The present invention relates to the field of genetic engineering and molecular biology. In particular, the present invention relates to novel promoter DNA polynucleotides and its use as a tool for improved protein expression in host cells, notably in Drosophila melanogaster. Furthermore, the present invention relates to vectors containing the polynucleotide and also the use of these in recombinant expression of polypeptides, in particular heterologous expression of proteins, such as industrial enzymes or proteins for pharmaceutical use including eukaryotic (e.g. mammalian, such as human, but also protozoan or helminthic) and viral proteins. The invention is particularly relevant in the field of protein expression where the expression product is secreted from recombinant host cells, especially if these host cells are insect cells.
Protein production systems, in which polypeptides or proteins of interest are produced in recombinant organisms or cells, are the backbone of commercial biotechnology. The earliest systems, based on bacterial expression in hosts such as E. coli, have been joined by systems based on eukaryotic hosts, in particular mammalian cells in culture, insect cells both in culture and in the form of whole insects, and transgenic mammals such as sheep and goats.
Prokaryotic cell culture systems are easy to maintain and cheap to operate. However, prokaryotic cells are not capable of post-translational modification of eukaryotic proteins. Moreover, many proteins are incorrectly folded, requiring specific procedures to refold them, which adds to the cost of production.
Eukaryotic cell culture systems have been described for a number of applications. For example, mammalian cells are capable of post-translational modification, and generally produce proteins which are correctly folded and soluble. The chief disadvantages of mammalian cell systems include the requirement for specialised and expensive culture facilities, the risk of infection, which can lead to loss of the whole culture, and the risk of contaminating the end product with potentially hazardous mammalian proteins.
Insect cells are also used for polypeptide expression. The most widespread expression system used in insect cells is based on baculovirus vectors. A baculovirus expression vector is constructed by replacing the polyhedrin gene of baculovirus, which encodes a major structural protein of the baculovirus, with a heterologous gene, under the control of the strong native polyhedrin promoter. Cultured insect host cells are infected with the recombinant virus, and the protein produced thereby can be recovered from the cells themselves or from the culture medium if suitable secretion signals are employed. These systems also, however, suffer from problems associated with reproducibility of expression level and quality, infection of the culture, and may require specialised culture facilities. Furthermore, baculovirus stocks, which for the production of certain proteins may have to be made under GMP conditions, is not always stable over time.
Suitable promoters used in Drosophila melanogaster S2 cells for protein expression also include the pMT promoter and the P2ZOp2F (OPIE2 promoter)
Chung et al. Molecular and Cellular Biology, Vol. 10, No. 12, 1992 relates to characterization of positive and negative regulatory elements in the Actin5C distal promoter.
Angelichio et al. Nucleic Acids Research, Vol. 19, No. 18 5037-5043, 1991 relates to a comparison of several promoters and polyadenylation signals for use in heterologous gene expression in cultured Drosophila cells.
It is an object of the present invention to provide more efficient expression and/or secretion in host cells, notably in Drosophila melanogaster. It is a further object to provide polynucleotides and vectors that facilitate this efficient expression and secretion.
In a broad aspect the present invention relates to promoter DNA polynucleotides, suitable for use in the heterologous expression of a polypeptide of interest. In another broad aspect the present invention relates to an isolated DNA polynucleotide, a so-called expression vector, comprising such promoter DNA polynucleotides suitable for expression and production in relatively high amounts of a protein of interest, such as therapeutically effective proteins or industrial enzymes.
Thus, in a first aspect the present invention relates to a promoter DNA polynucleotide comprising at least one sequence selected from the group consisting of:
In a second aspect the present invention relates to an isolated DNA polynucleotide suitable for heterologous expression of a polypeptide of interest in an insect cell the DNA polynucleotide comprising
a promoter DNA polynucleotide comprising at least one sequence selected from the group consisting of:
In a third aspect the present invention relates to a cell comprising a DNA polynucleotide suitable for heterologous expression of a polypeptide of interest in an insect cell the DNA, the polynucleotide comprising a promoter DNA polynucleotide comprising at least one sequence selected from the group consisting of:
In a further aspect the present invention relates to a method for the production of a polypeptide of interest encoded by a polynucleotide the method comprising the steps of
In a further aspect the present invention relates to a polypeptide produced by a method comprising the steps of
(A) Vector map for pHP34s-hybrid vector containing a RANKL encoding region.
(B) The original pHP34s vector containing the truncated actin 5c promoter. The hybrid promoter consists of the upstream part of the truncated actin 5c promoter (minus the Actin 5c core promoter), and the HSP70 core promoter.
As discussed above the inventors of the present invention have found particular highly efficient promoters as well as regulatory elements and their combination suitable for the high level expression of heterologous proteins in insect cells.
A “heterologous expression” as used herein refers to the expression of a polypeptide not normally expressed and secreted by the host cell used to express that particular polypeptide. The term “Promoter DNA polynucleotide” as used herein means a nucleotide sequence that provides a cell with the regulatory sequences for expression of a coding sequence operably linked thereto. In general, a coding sequence is located 3′ to a promoter sequence. The promoter DNA polynucleotide may consists of proximal and more distal upstream elements as well as other functional fragments or elements, the latter elements often referred to as enhancers.
As used herein the terms “functional fragment”, “elements” and “enhancers” refers to DNA sequences and parts of the promoter, which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. An unregulated promoter that allows for continual transcription of its associated gene is often referred to as “constitutive promoter”.
Unless otherwise stated the term “Sequence identity” for nucleic acids as used herein refers to the sequence identity calculated as (nref−ndif)·100/nref, wherein ndif is the total number of non-identical residues in the two sequences when aligned and wherein nref is the number of residues in one of the sequences. Hence, the DNA sequence agtcagtc will have a sequence identity of 75% with the sequence aatcaatc (ndif=2 and nref=8).
In some embodiments the sequence identity is determined by conventional methods, e.g., Smith and Waterman, 1981, Adv. Appl. Math. 2:482, by the search for similarity method of Pearson & Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:2444, using the CLUSTAL W algorithm of Thompson et al., 1994, Nucleic Acids Res 22:467380, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group). The BLAST algorithm (Altschul et al., 1990, Mol. Biol. 215:403-10) for which software may be obtained through the National Center for Biotechnology Information www.ncbi.nlm.nih.gov/) may also be used. When using any of the aforementioned algorithms, the default parameters for “Window” length, gap penalty, etc., are used.
A “chimeric nucleotide sequence” as used herein refers to a nucleotide sequence consisting of a first nucleotide sequence derived from a first original nucleotide sequence fused to a second nucleotide sequence derived from a second original nucleotide sequence, which first and second original sequence are not normally fused to each other in the same sequence.
When indicating that a first polynucleotide exhibits an improved/higher “protein expression level” compared to a second polynucleotide is herein meant that the first polynucleotide provides for a larger amount of recoverable protein expression product than does the second polynucleotide when transforming and culturing a reference cell (typically an insect cell, such as a Drosophila S2 cell) with the polynucleotides so as to obtain expression of the polynucleotides under identical conditions.
An “S2 cell” refers to a cell from the Schneider-2 embryonic Drosophila melanogaster cell line, which is i.a. available from DSMZ—Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Inhoffenstraβe 7 B, 38124 Braunschweig, Germany under the deposit number DSMZ ACC 130 and from American Type Culture Collection (ATCC), P.O. Box 1549, Manassas, Va. 20108, USA, under the deposit number CRL-1963.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence selected from the group consisting of:
a nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO: 68 with or without flanking restriction site sequences at either terminus.
In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO:1. In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO:2. In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO:3. In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO:4. In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO:5. In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO:6. In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO:33. In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO:36. In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO:37. In some embodiments the promoter DNA polynucleotide comprises a nucleotide sequence of SEQ ID NO: 68, optionally lacking residues 1 or 1-2 or 1-3 or 1-4 or 1-5 or 1-6 and/or optionally lacking residues 587-592 or 588-592 or 589-592 or 590-592 or 591-592 or 592.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to any one sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO: 68.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional nucleotide sequence with a sequence identity of at least 80% to any one sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:37 or SEQ ID NO: 68 said functional nucleotide sequence having promoter activity in a Drosophila S2 cell.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:1. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:2. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:3. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:4. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:5. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:6. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:33. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:36. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:37. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the sequence of SEQ ID NO:68. In specific embodiments the sequence identity in each of these cases is at least 85%, such as at least 90%, such as at least 95%, such as at least 98%.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of any one sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO: 68.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of any one sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, or SEQ ID NO:37, or SEQ ID NO: 68 said functional fragment having promoter activity in a Drosophila S2 cell.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:1. In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:2. In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:3. In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:4. In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:5. In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:6. In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:33. In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:36. In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:39. In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:68.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of any one sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:37 or SEQ ID NO: 68.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a functional nucleotide sequence with a sequence identity of at least 80% to said functional fragment of at least 6 contiguous nucleotides of any one sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:37 or SEQ ID NO: 68, said functional nucleotide sequence having promoter activity in a Drosophila S2 cell.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:1. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:2. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:3. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:4. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:5. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:6. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:33. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:36. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:37. In some embodiments the promoter DNA polynucleotide according to the invention comprises a sequence with a sequence identity of at least 80% to the functional fragment of at least 6 contiguous nucleotides of the sequence of SEQ ID NO:68.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a chimeric sequence comprising two or more sequences selected from the following group
a nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, or SEQ ID NO:37;
a sequence with a sequence identity of at least 80% to any one sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, or SEQ ID NO:37;
a functional fragment of at least 6 contiguous nucleotides of any one sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, or SEQ ID NO:37;
a sequence with a sequence identity of at least 80% to a functional fragment of at least 6 contiguous nucleotides of any one sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, or SEQ ID NO:37.
An example of such a chimeric sequence is the hybrid promoter sequence set forth in SEQ ID NO: 68.
In some embodiments the promoter DNA polynucleotide according to the invention comprises a chimeric nucleotide sequence comprising two or more sequences selected from
In some embodiments the promoter DNA polynucleotide according to the invention comprises a chimeric nucleotide sequence as defined in (vi) above.
