Patent Application
20230414632
The present invention concerns inhibitors of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1).
The present invention also concerns inhibitors for use in the treatment of the acquired immune deficiency syndrome.
The present invention also concerns compound of formula (I) or (II) for use in the treatment of the acquired immune deficiency syndrome and a method of therapeutic treatment comprising the administration of such an inhibitor or compound of formula (I) or (II).
Human immunodeficiency virus (HIV) is the etiological agent responsible for acquired immune deficiency syndrome (AIDS), a fatal disease characterized by destruction of the immune system and the degeneration of the central and peripheral nervous system.
Currently, there are several antiviral drugs available anti-HIV. These drugs can be divided into several classes based on the viral protein they target and their mode of action: nucleoside and nucleotide reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, fusion inhibitors, integrase inhibitors and CCR5 receptor antagonists. Treatments against HIV are usually combinations of several antiviral drugs belonging to different classes (tritherapies).
However, not all patients are responsive to these treatments. In most cases, treatment failure is caused by the emergence of viral resistance, due to the rapid turnover of HIV, in particular of HIV-1, during the course of infection combined with a high viral mutation rate. Also, most of the drugs have known side effects.
Thus, there is still a need for the development of further new anti-HIV drugs, particularly the development of anti-HIV drugs having a new mechanism.
One aim of the present invention is to solve the technical problem of providing an improved treatment against HIV, in particular HIV-1, that could alleviate the above limitations.
The present invention aims to solve the technical problem of providing new treatments against HIV, in particular HIV-1.
In particular, the present invention aims to solve the technical problem of providing anti-HIV drugs having a new mechanism, in particular providing anti-HIV-1 drugs.
The present invention concerns a compound inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) for use in a method for treating a type 1 human immunodeficiency virus (HIV-1).
Preferably, the compound inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus inhibits the interaction between an integrase of the type 1 human immunodeficiency virus and a mitochondrial lysyl-tRNA synthetase of a cell infected by the type 1 human immunodeficiency virus.
Type 1 human immunodeficiency virus (HIV-1) is a retrovirus whose genome made up of two single-stranded RNA molecules. The reverse transcriptase encoded by HIV-1 uses the tRNA3Lys of the host cell to initiate replication of its RNA into proviral DNA. tRNA3Lys is encapsulated into virions during assembly; host cellular mitochondrial lysyl-tRNA synthetase (LysRS), and in particular its mature form human mitochondrial lysyl-tRNA synthetase (mLysRS), is involved in this mechanism and serves as a co-transporter for tRNAP3Lys.
The protein-protein interactions involved in the formation of the tRNAP3Lys encapsulating complex can be modelled as the interactions between the Pol domain of the precursor GagPol, in particular the transframe TF and integrase IN subdomains of the Pol domain, and the catalytic domain of mLysRS (Kobbi et al. J. Mol. Biol. 2011, 410:875).
Surprisingly, it was discovered by present inventors that it is possible to inhibit the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus by inhibiting the interaction between the precursor GagPol of a type 1 human immunodeficiency virus (UniProtKB-P12497 (POL_HV1N5)) and catalytic domain of mLysRS (residues 259 to 618 from H6-mLysRS-HA sequence) of the host cell, which inhibits the assembly of Gag Pol-tRNAP3Lys-mLysRS complex. Because the primer RNA is not packaged into the virus, this prohibits the initiation step of the reverse transcription of RNA of a HIV-1.
Sequence of HIV-1 virus is for instance the plasmid sequence pNL4-3 (GenBank: AF324493.2).
Inhibitors according to the invention are able to inhibit the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus.
Inhibitors according to the invention have anti-viral activity without significant cellular toxicity.
The invention also concerns a compound of formula (I) for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1), preferably for use in a method of treatment of type 1 human immunodeficiency virus (HIV-1), wherein said formula (I) is as follows:
wherein R1 is selected form the group consisting of:
wherein R2, R3, R4 and R5 are independently selected from the group consisting of:
wherein R4 and R5 optionally form together a heterocycle,
and/or a salt thereof and/or a solvate thereof.
