Patent Application
20100069253
1. Field of the Invention
This invention generally relates to Deoxyribonucleic acid (DNA) detection and, more particularly, to a system and method for the measurement of DNA by impedance spectroscopy.
2. Description of the Related Art
Microarray technology is a power research tool that permits the assaying of multiple analytes in a single sample—a multiplexed assay format. To perform such assay, a microarray has to contain multiple transducers modified with different bio-components. Selective attachment of a desired bio-component to a particular transducer constitutes one of the biggest challenges in the microarray technology. At present, the major approaches for microarray multiplexing are; (i) spotting of different bio-components over an array; (ii) physical separation of transducers via a nano-fluidic set of connections, and target delivery of bio-components to pre-selected transducers; (iii) self-assembling of tagged bio-components on an array surface that is modified with an agent capable of the specific capturing of bio-component tags; and (iv) controlled synthesis of bio-components on the surface of transducers.
Real time polymerase chain reaction (PCR) techniques are widely used for monitoring of biomarker gene expression, genotyping, detection of mutations, and rapid diagnosis and quantitation of infections in clinical microbiology. It can also be used in methylation detection, DNA damage and radiation exposure measurements and high-resolution genotyping that would have been less efficient or impossible to perform with the standard PCR.
PCR derives its name from one of its key components, a DNA polymerase used to amplify a piece of DNA by in vitro enzymatic replication. As PCR progresses, the DNA thus generated is itself used as a template for replication. This sets in motion a chain reaction in which the DNA template is exponentially amplified. With PCR it is possible to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating millions or more copies of the DNA piece. PCR can be extensively modified to perform a wide array of genetic manipulations.
Almost all PCR applications employ a heat-stable DNA polymerase, such as Taq polymerase, an enzyme originally isolated from the bacterium Thermoiiis aqtuatlcits. This DNA polymerase enzymatically assembles a new DNA strand from DNA building blocks, the nucleotides, using single-stranded DNA as template and DNA oligonucleotides (also called DNA primers) required for initiation of DNA synthesis. The vast majority of PCR methods use thermal cycling, i.e. alternately heating and cooling the PCR sample to a defined series of temperature steps. These thermal cycling steps are necessary to physically separate the strands (at high temperatures) in a DNA double helix (DNA melting) used as template during DNA synthesis (at lower temperatures) by the DNA polymerase to selectively amplify the target DNA. The selectivity of PCR results from the use of primers that are complementary to the DNA region targeted for amplification under specific thermal cycling conditions.
A basic PCR set up requires several components and reagents. These components include:
DNA template that contains the DNA region (target) to be amplified.
Two primers which are complementary to the DNA regions at the 3′ (three prime) end of each DNA strand.
A DNA polymerase such as Taq polymerase or another DNA polymerase with a temperature optimum at around 70° C.
Deoxynucleoside triphosphates (dNTPs; also very commonly and erroneously called deoxynucleotide triphosphates), the building blocks from which the DNA polymerases synthesizes a new DNA strand.
Buffer solution, providing a suitable chemical environment for optimum activity and stability of the DNA polymerase.
Divalent cations, magnesium or manganese ions; generally Mg2+ is used, but Mn2+ can be utilized for PCR-mediated DNA mutagenesis, as higher Mn2+ concentration increases the error rate during DNA synthesis.
Monovalent cation potassium ions.
In stage three (3) extension or elongation occurs, e.g., at 72° C. At this step the DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand by adding dNTPs that are complementary to the template in 5′ to 3′ direction, condensing the 5′-phosphate group of the dNTPs with the 3′-hydroxyl group at the end of the nascent (extending) DNA strand. The extension time depends both on the DNA polymerase used and on the length of the DNA fragment to be amplified. As a rule-of-thumb, at its optimum temperature, the DNA polymerase will polymerize a thousand bases per minute. Under optimum conditions, i.e. if there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment.
Two cycles are shown. The solid lines represent the DNA template to which primers anneal that are extended by the DNA polymerase (circles), to give shorter DNA products (hatched lines), which themselves are used as templates as PCR progresses. The PCR usually consists of a series of 20 to 40 repeated temperature changes called cycles; each cycle typically consists of 2-3 discrete temperature steps. Most commonly, PCR is carried out with cycles that have three temperature steps. The cycling is often preceded by a single temperature step (called hold) at a high temperature (>90° C.), and followed by one hold at the end for final product extension or brief storage. The temperatures used and the length of time they are applied in each cycle depend on a variety of parameters. These include the enzyme used for DNA synthesis, the concentration of divalent ions and dNTPs in the reaction, and the melting temperature (Tm) of the primers.
Quantitative PCR (Q-PCR) is used to measure the quantity of a PCR product (preferably real-time). It is the conventional method used to quantitatively measure the starting amounts of DNA, cDNA or RNA. Q-PCR is commonly used to determine whether a DNA sequence is present in a sample and the number of its copies in the sample. The conventional method with the highest level of accuracy is Quantitative real-time PCR. It is often confusingly known as RT-PCR (Real Time PCR) or RQ-PCR. QRT-PCR or RTQ-PCR is a more appropriate contraction. RT-PCR commonly refers to reverse transcription PCR, which is often used in conjunction with Q-PCR. QRT-PCR methods use fluorescent dyes, such as Sybr Green, or fluorophore-containing DNA probes, such as TaqMan, to measure the amount of amplified product in real time.
