The present invention provides a method for enhancing hematopoietic recovery after hematopoietic stem cell transplantation. More specifically, the invention refers to a method for enhancing hematopoietic stem cell activity by estrogens.
Hematopoietic Stem Cells (HSCs) are a rare cell population resident in the bone marrow of adult mammals and sit atop a hierarchy of progenitors that become progressively restricted to several or a single blood lineage. HSCs are capable of self-renewal (the production of additional HSCs) and multipotent differentiation to all blood cell lineages (Orkin & Zon, 2008). HSCs are crucial in the maintenance of lifelong production of all blood cells. HSCs are highly regulated to maintain homeostasis through a delicate balance between quiescence, self-renewal and differentiation. Although HSCs divide infrequently, they are activated to self-renew in response to bone marrow injury to re-establish homeostasis (Wilson et al., 2008).
Hematopoietic stem cell transplantation (HSCT) is the most used cell therapy currently. HSCT is the recommended treatment for several life-threatening conditions such as leukemia, rare blood cell diseases, aplastic anemia, and to restore the hematopoietic system after bone marrow ablating chemotherapy or irradiation therapy. More than one million HSCT has been done worldwide so far. HSC are responsible for the lifelong production of blood cells. The special characteristics of the HSCs, such as self-renewal and multipotency, have guaranteed the success of HSCT. Among others, main bottlenecks of HSCT are HSC donor shortage and HSCT failure by infusing a reduce number of donor HSC. Different approaches have been addressed to solve these problems, such as using different sources of HSCs (bone marrow, cord blood, mobilized peripheral blood, amniotic fluid or placental cord), generating engraftable HSCs from embryonic cells, and expanding HSCs ex vivo. In addition, how maximizing engraftment of limiting number of HSC has been researched extensively; different HSCT modulators, either accessory cells or defined modulator molecules, are been assayed to enhance the hematopoietic reconstitution of a reduce number of donor HSC.
The term “estrogen” is applied for a group of female sex hormones, derived from cholesterol, which group comprises several compounds: estrone (E1), 17β-estradiol (E2, usually abbreviated as β-estradiol or simply estradiol), estriol (E3) and even the estrogen produced during pregnancy known as estetrol (E4: also known as 15α-hydroxyestriol), which is expressed from fetal liver exclusively (as reviewed by Holinka et al., 2008, abstract available at: https://www.sciencedirect.com/science/article/abs/pii/S0960076008000794). Estrogen is the primary female sex hormone and is responsible for controlling many cellular processes including growth, differentiation and function of the reproductive system. Estrogen acts through the genomic (nuclear-initiated steroid signaling) and non-genomic (membrane-initiated steroid signaling) signaling pathways. Additionally, both genomic and non-genomic signaling can start with the interaction of the estrogens with either Estrogen Receptor α (ESRα) or ESRβ. Consequently, the estrogen regulation of the cellular process can follow different mechanisms and maybe get different responses.
Recently, it has been described that both 1β-estradiol (E2) and estetrol (E4) signaling occurs mainly through their interaction with ESRα, although estetrol regulation is independent of non-genomic signaling (Abot et al., 2014). More specifically, according to Abot et al., (Abot et al., 2014), estetrol shows a specific profile of modulation of ESRα, different from that of β-estradiol, particularly because estetrol is not capable of triggering cell responses mediated by ESRα acting on the membrane, although it is capable of triggering other responses common to estrogens that seem to be associated with estetrol nuclear activity. Furthermore, estetrol can act as a weak estrogen antagonizing estradiol-dependent mammary gland proliferation (Gerard et al., 2015), which is an important consideration for its clinical use. Moreover, E4 has a high affinity for ESRα as compared to the ESRβ, which is different from other estrogens. Furthermore, in vivo E4 half-life is considerably longer than that of other estrogens, which compensates it apparently low potency as estrogen. Another characteristic of E4 is not bound by sex hormone-binding globulin (SHBG), in contrast to most known estrogens, which E4 serum level is representative for bio-activity and independent of SHBG levels. Lastly, another important benefit of E4 is less dependent on regulation of microsomal liver enzymes and its relative insensitivity to interact with other drugs (Coelingh Bennink, Holinka, & Diczfalusy, 2008).