According to the invention, an “alkyl group” represents, unless expressly specified, a hydrocarbonated group, linear or branched, saturated or comprising at least one unsaturation.
According to the invention, a “hydrocarbonated group” is a group comprising or consisting in hydrogen and carbon atoms.
According to the invention, an “aryl group” represents an aromatic radical, unless expressly specified. An example of aryl group is a monocyclic aromatic radical comprising 6 carbon atoms.
According to the invention, a “heteroatom” represents, unless expressly specified, an atom selected from the group consisting of oxygen, nitrogen, sulfur and phosphorus.
According to the invention, a “heterocycle” represents, unless expressly specified, a cyclic moiety, saturated or unsaturated, comprising from 2 to 7 carbon atoms and at least one heteroatom chosen from nitrogen, oxygen and sulfur.
According to the invention, a “substituted” group or moiety means that at least one hydrogen radical of said group or moiety is replaced with an atom or a group of atoms called substituent.
Examples of preferred substituents are halogen (chloro, iodo, bromo, or fluoro); alkyl; alkenyl; alkynyl; hydroxy; alkoxy; nitro; thiol; thioether; imine; cyano; amido; phosphonato; phosphine; carboxyl; thiocarbonyl; sulfonyl; sulfonamide; ketone; aldehyde; ester; oxygen (—O); haloalkyl (e.g., trifluoromethyl); cycloalkyl, which may be monocyclic or fused or non-fused polycyclic (e.g., cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl), or a heterocycloalkyl, which may be monocyclic or fused or non-fused polycyclic (e.g., pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, or thiazinyl), monocyclic or fused or non-fused polycyclic aryl or heteroaryl (e.g., phenyl, naphthyl, pyrrolyl, indolyl, furanyl, thiophenyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, triazolyl, tetrazolyl, pyrazolyl, pyridyl, quinolinyl, isoquinolinyl, acridinyl, pyrazinyl, pyridazinyl, pyrimidinyl, benzimidazolyl, benzothiophenyl, or benzofuranyl); amino (primary, secondary, or tertiary); CO2CH3; CONH2; OCH2CONH2; NH2; SO2NH2; OCHF2; CF3; OCF3; and such moieties may also be optionally substituted by a fused-ring structure or bridge, for example —OCH2O—. These substituents may optionally be further substituted with a substituent selected from such groups.
According to the invention, an alkyl group “comprising at least one heteroatom” means that at least one hydrogen of said alkyl group is replaced by a substituent comprising at least on heteroatom, and/or that at least one carbon atom of said alkyl group is replaced by a heteroatom. Examples of alkyl groups comprising at least one heteroatom are alkyl groups comprising a primary, secondary or tertiary amine, an amido group, an azo group, an nitrile group, an imino group, an imido group, a azo group, a cyano group, a nitrile group, an aldehyde, a ketone, an ether, an ester group, an alcoxy group, a carbonate group, a carboxylic acid group, a peroxide group, a thiol group, a sulfide group, a disulfide group, a sulfoxide group, a sulfone group, a sulfonic acid group, a sulfinic acid group, a sulfonate ester group, a thiocyanato group, a thioketone, a thial, a thioester group, heterocycles internal to the alkyl group and heterocycles as substituents to the alkyl group.
According to an embodiment, a C1-C20 alkyl group, linear or cyclic or branched, saturated or unsaturated, optionally substituted and/or optionally comprising a heteroatom comprises at least an unsaturation and at least an ester group. An example of such C1-C20 alkyl group, linear or cyclic or branched, saturated or unsaturated, optionally substituted and/or optionally comprising a heteroatom is —CH═CH—C(O)O-tBu.
