Patent Application
20120142750
A recently discovered molecular mechanism contributing to peripheral immune tolerance is the immunoregulatory enzyme indoleamine 2,3-dioxygenase (IDO). Cells expressing the tryptophan-catabolizing enzyme IDO are capable of inhibiting T cell proliferation in vitro and reducing T cell immune responses in vivo (U.S. Pat. Nos. 6,451,840 and 6,482,416; Munn et al., Science 1998; 281:1191; Munn et al., J. Exp. Med. 1999; 189:1363; Hwu et al., J. Immunol. 2000; 164:3596; Mellor et al., J. Immunol. 2002; 168:3771; Grohmann et al., J. Immunol. 2001; 167:708; Grohmann et al., J. Immunol. 2001; 166:277; and Alexander et al., Diabetes 2002; 51:356).
IDO degrades the essential amino acid tryptophan (for reviews see Taylor et al., FASEB Journal 1991; 5:2516-2522; Lee et al., Laboratory Investigation, 2003; 83:1457-1466; and Grohmann et al., Trends in Immunology 2003; 24:242-248). Expression of IDO by human monocyte-derived macrophages (Munn et al., J. Exp. Med. 1999; 189:1363-1372), human dendritic cells (Munn et al., Science 2002; 297:1867-1870 and Hwu et al., J. Immunol. 2000; 164:3596-3599), and mouse dendritic cells (Mellor et al., J. Immunol. 2003; 171:1652-1655) allows these different antigen-presenting cells (APCs) to inhibit T cell proliferation in vitro. In vivo, IDO participates in maintaining maternal tolerance toward the antigenically foreign fetus during pregnancy (Munn et al., Science 1998; 281:1191-1193).
IDO has also been implicated in maintaining tolerance to self antigens (Grohmann et al., J. Exp. Med. 2003; 198:153-160), in suppressing T cell responses to MHC-mismatched organ transplants (Miki et al., Transplantation Proceedings 2001; 33:129-130; Swanson, et al. Am J Respir Cell Mol Biol 2004; 30:311-8; Beutelspacher et al. Am J Transplant 2006; 6:1320-30) and in the tolerance-inducing activity of recombinant CTLA4-Ig (Grohmann et al. Nature Immunology 2002; 3:985-1109; Mellor et al. J. Immunol. 2003; 171:1652-1655) and the T cell regulatory functions of interferons (Grohmann et al. J Immunol 2001; 167:708-14; and Baban et al. Int. Immunol 2005; 17:909-919). In these four systems, the immunosuppressive effect of IDO can be blocked by the in vivo administration of an IDO inhibitor, such as 1-methyl-tryptophan (also referred to herein as 1-MT or 1 MT).
The transfection of IDO into mouse tumor cell lines confers the ability to suppress T cell responses both in vitro and in vivo (Mellor et al., J. Immunol. 2002; 168:3771-3776). In a Lewis Lung carcinoma model, administration of 1-MT significantly delayed tumor outgrowth (Friberg et al., International Journal of Cancer 2002; 101:151-155). The mouse mastocytoma tumor cell line P815 forms lethal tumors in naive hosts, but is normally rejected by pre-immunized hosts. However, transfection of P815 with IDO prevents its rejection by pre-immunized hosts (Uyttenhove et al., Nature Medicine 2003; 9:1269-1274). Inhibition of tumor growth was entirely dependent on the presence of an intact immune system and was substantially reversed, that is, tumor growth inhibited, by the concomitant administration of 1-MT.
The selective recruitment of IDO+ APCs in the tumor-draining (sentinel) lymph nodes of patients with melanoma (Munn et al., Science 2002; 297:1867-1870 and Lee et al., Laboratory Investigation 2003; 83:1457-1466) indicates that tumors take advantage of the immunosuppressive effect of IDO by recruiting a population of IDO-expressing host APCs to present tumor antigens. Similar changes have been seen in breast carcinoma and other tumor-associated lymph nodes. In mouse tumor models the IDO-expressing APCs in tumor-draining lymph nodes are phenotypically similar to a subset of dendritic cells recently shown to mediate profound IDO-dependent immunosuppressive in vivo (Mellor et al., J. Immunol. 2003; 171:1652-1655; and Baban et al. Int. Immunol 2005; 17:909-919). IDO-expressing APCs in tumor-draining lymph nodes thus constitute a potent tolerogenic mechanism.
Plasmacytoid dendritic cells (PDCs) are a unique dendritic cell (DC) subset that plays a critical role in regulating innate and adaptive immune responses (Liu, 2005 Annu Rev Immunol 23:275-306). PDCs sense the microbial pathogen components via Toll-like receptor (TLR) recognition, rapidly produce large amounts of type I interferons (including IFN-α and IFN-β, and activate diverse cell types such as natural killer (NK) cells, macrophages, and CD11c+ DCs to mount immune responses against microbial infections. In addition to stimulating immune responses, increasing evidence suggests that PDCs may also represent a naturally occurring regulatory DC subset (Chen, Curr Opin Organ Transplant 2005; 10:181-185). Under certain circumstances PDCs appear to be able to induce the differentiation of regulatory T cells (Tregs) that downregulate immune responses (Martin et al., Blood 2002; 100:383-390). In humans, PDCs can prime allogeneic naive CD8+ T cells to differentiate into CD8+ suppressor T cells (Gilliet and Liu. J Exp Med 2002; 195:695-704; Wei et al., Cancer Res 2005; 65:5020-5026). It has recently been shown that human PDCs also induce the generation of CD4+ Tregs (Moseman et al., J Immunol 2004; 173:4433-4442). These CD4+ Tregs strongly inhibit autologous or allogeneic T cell proliferation in vitro. Tregs are critical in maintaining self-tolerance and controlling excessive immune reactions (Sakaguchi, Nat Immunol 2005; 6:345-352), so their generation by PDCs is potentially of high biologic significance. However, the mechanism underlying PDC-induced CD4+ Treg generation remains unknown.
The present invention includes a method of suppressing the induction of regulatory T cells (Tregs) in a subject, the method including administering to the subject an inhibitor of indoleamine-2,3-dioxygenase (IDO) in an amount effective to suppress the induction of Tregs.
The present invention also includes a method of suppressing the generation or reactivation of regulatory T cells (Tregs) in a subject, the method including administering to the subject an inhibitor of indoleamine-2,3-dioxygenase (IDO) in an amount effective to suppress induction of Tregs.
The present invention also includes a method of reducing immune suppression mediated by regulatory T cells (Tregs) in a subject, the method including administering to the subject an inhibitor of indoleamine-2,3-dioxygenase (IDO) in an amount effective to enhance an immune response.
The present invention also includes a method to reduce the induction of antigen-specific regulatory T cells in a subject, the method including administering to the subject an effective amount of such an antigen in combination with an inhibitor of IDO. In some embodiments, the antigen is a tumor antigen. In some embodiments, the antigen is a viral antigen. In some embodiments, the antigen is an allergen.
The present invention also includes a method to enhance the immune response in a subject to a vaccine antigen, the method including administering to the subject the vaccine antigen, a CpG oligonucleotide (ODN), and an inhibitor of indoleamine-2,3-dioxygenase (IDO).
The present invention also includes a method to enhance the immune response in a subject to a vaccine antigen, the method including administering to the subject the vaccine antigen, a CpG oligonucleotide (ODN), and an inhibitor of GCN2.
The present invention also includes a method to enhance the immune response in a subject to a vaccine antigen, the method including administering to the subject the vaccine antigen and an inhibitor of GCN2.
The present invention also includes a method to induce regulatory T cells in a subject, the method including administering to the subject a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan. In some embodiments, the metabolic breakdown product of tryptophan is L-kynurenine, kynurenic acid, anthranilic acid, 3-hydroxyanthranilic acid, quinolinic acid, picolinic acid, analogs thereof, or a combination thereof.
The present invention also includes a method of generating regulatory T cells (Tregs) in a subject, the method including administering to the subject a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan.
The present invention also includes a method of increasing immune suppression mediated by regulatory T cells (Tregs) in a subject, the method including administering to the subject a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, in an amount effective to enhance an immune response.
The present invention also includes a method of inducing antigen tolerance in a subject, the method including administering to the subject a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan. Some embodiments of the invention include further administering the antigen to the subject.
The present invention also includes a method of inducing a dominant suppressive immune response against an antigen in a subject, the method including administering to the subject a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan. In some embodiments, the antigen is the target of an autoimmune response. In some embodiments of the method, the antigen is an alloantigen present in an allograft for transplantation into the subject. Some embodiments include further transplanting the allograft into the subject.
The present invention also includes a method of preventing allograft rejection in a subject, the method including administering to the subject a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and one or more alloantigens present in the allograft.
The present invention also includes a method of preventing allograft rejection in a recipient, the method including administering a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, to the recipient after the transplantation of the allograft into the recipient.
The present invention also includes a method of preventing graft versus host disease in a recipient, the method including administering to the donor a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and one or more alloantigens present in the recipient, wherein the metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and the one or more alloantigens present in the recipient are administered to the donor prior to obtaining donor cells from the donor; obtaining donor cells from the donor; and administering the donor cells to the recipient.
The present invention also includes a method of preconditioning a recipient of an allograft to suppress allograft rejection in the recipient, the method including administering to the recipient a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and one or more alloantigens present in the allograft, wherein the metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and the one or more alloantigens present in the allograft are administered to the recipient prior to allografting; and transplanting the allograft into the recipient.
The present invention also includes a method of generating regulatory T cells (Tregs) in vitro, the method including obtaining naïve CD4+ cells from a subject; obtaining pDCs from the subject; and co-incubating the naïve CD4+ cells and the pDCs with a CpG ODN and a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, for a time sufficient to induce the generation of Tregs.
The present invention also includes a method of suppressing immune mediated allograft rejection in a recipient, the method including obtaining naïve CD4+ cells from the allograft donor; obtaining pDCs from the recipient; and co-incubating the naïve CD4+ cells and the pDCs with a CpG ODN and a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, for a time sufficient to induce the generation of Tregs; administering the induced Tregs to the recipient before, during, and/or after the allograft transplant.
The present invention also includes a method of suppressing immune mediated allograft rejection in a recipient, the method including obtaining naïve CD4+ cells from the allograft donor; obtaining pDCs from the donor; and co-incubating the naïve CD4+ cells and the pDCs with a CpG ODN and a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, for a time sufficient to induce the generation of Tregs; administering the induced Tregs to the recipient before, during, and/or after the allograft transplant.
Also included in the present invention is an isolated cell population preconditioned to minimize graft versus host disease when transplanted into a recipient, the cell population obtained by a method including administering to the donor a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and one or more alloantigens present in the recipient, wherein the metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and the one or more alloantigens present in the recipient are administered to the donor prior to obtaining donor cells from the donor; and obtaining donor cells from the donor.
The present invention also includes a composition to induce tolerance to an antigen, the composition including a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan.
The present invention also includes a composition to induce the generation of regulatory T cells (Tregs), the composition including a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan.
The present invention also includes a vaccine for use in immunization protocols for the induction of immune tolerance to an antigen, the vaccine including a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and the antigen.
The present invention also includes a method to enhance an immune response in a subject including the administration of an effective amount of an inhibitor of a GCN2 kinase. In some embodiments, the method further includes the administration of a vaccine.
The present invention also includes a method to prevent immune suppression mediated by Tregs, the method including the administration of an effective amount of an inhibitor of a GCN2 kinase. In some embodiments, the method further includes the administration of a vaccine.
The present invention also includes a method to enhance an immune response in a subject, the method including administering two or more agents, each agent selected from the group consisting of an inhibitor of indoleamine-2,3-dioxygenase (IDO), a CpG oligonucleotide (ODN), an inhibitor of a GCN2 kinase, a vaccine, and a chemotherapeutic agent.