Recent evidences indicate that estrogen is involved in regulating the proliferation and lineage commitment of hematopoietic stem cells (Heo et al., 2015). However, the role of estrogens in the regulation of the HSC self-renewal and multipotency needs to be clearly defined. There are few and sometimes contradictory studies about the effect of the estrogen over HSC, which studies have been carried out mainly with β-estradiol, although it has been commonly accepted that it could be applicable to other estrogens in spite of the fact that none of the studies involving either hematopoietic progenitors or hematopoietic cells has been carried out with estetrol. Thus, it is considered that estrogen treatment, in general, has been found to be able to increase specifically the number of vascular but not endosteal HSC in mice; however, estrogen limited the long term repopulating capacity of the HSC (Illing et al., 2012). Specifically, Illing et al. discloses assays where estradiol is administered subcutaneously or intraperitoneally to mice. Among the findings described in the cited article, it can be mentioned that estradiol increases progenitor cell (HSC) numbers in the vascular but not in the endosteal compartment of bone marrow, which is an effect which also occurs in the absence of increased bone mass in ERα knockout mice, which indicates that the increase in HSC number induced by estradiol I independent of estradiol effects on the bone. It is also described that the increase in HSC numbers (the increase of hematopoietic progenitors capable of reconstituting lethally irradiated mice) is increased by enhanced cell cycle entry, so that mice transplanted with different dilutions of BM cells from estradiol treated animals showed better reconstitution after four months than mice receiving control treated BM, but estradiol treatment also leads to a diminished long-term reconstitution potential after serial transplantation Additionally, Illing et al. also describes that estradiol treatment enhances retention of hematopoietic stem cells in the vascular niche of the bone marrow.
Additionally, estrogen has been shown to promote cell cycle of HSC and multipotent progenitors (MPP) and increase erythroid differentiation in female. It has been reported (Notta et al., 2010) that female NOD/SCID/IL-2Rgc-null (NSG) mice are far superior to their male counterparts in engrafting and detection of single human HSCs. In the same article it is also commented that female NSG recipients appear to support better the self-renewal of human HSCs. Notta and coworkers suggest two rationales to explain the obtained results: either that female NSG mice might be more immunodeficient than males, or sex-associated factors, such as steroid hormones, can positively or negatively regulate human HSCs, without discussing clearly the circumstances under which positive or negative regulation can occur. Their results lead to Notta and coworkers to recommend a careful monitoring of sex in the future design of experiments requiring human HSC assays.
The increase in cell cycle promotion of HSCs and erythroid differentiation in female observed with estrogens is an effect on HSCs which is mentioned to be mediated by estrogen receptor α (ESRα) and which could be detected during pregnancy (Nakada et al., 2014)). On the contrary, tamoxifen (whose active metabolite, 4-hydroxytamoxifen, acts as an estrogen receptor antagonist) reduces the number of MPP and short-term HSC but activate proliferation of long-term HSC (Sanchez-Aguilera et al., 2014).
Studies on estradiol effects on male animal models (mice) with different combinations of expression capabilities with regard to the gene of the estrogen receptor alpha (ER−/−: ERα knockout, ER+/+: wild-type, and radiation chimeric: ERα positive or negative in either nonhematopoietic or hematopoietic elements, or both) have been also reported (Thurmond et al., 2000). The bone marrow chimeras were obtained by irradiating C57BL/6 (Ly5.1) and 129/SV×C57BL/6N (Ly5.2) ER+/+ or ER−/− mice and administering the irradiated mice bone marrow cells from Ly5.1, Ly5.2 ER+/+ or Ly5.2 ER−/− mice, that is: the administered bone marrow cells were also mouse cells. ER−/−: ER+/+: or ERα chimeric mice received a single subcutaneous injection of estradiol in the minimum dose to produce an effect upon the immune system, which injection was administered to the chimeric mice 4 weeks after the administration of bone marrow cells. The effects were studied 10 days after estradiol administration. In all animals with at least an ER+ element a decrease in total bone marrow cells was observed after estradiol administration, whereas estradiol treatment of the ER−/− and the chimeric animals completely negative for ER, that is, ER−/− animals and chimeric animals ER−/− both in the hematopoietic and the non-hematopoietic compartment did not result in a significant decrease in the bone marrow cell counts. It is suggested that the decrease in bone marrow cells could be associated with the previously reported capability of mice-administered estrogens to up-regulate osteoblast activity and subsequently increase bone density.