According to an embodiment, the compound of formula (I) according to the invention is a compound of formula (I′) as follows:
wherein R1, Ra, Ra′, R4 and R5 are as defined above.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) or (I′), wherein R1 is selected form the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) wherein R2 and R3 are each independently an ester group of formula —C(O)O—Ra or of formula —C(O)O—Ra′, or a compound of formula (I′),
wherein Ra and Ra′ are independently selected from the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) or (I′), wherein R4 and R5 are independently selected from the group consisting of:
or R4 and R5 form together a heterocycle.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) wherein R2 and R3 are each independently an ester group of formula —C(O)O—Ra or of formula —C(O)O—Ra′, or a compound of formula (I′),
wherein R1 is selected form the group consisting of:
wherein Ra and Ra′ are independently selected from the group consisting of:
wherein R4 and R5 are independently selected from the group consisting of:
or R4 and R5 form together a heterocycle.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) or (I′), wherein R1 is selected form the group consisting of a methyl group CH3 and an amino group NH2, preferably R1 is a methyl group.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) wherein R2 and R3 are each independently an ester group of formula —C(O)O—Ra or of formula —C(O)O—Ra′, or a compound of formula (I′),
wherein Ra and Ra′ are independently selected from the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) or (I′), wherein R4 is hydrogen and R5 is different from hydrogen, or R5 is hydrogen and R4 is different from hydrogen.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) wherein R2 and R3 are each independently an ester group of formula —C(O)O—Ra or of formula —C(O)O—Ra′, or a compound of formula (I′),
wherein R1 is selected form the group consisting of:
wherein Ra and Ra′ are independently selected from the group consisting of:
wherein R4 is hydrogen and R5 is different from hydrogen, or R5 is hydrogen and R4 is different from hydrogen.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) wherein R2 and R3 are each independently an ester group of formula —C(O)O—Ra or of formula —C(O)O—Ra′, or a compound of formula (I′),
wherein R1 is selected form the group consisting of a methyl group CH3 and an amino group NH2, preferably R1 is a methyl group,
wherein Ra and Ra′ are independently selected from the group consisting of:
wherein R4 is hydrogen and R5 is different from hydrogen, or R5 is hydrogen and R4 is different from hydrogen.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) wherein R2 and R3 are each independently an ester group of formula —C(O)O—Ra or of formula —C(O)O—Ra′, or a compound of formula (I′),
wherein Ra and Ra′ are independently selected from the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) or (I′), wherein R4 and R5 are independently selected from the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) wherein R2 and R3 are each independently an ester group of formula —C(O)O—Ra or of formula —C(O)O—Ra′, or a compound of formula (I′),
wherein R1 is selected form the group consisting of:
wherein Ra and Ra′ are independently selected from the group consisting of:
wherein R4 and R5 are independently selected from the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (I) wherein R2 and R3 are each independently an ester group of formula —C(O)O—Ra or of formula —C(O)O—Ra′, or a compound of formula (I′),
wherein R1 is selected form the group consisting of a methyl group CH 3 and an amino group NH2, preferably R1 is a methyl group,
wherein Ra and Ra′ are independently selected from the group consisting of:
wherein R4 and R5 are independently selected from the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is selected from the group consisting of:
Preferably, the compound is a compound of formula (I) or (I′) is selected from the group consisting of compound (I-a) and compound (I-b).
The present invention also concerns a compound of formula (I) for use in a method of treatment against type 1 human immunodeficiency virus (HIV-1), wherein said formula (I) is as follows:
wherein R1 is selected form the group consisting of:
wherein R2, R3, R4 and R5 are independently selected from the group consisting of:
wherein R4 and R5 optionally form together a heterocycle,
and/or a salt thereof and/or a solvate thereof.
All embodiments and preferred features relative to the compound of formula (I) for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) apply, alone or in any combination thereof, also to the compound of formula (I) for use in a method of treatment against type 1 human immunodeficiency virus (HIV-1).