In some embodiments the functional fragment of at least 6 contiguous nucleotides according to the invention is at least 7, such as at least 8, such as at least 9, such as at least 10, such as at least 11, such as at least 12, such as at least 13, such as at least 14, such as at least 15, such as at least 16, such as at least 17, such as at least 18, such as at least 19, such as at least 20, such as at least 21, such as at least 22, such as at least 23, such as at least 24, such as at least 25, such as at least 26, such as at least 27, such as at least 28, such as at least 29, such as at least 30, such as at least 31, such as at least 32, such as at least 33, such as at least 34, such as at least 35, such as at least 36, such as at least 37, such as at least 38, such as at least 39, such as at least 40, such as at least 41, such as at least 42, such as at least 43, such as at least 44, such as at least 45, such as at least 46, such as at least 47, such as at least 48, such as at least 49, such as at least 50, such as at least 51, such as at least 52, such as at least 53, such as at least 54, such as at least 55, such as at least 56, such as at least 57, such as at least 58, such as at least 59, such as at least 60, such as at least 61, such as at least 62, such as at least 63, such as at least 64, such as at least 65, such as at least 66, such as at least 67, such as at least 68, such as at least 69, such as at least 70, such as at least 71, such as at least 72, such as at least 73, such as at least 74, such as at least 75, such as at least 76, such as at least 77, such as at least 78, such as at least 79, such as at least 80, such as at least 81, such as at least 82, such as at least 83, such as at least 84, such as at least 85, such as at least 86, such as at least 87, such as at least 88, such as at least 89, such as at least 90, such as at least 91, such as at least 92, such as at least 93, such as at least 94, such as at least 95, such as at least 96, such as at least 97, such as at least 98, such as at least 99, such as at least 100, such as at least 101, such as at least 102, such as at least 103, such as at least 104, such as at least 105, such as at least 106, such as at least 107, such as at least 108, such as at least 109, such as at least 110, such as at least 111, such as at least 112, such as at least 113, such as at least 114, such as at least 115, such as at least 116, such as at least 117, such as at least 118, such as at least 119, such as at least 120, such as at least 121, such as at least 122, such as at least 123, such as at least 124, such as at least 125, such as at least 126, such as at least 127, such as at least 128, such as at least 129, such as at least 130, such as at least 131, such as at least 132, such as at least 133, such as at least 134, such as at least 135, such as at least 136, such as at least 137, such as at least 138, such as at least 139, such as at least 140, such as at least 141, such as at least 142, such as at least 143, such as at least 144, such as at least 145, such as at least 146, such as at least 147, such as at least 148, such as at least 149, such as at least 150, such as at least 151, such as at least 152, such as at least 153, such as at least 154, such as at least 155, such as at least 156, such as at least 157, such as at least 158, such as at least 159, such as at least 160, such as at least 161, such as at least 162, such as at least 163, such as at least 164, such as at least 165, such as at least 166, such as at least 167, such as at least 168, such as at least 169, such as at least 170, such as at least 171, such as at least 172, such as at least 173, such as at least 174, such as at least 175, such as at least 176, such as at least 177, such as at least 178, such as at least 179, such as at least 180, such as at least 181, such as at least 182, such as at least 183, such as at least 184, such as at least 185, such as at least 186, such as at least 187, such as at least 188, such as at least 189, such as at least 190, such as at least 191, such as at least 192, such as at least 193, such as at least 194, such as at least 195, such as at least 196, such as at least 197, such as at least 198, such as at least 199, such as at least 200, such as at least 201, such as at least 202, such as at least 203, such as at least 204, such as at least 205, such as at least 206, such as at least 207, such as at least 208, such as at least 209, such as at least 210, such as at least 211, such as at least 212, such as at least 213, such as at least 214, such as at least 215, such as at least 216, such as at least 217, such as at least 218, such as at least 219, such as at least 220, such as at least 221, such as at least 222, such as at least 223, such as at least 224, such as at least 225, such as at least 226, such as at least 227, such as at least 228, such as at least 229, such as at least 230, such as at least 231, such as at least 232, such as at least 233, such as at least 234, such as at least 235, such as at least 236, such as at least 237, such as at least 238, such as at least 239, such as at least 240, such as at least 241, such as at least 242, such as at least 243, such as at least 244, such as at least 245, such as at least 246, such as at least 247, such as at least 248, such as at least 249, such as at least 250, such as at least 251, such as at least 252, such as at least 253, such as at least 254, such as at least 255, such as at least 256, such as at least 257, such as at least 258, such as at least 259, such as at least 260, such as at least 261, such as at least 262, such as at least 263, such as at least 264, such as at least 265, such as at least 266, such as at least 267, such as at least 268, such as at least 269, such as at least 270, such as at least 271, such as at least 272, such as at least 273, such as at least 274, such as at least 275, such as at least 276, such as at least 277, such as at least 278, such as at least 279, such as at least 280, such as at least 281, such as at least 282, such as at least 283, such as at least 284, such as at least 285, such as at least 286, such as at least 287, such as at least 288, such as at least 289, such as at least 290, such as at least 291, such as at least 292, such as at least 293, such as at least 294, such as at least 295, such as at least 296, such as at least 297, such as at least 298, such as at least 299, such as at least 300, such as at least 301, such as at least 302, such as at least 303, such as at least 304, such as at least 305, such as at least 306, such as at least 307, such as at least 308, such as at least 309, such as at least 310, such as at least 311, such as at least 312, such as at least 313, such as at least 314, such as at least 315, such as at least 316, such as at least 317, such as at least 318, such as at least 319, such as at least 320, such as at least 321, such as at least 322, such as at least 323, such as at least 324, such as at least 325, such as at least 326, such as at least 327, such as at least 328, such as at least 329, such as at least 330, such as at least 331, such as at least 332, such as at least 333, such as at least 334, such as at least 335, such as at least 336, such as at least 337, such as at least 338, such as at least 339, such as at least 340, such as at least 341, such as at least 342, such as at least 343, such as at least 344, such as at least 345, such as at least 346, such as at least 347, such as at least 348, such as at least 349, such as at least 350, such as at least 351, such as at least 352, such as at least 353, such as at least 354, such as at least 355, such as at least 356, such as at least 357, such as at least 358, such as at least 359, such as at least 360, such as at least 361, such as at least 362, such as at least 363, such as at least 364, such as at least 365, such as at least 366, such as at least 367, such as at least 368, such as at least 369, such as at least 370, such as at least 371, such as at least 372, such as at least 373, such as at least 374, such as at least 375, such as at least 376, such as at least 377, such as at least 378, such as at least 379, such as at least 380, such as at least 381, such as at least 382, such as at least 383, such as at least 384, such as at least 385, such as at least 386, such as at least 387, such as at least 388, such as at least 389, such as at least 390, such as at least 391, such as at least 392, such as at least 393, such as at least 394, such as at least 395, such as at least 396, such as at least 397, such as at least 398, such as at least 399, such as at least 400, such as at least 401, such as at least 402, such as at least 403, such as at least 404, such as at least 405, such as at least 406, such as at least 407, such as at least 408, such as at least 409, such as at least 410, such as at least 411, such as at least 412, such as at least 413, such as at least 414, such as at least 415, such as at least 416, such as at least 417, such as at least 418, such as at least 419, such as at least 420, such as at least 421, such as at least 422, such as at least 423, such as at least 424, such as at least 425, such as at least 426, such as at least 427, such as at least 428, such as at least 429, such as at least 430, such as at least 431, such as at least 432, such as at least 433, such as at least 434, such as at least 435, such as at least 436, such as at least 437, such as at least 438, such as at least 439, such as at least 440, such as at least 441, such as at least 442, such as at least 443, such as at least 444, such as at least 445, such as at least 446, such as at least 447, such as at least 448, such as at least 449, such as at least 450, such as at least 451, such as at least 452, such as at least 453, such as at least 454, such as at least 455, such as at least 456, such as at least 457, such as at least 458, such as at least 459, such as at least 460, such as at least 461, such as at least 462, such as at least 463, such as at least 464, such as at least 465, such as at least 466, such as at least 467, such as at least 468, such as at least 469, such as at least 470, such as at least 471, such as at least 472, such as at least 473, such as at least 474, such as at least 475, such as at least 476, such as at least 477, such as at least 478, such as at least 479, such as at least 480, such as at least 481, such as at least 482, such as at least 483, such as at least 484, such as at least 485, such as at least 486, such as at least 487, such as at least 488, such as at least 489, such as at least 490, such as at least 491, such as at least 492, such as at least 493, such as at least 494, such as at least 495, such as at least 496, such as at least 497, such as at least 498, such as at least 499, such as at least 500, such as at least 501, such as at least 502, such as at least 503, such as at least 504, such as at least 505, such as at least 506, such as at least 507, such as at least 508, such as at least 509, such as at least 510, such as at least 511, such as at least 512, such as at least 513, such as at least 514, such as at least 515, such as at least 516, such as at least 517, such as at least 518, such as at least 519, such as at least 520, such as at least 521, such as at least 522, such as at least 523, such as at least 524, such as at least 525, such as at least 526, such as at least 527, such as at least 528, such as at least 529, such as at least 530, such as at least 531, such as at least 532, such as at least 533, such as at least 534, such as at least 535, such as at least 536, such as at least 537, such as at least 538, such as at least 539, such as at least 540, such as at least 541, such as at least 542, such as at least 543, such as at least 544, such as at least 545, such as at least 546, such as at least 547, such as at least 548, such as at least 549, such as at least 550, such as at least 551, such as at least 552, such as at least 553, such as at least 554, such as at least 555, such as at least 556, such as at least 557, such as at least 558, such as at least 559, such as at least 560, such as at least 561, such as at least 562, such as at least 563, such as at least 564, such as at least 565, such as at least 566, such as at least 567, such as at least 568, such as at least 569, such as at least 570, such as at least 571, such as at least 572, such as at least 573, such as at least 574, such as at least 575, such as at least 576, such as at least 577, such as at least 578, such as at least 579, such as at least 580, such as at least 581, such as at least 582, such as at least 583, such as at least 584, such as at least 585, such as at least 586, such as at least 587, such as at least 588, such as at least 589, such as at least 590, such as at least 591 contiguous nucleotides.