Besides, estrogen can modulate HSC indirectly through acting bone formation and their mesenchymal stem cells (MSC). However, the regulation mediated by this family of hormones can be more indirect. Estrogen (β-estradiol) treatment has been described to activate MSC osteogenic differentiation and GM-CSF and IL6 secretion from these MSC, all of which improves the number of HSC by modulating their niche (Qiu_Zhao). However, this estrogen's action to regulate hematopoietic progenitors through the MSC is controversial (Illing et al., 2012), as discussed above.
Additionally, the frequency of hematopoietic progenitors present in cord blood has been associated with the level of different hormones and growth factors, among them estriol (Savarese et al., 2007).
European Patent Application EP-2049129-A1 mentions estrogens as agents which can improve HSC transplantation, because they are presented, together with the myeloid cytokines such as GM-CSF, G-CSF and IL-3 or with an expression vector of the catecholamine receptor itself, as examples of agents capable of upregulating the expression of catecholamine receptors, establishing an association with the fact that catecholamine neurotransmitters directly regulate hematopoietic progenitor cell proliferation and migration, which are important in transplantation therapy. However, it is not discussed if such effects are expected specifically for estradiol or for any other estrogen and no assay is shown proving that any estrogen has indeed such effect.
The US patent application published as US 2018/163177 A1 describes a serum-free culture medium for hematopoietic stem cell (HSC) expansion which includes a base medium, cytokines, an umbilical cord mesenchymal stem cell conditioned medium (or MSC feeder cells) and supplemental components, which supplemental components may include vitamin C, vitamin E and estradiol (E2). The cells (derived from umbilical cord blood) are cultured during 12 days. The assays (see FIG. 6 of US 2018/163177) show increased expansion of CD34+ cells (a marker associated with hematopoiesis progenitors) and colony forming units by addition of estradiol (E2), vitamin C and vitamin E.
In spite of these evidences, the complete role of different estrogens in the regulation of hematopoietic progenitors and their underlying mechanism is unclear. So, a comprehensive study on the role of the estrogens in the HSC regulation is essential to be able to develop the clinical potential of these hormones. And, particularly, the knowledge about the activity of each estrogen (particularly, β-estradiol and estetrol) on HSCs and about the possibilities of using them in order to increase HSC number in control and/or their applicability to improve hematopoietic reconstitution in individuals who have been the subject of hematopoietic cell transplantation should be increased, in order to see if their clinical use for that purpose can be provided and to know the appropriate conditions to do it, particularly in those case where there might be a certain preference, for instance, for the enhancement of the capability of generating a particular cell lineage. Thus, it should be clarified if estrogens can be used to enhance hematopoietic recovery, the estrogens that can be used for that purpose and the conditions for that use.
The present invention provides a solution to said problem.
The invention relates to the enhancement of recovery from hematopoietic stem cell transplantation (HSCT) by treatment with estrogens, specifically estetrol.
In a first aspect, the invention relates to an estrogen for use in enhancing hematopoietic reconstitution after hematopoietic stem cell transplantation (HSCT) or hematopoietic progenitor cell transplantation in a subject, wherein the estrogen is to be administered to the subject who is the recipient of the transplantation (that is, the recipient of the transplanted cells), and wherein the estrogen is estetrol The estrogen is preferably administered systemically. Also preferably, the estrogen (estetrol) is administered to the subject after the subject has received the transplantation of hematopoietic stem cells or progenitor stem cells.