Detection is based on differences in the fluorescence of dyes bound to single-strand versus double-strand DNA molecules. The optically detectable dyes act as a label. The practical application of fluorescence detecting techniques are limited by (i) the high initial expenditure of purchasing a PCR unit integrated with a fluorescent reader; (ii) the high ownership costs due to expensive consumables (fluorescent dyes and special kits); and, (iii) expensive maintenance of optical light-detecting equipment. In addition, miniaturization of the fluorescent based real time PCR, if possible, is very challenging.
Other detection methods add Ferrocene based labels, an organometallic compound Fe(C5H5)2, to create a signal associated with a DNA target that can be measured electiochemically. Fluorescent dyes and Ferrocene are both additives (labels) that unfortunately create background “noise” in the solution that that can interfere with DNA measurement. The application of labeled components in real time PCR has two major drawbacks: (i) insufficient stability of the label itself during thermal cycling process, and (ii) PCR bias associated with amplification error and chain reaction termination due to usage of a ‘foreign’ component. It is very desirable to avoid an application of any labeled components in the PCR process.
It would be advantageous if there was a simpler and more cost-effective way to detect DNA using PCR. It would be advantageous if the DNA measurement could be made without labels that interfere with the DNA signal.
In contrast to fluorescent detection, the DNA measurement approach described herein has a high potential for miniaturization and low-cost formats. The principle of action is based on the coupling of a standard thermal cycling PCR process with a transducer capable of quantitative real time label-free detection of DNA products. The transducer is based on an impedance spectroscopy electrode with specific surface functionalization.
Accordingly, an impedance spectroscopy method is provided for quantitatively measuring Deoxyribonucleic acid (DNA). The method provides a transducer having electrode surfaces exposed to a shared local environment. The electrode surfaces are functionalized with an oligonucleotide to interact with a predetermined DNA target. A DNA sample solution is introduced into the local environment. The solution includes nucleotides, polymerase enzyme, and primers. The DNA sample is thermocycled to promote a first DNA target polymerase chain reaction (PCR). Then, capacitance is measured between a pair of transducer electrodes, and in response to measuring the capacitance, a determination is made of the presence of first DNA amplicons in the DNA sample. Typically, a number of thermocycles are performed and capacitance measurements are made after each cycle, so that an amplicon growth rate can be determined.
In one aspect, providing the transducer having electrode surfaces functionalized with the oligonucleotide includes either providing an immobilized probe molecule with a 3′ end attached to the electrodes surfaces and a solution-exposed 5′ end, or an immobilized probes molecule with a 5′ end attached to the electrode surfaces and a solution-exposed 3′ end.
Additional details of the above described method and a system for selectively functionalizing a transducer microarray are provided below.
A transducer is a detector capable of generating a physical signal (output) in response to alterations of biological or chemical environment in the vicinity of the transducer's surface. The signal may be visual or electrical, for example. These alterations occur when a pre-selected biological component that is attached to the transducer's surface specifically interacts with a target analyte, which is the process of bio-recognition. The transducer integrated with the biological component forms a sensing element of a biosensor.
The biological component responsible for bio-recognition is a molecule capable of specific binding with the target analyte, specific transformation of the corresponding target analyte, or both. An analyte is a substance or chemical constituent that is determined in an analytical procedure, such as a titration. For instance, in an immunoassay, the analyte may be the ligand or the binder, while in blood glucose testing, the analyte is glucose. In medicine, the term “analyte” often refers to the type of test being run on a patient, as the test is usually determining a chemical substance in the human body. An analyte cannot typically be measured, but a measurable property of the analyte can be. For instance, glucose cannot be measured, but glucose concentration can be measured. In this example “glucose” is the component and “concentration” is the property. In laboratory and layman jargon the “property” is often left out provided the omission does not lead to an ambiguity of what property is measured.
Biological components include oligonucleotides, DNA/RNA molecules or their fragments, peptides, receptors, antibodies, enzymes, whole cells and cellular fragments, etc. In some applications biotin and streptavidin can also be considered as biological components.
The transducer surface can be conductive, semi-conductive, or non-conductive. The surface material can be metal or alloy such as gold, platinum, aluminum, chrome, or silica, carbon-based such as graphite or glassy carbon, glass, ceramic, a composite such as silicon nitride or indium tin oxide (ITO), or a plastic such as polystyrene or nylon.
The initial modification of the transducer surface introduces functional groups that are capable of binding other biological components to the sensing element. The introduction of the functional groups to the transducer surface can be performed in one of the following ways:
Functionalization describes the modification of a transducer surface with attached bio-probe molecules capable of specific biological recognition of analyte molecules. Biological recognition is an ability of the bio-probe molecule to specifically bind or catalytically convert analyte molecules.
