Ingenol Derivatives in the Reactivation of Latent HIV

Abstract
The present invention broadly relates to the use of certain ingenol derivatives as HIV reactivators of latent HIV virus in viral reservoirs. In another aspect, the present invention relates to an association comprising such ingenol derivatives and antiretroviral agents substantially active against actively replicating virus.
Description

The present invention generally relates to the use of-certain ingenol derivatives as reactivators of latent HIV virus in viral reservoirs. In another aspect, the present invention relates to associations and compositions comprising said ingenol derivatives and anti-retroviral agents substantially active against actively replicating virus.


BACKGROUND OF THE INVENTION

It is known that the human immunodeficiency virus (HIV) is the etiological agent responsible for AIDS - acquired immune deficiency syndrome, a fatal disease that is characterized by the destruction of the immune system, disabling the organism to react appropriately to life threatening opportunistic infections.


Highly active anti-retroviral therapy (known as HAART) has been used to suppress HIV replication. It consists of the treatment commonly known as anti-AIDS “cocktail”, with at least three active anti-retroviral compounds, containing reverse transcriptase inhibitors, integrase, protease and entry.


However, in infected patients, the virus from reservoirs of CD4+ T lymphocyte cells latently infected (i.e. containing residual latent DNA, integrated into the genome of host cells) quickly resumes the viral replication after cessation of the HAART treatment.


Thus, HIV remains a chronic viral infection when such persistent latent infection is not fought.


According to the current rationale in the art, the activation of latent viruses contained in such reservoirs, in the presence of anti-retroviral drugs, intends to make them detectable by the body immune system and accessible to active medication against the virus to cause destruction of cells expressing viral proteins, by reaction of the host immune system and/or such that the cells are brought to apoptosis, inhibiting the replication of viruses that come out from the reservoirs by action of the anti-retroviral drugs, thus exhausting the reservoir of HIV persistent infection and enabling the total eradication of the infection.


In other words, the selective induction of latent infection allows anti-retroviral drugs and the antiviral immune response to access and eradicate residual HIV infection—i.e. not just temporarily stabilizing the immune system without later use of anti-retrovirals, but definitely suppressing the HIV infection in the human body.


DESCRIPTION OF THE INVENTION

It is understood in the text below that mention to “antiretroviral agents active against viruses under active replication” relates to agents that do not substantially act, or act only in a limited way, on HIV viral reservoirs in the human body.


The present invention relates, in a first aspect, to the use of one or more ingenol derivatives of formula I below:




embedded image


used in the preparation of product adjuvant in the treatment of HIV infection or AIDS treatment, wherein Z is Z1




embedded image


or Z2



embedded image


such that, when Z=Z1, ingenol derivatives of the invention are as depicted in the formula II below:




embedded image


x and y are integers, x varies between 2 and 10 and y varies between 2 and 7.


Particularly for formula II, x varies between 3 and 5 and y varies between 3 and 4. Particular embodiments of formula II can be cited, wherein x=3 and y=4:




text missing or illegible when filed


(3-(2,4,6,8-tetradecatetranoyl)-ingenol)


In relation to formula I, when Z=Z2, ingenol derivatives of the invention are as depicted in the formula III below:




embedded image


A is phenyl, CH3—or CH2=CH—, and


B is —CH=CH—, [—CH2—]q or [—CH2—]w,


wherein q is an integer ranging between 1 and 10, preferably between 2 and 6, and w is an integer ranging between 1 and 10,


preferably between 8 and 10,


provided that:


when A is phenyl, B is —CH═CH—;


when A is CH3—, B is [—CH2—]q;


when A is CH2=CH—, B is [—CH2—]w


Particular examples of ingenol derivatives of formula III suitable for the invention, in a non-exclusive manner, are structures A, B, C and D below:




text missing or illegible when filed


Particularly, formula I of ingenol derivatives of the invention presents the following conformation:




embedded image


According to the thrust of this invention, “adjuvant” is an agent or active principle whose action is concomitant or adjuvant to the action of another agent or active principle, in the treatment of a particular disease or condition. The typical individual effect of “adjuvant” (since it can comprise others) is not the one who, alone, effectively treats the disease or disorder, achieving the cure.