The present invention also concerns a compound of formula (II) for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1), preferably for use in a method of treatment of type 1 human immunodeficiency virus (HIV-1), wherein said formula (II) is as follows:
wherein X and Z together represent a fused benzene ring, optionally substituted by at least one substituent selected from the group consisting of:
wherein R and R′ are independently selected form the group consisting of:
and/or a salt thereof and/or a solvate thereof.
According to an embodiment, the compound of formula (II) according to the invention is a compound of formula (II′) as follows:
wherein R and R′ are as defined above.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (II) or (II′), wherein R is selected form the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (II) or (II′), wherein R′ is selected form the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (II) or (II′),
wherein R is selected form the group consisting of:
wherein R′ is selected form the group consisting of:
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (II) or (II′), wherein R is a —CH2—Ph group, Ph being an aryl group, optionally substituted by at least one substituent selected from the group consisting of a halogen atom, a hydroxyl group, a C1-C20 alkyl group, a carboxyl group, a nitro group and a cyano group.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (II) or (II′), wherein R′ is a saturated heterocycle comprising from 2 to 7 carbon atoms and at least one nitrogen atom, said heterocycle being optionally substituted by at least one C1-C10 alkyl group.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) is a compound of formula (II) or (II′),
wherein R is a —CH2—Ph group, Ph being an aryl group, optionally substituted by at least one substituent selected from the group consisting of a halogen atom, a hydroxyl group, a C1-C20 alkyl group, a carboxyl group, a nitro group and a cyano group, and
wherein R′ is a saturated heterocycle comprising from 2 to 7 carbon atoms and at least one nitrogen atom, said heterocycle being optionally substituted by at least one C1-C10 alkyl group.
According to an embodiment, the compound for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) has the following structure:
The present invention also concerns a compound of formula (II) for use in a method of treatment against type 1 human immunodeficiency virus (HIV-1), wherein said formula (II) is as follows:
wherein X and Z together represent a fused benzene ring, optionally substituted by at least one substituent selected from the group consisting of:
wherein R and R′ are independently selected form the group consisting of:
and/or a salt thereof and/or a solvate thereof.
All embodiments and preferred features relative to the compound of formula (II) for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) apply, alone or in any combination thereof, also to the compound of formula (II) for use in a method of treatment against type 1 human immunodeficiency virus (HIV-1).
The invention includes all pharmaceutically acceptable salt forms of the compounds of formula (I) and (I′) and of formula (II) and (II′). Pharmaceutically acceptable salts are those in which the counter ions do not contribute significantly to the physiological toxicity of the compounds and comprises pharmacological equivalents.
Some of the compounds of formula (I) and (I′) and of formula (II) and (II′) exist in stereoisomeric forms. The invention includes all stereoisomeric forms of the compounds of formula (I) and (I′) and of formula (II) and (II′) including enantiomers, diastereromers and tautomers.
The present invention also concerns the compound of formula (I), the compound of formula (I′), the compound of formula (II) and/or the compound of formula (II′) for use in the treatment of the acquired immune deficiency syndrome.
All embodiments and preferred features relative to the compound of formula (I), compound of formula (I′), compound of formula (II) and compound of formula (II′) for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) apply, alone or in any combination thereof, also to the compound of formula (I), the compound of formula (I′), the compound of formula (II) and/or the compound of formula (II′) for use in the treatment of the acquired immune deficiency syndrome.
The present invention also concerns a method of therapeutic treatment comprising the administration of an effective amount of an inhibitor according to the invention or of a compound of formula (I) or (I′) and/or (II) or (II′) to a subject in need thereof, in particular to a human or animal.
The invention also relates to a pharmaceutical composition or kit comprising a compound of formula (I) or (I′) and/or (II) or (II′) as defined according to the present invention for use as an inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1).
Preferably, the pharmaceutical composition or kit comprising comprising a compound of formula (I) or (I′) and/or (II) or (II′) as defined according to the present invention is for use in a method for treating a type 1 human immunodeficiency virus (HIV-1).
