Patent Application
20230332162
Pursuant to the EFS-Web legal framework and 37 C.F.R. § 1.821-825 (see M.P.E.P. § 2442.03(a)), a Sequence Listing in the form of an ASCII-compliant text file (entitled 2920951-179001 Sequence Listing ST26.xml” created on 10 Nov. 2022, and 364,981 bytes in size) is submitted concurrently with the instant application, and the entire contents of the Sequence Listing are incorporated herein by reference.
Disclosed herein are immunostimulatory oligonucleotides and compositions and methods of use thereof. More specifically, immunostimulatory oligonucleotides, methods of optimizing the immunostimulatory properties of oligonucleotides, and methods of using the immunostimulatory oligonucleotides to elicit a toll-like receptor 21 (TLR21)-mediated immune response are disclosed.
Some molecular attributes of microorganisms including proteins and other antigens on a microbe's surface, as well as internal compositions such as certain motifs contained within a microbe's genome (e.g., unmethylated CpG motifs), can be recognized by a host organism's immune system and elicit immune responses. Interaction between these molecular attributes, or pathogen associated molecular patterns (PAMPs), and a host's cognate pathogen recognition receptors can initiate cell signaling cascades involved in immune responses. Toll-like receptor 21 (TLR21) is the chicken functional homolog of mammalian toll-like receptor 9 (TLR9) and a PAMP receptor capable of recognizing unmethylated CpG motifs. Activation of TLR21 by nucleic acids having these CpG motifs has been shown to activate cellular signals involved in immune responses to microbial infection.
Comprehension of TLR21's role in the immune response in chickens has not led to a shift in disease prevention or treatment in the poultry industry. Large populations of poultry housed in brooder facilities are at increased risk of microbial infections at all stages of life due to inherently crowded and nonsterile environments, but currently available prophylactic compositions and post-infection treatments generally do not elicit PAMP-mediated immune responses. Instead, large scale production facilities rely on commercially available vaccines and antibiotics to prevent or curtail infectious outbreaks. Although antibiotics are becoming disfavored due to concerns of resistance and unintended consequences of consuming treated meat, antibiotic administration remains a standard operating procedure in many agricultural settings, including large-scale brooder houses, and adoption of new methods can be prohibitively expensive and burdensome. One hindrance to adopting TLR21 agonists as a prophylactic measure or as a treatment for infection includes the inefficiencies associated with screening large numbers of candidate compounds, which effectively disincentivizes research to identify such agonists.
Thus, there is a need for TLR21 stimulatory compositions, methods for identifying them, and optimizing the immunostimulatory properties of the compositions. The disclosed methods and compositions are directed to these and other important needs.
Disclosed herein are oligonucleotides comprising at least one CpG motif and a guanine nucleotide enriched (“guanine-enriched”) sequence beginning at or within four nucleotides of the 5′ terminus of the oligonucleotide.
Also disclosed herein are oligonucleotides comprising a 5′-cholesteryl modification with at least one CpG motif and with or without a guanine nucleotide enriched sequence within four nucleotides of the 5′ terminus of the oligonucleotide.
Also provided are methods of stimulating toll-like receptor 21 (TLR21) comprising administering to a subject in need thereof an immunostimulatory oligonucleotide having at least one CpG motif and an guanine nucleotide enriched sequence beginning at or within four nucleotides of the 5′ terminus of the oligonucleotide.
Methods for increasing TLR21-stimulatory activity of an oligonucleotide having at least one CpG motif comprising fusing the 5′ end of the oligonucleotide to a guanine nucleotide enriched sequence are also disclosed.
Provided herein are methods for eliciting an immune response in a subject comprising administering to a subject an oligonucleotide having at least one CpG dinucleotide motif and a guanine nucleotide enriched sequence beginning at or within four nucleotides of the 5′ terminus of the oligonucleotide to the subject.
The summary, as well as the following detailed description, is further understood when read in conjunction with the appended drawings. For the purpose of illustrating the disclosed compositions and methods, there are shown in the drawings exemplary embodiments of the compositions and methods; however, the compositions and methods are not limited to the specific embodiments disclosed. In the drawings:
The disclosed compositions and methods may be understood more readily by reference to the following detailed description taken in connection with the accompanying figures, which form a part of this disclosure. It is to be understood that the disclosed compositions and methods are not limited to the specific compositions and methods described and/or shown herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claimed compositions and methods.
Unless specifically stated otherwise, any description as to a possible mechanism or mode of action or reason for improvement is meant to be illustrative only, and the disclosed compositions and methods are not to be constrained by the correctness or incorrectness of any such suggested mechanism or mode of action or reason for improvement.
Throughout this text, the descriptions refer to compositions and methods of using said compositions. Where the disclosure describes or claims a feature or embodiment associated with a composition, such a feature or embodiment is equally applicable to the methods of using said composition. Likewise, where the disclosure describes or claims a feature or embodiment associated with a method of using a composition, such a feature or embodiment is equally applicable to the composition.
When a range of values is expressed, another embodiment includes from the one particular value and/or to the other particular value. Further, reference to values stated in ranges include each and every value within that range. All ranges are inclusive and combinable. When values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. Reference to a particular numerical value includes at least that particular value, unless the context clearly dictates otherwise.
It is to be appreciated that certain features of the disclosed compositions and methods which are, for clarity, described herein in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosed compositions and methods that are, for brevity, described in the context of a single embodiment, may also be provided separately or in any subcombination.
As used herein, the singular forms “a,” “an,” and “the” include the plural.
As used herein, “fuse” or “fusing” refers to creating a chemical bond between to chemical reactive species. In the context of this disclosure, fusing most often refers to incorporating specific elements into an oligonucleotide. For example, a run of thymine nucleotides can be fused to the 3′ end of an oligonucleotide.
As used herein, “G-quartet sequence” refers to a stretch of consecutive guanine residues near the 5′ end of an oligonucleotide that enables the oligonucleotide to interact with other G-quartet sequences to form a G-quartet. The G-quartet enhances the immunostimulatory properties of the nucleic acid. For example, oligonucleotides comprising G-quartet sequences may interact, resulting in G-quartets. G-quartet sequences occurring in the promoter region of a gene may form quaternary structures involved in regulating expression of the gene. While a G-quartet sequence is not limited to any particular sequence, an example of a G-quartet sequence is TGGGGT (SEQ ID NO: 265).
As used herein, “G-wire sequence,” “G wire sequence,” “Gwire sequence,” and related terms, refer to a plurality, most often two, of at least four consecutive guanine nucleotides. The pluralities of guanine nucleotides, located at or near the 5′ terminus of an oligonucleotide, are separated by two or more non-guanine nucleotides (i.e., thymine nucleotides). G-wire sequences are capable of interacting with other G-wire sequences to form a G-wire structure. A G-wire structure can enhance the immunostimulatory properties of a nucleic acid. An exemplary G-wire sequence is
As used herein, the terms “guanine nucleotide enriched sequence,” “guanine-enriched sequence,” and the like, refer to nucleic acid sequences comprising either a run of consecutive guanine nucleotides, usually between four to six guanine nucleotides, or a region of a nucleic acid, typically at or near the 5′ end of an oligonucleotide having more guanine nucleotides than adenine, cytosine, or thymine nucleotides. A guanine nucleotide enriched sequence as disclosed herein can enhance the immunostimulatory properties of an oligonucleotide. G-quartet and G-wire sequences are both types of guanine nucleotide enriched sequences.
As used herein, “inserting” refers to adding specific nucleotide(s) at specific positions during the synthesis of an oligonucleotide.
As used herein, “parallel orientation” refers to the directional interaction between different oligonucleotides. For example, the circled illustration in
The term “subject” as used herein is intended to mean any animal, including any type of avian, mammalian, or aquatic species, and in particular chickens. Subjects can be treated using the disclosed methods and with the disclosed compositions.
The term “TLR21 testing,” or variations thereof, refers to administering oligonucleotides to the HEK293-NFκB-bsd-cTLR21 cell line described in Example 2 to determine if the oligonucleotide stimulates TLR21.
Various terms relating to aspects of the description are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definitions provided herein.
Disclosed herein are recombinant HEK293 cell lines comprising a blasticidin resistance gene and a synthetic SEAP reporter gene construct (“NFκB-SEAP”) as well as a stable cell line co-transfected with the NFκB-SEAP construct and a chicken TLR21 construct (HEK293-NFκB-bsd-cTLR21). This latter cell line can be employed to test the TLR21-mediated immunostimulatory properties of candidate compounds. As demonstrated in the examples, the HEK293-NFκB-bsd-cTLR21 cell line can be used to identify oligonucleotides capable of eliciting a TLR21-mediated immune response.
Oligonucleotides and methods for their use in activating or otherwise stimulating TLR21 are also provided herein. In some embodiments the oligonucleotides comprise at least one pathogen associated molecular marker (PAMP), specifically an unmethylated dinucleotide CpG motif, which interacts with pathogen recognition receptors expressed in the host organism. In some embodiments, the oligonucleotides also have a guanine nucleotide enriched sequence. These sequences can facilitate the folding of a DNA strand into a quaternary structure or, in the case of oligonucleotides, promote the aggregation of one or more oligonucleotides comprising the sequence. It is demonstrated herein that the immunogenicity of oligonucleotides having CpG dinucleotide motifs can be enhanced if the oligonucleotide further comprises a guanine nucleotide enriched sequence. The guanine nucleotide enriched sequence need not be comprised solely of guanine nucleotides, but it must be enriched. A guanine-enriched sequence, as described above and as exemplified throughout these disclosures, is a segment of an oligonucleotide comprising more guanine nucleotides than any other residue (i.e., adenine, cytosine, thymine nucleotides). In some embodiments, additional manipulation of the oligonucleotide sequence and structure can further enhance the oligonucleotide's ability to stimulate TLR21. Therefore, one embodiment of the present disclosure comprises an oligonucleotide comprising at least one CpG motif and a guanine nucleotide enriched sequence beginning at or within four nucleotides of the 5′ terminus of the oligonucleotide.
It has been previously shown that the addition of deoxyguanine (dG) nucleotides to the 3′ end of a CpG containing oligonucleotide enhanced TLR9 activation in vitro. Because TLR9 is the mammalian functional equivalent of chicken TLR21, it was expected that 3′ dG runs would also improve immunogenicity of oligonucleotides designed to activate TLR21. Surprisingly, this is not true for 3′ guanine nucleotide enriched sequences in TLR21 activation. Oligonucleotides having 3′ runs of two or more dGs failed to activate TLR21 (
Not only does the position of the guanine nucleotide enriched sequence in the oligonucleotide affect enhancement of TLR21 activation, but the content of the sequence has an effect as well. For this reason, in some embodiments of the present disclosure, the guanine nucleotide enriched sequence comprises a first plurality of consecutive guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises two to eight guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises two guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises three guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises four guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises five guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises six guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises seven guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises eight guanine nucleotides. In still other aspects, the first plurality of guanine nucleotides comprises more than eight guanine nucleotides.
In some embodiments of the present invention, an oligonucleotide comprises SEQ ID NO: 16, 17, 18, 19, 20, 21, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 77, 78, 81, 82, 85, 86, 89, 90, 92, 93, 96, 97, 100, 102, 104, 106, 108, or 143. In some embodiments, the guanine nucleotide enriched sequence comprises TTAGGG, TTAGGGTTAGGG (SEQ ID NO:261), TTTTGGGG, GGGGTTTT, GGGGTTTTGGGG (SEQ ID NO:262), TTAGGG, TTAGGGTTAGGGTTTT (SEQ ID NO:263), TGTGGGTGTGTGTGGG (SEQ ID NO: 268), GGAGG, TGGAGGC, or TGGAGGCTGGAGGC (SEQ ID NO:264). In still other embodiments, the oligonucleotide comprises SEQ ID NO: 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 124, 125, 126, 127, 129, 130, 131, 134, 136, 137, or 138.
A single run of dG is not the only 5′ modification that can enhance TLR21 stimulation. For example, adenine, cytosine, and thymine nucleotides enriched sequences can also be added to the 5′ end of an oligonucleotide having at least one CpG motif and result in enhanced TLR21 stimulation, albeit less than that elicited by guanine-enriched sequences at the 5′ end of the oligonucleotide (see
In some aspects, the plurality of guanine nucleotides comprises a G-quartet sequence. In some embodiments, the first plurality of guanine nucleotides, the second plurality of guanine nucleotides, or both comprise a G-quartet sequence. G-quartet sequences, as defined above, allow for interaction between oligonucleotides. Without being bound by theory, interaction of the oligonucleotides via G-quartet sequences allows for the concentration of CpG dinucleotide motifs and a corresponding enhanced probability of recognition by TRL21. G-quartet sequences also provide the opportunity for multiple TLR21 receptor interactions (enhancing avidity) and for receptor crosslinking. In some embodiments, the immunostimulatory composition further comprises at least one additional oligonucleotide having a G-quartet sequence, wherein the oligonucleotide and the at least one additional oligonucleotide have a parallel orientation in a quaternary structure. In some aspects, the G-quartet sequence comprises TGGGGT (SEQ ID NO: 265).
A G-wire sequence is another guanine nucleotide enriched sequence that can be added to the 5′ of an oligonucleotide having CpG motifs. In some aspects of the present disclosure, the first and second pluralities of guanine nucleotides comprise a G-wire sequence. In some aspects, the G-wire sequence comprises SEQ ID NO:257 or 258. In still other aspects, the G-wire sequence comprises SEQ ID NO:141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, or GCGT-Gwire3. The two pluralities of guanine nucleotides can be separated by non-guanine nucleotides, nucleotide analogs, or any other spacer or linker. For example, in some aspects of the present disclosure, the first plurality of guanine nucleotides and the second plurality of guanine nucleotides are separated by at least one nucleotide. As used herein, the term “spacer” refers a chemical linkage between similar nucleotide motifs, i.e., between two CpG motifs or between two guanine nucleotide enriched sequence motifs, whereas the term “linker” refers to a chemical linkage between different nucleotide motifs, i.e., between a guanine nucleotide enriched sequence and another nucleotide motif, e.g., a CpG motif. The terms “spacer” and “linker” are used for clarity in describing which aspect of an oligonucleotide is being discussed. However, it will be understood by those skilled in the art that the structures disclosed herein for spacers can be interchangeable with the structures disclosed herein for linkers, and vice versa.
Without being bound by any particular theory, it is possible that a G-wire sequence enables an oligonucleotide to interact, and aggregate, with other oligonucleotides having G-wire sequences. This accumulation of oligonucleotides and their CpG motifs may lead to enhanced stimulation of TLR21.