In a second aspect, the invention relates to a method for increasing the number of hematopoietic progenitor cells and/or hematopoietic stem cells in a culture, the method comprising the steps of adding an estrogen to the cell culture with the hematopoietic progenitor cells and/or hematopoietic stem cells, culturing the cells in the presence of the estrogen and, optionally, collecting the hematopoietic progenitor cells and/or hematopoietic stem cells, wherein the estrogen added to the cell culture is estetrol. The cells are preferably cultured in the presence of a niche of bone marrow-mesenchymal stem cells (BM-MSCs). It can be cultured, for instance, during one week.
In third aspect, the invention relates to a hematopoietic progenitor cell or an hematopoietic stem cell or a composition comprising hematopoietic progenitor cells and/or hematopoietic stem cells for use in transplantation to a subject, wherein the cell or cells has(have) been cultured in the presence of an estrogen which is estetrol. The hematopoietic progenitor cell or the hematopoietic stem cell or population of hematopoietic progenitor cells and/or hematopoietic stem cells can have been obtained by applying the above method, the method of the second aspect of the invention.
For any of the aspects of the invention, the estrogen Is estetrol.
Also for any of the aspects of the invention, the recipient subject, that is, the subject that has received or is intended to receive the transplantation can be any mammal, preferably a human being.
Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
The present invention is based on the findings disclosed in the present application, where it can be seen that estrogens, and particularly 17β-estradiol (or simply estradiol) and 15α-hydroxyestriol (also known as estetrol) are capable of increasing the number of hematopoietic progenitor cells (CD34+) and/or hematopoietic stem cells (CD34+/CD38+) both when administered to individuals that have been or are intended to be (because they are in need of) the subject recipient of hematopoietic stem cell transplantation (HSCT), thus facilitating the recovery after transplantation and the efficiency of the process, and when added to in vitro bone marrow-like cultures where CD34+ cells are present, thus facilitating the availability of hematopoietic stem cells or progenitor stem cells from a donor before using them for transplantation, because such cells previously treated with estrogens, particularly with estetrol can be also effectively used for transplantation.
Thus, it can be said that the present invention provides a method to enhance hematopoietic reconstitution after HSCT, which is mainly based on the finding, disclosed in the present application, that low doses of estrogens, particularly estetrol, can enhance hematopoietic engraftment causing an increment in hematopoietic reconstitution after HSCT, not only when estrogens are administered to a subject which has undergone or is to undergo HSCT, but also when they are administered to the cell culture where the donor cells (CD34+ cells) are being cultured. And it has three possible aspects:
A estrogen which is specifically estetrol for use in enhancing hematopoietic reconstitution before or after hematopoietic stem cell transplantation in a subject (the aspect that can be considered, more directly, also as a method to enhance hematopoietic reconstitution after hematopoietic stem cell transplantation (HSCT) in a subject who has already received the cell transplantation or will be the recipient of the mentioned cells, the method comprising administering an effective amount of estrogens, specifically estetrol, to the subject to boost hematopoietic contribution from the transplanted hematopoietic stem cells (HSC)). The subject or individual can be any mammal which has undergone HSCT or is to undergo HSCT because he/she is in need of it, and will be preferably a human being, particularly taken into account that the assays of the present application carried out with human cells support the applicability to human beings. The subject may suffer or have suffered from a solid tumor, myeloma, lymphoma or any blood disease requiring HSC transplantation after bone marrow ablation or myelosuppression by chemo- and/or radio-therapy. HSCT may be autologous or allogeneic to the subject. The subject may suffer anemia (sickle cell anemia, thalassemia, pyruvate kinase deficiency, Fanconi anemia or other aplastic anemia), primary or acquired immunodeficiency, an inherited genetic disease that can be cured by allogeneic hematopoietic progenitors transplantation, an inherited genetic disease that can be cured by transplantation of genetically corrected hematopoietic progenitors, or any other disease that might benefit from the transplantation of hematopoietic progenitors. HSC population may be obtained from peripheral blood, cord blood, bone marrow, amniotic fluid, placental cord or any other source of hematopoietic progenitors. HSC can be genetically modified using state of the art procedures. This aspect of the invention in particular is based on the discovery that estrogens cause an increment in hematopoietic reconstitution after HSCT. Estrogen, (specifically estetrol), administration occurs preferably by systemic route (although other routes, such as the subcutaneous one, are also eligible), and occurs after any myelosuppressive treatment of the subjects to avoid the HSC damage by myelosuppressive agents, since estrogen induces self-renewal of HSC, when these cells are more sensitive to these myeloablating treatments.