In another aspect, the invention relates to the use of ingenol derivatives of formula I above, on reactivation of the latent HIV virus in viral reservoirs of the human body. It is an use in medical therapy.


In another aspect, the invention relates to a useful association for the treatment or prevention of infection of the HIV comprising one or more ingenol derivatives of formula I, and at least one active anti-retroviral agent in viruses under active replication, particularly selected among nucleoside or non-nucleoside reverse transcriptase inhibitors, protease inhibitors, co-receptor antagonists, retroviral integrase inhibitors, viral adsorption inhibitors, specific viral transcription inhibitors, cyclin-dependent kinase inhibitors and combinations thereof.


According to the purpose of this invention, “association” is understood as any form of proper dosage, in combination, mixture, formulation, preparation or equivalent, to be administered to a person, containing at least a ingenol derivative of formula I (component a) and at least one anti-retroviral agent substantially active in actively replicating virus (component b).


“association” associations that of one or more ingenol derivatives of formula I (component a) and one or more antiretroviral agents (component b) may be available in a single dosage unit (e.g., tablet, capsule, ampoule, bag, etc.) or in different dosage units, in which the components (a) and (b) are provided for administration to a patient together or separately, either simultaneously or sequentially.


There is no particular limitation on the dosage form for the association of the invention, including, besides those already mentioned, liposomes and nanoparticles or any other forms known by a person skilled in the art.


Particularly, the invention relates to pharmaceutical compositions containing the association cited before, and pharmaceutically acceptable excipients. The following publications can be cited as information sources on such excipients: “Remington: The Science and Practice of Pharmacy”, 20th Edition or later editions, Lippincott publishing house, Williams and Wilkins; “Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H.C. Ansel et al., 7th ed., Lippincott publishing house, Williams & Wilkins; “Handbook of Pharmaceutical Excipients”(2000) A. H. Kibbe et al, 3rd edition, American Pharmaceutical Association Publishing House.


In another particular aspect, the composition of the invention can further contain other active principle (s) different from the ingenol(s) of formula I and antiretroviral agents. Particularly, the composition of the invention comprises one or more compounds capable of reactivating the latent HIV virus in viral reservoirs in the human body, other than those ingenol derivatives of formula I.


In another aspect, the invention relates to an adjunct useful to reactivate latent HIV virus in viral reservoirs in the human body, characterized in that it comprises one or more ingenol derivatives of formula I, and pharmaceutically acceptable excipients.


In another aspect, the invention relates to a method of treatment or prevention of HIV infections, characterized in that it comprises administering an association to a patient in need of such treatment, as mentioned above. Said treatment comprises administering the association components at the same time or sequentially.


In yet another particular aspect, the invention relates to a method for reactivating latent HIV virus in viral reservoirs in the human body, characterized by administering one or more ingenol derivatives of formula I to a patient.


Among the reverse transcriptase nucleoside inhibitors suitable for the invention, there can be cited, in a non-exclusive manner, the compounds AZT (zidovudine), 3TC (lamivudine), d4T (stavudina), abacavir, ddl (didanosine), ddC (zalcitabine), FTC (emtricitabine), PMPA (R)-9-(2-phosphonylmethoxypropyl)adenine), tenofovir, adefovir, amdoxovir, elvucitabine, alovudine, racivir, apricitibine, phosphazide and fozivudine tidoxil.


Among the non-nucleoside reverse transcriptase inhibitors of the invention, there can be cited, in a non-exclusive manner, the compounds nevirapine, efavirenz, delavirdine, loviride, etravirine, (+)calanolide, rilpivirine and lersivirine.


Among the protease inhibitors suitable for the invention, there can be cited, in a non-exclusive manner, the compounds ritonavir, lopinavir, nelfinavir, saquinavir, indinavir, atazanavir, amprenavir, darunavir, fosamprenavir and tipranavir.


Among the integrase inhibitors suitable for the invention, there can be cited, in a non-exclusive manner, the compounds raltegravir, elvitegravir and dolutegravir.