The guanine nucleotide enriched sequences within an oligonucleotide may be separated from the CpG nucleotide motifs by nucleotides, nucleotide analogs, or other linkers. Therefore, in some embodiments of the present disclosure, the oligonucleotide further comprises a linker between the guanine nucleotide enriched sequence and the downstream at least one CpG motif. The linker need not be directly adjacent to either the guanine nucleotide enriched sequence or the CpG motif, but the linker must reside between the two sequence motifs regardless of intervening sequences between the guanine nucleotide enriched sequence and the linker, as well as between the CpG motif and the linker. In some embodiments of the present disclosures, the linker comprises at least three nucleotides. In some embodiments, the linker may not comprise nitrogenous bases. For example, in some aspects, the linker is a hexaethyleneglycol, a propanediol, a triethyleneglycol, or derivatives thereof. In other examples, the oligonucleotide having a linker comprises 2006-PDE5dG4-X1 or 2006-PDE5dG4-X3.
Dinucleotide CpG motifs present in the oligonucleotides of the present disclosure are believed to be PAMPs recognized by TLR21 in chickens. While even a single CpG motif can stimulate TLR21, multiple CpGs present on an oligonucleotide can increase stimulated TLR21 signal strength. For this reason, in some aspects of the present invention, the at least one CpG motif comprises two, three, four, or five CpG motifs. In some aspects the at least one CpG motif comprises six or more CpG motifs. In some aspects, the at least one CpG motif comprises two CpG motifs. In some aspects, the at least one CpG motif comprises three CpG motifs. In some aspects, the at least one CpG motif comprises four CpG motifs. In some embodiments, the at least one CpG motif comprises four CpG motifs.
In some embodiments of the presently disclosed oligonucleotides, each CpG motif may be separated from the other CpG motifs by at least one nucleotide or nucleotide analog. In some aspects, the at least one nucleotide is two or three thymine nucleotides. In other aspects, the at least one nucleotide is between one and four nucleotides, although the number of intervening nucleotides may differ depending on the sequence of the intervening nucleotides. In some aspects, the oligonucleotide comprises SEQ ID NO: 217, 218, 219, or 220. The nucleotides adjacent to a CpG motif—along with the CpG motif itself—constitute a CpG sequence element (e.g., XCGX, where X=any nucleotide). In some embodiments, the oligonucleotides of the present disclosure, comprise CpG sequence elements that are GCGA, GCGG, ACGC, CCGC, GCGT, TCGC, or any combination thereof.
In some embodiments of the present disclosures, the CpG motif comprises a CpG sequence element having four nucleotides. In some aspects, the oligonucleotide comprises at least two CpG sequence elements. In some aspects, the oligonucleotide comprises at least three CpG sequence elements. In some aspects, the oligonucleotide comprises at least four CpG sequence elements. In some aspects, the oligonucleotide comprises at least five CpG sequence elements. In some aspects, the oligonucleotide comprises at least six CpG sequence elements. In some aspects, the oligonucleotide comprises more than eight, ten, fifteen, or even twenty CpG sequence elements.
In other embodiments of the presently disclosed oligonucleotides, each of the CpG motifs are separated from each other CpG motif by a spacer or a combination of a spacer and at least one nucleotide. In some aspects, at least one CpG motif is separated from the nearest other CpG motif by a spacer or a combination of a spacer and at least one nucleotide, while at least two other CpG motifs are adjacent to each other. Although separated CpG motifs may enhance the immunostimulatory capabilities of the designed oligonucleotides, it is acknowledged that CpG motifs adjacent to each other can still stimulate TLR21.
The spacer employed to linearly separate CpG motifs can be any linkage that bridges at least a portion of the oligonucleotide between the CpG motifs. The spacer may be comprised of, but not necessarily limited to, a deoxyribosephosphate bridge, a multiple carbon chain, or a repeated chemical unit. One essential property of a spacer is the ability to form a chemical bond with the nucleotide backbone of the oligonucleotide. Therefore, in some embodiments the spacer is a deoxyribosephosphate bridge. The deoxyribosephosphate bridge may comprise nitrogenous bases in some aspects while in others the deoxyribosephosphate bridge is abasic. In some aspects, the oligonucleotide comprises SEQ ID NO:221, which comprises an abasic deoxyribosephosphate bridge.
In other embodiments of the present disclosure, the spacer comprises a carbon chain. The carbon chain can comprise two to twelve carbon atoms. Diols comprising a carbon chain can be used as the terminal alcohol groups can react with terminal alcohol and/or phosphate groups of an oligonucleotide. In some embodiments, the carbon chain comprises two carbon atoms, and in some aspects, the carbon chain is derived from ethanediol. In some embodiments, the oligonucleotide comprises ODN-X2, wherein X2 is ethanediol.
Other embodiments of the present disclosure provide for the carbon chain comprising three carbon atoms. In some aspects of these embodiments, the carbon chain is derived from 1,3-propanediol. In some embodiments, the oligonucleotide comprises CG-Gw2X2, CG-Gw2X2-2, or ODN-X3, CG-Gw2X2-1, CG-Gw2X2-3, CG-Gw2X2-4, CG-Gw2X2-5, CG-G4T16X2-1, CG-G4T16X2-2, CG-G4T16X2-3, CG-G4T16X2-4, or CG-G4T16X2-5, wherein X2 is a three carbon chain; 2006-PDE5dG4-X2, wherein X2 is a three carbon chain derived from 1,3-propanediol; or 2006-PDE5dG4-X4, wherein X4 is a three carbon chain derived from 1,3-propanediol.
In yet other embodiments of the present disclosure, the oligonucleotide comprises a carbon chain spacer, wherein the carbon chain comprises four carbon atoms. In some aspects of these embodiments, the carbon chain is derived from 1,4-butanediol. In some embodiments, the oligonucleotide comprises ODN-X4, wherein X4 is a four carbon chain derived from 1,4-butanediol.
In still other embodiments of the present disclosures, the oligonucleotide comprises a spacer having a repeated chemical unit. For example, in some embodiments, the repeated chemical unit is an ethylene glycol. The repeated chemical unit may be repeated two to twelve times. In some embodiments, ethylene glycol is repeated six times. Thus, in some aspects, the oligonucleotide comprises CCGC-Gw2X1, wherein X1 is a spacer derived from hexaethyleneglycol.
Although dG runs on the 3′ terminus of an oligonucleotide results in little, if any, TLR21 stimulation, other nucleotide runs can impart enhanced immunogenicity to the oligonucleotide. Specifically, in some aspects of the present disclosures, the oligonucleotide may further comprise a tri-thymine nucleotide 3′ terminus. In some aspects, the oligonucleotide comprises SEQ ID NO: 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, or 215.
For each oligonucleotide disclosed herein, one skilled in the art would know that a nucleotide can be substituted for a nucleotide analog. The oligonucleotides in some embodiments comprise a phosphodiester backbone, although other embodiments of the oligonucleotides disclosed herein comprise a phosphorothioate backbone.
In some embodiments of the present disclosure, the oligonucleotide may comprise a lipid moiety, which can lead to an increase in the oligonucleotide's immunogenicity. One possible explanation for the increased immunogenicity is that the lipid moiety may function to enhance the bioavailability of the oligonucleotide. In some embodiments the lipid moiety is at or near the 5′ terminus of the oligonucleotide. This lipid “cap” may prevent degradation, increase solubility, improve the oligonucleotide's stability in a pharmaceutical composition, may lead to polydentate ligands via micelle or other aggregate formation, or any combination thereof. In some aspects, the lipid moiety is a cholesterol.
Because the oligonucleotides disclosed stimulate an enhanced immune response via TLR21, other embodiments of the present disclosure includes methods of preventing or treating disease by administering to a subject in need thereof a herein disclosed immunostimulatory oligonucleotide.
Also provided are immunostimulatory compositions comprising a herein disclosed immunostimulatory oligonucleotide. While these immunostimulatory compositions comprise an oligonucleotide as described herein, the compositions may also include other components that affect the immunogenicity, effectiveness, and efficiency of the composition. For example, in some aspects the immunostimulatory composition comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier adapts the composition for administration by a route selected from intravenous, intramuscular, intramammary, intradermal, intraperitoneal, subcutaneous, by spray, by aerosol, in ovo, mucosal, transdermal, by immersion, oral, intraocular, intratracheal, intranasal, pulmonary, rectal, or other means known to those skilled in the art. The pharmaceutically acceptable carrier(s) may be a diluent, adjuvant, excipient, or vehicle with which the immunostimulatory composition is administered. Such vehicles may be liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. For example, 0.4% saline and 0.3% glycine can be used. These solutions are sterile and generally free of particulate matter. They may be sterilized by conventional, well-known sterilization techniques (e.g., filtration). The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, stabilizing, thickening, lubricating, and coloring agents, etc. The concentration of the molecules of the invention in such pharmaceutical formulation may vary widely, i.e., from less than about 0.5%, usually to at least about 1% to as much as 15 or 20% by weight and will be selected primarily based on required dose, fluid volumes, viscosities, etc., according to the particular mode of administration selected. Suitable vehicles and formulations, inclusive of other human proteins, e.g., human serum albumin, are described, for example, in e.g., Remington: The Science and Practice of Pharmacy, 21st Edition, Troy, D. B. ed., Lipincott Williams and Wilkins, Philadelphia, P A 2006, Part 5, Pharmaceutical Manufacturing pp 691-1092, See especially pp. 958-989.
In some embodiments, the oligonucleotide and the carrier are linked. As used to describe the relationship between the oligonucleotide and the carrier, “linked” refers to physical association of the oligonucleotide and the carrier. When the oligonucleotide and the carrier are bound to each other, interact with each other, or are combined, coupled, or otherwise joined, they can be deemed to be linked.
The immunostimulatory compositions described herein further comprise a hapten in some embodiments. In some aspects, the immunostimulatory oligonucleotide is linked to the hapten. The hapten may elicit an immunoresponse against a specific microorganism, such as, but not limited to, E. coli or Salmonella, while the immunostimulatory oligonucleotide elicits a non-specific immunoresponse mediated by TLR21 interaction with the oligonucleotide. These and other infectious microorganisms are of particular concern in large scale brooder houses in which the inhabitants are at increased risk of infection.
Some embodiments of the immunostimulatory compositions provide a vaccine for preventing or treating infectious disease comprising at least one of the immunostimulatory oligonucleotides described herein. For an oligonucleotide to elicit any immune response it must be effectively delivered to its target, whether the target is a cell culture, a chicken, or another vertebrate. Therefore, one aspect of the present disclosure provides a vector comprising an immunostimulatory oligonucleotide described herein.
The potency of the immunostimulatory oligonucleotide, and therefore immunostimulatory composition comprising only the oligonucleotide as an active ingredient, can be measured by its half-maximum effective concentration (EC50). EC50 is a measurement of the concentration of the immunostimulatory composition that induces a response that is half of the maximum response that can be attained by administering the composition. The lower the concentration, the more potent the oligonucleotide. In some aspects of the present disclosure, the immunostimulatory composition can have an EC50 in the pM range. In some aspects, the EC50 is between about 0.1 and 100 pM. In some aspects, the EC50 is between about 100 and 200 pM. In some aspects the EC50 is between about 200 and 300 pM. In some aspects, the EC50 is between about 300 and 400 pM. In some aspects the EC50 is between about 400 and 500 pM. In some aspects the EC50 is between about 500 and 600 pM. In some aspects the EC50 is between about 600 and 700 pM. In some aspects the EC50 is between about 700 and 800 pM. In some aspects the EC50 is between about 800 and 900 pM. In some aspects the EC50 is between about 900 pM and 1 nM. In still other aspects, the EC50 is less than about 100 pM.
Regarding the concentration of the oligonucleotide in the immunostimulatory composition, in some aspects the concentration of the oligonucleotide is between about 0.1 and 10 nM. In some aspects, the concentration of the oligonucleotide is between about 10 and 20 nM. In some aspects the concentration of the oligonucleotide is between about 20 and 30 nM. In some aspects, the concentration of the oligonucleotide is between about 30 and 40 nM. In some aspects the concentration of the oligonucleotide is between about 40 and 50 nM. In some aspects the concentration of the oligonucleotide is between about 50 and 60 nM. In some aspects the concentration of the oligonucleotide is between about 60 and 70 nM. In some aspects the concentration of the oligonucleotide is between about 70 and 80 nM. In some aspects the concentration of the oligonucleotide is between about 80 and 90 nM. In some aspects the concentration of the oligonucleotide is between about 90 and 1 μM. In still other aspects, the concentration of the oligonucleotide is less than about 20 nM.
The immunostimulatory composition may further comprise at least one additional oligonucleotide having a G-wire sequence in some embodiments of the present disclosure. Because the G-wire sequence facilitates the aggregation of other oligonucleotides having the same, or similar, G-wire sequence, one aspect of the immunostimulatory composition further comprises at least one additional oligonucleotide having a G-wire sequence. In some aspects in which the immunostimulatory composition comprises multiple oligonucleotides having G-wire sequences, the oligonucleotide and the at least one additional oligonucleotide have a G-wire conformation.
Also provided herein are methods of stimulating toll-like receptor 21 (TLR21) comprising administering to a subject in need thereof an oligonucleotide having at least one CpG motif and an guanine nucleotide enriched sequence beginning at or within four nucleotides of the 5′ terminus of the oligonucleotide. Methods are also provided for eliciting an immune response in a subject comprising administering to a subject in need thereof an immunostimulatory oligonucleotide having at least one CpG dinucleotide motif and at least one guanine nucleotide enriched sequence beginning at or within four nucleotides of the 5′ terminus of the oligonucleotide.
The oligonucleotide can be administered in the form of an immunostimulatory composition as described above. The immunostimulatory composition may further comprise a hapten, a pharmaceutically acceptable carrier, or both, as described above. Administering the immunostimulatory composition, in some aspects, can be performed intravenously, intramuscularly, intramammary, intradermally, intraperitoneally, subcutaneously, by spray, by aerosol, in ovo, mucosally, transdermally, by immersion, orally, intraocularly, intratracheally, or intranasally. The subject in need of the administration is an animal. In some aspects, the subject is a member of an avian species. For example, the immunostimulatory composition disclosed herein may be administered in ovo to an embryonated chicken egg or intramuscularly to hatched chicks or even adult birds.
Also provided herein are methods for increasing TLR21-stimulatory activity of an oligonucleotide having at least one CpG motif, comprising fusing the 5′ end of the oligonucleotide to a guanine nucleotide enriched sequence. In some aspects, the guanine nucleotide enriched sequence is a G-quartet sequence. In some aspects, the G-quartet sequence comprises a first plurality of guanine nucleotides. This first plurality of guanine nucleotides may comprise part of a TGGGGT sequence (SEQ ID NO: 265). In some aspects, the first plurality of guanine nucleotides comprises three to eight guanine nucleotides. In still other aspects, the G-quartet sequence comprises TTAGGG, TTAGGGTTAGGG (SEQ ID NO:261), TTTTGGGG, GGGGTTTT, GGGGTTTTGGGG (SEQ ID NO:262), TTAGGG, TTAGGGTTAGGGTTTT (SEQ ID NO:263), TGTGGGTGTGTGTGGG (SEQ ID NO: 268), GGAGG, TGGAGGC, or TGGAGGCTGGAGGC (SEQ ID NO:264).