The present invention also includes a method to prevent immune suppression mediated by Tregs, the method including the administration administering two or more agents, each agent selected from the group consisting of an inhibitor of indoleamine-2,3-dioxygenase (IDO), an inhibitor of a GCN2 kinase, a vaccine, and a chemotherapeutic agent.
In some embodiments of the methods and compositions of the present invention, the inhibitor of IDO is 1-methyl-tryptophan (1-MT). In some embodiments, 1 MT may be a D isomer of 1MT, a L isomer of 1 MT, or a racemic mixture of 1-MT.
Unless otherwise specified, “a,” “an,” “the,” and “at least one” are used interchangeably and mean one or more than one.
The present invention demonstrates the role of indoleamine 2,3 dioxygenase (IDO) expression in the induction of regulatory T cells (Tregs), showing that IDO expression is necessary for the induction of CD4+ Tregs by plasmacytoid dendritic cells (also referred to herein as “PDCs” or “pDCs”). The present invention shows that inhibitors of IDO suppress the induction and/or activation of Tregs. A suppression of Tregs is associated with an active immune response. The present invention shows that IDO expression induces of Tregs. The induction of Tregs is associated with the induction of immune tolerance and the suppression of an immune response. The present invention also shows that the induction of Tregs by IDO can be pharmacologically reproduced by the addition of a downstream tryptophan metabolite, including, but not limited to kynurenin (also referred to herein as “KYN” or “kyn”). The observations of the present invention have wide applicability, including for example, in methods for the treatment of autoimmunity, allergic responses, transplant situations, vaccination, and cancer therapy. As used herein, the “induction of Tregs” includes both the generation of Tregs from naïve T cells and the reactivation of quiescent Tregs.
Although most auto-reactive T lymphocytes are regulated and eliminated during thymic development, healthy individuals continue to carry self-reactive cells. T regulatory cells (Tregs) are an immunoregulatory cell type used to control autoimmunity in the periphery. Tregs are CD4 positive. The constitutive expression of CD25 is considered to be a characteristic feature of human Tregs. Thus, Tregs are often CD4+CD25+ T cells.
Tregs are potent suppressors of T cell mediated immunity in a range of inflammatory conditions, including infectious disease, autoimmunity, pregnancy and tumors (Sakaguchi, S, Nat Immunol 2005; 6:345-352). Mice lacking Tregs die rapidly of uncontrolled autoimmune disorders (Khattri et al. Nat Immunol 2003; 4:337-342). In vivo, a small percentage of Tregs can control large numbers of activated effector T cells. Although freshly isolated Tregs exhibit minimal constitutive suppressor functions, ligating the T cell antigen receptor (TCR) in vitro (Thornton et al. Eur J Immunol 2004; 34:366-376), or pre-immunizing mice with high-dose self-antigen in vivo stimulates Treg suppressor functions (Nishikawa et al. J Exp Med 2005; 201:681-686). This requirement for TCR signaling to enhance Treg suppressor functions is paradoxical because most Tregs are thought to recognize constitutively expressed self-antigens (Nishikawa et al. J Exp Med 2005; 201:681-686; Hsieh et al. Immunity 2004; 21:267-277; Fisson et al. J Exp Med 2003; 198:737-746; Kronenberg et al. Nature 2005; 435:598-604). The present invention shows that increased IDO activity stimulates a rapid increase in suppressive functions mediated by splenic Tregs and that the inhibition of IDO activity abrogates suppressive functions.
Tregs of the present invention may express CD4 (CD4+) and/or CD25 (CD25+). Tregs of the present invention may also be positive for the transcriptional repression factor forkkhead box P3 (FoxP3). Tregs of the present invention may express a high affinity IL-2 receptor. Tregs of the present invention may be CD8+ Tregs. Tregs have been studied for more than thirty years and are further reviewed in, for example, Beyer and, Schultze, Blood, 2006; 108(3):804-11; Elkord, Inflamm Allergy Drug Targets, 2006; 5(4):21′-7; Ghiringhelli et al., Immunol Rev, 2006; 214:229-38; Jiang et al., Hum Immunol, 2006; 67(10):765-76; Kabelitz et al., Crit Rev Immunol, 2006; 26(4):291-306; Le and Chao, Bone Marrow Transplant, 2007; 39(1):1-9; Sakaguchi et al., Immunol Rev, 2006; 212:8-27; Shevach et al., Immunol Rev, 2006; 212:60-73; Stein-Streilein and Taylor, “An eye's view of T regulatory cells,” J Leukoc Biol, Dec. 28, 2006 (epub ahead of print); and Wing and Sakaguchi, Curr Opin Allergy Clin Immunol, 2006; 6(6):482-8.
The IDO enzyme is well characterized (see, for example, Taylor et al., FASEB Journal 1991; 5:2516-2522; Lee et al., Laboratory Investigation, 2003; 83:1457-1466; and Grohmann et al., Trends in Immunology 2003; 24:242-248) and compounds that serve as substrates or inhibitors of the IDO enzyme are known. For example, Southan (Southan et al, Med. Chem. Res., 1996; 343-352) utilized an in vitro assay system to identify tryptophan analogues that serve as either substrates or inhibitors of human IDO. Methods for detecting the expression of IDO in cells are well known and include, but are not limited to, any of those described herein and those described, for example in U.S. Pat. Nos. 6,395,876, 6,451,840, and 6,482,416, US. Patent Application Nos. 20030194803, 20040234623, 20050186289, and 20060292618, and PCT application “The Induction of Indoleamine 2,3-dioxygenase in Dendritic Cells by TLR Ligands and Uses Thereof,” filed Oct. 21, 2006.
IDO degrades the essential amino acid tryptophan (for reviews see Taylor et al., FASEB Journal 1991; 5:2516-2522; Lee et al., Laboratory Investigation, 2003; 83:1457-1466; and Grohmann et al., Trends in Immunology 2003; 24:242-248). IDO is the first and rate-limiting step in the degradation of tryptophan to the downstream metabolite kynurenine (KYN) and subsequent metabolites along the KYN pathway (Mellor and Munn, Nat Rev Immunol 2004; 4:762-774; Grohmann et al., Trends Immunol 2003; 24:242-248). IDO mediates T cell regulatory effects in inflammatory conditions associated with a diverse range of clinical syndromes including cancer, infectious and autoimmune diseases, allergy and tissue transplantation and pregnancy, (Munn et al., Science 1998; 281:1191-1193; Gurtner et al., Gastroenterology 2003; 125:1762-1773; Uyttenhove et al., Nat Med 2003; 9:1269-1274; Muller et al., Nat Med 2005; 11:312-319; Munn et al., J Clin Invest 2004; 114:280-290; Swanson et al., Am J Respir Cell Mol Biol 2004; 30:311-318; Hayashi et al., J Clin Invest 2004; 114:270-279; Potula et al., Blood 2005; 106:2382-2390).
Expression of IDO by human monocyte-derived macrophages (Munn et al., J. Exp. Med. 1999; 189:1363-1372), human dendritic cells (Munn et al., Science 2002; 297:1867-1870 and Hwu et al., J. Immunol. 2000; 164:3596-3599), and mouse dendritic cells (Mellor et al., J. Immunol. 2003; 171:1652-1655) allows these different antigen-presenting cells (APCs) to inhibit T cell proliferation in vitro. In vivo, IDO participates in maintaining maternal tolerance toward the antigenically foreign fetus during pregnancy (Munn et al., Science 1998; 281:1191-1193).
IDO has also been implicated in maintaining tolerance to self antigens (Grohmann et al., J. Exp. Med. 2003; 198:153-160), in suppressing T cell responses to MHC-mismatched organ transplants (Miki et al., Transplantation Proceedings 2001; 33:129-130), and in the tolerance-inducing activity of recombinant CTLA4-Ig (Grohmann et al., Nature Immunology 2002; 3:985-1109). In these three systems, the immunosuppressive effect of IDO can be blocked by the in vivo administration of an IDO inhibitor, such as 1-methyl-tryptophan (also referred to herein as 1-MT or 1MT). In mice, IDO is expressed in certain DC subsets, including PDCs, that have been linked to immunosuppression and tolerance induction (Grohmann et al., 2001 J Immunol 167:708-714; Mellor et al., 2003 J Immunol 171:1652-1655; and Munn et al., 2004 J Clin Invest 114:280-29010-12).
The transfection of IDO into mouse tumor cell lines confers the ability to suppress T cell responses both in vitro and in vivo (Mellor et al., J. Immunol. 2002; 168:3771-3776). In a Lewis Lung carcinoma (LLC) model, administration of 1-MT significantly delayed tumor outgrowth (Friberg et al., International Journal of Cancer 2002; 101:151-155). The mouse mastocytoma tumor cell P815 line forms lethal tumors in naïve hosts, but is normally rejected by pre-immunized hosts. However, transfection of P815 with IDO prevents its rejection by pre-immunized hosts (Uyttenhove et al., Nature Medicine 2003; 9:1269-1274). This effect was entirely dependent on the presence of an intact immune system and was substantially reversed, that is, tumor growth inhibited, by the concomitant administration of 1-MT.
The present invention includes methods of suppressing the generation of Tregs, reducing the immune suppression mediated by Tregs, reducing the induction of antigen-specific Tregs, and/or enhancing an immune response to an antigen by administering an inhibitor of IDO.
IDO inhibitors include, but are not limited to, 1-methyl-tryptophan, β-(3 benzofuranyl)-alanine, β-[3-benzo(b)thienyl]-alanine, 6-nitro-tryptophan, and derivatives thereof. An inhibitor of IDO may be an L isomer, a D isomer, or a racemic mixture of IDO. In some embodiments, a preferred IDO inhibitor is 1-methyl-tryptophan, also referred to as 1MT or 1-MT. In some embodiments, an IDO inhibitor is a D isomer of 1MT, an L isomer of 1MT, or a racemic mixture of 1MT. See, for example, published U.S. Patent Application Nos. 2004/0234623 and 2005/0186289. Additional examples of compounds that inhibit IDO activity are brassinin derivatives described by Gaspari et al., J Medicinal Chem 2006; 49(2):684-92), a series of indole derivatives described in patent application PCT/US04/05154, and a series of compounds derived from naphtoquinones described in WO/2006/005185. Inhibitors of the IDO enzyme are readily commercially available, for example, from Sigma-Aldrich Chemicals, St. Louis, Mo.
Additional examples of compounds that inhibit IDO activity include, for example, any of the compounds with IDO inhibitory activity described in Prendergast et al., “Novel Indoleamine-2,3-dioxygenase inhibitors,” (PCT/US2004/005154); Peterson et al., “Evaluation of substituted beta-carbolines as noncompetitive indoleamine-2,3-dioxygenase inhibitors,” (Med Chem Res 1993; 3:473-482); Gaspari et al., “Structure-activity study of brassinin derivatives as indoleamine-2,3-dioxygenase inhibitors,” (J. Med. Chem 2006; 49:684-92); Vottero et al., “Inhibitors of human indoleamine 2,3 dioxygenase identified with a target-based screen in yeast,” (Biotechnol J. 2006; 1:282-288); Sono et al., “Herne containing oxygenases,” Chem Rev 1996; 96:2841); Muller et al., “Inhibition of indoleamine 2,3-dioxygenase an immunoregulatory target of the cancer suppression gene Binl potentiates cancer immunotherapy,” Nat. Med. 2005; 11:312-319); Peterson et al., “Evaluation of substituted beta-carbolines as noncompetitive indoleamine-2,3-dioxygenase inhibitors,” Med Chem Res 1993; 4:473-482); Sono et al., “Enzyme kinetic and spectroscopic studies of inhibitor and effector interactions with indoleamine-2,3-dioxygenase,” (Biochemistry 1989; 28:5392-9); and Andersen et al., “Indoleamine-2,3-dioxygenase inhibitors,” (PCT/CA2005/001087). For example, inhibitors include any of A-YY, shown below, and analogs and derivatives thereof, wherein an analog or derivative thereof inhibits IDO.