The invention will be better understood from reading the following non-limiting examples.
Compound of formula I-a was purchase from Prestwick (commercial reference: Prestw-1297) or from Sigma-Aldrich (commercial reference: SML0946).
Compound of formula I-b was purchase from Prestwick (commercial reference: Prestw-1376) or from Sigma-Aldrich (commercial reference: C1493).
Compound of formula II-a was purchase from Prestwick (commercial reference: Prestw-1130) or from Sigma-Aldrich (commercial reference: A7611).
Experiments were performed on the interaction between the HIV-1 integrase (IN) and the catalytic domain of the human mitochondrial lysyl-tRNA synthetase (mLysRS), which constitutes the main contribution to the Gag Pol:mLysRS interaction.
The cDNA encoding the mitochondrial species of human lysyl-tRNA synthetase (mLysRS, from amino acid residues 31 to 625 of the pre-protein from transcript NM_001130089.2) was amplified by PCR with oligonucleotides 5′-GGGGCTAGCCAACTTGCTCCTTTCACAGCGCCT (SEQ ID_NO 1) and 5′-CCCCTCGAGCTAGGCATAATCTGGCACATCATAAGGGTAGACAGAACTGCCAACTGT TGT (SEQ ID_NO 2) and inserted into the pET28b plasmid (Novagen) digested with NheI and XhoI. The sequence of the recombinant plasmid was verified by DNA sequencing. The encoded protein, named H6-mLysRS-HA (SEQ ID_NO 3), contains a N-terminal His-tag (MGSSHHHHHH) (SEQ ID_NO 4), followed by a thrombin cleavage site (SSGLVPRGSHMAS) (SEQ ID_NO 5), and a C-terminal HA-tag (YPYDVPDYA) (SEQ ID_NO 6).
The protein was expressed in E. coli BL21(DE3) grown in LB medium supplemented with kanamycin (50 μg/ml). Culture (3 liters) was grown at 37° C. to an A600=0.25, transferred at 28° C. and grown to an A600=0.5, and expression was induced by addition of 1 mM IPTG for 4 hours. Cells were collected by centrifugation (3,000 g, 10 min, 4° C.), washed twice with ice-cold buffer A (20 mM K-phosphate pH 7.5, 150 mM NaCl, 5% glycerol, 5 mM 2-mercaptoethanol) containing 10 mM imidazole, resuspended in the same buffer (1 ml per g of cell pellet) and lysed in an Eaton Press after freezing in dry ice. All subsequent steps were conducted at 4° C. After addition of 2 vol. of buffer B (20 mM K-phosphate pH 7.5, 500 mM NaCl, 5% glycerol, 5 mM 2-mercaptoethanol) containing 10 mM imidazole, and of protease inhibitors (1 mM Pefabloc, 10 mM benzamidine and 10 mM PMSF), extracts were clarified by sonication and by centrifugation at 20,000 g for 20 min, and at 70,000 g for 1 hour.
The clear supernatant was applied to a 5 ml column of Ni-NTA Superflow (Qiagen), at 4° C. The matrix was extensively washed with buffer B containing 10 mM imidazole, and elution was performed by a linear gradient of imidazole (10 to 500 mM) in buffer B. Fractions containing H6-mLysRS-HA were dialyzed against buffer AS (20 mM Tris-HCl pH 7.5, 50 mM KCl, 10% glycerol, 10 mM 2-mercaptoethanol), and were applied to a 1 ml column of Source 15S (GE Healthcare) equilibrated in the same buffer. Proteins were eluted by a linear gradient (50 column vol.) of KCl from 50 to 335 mM in the same buffer. Fractions containing H6-mLysRS-HA were dialyzed against storage buffer (25 mM K-phosphate pH 7.5, 55% glycerol, 2 mM DTT), and stored at −20° C.
Protein concentration was determined by using a calculated absorption coefficient of 0.674 A280 units·mg−1·cm2.