Among the fusion Inhibitors suitable for the invention, there can be cited, in a non-exclusive manner, the compounds enfuvirtide and tifuvirtide.


Among the co-receptor inhibitors suitable for the invention, there can be cited, in a non-exclusive manner, the CCR5 co-receptor inhibitors vicriviroc and maraviroc.


The ingenol derivatives of the invention, the active antiretrovirals actively on replicating virus or the association of the invention containing them can be administered to a patient by any appropriate path, for example, by oral, parenteral, intravenous, intra-arterial, Intraperitoneal, transdermal, sublingual, rectal, intramuscular, transbucal, intra-nasal, liposomal, inhalation, vaginal, subcutaneous, intra-adipose, intraocular, intra-articular or intrathecal, as well as administration using a catheter or stent, etc.


There is no specific restriction regarding the dosage forms used with ingenol derivatives of the invention or with the inventive association. For example, tablets, pill, capsules, granules, pellets and the like can be used for oral administration. For liquid oral administration solutions, dispersions, suspensions, emulsions, oils, etc., can be used.


The dosage form may be of immediate, slow or controlled release.





BRIEF DESCRIPTION OF THE FIGURES


FIG. 1A represents a graph of latency induction in Jlat 8.4 clone with different concentrations of an ingenol derivative of the invention, hereinafter KyoII, when Z=Z1 in the Markush structure shown above. 20 ng of TNF-α were used as positive control and the results are shown as % of induced cells.



FIG. 1B represents a graph of latency induction in Jlat 6.3 clone with different concentrations of the KyoII derivative mentioned above. 20 ng of TNF-α were used as positive control and the results are shown as % of induced cells.



FIG. 1C is a histogram showing the latency induction in Jlat 6.3 clone with 4 μm of the KyoII derivative mentioned above. In this case, 20 ng of TNF-α were used as positive control and the results are also shown as % of induced cells.



FIG. 2 is a histogram showing the apoptosis activation in human PBMC (peripheral blood mononuclear cells) cells cultivated for 72 h with the different concentrations of the ingenol derivative KyoII mentioned above. The drug concentration is shown beside each graphic and the % of cells under apoptosis is marked on the left quadrant of each graph.



FIGS. 3 to 6 are composite graphs which show the induction of HIV latency in Jlat 6.3 clone and the corresponding cytotoxicity, for both the KyoII derivative (where Z=Z1) and the A, B and C derivatives (where Z=Z2).



FIGS. 7 and 8 are PCR (polymerase chain reaction) graphs for blood cells from patients treated exclusively with efavirenz (FIG. 7), and with a mixture of efavirenz and the ingenol B derivative of the invention (FIG. 8).



FIGS. 9 to 12 are flow cytometry readings, indicating down modulation of CD4 HIV-1 receptor on the surface of human and monkey lymphocytes, for the KyoII derivative (where Z=Z1) and for the A, B and C ingenol derivatives (where Z=Z2).





EXAMPLES

Exemplary embodiments of the invention are given below, in a non-limited sense to such examples, since limitations of the invention are set forth only in the attached claims.


Z1 Derivatives of Ingenol of the Invention

Examples 1 and 2 relate to a 1:1 mixture of two ingenol derivatives of formula (I), when Z=Z1, which are 3-(2,4,6-dodecatrienoyl)-ingenol (x=3 and y=4) and 3-(2, 4,6,8-tetradecatetranoyl)-ingenol (x=4 and y=4), a mixture herein called KyoII, in dimethyl sulfoxide solution at a concentration of 20 mM. Such a solution is used to make dilutions in culture media to achieve the active concentration.


Example 1

The test below was performed with cell line called J-lat, derived from Jurkat lineages, which works as an in vitro model of latent HIV-1. Similarly to resting CD4+ T cells infected with HIV-1 virus, J-Lat cells carry a complete genome of HIV-1 integrated into the cell genome regions that can be activated; however, the transcription of these regions is temporarily inhibited. Additionally, the latent provirus integrated in J-Lat cell lines encodes a GFP (green fluorescent protein) gene, thus providing a fluorescent reporter of HIV-1 transcriptional activity. These cells were treated with TNF-α (20 ng/ml) for viral re-activation as a positive control and the effect was compared with the mixture of ingenol Z1 derivatives. The expression of HIV viral genes was monitored by the GFP reporter gene during 48-72 hours after treatment with TNF-α through flow cytometry.