In some embodiments the functional fragment of at least 20 contiguous nucleotides according to the invention is not more than 999 contiguous nucleotides, such as not more than 998, such as not more than 997, such as not more than 996, such as not more than 995, such as not more than 994, such as not more than 993, such as not more than 992, such as not more than 991, such as not more than 990, such as not more than 989, such as not more than 988, such as not more than 987, such as not more than 986, such as not more than 985, such as not more than 984, such as not more than 983, such as not more than 982, such as not more than 981, such as not more than 980, such as not more than 979, such as not more than 978, such as not more than 977, such as not more than 976, such as not more than 975, such as not more than 974, such as not more than 973, such as not more than 972, such as not more than 971, such as not more than 970, such as not more than 969, such as not more than 968, such as not more than 967, such as not more than 966, such as not more than 965, such as not more than 964, such as not more than 963, such as not more than 962, such as not more than 961, such as not more than 960, such as not more than 959, such as not more than 958, such as not more than 957, such as not more than 956, such as not more than 955, such as not more than 954, such as not more than 953, such as not more than 952, such as not more than 951, such as not more than 950, such as not more than 949, such as not more than 948, such as not more than 947, such as not more than 946, such as not more than 945, such as not more than 944, such as not more than 943, such as not more than 942, such as not more than 941, such as not more than 940, such as not more than 939, such as not more than 938, such as not more than 937, such as not more than 936, such as not more than 935, such as not more than 934, such as not more than 933, such as not more than 932, such as not more than 931, such as not more than 930, such as not more than 929, such as not more than 928, such as not more than 927, such as not more than 926, such as not more than 925, such as not more than 924, such as not more than 923, such as not more than 922, such as not more than 921, such as not more than 920, such as not more than 919, such as not more than 918, such as not more than 917, such as not more than 916, such as not more than 915, such as not more than 914, such as not more than 913, such as not more than 912, such as not more than 911, such as not more than 910, such as not more than 909, such as not more than 908, such as not more than 907, such as not more than 906, such as not more than 905, such as not more than 904, such as not more than 903, such as not more than 902, such as not more than 901, such as not more than 900, such as not more than 899, such as not more than 898, such as not more than 897, such as not more than 896, such as not more than 895, such as not more than 894, such as not more than 893, such as not more than 892, such as not more than 891, such as not more than 890, such as not more than 889, such as not more than 888, such as not more than 887, such as not more than 886, such as not more than 885, such as not more than 884, such as not more than 883, such as not more than 882, such as not more than 881, such as not more than 880, such as not more than 879, such as not more than 878, such as not more than 877, such as not more than 876, such as not more than 875, such as not more than 874, such as not more than 873, such as not more than 872, such as not more than 871, such as not more than 870, such as not more than 869, such as not more than 868, such as not more than 867, such as not more than 866, such as not more than 865, such as not more than 864, such as not more than 863, such as not more than 862, such as not more than 861, such as not more than 860, such as not more than 859, such as not more than 858, such as not more than 857, such as not more than 856, such as not more than 855, such as not more than 854, such as not more than 853, such as not more than 852, such as not more than 851, such as not more than 850, such as not more than 849, such as not more than 848, such as not more than 847, such as not more than 846, such as not more than 845, such as not more than 844, such as not more than 843, such as not more than 842, such as not more than 841, such as not more than 840, such as not more than 839, such as not more than 838, such as not more than 837, such as not more than 836, such as not more than 835, such as not more than 834, such as not more than 833, such as not more than 832, such as not more than 831, such as not more than 830, such as not more than 829, such as not more than 828, such as not more than 827, such as not more than 826, such as not more than 825, such as not more than 824, such as not more than 823, such as not more than 822, such as not more than 821, such as not more than 820, such as not more than 819, such as not more than 818, such as not more than 817, such as not more than 816, such as not more than 815, such as not more than 814, such as not more than 813, such as not more than 812, such as not more than 811, such as not more than 810, such as not more than 809, such as not more than 808, such as not more than 807, such as not more than 806, such as not more than 805, such as not more than 804, such as not more than 803, such as not more than 802, such as not more than 801, such as not more than 800, such as not more than 799, such as not more than 798, such as not more than 797, such as not more than 796, such as not more than 795, such as not more than 794, such as not more than 793, such as not more than 792, such as not more than 791, such as not more than 790, such as not more than 789, such as not more than 788, such as not more than 787, such as not more than 786, such as not more than 785, such as not more than 784, such as not more than 783, such as not more than 782, such as not more than 781, such as not more than 780, such as not more than 779, such as not more than 778, such as not more than 777, such as not more than 776, such as not more than 775, such as not more than 774, such as not more than 773, such as not more than 772, such as not more than 771, such as not more than 770, such as not more than 769, such as not more than 768, such as not more than 767, such as not more than 766, such as not more than 765, such as not more than 764, such as not more than 763, such as not more than 762, such as not more than 761, such as not more than 760, such as not more than 759, such as not more than 758, such as not more than 757, such as not more than 756, such as not more than 755, such as not more than 754, such as not more than 753, such as not more than 752, such as not more than 751, such as not more than 750, such as not more than 749, such as not more than 748, such as not more than 747, such as not more than 746, such as not more than 745, such as not more than 744, such as not more than 743, such as not more than 742, such as not more than 741, such as not more than 740, such as not more than 739, such as not more than 738, such as not more than 737, such as not more than 736, such as not more than 735, such as not more than 734, such as not more than 733, such as not more than 732, such as not more than 731, such as not more than 730, such as not more than 729, such as not more than 728, such as not more than 727, such as not more than 726, such as not more than 725, such as not more than 724, such as not more than 723, such as not more than 722, such as not more than 721, such as not more than 720, such as not more than 719, such as not more than 718, such as not more than 717, such as not more than 716, such as not more than 715, such as not more than 714, such as not more than 713, such as not more than 712, such as not more than 711, such as not more than 710, such as not more than 709, such as not more than 708, such as not more than 707, such as not more than 706, such as not more than 705, such as not more than 704, such as not more than 703, such as not more than 702, such as not more than 701, such as not more than 700, such as not more than 699, such as not more than 698, such as not more than 697, such as not more than 696, such as not more than 695, such as not more than 694, such as not more than 693, such as not more than 692, such as not more than 691, such as not more than 690, such as not more than 689, such as not more than 688, such as not more than 687, such as not more than 686, such as not more than 685, such as not more than 684, such as not more than 683, such as not more than 682, such as not more than 681, such as not more than 680, such as not more than 679, such as not more than 678, such as not more than 677, such as not more than 676, such as not more than 675, such as not more than 674, such as not more than 673, such as not more than 672, such as not more than 671, such as not more than 670, such as not more than 669, such as not more than 668, such as not more than 667, such as not more than 666, such as not more than 665, such as not more than 664, such as not more than 663, such as not more than 662, such as not more than 661, such as not more than 660, such as not more than 659, such as not more than 658, such as not more than 657, such as not more than 656, such as not more than 655, such as not more than 654, such as not more than 653, such as not more than 652, such as not more than 651, such as not more than 650, such as not more than 649, such as not more than 648, such as not more than 647, such as not more than 646, such as not more than 645, such as not more than 644, such as not more than 643, such as not more than 642, such as not more than 641, such as not more than 640, such as not more than 639, such as not more than 638, such as not more than 637, such as not more than 636, such as not more than 635, such as not more than 634, such as not more than 633, such as not more than 632, such as not more than 631, such as not more than 630, such as not more than 629, such as not more than 628, such as not more than 627, such as not more than 626, such as not more than 625, such as not more than 624, such as not more than 623, such as not more than 622, such as not more than 621, such as not more than 620, such as not more than 619, such as not more than 618, such as not more than 617, such as not more than 616, such as not more than 615, such as not more than 614, such as not more than 613, such as not more than 612, such as not more than 611, such as not more than 610, such as not more than 609, such as not more than 608, such as not more than 607, such as not more than 606, such as not more than 605, such as not more than 604, such as not more than 603, such as not more than 602, such as not more than 601, such as not more than 600, such as not more than 599, such as not more than 598, such as not more than 597, such as not more than 596, such as not more than 595, such as not more than 594, such as not more than 593, such as not more than 592, such as not more than 591, such as not more than 590, such as not more than 589, such as not more than 588, such as not more than 587, such as not more than 586, such as not more than 585, such as not more than 584, such as not more than 583, such as not more than 582, such as not more than 581, such as not more than 580, such as not more than 579, such as not more than 578, such as not more than 577, such as not more than 576, such as not more than 575, such as not more than 574, such as not more than 573, such as not more than 572, such as not more than 571, such as not more than 570, such as not more than 569, such as not more than 568, such as not more than 567, such as not more than 566, such as not more than 565, such as not more than 564, such as not more than 563, such as not more than 562, such as not more than 561, such as not more than 560, such as not more than 559, such as not more than 558, such as not more than 557, such as not more than 556, such as not more than 555, such as not more than 554, such as not more than 553, such as not more than 552, such as not more than 551, such as not more than 550, such as not more than 549, such as not more than 548, such as not more than 547, such as not more than 546, such as not more than 545, such as not more than 544, such as not more than 543, such as not more than 542, such as not more than 541, such as not more than 540, such as not more than 539, such as not more than 538, such as not more than 537, such as not more than 536, such as not more than 535, such as not more than 534, such as not more than 533, such as not more than 532, such as not more than 531, such as not more than 530, such as not more than 529, such as not more than 528, such as not more than 527, such as not more than 526, such as not more than 525, such as not more than 524, such as not more than 523, such as not more than 522, such as not more than 521, such as not more than 520, such as not more than 519, such as not more than 518, such as not more than 517, such as not more than 516, such as not more than 515, such as not more than 514, such as not more than 513, such as not more than 512, such as not more than 511, such