The invention, and its different aspects, are based on the results of the Examples shown below.
Firstly, it is shown that estrogens modulate HSCT (Example 1), suggesting that estrogens have a role either on transplanted HSC or on the recipient bone marrow.
As shown in Example 2, low doses estrogen treatment, mainly estetrol, boosts hematopoietic engraftment and enhances the engrafted hematopoietic stem cell compartment, which ensures HSCT success. It must be noted that estetrol gives rise to a higher value in the percentage of hematopoietic progenitors and hematopoietic stem cells than estradiol. It is also worth mentioning that the present inventors used a short-term treatment with reduced estetrol dose.
Afterwards, to determine whether estrogens have a positive effect in both male and female recipients, female animals were transplanted with limiting cell doses and treated with estrogens. Engraftment from a limited number of human HSCs in female immunodeficient mice was also enhanced by estrogens, in particular by estetrol (Example 3). This result indicates that the estrogen treatment can have a beneficial effect in the HSCT of female and male subjects. Given that estretol is a fetal estrogen, the results obtained were not expected after considering the teachings of Notta et al. discussed in the section of “Backgroun of the invention” and may not be explained with only gender differences,
Moreover, as shown in Example 4, human HSCs are positively modulated in a human bone marrow-like environment, which strongly suggests the estrogen efficacy in patients. And, as in the previous assays, the results obtained with estetrol were higher than those obtained with estradiol,
Besides, it has been observed that estetrol is less toxic than other natural estrogens for hematopoietic progenitors in vivo and that it antagonizes partially with the non-genomic signaling of ERα in response to β-estradiol (Example 5); the latter is consistent with the data of previous reports (Abot et al., 2014; Gerard et al., 2015). Therefore, the modulation of HSC activity by estetrol can differ from the general effect of estrogens in hematopoietic progenitors, allowing its use in to enhance hematopoietic recovery.
This is the first time that estetrol is found to act on human HSC after HSCT. As previously commented, it had been reported that female mice increase HSC self-renewal by their estrogen signaling (Nakada et al., 2014) but, on the other hand, a long treatment with estradiol seemed to increase HSC transiently, but reduced long-term repopulating activity of HSC (Illing et al., 2012). Estradiol induces the proliferation of HSC by acting on mesenchymal stem cells in vitro (Qiu, Jin, Shao, & Zhao, 2014) but, on the contrary, estrogen signaling has been shown playing a negative role on the hematopoietic progenitors and compromising HSC function (Sanchez-Aguilera et al., 2014). Contrary to the results shown in the present application, some of the previous data seemed to indicate that the estrogen action could be detrimental for HSCT. Moreover, such results had been obtained with β-estradiol and were indeed not indicative of the possible actions that might have other estrogens, like estetrol, which, in accordance with the results shown in the present application, seems to be more effective to enhance HSCT.
The discrepancy between the negative effect of the estrogens (Qu, 1983) (Dieter, French, Boorman, & Luster, 1987) (Illing et al., 2012; Perry, Samuels, Bird, & Tobias, 2000; Shevde & Pike, 1996; Sontas, Dokuzeylu, Turna, & Ekici, 2009) and their beneficial application to enhance HSC activity (Hayama, Nawa, Ezaki, & Kotani, 1983; Nakada et al., 2014) can be due not only to the estrogen treatment time and doses used, but also to the differences among estrogens and the molecular pathways triggered by them in the HSC.