Jlat clone cells 6.3 and 8.4 (provided by Dr. B. Matija Peterlin, University of California, San Francisco, Calif., USA) were maintained in RPMI culture medium (Rosewell Park Memorial Institute—sold by Invitrogen, USA) containing 10% FBS (fetal bovine serum). The Jlat clone cells 6.3 and 8.4, in a concentration of 106 cells/mL, were induced with different concentrations of the derived KyoII for 24 hours and TNF-α was used as a positive control at 20 ng/mL concentration.


After the induction step, the cells were washed with RPMI medium and then re-suspended in RPMI medium containing 10% fetal bovine serum and cultivated for more than 24 hours to obtain the induction of latent virus.


After induction, 30,000 cells were read in a BD-Excalibur flow cytometer (Beckton Dickinson Company and Co., USA) for reading cells expressing the GFP marker protein. A cell sample was not induced and remained 48 hours in culture to serve as a simulated control (referred to as “mock”), thus marking the spontaneous induction of the provirus provirus (background).


The histogram of FIGS. 1A and 1B shows that the KyoII sample, after a 24-hour induction, was able to activate the latent virus present in Jlat clones 6.3 and 8.4 in a dose-dependent manner, and even at very low doses (0.4 μm) it was able to induce up to 8% of Jlat clone cells 6.3 and 8.4 in culture, and at 40 μm concentration it induced almost 30% of the cells, thus overcoming the TNF-α potency.



FIG. 1
c shows histograms presenting raw data obtained from the Cellquest software (Becton Dickinson and Company, USA) showing the latency induction in a Jlat 6.3 clone, following the same protocol cited above with 4 μm KyoII. In this case, 20 ng of TNF-α were used as positive control and the results are also shown as % of induced cells.


Example 2
Toxicity

It is verified in this test that the derivatives in the KyoII mixture of example 1, at concentrations that induce latency in J-lat cells, are not cytotoxic to human PBMC cells. Thus, human PBMC cells at a concentration of 106 cells/mL were cultured in RPMI medium with 10% fetal bovine serum, exposed to different concentrations of KyoII and left in culture for 72 hours. After exposure, the cells were stained with propidium iodide. Thus, the cells were centrifuged at 1000G for 3 minutes and washed with the same volume with 1×PBS (without Ca2+ and Mg2+, Cat No. 9240, Irvine Scientific Company, USA) containing 2% fetal bovine serum. PBS, or “Phosphate Buffered Saline” is saline buffered with phosphate. This wash was repeated 3 times and the cells were suspended in 1×PBS containing 500 μg of propidium iodide and allowed to incubate for 5 min at 4° C. until being read by flow cytometry. After incubation, 30,000 cells were read in a BD-Excalibur flow cytometer. With this protocol it was possible to see the amount of cells with degraded DNA or in advanced stages of apoptosis (FIG. 2). It was possible to observe that, for concentrations up to 10 μM, the ingenol derivative is not cytotoxic to PBMCs cells and there was 100% of death at 100 μM.


Example 3
Cytotoxicity Verification vs. Reactivation

This example aimed at correlating the cytotoxicity effects and HIV reactivation both for the KyoII mixture of ingenol derivatives, wherein Z=Z1 of examples 1 and 2 above, and for 3 ingenol derivatives of formula I, wherein Z=Z2, indicated above as A, B and C. In these cases, a concentration of 106 cells/mL JLat 6.3 was induced with different concentrations of KyoII, A, B, and C for 24 hours. After the induction step, the cells were washed with RPMI medium and re-suspended in RPMI medium containing 10% fetal bovine serum and cultivated for another 24 hours for the induction of latent virus.