as not more than 510, such as not more than 509, such as not more than 508, such as not more than 507, such as not more than 506, such as not more than 505, such as not more than 504, such as not more than 503, such as not more than 502, such as not more than 501, such as not more than 500, such as not more than 499, such as not more than 498, such as not more than 497, such as not more than 496, such as not more than 495, such as not more than 494, such as not more than 493, such as not more than 492, such as not more than 491, such as not more than 490, such as not more than 489, such as not more than 488, such as not more than 487, such as not more than 486, such as not more than 485, such as not more than 484, such as not more than 483, such as not more than 482, such as not more than 481, such as not more than 480, such as not more than 479, such as not more than 478, such as not more than 477, such as not more than 476, such as not more than 475, such as not more than 474, such as not more than 473, such as not more than 472, such as not more than 471, such as not more than 470, such as not more than 469, such as not more than 468, such as not more than 467, such as not more than 466, such as not more than 465, such as not more than 464, such as not more than 463, such as not more than 462, such as not more than 461, such as not more than 460, such as not more than 459, such as not more than 458, such as not more than 457, such as not more than 456, such as not more than 455, such as not more than 454, such as not more than 453, such as not more than 452, such as not more than 451, such as not more than 450, such as not more than 449, such as not more than 448, such as not more than 447, such as not more than 446, such as not more than 445, such as not more than 444, such as not more than 443, such as not more than 442, such as not more than 441, such as not more than 440, such as not more than 439, such as not more than 438, such as not more than 437, such as not more than 436, such as not more than 435, such as not more than 434, such as not more than 433, such as not more than 432, such as not more than 431, such as not more than 430, such as not more than 429, such as not more than 428, such as not more than 427, such as not more than 426, such as not more than 425, such as not more than 424, such as not more than 423, such as not more than 422, such as not more than 421, such as not more than 420, such as not more than 419, such as not more than 418, such as not more than 417, such as not more than 416, such as not more than 415, such as not more than 414, such as not more than 413, such as not more than 412, such as not more than 411, such as not more than 410, such as not more than 409, such as not more than 408, such as not more than 407, such as not more than 406, such as not more than 405, such as not more than 404, such as not more than 403, such as not more than 402, such as not more than 401, such as not more than 400, such as not more than 399, such as not more than 398, such as not more than 397, such as not more than 396, such as not more than 395, such as not more than 394, such as not more than 393, such as not more than 392, such as not more than 391, such as not more than 390, such as not more than 389, such as not more than 388, such as not more than 387, such as not more than 386, such as not more than 385, such as not more than 384, such as not more than 383, such as not more than 382, such as not more than 381, such as not more than 380, such as not more than 379, such as not more than 378, such as not more than 377, such as not more than 376, such as not more than 375, such as not more than 374, such as not more than 373, such as not more than 372, such as not more than 371, such as not more than 370, such as not more than 369, such as not more than 368, such as not more than 367, such as not more than 366, such as not more than 365, such as not more than 364, such as not more than 363, such as not more than 362, such as not more than 361, such as not more than 360, such as not more than 359, such as not more than 358, such as not more than 357, such as not more than 356, such as not more than 355, such as not more than 354, such as not more than 353, such as not more than 352, such as not more than 351, such as not more than 350, such as not more than 349, such as not more than 348, such as not more than 347, such as not more than 346, such as not more than 345, such as not more than 344, such as not more than 343, such as not more than 342, such as not more than 341, such as not more than 340, such as not more than 339, such as not more than 338, such as not more than 337, such as not more than 336, such as not more than 335, such as not more than 334, such as not more than 333, such as not more than 332, such as not more than 331, such as not more than 330, such as not more than 329, such as not more than 328, such as not more than 327, such as not more than 326, such as not more than 325, such as not more than 324, such as not more than 323, such as not more than 322, such as not more than 321, such as not more than 320, such as not more than 319, such as not more than 318, such as not more than 317, such as not more than 316, such as not more than 315, such as not more than 314, such as not more than 313, such as not more than 312, such as not more than 311, such as not more than 310, such as not more than 309, such as not more than 308, such as not more than 307, such as not more than 306, such as not more than 305, such as not more than 304, such as not more than 303, such as not more than 302, such as not more than 301, such as not more than 300, such as not more than 299, such as not more than 298, such as not more than 297, such as not more than 296, such as not more than 295, such as not more than 294, such as not more than 293, such as not more than 292, such as not more than 291, such as not more than 290, such as not more than 289, such as not more than 288, such as not more than 287, such as not more than 286, such as not more than 285, such as not more than 284, such as not more than 283, such as not more than 282, such as not more than 281, such as not more than 280, such as not more than 279, such as not more than 278, such as not more than 277, such as not more than 276, such as not more than 275, such as not more than 274, such as not more than 273, such as not more than 272, such as not more than 271, such as not more than 270, such as not more than 269, such as not more than 268, such as not more than 267, such as not more than 266, such as not more than 265, such as not more than 264, such as not more than 263, such as not more than 262, such as not more than 261, such as not more than 260, such as not more than 259, such as not more than 258, such as not more than 257, such as not more than 256, such as not more than 255, such as not more than 254, such as not more than 253, such as not more than 252, such as not more than 251, such as not more than 250, such as not more than 249, such as not more than 248, such as not more than 247, such as not more than 246, such as not more than 245, such as not more than 244, such as not more than 243, such as not more than 242, such as not more than 241, such as not more than 240, such as not more than 239, such as not more than 238, such as not more than 237, such as not more than 236, such as not more than 235, such as not more than 234, such as not more than 233, such as not more than 232, such as not more than 231, such as not more than 230, such as not more than 229, such as not more than 228, such as not more than 227, such as not more than 226, such as not more than 225, such as not more than 224, such as not more than 223, such as not more than 222, such as not more than 221, such as not more than 220, such as not more than 219, such as not more than 218, such as not more than 217, such as not more than 216, such as not more than 215, such as not more than 214, such as not more than 213, such as not more than 212, such as not more than 211, such as not more than 210, such as not more than 209, such as not more than 208, such as not more than 207, such as not more than 206, such as not more than 205, such as not more than 204, such as not more than 203, such as not more than 202, such as not more than 201, such as not more than 200, such as not more than 199, such as not more than 198, such as not more than 197, such as not more than 196, such as not more than 195, such as not more than 194, such as not more than 193, such as not more than 192, such as not more than 191, such as not more than 190, such as not more than 189, such as not more than 188, such as not more than 187, such as not more than 186, such as not more than 185, such as not more than 184, such as not more than 183, such as not more than 182, such as not more than 181, such as not more than 180, such as not more than 179, such as not more than 178, such as not more than 177, such as not more than 176, such as not more than 175, such as not more than 174, such as not more than 173, such as not more than 172, such as not more than 171, such as not more than 170, such as not more than 169, such as not more than 168, such as not more than 167, such as not more than 166, such as not more than 165, such as not more than 164, such as not more than 163, such as not more than 162, such as not more than 161, such as not more than 160, such as not more than 159, such as not more than 158, such as not more than 157, such as not more than 156, such as not more than 155, such as not more than 154, such as not more than 153, such as not more than 152, such as not more than 151, such as not more than 150, such as not more than 149, such as not more than 148, such as not more than 147, such as not more than 146, such as not more than 145, such as not more than 144, such as not more than 143, such as not more than 142, such as not more than 141, such as not more than 140, such as not more than 139, such as not more than 138, such as not more than 137, such as not more than 136, such as not more than 135, such as not more than 134, such as not more than 133, such as not more than 132, such as not more than 131, such as not more than 130, such as not more than 129, such as not more than 128, such as not more than 127, such as not more than 126, such as not more than 125, such as not more than 124, such as not more than 123, such as not more than 122, such as not more than 121, such as not more than 120, such as not more than 119, such as not more than 118, such as not more than 117, such as not more than 116, such as not more than 115, such as not more than 114, such as not more than 113, such as not more than 112, such as not more than 111, such as not more than 110, such as not more than 109, such as not more than 108, such as not more than 107, such as not more than 106, such as not more than 105, such as not more than 104, such as not more than 103, such as not more than 102, such as not more than 101, such as not more than 100, such as not more than 99, such as not more than 98, such as not more than 97, such as not more than 96, such as not more than 95, such as not more than 94, such as not more than 93, such as not more than 92, such as not more than 91, such as not more than 90, such as not more than 89, such as not more than 88, such as not more than 87, such as not more than 86, such as not more than 85, such as not more than 84, such as not more than 83, such as not more than 82, such as not more than 81, such as not more than 80, such as not more than 79, such as not more than 78, such as not more than 77, such as not more than 76, such as not more than 75, such as not more than 74, such as not more than 73, such as not more than 72, such as not more than 71, such as not more than 70, such as not more than 69, such as not more than 68, such as not more than 67, such as not more than 66, such as not more than 65, such as not more than 64, such as not more than 63, such as not more than 62, such as not more than 61, such as not more than 60, such as not more than 59, such as not more than 58, such as not more than 57, such as not more than 56, such as not more than 55, such as not more than 54, such as not more than 53, such as not more than 52, such as not more than 51, such as not more than 50, such as not more than 49, such as not more than 48, such as not more than 47, such as not more than 46, such as not more than 45, such as not more than 44, such as not more than 43, such as not more than 42, such as not more than 41, such as not more than 40, such as not more than 39, such as not more than 38, such as not more than 37, such as not more than 36, such as not more than 35, such as not more than 34, such as not more than 33, such as not more than 32, such as not more than 31, such as not more than 30, such as not more than 29, such as not more than 28, such as not more than 27, such as not more than 26, such as not more than 25 contiguous nucleotides.
In some embodiments the promoter DNA polynucleotide according to the invention exhibits an increased protein expression level as compared to the protein expression level of any one of the promoter DNA polynucleotides having the sequence of SEQ ID NO:1 or SEQ ID NO:4.