In one aspect, a substrate 218 underlies the transducers 202 and a cover 220 overlies the transducers. The combination of the substrate 218 and cover 220 forms a cavity 222 to provide the shared DNA sample environment solution 210.
In one aspect, as shown in
In
The PCR thermal cycling process is based on a polymerase extension reaction that involves a target DNA molecule and two specific primers. The process is an exponential amplification, and thus, results in formation of a large amount of copies of the target DNA sequence located between the primers.
Step 702 provides a transducer having electrode surfaces exposed to a shared local environment. The electrode surfaces are functionalized with an oligonucleotide to interact with a predetermined first DNA target. Step 704 introduces a DNA sample solution, including nucleotides, polymerase enzyme, and primers, into the local environment. Step 706 thermocycles the DNA sample to promote a first DNA target polymerase chain reaction (PCR). Step 708 measures capacitance or impedance between a pair of transducer electrodes. In response to measuring the capacitance, Step 710 determines the presence of first DNA amplicons in the DNA sample. Typically, measuring capacitance between the pair of transducer electrodes in Step 708 includes measuring capacitance in a plurality of thermocycles, and comparing the plurality of capacitance measurements.
In one aspect, providing the transducer having electrode surfaces functionalized with the oligonucleotide in Step 702 includes providing either an oligonucleotide immobilized probe molecule with a 3′ end attached to the electrodes surfaces and a solution-exposed 5′ end (
In a different aspect, thermocycling the DNA sample to promote the first DNA target PCR in Step 706 includes substeps, in each thermocycle. Step 706a denatures the first DNA sample at a first temperature, and Step 706b anneals the first DNA sample at a second temperature, lower than the first temperature. In one variation, Step 706c performs an extension stage, after annealing, at a third temperature in a range between the first and second temperatures.
For example, thermocycling the DNA sample in. Step 706 may include performing 20 to 50 thermocycles. As another example, the denaturing performed in Step 706a may be performed at a temperature of about 95° C., and Step 706b may anneal at a temperature in the range of about 45 to 75° C.
When Step 702 provides electrode surfaces with an oligonucleotide immobilized probe molecule with a 3′ end attached to the electrodes surfaces and a solution-exposed 5′ end, thermocycling the DNA sample in Step 706 includes binding single stranded first DNA amplicons to the immobilized probe molecule in response to each cycle of annealing. Then, measuring capacitance between the pair of transducer electrodes in Step 708 includes measuring capacitance following each cycle of annealing.
When Step 702 provides electrode surfaces with an immobilized probe molecule having a 5′ end attached to the electrode surfaces and a solution-exposed 3′ end, thermocycling the DNA sample includes sustaining a bond between single stranded first DNA amplicons and the immobilized probe molecule following each cycle of denaturing. Then, measuring capacitance in Step 708 includes measuring capacitance following each cycle of denaturing.
Alternately or in addition, thermocycling the DNA sample in Step 706 includes binding single stranded first DNA amplicons to the immobilized probe molecule. The probe acts as a primer to enzymatically extend antisense single stranded first DNA amplicons from the immobilized probe molecules in response to each extension stage. Then, Step 708 may measure capacitance after each stage of extension.
1. Sample Preparation—A bacterial genome was PCR'ed to form a double stranded DNA as follows:
CAAACTGGTCACCGACGAACTGGTGATCGCGCTAAAGAGCGCATTGCTCA
The product was then rePCR'ed with a single primer bi-
Biotin-TTATGGATGCTGGCAAACTGGTCACCGACGAACTGGTGATCGC
TGTTGACCGTATCGTAGGCCGCCGCGTTCACGCGCCGTCTGGTCGTGTTT
The sample was then diluted in Phosphate Buffer Saline with 0.05% Tween 20 (PBST) (1:50) and used for impedance spectroscopy assay.
2. Thiol modified oligo immobilization on gold
a. a 500 mM solution of DTT was prepared by adding 100 uL of DI water to a Pierce DTT tube.
b. a 50 mM solution of DTT was prepared by adding 10 ul of the 500 mM DTT solution to 90 uL of DI water.
Four uL of 50 mM of Dithiothreitol (DTT) solution in water was added to 100 uL of thiol modified at 5′ end oligonucleotide GATACGGTCAACAATCAGTT solution (10 uM in Phosphate Buffer Saline) and incubated for one hour at ambient temperature. The solution was then applied to a P6 micro-spin column to remove excessive Dithiothreitol. The procedure was repeated with a fresh column. The obtained oligonucleotide solution (6 uL) was then applied to the cleaned gold surface of an interdigitated electrode (see
3. Impedance Spectroscopy Test
Impedance spectroscopy test was performed at 150 mV. The cell (transducer electrode surface) initially contained PBST alone. After baseline drift was stabilized, PBST was removed from the cell and the sample was added. The results (
An impedance spectroscopy system and method has been presented for quantitatively measuring DNA. Examples of specific procedures and materials have been used to illustrate the invention. However, the invention is not necessarily limited to just these examples. Other variations and embodiments of the invention will occur to those skilled in the art.