After induction, 30,000 cells were read in a BD-Excalibur flow cytometer for reading cells expressing the GFP marker protein. A cell sample was not induced and remained 48 hours in culture to serve as a simulated control (referred to as “mock”), thus marking the spontaneous induction of the provirus provirus (background). The staining technique with propidium iodide was used for measuring the cytotoxicity of compounds. Thus, the cells were centrifuged at 1000G for 3 minutes and washed with the same volume with 1×PBS (without Ca2+ and Mg2+, Cat No. 9240, Irvine Scientific Company, USA) containing 2% fetal bovine serum. This washing was repeated 3 times and the cells were suspended in 1×PBS containing 500 μg propidium iodide and incubated for 5 min at 4° C. until being read by flow cytometry. After incubation, 30,000 cells were read in a BD-Excalibur flow cytometer (Beckton Dickinson and Co., USA). With this protocol it was possible to precisely the amount of cells with degraded DNA or in advanced stages of apoptosis by measuring with precision cell viability (FIG. 2). The results were plotted in a composed graph, which compared the induction ability of compounds versus their cytotoxic activity.


Example 4
Test with HIV+ Human Cells Originated from Patients under Anti-Retroviral Treatment

It was tested, in this experiment, the ability of ingenol derivative, of formula I, wherein Z=Z2, mentioned as B, of activating latent cells from patients who were already under anti-retroviral treatment for more than 1 year with undetectable viral load. A patient (identified as MLV) was selected, which had already been under treatment with zidovudine+ lamivudine (AZT+3TC) and efavirenz for over 14 months, with undetectable viral load and CD4>500 cells/mm3. 20 mL of blood was collected from the patient in a EDTA (ethylene diamine tetra acetic acid)tube and PBMC cells were isolated, which were μlaced in RPMI culture medium with 10% fetal bovine serum and 50 IU/mL of IL2 (interleukin 2), and grown in 2 bottles with 5 mL of identical cells (106/mL) with different selective compositions. 10 μM efavirenz (antiviral) was added to the control bottle to block viral replication that would eventually arise from cultured cells. In another test bottle both efavirenz (10 μM) and the B derivative of the invention (1 μM) were included. Both bottles were cultured at 37° C. for 72 h and then the intracellular RNA from the PBMCs was extracted with a RNEasy kit (QiaGen Company, USA) and the amount of HIV-1 genomic RNA was dosed by semi-nested real time PCR reaction using primers that hybridize with the gag region of the HIV-1 genome taking the non-spliced viral RNA GAG1 Sense I, II ((5′ TCAGCCCAGAAGTAATACCCATGT 3′; genome position 1280-1303; TM=58.3° C.) and SK431 antisense I (5′ TGCTATGTCAGTTCCCCTTGGTTCTCT 3′; genome position 1474-1500; TM=61.5° C.) as 10 rounds of PCR and followed by a semi-nested real time reaction with primers GAG1 Sense I, II (5′ TCAGCCCAGAAGTAATACCCATGT3′; genome position 1280-1303; TM=58.3 ° C.) and antisense AG2 II (5′ CACTGTGTTTAGCATGGTGTTT 3′; genome position 1341-1362 55.1 TM=57° C.) and identified with GAG3 probe (FAM-ATTATCAGAAGGAGCCACCCCACAAGA-TAMRA; genome position 1311-1337; TM=61° C.). The semi-nested PCR real-time reaction for detecting HIV-1 vRNA was carried out as follows: the extracted cell RNA was diluted 10 times in water and treated with Dnase I (Invitrogen Corporation, USA) for 15 minutes to remove any trace of proviral proviral DNA. Then, DNase I was inactivated under incubation at 70° C. for 10 min in the presence of 1 mM EDTA and 50 mM DTT (dithiothreitol). Reverse transcription of RNA was conducted with random hexamer primers random hexamers and SuperScript III (brand enzyme for cDNA synthesis, from Invitrogen, USA) at 42° C. for 60 min. cDNA was then subjected to PCR reactions. The pair of primers used in the 1st PCR round was GAG1 and SK431 that amplifies the gag inner region of HIV-1. This first round was run on a conventional PCR machine in a 25 μL volume with 5 μL of cDNA, 20 mM tris (hydroxymethyl) aminomethane (pH 8.3), 50 mM KCl, 2 mMMgCl2, 0.4 mMDNTPs (deoxynucleotide triphosphates) and 1U Ampli-Taq (DNA polymerase, from Applied Biosystems, USA), and 50 ng of each primer. The PCR conditions were: 94° C. for 3 min, followed by 15 cycles at 94° C. for 30 s, 55° C. for 30 s and 72° C. for 1 min. The product of this first PCR underwent a 2nd semi-nested real-time PCR, in a ABI Prism 7000 machine machine real-time PCR (from Applied Biosystems, USA) using TaqMan in a total volume of 25 μl, with 2 μl of the 1st round diluted diluted 50 times with 0.2 μm of primers GAG1 and GAG2, and 0.2 μm FAM GAG3 probe. The real-time PCR conditions were: 50° C. for 2 min and 95° C. for 10 min, followed by 50 cycles of 95° C. for 15 seconds and 60° C. for 1 min. The sizes of amplicons were 221 by for the 1st round and 83 by for (real-time) PCR.