Inhibitor A has an EC50 of approximately 12-20 μM and a Ki of approximately 11 μM (Prendergast et al., PCT/US2004/005154; Muller et al., Nat. Med. 2005; 11:312-319). Inhibitor B has an EC50 of approximately 35-50 μM and a Ki of approximately 6-34 μM (Prendergast et al., PCT/US2004/005154). Inhibitor C has a Ki of approximately 24 μM (Sono et al., Chem Rev 1996; 96:2841). Inhibitor D has an EC50 of approximately 100 μM; inhibitor E has an EC50 of approximately 50 μM; and inhibitor F has an EC50 of approximately 200 μM (Prendergast et al., PCT/US2004/005154). Inhibitor G has a Ki of approximately 3 μM (Peterson et al., Med Chem Res 1993; 3:473-482). Inhibitor H has a Ki of approximately 41 μM; inhibitor I has a Ki of approximately 34 μM; inhibitor J has a Ki of approximately 42 μM; inhibitor K has a Ki of approximately 47 μM; inhibitor L has a Ki of approximately 37 μM; inhibitor M has a Ki of approximately 13 μM; inhibitor N has a Ki of approximately 17 μM; inhibitor O has a Ki of approximately 11 μM; inhibitor P has a Ki of approximately 28 μM; and inhibitor Q has a Ki of approximately 20 μM (Gaspari et al., J. Med. Chem. 2006; 49:684-92). Inhibitor R has an EC50 of approximately 3 μM and a Ki of approximately 1.5 μM; inhibitor S has an EC50 of approximately 1 μM; inhibitor T has an EC50 of approximately 5 nM; inhibitor U has an EC50 of approximately 1 μM; inhibitor V has an EC50 of approximately 1 μM; inhibitor W has an EC50 of approximately 2 nM; inhibitor X has an EC50 of approximately 5 μM; inhibitor Y has an EC50 of approximately 5 μM; and inhibitor Z has an EC50 of approximately 6 μM (Vottero et al., Biotechnol J. 2006; 1:282-288). Inhibitor AA has a Ki of approximately 8.5 μM; inhibitor BB has a Ki of approximately 5 μM; and inhibitor CC (Peterson et al., Med Chem Res 1993; 4:473-482). Inhibitor DD has a Ki of approximately 4 nM (Sono et al., Biochemistry 1989; 28:5392-9). Inhibitor EE has a Ki of approximately 25 nM; inhibitor FF has a Ki of approximately 45 nM; inhibitor GG has a Ki of approximately 48 nM; inhibitor HH has a Ki of approximately 86 nM; inhibitor H has a Ki of approximately 120 nM; inhibitor JJ has a Ki of approximately 140 nM; inhibitor KK has a Ki of approximately 0.6 μM; inhibitor LL has a Ki of approximately 180 nM; inhibitor MM has a Ki of approximately 0.3 μM; inhibitor NN has a Ki of approximately 0.6 μM; inhibitor OO has a Ki of approximately 0.5 μM; inhibitor PP has a Ki of approximately 1.2 μM; and inhibitor QQ has a Ki of approximately 1.2 μM (Andersen et al., PCT/CA2005/001087). Inhibitor RR has a Ki of approximately 1.4 μM; inhibitor SS has a Ki of approximately 3.1 μM; inhibitor TT has a Ki of approximately 3.2 μM; inhibitor UU has a Ki of approximately 1.8 μM; inhibitor VV has a Ki of approximately 3.4 μM; and inhibitor WW has a Ki of approximately 42 μM. Inhibitor XX has an EC50 of approximately 100 μM and a Ki of approximately 97 μM (Prendergast et al., PCT/US2004/005154; Gaspari et al., J. Med. Chem. 2006; 49:684-92). Inhibitor YY has an EC50 of approximately 100 μM (Prendergast et al., PCT/US2004/005154).
The present invention demonstrates that IDO expression is necessary for the generation of CD4+ Tregs and demonstrates that this effect can be pharmacologically reproduced by the addition of a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan. Tryptophan is also referred to herein as “Tryp,” “tryp,” “Trp” or “trp.” IDO degrades the essential amino acid tryptophan (Trp) to kynurenin (KYN), which is then metabolized by other enzymes to subsequent metabolites along the KYN pathway (Stone and Darlington, Nat Rev Drug Discov 2002; 1:609-620). The present invention includes the administration of a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, for the generation of Tregs. As used herein, an “analog” refers to a chemical compound or molecule made from a parent compound or molecule by one or more chemical reactions. As such, an analog can be a compound with a structure similar to or based on that of a metabolic breakdown product of tryptophan, but differing from it in respect to certain components or structural makeup, which may have a similar action metabolically. In preferred embodiments, the metabolic breakdown product of tryptophan is L-kynurenine, kynurenic acid, anthranilic acid, 3-hydroxyanthranilic acid, quinolinic acid, or picolinic acid, and an analog of a metabolic breakdown product of tryptophan is an analog of L-kynurenine, kynurenic acid, anthranilic acid, 3-hydroxyanthranilic acid, quinolinic acid, or picolinic acid. A metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions and methods.
With the present invention, an agonist of one or more Toll-like receptors (TLRs) may be administered to a subject to induce the generation of Tregs. The terms “agonist” and “agonistic,” as used herein, refer to or describe an agent that is capable of substantially inducing, promoting or enhancing TLR biological activity or TLR receptor activation or signaling. The terms “antagonist” or “antagonistic,” as used herein, refer to or describe an agent that is capable of substantially counteracting, reducing or inhibiting TLR biological activity or TLR receptor activation or signaling. In some aspects of the present invention, a TLR9 agonist may be administered to induce the expression of IDO. As used herein, a TLR9 agonist refers to an agent that is capable of substantially inducing, promoting or enhancing TLR9 biological activity or TLR9 receptor activation or signaling. TLR9 is activated by unmethylated CpG-containing sequences, including those found in bacterial DNA or synthetic oligonucleotides (ODNs). A TLR9 agonist may be a preparation of microbial DNA, including, but not limited to, E. coli DNA, endotoxin free E. coli DNA, or endotoxin-free bacterial DNA from E. coli K12. A TLR9 agonist may be isolated from a bacterium, for example, separated from a bacterial source; synthetic, for example, produced by standard methods for chemical synthesis of polynucleotides; produced by standard recombinant methods, then isolated from a bacterial source; or a combination of the foregoing.
In preferred embodiments, a TLR9 agonist is a synthetic oligonucleotide containing unmethylated CpG motifs, also referred to herein as “a CpG-oligodeoxynucleotide,” “CpGODNs,” or “ODN” (see, for example, Hemmi et al., Nature 2000; 408:740-745). A CpG-oligodeoxynucleotide TLR9 agonist includes a CpG motif. A CpG motif includes two bases to the 5′ and two bases to the 3′ side of the CpG dinucleotide. CpG-oligodeoxynucleotides may be produced by standard methods for chemical synthesis of polynucleotides. CpG-oligodeoxynucleotides may be purchased commercially, for example, from Coley Pharmaceuticals (Wellesley, Mass.), Axxora, LLC (San Diego, Calif.), or InVivogen, (San Diego, Calif.). A CpG-oligodeoxynucleotide TLR9 agonist may includes a wide range of DNA backbones, modifications and substitutions. In some aspects of the invention, a TLR9 agonist is a nucleic acid that includes the nucleotide sequence 5′ CG 3′. In some aspects of the invention, a TLR9 agonist is a nucleic acid that includes the nucleotide sequence 5′-purine-purine-cytosine-guanine-pyrimidine-pyrimidine-3′. In other aspects of the invention, a TLR9 agonist is a nucleic acid that includes the nucleotide sequence 5′-purine-TCG-pyrimidine-pyrimidine-3′. In some aspects of the invention, a TLR9 agonist is a nucleic acid that includes the nucleotide sequence 5′-(TGC)n-3′, where n≧1. In other aspects of the invention, a TLR9 agonist is a nucleic acid that includes the sequence 5′-TCGNN-3′, where N is any nucleotide.
With the methods of the present invention, a TLR agonist may be administered at a low dosage. In human subjects, a low dosage of a CpG agonist is about 30 mg or less. A low dosage of a CpG agonist may be about 25 mg or less. A low dosage of a CpG agonist may be about 20 mg or less. A low dosage of a CpG agonist may be about 15 mg or less. A low dosage of a CpG agonist may be about 10 mg or less. A low dosage of a CpG agonist may be about 5 mg or less. A low dosage of a CpG agonist may be about 1 mg or less. A low dosage of a CpG agonist may be about 0.5 mg or less. A low dosage of a CpG agonist may be a range of any of these dosages. For example, a low dosage of a CpG agonist may be from about 0.5 mg to about 30 mg. Such a low dosage may be administered, for example, when a TLR agonist is administered as a vaccine adjuvant. Such a low dosage may, for example, be administered subcutaneously, intradermal, or intratumoral.
With the methods of the present invention, a TLR agonist may be administered at a high dosage. In human subjects a high dosage is greater than 30 mg. A high dosage may, for example, be greater than about 30 mg, greater than about 50 mg, greater than about 75 mg, greater than about 100 mg, greater than about 125 mg, greater than about 150 mg, or more. A high dosage may be up to about 125 mg, up to about 250 mg, up to about 500 mg, or more. Such a high dosage maybe administered, for example, to induce an immunosuppressive effect. Such a low dosage may be administered systemically, including, for example, intravenously.
A TLR agonist may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions and methods.
The methods of the present invention may also be administered to a patient receiving a vaccine. Such a vaccine may be an anti-viral vaccine, such as, for example, a vaccine against HIV, or a vaccine against tuberculosis or malaria. The vaccine may be a tumor vaccine, including, for example, a melanoma, prostate cancer, colorectal carcinoma, or multiple myeloma vaccine. Dendritic cells (DC) have the ability to stimulate primary T cell antitumor immune responses. Thus, a tumor vaccine may include dendritic cells. Dendritic cell vaccines may be prepared, for example, by pulsing autologous DCs derived from the subject with synthetic antigens, tumor lysates, tumor RNA, or idiotype antibodies, by transfection of DCs with tumor DNA, or by creating tumor cell/DC fusions (Ridgway, Cancer Invest. 2003; 21:873-86). The vaccine may include one or more immunogenic peptides, for example, immunogenic HIV peptides, immunogenic tumor peptides, or immunogenic human cytomegalovirus peptides (such as those described in U.S. Pat. No. 6,251,399). The vaccine may include genetically modified cells, including genetically modified tumor cells or cell lines genetically modified to express granulocyte-macrophage stimulating factor (GM-CSF) (Dranoff, Immunol Rev. 2002; 188:147-54). In some aspects of the invention, a vaccine may include an antigen that is the target of an autoimmune response.
The methods of the present invention may be used in the treatment of an autoimmune disease. Autoimmune diseases that may be treated by the methods of the present invention include, but are not limited to, acute disseminated encephalomyelitis (ADEM), Addison's disease, ankylosing spondylitisis, antiphospholipid antibody syndrome (APS), aplastic anemia, autoimmune hepatitis, autoimmune uveitits celiac disease, Crohn's disease, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome (GBS), Hashimoto's disease, idiopathic thrombocytopenic purpura, insulin dependent diabetes mellitus (IDDM) lupus erythematosus, multiple sclerosis, myasthenia gravis, opsoclonus myoclonus syndrome (OMS), Ord's thyroiditis, pemphigus, pernicious Anaemia, polyarthritis, primary biliary cirrhosis, rheumatoid arthritis, Reiter's syndrome, Sjögren's syndrome, Takayasu's arteritis, temporal arteritis (also known as giant cell arteritis), warm autoimmune hemolytic anemia, and Wegener's granulomatosi.