In some embodiments the increase in protein expression level is from about 50 percent to about 300 percent relative to the protein expression level of any one of the promoter DNA polynucleotides having the sequence of SEQ ID NO:1 or SEQ ID NO:4, or to the pOPIE2 promoter. In some embodiments the increase in protein expression level is more than 300 percent relative to the protein expression level of any one of the promoter DNA polynucleotides having the sequence of SEQ ID NO:1 or SEQ ID NO:4, or to the pOPIE2 promoter.
In some embodiments the increase in protein expression level is 2 fold to 10 fold relative to the protein expression level of any one of the promoter DNA polynucleotides having the sequence of SEQ ID NO:1 or SEQ ID NO:4, or to the pOPIE2 promoter.
In some embodiments the increase in protein expression level is 10 fold to 100, such as 20 to 80, such as 20 to 40 fold, relative to the protein expression level of any one of the promoter DNA polynucleotides having the sequence of SEQ ID NO:1 or SEQ ID NO:4, or to the pOPIE2 promoter.
It is to be understood that the increase in activity is measured and compared to the reference under same and standard conditions.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises a selection marker, such as a selection marker selected from the group consisting of a Zeocin selection marker, a Neomycin selection marker, a Hygromycin selection marker, a Puromycin selection marker, and a Blasticidin selection marker.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises a bacterial promoter, such as the pKANR bacterial promoter, such as a functional fragment of Kanamycin promoter.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises a second promoter DNA polynucleotide suitable to drive the expression of the selection marker in an insect cell. In some embodiments this second promoter is selected from the group consisting of
In some embodiments the isolated DNA polynucleotide according to the invention further comprises one or more ubiquitous chromatin opening element upstream and/or downstream relative to the a multiple cloning site.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one Transcriptional insulator element, such as Su(Hw) or Gypsy (GSu(Hw)) insulator sequence. (Mol Cell Biol. 1997 April; 17(4): 2202-2206.)
In some embodiments the isolated DNA polynucleotide according to the invention further comprises a dihydrofolate reductase (dhfr) coding sequence suitable for selection in insect cells.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one polyadenylation signal sequence such as SV40 polyA signal and/or an OPIE2 polyA signal.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises an E. coli origin.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one protein export signal polynucleotide sequence, such as one selected from the list consisting of BIP and CPY.
In some embodiments the isolated DNA polynucleotide according to the invention is essentially free of viral DNA.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one HIS-tag sequence. In some embodiments the HIS-tag is an N-terminal HIS-tag. In some embodiments the HIS-tag sequence is according to the following sequence: atgaaacaccaacaccaacatcaacatcaacatcaacatcaa (SEQ ID NO: 38)
In some embodiments the isolated DNA polynucleotide according to the invention further comprises a multiple cloning site downstream of the promoter DNA polynucleotide for insertion of the gene encoding a polypeptide of interest into the isolated DNA polynucleotide.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one 72 bp elements from SV40. In some embodiments the isolated DNA polynucleotide according to the invention further comprises two 72 bp elements from SV40. In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one 72 bp elements from SV40 upstream of the promoter and at least one 72 bp elements from SV40 downstream of the promoter.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one PRE element from Hepatitis B virus. In some embodiments the PRE element from Hepatitis B virus is according to SEQ ID NO:40, such as nucleotides 10 to 574 of SEQ ID NO:40.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one amplification control element.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one Ori-beta element.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one matrix attachment region (MAR) element.
In some embodiments the promoter DNA polynucleotide sequence according to the invention controls the expression of a gene or other DNA sequence to which it is linked.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one polynucleotide sequence encoding a polypeptide heterologous to the promoter DNA polynucleotide sequence.
In some embodiments the isolated DNA polynucleotide according to the invention further comprises at least one nucleotide sequence which is a functional fragment of at least three contiguous nucleotides of any one sequence of a nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO: 68; and a functional nucleotide sequence with a sequence identity of at least 80% thereof, said functional fragment having promoter enhancer activity in a Drosophila S2 cell.
In some embodiments the isolated DNA polynucleotide according to the invention is a cloning vector.
In some embodiments the isolated DNA polynucleotide according to the invention is an expression vector.
One aspect relates to a cell comprising the isolated DNA polynucleotide according to the invention. In some embodiments the cell is an insect cell. In some embodiments the cell is a Drosophila melanogaster cell. In some embodiments the cell is a Drosophila melanogaster S2 cell.
In some embodiments the cell comprising the isolated DNA polynucleotide according to the invention is stably transfected with said isolated DNA polynucleotide.
As used herein “stably transfected” refers to a cell that has been transfected with a DNA polynucleotide according to the invention to produce permanent lines of cultured cells with a new gene inserted into their genome. Usually this is done by linking the desired gene with a “selectable” gene, i.e. a gene which confers resistance to a antibiotic (like Zeocin). Upon putting the antibiotic into the culture medium, only those cells which incorporate the resistance gene will survive, and essentially all of those will also have incorporated the DNA polynucleotide according to the invention.
A “cloning vector” means a plasmid DNA which can be used to insert a DNA fragment of interest into a host cell, normally in order to produce multiple copies of the fragment and hence the vector.
“Expression vector” means a plasmid or viral DNA containing necessary regulatory signals for the synthesis of mRNA derived from gene sequences, which can be inserted into the vector. The gene sequences being e.g. a chimeric polynucleotide as defined above.
A “polyadenylation sequence” as used herein refers to a DNA sequence which when transcribed is recognized by the expression host to add polyadenosine residues to transcribed mRNA. It is operably linked to the 3′-end of the DNA encoding the polypeptide to be expressed. Suitable polyadenylation sequences includes the OPIE2 polyA tail and the late SV40 polyA tail as described in Angelichio et al. 1991, Comparison of several promoters and polyadenylation signals for use in heterologous gene expression in cultured Drosophila cells, Nucleic Acids Research, Vol. 19, No. 18 5037-5043.
A “selectable marker” as used herein refers to a genetic element present in an expression vector, which, when expressed, provides an indication of successful transformation of the host cell. For instance, the selectable marker may provide the transformed host cell with resistance to an antibiotic (a dominant type marker) one or with the ability to metabolise a particular nutrient (an auxotrophic type of selectable marker, i.e. a marker that “cures” a deficiency in the host). Typically, the selectable marker is under the control of a promoter that is separate from the promoter that controls expression of the gene to be expressed by the vector.
The term “operably linked” refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).
The term “expression”, as used herein, refers to complete biological process in a host cell that sets out from the transcription and stable accumulation of mRNA derived from the isolated DNA polynucleotide of the invention (where this further comprises a polynucleotide sequence encoding a polypeptide) through subsequent translation of mRNA into a polypeptide product and finally to post-translational modifications of the polypeptide product effected by the host cell. “Overexpression” refers to the production of a gene product in transformed cells that exceeds levels of production in normal, non-transformed cells.
As used herein a “protein export signal polynucleotide sequence” refers to a sequence that directs or facilitates the translocation of an expressed protein across the membrane of the host expression cell. A “protein export signal polynucleotide sequence” may be present in the N-terminus of a precursor polypeptide (a pre-peptide or pre-pro-peptide) to directs its translocation across a membrane. Typically, a precursor polypeptide is processed by cleavage of the signal sequence to generate a mature peptide or a pro-peptide. If the product of off-cleavage of the signal peptide is a pro-peptide, the mature peptide is the product of subsequent post-translational modifications that involve further removal of amino acids.
Other suitable “protein export signal polynucleotide sequence” within this definition includes the Drosophila BiP signal sequence for secretion and CPY.
The Drosophila BiP protein encodes an immunoglobulin-binding chaperone protein. This secretion signal efficiently targets high levels of BiP into the secretory pathway of S2 cells (see Kirkpatrick, R. B. et al. (1995) J. Biol. Chem. 270: 19800-19805).
The terms “ubiquitous chromatin opening element” or “UCOE” as used herein refers to a DNA sequence which opens chromatin or maintains chromatin in an open state and facilitates reproducible expression of an operably-linked gene in cells.
The terms “matrix attachment region” or “MAR” or “Scaffold/matrix attachment region” as used herein refers to a nucleotide sequence in the DNA of eukaryotic chromosomes where the nuclear matrix attaches. MARs mediate structural organization of the chromatin within the nucleus. These elements constitute anchor points of the DNA for the chromatin scaffold and serve to organize the chromatin into structural domains. Studies on individual genes led to the conclusion that the dynamic and complex organization of the chromatin mediated by S/MAR elements plays an important role in the regulation of gene expression.
The terms “amplification control element” or “Ace” as used herein refers to an element, which is involved in initiating amplification of DNA from the replication origin. Deletion analyses of transgenic constructs derived from the third chromosome cluster have identified a 320-bp amplification control element (ACE3) required for amplification. Thus within this definition is included the D. melanogaster ACE3 element. Included within this definition is also amplification enhancing regions (AERs).
The terms “Ori-beta element” or “oriB” as used herein refers to an origin of replication. The origin of replication (also called the replication origin) is a particular sequence in a genome or plasmid at which replication is initiated. This can either be DNA replication in living organisms such as prokaryotes and eukaryotes, or RNA replication in RNA viruses, such as double-stranded RNA viruses. DNA replication may proceed from this point bidirectionally or unidirectionally. The origin of replication binds the pre-replication complex, a protein complex that recognizes, unwinds, and begins to copy DNA. One specific “Ori-beta element” within this definition is the D. melanogaster Ori-beta element.
For sequence requirements for functional ACE3 and ori-B elements see Hongjun Zhang and John Tower, 2004, Sequence requirements for function of the Drosophila chorion gene locus ACE3 replicator and ori-b origin elements, Development 131, 2089-2099, 2004 and Carminati et al. 1992, The Drosophila ACE3 Chorion Element Autonomously Induces Amplification, MOLECULAR AND CELLULAR BIOLOGY, May 1992, p. 2444-2453.