It can be observed in FIG. 7 that the PBMC cultures from MLV patient containing 10 μM efavirenz did not produce intracellular vRNA and, therefore, did not generate detectable product in real time semi-nested PCR.


On the other hand, in PBMC culture in which 10 μm efavirenz and 1 μM B derivative B of the invention were added—FIG. 8—the emergence of intracellular HIV-1 vRNA, a sign of HIV latent virus in these blood cells, is verified.


Example 5

Downregulation of CD4 receptor on the surface of human CD4+ T lymphocytes and macrophages and pig-tail monkeys (Macaca nemestrina).


It is verified in this test that ingenol derivatives of formula 1, when Z=Z2, at concentrations that activate HIV from latency in Jlat cells in example 3, downregulate the expression of CD4 cell receptor on the surface of HIV-human and SIV-pig-tail monkey CD4+ T lymphocytes and macrophages. For this experiment PBMC cells from human and monkeys were isolated from peripheral blood with isolation through Ficoll-Hypaque density gradient (mixture of high density hydrophilic neutral polysaccharides that readily dissolves in aqueous solution. “Ficoll” is a trademark of GE Healthcare Bio-Sciences, USA). Thus, PBMC cells from human and monkeys, at concentration of 106 cells/mL, were cultured in RPMI medium with 10% fetal bovine serum for 24 hours and adhered cells (monocytes differentiating into macrophages) were separated from the cell supernatant which contained total lymphocytes. Those two distinct populations of cells were exposed to different concentrations of A, B and C derivatives of the invention, and left in culture for 72 hours. After exposure, the cells were stained with specific lymphocyte monoclonals (anti-CD3) and monocytes/macrophages (anti-CD14) simultaneously with an anti-CD4. Thus, the cells were centrifuged at 1000 G for 3 minutes and washed with the same PBS volume (without Ca2+ and Mg2+, Cat. No. 9240, Irvine Scientific, USA) containing 2% fetal bovine serum. This wash was repeated 3 times and the cells were suspended in 1×PBS containing a 1/1000 dilution of relevant antibodies and left to incubate for 30 min at 4° C. until being read in flow cytometry. After incubation, 30,000 cells were read in a BD-Excalibur flow cytometer (from Beckton Dickinson and co., USA) and the populations were separated and the CD4 receptor density was estimated at different concentrations of the B derivative, assuming cell density without B derivative as 100%. Molecules already known to downregulate CD4 were also μlaced in these experiments, for comparison purposes with A, B and C derivatives, such as prostratin, bryostatin and PMA (phorbol).


It is noted that ingenol Z2 derivatives of the invention were able to downregulate the expression of CD4 HIV-1 receptor on the surface of human (FIG. 11) and Macaca nemestrina lymphocytes (FIG. 9). Similarly, these compounds also down regulated CD4 on human (FIG. 12) and Macaca nemestrina (FIG. 10) monocytes/macrophages. It was remarkable the greater power of Z2 ingenol derivatives in the downregulation of CD4 of monkey cells when compared with comparative molecules (prostratin, bryostatin and PMA, see FIGS. 9 and 10).