Certain pathological conditions, such as parasitic infections, AIDS (caused by the human immunodeficiency virus (HIV)) and latent cytomegaloviral (CMV) infections, are extremely difficult to treat since the macrophages act as reservoirs for the infectious agent. Even though the cells are infected with by a foreign pathogen, they are not recognized as foreign. The methods of the present invention may be used to treat such pathological conditions including, but not limited to, viral infections, infection with an intracellular parasite, and infection with an intracellular bacteria. Viral infections treated include, but are not limited to, infections with the human immunodeficiency virus (HIV) or cytomegalovirus (CMV). Intracellular bacterial infections treated include, but are not limited to infections with Mycobacterium leprae, Mycobacterium tuberculosis, Listeria monocytogenes, and Toxplasma gondii. Intracellular parasitic infections treated include, but are not limited to, Leishmania donovani, Leishmania tropica, Leishmania major, Leishmania aethiopica, Leishmania mexicana, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, and Plasmodium malariae. The efficacy of treatment of an infection may be assessed by any of various parameters well known in the art. This includes, but is not limited to, a decrease in viral load, an increase in CD4+ T cell count, a decrease in opportunistic infections, eradication of chronic infection, and/or increased survival time.
Current experimental methods of cancer treatment include tumor vaccination protocols including the administration of tumor peptides or whole cell tumor vaccines with CpG ODNs as immunostimulatory adjuvants. Currently CpG ODNs have been utilized as an adjuvant along with a tumor vaccine. However, as shown by the present invention, the administration of a CpG ODN adjuvant can induce the expression of IDO in a subpopulation of DCs that may lead to partial or full immunosuppression, precluding the full immunostimulatory capacity of DCs and therefore potentially dampening the immune response to tumor specific antigens. The present invention provides methods to enhance the immunostimulatory capacity of DCs to tumor antigens by co-administration of one or more inhibitors of IDO along with the administration of a TLR agonist, in an amount effective to suppress the induction of Tregs. The present invention includes methods of treating cancer in a subject by administering to the subject an inhibitor of IDO in an amount effective to suppress the induction or Tregs. The present invention also includes methods of treating cancer in a subject by administering an inhibitor of IDO along with a TLR agonist, such as, for example, a CpG oligonucleotide and/or an inhibitor of GCN2 and/or additional therapeutic treatments in an amount effective to suppress the induction or Tregs. Additional therapeutic treatments include, but are not limited to, surgical resection, radiation therapy, chemotherapy, hormone therapy, anti-tumor vaccines, antibody based therapies, whole body irradiation, bone marrow transplantation, peripheral blood stem cell transplantation, and the administration of chemotherapeutic agents (also referred to herein as “antineoplastic chemotherapy agent”). Antineoplastic chemotherapy agents include, but are not limited to, cyclophosphamide, methotrexate, 5-fluorouracil, doxorubicin, vincristine, ifosfamide, cisplatin, gemcitabine, busulfan (also known as 1,4-butanediol dimethanesulfonate or BU), ara-C (also known as 1-beta-D-arabinofuranosylcytosine or cytarabine), adriamycin, mitomycin, cytoxan, methotrexate, and combinations thereof. Additional therapeutic agents include, for example, one or more cytokines, an antibiotic, antimicrobial agents, antiviral agents, such as AZT, ddI or ddC, and combinations thereof. The cytokines used include, but are not limited to, IL-1α, IL-3, IL-2, IL-3, IL-4, IL-6, IL-8, IL-9, IL-10, IL-12, IL-18, IL-19, IL-20, IFN-α, IFN-β, IFN-γ, tumor necrosis factor (TNF), transforming growth factor-β (TGF-β), granulocyte colony stimulating factor (G-CSF), macrophage colony stimulating factor (M-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF)) (U.S. Pat. Nos. 5,478,556, 5,837,231, and 5,861,159), or Flt-3 ligand (Shurin et al., Cell Immunol. 1997; 179; 174-184). Antitumor vaccines include, but are not limited to, peptide vaccines, whole cell vaccines, genetically modified whole cell vaccines, recombinant protein vaccines or vaccines based on expression of tumor associated antigens by recombinant viral vectors.
The tumors to be treated by the present invention include, but are not limited to, melanoma, colon cancer, pancreatic cancer, breast cancer, prostate cancer, lung cancer, leukemia, lymphoma, sarcoma, ovarian cancer, Kaposi's sarcoma, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, small-cell lung tumors, primary brain tumors, stomach cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, and adrenal cortical cancer.
The efficacy of treatment of a tumor may be assessed by any of various parameters well known in the art. This includes, but is not limited to, determinations of a reduction in tumor size, determinations of the inhibition of the growth, spread, invasiveness, vascularization, angiogenesis, and/or metastasis of a tumor, determinations of the inhibition of the growth, spread, invasiveness and/or vascularization of any metastatic lesions, and/or determinations of an increased delayed type hypersensitivity reaction to tumor antigen. The efficacy of treatment may also be assessed by the determination of a delay in relapse or a delay in tumor progression in the subject or by a determination of survival rate of the subject, for example, an increased survival rate at one or five years post treatment. As used herein, a relapse is the return of a tumor or neoplasm after its apparent cessation, for example, such as the return of leukemia.
The present invention also includes methods of preventing graft versus host disease (GVHD) in a recipient, the method including administering to a the donor a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and one or more alloantigens present in the recipient, wherein the a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and the one or more alloantigens present in the recipient are administered to the donor prior to obtaining donor cells from the donor; obtaining donor cells from the donor; and administering the donor cells to the recipient. GVHD is a complication of an allogeneic bone marrow or cord blood transplant (BMT) in which functional immune cells in the transplanted marrow recognize the recipient as “foreign” and mount an immunologic attack. Thus, GVHD is a pathological condition in which cells from the transplanted tissue of a donor initiate an immunologic attack on the cells and tissue of the recipient. After bone marrow transplantation, T cells present in the graft, either as contaminants or intentionally introduced into the host, attack the tissues of the transplant recipient after perceiving host tissues as antigenically foreign. A wide range of host antigens, also referred to herein as “alloantigens” can initiate GVHD, among them the HLAs. However, graft-versus-host disease can occur even when HLA-identical siblings are the donors. HLA-identical siblings or HLA-identical unrelated donors (called a minor mismatch as opposed to differences in the HLA antigens, which constitute a major mismatch) often still have genetically different proteins that can be presented on the MHC.
The present invention includes methods of preconditioning a recipient of an allograft to suppress allograft rejection in the recipient, the method including administering to the recipient a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and one or more alloantigens present in the allograft, wherein the metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and the one or more alloantigens present in the allograft are administered to the recipient prior to allografting; and transplanting the allograft into the recipient.
The present invention includes isolated cell populations preconditioned to minimize graft versus host disease when transplanted into a recipient. The cell populations may be obtained by administering to the donor a metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and one or more alloantigens present in the recipient, wherein the metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, and the one or more alloantigens present in the recipient are administered to the donor prior to obtaining donor cells from the donor; and obtaining donor cells from the donor. The metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, may be administered in an amount effective to induce IDO expression in an IDO-competent subset of DCs. The metabolic breakdown product of tryptophan, or an analog of a metabolic breakdown product of tryptophan, may be administered in an amount effective to induce IDO expression in subpopulation of splenic DCs. Such preconditioned cell populations can be used in a number of immunotherapies, including, for example, for the prevention of GVHD, to decrease the likelihood of rejection of an allograft or xenotransplanted tissue or organ, or the treatment of autoimmune diseases.
The present invention includes the use of inhibitors of GCN2 to prevent the development or reactivation of Tregs by IDO. The protein kinase GCN2 (also referred to as “General Control Nonderepressible 2,” “eIF2AK4,” and “eukaryotic translation initiation factor 2 alpha kinase 4”) has been shown to play a role in the induction of proliferative arrest and anergy of CD8+ T cells in the presence of IDO+ DCs (see Munn et al., Immunity 2005; 22:1-10). Specifically, Munn et al. demonstrated that in order for IDO to mediate the proliferative arrest and anergy of effector T cells, the cells need GCN2. Thus, GCN2 is downstream in the pathway of IDO effects and inhibiting the function of GCN2 with an inhibitory agent should result in blockade of the inhibitory effect of IDO on the effector T cells. Example 1 describes that the expression of IDO by human DCs induces the differentiation of naïve CD4+ T cells into Tregs, and that this is mediated by Trp metabolites such as Kynurenine. It has also been shown that the combined effects of Trp depletion and Trp catabolites induces naïve T cells to acquire a regulatory phenotype, and that this mechanism was mediated by GCN2, since T cells from GCN2 knockout animals did not develop the regulatory phenotype (Fallarino et al., J Immunol 2006; 176:6752-6761). Examples 2 and 3 provide evidence showing that reactivation of pre-existing Tregs by IDO expressed in DCs requires GCN2. Thus, targeting GCN2 kinase with inhibitory agents can serve as an alternative to direct IDO inhibition (see, also, Muller and Scherle, Nature Reviews Cancer 2006; 6:613). Thus, GCN2 has been implicated in mediating the effects of IDO in various cell types, including, but not limited to, effector CD8+ T cells and naïve CD4+ T cells. Inhibitors of GCN2 may be used to bypass or replace the need for IDO inhibitors. The present invention includes any of the various methods described herein, in which an IDO inhibitor is replaced by or supplemented with a GCN2 inhibitor. Candidate GCN2 inhibitors, include, for example, a GCN2 blocking peptide, an antibody to GCN2 (both commercially available, for example, from Bethyl, Inc., Montgomery, Tex.) and small molecule inhibitors (including, for example, those discussed by Muller and Scherle, Nature Reviews Cancer 2006; 6:613).
The present invention includes methods to enhance an immune response in a subject by administering an effective amount of an inhibitor of a GCN2 kinase. With such a method a vaccine may also be administered, either simultaneously or shortly before or after the administration of an inhibitor of GCN2. The present invention includes methods to enhance the immune response in a subject to a vaccine antigen by administering to the subject the vaccine antigen, a CpG oligonucleotide (ODN), and an inhibitor of GCN2. The present invention also includes methods to enhance the immune response in a subject to a vaccine antigen by administering to the subject the vaccine antigen and an inhibitor of GCN2.
The present invention includes methods to prevent immune suppression mediated by Tregs with the administration of an effective amount of an inhibitor of a GCN2 kinase. The present invention also includes methods to enhance an immune response in a subject by administering two or more agents selected from an inhibitor of indoleamine-2,3-dioxygenase (IDO), a CpG oligonucleotide (ODN), an inhibitor of a GCN2 kinase, a vaccine, and/or a chemotherapeutic agent.
The present invention also includes methods to prevent immune suppression mediated by Tregs with the administration of two or more agents selected from an inhibitor of indoleamine-2,3-dioxygenase (IDO), a CpG oligonucleotide (ODN), an inhibitor of a GCN2 kinase, a vaccine, and/or a chemotherapeutic agent.
The present invention includes compositions including one or more inhibitors of GCN2. In some embodiments, such a composition may also include one or more additional active agents, including, for example, one or more IDO inhibitors, one of more TLR agonists, such as for example, one or more CpG oligonucleotides (ODN), one or more antigens, one or more metabolic breakdown products of tryptophan, one or more analogs of a metabolic breakdown product of tryptophan, or one or more chemotherapeutic agents. Chemotherapeutic agents include, for example, an antineoplastic chemotherapy agent, including, but not limited to, cyclophosphamide, methotrexate, fluorouracil, doxorubicin, vincristine, ifosfamide, cisplatin, gemcytabine, busulfan (also known as 1,4-butanediol dimethanesulfonate or BU), ara-C (also known as 1-beta-D-arabinofuranosylcytosine or cytarabine), adriamycin, mitomycin, cytoxan, methotrexate, or a combination thereof. Additional therapeutic agents also include cytokines, including, but not limited to, macrophage colony stimulating factor, interferon gamma, granulocyte-macrophage stimulating factor (GM-CSF), flt-3, an antibiotic, antimicrobial agents, antiviral agents, such as AZT, ddI or ddC, and combinations thereof.