The results obtained with estetrol can be considered particularly surprising. As its mechanism of action had been reported to be different from the mechanism of action of other estrogens, particularly β-estradiol, the expression of estetrol occurs from fetal liver exclusively, and estretol had not been previously used in any study involving either hematopoietic progenitors or hematopoietic cells, it was not predictable the effect that estetrol could have on HSCs, particularly after HSCTs, or on hematopoiesis. Moreover, estetrol had been traditionally considered a weaker estrogen that β-estradiol or other estrogens, and, surprisingly, the assays of the Examples below show that the effects of estetrol on hematopoietic progenitors are clearly stronger than those of estradiol, given rise both to a higher percentage of human hematopoietic reconstitution in the assays with irradiated mice (both male and female) transplanted with low doses of human cord blood CD34+ cells and to higher increase of human progenitors in the in vitro assays of human bone marrow-like cultures to which estrogens were added (see Example 4). Additionally, and as shown in Example 5, estetrol has a reduced toxicity in human hematopoietic progenitors, probably because it acts through a different mechanism than other estrogens (Abot et al., 2014; Gerard et al., 2015), which will facilitate the clinical use of the estetrol and makes it particularly suitable for the purposes of the present invention.
It has been described that estetrol binds to ER with less affinity than β-estradiol and with a small preference over ERβ. However, the ERα complex with estetrol was able to bind the important coactivator SRC3 as the complex with β-estradiol. Additionally, estetrol had similar solubility to β-estradiol into palmitoyl-oleoyl-phosphatidylcholine liposomes, but estetrol distribution in a bilayer (phenol at the lipid-water interface versus phenol within the hydrophobic core) was oriented predominantly toward the lipid-water interphase, whereas β-estradiol was orientated in equilibrium between the two orientations in the bilayer. These differential chemical characteristics of estetrol facilitate its special biological properties.
The method of the invention provides the following benefits: a) Patients who are considered at high risk of failed hematopoietic engraftment may be transplanted. b) Reduction of the apheresis cycles required to get an adequate harvest of HSC. c) Reduction of the dose of HSCT conditioning regimen that allows the engraftment of a specific number of HSCs. d) Overall, reduction of hematopoietic transplantation failure. The estrogen selected for the present invention, estetrol or any of its derivatives, will be administrated at low doses (0.1 mg/kg/day for 4 days) after HSCT (that is, a short-erm treatment with reduced estrogen dose compared with the assays described, for instance, by Illing et al. and Thurmond et al.). Blood recovery will be assessed by blood cell count and immunophenotype analyses.
Besides, it is remarkable that administration of estrogen, specifically estetrol, can enlarge hematopoietic reconstitution, such that even smaller amounts of hematopoietic stem cells can then be enough in transplantation. Consequently, for example, cord blood stem cells transplantation may be applied to not only children but also adults. Additionally, estrogen administration can enhance hematopoietic reconstitution in female animals; therefore, the present invention may be applied to female subjects.
Several embodiments will now be described in detail by the following non-limiting examples.
In the examples below, the following abbreviations have the following meanings. Abbreviations not defined have their generally accepted meanings.
Gy=Gray
NSG=NOD.Cg-Prkdcscid II2rgtm1wjl/SzJ mouse
LTC-IC=Long-Term Culture Initiating Cells
α-MEM=alpha-modified Eagle's medium
FBS=Fetal Bovine Serum
HS=Horse Serum
PS=Penicillin/Streptomycin
hEPO=human recombinant erythropoietin
hSCF=human recombinant stem cell factor
hFLT3L=human FMS-like tyrosine kinase 3 ligand
Male immunodeficient NSG mice were irradiated by 2.2 Gy and transplanted by 5×104 human cord-blood CD34+ cells twenty four hours later. 72 hours later, the transplanted animals were treated with either 2 μg of estrogen or vehicle (olive oil) daily for four days. Three-four months later, the animals were sacrificed and the human hematopoietic engraftment was analyzed by FACS. Human hematopoietic population was identified as the cells positive for hCD45-APC-Cy7 (Biolegend) and negative for mouse CD45.1-PE (Biolegend).