Other embodiments of the present disclosures provide for the guanine nucleotide enriched sequence to comprise a first and a second plurality of guanine nucleotides. In other aspects, the guanine nucleotide enriched sequence comprises a G-wire sequence. In some aspects, the G-wire sequence comprises SEQ ID NO:257 or 258. In still other aspects of the method, the first plurality of guanine nucleotides and the second plurality of guanine nucleotides are separated by at least one nucleotide.
The method as disclosed herein may further comprise, in some embodiments, inserting a linker between the first plurality of guanine nucleotides and the at least one CpG motif. The linker has been described above and may comprise, but is not limited to, at least three nucleotides or a hexaethylene glycol.
The ability of an oligonucleotide to stimulate TLR21 may be further enhanced according to some aspect of the invention by increasing the number of CpG motifs in the oligonucleotide. In some aspects, the at least one CpG motif is a plurality of CpG motifs, and the plurality of CpG motifs comprises two, three, four, or five CpG motifs. Distance between the CpG motifs can influence the oligonucleotide's TLR21 stimulatory properties. For this reason, some aspects of the method disclosed provide for inserting at least one nucleotide or nucleotide analog between the CpG motifs. The at least one nucleotide may be two or three thymine nucleotides.
Other embodiments of the method provide for inserting a spacer between each of the CpG motifs. The spacer must be able to bond to the 3′ terminus of one adjacent nucleotide strand and to the 5′ end of the other nucleotide strand. In some aspects, the spacer is a deoxyribosephosphate bridge, which can be abasic in some aspects.
The spacer, in some aspects, may comprise a carbon chain. In some embodiments the carbon chain comprises two carbon atoms. In some aspects the carbon chain is derived from ethanediol. Other embodiments provide for a carbon chain comprising three carbon atoms. In some aspects, the carbon chain is derived from 1,3-propanediol. In some embodiments, the carbon chain comprises four carbon atoms, and in some aspects the carbon chain is derived from 1,4-butanediol. In still other embodiments, the spacer comprises a repeated chemical unit. In some aspects, the repeated chemical unit is an ethylene glycol, and in some aspects the spacer is derived from hexaethyleneglycol.
Also envisioned in the method to enhance the TLR21 stimulatory properties of an oligonucleotide is incorporating at least one nucleotide analog or lipid moiety in the oligonucleotide. In some aspects, the lipid moiety is at or near the 5′ terminus of the oligonucleotide. Still other embodiments of the method include modifying the nucleotides adjacent to the CpG motif.
The following examples are provided to further describe some of the embodiments disclosed herein. The examples are intended to illustrate, not to limit, the disclosed embodiments.
pNifTy2-SEAP (Invivogen) and other commercially available plasmid vectors are routinely used to generate NFκB pathway reporter gene cell lines. The commercially available form of pNifTy2-SEAP comprises a zeocin resistance gene for bacterial and mammalian selection, which requires large amounts of this cytostatic (up to 400 μg/ml), and the selection is sometimes not reliable. Therefore, the generation of a reporter plasmid with better selection markers, preferably a blasticidin resistance, was initiated.
The open reading frame encoding the pNifty2-SEAP-encoded (secreted embryonic alkaline phosphatase) SEAP gene was synthesized in a human codon-optimized form. The 284 bp region in pNifty2-SEAP upstream the ATG start codon, which encompasses five NFκB recognition sites and an endothelial-leukocyte adhesion molecule (ELAM) promoter site, was also synthesized with the following modification: a KpnI site was constructed immediately upstream the ATG start codon (insertion of the sequence “GGTA”), and further upstream, a sequence was introduced consisting of 5′ to 3′ an EcoRV, an MluI, and an NdeI site. Furthermore, downstream from the stop codon, an NheI site and a second EcoRV site were introduced. Care was taken to avoid the presence of these sites in the SEAP open reading frame.
This synthetic SEAP gene construct (“NFκB-SEAP”) was excised from a cloning vector by MluI/NheI double digest and introduced by ligation into a pcDNA3.1(+) vector (
From this set of constructs, the bsd-containing plasmid pcDNA3.1(+)-bsd-NFκB-SEAP was chosen for HEK293 transfection. To this end, the PvuI-linearized form was introduced into the cells by standard transfection methods and cells with a genome-integrated construct were selected with 10 μg/ml blasticidin. Resistant cell pools were tested for tumor necrosis factor alpha (TNF-α) induced SEAP production, and by single cell cloning, one clonal line (HEK293-NF-03-SEAP-bsd or HEK293-NFκB-bsd) with a particularly advantageous signal-to-noise ratio was chosen for further studies. The EC50 for human TNF-α for this cell line is 3.2 ng/ml (
Chicken toll-like receptor 21 (TLR21) is a non-methylated CpG DNA receptor that is functionally homologous, but not orthologous, to mammalian TLR9 (Brownlie et al. 2009, Keestra et al. 2010). The gene encoding chicken TLR21 was synthesized based on the deduced protein sequence of Genbank accession number NM_001030558 and by optimizing towards human codon usage. Upstream from the start codon ATG, a KpnI site including a Kozak sequence was introduced, while downstream from the stop codon a NotI site and an EcoRV site was added. The TLR21 gene was excised from the cloning vector by KpnI/NotI double digest, gel-purified and ligated into KpnI/NotI-cut mammalian expression vector pcDNA3.1(+). This pcDNA3.1(+)-cTLR21 was linearized with PvuI and transfected together with PvuI-linearized pcDNA3.1(+)-bsd-NFκB-SEAP into HEK293 resulting in HEK293-NFκB-bsd-cTLR21, or HEK293—bsd-cTLR21.
A cell pool was selected by simultaneous application of blasticidin and G418, tested for functional NFκB pathway by TNF-α and for active cTLR21 by phosphorothioate oligonucleotide 2006-PTO (SEQ ID NO:3). Single cell cloning led to a clonal cell line with excellent signal-to-noise ratio in response to 2006-PTO. The clonal HEK293-NFκB-bsd-cTLR21 cell line showed excellent TNF-α sensitivity (EC50=1.4 ng/ml), akin to that observed for HEK293-NFκB-bsd (
Gallus gallus TLR21-Gen (based on NM_001030558)
The phosphorothioate (PTO) oligodeoxynucleotide (ODN) 2006-PTO (ODN 2006) is known to activate TLR21. Keestra, A. M., de Zoete, M. R., Bouwman, L. I., van Putten, J. P., 2010. Chicken TLR21 is an innate CpG DNA receptor distinct from mammalian TLR9. J. Immunol. 185, 460-467. In the clonal TLR21 cell line of this study (HEK293-NFκB-bsd-cTLR21), 2006-PTO was also active, with an EC50 of activation of ˜8.5 nM. By contrast the HEK293-NFκB-bsd did not show any SEAP secretion (
Impact of 3′Deoxyguanine (dG) Additions on TLR21 Recognition of 2006-PDE (ODN2006, Phosphodiester Form)
The phosphodiester-bonded version of 2006-PTO, 2006-PDE, was used as a basis to investigate the effect of 3′-dG modification on the TLR21-stimulatory activity in the HEK293-NFκB-bsd-cTLR21 cell line described in Example 2. To this end, titration experiments were performed starting at 20 nM with 15 dilution steps (1:2) reaching approximately 1 pM as a final dilution. Specifically, HEK293-NFκB-bsd-cTLR21 cells were seeded into 384 well plates at 10,000 cells/well in 45 μl growth medium. These cells were exposed to the oligonucleotide dissolved in growth medium and incubated at 37° for 3-4 days. 10 μl of culture supernatant per well was transferred to a 384 well plate and 90 μl of 50 mM NaHCO3/Na2CO3, 2 mM MgCl2, 5 mM para-nitrophenylphosphate (pNP) pH 9.6 were added and reaction rates were determined by kinetic measurement of the temporal changes of the optical density at 405 nM (mOD405 nm/min).
While as expected, 2006-PTO stimulated TLR21 in the nanomolar range, 2006-PDE showed no significant TLR21-stimulatory activity. Addition of one dG at the 3′ end led to some marked TLR21-stimulatory activity in the nM range, which was still present with a second (dG2) and a third (dG3) dG addition, albeit much weaker. Addition of a 4th, 5th, 6th, 7th and 8th dG (dG4-dG8) resulted in TLR21 inactive ODNs (
Impact of 5′ dG Additions on TLR21 Recognition of 2006-PDE (ODN2006, Phosphodiester Form)
The phosphodiester-bonded version of 2006-PTO, 2006-PDE, was used as a basis to investigate the effect of 5′-dG modification on the TLR21-stimulatory activity. To this end, titration experiments were performed starting at 20 nM with 15 dilution steps (1:2) reaching approximately 1 pM as a final dilution.
2006-PTO stimulated TLR21 in the nanomolar range and 2006-PDE showed no significant TLR21-stimulatory activity. Addition of one dG and two Gs at the 5′-end of 2006-PDE led to some minor TLR21-stimulatory activity in the double digit nM range. A third dG (dG3) led to a dramatic increase of TLR21 activity, with a calculated EC50 of 513 picoMolar (pM) (Table 3). Addition of a 4th dG further 14-fold increased activity (calculated EC50 of 36 pM, Table 3), while a 5th, 6th, 7th and 8th dG (dG4-dG8) resulted in a further EC50 increase and a TLR21 stimulatory plateau with EC50's between 17.1 and 22.2 pM. Taken together, it appears that after the addition of 3dGs, but not yet two dGs, at the 5′ end, some fundamental change in ODN structure happens, that leads to a massive increase of TLR21 activity, from almost inactivity to strong picomolar activity, that is further increased by additional 5′ dGs. The equivalent additions of dGs at the 3′ end do not lead to high activity, the corresponding ODN derivatives are largely inactive (compare
To investigate the electrophoretic migration behavior of the ODNs tested on TLR21, 16% TBE polyacrylamide gel electrophoresis was performed, followed by methylene blue staining. In the case of 2006-PDE-5dG0-8, there is a clear correlation between the appearance of higher order structures (
Further Examination of the Dependence on 5′ Guanine Runs of the Potent TLR21 Stimulation Using the Example 2006-PDE-5dG6.
2006-PDE-5dG6 was picked as an example, because it appeared to be forming the plateau of TLR21 stimulatory activity in the 5′dG, scan of 2006-PDE (see
When 2006-PDE is modified with dN6 at the 5′ end, every base homomer yields some increase of TLR21 activity in the order of improvement: dA6<dC6<dT6<<<<<<<<dG6 (
Examination of the Dependence on the Presence of CpG Elements of the Potent TLR21 Stimulation by 5′-dG-Modified 2006-PDE Using the Example 2006-PDE-5dG6.
2006-PDE-5dG6 was picked as an example, because it appeared to be forming the plateau of TLR21 stimulatory activity in the 5′dG, scan of 2006-PDE (see
Every modification investigated here that interferes with the integrity of the CpG motifs in 2006-PDE-5dG6 leads to a massive loss of activity (
Examination of the Impact of 3′- and 5′-dG6 Modifications of 2006-PTO on TLR21 Stimulatory Activity and Comparison to Equivalent Changes in 2006-PDE.
To investigate whether the TLR21-stimulatory activity improvement by dG run addition also applies to oligodeoxynucleotides with phosphorothioate backbone (PTO-ODNs), the PTO congeners of 2006-PDE, 2006-PDE-3dG5 and 2006-PDE-5dG6 were synthesized (Table 6), and their ability to stimulate TLR21 using HEK293-NFκB-bsd-cTLR21 cells as described in Example 3 was compared with each other and their PDE-versions (Table 7,
In the absence of 5′ dG residues, PTO modification confers much higher activity to ODNs compared to the PDE versions (Table 7,
Examination of the Impact of dA Replacements in the 5dG6 Run of 2006-PDE-5dG6 on TLR21 Stimulatory Activity.
Based on the hypothesis that the consecutive dG sequences 5′ of 2006-PDE form G-quartets conferring TLR21-stimulatory activity, it was predicted that dA replacements in a dG6 run expected to disrupt G-quartet formation should have, depending on the position, a negative impact on TLR21 stimulatory activity. To this end, single and double dA replacement 2006-PDE-5dG6 ODNs were synthesized using methods familiar to those in the art and tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3 (Tables 8 and 9,
In general, all dA replacements within the dG6 run led to little changes in Vmax (i.e., the maximal reporter gene readout obtained in comparative experiments), while the EC50 varied considerable up to more than two orders of magnitude (Table 9 and
Examination of the Impact of dC Replacements in the 5dG6 Run of 2006-PDE-5dG6 on TLR21 Stimulatory Activity.
Based on the hypothesis that the consecutive dG sequences 5′ of 2006-PDE form G-quartets conferring TLR21-stimulatory activity, it was predicted that dC replacements in a dG6 run expected to disrupt G-quartet formation should have, depending on the position, a negative impact on TLR21 stimulatory activity. To this end, single and double dC replacement 2006-PDE-5dG6 ODNs were synthesized and tested for their ability to stimulate TLR21 as explained in Example 3. (Table 10, Table 11,
In general, all dC replacements within the dG6 run led to little changes in Vmax (i.e., the maximal reporter gene readout obtained in comparative experiments), while the EC50 varied considerable up to more than two orders of magnitude (Table 11 and
Examination of the Impact of dT Replacements in the 5dG6 Run of 2006-PDE-5dG6 on TLR21 Stimulatory Activity.
Based on the hypothesis that the consecutive dG sequences at the 5′ terminus of 2006-PDE form G-quartets conferring TLR21-stimulatory activity, it was predicted that dT replacements in a dG6 run expected to disrupt G-quartet formation should have, depending on the position, a negative impact on TLR21 stimulatory activity. To this end, single and double dT replacement 2006-PDE-5dG6 ODNs were synthesized and tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3 (Table 12, Table 13,
In general, all dT replacements within the dG6 run led to little changes in Vmax, while the EC50 varied considerably, up to more than three orders of magnitude (Table 13 and
These data indicate that a consecutive run of four dGs is essential for high TLR21 stimulatory activity and disruption of the four dG run by any other nucleotide results in a dramatic loss of activity.
Examination of the Impact of dA Replacements in the 5dG4 Run of 2006-PDE-5dG4 on the TLR21 Stimulatory Activity.
To more stringently test the hypothesis that 5′-dG4 is necessary and sufficient to confer high level stimulatory activity to 2006-PDE, dG moieties in 2006-PDE-5dG4 were systematically replaced by dA and the various derivatives were tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3 (Table 14, Table 15,
All dA replacements within the dG4 run led to losses of TLR21 stimulatory activity. Somewhat surprising, a dramatic change in TLR21 stimulatory activity was noted in position 1, to the extent that an EC50 could not be calculated (Table 15 and
Examination of the Impact of dC Replacements in the 5dG4 Run of 2006-PDE-5dG4 on TLR21 Stimulatory Activity.
To test more stringently the hypothesis that 5′-dG4 is necessary and sufficient to confer high level stimulatory activity to 2006-PDE, dG moieties in 2006-PDE-5dG4 were systematically replaced by dC and the various derivatives were tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3 (Table 16, Table 17,
All dC replacements within the dG4 run led to losses of TLR21 stimulatory activity. A marked loss in TLR21 stimulatory activity was noted in position 1, with an EC50 increase of factor 89 (Table 17 and
Examination of the Impact of dT Replacements in the 5dG4 Run of 2006-PDE-5dG4 on TLR21 Stimulatory Activity.
