miltenyi Biotec Inc.) specific mAb and analyzed by flow cytometry.
Antigen Recognition Assays.
DR1+ ESO-specific monoclonal or polyclonal CD4 T cell populations were stimulated in the absence or presence of ESO peptides (2 μM) or PMA (100 ng/ml) and ionomycin (1 μg/ml), as indicated, and cytokine production was assessed in a standard 4 hr intracellular cytokine staining assay using mAb specific for IFN-γ, TNF-, IL-2, IL-4, IL-10 (BD Biosciences) and IL-17 (eBiosciences) and flow cytometric analysis, as previously described (24, 27). In order to assess DR1 restriction of monoclonal and polyclonal ESO-specific populations, they were incubated for 4 hrs with L.DR1 cells or with untransfected mouse fibroblasts that have been pulsed with peptide ESO119-143 for 1 hr at 37° C. and washed 3 times, and IFN-γ production was assessed by intracellular staining and flow cytometric analysis. In other experiments, specific polyclonal cultures were incubated for 24 hrs with either L.DR1 cells and serial dilutions of ESO peptides or monocyte derived dendritic cells pre-incubated overnight with serial dilutions of rESO, and IFN-γ was measured by ELISA in 24 hr culture supernatants, as previously described (4, 24).
Generation and Validation of DRB1*0101/ESO119-143 Tetramers.
Direct assessment with fluorescent MHC class II tetramers incorporating immunodominant peptides from frequently expressed tumor antigens is an attractive approach for the monitoring of anti-tumor CD4 T cells. At variance with MHC class I/peptide tetramers, originally developed in 1996 (11) that have since been generated for a large number of alleles incorporating a variety of peptides, including ones from tumor antigens, the development of MHC class II/peptide tetramers has proven significantly more difficult (12, 15-17). Among limiting factors are the high polymorphism of MHC class II molecules, the often low binding affinity of peptides from tumor/self antigens, and the structural characteristics of MHC class II molecules. Namely, because MHC class II αβ chain monomers are unstable in solution, one strategy to improve tetramer generation has consisted in adding leucine zippers to facilitate α,β pairing (28). MHC class II αβ chains incorporating leucine zippers, however, can form stable complexes also in the absence of bound peptides, which can lead to the generation of tetramers formed by “empty” MHC class II molecules. While attempting to generate tetramers of the alternate DR molecule DR52b incorporating peptide ESO1119-143, we found that the use of leucine zipper containing DR52b molecules alone was insufficient for the generation of tetramers able to significantly stain specific CD4 T cells. We therefore implemented the approach by using His-tagged peptides, allowing the isolation of folded MHC class II/peptide monomers by affinity purification, which resulted in the generation of efficient DR52b/ESO tetramers (25). In this study, we used the same strategy to generate tetramers of DRB1*0101 (DR1) incorporating ESO119-143. To validate the DR1/ESO119-143 tetramers, we initially assessed them on a specific clone (
Assessment of Peptide-Stimulated Cultures from Vaccinated Patients Using DRB1*0101/ESO119-143 Tetramers.
To evaluate vaccine-induced CD4 T cells in DR1+ immunized patients, we initially stained post-vaccine CD4 T cells from patient N03 (a high responder to the vaccine, expressing DRB1*0101) previously stimulated in vitro for 12 days with a pool of long overlapping peptides spanning the entire ESO sequence (4), with DR1/ESO119-143 tetramers during 1 hr at 37° C. As illustrated in
Isolation and Characterization of Vaccine-Induced DR1/ESO119-143 Tetramer+ Cells.
To assess vaccine-induced DR1/ESO119-143 tetramer+ cells, we isolated them by flow cytometry cell sorting and expanded them in vitro, as polyclonal monospecific cultures (
DR1/ESO119-143 Tetramer+ Cells Use a Conserved TCR Repertoire.
T cells recognizing defined MHC/peptide complexes often exhibit conserved features including the use of defined variable regions of the TCR α and β chains (Vα and Vβ). To address if DR1/ESO119-143 tetramer+ cells exhibited such conserved features, we assessed the polyclonal monospecific tetramer+ populations from vaccinated patients with a panel of anti-V13 mAb covering about 50% of the human TCR repertoire. Examples of co-staining with anti-Vβ mAb and tetramers are shown in
Assessment of the Minimal ESO Peptide Optimally Recognized by DR1/ESO119-143 Tetramer+ Cells.
In a previous study assessing ESO119-143 binding to several MHC class II alleles, including DR1, the 15-mer ESO123-137 showed a binding affinity for DR1 similar to that of ESO119-143 (21). To better define the DR1 epitope with respect to recognition by specific T cells, we assessed the recognition of truncated peptides within the ESO119-143 region by tetramer+ T cells. NH2-terminal truncations up to amino acid 123 did not significantly affect recognition by tetramer+ T cells (
Ex vivo assessment of the frequency and phenotype of vaccine-induced ESO-specific CD4 T cell responses with DR1/ESO119-143 tetramers. The relatively high frequency of DR1/ESO119-143 tetramer+ CD4 T cells detected in peptide-stimulated cultures from vaccinated patients encouraged us to attempt assessing the frequency and phenotype of vaccine-induced CD4 T cells in DR1 expressing patients ex vivo. To this end, for each patient, we isolated CD4 T cells by magnetic cell sorting from samples taken prior to and at different time points after vaccination, when available, and stained them with DR1/ESO tetramers together with antibodies directed against markers that distinguish CD4 T cells according to their differentiation stage (29). For 3 of the 4 patients, samples taken prior to vaccination were available. The frequency of DR1/ESO tetramer+ cells among memory (CD45RA−) CD4 T cells in pre-vaccine samples was below detection limits (<1:100 000) (
In conclusion, assessment of vaccine-induced CD4 T cells using DR1/ESO tetramers confirmed the ability of the ESO vaccine to induce strong and long lasting CD4 T cell memory responses of TH 1 type, that are generally associated with efficient anti-tumor responses. The high efficiency and specificity of the staining obtained with the DR1/ESO tetramers allowed the direct ex vivo detection of specific cells among total CD4 T cells, without the need for enrichment steps used in previous studies (28, 32). It is noteworthy that the frequency of vaccine-induced ESO-specific CD4 T cells detected ex vivo (in average 1:10 000 memory cells) is in the same range of ex vivo frequencies of previously reported DR1-restricted CD4 T cells specific for viral epitopes (28, 32). The generation and validation of DR1/ESO tetramers reported in this study encourage their further use for the evaluation of CD4 T cells specific for this important tumor antigen in the context of spontaneous or vaccine-induced immune responses in DR1 expressing patients.
The entire contents of all of the references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference for the purposes or subject matter referenced herein.
This application claims the benefit 35 U.S.C. §119(e) of U.S. Provisional Patent Application Ser. No. 61/278,051, filed Oct. 2, 2009, and U.S. Provisional Patent Application Ser. No. 61/320,060, filed Apr. 1, 2010. The entire disclosures of both Applications are incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US10/02668 | 10/1/2010 | WO | 00 | 10/12/2012 |
| Number | Date | Country | |
|---|---|---|---|
| 61320060 | Apr 2010 | US |