A thrombin cleavage site is inserted between the N-terminal His-tag and the coding sequence of mLysRS-HA. The H6-tag was removed from the purified H6-mLysRS-HA protein to generate mLysRS-HA (SEQ ID_NO 7).
H6-mLysRS-HA was incubated at a concentration of 1 mg/ml, in the presence of thrombin (Roche) at a ratio 50:1 (w:w), in a buffer containing 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2.5 mM CaCl2, 2 mM DTT, 10% glycerol. After 30 min at 25° C., digestion was stopped by addition of Pefabloc at 2 mM. The loss of the H6-tag was monitored by Western blotting with anti-His antibodies (Qiagen #34660), and using the HTRF assay (see below). In this assay, when mLysRS-HA was incubated in the presence of anti His-tag and anti HA-tag antibodies, no HTRF signal was detected. The protein mLysRS-HA was stored at −20° C. after addition of 1 vol. of glycerol.
Expression and purification of integrase from HIV-1 was conducted essentially as previously described (Khoder-Agha et al. BMC Biochemistry 2018, 19:2).
The HIV-1 integrase coding region from pNL4-3 (nucleotides 4230 to 5093) was amplified by PCR with oligonucleotides 5′-CGCGGATCCCGGTCCGAAGCGCGCGGAATTCATAATGGCGTTTTTAGATGGAATAG ATAAGG (SEQ ID_NO 8) and 5′-TCTCGACAAGCTTGGTACCGCATGCCTCGAGTTAGTGGTGGTGGTGGTGGTGATCC TCATCCTGTCTACTTG (SEQ ID_NO 9), and introduced in pFastBac1 (Life Technologies) digested with EcoRI and XhoI. The sequence of the recombinant plasmid was verified by DNA sequencing. A His-tag coding sequence has been appended at the C-terminus of integrase (the sequence of the resulting protein, named IN-H6, is SEQ ID_NO 10).
Recombinant bacmids and baculoviruses were obtained as previously described (Kobbi et al. Biochim Open. 2016, 2:52-61).
Baculoviruses were used to infect 8 liters of High Five cells (Life Technologies) grown in suspension in Express Five SFM medium (Life Technologies). After 68 h of culture at 27° C. with constant orbital shaking at 110 rpm, cells were harvested by centrifugation, washed with ice-cold buffer A containing 10 mM imidazole, and the cell pellet was stored at −80° C. Pellet was rapidly thawed at 37° C. and cells were lysed after addition of 120 ml of buffer A containing 10 mM imidazole and 1% Triton X-100, in the presence of 1 mM Pefabloc, 10 mM benzamidine and 10 mM PMSF. After addition of 240 ml of buffer B containing 50 mM imidazole, extract was clarified by centrifugation at 70,000 g for 30 min at 4° C. and incubated 1 h at 4° C. with 1 ml of Ni-NTA Superflow matrix (Qiagen). Beads were extensively washed with buffer B containing 50 mM imidazole, and elution was performed by adding 6×1 ml of buffer B containing 400 mM imidazole. Eluted proteins were dialyzed against buffer ASU (20 mM Tris-HCl pH 7.0, 1 M urea, 10% glycerol, 1 mM EDTA, 10 mM 2-mercaptoethanol) containing 150 mM NaCl, and applied to a Mono S HR5/5 column (GE Healthcare) equilibrated in the same buffer. Proteins were eluted by a linear gradient (40 column vol.) of NaCl from 150 to 450 mM in buffer ASU. Fractions containing integrase were concentrated by ultrafiltration (Vivaspin 6, 10 kDa), dialyzed against storage buffer (20 mM K-phosphate pH 7.5, 1 M NaCl, 2 mM DTT), and stored at −80° C. Protein concentration was determined by using a calculated absorption coefficient of 1.529 A280 units mg−1 cm2.