As used herein “treating” or “treatment” includes both therapeutic and prophylactic treatments. Desirable effects of treatment include preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
The agents of the present invention can be administered by any suitable means including, but not limited to, for example, oral, rectal, nasal, topical (including transdermal, aerosol, buccal and sublingual), vaginal, parenteral (including subcutaneous, intramuscular, intravenous and intradermal), intravesical, or injection into or around the tumor.
For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intraperitoneal, and intratumoral administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure (see for example, “Remington's Pharmaceutical Sciences” 15th Edition). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required by the FDA.
For enteral administration, the inhibitor may be administered in a tablet or capsule, which may be enteric coated, or in a formulation for controlled or sustained release. Many suitable formulations are known, including polymeric or protein microparticles encapsulating drug to be released, ointments, gels, or solutions which can be used topically or locally to administer drug, and even patches, which provide controlled release over a prolonged period of time. These can also take the form of implants. Such an implant may be implanted within the tumor.
Therapeutically effective concentrations and amounts may be determined for each application herein empirically by testing the compounds in known in vitro and in vivo systems, such as those described herein, dosages for humans or other animals may then be extrapolated therefrom.
An agent of the present invention may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions and methods.
With the present invention, the stimulation or inhibition of an immune response may be measured by any of many standard methods well known in the immunological arts. As used herein, a mixed leukocyte response (MLR) is a well-known immunological procedure, for example, as described in the examples herein. As used herein, T cell activation by an antigen-presenting cell is measured by standard methods well known in the immunological arts. As used herein, a reversal or decrease in the immunosuppressed state in a subject is as determined by established clinical standards. As used herein, the improved treatment of an infection is as determined by established clinical standards. The determination of immunosuppression mediated by an antigen presenting cell expressing indoleamine-2,3-dioxygenase (IDO) includes the various methods as described in the examples herein.
With the methods of the present invention, the efficacy of the administration of one or more agents may be assessed by any of a variety of parameters well known in the art. This includes, for example, determinations of an increase in the delayed type hypersensitivity reaction to tumor antigen, determinations of a delay in the time to relapse of the post-treatment malignancy, determinations of an increase in relapse-free survival time, determinations of an increase in post-treatment survival, determination of tumor size, determination of the number of reactive T cells that are activated upon exposure to the vaccinating antigens by a number of methods including ELISPOT, FACS analysis, cytokine release, or T cell proliferation assays.
As used herein, the term “subject” includes, but is not limited to, humans and non-human vertebrates. Non-human vertebrates include livestock animals, companion animals, and laboratory animals. Non-human subjects also include non-human primates as well as rodents, such as, but not limited to, a rat or a mouse. Non-human subjects also include, without limitation, chickens, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, mink, and rabbits. As used herein, the terms “subject,” “individual,” “patient,” and “host” are used interchangeably. In preferred embodiments, a subject is a mammal, particularly a human.
As used herein “in vitro” is in cell culture and “in vivo” is within the body of a subject.
As used herein, the term “pharmaceutically acceptable carrier” refers to one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal.
As used herein, the term “isolated” as used to describe a compound shall mean removed from the natural environment in which the compound occurs in nature. In one embodiment isolated means removed from non-nucleic acid molecules of a cell.
Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
In some embodiments, an “effective amount” of an agent is an amount that results in a reduction of at least one pathological parameter. Thus, for example, in some aspects of the present invention, an effective amount is an amount that is effective to achieve a reduction of at least about 10%, at least about 15%, at least about 20%, or at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, compared to the expected reduction in the parameter in an individual not treated with the agent.
The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
Human plasmacytoid dendritic cells (PDCs) can prime allogeneic naïve CD4+ T cells to differentiate into CD4+CD25+Foxp3+ regulatory T cells (Tregs). However, the molecular mechanism(s) underlying PDC-induced CD4+ Treg generation is unknown. This example shows that human PDCs express high levels of indoleamine 2,3-dioxygenase (IDO) protein. Triggering Toll-like receptor 9 with CpG oligodeoxynucleotides activates PDCs to sustain IDO expression and upregulate T-cell costimulatory molecules. Blocking IDO activity with its pharmacologic inhibitor 1-methyl-D-tryptophan (1MT) significantly abrogates PDC-induced CD4+ Treg generation and converts to the generation of alloreactive T cells. Adding kynurenine (KYN), an immediate downstream metabolite of tryptophan that is generated by IDO, bypasses the 1MT effect, and restores PDC-induced CD4+ Treg generation. This example demonstrates that the IDO pathway is essential for PDC-induced CD4+ Treg generation, and implicates generation of KYN pathway metabolites as the critical molecular mediator of this process.
PDC, B, and T cell isolation. Human PBMC were isolated under IRE-approved protocols from apheresis products of healthy blood donors (Memorial Blood Centers of Minnesota, Minneapolis, Minn.) by Ficoll-Paque density gradient centrifugation. Plasmascytoid dendritic cells (PDCs) were isolated from PBMC using BDCA-4 cell isolation kits and the MACS system, followed by staining and sorting to collect purified Lin-CD11c-CD123+ PDCs, as reported previously (Moseman et al., J Immunol 2004; 173:4433-4442). CD4+CD45RA+ naïve T cells were isolated from PBMC using CD4 T cell isolation kits followed by positive selection with CD45RA microbeads. The purity of naïve CD4+ T cells was greater than 95% for CD4+CD45RA+ expression and less than 0.5% for CD25+ expression. B cells were isolated from PBMC with CD19 microbeads and the MACS system to greater than 98% purity of CD19+ B cells. All cell isolations kits and microbeads were from Miltenyi Biotec (Bergisch Gladbach, Germany).
Reagents. Phosphorothioate-modified type-A CpG ODN 2216: gGGGACGATCGTCgggggG (SEQ ID NO:2), type-B CpG ODN 2006: tcgtcgttttgtcgttttgtcgtT (SEQ ID NO:3) (sequences are shown 5′-3′; small letters represent phosphorothioate linkage; capital letters represent phosphodiester linkage 3′ of the base; bold represents CpGdinucleotides) were from Integrated DNA Technologies (Coralville, Iowa), diluted in PBS, and used at a final concentration of 1 microgran per milliliter (μg/ml). 1-methyl-D-tryptophan (1MT, Sigma-Aldrich) was used at a final concentration of 250 micromolar (μM). Kynurenine (L-KYN, Sigma-Aldrich) was used at a final concentration of 50 μM.
In vitro priming of naive CD4+ T cells. CD4+CD45RA+ naive T cells were primed with allogeneic PDCs or irradiated B cells (30 Gy) at a 10:1 ratio (e.g., 2×106 naive CD4+ T cells plus 2×105 PDCs per well in 24-well plates) with ODN 2216 or ODN 2006 present in RPMI 1640 medium supplemented with 10% human AB serum. 1 MT and/or KYN were added into CpG ODN-PDC or CpG ODN-B cell mediated naive CD4+ T cell priming cultures as indicated. In some experiments, blocking Abs against CD80, CD86, HLA-DR or the control IgG Ab (R&D Systems, Minneapolis, Minn.) were added to CpG-PDC-mediated naive CD4+ T cell priming cultures at a final Ab concentration ranging from 0.1 to 10 μg/ml. After 7 days, primed T cells in cultures were harvested, assessed for their surface phenotype, intracellular Foxp3 expression, and their function in MLR assays.
Flow Cytometry. Fluorescent antibodies (Abs) against human CD3, CD4, CD11c, CD19, CD25, CD40, CD45, CD45RA, CD45RO, CD80, CD86, CD123, HLA-DR, lineage (Lin) markers, and isotype control Abs were from BD Biosciences (San Diego, Calif.). PE-conjugated anti-human Foxp3 staining set (PCH101) was from eBiosciences (San Diego, Calif.) and used per manufacture's instruction. Mean fluorescence intensity (MFI) and positive cell percentages of stained cells were determined by flow cytometry.
Western blots. Protein lysates were prepared from 2×105 fresh or cultured PDCs or B cells. Western blot was performed with antibody specific for IDO protein
MLR assays. The function of CpG-PDC or CpG-B cell primed CD4+ T cells with or without 1MT and/or KYN were determined by plating the primed T cells at graded doses as responders to irradiated allogeneic PBMC in MLR cultures or as third-party T cells into MLR cultures where freshly purified autologous or allogeneic naive CD4+ T cells were stimulated with irradiated allogeneic PBMC. In all T cell proliferation assays, plates were incubated at 37° C. for 5 days and pulsed with 1 μCi of 3H-thymidine per well for the last 18 hours before harvesting. All determinations were carried out in triplicate and 3H-thymidine incorporation was determined.
Data analysis. Data from experiments are expressed as the mean±SD. Statistical analysis of the results between groups was performed by student's t test. Values of p<0.05 were considered significant.
CD4+ Treg generation requires HLA-DR and CD80/86 expression on PDCs. It has been previously shown that CpG ODN promotes PDC-mediated priming of allogeneic naïve CD4+ T cells to differentiate into CD4+CD25+Foxp3+ Tregs (Moseman et al., 2004 J Immunol 173:4433-4442). Freshly isolated human PDCs from peripheral blood express very low levels of T-cell costimulatory molecules such as CD80 and CD86. Triggering TLR9 by type-A (2216) or type-B (2006) CpG ODN rapidly activates PDCs to upregulate cell surface expression of CD80, CD86 molecules and HLA-DR antigens (
Both Abs against CD80/CD86 or HLA-DR antigens effectively abrogated the capability of CpG ODN-activated PDCs (CpG-PDCs) to induce CD4+CD25+Foxp3+ Tregs, whereas control IgG Ab had no significant effect on CpG-PDC-induced CD4+ Tregs (
It has been suggested that immature DCs prime T cells to differentiate into suppressor/regulatory T cells, whereas mature DCs prime T cells for an effector-type immune response. However, this example demonstrates that CpG ODN-activated PDCs are phenotypically mature, yet remain tolerogenic and can induce CD4+ Tregs. Therefore, the capacity of PDCs to induce Tregs could not be attributed to their maturation stage, but rather to some intrinsic property of PDCs.
PDCs employ the IDO pathway to induce CD4+ Treg generation. Recent studies have highlighted the role of IDO as a potential mechanism of tolerance and immunosuppression (Mellor and Munn, 2004 Nat Rev Immunol 4:762-774; and Grohmann et al., 2003 Trends Immunol 24:242-248). However, it was not known whether human PDCs expressed IDO, or used the IDO pathway of immunosuppression. Western blots using antibody against an N-terminal peptide of human IDO (Munn et al., Science 2002; 297:1867-1870) demonstrated that freshly isolated human PDCs expressed readily detectable levels of IDO protein (
To determine if IDO was mechanistically involved in generation of Tregs by PDCs, 1-methyl-D-tryptophan (1MT), a pharmacologic inhibitor of IDO enzymatic activity, was added to MLRs containing CpG ODN, PDCs plus naive allogeneic CD4+ T cells. It has been previously shown that CD4+ T cells primed in this system acquire characteristics of Tregs, being hyporesponsive to secondary alloantigen stimulation and strongly inhibiting the proliferation of autologous or allogeneic CD4+ T cells in secondary MLR cultures (Moseman et al., 2004 J Immunol 173:4433-4442). The addition of 1MT to priming MLRs had insignificant effects on the expression of cell surface maturation markers by PDCs (CD80, CD86, HLA-DR) (
Addition of 1 MT to the priming MLRs prevented CD4+ T cells from becoming anergic/hyporesponsive to subsequent alloantigen stimulation (
Downstream metabolites generated by IDO are critical for Treg induction. IDO degrades the essential amino acid Tryp to KYN, which is then metabolized by other enzymes to subsequent metabolites along the KYN pathway (Stone et al., Nat Rev Drug Discov 1:609-620). This example explores the mechanistic role of KYN pathway metabolites in the generation of Tregs by adding exogenous KYN to priming MLRs and bypassing the effect of 1 MT and restoring Treg generation (diagrammed in
These findings thus demonstrate that the effect of IDO on Treg generation can be reproduced by exogenous KYN when endogenous IDO is blocked, and implicate KYN pathway metabolites as the mechanism of IDO-induced Treg generation (
Indoleamine 2,3 dioxygenase (IDO) activity mediates T cell suppressive effects in inflammatory conditions associated with a diverse range of clinical syndromes. When induced to express IDO specific subsets of dendritic cells acquire potent T cell suppressive functions. This example shows that induced IDO activity also stimulates CD4+CD25+ regulatory T cells (Tregs) to acquire increased T cell suppressor functions. After treating mice with TLR9 ligands to induce IDO purified splenic Tregs rapidly acquired potent suppressor functions that blocked allospecific T cell responses elicited in vitro and in vivo. Genetic or pharmacologic ablation of IDO prevented stimulation of Treg suppressor functions. Moreover, Tregs selectively expressed the GCN2-dependent inducible stress response protein CHOP following IDO induction, and this response was also IDO-dependent. These findings indicate the hypothesis that IDO rapidly stimulates peripheral Tregs to acquire potent suppressive functions via activation of the GCN2-kinase mediated stress response to amino acid withdrawal.