To test more stringently the hypothesis that the 5′-dG4 motif is necessary and sufficient to confer high level stimulatory activity to 2006-PDE, dG moieties in 2006-PDE-5dG4 were systematically replaced by dT and the various derivatives were tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3 (Table 18, Table 19,
All dT replacements within the dG4 run led to losses of TLR21 stimulatory activity. A somewhat surprising and dramatic change in TLR21 stimulatory activity was observed for position 1, to the extent that an EC50 could not be calculated (Table 19 and
As
Impact of 5′-dG4 and 5′-dG6 Addition to CpG-Containing PDE-ODNs on Conferring TLR21 Stimulatory Activity.
Eleven CpG-containing oligodeoxynucleotide sequences implicated in the literature as stimulatory for mammalian TLR9 (but mostly described as PTO versions) were chosen for synthesis as PDE derivatives (Table 20). TLR21 interaction was unknown for all these PDE ODNs. For five of these PDE ODNs, their 3′-dGS-, 5′-dG4- and 5′-dG6-versions were also synthesized. For one ODN, its 5′-dG4- and 5′-dG6-versions were synthesized; for another, its 3′-dGS- and 5′-dG6-versions were synthesized; while for 4 others, only the corresponding 5′-dG6-versions were synthesized (Table 20). These ODNs were subjected to TLR21 stimulation testing as described in Example 3 (Table 21,
In TLR21 activation tests of the unmodified PDE ODNs (Table 20), only 1826, BW006, D-SLO1 and 2007 showed some minor activity (Table 21,
In contrast, addition of 5′ dG4 (six ODNs) or 5′ dG6 (eleven ODNs) led to increased TLR21 stimulatory activity in each case including nanomolar EC50's in five cases picomolar (pM) EC50 in thirteen other cases (Table 21). Six even had double digit pM EC50 (as low as 20 pM), which is highly remarkable, given that the starting point was near zero. Taken together, the data suggests that potent TLR21 activity can be achieved by attaching dG runs to the 5′-end (but NOT the 3′-end) of previously poorly active or inactive CpG-containing PDE-ODNs.
The data presented here also suggests that the activity gain is connected to the intermolecular formation by the 5′ dGn-modified ODNs of a G-quartet DNA superstructure.
Impact of 5′dG Additions on Mouse TLR9 Recognition of 2006-PDE
The phosphodiester bond version of 2006-PTO, 2006-PDE, was used as a basis to investigate the effect of 5′-dG modification on the stimulatory activity on murine TLR9 and human TLR9. Titration experiments were performed starting at 2000 nM or 5000 nM ODN concentration with 15 dilution steps (1:2) reaching approximately 100 pM or 500 pM as final dilutions. Derivative ODNs of 2006-PTE are described in Table 21-2.
2006-PTO stimulated mouse and human TLR9 in the nanomolar range. 2006-PDE showed only minor mouse or human TLR9-stimulatory activity (
Impact of 3′ dG Additions on Mouse and Human TLR9 Recognition of 2006-PDE
Addition of one to three dGs at the 3′ end of 2006-PDE led minor progressive increases of activity in mouse TLR9 (
For stimulation of human TLR9, addition of one to three dG at the 3′ end of 2006-PDE led to marked progressive increase in stimulatory activity relative to the parental 2006-PDE. Addition of a fourth dG at the 3′ end of the oligonucleotide led to a strong increase in human TLR9 stimulatory activity. This stimulatory effect was slightly improved or preserved upon addition of a 5th, 6th, 7th or 8th 3′ dG (
Collectively, this picture is in stark contrast to the observation that chicken TLR21 stimulatory activity of 2006-PDE is not boosted or even decreased by the addition of 3-8 dGs at the 3′ end. Taken together, the structure-activity relationships for 5′-dG and 3′-dG additions on 2006-PDE with respect to TLR stimulatory activity are fundamentally different for mouse and human (and presumably mammalian) TLR9 compared to chicken (and presumably bird) TLR21. This may reflect the fact that TLR21 is only a functional, but not a true genetic, ortholog of TLR9 in birds.
Test phase I. A number of telomere and promoter sequence elements with proposed G-quartet-forming potential were added to the 5′ end of 2006-PDE. Additionally, 5′ T4-modified 2006-PDE (2006-PDE-T4) was used to determine the ability of HEK293-NFκB-bsd-cTLR21 cells to stimulate TLR21 as described in Example 3 (Table 22).
GGGGTCGTCGTTTTGTCGTTTTGTCGTT
TTAGGGTCGTCGTTTTGTCGTTTTGTCGTT
TTAGGGTTAGGGTCGTCGTTTTGTCGTTTTGTCGTT
TTTTGGGGTCGTCGTTTTGTCGTTTTGTCGTT
GGGGTTTTTCGTCGTTTTGTCGTTTTGTCGTT
GGGGTTTTGGGGTCGTCGTTTTGTCGTTTTGTCGTT
TTAGGGTTTTTCGTCGTTTTGTCGTTTTGTCGTT
TTAGGGTTAGGGTTTTTCGTCGTTTTGTCGTTTTGTCGTT
TGTGGGTGTGTGTGGGTTTTTCGTCGTTTTGTCGTTTTGTCGTT
GGAGGTTTTTCGTCGTTTTGTCGTTTTGTCGTT
TGGAGGCTTTTTCGTCGTTTTGTCGTTTTGTCGTT
TGGAGGCTGGAGGCTTTTTCGTCGTTTTGTCGTTTTGTCGTT
Fusion of human telomere sequences to 2006-PDE and 2006-PDE-T4 resulted in ODNs capable of activating TLR21 with nanomolar (nM) EC50 or even picomolar (pM) activity (Table 23,
2006-PDE fusions with sequence elements of Oxytricha spp. telomeres (a preferred early model species for telomere research, and for G-quartet structure research) were synthesized (Table 22) and tested for their TLR21 stimulatory potential (Table 24,
The Oxytricha spp. telomere sequence elements conferred highly potent TLR21 activity to inactive 2006-PDE. The resulting derivatives were amongst the most potent derivatives identified to this point.
Test phase II. 20 different promoter elements shown or predicted to involve G-quartet formation were selected, and 5′ fusion constructs comprising 2006-PDE and the promoter elements were synthesized (Table 25) for testing in HEK293-NFκB-bsd-cTLR21 cells to determine their ability to stimulate TLR21.
GGGGGGTCGTCGTTTTGTCGTTTTGTCGTT
GCTGCGAGGCGGGTGGGTGGGATCGTCGTTTTGTCGTTTTGTCGTT
GCTGCGGGCGGGTGGGTGGGATCGTCGTTTTGTCGTTTTGTCGTT
CGAGGCGGGTGGGTGGGATCGTCGTTTTGTCGTTTTGTCGTT
CGGGCGGGTGGGTGGGATCGTCGTTTTGTCGTTTTGTCGTT
GGGCGTGGTGGGTGGGGTTCGTCGTTTTGTCGTTTTGTCGTT
GGGGTGGGAGGAGGGTTCGTCGTTTTGTCGTTTTGTCGTT
GGGGTCGGGCGGGCCGGGTGTCGTCGTTTTGTCGTTTTGTCGTT
GGTGGTGGGGGGGGTTGGTAGGGTTCGTCGTTTTGTCGTTTTGTCGTT
GGGTTAGGGTTAGGGTAGGGTCGTCGTTTTGTCGTTTTGTCGTT
TGGGGGGGTGGGTGGGTTCGTCGTTTTGTCGTTTTGTCGTT
GGGCGGGCGGGCGGGCTCGTCGTTTTGTCGTTTTGTCGTT
GGTTGGTGTGGTTGGTCGTCGTTTTGTCGTTTTGTCGTT
GGTGGATGGCGCAGTCGGTCGTCGTTTTGTCGTTTTGTCGTT
TGGGGGTGGACGGGCCGGGTTCGTCGTTTTGTCGTTTTGTCGTT
TGTGGGGGTGGACGGGCCGGGTTCGTCGTTTTGTCGTTTTGTCGTT
GGGTTAGGGTTAGGGTTAGGGTCGTCGTTTTGTCGTTTTGTCGTT
GGGCGCGGGAGGAAGGGGGCGGGTCGTCGTTTTGTCGTTTTGTCGTT
AGGGTGGGGAGGGTGGGGATCGTCGTTTTGTCGTTTTGTCGTT
AGGGAGGGCGCTGGGAGGAGGGTCGTCGTTTTGTCGTTTTGTCGTT
GGGGCGGGCCGGGGGCGGGGTCGTCGTTTTGTCGTTTTGTCGTT
The TLR21 assay revealed that all elements tested conferred activity to the inactive 2006-PDE. Eleven of the twenty elements tested showed potencies exceeding that of TLR21 agonist, 2006-5dG6, with EC50 values below 30 pM, and as low as 15.6 pM (Table 26).
G-quartets (
Test phase I. A number of telomere and promoter sequence elements with proposed G-quartet-forming potential were fused to the 5′ end of 2006-PDE and 2006-PDE-T4 for testing in HEK293-NFκB-bsd-cTLR21 cells to determine their ability to stimulate TLR21 (Table 27).
Particularly interesting in this respect is the formation of a polymeric G-quartet structure from ODN monomers, called a G-wire (
It was previously reported, that the G-rich hexanucleotide TGGGGT (SEQ ID NO: 265) preferentially forms parallel-oriented tetrameric G-quartet structures (Phillips K, Dauter Z, Murchie A I, Lilley D M, Luisi B J, The Crystal Structure of a Parallel-Stranded Guanine Tetraplex at 0.95Å Resolution, J. Mol Biol. 273: 171-182 (1997)), (
GGGGTCGTCGTTTTGTCGTTTTGT
GGGGGGTCGTCGTTTTGTCGTTTT
GGGGTTGGGGTCGTCGTTTTGTCG
GGGGTTGGGGTTTTTCGTCGTTTT
TGGGGTTCGTCGTTTTGTCGTTTT
Addition of GGGGTTGGGG (SEQ ID NO: 257) to the 5′ end of TLR21-inactive 2006-PDE (2006-PDE-Gwire1) led to an ODN with pM EC50, but its activity fell short of the EC50's of 2006-PDE-5dG4 and 2006-PDE-5dG6, which were used as benchmarks in this study (Table 28,
Taken together, two superior, presumably G-quartet sequence elements leading to potent TLR21 stimulatory activity of 2006-PDE were identified in this study. Without being bound by theory, it is likely that the potent TLR21 activating capacity of GGGGTTGGGG (SEQ ID NO: 257) is related to its known potential to form so-called G-wire structures (
Test phase II. The potential for TLR21 stimulation-enhancing activity of the benchmark sequence GGGGGG was tested and compared with the G-wire sequence GGGGTTGGGGTTTT (SEQ ID NO:258), that proved to be superior in the preceding study. To this end, 16 oligonucleotides were designed that were of the general sequence TTTTTTTXCGXTTT (SEQ ID NO:259), where X represented any base (Table 29). The dTs were used to generate an oligonucleotide of acceptable length (14 bases), to encase the tetranucleotide CpG “warhead” in an ODN context, because it generates no problems in synthesis, and because of its low propensity to form unwanted secondary structures. Such short ODNs with only one CpG element and with PDE bonds are expected to be of low TLR21 stimulatory activity. Hence, the starting concentration for testing on TLR21 was raised 50-fold from 20 nM to 1000 nM. These 16 ODNs were also synthesized having 5′-GGGGGG termini and 5′-GGGGTTGGGGTTTT (Gwire2; SEQ ID NO: 258) termini (Table 29) and tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21.
GGGGGGTTTTTTTACGATTT
GGGGGGTTTTTTTGCGATTT
GGGGGGTTTTTTTCCGATTT
GGGGGGTTTTTTTTCGATTT
GGGGGGTTTTTTTACGGTTT
GGGGGGTTTTTTTGCGGTTT
GGGGGGTTTTTTTCCGGTTT
GGGGGGTTTTTTTTCGGTTT
GGGGGGTTTTTTTACGCTTT
GGGGGGTTTTTTTGCGCTTT
GGGGGGTTTTTTTCCGCTTT
GGGGGGTTTTTTTTCGCTTT
GGGGGGTTTTTTTACGTTTT
GGGGGGTTTTTTTGCGTTTT
GGGGGGTTTTTTTCCGTTTT
GGGGGGTTTTTTTTCGTTTT
GGGGTTGGGGTTTTTTTTTTTACGATTT
GGGGTTGGGGTTTTTTTTTTTGCGATTT
GGGGTTGGGGTTTTTTTTTTTCCGATTT
GGGGTTGGGGTTTTTTTTTTTTCGATTT
GGGGTTGGGGTTTTTTTTTTTACGGTTT
GGGGTTGGGGTTTTTTTTTTTGCGGTTT
GGGGTTGGGGTTTTTTTTTTTCCGGTTT
GGGGTTGGGGTTTTTTTTTTTTCGGTTT
GGGGTTGGGGTTTTTTTTTTTACGCTTT
GGGGTTGGGGTTTTTTTTTTTGCGCTTT
GGGGTTGGGGTTTTTTTTTTTCCGCTTT
GGGGTTGGGGTTTTTTTTTTTTCGCTTT
GGGGTTGGGGTTTTTTTTTTTACGTTTT
GGGGTTGGGGTTTTTTTTTTTGCGTTTT
GGGGTTGGGGTTTTTTTTTTTCCGTTTT
GGGGTTGGGGTTTTTTTTTTTTCGTTTT
GGGGTTGGGGTTTT
The sixteen 14-mer ODNs comprising all potential permutations of tetranucleotides with a central CpG were largely inactive on TLR21 up to 1000 nM concentration, with the exception of the ACGC-containing and the CCGC-containing species (ODNs 9 and 11, respectively), which showed a detectable signal at the highest concentration.
Addition of dG6 (GGGGGG) to the 5′ end of basal ODNs (SEQ ID NOs:144-159) led to some TLR21 stimulatory activity in most cases, with the exception of CCGA (ODN 19), CCGG (ODN 23), GCGC (ODN 26), and CCGT (ODN 31) (
Addition of Gwire2 (GGGGTTGGGGTTTT (SEQ ID NO:258)) to the 5′ end of basal ODNs (SEQ ID NOs:144-159) led to TLR21 stimulatory activity in all the cases, where 5dG6 succeeded, and in addition for CCGA (ODN 35), CCGG (ODN 39) and GCGC (ODN 42), while CCGT (ODN 47) remained refractory (
The CpG-containing sequence elements GCGA, GCGG, ACGC, CCGC GCGT, and perhaps also TCGC, have not previously been described in the context of TLR21 activation.