Nuclear import in non-dividing cells such as muscle cells is one of the problems for non-viral gene delivery systems. This can result in lowered synthesis of the antigen that will subsequently result in poor antigen presentation. A 72 bp repeat of the SV40 enhancer region that enhances nuclear transport of nonviral DNA in non dividing cells has been identified. The enhancer region has several transcription factor binding sites. As soon as the plasmid enters the cytoplasm, it is bound by several transcription factors thus allowing the nonviral DNA to be rapidly transferred to the nucleus by providing the nuclear localization signal (Exp Cell Res. 1999, 253, 713). Enhancement in gene expression was also observed using the SV40 enhancer element containing vector injected in murine muscle by electroporation (Gene Ther., 2001, 8, 494).
The term “72 bp elements from SV40” as used herein refers to the 72 bp repeat of the SV40 enhancer region that enhances nuclear transport of nonviral DNA in non dividing cells. In particular embodiments the “72 bp elements from SV40” refers to an element with the following sequence ATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCA CAGCTGGTT corresponding to nucleotide no. 10 to nucleotide no. 86 of SEQ ID NO:39 In particular embodiments the “72 bp elements from SV40” refers to an element with the sequence of SEQ ID NO:39.
PRE Element from Hepatitis B Virus (SEQ ID NO:40)
Some eukaryotic or viral mRNA contains inhibitory sequences preventing them from being transported out of nucleus to the cytoplasm where they can be translated. Hepatitis B virus S transcripts contain a region, known as the posttranscriptional regulatory element (PRE) that functions in cis to activate their transportation. This element can partially substitute for the human immunodeficiency virus Rev-response element (RRE). It has been shown that adding this element or elements with similar function in the 3′ untranslated region of the gene encoding the antigen (such as HIV-1 Gag) can increase the expression level of the antigen and improve immune responses.
The term “insulator sequence”, as used herein refers to DNA sequences that affect interactions between promoters and enhancers/silencers and function as barriers for spreading of repressive chromatin. Included within this definition is the (su(Hw)) insulator sequence as described in Lu L, Tower 3, 1997, A transcriptional insulator element, the su(Hw) binding site, protects a chromosomal DNA replication origin from position effects, Mol Cell Biol. April; 17(4): 2202-2206. Among the variety of sequences with an insulator function present in the Drosophila melanogaster genome, the well-studied and perhaps the strongest insulator consisting of reiterated binding sites for the Su(Hw) protein, first found in the gypsy retrotransposon may be used. The Su(Hw) insulator is a versatile modulator of regulatory interactions, blocking more than a score of different enhancers. Recently, an endogenous Su(Hw)-dependent but structurally distinct insulator has been found between the yellow and achaete genes.
The term “ligation independent cloning” or “LIC” is used herein according to the definition by Robert E. Novy, Keith W. Yaeger and Kristin M. Kolb in the article “Efficient Directional Cloning of PCR Products” (http://www.emdbiosciences.com/docs/NDIS/inno05-002.pdf), ligation independent cloning (LIC) can be described as follows: “Ligation independent cloning (LIC) was developed for the directional cloning of PCR products without restriction enzyme digestion or ligation reactions. LIC vectors are created by treating a linearized backbone with T4 DNA polymerase in the presence of only one dNTP. The 3′ to 5′ exonuclease activity of T4 DNA polymerase removes nucleotides until it encounters a residue corresponding to the single dNTP present in the reaction mix. At this point, the 5′ to 3′ polymerase activity of the enzyme counteracts the exonuclease activity to effectively prevent further excision. Plasmid sequences adjacent to the site of linearization are designed to produce specific non-complementary 13- or 14-base single stranded overhangs in the LIC vector. PCR products with complementary overhangs are created by building appropriate 5′ extensions into the primers. The PCR product is purified to remove dNTPs (and original plasmid if it was used as template) and then treated with T4 DNA polymerase in the presence of the appropriate dNTP to generate the specific vector-compatible overhangs. The annealed LIC vector and insert are transformed into competent E. coli cells. Covalent bond formation at the vector insert junctions occurs within the cell to yield circular plasmid.”
A detailed description of LIC methodology can be found in Nick S. Berrow et al. 2007 “A versatile ligation-independent cloning method suitable for high-throughput expression screening applications”, Nucleic Acids Research.
A number of specific embodiments of LIC enabled vectors of the present invention are provided in SEQ ID NOs. 69-73.
In one specific embodiment the isolated DNA polynucleotide according to the invention consists of the following elements:
In one specific embodiment the isolated DNA polynucleotide according to the invention consists of the following elements:
In one specific embodiment the isolated DNA polynucleotide according to the invention consists of the following elements:
In one specific embodiment the isolated DNA polynucleotide according to the invention consists of the following elements:
In some specific embodiments the following elements will be exchanged in the isolated DNA polynucleotide according to the invention:
One suitable vector according to the invention may consist of:
It is to be understood from the above that the individual elements may be placed in any given order. Accordingly the insect promoter and the bacterial promoter may be placed directly following each other. Also the same selection marker sequence may be used by both the bacterial promoter and by the insect cell promoter.
The following elements may be added to the expression vector to increase expression level.
In some embodiments a polynucleotide sequence according to the invention hybridizes under conditions of moderate stringency to a sequence selected from the group consisting of:
The term “moderate stringency” as used herein refers to conditions of polynucleotide hybridization in about 50% formamide, 6×SSC at about 42° C. and washing conditions of about 60° C., 0.5×SSC, 0.1% SDS.
Another aspect of the present invention relates to expression and recovery of polypeptides from host cells.
As detailed above, this aspect of the invention generally utilises the finding that promoter DNA polynucleotide comprising at least one sequence selected from the group consisting of:
The present inventor has recently demonstrated that this improved yield (over e.g. construct utilising the pOPIE2 promoter) is a consequence of improved expression levels as well as secretion. As mentioned above the method according to the invention comprises the steps of
Methods for transformation will vary according to the choice of host cell, but typically transfection by means of lithium acetate (Okazaki et al. Nucleic acid Res. 18: 6485-6489, 1990, incorporate by reference herein) or electroporation is used in yeast, whereas both transfection and transduction (i.e. transfer of genetic material by means of a viral vector) may be used in cells from multicellular organisms. Suitable methods for transfection in Drosophila melanogaster S2 cells is described in Park J. H.; Kim H. Y.; Han K. H.; Chung I. S, Optimization of transfection conditions for expression of green fluorescent protein in Drosophila melanogaster S2 cells—a highly efficient, lipid-mediated DNA-transfection procedure. Enzyme and Microbial Technology, Volume 25, Number 7, October 1999, pp. 558-563(6)
More general teachings on transformation and culture of transformed cells (yeast or higher) can be found in Sambrook 3 et al., “Molecular Cloning: A laboratory Manual”, 3rd edition.
The teachings provided above concerning choice of promoter, functional secretion signal peptides, choice of format of vectors, choice of host cells, use of selectable markers, and use of stabilizing elements, apply mutatis mutandis to the method of the invention. The only difference in these teachings and the teachings pertaining to the method of the invention is the precise composition of the coding sequence in the vector, since the method of the invention does not rely on the presence of a chimeric polynucleotide as defined herein. It is however, preferred that the expression vector used in the method of the invention is an expression vector of the invention.
It some embodiments, the method of the invention comprises the further step of subjecting the polypeptide obtained in step (c) to post-translational modification—this entails both post-translational modifications that are effected by the host cell (and subsequently made before recovery of the polypeptide) and modifications made in vitro after recovery of the polypeptide.
Step (a) of the method of the invention normally comprises the steps of introducing the vector into the host cell and subsequently selecting transformants that express a selectable marker gene present in the vector. Useful selectable marker genes have been detailed above.
The invention will be illustrated by means of the following non-limiting examples.
E. coli
Escherichia coli
Drosophila S2 cells was derived from ATCC(CRL-1963, lot. no. 3225543)
A vial of Drosophila S2 cells from ATCC was resuscitated and expanded in tissue culture flasks. When the cell number exceeded 108 cells, a cell bank consisting of twenty vials containing 2×107 Drosophila S2 cells in 1 mL freeze medium (Excell420+50% FBS+10% DMSO) was established and stored at −80° C.
For this study the model protein, RANK ligand (RANK-L, or RANKL) was used. This protein was inserted after the BIP-signal sequence, in the multiple cloning site, in each of the tested vectors.
pKanR sequence used according to the present examples: AAGGGATTTTGGTCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTT CATAGTATAATACGACTCACTATAGGAGGGCC (SEQ ID NO: 63, sequence in bold KanaR promoter, remaining sequence EM7 promoter).
Construction of the S2 vectors
pZOp2F-NheI (p2260, strain MR#3070). The vector was created with NheI-site downstream SV40 by using QuikChange Site-Direct Mutagenesis Kit from Stratagene, for cloning vectors with different promoters
The QuickChange was made with primers 975 and 976 using p1205 as template. The PCR product was treated with DpnI for one hour at 37° C. and transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
The plasmid has been fully sequenced using primers 590
pHP11 (p2263, strain MR#3073) was constructed by one step PCR amplification. The PCR was made with primers 980 and 979 using p805 (pAc5.1/V5-HisA) as template. The resulting fragment was 2540 bp, containing Actin 5C promoter. The PCR fragment digested with restrictions endonucleases NheI and HindIII and clone into NheI and HindIII digested and SAP treated p2260. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
In the resulting plasmid the insert has been fully sequenced using primers 590, 981, 986 and 917.
pHP12-vector (p2263, strain MR#3073) was constructed by one step PCR amplification. The PCR was made with primers 981 and 982 using p2546 as template. The resulting fragment was 299 bp, containing Hsp70 promoter from Hsp70-pFast-Bac which was taken from genomic DNA from S2-cells.
The PCR fragment digested with restrictions endonucleases NheI and HindIII and clone into NheI and HindIII digested and SAP treated p2260. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
In the resulting plasmid the insert has been fully sequenced using primers 590, 981, 986 and 917.
pHP13 (p2264, strain MR#3074) was constructed by one step PCR amplification. The PCR was made with primers 983 and 984 using p2546 as template. The resulting fragment was 473 bp, containing full-length Hsp70 promoter from Hsp70-pFast-Bac which was taken from genomic DNA from S2-cells.