Estrogen or vehicle treated animals were compared. The results are shown in Table 1:
Additionally, human multilineage reconstitution of these animals was analyzed. The results are shown in Table 2:
Thus, the estrogen treated mice had approximately 80% more human hematopoietic engraftment than control animals. Moreover, there was no difference in any of the hematopoietic lineages. All together indicates that estrogen have a positive effect on the human hematopoietic reconstitution.
In order to further examine the effect of the estrogen in HSCT, hematopoietic progenitors (hCD34+) and hematopoietic stem cells (hCD34+/hCD38−) were analyzed by FACS inside of the human population in the treated NSG described in Example 1. The results are shown in Table 3.
Moreover, to study the long-term effect in HSCT, human CD45+ cells were sorted and transplanted in secondary irradiated female NSG mice. Three months after the secondary transplant, human hematopoietic engraftment was detected in all the animals transplanted with cells from estrogen treated primary mice.
Thus, estrogen treatment resulted in a 70% increase in human hematopoietic progenitors and in a doubling in human HSC. More importantly, the treatment did not affect to the long-term human reconstitution.
To determine whether estrogen can improve hematopoietic reconstitution of low number of hematopoietic progenitors, male NSG were irradiated and transplanted with low doses of human cord blood CD34+ (5×103 hCD34+). The human engraftment was analyzed as described in Example 1. The effect of estrogen to enhance engraftment of low human progenitor doses is shown in Table 4:
The estrogens, mainly E4, favored the success of the HSCT by limited HPC doses when non-engrafted animals with 0.1% or less of human hematopoietic cells in their bone marrow were considered. As has been shown previously, around one-fourth of the mice had a human engraftment above 0.1%. However, either E2 or E4 treatment almost tripled the proportion of engrafted mice.
To assess whether estrogen can improve hematopoietic reconstitution in female recipients, female NSG were irradiated and transplanted by a low doses of human cord blood CD34+ (5×103 hCD34+). The human engraftment was analyzed as described in Example 1. Interestingly, human engraftment in female animals was higher than in male recipients transplanted with the same reduced number of hematopoietic progenitors, perhaps due to the presence of endogenous estrogens in the female animals. However, in spite of this presence of endogenous estrogens, the human engraftment in female recipients was increased after E2 and more importantly after E4 treatment.
Additionally, the presence of primitive hematopoietic progenitors was higher in the female mice treated with estrogens, which indicated the quality of the reconstitution.
The data indicate that estrogen can also improve engraftment in recipients of limited number of hCD34+.
To further investigate the beneficial effect of the estrogen in human HSCT, human bone marrow-like cultures, such as LTC-IC culture, were established. 1×105 human mesenchymal stromal cells (hMSC) were seeded in a p6 well and irradiated with 30 Gy next day. The following day, 5×104 hCD34+ were added to the hMSC in LTC-IC media: 75% α-MEM without Phenol Red (Life Technologies), 12.5% Hyclone FBS (GE Healthcare), HS (Life Technologies), β-mercaptoethanol (Life Technologies), 0.5% PS and 1×10−6 M Hydrocortisone (Sigma-Aldrich). 100 μM of estrogens, dissolved in ethanol, was added to the co-culture for a week, and then the cells were collected and the amount of human hematopoietic progenitors were evaluated in semisolid media supplement with specific hematopoietic cytokines (H4535, StemCell Technologies) plus 8 U/ml hEPO. After fourteen days, colony-forming units (CFU) were evaluated and normalized to the control:
Thus, estrogen treatment improved up to 98% the frequency of human hematopoietic progenitors in an in vitro human bone marrow-like culture.