XCGA series. None of the 14-mers from the XCGA series shows any TLR21 activity up to 1000 nM. Addition of 5′-dG6 leads to some activity of GCGA>ACGA>TCGA, while CCGA remains inactive. Most remarkably, addition of 5′-Gwire2 leads to TLR21 activity for all four derivatives. A dramatic increase in TLR21 activity is noted for GCGA, while the others have increased activity in the relative order TCGA>ACGA>CCGA (
XCGG series. Two of the 14-mers from the XCGG series show minor, if any, TLR21 activity at 1000 nM (GCGG, TCGG), while the other two oligonucleotides are inactive. Addition of 5′-dG6 leads to some activity of GCGG>ACGG>=TCGG, while CCGG remains inactive. Most remarkably, addition of 5′-Gwire2 leads to TLR21 activity for all four derivatives. A dramatic increase in TLR21 activity is noted for GCGG, while the others have increased activity in the relative order TCGG>ACGG>CCGG (
XCGC series. Two of the 14-mers from the XCGC series show minor, if any, TLR21 activity at 1000 and 500 nM (ACGC, CCGC), while the other two are inactive. Addition of 5′-dG6 leads to strong activity of TCGC>ACGC>CCGC, while GCGC remains inactive. Most remarkably, addition of 5′-Gwire2 leads once again to TLR21 activity for all four derivatives. A massive increase in TLR21 activity is noted for TCGC>ACGC>CCGC, in that order of activity, while GCGC remains weak (
XCGT series. None of the 14-mers from the XCGT series shows any TLR21 activity up to 1000 nM (
The investigations of SAR of GCGT-Gwire2 included modifying the central CpG element by inversion (GC), and pyrimidine-pyrimidine (TG) as well as purine-purine (CA) exchange (Table 30). Testing of these derivatives in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3 revealed a complete loss of activity after these manipulations (Table 31,
The number of dTs between the Gwire2 element and the GCGT element was also decreased (Table 30), and the corresponding ODNs were tested:
The results from deletions T1-T4 on GCGT-Gwire2 led to little changes in Vmax, and, except for T3, largely similar EC50 values. However, T5 and T6 deletions led to increased EC50, and, particularly, a decrease in Vmax, suggesting a loss of intrinsic activity (Table 31,
For a third SAR study, the number of Ts flanking the GCGT element at the 3′-end of the ODN was decreased (Table 30), and the corresponding ODNs were tested. The effects were immediately obvious. While loss of one T (eT1) led to a decreased Vmax under preservation of the EC50, loss of two Ts (eT2) increased EC50 and dramatically reduced Vmax, loss of three dTs eliminated the activity altogether (Table 31,
In a fourth experiment, the effect of incorporating an additional GGGGTT motif (GCGT-Gwire3, Table 30) on the intrinsic TLR21-stimulatory activity of GCGT-Gwire2 was investigated. The activity of GCGT-Gwire3 was superior to that of the parental GCGT-Gwire2 (Table 31,
GCGT-Gwire2 showed the expected nanomolar EC50. Addition of a second GCGTTTT element (GCGT-Gwire2-do, Table 32) at the 3′-end led to a massive improvement of EC50 (by a factor of ˜65) and an increase in Vmax (Table 33,
GCGA-Gwire2 showed the expected nanomolar EC50. Addition of a second GCGATTT element (GCGA-Gwire2-do, Table 32) at the 3′-end led to a strong improvement of EC50 (by a factor of ˜24) and an increase in Vmax (Table 33,
ACGC-Gwire2 showed the expected nanomolar EC50. Addition of a second ACGCTTT element (ACGC-Gwire2-do, Table 32) at the 3′-end led to a mild improvement of EC50 (by a factor of ˜8) and an increase in V. (Table 33,
TCGC-Gwire2 showed the expected nanomolar EC50. Addition of a second TCGCTTT element (TCGC-Gwire2-do, Table 32) at the 3′-end led to a strong improvement of EC50 (by a factor of ˜12) and an increase in Vmax (Table 33,
CCGC-Gwire2 showed the expected nanomolar EC50. Addition of a second CCGCTTT element (CCGC-Gwire2-do, Table 32) at the 3′-end led to a massive improvement of EC50 (by a factor of ˜50) as well as Vmax (Table 33,
GCGG-Gwire2 showed only weak signals in the low concentration range considered. Addition of a second GCGGTTT element (GCGG-Gwire2-do, Table 32) at the 3′-end led to a massive improvement of EC50 as well as Vmax (by a factor of −51) (Table 33,
In summary, it is shown that addition of further CpG-containing TLR21-stimulatory sequence elements to oligonucleotides having a Gwire2 sequence and a single CpG element leads to EC50 improvements from a factor of 8 to a factor of 55, while the Vmax is typically doubled. Addition of a third element also uniformly improved TLR21 stimulatory activity further. It appears that this is a generic method to generate high activities from initial simple low activity hits.
The 5′-Gwire2-technology (GGGGTTGGGGTTTT (SEQ ID NO:258)) was used to investigate the TLR21 stimulatory potency of a conceptually simple potential stimulatory sequence: three consecutive CpGs encased by four dTs at the 5′-end and three dTs at the 3′end (Table 34 CG-Gw2-T0). The influence of spacing of the CpG elements on TLR21 stimulatory activity was investigated by stepwise insertion of one, two, three and four dTs between the three CpG elements (resulting in CG-Gw2-T1-CG-Gw2-T4, Table 34). A TLR21 stimulation assay in HEK293-NFκB-bsd-cTLR21 cells to determine the ability of the ODNs in Table 34 to stimulate TLR21 as described in Example 3 was performed, and EC50 and Vmax values calculated (Table 35,
Remarkably, CG-Gw2-TO was completely inactive on TLR21 in the concentration range considered (up to 20 nM), while one spacing dT between the CpGs already led to a strongly stimulatory ODN with an EC50 in the picomolar range. A second dT between the CpGs did not improve activity, but dT3 and dT4 led to EC50 of 16.6 and 11.3 pM, respectively (Table 35,
Does TLR21 Stimulatory Activity Require a Base in the Spacer Group?
An ODN with deoxyribosephosphate bridges (“abasic sites”) between the CpGs, instead of dTs (CG-Gw2-abase) was synthesized. This ODN and the parental CG-Gw2-T1 were tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3 (Table 36,
Surprisingly, CG-Gw2-abase (
Impact of Linear Spacer Groups on TLR21 Activity of CG-Gw2 ODNs
In this study, the dT nucleotide spacing two CpGs in CG-Gw2-T1 was replaced by either a “C18” hexaethyleneglycol linker, or a “C3” propanediol linker (Table 38). These ODNs were tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3
While a C18 spacer, formed by hexaethyleneglycol when inserted between CpG elements of CG-Gw2 (Table 36,
Investigations on the TLR21 Stimulatory Activity of G-Wire and TGGGGT (SEQ ID NO: 265)-Activated C3 Spacer-Connected CpG Structures
In this study, either a GGGGTTGGGG (SEQ ID NO: 257) G-wire (CG-Gw2X2-1) or a TGGGGT (SEQ ID NO: 265) element (CG-G4T16X2-1) was connected to TTTTTTTTCG-X2-CGTTT (SEQ ID NO. 271) (Table 40), and the TLR21 stimulatory potency was assessed. Then, both ODNs were further modified by consecutive additions of a C3-spacers connected to a CpG motifs, yielding ODNs with three, four, and five CpG motifs, each separated by C3 (Table 40). Their activation potency on TLR21 was also assessed in HEK293-NFκB-bsd-cTLR21 cells as explained in Example 3 (Table 41,
In G-wire activation, the first ODN with two CpG motifs separated by C3 showed already picomolar activity (EC50=312 pM), albeit in the triple digit range. A third C3-separated CpG gave an EC50 of 78.5 pM, which compares well with the 96.5 pM determined for a second, separately synthesized batch (see Table 39). Addition of a fourth C3-separated CpG motif gave another 10-fold increase in potency (EC50=7.4 pM). Additions of fifth and sixth C3-separated CpG motifs retained the high potency and even resulted in minor improvement. These single digit picomolar potencies are amongst the highest activities seen so far on TLR21, a remarkable and unexpected feat for structural elements as simple as propanediolphosphate-separated CpG motifs (Table 41,
Investigations of the Impact of Spacer Length and Detailed Chemical Structure on the TLR21 Stimulatory Activity of G-Wire-Activated C3 Spacer-Connected CpG Motifs
In this study, a GGGGTTGGGG (SEQ ID NO: 257) G-wire was connected to TTTTTTTTCG-X-CGXCGTTT (SEQ ID NO:260) (Table 42), and the TLR21 stimulatory potency was assessed. X is a series of alkyldiol-phosphates used to separate CpG motifs (Table 42,
Structurally, the spacing between the 3′-phosphate of one CpG element to the 5′-phosphate of the next CpG element in CG-Gw2-T1 is via three linked carbon atoms from 5′C to 4′C to 3′C (
Based on the finding that 1,3-propanediol is equivalent as a spacer to deoxythymine (dT) or an abasic site (Table 43), that was also already suggested by earlier experiments (Tables 36-39), we investigated the effect of spacer length on TLR21 activity.
The shorter derivative ethanediol (ODN-X2, Table 42,
Does the C3 Spacer Principle Also Function for CpG-Containing Tetranucleotide Structures?
C3 spacer-(1,3-propanediol)-containing TLR21-active ODNs having CpG-containing tetranucleotide structures were examined. To this end, in a first experiment the 5′-G-wire sequence-containing ACGC-Gw2X1, ACGC-Gw2X2, CCGC-Gw2X1 and CCGC-Gw2X2 were synthesized and tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3 (Table 44). This was followed by synthesis and TLR21 testing of the 5′-G4T16-containing ACGC-G4T16X2, and CCGC-G4T16X2 (Table 44).
C3 spacing of CpG tetranucleotide sequences is clearly capable of stimulating TLR21. ACGC-Gw2X2 and CCGC-Gw2X2 (Table 44) displayed TLR21 EC50s (Table 45,
Impact of C3 and C18 Linkers at/in the 5′-G-Rich Sequence of TLR21-Activating ODNs
It was investigated if C3 spacers (1,3-propanediol) or C18 spacers (hexaethyleneglycol, HEG) can improve the activity of TLR21-active 5′-G-quartet-containing ODNs, when placed between the CpG motif and the G-quartet sequence, or when positioned within the G-quartet sequence. Two ODNs based on 2006-PDE5dG4 were synthesized. One with a C18 linker 3′ of downstream the dG4 sequence (2006-PDE5dG4-X1) and one with a C3 linker at the same position (2006-PDE5dG4-X2) (Table 46). Furthermore 2006-G-wire1 was modified by replacing the T's in the GGGGTTGGGG (SEQ ID NO: 257) sequence by either a C18 linker (2006-5dG4-X3) or a C3 linker (2006-5dG4-X4). All these derivatives were tested in HEK293-NFκB-bsd-cTLR21 cells for their ability to stimulate TLR21 as described in Example 3 (Table 47).
In 2006-PDE5dG4, the addition of the C18 spacer between dG4 and 2006-PDE improved TLR21 activity as measure by EC50 more than 6-fold (Table 47,
The impact of the classical 3′-cholesterol modification and the more rarely used 5′-cholesterol modification on TLR21 stimulatory potential of moderately and highly active ODN species was examined.
3′-Cholesterol Modification
A commonly applied 3′-cholesterol modification (
The results suggest that the TLR21-stimulatory activity of both ODNs did not improve upon 3′-cholesterol modification (Table 49,
ODNs comprising a 3′ cholesterol moiety were purchased from Eurofins. The structure of the cholesterol moiety was based on 3′ Cholesterol SynBase™ shown in www_linktech_co_uk/products/modifiers/hydrophobic_group_cholesterol_palmitate_modification/9 69_3-cholesterol-synbase-cpg-1000-110.
5′-Cholesterol Modification (I)
The much less commonly applied 5′-cholesterol modification (
The results of two independent measurements suggest that the TLR21-stimulatory activity of GCGT3-TG4T is massively improved by 5′-cholesterol modification (Table 51,
ODNs comprising a 5′ cholesterol moiety were ordered from Genelink, and the structure of the lipid moiety of these ODNs was based on the structure shown at www_genelink_com/newsite/products/MODPDFFILES/26-6602.pdf. Other ODNs comprising a 5′ cholesterol moiety were ordered from Sigma Aldrich. The structure of the lipid moiety of these ODNs was based the structures shown at www_sigmaaldrich_com/content/dam/sigma-aldrich/docs/Sigma-Aldrich/General Information/1/custom-oligonucleotide-modifications-guide.pdf, pages 85/86. Other ODNs comprising a 5′ cholesterol moiety were ordered from IBA Lifesciences and had a structure based on that shown at www iba-lifesciences com/Services custom oligos custom DNa Non-fluorescent 5-modifications.html.
5′-Cholesterol Modification (I)
A 5′-cholesterol modification (
The results of two independent measurements suggest that the TLR21-stimulatory activity of both GCGT-3-TG4T and GCGT-3-Gw2 is massively improved by 5′-cholesterol modification (Table 53,
5′-Cholesterol Modification (II)
A 5′-cholesterol modification (
The results of two independent measurements suggest that the TLR21-stimulatory activity of both GCGT-3-TG4T and GCGT-3-Gw2 is improved by 5′-cholesterol modification (Table 55,
5′-Cholesterol Modification (III)
A 5′-cholesterol modification (
The 5′-cholesteryl-modified form of GCGT3-TG4T showed highly potent TLR21 stimulatory activity, with single digit pM EC50 values (Table 57,
5′-Cholesterol Modification (IV)
A 5′-cholesterol modification (
The results of two independent measurements suggest that the TLR21-stimulatory activity of CCGC3-Gw2 is improved by 5′-cholesterol modification (Table 59,
To summarize, this is believed to be the first report on increased intrinsic activity of ODNs on TLR21 due to a 5′-cholesteryl modification. This has been shown for GCGT3-TG4T (an ODN newly identified in this study series) in three different batches synthesized by three different suppliers. The TLR21 activity-increasing effect is in addition to the activation due to 5′-G-quartet-forming sequences (such as Gwire2 or TG4T), but does not require them (see GCGT3). The TLR21 activity-increasing effect has also been demonstrated for another CpG-ODN identified in this study series: CCGC3-Gwire2 and CCGC3. The 3′-cholesteryl modification does not have a TLR21 activity-increasing effect. It appears likely that a 5′cholesteryl derivatization has also a stabilizing effect against nuclease degradation. It can be speculated that cholesteryl micelle assembly contributes to the formation of polydentate TLR21 ligands. The 5′ location, as opposed to the 3′ location, is likely to be required for correct orientation of the CpG motifs. Furthermore, it is possible that a 5′ cholesteryl derivatization has a modifying effect on bioavailability in vivo.
Those skilled in the art will appreciate that numerous changes and modifications can be made to the preferred embodiments of the invention and that such changes and modifications can be made without departing from the spirit of the invention. It is, therefore, intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention.
The disclosures of each patent, patent application, and publication cited or described in this document are hereby incorporated herein by reference, in their entirety.
To determine the suitability and efficacy of ODN1, ODN2, and ODN3 as immune stimulants, each was tested in three different concentrations.