Mice. All mice were bred in a specific pathogen-free facility. BM3 TCR transgenic mice IDO-deficient (IDO-KO) and GCN2-deficient (GCN2-KO) mice were described previously (Mellor et al. J Immunol 2005; 175:5601-5605; Munn et al. Immunity 2005; 22:1-10). All procedures involving mice were approved by the Institutional Animal Care and Use Committee.
CpG Oligonucleotides. CpG-ODNs (CpG no. 1826, TCCATGACGTTCCTGACGTT; (SEQ ID NO:4) and sequence matched non-CpG-B no. 2138, TCCATGAGCTTCCTGAGCTT (SEQ ID NO:5)) with fully phosphorothioate backbones were purchased from Coley Pharmaceuticals. Mice were injected with relatively high doses of ODNs (50 μg/mouse, i/v) as described (Mellor et al. J Immunol 2005; 175:5601-5605).
1-methyl-[D]-tryptophan (1 mT). 1 mT (catalog number 45, 248-3, Sigma) was prepared as a 20 mM stock solution in 0.1 N NaOH, adjusted to pH 7.4, and stored at −20° C. protected from light. For in vitro use, 1 mT was added to MLRs to a final concentration of 100 μM. For in vivo treatment, slow-release polymer pellets (*5 mg/day) containing 1 mT or vehicle alone were inserted under the dorsal skin as described (Munn et al. Science 1998; 281:1191-1193) 24 hours before CpG treatment.
Preparative flow cytometry to sort CD4+ T cells subsets. CD4+ T cell subsets were purified using a Mo-Flo cytometer as described (Mellor et al. J Immunol 2005; 175:5601-5605; Munn et al. Immunity 2005; 22:1-10).
Analytical flow cytometry. Intracellular CHOP staining was performed as described (Munn et al. (2005) Immunity 22:1-10), using antibody sc-7351 (Santa Cruz Biotechnology, Santa Cruz, Calif.).
Ex vivo T cell suppression assays. Suppression assays were performed by adding sorted CD4+ cells to T cell proliferation assays (72 hour thymidine incorporation assays) containing responder H-2Kb-specific splenocytes from BM3 TCR transgenic mice (nylon-wool enriched) and CD11c+ splenocytes (AutoMacs enriched) from CBK (H-2Kb transgenic CBA) mice prepared as described (Mellor et al. J Immunol 2005; 175:5601-5605).
Co-Adoptive Transfer. Purified (Mo-Flo sorted) CD4+CD25+ Tregs were prepared from spleens of CBK donor mice treated 24 hours previously with either 50 μg CpG or non-CpG. Tregs (1×106/recipient) were mixed with nylon-wool enriched BM3 responder T cells (5×106/recipient) and co-injected into CBK recipients (2-3 mice/group). Positive controls were CBK mice receiving BM3 T cells without Tregs; negative controls were CBA mice (lacking target antigen) receiving BM3 T cells. After 96 hours, mice were sacrificed and spleen cells stained with antibodies against CD8 (PerCP), CD25 (APC), H2Kb (PE) and biotinylated Ti98 (BM3 anti-clonotypic antibody, visualized with streptavidin APC (Tarazona et al. (1996) International Immunology 8:351-358). Except for Ti98, all antibodies were from Pharmingen (San Diego, Calif.).
TLR9 ligands rapidly enhance Treg suppressor functions. To test if IDO activity enhanced Treg suppressor functions, mice were treated with relatively high systemic doses of TLR9 ligands (CpG), which induces splenic pDCs expressing CD19 (CD19+ pDCs) to express functional IDO. Following CTLA4-Ig or TLR9 ligand treatment, CD19+ pDCs acquired potent and dominant T cell suppressive functions that blocked CD8+ T cell responses elicited in vitro and in vivo (Mellor et al. Int Immunol 2004; 16:1391-1401; Baban et al. Int Immunol 2005; 77:909-919; Mellor et al. J Immunol 2005; 115:5601-5605; Mellor et al. J Immunol 2003; 171:1652-1655). Closely related CD19+ pDCs with IDO-dependent T cell suppressive properties also accumulated in lymphoid tissues draining sites of B16 melanoma tumor growth in mice (Munn et al. J Clin Invest 2004; 114:280-290).
Purified Tregs from mice treated for 24 hours with TLR9 ligands (CpG #1826) suppressed proliferation of BM3 (H-2Kb-specific) CD8+ T cells when ≧5×103 sorted Tregs were added to cultures containing BM3 T cells and APCs expressing H-2Kb (
TLR9 ligands stimulate Treg suppressor activity by inducing, functional IDO expression. To test if the stimulatory effects of in vivo CpG treatment on Treg suppressive functions were IDO-dependent, CpG was administered to IDO-deficient (IDO-KO) or wild type (IDO-WT) mice and tested if Tregs acquired increased suppressive functions. Purified Tregs isolated from IDO-KO mice exposed to CpG or non-CpG exhibited no significant increase in suppressor functions (
An alternative approach was used to determine that IDO was essential for TLR9-mediated stimulation of Treg suppressive functions by treating IDO-WT mice with the pharmacologic IDO-inhibitor, 1-methyl-(D)-tryptophan (1 mT) 24 hours before exposing them to CpG. As shown in
IDO-activated Tregs suppress alloreactive T cell responses elicited in vivo. Next, whether IDO-activated Tregs suppressed tissue destruction mediated by alloreactive T cells was assessed by co-injecting purified Tregs and splenocytes from BM3 TCR transgenic mice into recipient mice expressing H-2Kb alloantigen (
Tregs respond selectively to induced IDO by undergoing the GCN2-dependent stress response. It has recently been reported that IDO activated the GCN2-kinase dependent integrated stress response in naïve effector T cells blocking clonal expansion and differentiation in response to antigenic stimulation, which lead to T cell apoptosis and anergy (Munn et al. Immunity 2005; 22:1-10). As IDO also stimulates suppressive functions in Tregs, if IDO activated GCN2-kinase in Tregs was addressed by assessing CHOP expression, a downstream inducible gene controlled by GCN2-kinase (Munn et al. Immunity 2005; 22:1-10; Dong et al. Mol Cell 2000; 6:269-279; Harding et al. Mol Cell 2003; 11:619-633; Wek et al. (Biochem Soc Trans 2006; 34:7-11). Following CpG treatment, <1% of total splenocytes expressed CHOP, and all CHOP+ cells expressed CD4 (
This example shows that IDO activity stimulated rapid increase of Treg suppressor functions and activated the GCN2 stress response selectively in Tregs. Following IDO induction, Tregs suppressed robust alloreactive T cell responses elicited ex vivo and in vivo under conditions where Tregs from mice treated with control reagents (non-CpG) exhibited no detectable suppressor activity. These findings provide a potential explanation for the potent IDO-dependent suppressive effects of CD19+ pDCs, which constitute less than 10% of total splenic DCs (Baban et al. Int Immunol 2005; 17:909-919; Mellor et al. J Immunol 2005; 175:5601-5605). Hence, as well as direct suppression of effector T cell responses, CD19+ pDCs expressing IDO may also activate the suppressive functions of quiescent Tregs to promote bystander suppression. However, an alternative possibility is that TLR9 ligands acted directly to induce IDO expression in Tregs, as Tregs express TLRs (Wang et al. Semin Immunol 2006; 18:136-142), and T cells can be induced to express IDO in some circumstances (Curreli et al. Journal of Interferon and Cytokine Research 2001; 21:431-437; Boasso et al. Blood 2005; 105:1574-1581). Though we cannot exclude this possibility completely, quantitative RT-PCR analyses of RNA samples from purified Tregs revealed that CpG treatment did not induce IDO transcription in Tregs, suggesting that Tregs themselves were not the source of IDO activity that triggered increased suppressor functions.
The observations that CpG treatment induced selective CHOP expression in almost all splenic Tregs, and that this response did not occur in Tregs from IDO-KO mice, suggest that IDO-mediated tryptophan catabolism caused selective activation of the GCN2-dependent stress response to amino acid withdrawal in Tregs. The selectivity of this response was particularly striking because the GCN2-dependent stress response is a generalized response to amino acid withdrawal exhibited by all cell types (Wek et al. Biochem Soc Trans 2006; 34:7-11). Thus, additional signals may control the selective response of Tregs to IDO induction in the splenic microenvironment. Tregs might also require simultaneous TCR signals via recognition of constitutively expressed self-antigens on splenic APCs in order to activate suppressor functions (Hsieh et al. Immunity 2004; 21:267-277). It is unclear if an intact GCN2-kinase stress response is required for Tregs to acquire increased suppressor functions following IDO induction. Although GCN2-KO mice possess peripheral Tregs, the proportion of Tregs within the CD4+ T cell compartments is substantially reduced relative to wild-type mice (˜10 fold less), suggesting that Treg development and survival may be impaired in GCN2-KO mice.
Freshly isolated Tregs possess relatively weak suppressor functions, which increase significantly following mitogenic and antigenic activation (Thornton et al. Eur Immunol 2004; 34:366-376; Nishikawa et al. J Exp Med 2005; 201:681-686; Yu et al. J Immunol 2005; 174:6772-6780). However, increased Treg suppressor activity takes some time to manifest, probably due to requirements for Treg proliferation and/or differentiation after TCR ligation. Moreover, Treg suppressor activity is antagonized by signals from activated DCs and TLR8 (Pasare and Medzhitov Science 2003; 299:1033-1036; Peng et al. Science 2005; 309:1380-1384). This example detected increased Treg suppressor activity as soon as 18 hours after mice were treated with TLR9 ligands. This suggests that Treg proliferation was not required for enhanced suppressor activity in our experimental system, and that the well documented immunostimulatory effects of TLR9 ligation were subordinate to the enhanced suppressive functions acquired by Tregs following IDO induction. It has been suggested that Tregs expressing surface CTLA4 might suppress T cell responses by inducing IDO via ligation of B7 (CD80/86) molecules expressed by DCs (Mellor et al. Int Immunol 2004; 16:1391-1401, Finger and Bluestone Nat Immunol 2002; 3:1056-1057; Fallarino et al. Nat Immunol 2003; 4:1206-1212). In the present example, IDO inhibitor did not block Treg suppression measured ex vivo, indicating that IDO was not mechanistically required for Treg-mediated suppression following IDO-dependent stimulation in vivo.
In summary, this example demonstrates that 100 triggers a rapid increase in suppressor functions of splenic Tregs. Clearly, IDO is not the only mechanism capable of activating Treg suppressor functions, especially as IDO-KO and GCN2-KO mice do not succumb to the lethal phenotype of Treg-deficient mice. However, the significance of the present study is that it identifies a novel checkpoint at which the Treg system can be regulated. This example also provides a mechanistic explanation for potent bystander suppression created by minor cohorts of 100+ pDCs (Munn et al. J Clin Invest 2004; 114:280-290; Mellor et al. J Immunol 2003; 171:1652-1655). Thus, this example study identifies a mechanism that amplifies the direct suppressive effects of IDO+pDCs by stimulating the suppressor functions of Tregs.