To assess the toxicity of the natural estrogens (E1, E2, E3 and E4) for hematopoietic progenitors, in vitro studies were performed. 5×104 hCD34+ were cultured in a phenol red-free media, X-Vivo 20 (Lonza), in presence of 100 ng/ml SCF, 100 ng/ml FLT3L, 100 ng/ml TPO, 0.5% PS, 1% Glutamax (Thermofisher) and different concentrations of E1, E2, E3 or E4 (from 10 nM to 500 μM). Cell proliferation and immunophenotype of different hematopoietic subsets (CD34+/CD38−, HSC [CD34+/CD38−/CD45RA−/CD90+], Multipotent Progenitors [MPP, CD34+/CD38−/CD45RA−/CD90−], Multipotent Lymphoid Progenitors [MLP, CD34+/CD38−/CD45RA+] were evaluated at day 0 and four days after culture.
E1, E2 and E3 were more toxic for all the hematopoietic progenitor subpopulations than E4. On the contrary, high concentration of E4 seemed to be better tolerated for all the hematopoietic progenitor subsets, mainly the most primitive one (HSC). E4 is less toxic than other natural estrogens for hematopoietic progenitors in vitro.
To understand the underlying mechanism that is triggered by the different estrogens in hematopoietic progenitors, mRNA expression level of ESRα (ESR1) and ESRβ (ESR2) in the hematopoietic progenitor compartment. HSC (CD34+/CD38−/CD45RA−/CD90+), Multipotent Lymphoid Progenitors [MLP, CD34+/CD38−/CD45RA+] and the rest of hematopoietic progenitors (CD34+CD45RA−) were sorted; mRNA was purified by Tryzol reagent (Thermo Fisher Scientific). mRNA was retro-transcripted to cDNA by SuperScript® VILO™ cDNA Synthesis Kit (Thermo Fisher Scientific) and it was quantified by qRT-PCR using SYBR® Green (Applied Biosystems). mRNA expression level of both estrogen receptors were relative to HPRT1 expression and all the valors were normalize at ESRs of HSC subpopulation according with Pfaffl's method. The specific primers used in the analysis were: ESR1 Forward (ATCCACCTGATGGCCAAG: SEQ ID NO:1) and ESR1 Reverse (GCTCCATGCCTTTGTTACTCA: SEQ ID NO:2); ESR2 Forward (GATGCTTTGGTTTGGGTGAT: SEQ ID NO:3) and ESR2 Reverse (AGTGTTTGAGAGGCCTTTTCTG: SEQ ID NO:4); HPRT1 Forward (ATGATGGGGCTGATGTGG: SEQ ID NO:5) and HPRT1 Reverse ((TTCTACGCATTTCCCCTCA: SEQ ID NO:6).
A differential expression of both ESR was identified among the different hematopoietic progenitors subset. ESRα was expressed up to four times more in MLP than in HSC. Surprisingly, ESRβ expression in HSC was double than in other progenitor. These differences might explain the different effects of the estrogens in hematopoietic progenitors.
To provide a further insight into the positive impact of estrogens on promoting human hematopoietic engraftment, we examined mesenchymal and vascular endotelial compartments of the mouse BM niche four months after being transplanted and treated with E2 (estradiol) or E4 (estetrol). The percentage of mouse MSCs (mCD140a+, also called Pdgfra+) and vascular endothelial cells (mCD144+, also called VE-Cadherin+) was analyzed in the non-hematopoietic compartment (
Then, it was evaluated whether human mesenchymal stromal cells might interact with these estrogens. So, the expression of ESR1 and ESR2 was also analyzed in the human BM-MSCs compartment by RT-PCR (
Both estrogen receptors were present in human BM-MSCs, indicating that the presence of estrogens could influence the behavior of these stromal cells and affect indirectly the biology and/or the engraftment of humans HSPCs.
Altogether, estrogens, and more importantly estetrol, enhance and favor the hematopoietic engraftment of human progenitors into immunodeficient mice.
Number | Date | Country | Kind |
---|---|---|---|
18382779.9 | Oct 2018 | EP | regional |
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/EP2019/079945 | 10/31/2019 | WO | 00 |