The following immune stimulants were investigated:
Each immune stimulant was added to an oil emulsion containing a suboptimal concentration of an inactivated Newcastle disease virus (NDV) according to Table 61. For the preparaton of the suboptimal NDV vaccine, the NDV antigen batch was diluted 50 times in NDV-negative allantoic fluid (AF). The efficacies of ODN1, ODN2, and ODN3 in combination with a suboptimal dosage of a Newcastle disease vaccine were tested in SPF layer chickens (Leghorn). The serological response was measured and compared to the similar suboptimal NDV vaccine without the immune stimulant. The antibody titre was determined at different time points after vaccination to investigate whether the addition of the immune stimulants leads to an earlier immune response. To determine the most optimal dosage of the three ODNs, each was supplemented in three different doses of 100 ng, 1000 ng and 5000 ng to the suboptimal NDV vaccine, resulting in nine immune stimulant groups. Besides these nine immune stimulant groups, five control groups were incorporated in this study, consisting of a suboptimal NDV vaccine without immune stimulant group, the non-diluted NDV vaccine group, a negative control group (immune stimulants in combination with adjuvant) and two positive control groups with polyinosinic:polycytidylic acid (poly I:C) at two different concentrations (Table 60).
The following parameters were tested: health of the chickens (data not shown) and serology by the Haemagglutination inhibition (HI) assay.
Chickens enrolled in treatment groups T01-T14 received the Test Article or Control Item according to the study design. In groups T13 and T14, nine instead of ten chickens per group were vaccinated due to the loss of two animals before the start of the study.
Chickens allocated to treatment groups T01, T02, T03, T04, T05, T06, T07, T08 and T09 were vaccinated with a suboptimal NDV suspension containing 1 of 3 different immune stimulants (ODNs), each in 3 different concentrations (100, 1000, 5000 ng/dose). For the preparation of the water in oil emulsions, the NDV antigen suspension and immune stimulant (water phase) were formulated together with the adjuvant Stimune (oil phase) at a ratio of 4:5 (Table 61).
Chickens allocated to control group of T10 were vaccinated with a suboptimal NDV suspension without immune stimulant in adjuvant (Stimune) at a ratio of 4:5.
Chickens allocated to control group of T11 were vaccinated with a non-diluted NDV suspension without immune stimulant in adjuvant (Stimune) at a ratio of 4:5.
Chickens allocated to group T12 were vaccinated with immune stimulant 1 (3 chickens), immune stimulant 2 (3 chickens) or immune stimulant 3 (3 chickens) in adjuvant (Stimune) at a ratio of 4:5. One chicken was vaccinated with dilution buffer in adjuvant (Stimune).
Chickens allocated to control groups of T13 (n=9) and T14 (n=9) were vaccinated with a suboptimal NDV suspension in combination with Poly I:C in two concentrations (10,000 ng and 100 μg) in adjuvant (Stimune) at a ratio of 4:5.
Test Article or Control Item Administration
The inactivated NDV strain Ulster suspension stored at −70° C. was thawed and diluted 50 times in negative allantoic fluid to create the suboptimal vaccine dose. Immune stimulants were added according to the study design. The resulting water phases were mixed with Stimune in a ratio of 4:5 according to the vaccination preparation scheme shown in Table 61. During preparation, all vaccine ingredients with the exception of the Stimune adjuvant were placed in melting ice. The formulated vaccines were injected (0.5 ml, intramuscular) directly after preparation.
General health was monitored by an experienced bio-technician daily from day of arrival until the end of the study.
Serum Blood Sampling
Blood samples for serology were collected from all chickens on study days 0 (prior to vaccination), 7, 14 and 21. Blood samples were labelled with the study number, a unique sample identification and the date of collection. Depending on the amount of the drawn blood volume, sera were aliquoted in two aliquots of approximately 0.5 ml and stored at −20±5° C.
Haemagglutination Inhibition (HI) Assay
In brief, dilution series of sera were incubated with 8 HAU (haemagglutinating units) of NDV strain Ulster at room temperature for 60 minutes. The HAU were titrated before each assay. Thereafter, chicken erythrocytes were added and agglutination was scored after incubation at 4° C. for 45 minutes. A negative control serum and three positive control sera, with low, intermediate and high antibody titres were included in each assay.
The HI titre results were expressed as the reciprocal of the highest serum dilution completely inhibiting agglutination, which were logarithmically transformed to the final Log 2 titres.
Statistics
Logarithmically transformed HI results were summarized per animal (see Tables 62-65). Per treatment group, the mean and standard deviation of the antibody titres were calculated. The statistical analysis was performed with the non-parametric Mann-Whitney t-test.
Results
No clinical symptoms or adverse events related to the vaccination were observed in any group. All chickens appeared healthy during the entire study period.
Two chickens, however, were scored with minor injuries due to pecking behaviour, which started 6 days before the start of the study. On the day of vaccination these chickens were allocated to the Poly I:C groups T13 (#11658) and T14 (#11676). Recovery took place within one week after vaccination.
ODN1, GCGT3-TG4T-5Chol
The individual HI results expressed as Log 2 titres of the 100 ng, 1000 ng and 5000 ng ODN1 dose groups are indicated in Table 62. The mean HI titres and standard deviation of these groups are indicated in
The GCGT3-TG4T-5Chol groups showed significantly higher HI titres compared to the diluted NDV vaccine (mean HI titre: 4.8 Log 2/SD 1.0). At day 14 pv this was the case for all three doses; 100 ng: mean HI titre 6.2 Log 2/SD 1.4 (p=0.0214), 1000 ng: mean HI titre 6.9 Log 2/SD 1.1 (p=0.0003) and 5000 ng: mean HI 5.9 Log 2/SD 0.7 (p=0.0243).
At day 21 pv, however, no significant differences were observed for all concentrations; 100 ng: mean HI titre 6.9 Log 2/SD 0.8 (p=0.1995); 1000 ng: mean HI titre 7.3 Log 2/SD 0.9 (p=0.0527); and 5000 ng: mean HI 6.7 Log 2/SD 0.9 (p=0.4523) when comparing to the NDV vaccine; HI titre 6.2 Log 2/SD1.0. (
ODN2, GCGT3-TG4T
The individual HI results expressed as Log 2 titres of the 100 ng, 1000 ng and 5000 ng ODN1 dose groups are indicated in Table 63. The mean HI titres and standard deviation of these groups are indicated in
The ODN2, GCGT3-TG4T groups showed significantly higher HI titres compared to the diluted NDV vaccine (mean HI titre: 4.8 Log 2/SD 1.0). This was the case at day 14 post vaccination for all three doses; 100 ng: mean HI titre 7.1 Log 2/SD 1.2 (p=0.0003), 1000 ng: mean HI titre 6.4 Log 2/SD 0.7 (p=0.0027) and 5000 ng: mean HI titre 6.1 Log 2/SD 1.1 (p=0.0236). At day 21 significant differences were only observed at the 100 ng dose with a mean HI titre of 7.6 Log 2/SD 0.8 (p=0.0083) when compared to the NDV vaccine (HI titre 6.2 Log 2/SD 1.0). The mean HI titres for the 1000 ng and 5000 ng were 7.1 Log 2/0.6 (p=0.0696) and 7.2 Log 2/SD 1.0 (p=0.0956) respectively (
ODN3, 2006-PTO
The individual HI results expressed as Log 2 titres of the 100 ng, 1000 ng and 5000 ng ODN1 dose groups measured are indicated in Table 64. During the triplicate HI assay performance an outlier result was observed for animal 11570 on day 21, this was most likely caused by a pipetting error (not enough AF added) and therefore this result was omitted from the final analysis (highlighted in Table 64). Thus, for this animal and date the mean HI titre was based on the duplicate measurement.
The mean HI titres and standard deviation of these groups are indicated in
The ODN3, 2006-PTO groups showed significantly higher HI titres compared to the diluted NDV vaccine (mean HI titre: 4.8 Log 2/SD 1.0). This was the case at day 14 post vaccination for two doses; 1000 ng: mean HI titre: 6.3 Log 2/SD 1.2 (p=0.0081) and 5000 ng: mean HI titre: 6.2 Log 2/SD 0.8 (p=0.0059). The mean HI titre of the 100 ng dose was 5.3 Log 2/SD 0.5 (p=0.2090). At day 21 pv significant differences were only measured at the 5000 ng: mean HI titre 7.3 Log 2/SD 0.6 (p=0.0296). No significant differences were observed at the 100 ng and 1000 ng doses, with mean HI titres of 6.6 Log 2/SD 0.5 (p=0.7183) and 6.8 Log 2/SD 1.1 (p=0.1685) respectively, when comparing to the NDV vaccine; HI titre 6.2 Log 2/SD 1.0 (
Control Groups
The individual HI results expressed as Log 2 titres of the 10 μg and 100 μg Poly I:C dose groups, the diluted and non-diluted NDV vaccines and the negative control groups are indicated in Table 65. The mean HI titres and standard deviation of these groups are indicated in
For Poly I:C, the positive control groups, significantly higher HI titres were only observed at the 100 μg dose: HI titre 7.5 Log 2/SD 0.4 at day 21 (p=0.0053) when compared with the NDV vaccine (6.2 Log 2/SD 1.0). The mean HI titres at day 14 pv of the 10 μg and 100 μg dose groups were 5.8 Log 2/SD 1.3 (p=0.1859) and 5.5 Log 2/SD 0.8 (p=0.1609) respectively. The mean HI titre of the 10 μg dose group at day 21 pv was 6.4 Log 2/SD 1.3 (p=0.7273). Significant differences (p<0.0001) were observed between the non-diluted NDV vaccine (8.3/SD 0.5 and 8.5 Log 2/SD 0.7) and the negative control group compared to the diluted NDV group at days 14 and 21 post vaccination (4.8/SD 1.0 and 6.2 Log 2/SD 1.0, respectively) (
The goal was to study adjuvant activity of three different immune stimulants. This was tested by measuring the serological response after vaccination with oil emulsion vaccines containing a suboptimal concentration of inactivated NDV and different concentrations of one of three different immune stimulants.
The following immune stimulants were investigated:
The backbones of ODN1 and ODN2 immune were phosphodiester-linked, while the backbone of ODN3 was phosphorothioate-linked. The efficacy of each ODN was determined at three different doses; 100 ng, 1000 ng and 5000 ng, supplemented to the suboptimal NDVvaccine.
The serological response was determined at days 0 (prior to vaccination), 7, 14 and 21 after vaccination to investigate whether the addition of these immune stimulants may also lead to an earlier immune response. On days 0 and 7 post vaccination (pv) no antibody levels against NDV were detected, with the exception of one animal (#11618) in the non-diluted NDV vaccine group at day 7.
The serological response expressed as Log 2 HI titres showed significant differences (p<0.0001) between the non-diluted and the suboptimal NDV vaccines at days 14 and 21 pv, indicating that the dilution factor of 50 times was sufficient to create the suboptimal vaccine dose.
The negative control group remained negative during the entire study, indicating that the immune stimulants without NDV vaccine did not result in a non-specific immune response.
The positive control Poly I:C 100 μg dose group showed significantly higher HI titres compared to the naïve NDV vaccine at day 21 (p=0.0053), indicating that this dose group served as a valid positive control group.
The GCGT3-TG4T-5Chol (ODN1) group showed significantly higher HI titres when compared to the diluted NDV vaccine at day 14 pv for all three doses; 100 ng (p=0.0214), 1000 ng (p=0.0003) and 5000 ng (p=0.0243). At day 21 pv, however, no significant differences were observed.
The GCGT3-TG4T (ODN2) group showed significantly higher HI titres when compared to the diluted NDV vaccine at day 14 pv for all three doses; 100 ng (p=0.0003), 1000 ng (p=0.0027) and 5000 ng (p=0.0236). At day 21 significant differences (p=0.0083) were only measured at the 100 ng dose group.
The 2006-PTO (ODN3) group showed significantly higher HI titres compared to the diluted NDV vaccine at day 14 pv for two doses; 1000 ng (p=0.0081) and 5000 ng (p=0.0059). At day 21 pv significant differences (p=0.0296) were only measured at the 5000 ng dose group.
In conclusion, the highest mean HI titres were observed with the 100 ng GCGT3-TG4T (ODN2) dose group, 7.1 Log 2 (14 days pv) and 7.6 Log 2 (21 days pv), indicating an increase in titres when compared to the naïve NDV vaccine of 2.3 Log 2 and 1.4 Log 2 at day 14 and 21 pv, respectively.
The titres of the 1000 ng GCGT3-TG4T-5Chol (ODN1) dose group, 6.9 Log 2 and 7.3 Log 2, at day 14 and 21 pv respectively were almost similar to the ODN2 group. At day 14 pv no significant difference (p=0.7513) between ODN1 and ODN2 groups was observed.
The titres of the 5000 ng 2006-PTO (ODN3) dose group were 6.2 Log 2 and 7.3 Log 2 at day 14 and 21 pv, respectively. At day 14 pv, the ODN3 group significantly differed (p=0.0300) from both the ODN1 and ODN2 groups (
At day 21 pv no significant differences between all ODN groups were shown.
These results therefore indicate that all ODNs were capable of significantly increasing the serological response, especially on day 14 after vaccination, also indicating an earlier onset of immunity.
For further illustration, additional non-limiting embodiments of the present disclosure are set forth below.
For example, embodiment 1 is an immunostimulatory oligonucleotide comprising at least one CpG motif and a guanine nucleotide enriched sequence beginning at or within four nucleotides of the 5′ terminus of the oligonucleotide.
Embodiment 2 is the oligonucleotide of embodiment 1, wherein the guanine nucleotide enriched sequence comprises a first plurality of guanine nucleotides.
Embodiment 3 is the oligonucleotide of embodiment 2, wherein the first plurality of guanine nucleotides comprises three to eight guanine nucleotides.
Embodiment 4 is the oligonucleotide of embodiment 3, wherein the oligonucleotide comprises SEQ ID NO: 16, 17, 18, 19, 20, 21, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 77, 78, 81, 82, 85, 86, 89, 90, 92, 93, 96, 97, 100, 102, 104, 106, 108, 143, or 252.
Embodiment 5 is the oligonucleotide of any one of embodiment s 1 to 3, wherein the guanine nucleotide enriched sequence comprises TTAGGG, TTAGGGTTAGGG (SEQ ID NO:261), TTTTGGGG, GGGGTTTT, GGGGTTTTGGGG (SEQ ID NO:262), TTAGGG, TTAGGGTTAGGGTTTT (SEQ ID NO:263), TGTGGGTGTGTGTGGG (SEQ ID NO: 268), GGAGG, TGGAGGC, TGGAGGCTGGAGGC (SEQ ID NO:264), or TGGGGT (SEQ ID NO:265).
Embodiment 6 is the oligonucleotide of any one of embodiment s 1 to 3, wherein the oligonucleotide comprises SEQ ID NO: 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 124, 125, 126, 127, 129, 130, 131, 134, 136, 137, or 138.