A subset of dendritic cells (DCs) in tumor-draining lymph nodes can express the immunoregulatory enzyme indoleamine 2,3-dioxygenase (IDO). This example shows that IDO expression by these DCs directly activates potent suppressor activity in regulatory T cells (Tregs). This IDO-induced form of activation affected only mature, CD4+CD25+Foxp3+ Tregs, and did not cause differentiation of new Tregs from precursor cells. IDO induced freshly-isolated, resting Tregs to become potently suppressive for bystander cells without the need for exogenous mitogen or in vitro pre-activation. IDO-induced activation showed a strict requirement for interaction of Tregs with MHC molecules on the IDO+ DCs, required an intact GCN2 kinase pathway in the Tregs, and caused Treg-mediated target cell suppression in a non-contact-dependent fashion requiring interleukin-10 and TGFβ. This example indicates that IDO-induced Treg activation allows the local immunosuppressive effects of IDO+ DCs in tumor-draining lymph nodes to be amplified and extended to contribute to systemic tolerance.
Mice and Reagents. Reagents were from Sigma unless otherwise noted. 1-methyl-D-tryptophan (catalog number 45, 248-3, Sigma) was prepared as described (Munn et al., Immunity 2005; 22:633-642). Details of the various transgenic and knockout mouse models are given below.
Isolation of tumor-draining lymph node DCs. Tumors were initiated using 1×106 B78H1.GM-CSF cells (a sub-line of B16 melanoma transfected with GM-CSF (Huang et al., Science 1994; 264:961-965) implanted in thigh of either B6 mice or IDO-KO mice on the B6 background, as described (Munn et al., J. Clin. Invest. 2004; 114:280-290). Inguinal LNs were removed for cell sorting. IDO+ DCs were enriched using high-speed MoFlo cell-sorting for CD11c+B220+ cells as previously described (Munn et al., J. Clin. Invest. 2004; 114:280-290).
Bystander-suppression assays. All experiments were repeated 3-5 times unless otherwise indicated. OT-I cells were sorted as CD8+ spleen cells, gated on the CD11cNEGB220NEG fraction to exclude DCs. Sorted DCs from TDLN were mixed with 1×105 responder cells at a 1:40 ratio in V-bottom culture wells (Nunc). Sorted CD4+CD25+ Tregs (typically 90% Foxp3+) were added at 5000 per well unless otherwise specified. Sorted CD4+ A1 cells (1×105) and CD11c+ DCs (1:40 ratio) from normal CBA spleen were added as bystander cells. All assays received 100 nM OVA peptide SIINFEKL (SEQ ID NO:1) and 100 nM H—Y peptide REEALHQFRSGRKPI (SEQ ID NO:6) (Zelenika et al., J. Immunol. 1998; 161:1868-1874). Some wells received one or more of the following: 200 uM 1MT; rat anti-IL-10-receptor neutralizing antibody (Pharmingen, clone 1B1.3a); or chicken anti-TGF-β, -β2, -β3 antibody (R&D Systems, MAB1835). For transwell assays, 96-Multiwell insert plates (1 uM pore size, BD Falcon) were used and the number of cells in all groups was doubled.
Feeder layer. Plasmacytoid DCs and Tregs have been reported to require survival factors to maintain viability and function in vitro. Therefore, as a feeder layer for these cells we added T cell-depleted spleen cells (1×105 sorted CD4NEGCD8NEG cells) to all assays, similar to other culture systems (Thornton et al., Eur. J. Immunol. 2004; 34:366-376). This feeder layer was necessary for Treg function but it was entirely nonspecific, in that it could be derived from any host regardless of MHC haplotype (H2b or H2k) or strain background (B6, CBA, Balb/c or 129), and could be from GCN2-KO, IDO-KO or Foxp3-KO mice. The feeder layer could also be fully replaced by a cocktail of recombinant cytokines (IFNα+IL-10+TGFβ), chosen for their published ability to support survival of pDCs and Tregs. Thus, the function of the feeder layer was supportive only.
Readouts for T cell proliferation. For CFSE assays, sorted A1 and OT-I cells were labeled with CFSE dye as previously described (Munn at al., Immunity 2005; 22:633-642). After 72 hours, assays were stained for CD4 vs CD8 and CFSE fluorescence analyzed gated on CD4+ (A1) and CD8+ (OT-I) populations. Because the bystander assays were high-density and crowded (2×105 TCR-transgenic T cells proliferating in 200 ul medium), they could not support more than 2-3 rounds of cell division without feeding or subculturing. However, this was sufficient to unambiguously determine which populations were dividing and which were arrested.
Thymidine-incorporation assays were more quantitative than CFSE for performing titrations and comparing multiple groups. However, thymidine incorporation could not distinguish whether one or both responder populations were proliferating; and, like CFSE assays, the proliferating cells tended to plateau at some maximum achievable value per well, regardless of whether one or both populations were proliferating. However, in cases where all thymidine incorporation was inhibited (which was the readout of interest) then this unambiguously revealed that suppression of both populations had occurred. Differences between groups (suppression vs. no suppression) were significant at P<0.01 by ANOVA, and are shown by arrows in the figures.
Anti-CD3 proliferation and preactivation assays. For anti-CD3-induced Treg activity, bystander-suppression assays were performed using higher numbers of Tregs (up to 1:1 ratio of Tregs to bystander cells, instead of 1:20) and with the addition of 0.1 ug/ml αCD3 antibody (Pharmingen, clone 145-2C11). For pre-activation studies, 2×104 Tregs were cultured with 1×105T-depleted spleen cells plus 0.1 ug/ml αCD3 antibody and 200 U/ml IL-2 (R&D Systems) for 48 hours. Activated Tregs were fragile, so they were gently pipetted and transferred without washing into readout MLRs comprising 1×105 sorted CD8+BM3 T cells (TCR-transgenic, anti-H2Kb) plus 1×105 irradiated B6 spleen cells. Recovered Treg number approximated the initial starting number, and data are presented in all cases as the nominal starting number of Tregs. BM3 T cells already have a high affinity for their cognate antigen, and validation studies showed that there was no further effect on the readout assay from the ecCD3 used to pre-activate the Tregs.
Flow cytometry. Details of the staining protocols are given below. For CHOP and Foxp3 staining, assays were set up without the A1 bystander cells, so that the Tregs were the only CD4+ cells in the system and thus could be unambiguously followed throughout the assay.
Adoptive transfer and ex-vivo Treg assay. The adoptive transfer model has been previously described (Munn et al., Immunit), 2005; 22:633-642; and Munn et al., J. Clin. Invest. 2004a; 114; 280-290). Briefly, DCs were sorted from TDLNs (total CD11c+ cells), pulsed with SIINFEKL (SEQ ID NO:1) peptide, and 5×104 DCs injected into anteriomedial thigh. For studies measuring ex vivo Treg suppressor activity, the recipient mice were pre-loaded with 5×106 sorted CD8+ T-I cells. After four days, the inguinal LNs draining the site of DC injection were removed, and the CD4+CD25+ Tregs were isolated by FACS sorting. A titration of Tregs was added to readout assays, comprising CD4+ A1 cells, CBA DCs, feeder layer, and H—Y peptide, all as described above. For CFSE proliferation studies, CD8+ OT-I (wild-type or GCN2-KO background) were sorted, labeled with CFSE, and 5×106 cells injected intravenously into wild-type or GCN2-KO recipients. OVA-pulsed DCs from TDLNs were injected as above, and the inguinal (draining) LNs harvested after four days. LN cells were analyzed by FACS for CD8 vs 1B11 vs CFSE.
Mouse models. All animal studies were approved by the institutional animal use committee of the Medical College of Georgia. TCR-transgenic OT-I mice (CD8+, recognizing the SIINFEKL (SEQ ID NO:1) peptide of chicken ovalbumin in the context of H2Kb (Hogquist et al., Cell 1994; 76:17-27) and CHOP-KO (B6.129S-Ddittm1Dron/J (Zinszner et al., 1998; Genes Dev 12:982-995)), both on the B6 background, were purchased from Jackson Laboratories (Bar Harbor, Me.). GCN2-KO mice inbred on the B6 background have been previously described (Munn et al., Immunity 2005; 22:633-642). OT-I mice bred onto the GCN2-KO background have been previously described (Munn et al., Immunity 2005; 22:633-642), and for this study were re-bred onto a pure B6 background. A1 mice (CBA background, anti-HY peptide) (Zelenika et al., J. Immunol. 1998; 161:1868-1874), BM3 (CBA background, anti-H2Kb (Tarazona et al., Int. Immunol. 1996; 8:351-358)) and IDO-KO mice (B6 and CBA backgrounds (Baban et al., Int. Immunol. 2005; 17:909-919; and Mellor et al., J. Immunol. 2003; 171:1652-1655)) were as described. H2-M mutant mice inbred on the B6 background were as previously described (Martin et al., Cell 1996; 84:543-550).
FAGS staining. Antibodies were from BD-Pharmingen unless otherwise noted. Anti-mouse CD25-APC conjugate (clone PC61, cat. #17-0251-81) was from eBioscience: This conjugate gave brighter signal and better separation of CD25+ cells than other conjugates from other suppliers. For intracellular staining of CHOP, live cells were first blocked for 10 minutes with mouse Fc Block (BD Pharmingen) in 10% fetal calf serum medium, stained with anti-CD4-FITC for 30 minutes on ice, washed with PBS, then fixed and permeablized for 20 minutes in 250 ul Cytoperm/Cytofix solution (BD Pharmingen) on ice. All subsequent staining and wash steps were in BD Permwash solution. Fixed cells were stained with 1:100 dilution of monoclonal anti-gadd153/CHOP (sc-7351, Santa Cruz Biotechnology), washed, and stained with secondary monoclonal rat anti-mouse-IgG1-PE (#550083, BD Biosciences). This secondary antibody was selected because it did not cross-react with surface immunoglobulin on mouse B cells. For CHOP staining, assays were set up without A1 bystander cells, so that Tregs were the only CD4+ cells, and thus could be unambiguously followed throughout the assay. For Foxp3 staining, anti-Foxp3-PE antibody (clone FJK-16s) was obtained from eBioscience and used per the manufacturer's protocol. For Foxp3 staining, assays omitted A1 bystander cells and Tregs were identified by CD4 expression, as for CHOP staining.
Activated Tregs create IDO-induced bystander suppression. Bystander suppression was measured using the system diagrammed in
Comparison of IDO-induced activation vs. mitogen-induced activation of Tregs. In the literature, most reports have used one of two strategies to activate Tregs: occasionally, transgenic Tregs were are activated with a defined cognate antigen (Lerman et al., J. Immunol. 2004; 173:236-244); or, more often, polyclonal Tregs were activated with a mitogen such as anti-CD3 (Fontenot et al., Immunity 2005; 22:329-341; McFhigh et al., Immunity 2002; 16: 311-323; and Wan and Flavell, Proc. Natl. Acad. Sci. USA 2005; 102:5126-5131). The key observation from these reports is that activation is obligatory: in the absence of mitogen or cognate antigen, freshly-isolated Tregs do not display suppressor activity (Nishikawa et al., J. Exp. Med. 2005; 201:681-686; and Thornton et al., Eur. J. Immunol. 2004; 34:366-376). In contrast, in the present system IDO allowed freshly-isolated, resting Tregs to display spontaneous suppressor activity without exogenous mitogen. In order to directly compare the IDO-induced form of Treg activation with mitogen-induced activation, titrations of Tregs in bystander assays were performed (
The quantitative level of αCD3-induced suppressor activity, although lower than that induced by IDO, was comparable to that reported in the literature for αCD3 and other mitogens (Fontenot et al., Immunity 2005; 22:329-341; and Wan and Flavell, Proc. Natl. Acad. Sci. USA 2005; 102:5126-5131). It has also been reported that the activity of resting Tregs can be increased by a period of in vitro pre-activation with αCD3 plus exogenous IL-2 (Thornton et al., Eur. J. Imnzunol. 2004; 34:366-376). To confirm that the starting Treg preparation was fully functional,
IDO acts directly on pre-existing Foxp3+ Tregs.