The PCR fragment digested with restrictions endonucleases NheI and HindIII and clone into NheI and HindIII digested and SAP treated p2260. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
In the resulting plasmid the insert has been fully sequenced using primers 590, 984 and 917.
pHP15a (p2270, strain MR#3080)
The vector containing ptrc promoter instead EM7 promoter and Actin 5C promoter instead of OpIE2 all upstream the ZeoR gene.
The construct was constructed by SOE-PCR. First PCR1 fragment was made with primers 4007 and 4009 using p2263 as template. The resulting PCR-product have the size of 234 bp. The second PCR2 fragment was made with primers 4008 and 4000 using p2263 as template. The fragment have the size of 1134 bp.
The SOE-PCR was made by mixing PCR1 and PCR2 products. Finally the fragment is amplified using primers 4000 and 4009.
The resulting fragment was 1433 bp and digested with restrictions endonucleases EcoRI and NcoI and clone it into EcoRI and NcoI digested and SAP treated p2263. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
In the resulting plasmid the insert has been fully sequenced using primers 1892, 2232, 2233, 2234, 2235, 2236, 2007, 4000, 4002, 4007 and 4009.
pHP15b (p2271, strain MR#3081)
The vector is almost like pHP15a but containing Hsp70 promoter instead of Actin 5C promoter upstream the ZeoR gene. Constructed by one step PCR amplification. The PCR was made with primers 4001 and 4002 using p2270 as template. The resulting fragment was 290 bp, containing actin 5c promoter.
The PCR fragment digested with restrictions endonucleases XmnI and SphI and clone into XmnI and SphI digested and SAP treated p2270. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
In the resulting plasmid the insert has been fully sequenced using primers 2007, 4000 and 4001.
pHP15c (p2272, strain MR#3082) containing promoter sequence upstream for KanaR instead of EM7 promoter upstream the ZeoR gene.
The construct was constructed by SOE-PCR. First PCR1 fragment was made with primers 4003 and 4009 using p2270 as template. The resulting PCR-product have the size of 296 bp.
The second PCR2 fragment was made with primers 4004 and 2007 using p2270 as template. The fragment have the size of 189 bp.
The SOE-PCR was made by mixing PCR1 and PCR2 products. Finally the fragment is amplified using primers 4009 and 2007.
The resulting fragment of 450 bp was digested with restrictions endonuclease(s) SphI and NcoI and cloned into SphI and NcoI digested and SAP treated p2270. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
In the resulting plasmid the insert has been fully sequenced using primers 2007 and 4003
Construction of Truncated Actin 5c Promoter from pHP11
pHP17 (p2276, strain MR#3086) containing truncated sequence from Actin 5c promoter 1486 bp.
Vector p2262 was digested with restrictions endonucleases SphI and NheI and the vector was ligated again with use of Klenow. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
Colonies were screen by colony PCR using primers 590 and 980. Correct inserts display DNA fragment have size of 1510 bp.
In the resulting plasmid the insert has been fully sequenced using primers 590, 917, 990, 992, 993, 994, 995 and 2509
pHP18 (p2277, MR#3087) containing truncated sequence from Actin 5c promoter 612 bp.
Vector p2262 was digested with restrictions endonucleases SpeI and NheI and the vector was ligated again with use of Klenow. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
Colonies were screen by colony PCR using primers 590 and 980. Correct inserts display DNA fragment have size of 660 bp.
In the resulting plasmid the insert has been fully sequenced using primers 590, 917, 993, 995 and 2509
pHP12-Afl II (p2287, strain MR#3097) The vector was constructed by SOE-PCR. First PCR1 fragment was made with primers 987 and 4036 using p2263 as template. The resulting PCR-product have the size of 217 bp.
The second PCR2 fragment was made with primers 4035 and 986 using p22630 as template. The fragment have the size of 190 bp.
The SOE-PCR was made by mixing PCR1 and PCR2 products. Finally the fragment is amplified using primers 986 and 987.
The resulting fragment of 362 bp was digested with restrictions endonucleases NheI and HindIII and cloned into NheI and HindIII digested and SAP treated p2263. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
In the resulting plasmid the insert has been fully sequenced using primer 982.
Cloning of Hybrid Vectors with Actin5c Core and Hsp70 Core Promoter.
pHP18-Afl II (p2288, strain MR#3098) The vector was constructed by SOE-PCR. First PCR1 fragment was made with primers 987 and 4038 using p2277 as template. The second PCR2 fragment was made with primers 4037 and 986 using p2277 as template. The fragment have the size of 224 bp.
The SOE-PCR was made by mixing PCR1 and PCR2 products. Finally the fragment is amplified using primers 986 and 987.
The resulting fragment of 689 bp was digested with restrictions endonucleases NheI and HindIII and cloned into NheI and HindIII digested and SAP treated p2277. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
In the resulting plasmid the insert has been fully sequenced using primer 980.
pHP19 hybrid actin5c core vector, containing Actin5C core promoter and Hsp70 promoter sequence upstream the Hsp70 core promoter.
Vector p2288 was digested with restrictions endonucleases AflII and HindIII, the resulting product have the size of 178 bp and the fragment clones into AflII and HindIII digested p2287. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
Colonies were screen by colony PCR using primers 4000 and 917. Correct inserts display DNA fragment of expected size. In the resulting plasmid the insert has been fully sequenced using primers 980 and 917.
pHP20 hybrid-Hsp70-core, containing Hsp70 core promoter and Actin5C promoter sequence upstream the Actin5c core promoter.
Vector p2287 was digested with restrictions endonucleases AflII and HindIII, the resulting product have the size of 144 bp and clone it into AflII and HindIII digested p2288. Ligated over night in a termo cycler. The ligation product was transformed into DH10B cells, plated out on LB Agar plates containing 0.75 ug/ml Zeocin and incubatet ON.
Colonies were screen by colony PCR using primers 993 and 901. Correct inserts display DNA fragment have size 478 bp. In the resulting plasmid the insert has been fully sequenced using primers 986 and 917
Cryovials, 1.8 ml: Nunc cat. no. 377267
Excell420: SAFC cat. no. 14420
Fetal Bovine Serum, FBS, 500 ml: Life Technologies cat. no. 10099-141
Shake flasks, 250 ml with 0.2 μm vented cap: Corning cat. no. 431144 (Working volume: 25-70 ml)
Shake flasks, 1000 ml with 0.2 μm vented cap: Corning cat. no. 431147 (Working volume: 100-225 ml)
Tissue Culture Flasks, 25 cm2: Greiner cat. no. 690160 (Working volume: 4-8 ml)
Tissue Culture Flasks, 75 cm2: Greiner cat. no. 658170
Initiating of Cell Culture from Frozen Stock
Use cells from a growing culture maintained as stipulated above, that have been diluted or resuspended after centrifugation one to two days prior to the transfection. Viability should be >90%.
Other suitable methods for transfection in Drosophila melanogaster S2 cells is described in Park J. H.; Kim H. Y.; Han K. H.; Chung I. S, Optimization of transfection conditions for expression of green fluorescent protein in Drosophila melanogaster S2 cells—a highly efficient, lipid-mediated DNA-transfection procedure. Enzyme and Microbial Technology, Volume 25, Number 7, October 1999, pp. 558-563(6).
Effectene Transfection Reagent is a non-liposomal lipid formulation that has minimal cytotoxicity by transfecting in the presence of serum and has high transfection efficiency. Effectene Reagent is used in conjunction with the Enhancer and the DNA-condensation buffer (Buffer EC) to achieve high transfection efficiencies.
After transfection cells are allowed to grow and produce at 23° C. for 2 to 4 days before a sample is taken for cell number, protein-of-interest and total protein determination. No selection agent should be added during transient transfections.
After transfection the cells are allowed to grow for 1 to 2 days before 1.5 mg/mL Zeocin (or other appropriate selection agent at appropriate concentration) is added. The cells are then expanded in T-flasks and shake flasks as described above (Expansion of the cells in T-flasks; Expansion of the cells in shake flasks). After 2 to 4 weeks only cells resistant to the selection marker, because of integration of the resistance marker into the genome, will be present and the cell line can be considered stable. The selection agent can at this point be left out from further cultivation or propagation steps, and the cells can be frozen down as described above.
ELISA was used to analyze the model protein (RANK-ligand) used in this study. Bradford total protein analysis was used to determine total protein concentration.
A range of vectors with enhanced protein expression levels have been created. There are 3 main classes of NN2 expression vector: The first class comprises vectors with different variants of the actin5C promoter driving protein expression; the second class refers to vectors employing the HSP70 promoter, while the third involves hybrid actin5C/HSP70 promoters.
A mutant Actin5c promoter (see mutations under sequence alignment section) was investigated to determine its protein expression level (vector pHP11). It was found that the mutant Actin5C promoter resulted in a consistently higher expression level compared to pOPIE2 (See
Two versions of the Drosophila melanogaster S2 HSP70 promoter were also tested. The first promoter was the full-length HSP70 promoter (457 bp, vector pHP 13), while the second was a truncated version of HSP70 (59 bp to 342 bp, see sequences section, vector pHP12). The truncated version was found to have up to five-fold higher protein expression levels compared to the full-length promoter (see
The Actin5C promoter mutant and the truncated HSP70 promoter were further studied through truncation. The protein expression results for both transient and stable cell lines can be seen in
A 3 to 9 fold increase in protein expression was achieved over the pOPIE2 promoter for the Actin5C and HSP70 promoter variants in stable cell lines (
Protein expression levels were increased 4 to 12 fold in transient transformations compared to the pOPIE2 promoter. The shortest truncated Actin5C promoter (vector pHP18) had the highest consistent expression level in transient transfections.