Embodiment 7 is the oligonucleotide of any one of the preceding embodiments 1-6 further comprising a second plurality of guanine nucleotides between the first plurality of guanine nucleotides and the at least one CpG motif.
Embodiment 8 is the oligonucleotide of any one of embodiments 2 to 7, wherein the first plurality of guanine nucleotides, the second plurality of guanine nucleotides, or both comprise a G-quartet sequence.
Embodiment 9 is the oligonucleotide of embodiment 8, wherein the G-quartet sequence is an interaction site for other G-quartet sequences.
Embodiment 10 is the oligonucleotide of embodiment 9, wherein the G-quartet sequence comprises TGGGGT (SEQ ID NO: 265).
Embodiment 11 is the oligonucleotide of embodiment 7 wherein the first and second pluralities of guanine nucleotides comprise a G-wire sequence.
Embodiment 12 is the oligonucleotide of embodiment 11 the G-wire sequence is an interaction site for other G-wire sequences.
Embodiment 13 is the oligonucleotide of embodiment 10 or 11, wherein the G-wire sequence comprises SEQ ID NO:257 or 258.
Embodiment 14 is the oligonucleotide of embodiment 11 or 12, wherein the oligonucleotide comprises SEQ ID NO:141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 252, or GCGT-Gwire3.
Embodiment 15 is the oligonucleotide of any one of embodiments 7 to 14, wherein the first plurality of guanine nucleotides and the second plurality of guanine nucleotides are separated by at least one nucleotide.
Embodiment 16 is the oligonucleotide of any one of embodiment s 1 to 3, further comprising a linker between the first plurality of guanine nucleotides and the at least one CpG motif.
Embodiment 17 is the oligonucleotide of embodiment 16, wherein the linker comprises at least three nucleotides.
Embodiment 18 is the oligonucleotide of embodiment 16 or 17, wherein the linker comprises a hexaethyleneglycol, triethyleneglycol, propanediol, or derivatives thereof.
Embodiment 19 is the oligonucleotides of any one of embodiments 16 to 18, wherein the oligonucleotide comprises 2006-PDE5dG4-X1 or 2006-PDE5dG4-X3.
Embodiment 20 is the oligonucleotide of any one of the preceding embodiments 1-19, wherein the at least one CpG motif is a plurality of CpGmotifs.
Embodiment 21 is the oligonucleotide of embodiment 20, wherein the plurality of CpG motifs comprises two, three, four, or five CpG motifs.
Embodiment 22 is the oligonucleotide of embodiment 20 or 21, wherein each CpG motif is separated from the other CpG motifs by at least one nucleotide or nucleotide analog.
Embodiment 23 is the oligonucleotide of embodiment 22, wherein the at least one nucleotide is one to four thymine nucleotides.
Embodiment 24 is the oligonucleotide of embodiment 22 or 23, wherein the oligonucleotide comprises SEQ ID NO:217, 218, 219, or 220.
Embodiment 25 is the oligonucleotide of embodiment 20, wherein each of the CpG motifs is separated from the other CpG motifs by a spacer.
Embodiment 26 is the oligonucleotide of embodiment 25, wherein the spacer is a deoxyribosephosphate bridge.
Embodiment 27 is the oligonucleotide of embodiment 26, wherein the deoxyribosephosphate bridge is abasic.
Embodiment 28 is the oligonucleotide of embodiment 27, wherein the oligonucleotide comprises SEQ ID NO:221.
Embodiment 29 is the oligonucleotide of embodiment 25, wherein the spacer comprises a carbon chain.
Embodiment 30 is the oligonucleotide of embodiment 29, wherein the carbon chain comprises two carbon atoms.
Embodiment 31 is the oligonucleotide of embodiment 30, wherein the carbon chain is derived from ethanediol.
Embodiment 32 is the oligonucleotide of embodiment 31, wherein the oligonucleotide comprises ODN-X2, wherein X2 is ethanediol.
Embodiment 33 is the oligonucleotide of embodiment 29, wherein the carbon chain comprises three carbon atoms.
Embodiment 34 is the oligonucleotide of embodiment 33, wherein the carbon chain is derived from 1,3-propanediol.
Embodiment 35 is the oligonucleotide of embodiment 33 or 34, wherein the nucleotide comprises CG-Gw2X2, Gw2X2-2, or ODN-X3, CG-Gw2X2-1, CG-Gw2X2-3, CG-Gw2X2-4, CG-Gw2X2-5, CG-G4T16X2-1, CG-G4T16X2-2, CG-G4T16X2-3, CG-G4T16X2-4, or CG-G4T16X2-5, wherein X2 is a three carbon chain; 2006-PDE5dG4-X2 wherein X2 is a three carbon chain derived from propanediol; or 2006-PDE5dG4-X4, wherein X4 is a three carbon chain derived from propanediol.
Embodiment 36 is the oligonucleotide nucleotide of embodiment 29, wherein the carbon chain comprises four carbon atoms.
Embodiment 37 is the oligonucleotide of embodiment 36, wherein the carbon chain is derived from 1,4-butanediol.
Embodiment 38 is the oligonucleotide of embodiment 36 or 37, wherein the oligonucleotide comprises ODN-X4, wherein X4 is a four carbon chain derived from 1,4-butanediol.
Embodiment 39 is the oligonucleotide of embodiment 25, wherein the spacer comprises a repeated chemical unit.
Embodiment 40 is the oligonucleotide of embodiment 39, wherein the repeated chemical unit is an ethylene glycol.
Embodiment 41 is the oligonucleotide of embodiment 39 or 40, wherein the oligonucleotide comprises CCGC-Gw2X1, wherein X1 is a spacer derived from hexaethyleneglycol.
Embodiment 42 is the oligonucleotide of any one of the preceding embodiments 1-41 further comprising at least one nucleotide analog.
Embodiment 43 is the oligonucleotide of any one of the preceding embodiments 1-42 further comprising a phosphodiester backbone.
Embodiment 44 is the oligonucleotide of any one of the preceding embodiments 1-43 further comprising a phosphorothioate backbone.
Embodiment 45 is the oligonucleotide of any one of the preceding embodiments 1-44 further comprising a lipid moiety.
Embodiment 46 is the oligonucleotide of embodiment 45, wherein the lipid moiety is a cholesterol.
Embodiment 47 is the oligonucleotide of embodiment 45 or 46, wherein the lipid moiety is at or near the 5′ terminus of the oligonucleotide.
Embodiment 48 is the oligonucleotides of any one of the preceding embodiments 1-47, wherein the CpG motif comprises a CpG sequence element having at least four nucleotides.
Embodiment 49 is the oligonucleotide of embodiment 48 comprising at least two CpG sequence elements.
Embodiment 50 is the oligonucleotide of embodiment 48 or 49 comprising at least three CpG sequence elements.
Embodiment 51 is the oligonucleotides of any one of embodiments 48 to 50, wherein the CpG sequence elements are GCGA, GCGG, ACGC, CCGC, GCGT, TCGC, or any combination thereof.
Embodiment 52 is the oligonucleotide of any one of the preceding embodiments 1-51 further comprising a tri-thymine nucleotide 3′ terminal end.
Embodiment 53 is the oligonucleotide of embodiment 55, wherein the oligonucleotide comprises SEQ ID NO: 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, or 215.
Embodiment 54 is a vaccine for preventing or treating infectious disease comprising the oligonucleotide of any one of the preceding embodiments 1-53.
Embodiment 55 is a vector comprising the oligonucleotide of any one of the preceding embodiments 1-54.
Embodiment 56 is an immunostimulatory composition comprising the oligonucleotide of any one of the preceding embodiments 1-55.
Embodiment 57 is the immunostimulatory composition of embodiment 56 further comprising a pharmaceutically acceptable carrier.
Embodiment 58 is the immunostimulatory composition of embodiment 57, wherein the oligonucleotide and the carrier are linked.
Embodiment 59 is the immunostimulatory composition of embodiment 56 further comprising a hapten.
Embodiment 60 is the immunostimulatory composition of embodiment 57, wherein the oligonucleotide and the hapten are linked.
Embodiment 61 is a method of stimulating toll-like receptor 21 (TLR21) comprising: administering to a subject in need thereof an immunostimulatory oligonucleotide having at least one CpG motif and a guanine nucleotide enriched sequence beginning at or within four nucleotides of the 5′ terminus of the oligonucleotide, the guanine nucleotide enriched sequence comprising a first plurality of guanine nucleotides.
Embodiment 62 is the method of embodiment 61, wherein the concentration of the oligonucleotide is less than 20 nM.
Embodiment 63 is the method of embodiment 61 or 62, wherein the oligonucleotide further comprises a pharmaceutically acceptable carrier.
Embodiment 64 is the method of any one of embodiments 61 to 63, wherein the immunostimulatory composition further comprises a hapten.
Embodiment 65 is the method of any one of embodiments 61 to 64, wherein the half maximum concentration (EC50) of the oligonucleotide is less than 100 pM.
Embodiment 66 is the method of any one of embodiments 61 to 65, wherein the guanine nucleotide enriched nucleotide sequence comprises TTAGGG, TTAGGGTTAGGG (SEQ ID NO:261), TTTTGGGG, GGGGTTTT, GGGGTTTTGGGG (SEQ ID NO:262), TTAGGG, TTAGGGTTAGGGTTTT (SEQ ID NO:263), TGTGGGTGTGTGTGGG (SEQ ID NO: 268), GGAGG, TGGAGGC, or TGGAGGCTGGAGGC (SEQ ID NO:264).
Embodiment 67 is the method of any one of embodiments 61 to 66, wherein the oligonucleotide comprises SEQ ID NO: 110, 111, 112, 113, 114, 115, 116, 117118, 119, 120, 124, 125, 126, 127, 129, 130, 131, 134, 136, 137, or 138.
Embodiment 68 is the method of any one of embodiments 61 to 67, wherein the oligonucleotide further comprises a G-wire sequence.
Embodiment 69 is the method of embodiment 68, wherein the G-wire sequence comprises SEQ ID NO:257 or 258.
Embodiment 70 is the method of embodiment 68, wherein the oligonucleotide comprises SEQ ID NO:141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 252, or GCGT-Gwire3.
Embodiment 71 is the method of any one of embodiments 61 to 70, comprising a second plurality of guanine nucleotides, wherein the first plurality of guanine nucleotides and the second plurality of guanine nucleotides are separated by at least one nucleotide.
Embodiment 72 is the method of any one of embodiments 61 to 71, wherein the oligonucleotide further comprises a linker between the first plurality of guanine nucleotides and the at least one CpG motif.
Embodiment 73 is the method of embodiment 72, wherein the linker comprises at least three nucleotides.
Embodiment 74 is the method of embodiment 72, wherein the linker comprises a hexaethyleneglycol, triethyleneglycol, propanediol, or derivatives thereof.
Embodiment 75 is the method of embodiment 72 to 74, wherein the oligonucleotide comprises 2006-PDE5dG4-X1 or 2006-PDE5dG4-X3.
Embodiment 76 is the method of embodiment 72 to 75, wherein the at least one CpG motif is a plurality of CpG motifs.
Embodiment 77 is the method of embodiment 76, wherein the plurality of CpG motifs comprises two, three, four, or five CpG motifs.
Embodiment 78 is the method of embodiment 76 or 77, wherein each CpG motif is separated from the other CpG motifs by at least one nucleotide or nucleotide analog.
Embodiment 79 is the method of embodiment 78, wherein the at least one nucleotide is one to four thymine nucleotides.
Embodiment 80 is the method of embodiment 78 or 79, wherein the oligonucleotide comprises SEQ ID NO:217, 218, 219, or 220.
Embodiment 81 is the method of embodiment 76 or 77, wherein each of the CpG motifs is separated from the other CpG motifs by a spacer.
Embodiment 82 is the method of embodiment 81, wherein the spacer is a deoxyribosephosphate bridge.
Embodiment 83 is the method of embodiment 82, wherein the deoxyribosephosphate bridge is abasic.
Embodiment 84 is the method of embodiments 82 or 83, wherein the oligonucleotide comprises SEQ ID NO:221.
Embodiment 85 is the method of embodiment 81, wherein the spacer comprises a carbon chain.
Embodiment 86 is the method of embodiment 85, wherein the carbon chain comprises two carbon atoms.
Embodiment 87 is the method of embodiment 86, wherein the carbon chain is derived from ethanediol.
Embodiment 88 is the method of embodiment 86 or 87, wherein the oligonucleotide comprises ODN-X2, wherein X2 is ethanediol.
Embodiment 89 is the method of embodiment 85, wherein the carbon chain comprises three carbon atoms.
Embodiment 90 is the method of embodiment 89, wherein the carbon chain is derived from 1,3-propanediol.
Embodiment 91 is the method of embodiment 89 or 90, wherein the nucleotide comprises CG-Gw2X2, Gw2X2-2, or ODN-X3, CG-Gw2X2-1, CG-Gw2X2-3, CG-Gw2X2-4, CG-Gw2X2-5, CG-G4T16X2-1, CG-G4T16X2-2, CG-G4T16X2-3, CG-G4T16X2-4, or CG-G4T16X2-5, wherein X2 is a three carbon chain; 2006-PDE5dG4-X2, wherein X2 is a three carbon chain derived from propanediol; or 2006-PDE5dG4-X4, wherein X4 is a three carbon chain derived from propanediol.
Embodiment 92 is the method of embodiment 85, wherein the carbon chain comprises four carbon atoms.
Embodiment 93 is the method of embodiment 92, wherein the carbon chain is derived from 1,4-butanediol.
Embodiment 94 is the method of embodiment 92 or 93, wherein the oligonucleotide comprises ODN-X4, wherein X4 is a four carbon chain derived from 1,4-butanediol.
Embodiment 95 is the method of embodiment 81, wherein the spacer comprises a repeated chemical unit.
Embodiment 96 is the method of embodiment 95, wherein the repeated chemical unit is an ethylene glycol.
Embodiment 97 is the method of embodiment 95 or 96, wherein the oligonucleotide comprises CCGC-Gw2X1, wherein X1 is a spacer derived from hexaethyleneglycol.
Embodiment 98 is the method of any one of the preceding embodiments 61-97 further comprising at least one nucleotide analog.
Embodiment 99 is the method of any one of the preceding embodiments 61-98 further comprising a lipid moiety.
Embodiment 100 is the method of embodiment 99, wherein the lipid moiety is cholesterol.
Embodiment 101 is the method of embodiment 99 or 100, wherein the lipid moiety is at or near the 5′ terminus of the oligonucleotide.
Embodiment 102 is the method of any one of embodiments 61 to 101, wherein the CpG motif comprises a CpG sequence element having at least four nucleotides.
Embodiment 103 is the method of embodiment 102, wherein the oligonucleotide comprises at least two CpG sequence elements.
Embodiment 104 is the method of embodiment 102 or 103, wherein the oligonucleotide comprises at least three CpG sequence elements.
Embodiment 105 is the method of any one of embodiments 101 to 104, wherein the CpG sequence elements are GCGA, GCGG, ACGC, CCGC, GCGT, TCGC, or any combination thereof.