In some situations, Tregs themselves have been reported to trigger expression of IDO in certain DCs (Fallarino et al., Nat. Immunol. 2003; 4:1206-1212). To test whether activated Tregs in our system might exert their effect by causing IDO upregulation in the bystander (CBA) DCs, assays were performed using bystander DCs derived from IDO-knockout (IDO-KO) mice. As shown in
GCN2 kinase is required for IDO-induced activation of Tregs. As a molecular mechanism mediating the response to IDO, the GCN2 stress-kinase pathway was tested (
Further consistent with the hypothesis,
Bystander suppression is abrogated in CHOP-KO Tregs. To further test the hypothesis that IDO activated the GCN2 pathway in Tregs, a second point in the Integrated Stress Response (ISR) pathway downstream of GCN2 was targeted, to ask whether this produced a similar effect. For these studies, Tregs from mice deficient in the ISR-inducible transcription factor CHOP (Wek et al., Biochem. Soc. Trans. 2006; 34:7-11) were tested.
IDO-induced activation of Tregs requires contact with MHC. It has been previously shown that CHOP induction in CD8 T cells requires two signals: one delivered via the GCN2 pathway, and the second via the T cell receptor (TCR) pathway (Munn et al., Immunity 2005; 22:633-642). Therefore it was asked whether Tregs required signaling via their TCR in order to become activated by the IDO/GCN2 pathway. In
Tregs showed a similar strict requirement for interaction with MHC in order to create functional bystander suppression.
In theory, this MHC restriction might indicate only an interaction with the MHC framework elements, rather than actual antigen presentation. To test whether the peptide antigen presented by the MHC molecules also influenced Treg activation, H2-DM mutant mice were used. These mice have normal levels of cell-surface MHC-II (Martin et al., Cell 1996; 84:543-550), but the large majority of these molecules contain only the Class-II Associate Invariant-chain Peptide (CLIP), rather than the normal repertoire of peptide antigens. Tumors were grown in H2-DM−/− hosts, then H2-DM−/− pDCs were isolated from TDLNs and used as the IDO-expressing DCs in bystander-suppression assays. Control assays received TDLN pDCs from wild-type B6 mice. In all assays, the Tregs were from the same wild-type B6 donors.
Suppression by IDO-activated Tregs does not require cell-cell contact. Next it was asked whether IDO-activated Tregs required physical contact with their target bystander cells in order to suppress them. The molecular mechanism of Treg-mediated suppression is still controversial (reviewed by Wing et al., Int. Immunol. 2006; 18:991-1000; and Bluestone and Tang, Curr. Opin. Immunol. 2005; 17:638-642) but most in vitro studies have found that conventional suppressor activity by Foxp3+ Tregs is contact-dependent.
As shown in the top panel of
In contrast, conventional Treg activity (such as produced by αCD3) is reported to be contact-dependent (Wing et al., Int. Immunol. 2006; 18:991-1000). Therefore, whether one could discriminate αCD3-induced Treg activity in this system from IDO-induced Treg activity on the basis of contact dependence was addressed. Transwell experiments were performed as in
Further consistent with the hypothesis that the soluble factor mediating bystander suppression was not derived from IDO itself, the addition of excess tryptophan to bystander assays abrogated suppression (
Two specific soluble factors, IL-10 and TGFβ, have been implicated in certain forms of Treg-mediated suppression. Although not usually though to be involved in suppression by CD4+CD25+Foxp3+ (Wing et al., Int. Immunol. 2006; 18:991-1000), they are important in other types of regulatory T cell activity.
IDO+ DCs activate Tregs in vivo. To test whether IDO could activate Tregs in vivo, CD11c+ DCs were isolated from TDLNs and adoptively transferred into new hosts without tumors. Recipient mice had been pre-loaded with a population of OT-I T cells, and the DCs were pulsed with SIINFEKL (SEQ ID NO:1) antigen prior to adoptive transfer. Four days later, the endogenous host Tregs were isolated from the lymph nodes draining the site of DC injection, and tested for spontaneous suppressor activity in a readout assay consisting of A1 T cells stimulated by normal CBA DCs and H—Y peptide. Thus, all of these cell populations were similar to the bystander assay shown in
T cell inhibition by IDO+DC's in vivo is mediated by both host and target cell
GCN2. Finally, it was asked if there was evidence that IDO-activated Tregs were suppressive for T cells in vivo. To perform these studies, advantage was taken of the fact that GCN2-KO effector T cells (OT-I cells on the GCN2-KO background) were known to be refractory to direct suppression by IDO (Munn et al., Immunity 2005; 22:633-642). Although these cells were indifferent to IDO itself, it was found that they remained fully susceptible to Treg-mediated bystander suppression that was triggered by IDO (see
As shown in
As shown in
As shown in
The present example demonstrates that IDO+ DCs possess the ability to directly and rapidly activate the latent suppressor function of resting Tregs. This novel form of Treg activation was still TCR-driven (i.e., it was restricted on MHC expressed by the DCs), and it affected only mature, differentiated CD4+CD25+Foxp3+ (“natural”) Tregs. Thus, it resembled in some ways the conventional Treg activity reported in the literature (Wing et al., Int. Immunol. 2006; 18:991-1000). However, IDO-induced Treg activation did not require mitogens such as anti-CD3 in order to trigger suppressor activity, nor did it require a period of in vitro pre-activation in order to produce potent, antigen-independent suppression of target cells. When IDO was active, even a small number of freshly-isolated, resting Tregs was able to completely suppress a large population of target T cells, driven only by the MHC molecules naturally expressed on the IDO+ DCs, and whatever cognate antigen was presented in the context of this MHC.
This raises the question of whether the IDO-induced form of suppression was mechanistically distinct from αCD3-induced suppression, or merely represented a quantitative increase in the same suppressive mechanism. This is difficult to definitively answer at present, because the molecular mechanism of conventional Treg activity is still controversial (Bluestone and Tang Curr. Opin. Immunol. 2005; 17:638-642; and Wing et al., Int. Immunol. 2006; 18:991-1000). However, it is suspected that IDO-induced suppression represents a distinct molecular mechanism. This is suggested by the fact that cell-cell contact was required only for the initial, IDO-induced Treg activation step, but not for the suppression of target cells (see
That said, CHOP-KO Tregs displayed a partial quantitative defect in conventional αCD3-induced suppression, in addition to their complete lack of IDO-induced suppression. Thus, it is possible that the two suppressor pathways may share common elements at some point, even though they appear mechanistically distinct by the above criteria. The CHOP transcription factor, which lies further down the multi-functional Integrated Stress Response (ISR) pathway than GCN2, may be involved in additional signaling pathways; consistent with this, it is known that CHOP-KO mice have a number of immunologic abnormalities (Endo et al., J. Immunol. 2006; 176:6245-6253). Overall, the role of the ISR pathway in T cell biology is not yet fully elucidated. However, it has been previously shown that IDO inhibits CD8+ T cell activation and creates antigen-specific anergy by activating the GCN2/ISR pathway (Munn et al., Immunity 2005; 22:633-642). Others have shown that resting CD4+ T cells from GCN2-deficient mice are refractory to IDO-induced differentiation of new Tregs in vitro (Fallarino et al., J. Immunol. 2006; 176:6752-6761). Recently, helper CD4+ cells undergoing Th1/Th2 differentiation in vivo also were found to show marked ISR activation, although the mechanism of this is not yet known (Scheu et al., Nat. Immunol. 2006; 7:644-651). Thus, the ISR is emerging as a previously unappreciated regulatory pathway in T cell biology, with different downstream effects depending on the type of T cells involved.
The novel IDO-induced form of Treg activation that we describe is likely to represent a specialized pathway relevant specifically to those contexts in which IDO is important, rather than a generalized pathway of Treg activation. Consistent with this, the knockout mice used in this study (IDO-KO, GCN2-KO and CHOP-KO) did not display the spontaneous autoimmune phenotype seen in mice with a global defect in Tregs (e.g., Foxp3-deficient mice). This selective phenotype was expected, because the loss of IDO itself does not cause spontaneous global autoimmunity. Rather, mice in which IDO is acutely blocked show highly selective defects: e.g., rejection of allogeneic pregnancies (Muller et al., Nat. Med. 2005; 11:312-319; and Munn et al., Science 1998; 281:1191-1193), loss of ability to be tolerized by agents such as CTLA4-Ig (Grohmann et al., Nat. Immunol. 2002; 3:985-1109; and Mellor et al., J. Immunol. 2003; 171:1652-1655), and rapid death from otherwise survivable autoimmune inflammation (Gurtner et al., Gastroenterology 2003; 125:1762-1773). More beneficially, blocking IDO allows tumor-bearing mice to mount immune-mediated rejection of established tumors following chemotherapy, rather than permitting the tumors to grow unchecked (Muller et al., (2005) Nat. Med. 11, 312-319). Thus, the biologic role for IDO appears to lie in certain specific forms of acquired peripheral tolerance, including tolerance to tumors.
To date, however, it has been unclear how an apparently localized mechanism such as IDO could create such powerful systemic effects. Now, by elucidating the link between IDO expression and activation of the potent Treg system, we provide one possible mechanistic explanation for the systemic effects of IDO. The pathway of Treg activation that we describe is different from the well-known ability of certain DCs to cause the differentiation of new Tregs from uncommitted progenitors (Jonuleit et al., Trends Immunol. 2001; 22:394-400). IDO may also contribute to this process of de novo Treg differentiation as well (Fallarino et al., J. Immunol. 2006; 176:6752-6761). However, all studies to date have consistently found that de novo differentiation of Tregs is slow, occurring over many days. Therefore, this could not be the mechanism of IDO-induced bystander suppression, which must occur rapidly (within hours) in order to suppress T cells prior to their first cell division. The present example shows that IDO-induced Treg activation affects only mature, fully-differentiated CD4 CD25 Foxp3+ Tregs, and has no effect on the uncommitted CD25NEG population of CD4+ T cells.
The present example indicates that the biologic significance of IDO-induced Treg activation is that it allows the immunosuppressive effects of IDO to extend beyond those T cells to which the IDO+ DCs physically present antigen. Via the activation of Tregs, the immunoregulatory effects of IDO+ DCs can be amplified and extended to suppress neighboring T cells, and perhaps to create systemic tolerance as well. As recently discussed (Munn and Mellor The tumor-draining lymph node as an immune-privileged site. Immunol. Rev. 2006 (in press)), this could have profound implications for the many TDLNs that harbor an abnormally increased population of IDO+ DCs. The present findings suggest that this small population of IDO+ DCs may be able to functionally suppress the entire TDLN, converting it from a normally immunizing milieu into an immunosuppressive and tolerogenic microenvironment.
The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
This application claims the benefit of U.S. Provisional Application Ser. No. 60/756,861, filed Jan. 6, 2006, which is incorporated by reference herein.
The present invention was made with government support under Grant Nos. R01AI34495, 2R37HL56067, R01HL49997, R01HL63453, R01CA103320, R01 CA096651, R01 CA 112431, HD41187, and AI063402 awarded by the National Institutes of Health. The Government may have certain rights in this invention.
| Number | Date | Country | |
|---|---|---|---|
| 60756861 | Jan 2006 | US | |
| 60729041 | Oct 2005 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 12158170 | Oct 2008 | US |
| Child | 13308060 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 12083855 | Jul 2009 | US |
| Child | 12158170 | US |