The core promoters of Actin5C (vector pHP10) and HSP70 (vector pHP16) were compared to pOPIE2 to gain further insight into their relative properties. The expression level of the HSP70 core promoter is significantly higher than the Actin5C core promoter, although both promoters are significantly weaker than the pOPIE2 promoter that was used as internal control. (
The Actin5C core promoter was used to express the ZeoR zeocin resistance gene in conjunction with the KanR bacterial promoter (vector pHP15c). This allows Zeocin to be used as selection marker in both E. coli and S2 insect cells. In addition, the Actin5C core promoter is significantly weaker than the pOPIE2 promoter used to express the zeocin resistance marker in p2ZOp2F. This leads to a 2-fold decrease in antibiotic resistance after transfection compared to cells transfected with the p2ZOp2F plasmid, leading to 2-fold less Zeocin (0.75 mg/ml vs. 1.5 mg/ml) to be used when selecting for stable cells.
Furthermore, different selection markers were included to allow for greater flexibility in the application of the vectors. The following markers are included: Zeocin, neomycin and blasticidin.
The expression level of a mutant Actin5C promoter was compared to the commercially available pOPIE2 promoter and found to be significantly higher (see
In Drosophila melanogaster S2 cells, regulatory mechanisms not only lead to induction of HSP70 from heat shock, but also prevent expression at normal temperatures (Feder et al. 1992, Genes Dev. August; 6(8):1402-13). Surprisingly, the truncated HSP70 promoter showed the highest expression level in stably transfected cell lines compared to the Actin5C and pOPIE2 promoters (see
Using the significantly weakened expression level (compared to the full-length and pOPIE2 promoters) of Actin5C core promoter along with the KanR bacterial promoter results in hightened Zeocin sensitivity of transfected cell lines (2-fold). Lower resistance could help in selecting higher multicopy integration events to make up for the poor expression level of the ZeoR resistance marker, leading to higher gene-of-interest protein expression level. The ability to select for high copy-number gene-integration events using less Zeocin when making stable cell lines would be an advantage in itself, as Zeocin is a mutagen and could have adverse and unexpected effects on the cells.
In the above-discussed experiments it was found that the truncated HSP70 promoter led to the highest expression level in stable cell lines (
It was therefore decided to make hybrid promoters, where the core promoter from Actin5C and HSP70 were exchanged in the truncated Actin5C and truncated HSP70 promoters, respectively. This was believed to lead to a significant increase in expression level in the Actin5C-HSP70core hybrid-promoter compared to the original Actin5C promoter.
The DNA for the pHP34s vector was ordered synthetically from GeneART, Germany (SEQ ID NO: 58). All vectors created from pHP34s were made using synthetic DNA ordered from GeneART, Germany and primers ordered from DNA-technology, Denmark.
The hybrid promoter coding sequence was created in plasmid pHP34s-Hybrid, by PCR of the HSP70 core promoter encoding sequence from synthetic HSP70 promoter DNA (SEQ ID NO: 37) ordered from GeneART (PCR primers: GCGAACTTAAGAGCGCCGGAGTATAAATAG (SEQ ID NO: 64) and CCAAGCTTCTGCAGATTGTTTAGCTTG (SEQ ID NO: 65). A second PCR was then done to obtain the Actin 5c promoter upstream part of the promoter (primers: GGTTTGTCCAAACTCATCAATGTAT (SEQ ID NO: 66) and TATACTCCGGCGCTCTTAAGTTCGCTCGCGTTCAAAACTTTTACC (SEQ ID NO: 67)) from pHP34s, and the two PCR fragments were fused using PCR.
The resulting fused PCR product was then digested with SpeI and HindIII, and ligated into the pHP34s vector digested with SpeI and HindIII according to standard molecular biology procedures. The DNA can also be ordered synthetically for the hybrid promoter and cloned using the SpeI and HindIII into pHP34s-Hybrid.
The intron (synthetic, SEQ ID NO: 60)) was ordered from GeneART and inserted by GeneART into the pHP34s-Hybrid vector between the SacI and EcoRI restriction sites to create the pHP34s-Hybrid.i vector.
The HSP70 matrix attachment region or hSAR element (SEQ ID NO: 59), was inserted into pHP34s-Hybrid in two positions flanking the expression cassette. The hSAR element was ordered as a synthetic sequence from GeneART with flanking SpeI and NarI sites on each side. The pHP34s-hybrid vector and hSAR containing GeneART vector were digested with NarI, the desired fragments gel purified and ligated to produce two vectors, pHP34s-Hybrid-hSAR-F or -R (-F or -R indicated forward or reverse orientation), with the hSAR element inserted in both orientations. Each of these two vectors and the GeneART hSAR containing vector were then digested with SpeI, the desired fragments gel purified and ligated to create four vectors. The four vectors contain two hSAR elements in all four possible orientations.
The above mentioned vectors and synthetically ordered RANKL (variant hRP1.12-RA) and HA model protein DNA encoding sequences were digested with EcoRI and NotI, the desired fragments gel purified and ligated (for instance RANKL with one of the vectors or HA with one of the vectors) to produce the above mentioned vectors with RANKL or HA encoding DNA inserted. The resulting vectors were named with the hRP1.12-RA-vector name or HA-vector name, for instance: hRP1.12-RA, pHP34s-Hybrid.
Creation of RANKL and HA (from H5N1 avian flu) containing pMT/V5.HIS.A and pAC5.1 vectors. The vectors were obtained from Invitrogen, digested with EcoRI and NotI, the desired fragments gel purified and ligated with EcoRI and NotI digested and gel purified synthetic RANKL or HA as described above, to produce pMT/V5 and pAC5.1 vectors with RANKL encoding DNA inserted.
A kanamycin/Geneticin (G418) resistance marker vector was created and named pHP34s-Hybrid-KanR. The vector was created by inserting geneART ordered synthetic DNA coding for the KanR/NeoR gene (optimized for E. coli and S2 cell expression) and E. coli promoter into the pHP34s-Hybrid vector. The vector and insert were digested with XmnI and SalI, the linear vector and kanR containing fragments were gel purified and ligated according to standard procedures.
The vector map for hRP1.12-RA-pHP34s-Hybrid, pHP34s, pHP34s-hybrid-hSAR-FR, and pHP34s-hybrid.i are shown in
For the comparison experiments the two Invitrogen vectors (pMT/V5.HIS.A and pAC5.1) were used. These two vectors do not contain a selection marker, and therefore were co-transfected with a hygromycin resistance conferring vector also obtained from Invitrogen (pCoHygro). The transfection was conducted according to the same protocol as for the pHP34s derived vectors, but the hygromycin resistance vector was added for the pMT/V5.HIS.A and pAC5.1 vectors at a ratio of 10:1 (10 fold more expression vector than hygromycin resistance vector).
The remaining vectors were transfected according to the standard procedure detailed above.
The hygromycin resistant cells were made stable according to the same method described for the Zeocin resistant cells above, except that 600 ug/mL of Hygromycin was added to the media instead of 1500 ug/mL Zeocin.
The vector conferring kanamycin/Geneticin (G418) resistance was transfected according to the method described above, but selection was done using between 1200 and 1500 ug/mL of G418 in S2 cells or with standard Kanamycin concentration for E. coli cells.
The pMT/V5.HIS.A vector has a cadmium inducible promoter so for the expression comparison test the cells were induced with CdCL2. The cells were grown in shakeflasks for 2-3 days and then induced using 1 ul of stock per 1 ml media (Stock: 1 mM CdCl2 Sigma C-2544 lot13H0424: 183 mg in 1000 ml H20). The cells were allowed to produce protein for a further three to four days before taking samples for analysis.
The remaining vectors have constitutive promoters and did hence not need to be induced. Samples were taken after 3-4 days of growth and production.
The experiments were conducted as duplicates or triplicates (see raw data below) in shake flasks.
Exchanging the weak core-promoter of the actin 5c promoter with the stronger HSP70 core promoter led to a 50% increase in expression over the truncated Actin 5c promoter (see
We also tested the effect of a new element, an intron, specifically the intron described in the paper Zieler H., Huynh C Q. “Intron-dependent stimulation of marker gene expression in cultured insect cells”, Insect Mol Biol. 2002 1, 87-95. The DNA sequence of this intron is set forth in SEQ ID NO: 60, where it is flanked by two restriction sites. So, according to the invention, the inclusion of a promoter such as SEQ ID NO: 60 between the promoter nucleic acid sequence and the coding sequence for a protein of interest can add significantly to the increased expression levels obtained by the present invention:
Finally,
To conclude, a significant increased expression level was obtained using the vectors developed in this work compared to the commercially available vectors.
The vector functionality was also improved by adding a second selection marker, kanamycin/geneticin (G418). This allows co-transfection of two vectors expressing different proteins into one cell. It also allows for consecutive transformation with the Zeocin resistance and then kanamycin resistance markers (in any order).
CTTTTTGGGTCTCTCCCTCTCTGCACTAATGCTCTCTCACTCTGTCACAC
AGTAAACGGCATACTGCTCTCGTTGGTTCGAGAGAGCGCGCCTCGAATGT
TCGCGAAAAGAGCGCCGGAGTATAAATAGAGGCGCTTCGTCTACGGAGCG
ACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAGCGAAAGCTAA
GCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCTGCAGTAAAGTGC
ATTCAAACAAGCAAAGTGAACACGTCGCTAAGCGAAAGCTAAGCAAATAA
GAGCTCGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA
GAATTCGCCACCATGAAGCTGTGCATCCTGCTGGCCGTGGTGGCCTTCGT
GAATTAATTCGGATCTCTGCAAGGGATTTTGGTCATGAACAATAAAACTG
PCR Primers for pHP34s Constructs:
ACTAGTGAATGCCCTACTAGAAGATGTGTGTTGCACAAAATGTCCCTGGA
Number | Date | Country | Kind |
---|---|---|---|
08158168.8 | Jun 2008 | EP | regional |
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/EP2009/057278 | 6/12/2009 | WO | 00 | 2/22/2011 |
Number | Date | Country | |
---|---|---|---|
61061959 | Jun 2008 | US |