Embodiment 106 is the method of embodiment 61 further comprising a tri-thymine nucleotide 3′ terminal end.
Embodiment 107 is the method of embodiment 106, wherein the oligonucleotide comprises SEQ ID NO: 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, or 215.
Embodiment 108 is the method of any one of embodiments 61 to 107, wherein the immunostimulatory composition comprises a vaccine for preventing or treating infectious disease.
Embodiment 109 is the method of any one of embodiments 61 to 107, wherein the immunostimulatory composition comprises a vector.
Embodiment 110 is the method of any one of embodiments 61 to 109, wherein the immunostimulatory composition further comprises a pharmaceutically acceptable carrier.
Embodiment 111 is the method of embodiment 110, wherein the the oligonucleotide and the carrier are linked.
Embodiment 112 is the method of any one of embodiments 61 to 111, wherein the immunostimulatory composition further comprises a hapten.
Embodiment 113 is the method of any one of embodiments 112, wherein the oligonucleotide and the hapten are linked.
Embodiment 114 is the method of any one of embodiments 61 to 113, wherein the administering is performed intravenously, intramuscularly, intramammary, intradermally, intraperitoneally, subcutaneously, by spray, by aerosol, in ovo, mucosally, transdermally, by immersion, orally, intraocularly, intratracheally, or intranasally.
Embodiment 115 is the method of any one of embodiments 61 to 114, wherein the subject is an animal.
Embodiment 116 is the method of any one of embodiments 61 to 115, wherein the subject is a member of an avian species.
Embodiment 117 is a method for increasing TLR21-stimulatory activity of an oligonucleotide having at least one CpG motif comprising fusing the 5′ end of the oligonucleotide to a guanine nucleotide enriched sequence.
Embodiment 118 is the method of embodiment 117, wherein the guanine nucleotide enriched sequence is a G-quartet sequence.
Embodiment 119 is the method of embodiment 118, wherein the G-quartet sequence comprises a first plurality of guanine nucleotides.
Embodiment 120 is the method of embodiment 119, wherein the first plurality of guanine nucleotides comprises three to eight guanine nucleotides.
Embodiment 121 is the method of embodiments 119 or 120, wherein the G-quartet sequence comprises TTAGGG, TTAGGGTTAGGG (SEQ ID NO:261), TTTTGGGG, GGGGTTTT, GGGGTTTTGGGG (SEQ ID NO:262), TTAGGG, TTAGGGTTAGGGTTTT (SEQ ID NO:263), TGTGGGTGTGTGTGGG (SEQ ID NO: 268), GGAGG, TGGAGGC, or TGGAGGCTGGAGGC (SEQ ID NO:264).
Embodiment 122 is the method of any one of embodiments 117 to 121, wherein the oligonucleotide comprises a second plurality of guanine nucleotides.
Embodiment 123 is the method of any one of embodiments 117 to 122, wherein the guanine nucleotide enriched sequence comprises a G-wire sequence.
Embodiment 124 is the method of embodiment 123, wherein the G-wire sequence comprises SEQ ID NO:257 or 258.
Embodiment 125 is the method of any one of embodiments 119 to 124, wherein the first plurality of guanine nucleotides and the second plurality of guanine nucleotides are separated by at least one nucleotide.
Embodiment 126 is the method of embodiment 117, further comprising inserting a linker between the first plurality of guanine nucleotides and the at least one CpG motif.
Embodiment 127 is the method of embodiment 126, wherein the linker comprises at least three nucleotides.
Embodiment 128 is the method of embodiment 126 or 127, wherein the linker comprises a hexaethyleneglycol, triethyleneglycol, propanediol, or derivatives thereof.
Embodiment 129 is the method of any one of embodiments 126 to 128, wherein the oligonucleotide comprises 2006-PDE5dG4-X1 or 2006-PDE5dG4-X3.
Embodiment 130 is the method of embodiment 117, wherein the at least one CpG motif is a plurality of CpG motifs.
Embodiment 131 is the method of embodiment 130, wherein the plurality of CpG motifs comprises two, three, four, or five CpG motifs.
Embodiment 132 is the method of embodiment 130 or 131 further comprising inserting at least one nucleotide or nucleotide analog between the CpG motifs.
Embodiment 133 is the method of claim 132 wherein the at least one nucleotide is one to four thymine nucleotides.
Embodiment 134 is the method of embodiment 117, further comprising inserting a spacer between each of the CpG motifs.
Embodiment 135 is the method of embodiment 134, wherein the spacer is a deoxyribosephosphate bridge.
Embodiment 136 is the method of embodiment 135, wherein the deoxyribosephosphate bridge is abasic.
Embodiment 137 is the method of embodiment 134, wherein the spacer comprises a carbon chain.
Embodiment 138 is the method of embodiment 137, wherein the carbon chain comprises two carbon atoms.
Embodiment 139 is the method of embodiments 137 or 138, wherein the carbon chain is derived from ethanediol.
Embodiment 140 is the method of embodiment 137, wherein the carbon chain comprises three carbon atoms.
Embodiment 141 is the method of embodiment 137 or 140, wherein the carbon chain is derived from 1,3-propanediol.
Embodiment 142 is the method of embodiment 137, wherein the carbon chain comprises four carbon atoms.
Embodiment 143 is the method of embodiment 137 or 142, wherein the carbon chain is derived from 1,4-butanediol.
Embodiment 144 is the method of embodiment 137, wherein the spacer comprises a repeated chemical unit.
Embodiment 145 is the method of embodiment 137 or 144, wherein the repeated chemical unit is an ethylene glycol.
Embodiment 146 is the method of any one of embodiments 137, 144, or 145, wherein the spacer is derived from hexaethyleneglycol.
Embodiment 147 is the method of any one of embodiments 117 to 146 further comprising inserting at least one nucleotide analog.
Embodiment 148 is the method of any one of embodiments 117 to 147 further comprising inserting a lipid moiety.
Embodiment 149 is the method of embodiment 148, wherein the lipid moiety is a cholesterol.
Embodiment 150 is the method of embodiment 148 or 149, wherein the lipid moiety is at or near the 5′ terminus of the oligonucleotide.
Embodiment 151 is the method of any one of embodiments 117 to 150, further comprising modifying the nucleotides adjacent to the CpG motif.
Embodiment 152 is a method of eliciting an immune response in a subject comprising:
Embodiment 153 is the method of embodiment 152, wherein the concentration of the oligonucleotide is less than 20 nM.
Embodiment 154 is the method of embodiment 152 or 153, wherein the immunostimulatory composition further comprises a pharmaceutically acceptable carrier.
Embodiment 155 is the method of any one of embodiments 152 to 154, wherein the immunostimulatory composition further comprises a hapten.
Embodiment 156 is the method of any one of embodiments 152 to 155, wherein the half maximum concentration (EC50) of the immunostimulatory composition is less than 100 pM.
Embodiment 157 is the method of embodiment 152, wherein the guanine nucleotide enriched sequence comprises a G-quartet sequence.
Embodiment 158 is the method of any one of embodiments 152 to 156, wherein the G-quartet sequence comprises TTAGGG, TTAGGGTTAGGG (SEQ ID NO:261), TTTTGGGG, GGGGTTTT, GGGGTTTTGGGG (SEQ ID NO:262), TTAGGG, TTAGGGTTAGGGTTTT (SEQ ID NO:263), TGTGGGTGTGTGTGGG (SEQ ID NO: 268), GGAGG, TGGAGGC, TGGAGGCTGGAGGC (SEQ ID NO:264), or TGGGGT (SEQ ID NO:265).
Embodiment 159 is the method of any one of embodiments 152 to 157, wherein the oligonucleotide comprises SEQ ID NO: 110, 111, 112, 113, 114, 115, 116, 117118, 119, 120, 124, 125, 126, 127, 129, 130, 131, 134, 136, 137, or 138.
Embodiment 160 is the method of embodiment 152, wherein the guanine nucleotide enriched sequence comprises a G-wire sequence.
Embodiment 161 is the method of embodiment 160, wherein the G-wire sequence comprises SEQ ID NO:257 or 258.
Embodiment 162 is the method of embodiment 160, wherein the oligonucleotide comprises SEQ ID NO:141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 252, or GCGT-Gwire3.
Embodiment 163 is the method of embodiment 152, wherein the guanine nucleotide enriched sequence comprises first and second pluralities of guanine nucleotides separated by at least one nucleotide.
Embodiment 164 is the method of embodiment 152, wherein the oligonucleotide further comprises a linker between the guanine nucleotide enriched sequence and the at least one CpG motif.
Embodiment 165 is the method of embodiment 164, wherein the linker comprises at least three nucleotides.
Embodiment 166 is the method of embodiment 164, wherein the linker comprises a hexaethyleneglycol, triethyleneglycol, propanediol, or derivatives thereof.
Embodiment 167 is the method of embodiments 164 to 166, wherein the oligonucleotide comprises 2006-PDE5dG4-X1 or 2006-PDE5dG4-X3.
Embodiment 168 is the method of embodiment 152, wherein the at least one CpG motif is a plurality of CpG motifs.
Embodiment 169 is the method of embodiment 168, wherein the plurality of CpG motifs comprises two, three, four, or five CpG motifs.
Embodiment 170 is the method of embodiment 168 or 169, wherein each CpG motif is separated from the other CpG motifs by at least one nucleotide or nucleotide analog.
Embodiment 171 is the method of embodiment 170, wherein the at least one nucleotide analog is one to four thymine nucleotides.
Embodiment 172 is the method of embodiments 170 or 171, wherein the oligonucleotide comprises SEQ ID NO:217, 218, 219, or 220.
Embodiment 173 is the method of embodiment 168 or 169, wherein each of the CpG motifs is separated from the other CpG motifs by a spacer.
Embodiment 174 is the method of embodiment 173, wherein the spacer is a deoxyribosephosphate bridge.
Embodiment 175 is the method of embodiment 174, wherein the deoxyribosephosphate bridge is abasic.
Embodiment 176 is the method of embodiment 174 or 175, wherein the oligonucleotide comprises SEQ ID NO:221.
Embodiment 177 is the method of embodiment 173, wherein the spacer comprises a carbon chain.
Embodiment 178 is the method of embodiment 177, wherein the carbon chain comprises two carbon atoms.
Embodiment 179 is the method of embodiment 177 or 178, wherein the carbon chain is derived from ethanediol.
Embodiment 180 is the method of any one of embodiments 177 to 179, wherein the oligonucleotide comprises ODN-X2 wherein X2 is ethandiol.
Embodiment 181 is the method of embodiment 177, wherein the carbon chain comprises three carbon atoms.
Embodiment 182 is the method of embodiment 177 or 181, wherein the carbon chain is derived from 1,3-propanediol.
Embodiment 183 is the method of any one of embodiments 177, 181, or 182, wherein the nucleotide comprises CG-Gw2X2, Gw2X2-2, or ODN-X3, CG-Gw2X2-1, CG-Gw2X2-3, CG-Gw2X2-4, CG-Gw2X2-5, CG-G4T16X2-1, CG-G4T16X2-2, CG-G4T16X2-3, CG-G4T16X2-4, or CG-G4T16X2-5, wherein X2 is a three carbon chain; 2006-PDE5dG4-X2, wherein X2 is a three carbon chain derived from propanediol; or 2006-PDE5dG4-X4, wherein X4 is a three carbon chain derived from propanediol.
Embodiment 184 is the method of embodiment 177, wherein the carbon chain comprises four carbon atoms.
Embodiment 185 is the method of embodiment 177 or 184, wherein the carbon chain is derived from 1,4-butanediol.
Embodiment 186 is the method of any one of embodiments 177, 184, or 185 wherein the oligonucleotide comprises ODN-X4, wherein X4 is a four carbon chain derived from 1,4-butanediol.
Embodiment 187 is the method of embodiment 173, wherein the spacer comprises a repeated chemical unit.
Embodiment 188 is the method of embodiment 187, wherein the repeated chemical unit is an ethylene glycol.
Embodiment 189 is the method of embodiments 187 or 188, wherein the oligonucleotide comprises CCGC-Gw2X1 and wherein X1 is a spacer derived from hexaethyleneglycol.
Embodiment 190 is the method of any one of embodiments 152 to 189 further comprising at least one nucleotide analog.
Embodiment 191 is the method of embodiments 152 to 190 further comprising attaching a lipid moiety into the oligonucleotide.
Embodiment 192 is the method of embodiment 191, wherein the lipid moiety is cholesterol.
Embodiment 193 is the method of embodiment 191 or 192, wherein the lipid moiety is at or near the 5′ terminus of the oligonucleotide.
Embodiment 194 is the method of embodiment 152, wherein the CpG motif comprises a CpG sequence element having at least four nucleotides.
Embodiment 195 is the method of embodiment 194 comprising at least two CpG sequence elements.
Embodiment 196 is the method of embodiment 194 or 195 comprising at least three CpG sequence elements.
Embodiment 197 is the method of any one of embodiments 194 to 196, wherein the CpG sequence elements are GCGA, GCGG, ACGC, CCGC, GCGT, TCGC, or any combination thereof.
Embodiment 198 is the method of embodiment 152 further comprising inserting a tri-thymine nucleotide run onto the 3′ terminal end of the oligonucleotide.
Embodiment 199 is the method of embodiment 198, wherein the oligonucleotide comprises SEQ ID NO: 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, or 215.
Embodiment 200 is an immunostimulatory oligonucleotide comprising SEQ ID NO:252.
Embodiment 201 is the oligonucleotide of embodiment 200, further comprising a 5′ cholesteryl modification.
Embodiment 202 is the oligonucleotide of embodiment 201, wherein the 5′ cholesteryl modification comprises a triethyleneglycol linker.
When introducing elements of the present disclosure or the preferred embodiment(s) thereof, the articles “a”, “an”, “the” and “said” are intended to mean that there are one or more of the elements. The terms “comprising”, “including” and “having” are intended to be inclusive and mean that there may be additional elements other than the listed elements.
In view of the above, it will be seen that the several objects of the disclosure are achieved and other advantageous results attained.
As various changes could be made in the above products and methods without departing from the scope of the disclosure, it is intended that all matter contained in the above description shall be interpreted as illustrative and not in a limiting sense.
| Number | Date | Country | Kind |
|---|---|---|---|
| 17207740.6 | Dec 2017 | EP | regional |
| 17207746.3 | Dec 2017 | EP | regional |
| 17207750.5 | Dec 2017 | EP | regional |
This application is a Continuation of U.S. application Ser. No. 16/771,789, filed 11 Jun. 2020, which is the National Stage entry of International Application No. PCT/EP2018/083958, filed 7 Dec. 2018, which claims priority to European Patent Application No. 17207750.5, filed 15 Dec. 2017, European Patent Application No. 17207740.6, filed 15 Dec. 2017, and European Patent Application No. 17207746.3, filed 15 Dec. 2017, the disclosures of which are incorporated herein by reference in their entireties.
| Number | Date | Country | |
|---|---|---|---|
| Parent | 16771789 | Jun 2020 | US |
| Child | 18057053 | US |