The A, B and C ingenol derivatives were able to downregulate the main HIV receptor (CD4) on the surface of the infection targeted cells. Thus, it has been proven that the ingenol derivatives of the invention, besides of activating HIV from latency, hinder the ongoing of the virus infection by blocking its entry into new cells,


The person skilled in the art can readily evaluate, by means of the teachings contained in the text and in the presented examples, advantages of the invention, as well as propose modifications and equivalent alternatives to the embodiments, without departing to the scope of the invention, as defined in the attached claims.

Claims
  • 1. Use of one or more ingenol derivatives of formula I
  • 2. Use, according to claim 1, characterized in that said one or more ingenol derivatives of formula I have structure
  • 3. Use, according to claim 1, characterized in that, when Z=Z1, x varies between 3 and 5 and y varies between 3 and 4.
  • 4. Use, according to claim 1, characterized in that, when Z=Z1, said ingenol derivatives are one or more among 3-(2,4,6-dodecatrienoyl)-ingenol and/or 3-(2,4,6,8-tetradecatetranoyl)-ingenol.
  • 5. Use, according to claim 1, characterized in that, when Z=Z2, said derivatives are one or more among A, B, C and D as follows:
  • 6. Use of one or more derivatives of formula I, characterized in that they are used on the reactivation of the latent HIV virus in viral reservoirs of the human body.
  • 7. Pharmaceutical association for the treatment of HIV virus infection, characterized in that it comprises one or more ingenol derivatives of formula I, and at least one anti-retroviral agent active against viruses under active replication.
  • 8. Pharmaceutical association, according to claim 7, characterized in that said at least one active anti-retroviral agent active against actively replicating viruses are selected among nucleoside or non-nucleoside reverse transcriptase inhibitors, protease inhibitors, co-receptor antagonists, retroviral integrase inhibitors, viral adsorption inhibitors, specific viral transcription inhibitors, cyclin-dependent kinase inhibitors and combinations thereof.
  • 9. Association, according to claim 7, characterized in that said one or more ingenol derivatives of formula I and said one or more antiretroviral agents are comprised in the same dosage form.
  • 10. Pharmaceutical composition for treating HIV virus infection, characterized in that it contains an association according to claim 7 and pharmaceutically acceptable excipients.
  • 11. Pharmaceutical composition, according to claim 10, characterized in that it further contains other active principle(s) different from ingenol derivatives of formula I, or from antiretroviral agents active against actively replicating viruses.
  • 12. Pharmaceutical composition useful in reactivation of latent HIV viruses in viral reservoirs in the human body, according to claim 10, characterized in that it comprises one or more ingenol derivatives of formula I.
  • 13. Adjuvant for treating infection caused by HIV virus, characterized in that it comprises one or more ingenol derivatives of formula I and pharmaceutically acceptable excipients.
  • 14. Method of treating a HIV infection, characterized in that it comprises administering to a patient in need of such a treatment an association according to claim 7.
  • 15. Method of treatment, according to claim 14, characterized in that the administration of components of said association is concomitant or sequential.
  • 16. Method for reactivating latent HIV virus in viral reservoirs in the human body, characterized in that it comprises administering to a patient one or more ingenol derivatives of formula I.
  • 17. Pharmaceutical association adapted to administration to patients, according to claim 7, characterized in that it is for use in medical therapy.
  • 18. Pharmaceutical composition adapted to administration to patients, according to claim 10, characterized in that it is for use in medical therapy.
  • 19. Adjuvant adapted to administration to patients, according to claim 13, characterized in that it is for use in medical therapy.
  • 20. Use of one or more ingenol derivatives of formula I, characterized in that it is for aiding the treatment of HIV virus infection or prevention of AIDS.
Priority Claims (2)
Number Date Country Kind
10 2012 004739 Mar 2012 BR national
10 2012 006549 5 Mar 2012 BR national
PCT Information
Filing Document Filing Date Country Kind
PCT/BR2013/000063 3/1/2013 WO 00