Homogeneous time-resolved fluorescence (HTRF) assays were performed in black, half-area, flat bottom, 96-well microplates (Costar #3694). Human mitochondrial LysRS with a C-terminal HA-tag (mLysRS-HA), diluted in HTRF buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl, 10 mM 2-mercaptoethanol, BSA at 1 mg/ml) was added (20 μl at a dimer concentration of 3.75 nM) in the wells of microplates placed on ice. Compounds of formula I or II (1 μl of a 10 mM solution in DMSO) were then added to the wells, and mixing was achieved by pipetting up and down 3-times 10 μl. After centrifugation at 900 g for 1 min at 4° C., plates were placed at 4° C. on thermal modules of an epMotion 5075 v automated pipetting system (Eppendorf). A 10 μl sample of IN-H6 diluted in HTRF buffer at a dimer concentration of 250 nM was added and mixing was achieved by pipetting up and down 3-times 15 μl. Incubation was conducted at 4° C. for 1 h.
A 10 μl aliquot of a mix of antibodies prepared in HTRF buffer, directed to the His-tag, conjugated with Eu3+ cryptate (Cisbio #61HISKLB, 0.125 μl per test, prepared as recommended by the supplier), and to the HA-tag, conjugated with XL665 (Cisbio #610HAXLB, 0.375 μl per test, prepared as recommended by the supplier), was added and mixing was achieved by pipetting up and down 3-times 15 μl. Incubation was conducted at 4° C. for 30 min.
A 10 μl solution of KF prepared in HTRF buffer at a concentration of 250 mM was then added and mixing was achieved by pipetting up and down 3-times 20 μl. After centrifugation at 900 g for 3 min at 4° C., fluorescence of Eu3+ cryptate and of XL665 was recorded at 620 nm (I620) and 665 nm (I665), respectively, after excitation of Eu3+ cryptate at 317 nm, in an Infinite M1000 PRO microplate reader (TECAN). Results are expressed as the ratio of I665/I620. The HTRF signal corresponds to the ratio of fluorescence at 665 and 620 nm (I665/I620). HTRF (%) corresponds to normalization of the values (for each curve 100% corresponds to the value obtained without inhibitor).
Two control tests were performed to avoid false positives.
The first control test utilizes p38-H6, instead of IN-H6. This protein p38-H6 is the scaffold protein from the cytoplasmic human multisynthetase complex that interacts with the catalytic domain of LysRS at a site distinct from that involved in the interaction with IN-H6 (Kobbi et al. J. Mol. Biol. 2011, 410:875-886). The assay was performed as described above, except that a 10 μl sample of p38-H6 diluted in HTRF buffer at a dimer concentration of 50 nM was used, and anti HA-tag antibodies, conjugated with Eu3+ cryptate (Cisbio #610HAKLB, 0.125 μl per test, prepared as recommended by the supplier), and anti His-tag antibodies, conjugated with XL665 (Cisbio #61 HISXLB, 0.125 μl per test, prepared as recommended by the supplier), were used.
In the second control, only H6-mLysRS-HA (a 30 μl sample diluted in HTRF buffer at a dimer concentration of 1.34 nM) was added in the assay, in the absence of a partner protein. Fluorescence energy transfer results from the binding of one antibody to the N-terminal His-tag, and of the second antibody to the C-terminal HA-tag. Thus, a compound reducing the HTRF signal by interfering with the fluorescence donor (Eu3+) or acceptor (XL665) should be eliminated.
IC50 of the compounds of formula I and II were determined in the HTRF assay after incubation of the protein partners in the presence of increasing concentrations of the compound of formula I or II (from 17 to 666 μM). IC50s were obtained by nonlinear regression of the theoretical equation to the experimental curve using the KaleidaGraph 4.5 software (Synergy Software).
Ability of compounds of formula I or II to inhibit the HIV-1 replicative cycle ex vivo was conducted by methods commonly used in antiretroviral pharmacology.
Cells and Viruses.
MT4 cell line (Charneau et al. J. Virol. 1992, 66:2814) were maintained in RPMI 1640. HEK293T were maintained in Dulbecco's Modified Eagle Medium (DMEM). All media were supplemented with Glutamax and with 10% heat-inactivated fetal calf serum (Hyclone) and 1% penicillin/streptomycin (100 units/mL) (Gibco). All media were purchased from Gibco (Life Technologies Co.). All cell lines used here were incubated at 37° C., under 5% CO2 atmosphere. HIV-1 stocks were prepared by calcium phosphate-mediated transfection of HEK293T cells, as previously described (Manic et al. Human gene therapy methods 2012, 23:84), with shuttle vector plasmids encoding HIV-1 NL4-3 (GenBank: AF324493.1) or NLENG1-IRES-GFP (Levy et al. Proc. Natl. Acad. Sci. USA 2004, 101:4204). The latter vector comes from HIV NL4-3 strain, and contains a gfp-IRES-nef cassette at the nef locus. For clarity reason, we designate this vector here as “HIV-1 gfp+”.
The HIV-1 p24gag antigen contents in viral inocula were determined by enzyme-linked immunosorbent assay (ELISA, Perkin-Elmer Life Sciences).
HIV infectivity and toxicity assays.
Replication of the NL4-3 virus was determined by the ELISA technique. The cytotoxicity is evaluated by the MTT technique.
For HIV-1 gfp+ vectors, viral replication is followed by GFP expression [i.e. the percentage and geometric mean fluorescence intensity (MFI) of GFP+ cells]. Infectivity was estimated by flow cytometry using a FACSCalibur™ cytofluorometer (BD Biosciences). Toxicity is also assessed by flow cytometry (side and forward scatter).
Effect of drugs on multi-cycle virus replication.
At J0 (day zero) MT4 cells was used for infection with HIV gfp+ virus at multiplicity of infection (m.o.i.) reaching 0.1-0.2 (50 ng of p24gag antigen per 106 cells). Two days post-infection (J2), MT4 cells are washed extensively (3 times with PBS) and resuspended using fresh RPMI medium (2×105 cells per ml) and plated into 6 well plates (2 ml per well) in the presence of compounds of formula I or II at various molecules concentrations. A control not infected with the virus (MT4 Ninf), or brought into contact with DMSO (inf DMSO, the solvent of compounds of formula I or II), or with dolutegravir (DTG) at 100 nM, a known inhibitor of the integrase, are conducted in parallel. At time J5 (day five), cells are then collected for cytometry analysis to quantify the production of viral particles and cell survival.
IC50 of compounds of formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, and II-a were determined by HTRF, as described above. As the control test, the mLysRS:p38 interaction was also determined.
The IC50 of compounds of formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, and II-a are gathered in the table below.
These results demonstrate that compounds of formula I and II inhibit the interaction between the HIV-1 integrase (IN) and the catalytic domain of the human mitochondrial lysyl-tRNA synthetase (mLysRS).
It was also demonstrated that compounds of formula I and II inhibit the mLysRS:Pol interaction with IC50 values comparable with those obtained for the mLysRS:IN interaction. Consequently, the inhibition of the mLysRS:IN interaction is sufficient to prevent the mLysRS:Pol association.
Compounds of formula I-a, I-b and II-a were tested for their ability to inhibit the HIV-1 replicative cycle ex vivo following the method described above.
The results regarding the HIV-1 replication at day 5 are presented in
At a concentration of 10 μM for compound II-a and of 33 μM for compounds I-a and I-b, the production of viral particles is greatly reduced. At the same time, no cellular toxicity has been observed up to 10 μM of compound of formula I-a, I-b or II-a.
These results demonstrate the anti-viral activity of the compounds of formula I and II.
| Number | Date | Country | Kind |
|---|---|---|---|
| 20306238.5 | Oct 2020 | EP | regional |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/EP2021/078829 | 10/18/2021 | WO |
