Patent Grant
12186388
The content of the electronic sequence listing (253322000200SEQLIST.xml; Size: 284,897 bytes; and Date of Creation: Jan. 17, 2023) is herein incorporated by reference in its entirety.
The present invention relates to interferon (IFN)-producing universal sarbecovirus vaccines, such as IFN-producing universal SARS-CoV-2 vaccines. Further provided herein are pharmaceutical compositions comprising the vaccines, methods of preventing or ameliorating viral infection using the vaccines, and kits comprising the vaccines.
Since the first human case of COVID-19 was reported in late 2019, SARS-CoV-2 has caused more than 0.6 billion infections and 6.5 million deaths globally as of 27 Sep. 2022. Three major categories of COVID-19 vaccines (lipid nanoparticle-based mRNA vaccines, adenoviral vector-based vaccines, and inactivated whole virion vaccines) are currently available. Both mRNA and adenoviral vector-based vaccines encode the SARS-CoV-2 surface spike protein as the immunogen, while the inactivated vaccine was made of inactivated whole virions. All these first-generation vaccines were designed based on the original SARS-CoV-2 strain circulating during the early pandemic. However, SARS-CoV-2 has evolved significantly during the first two years of worldwide spread and several variants of concern, such as alpha (lineage B.1.1.7), beta (B.1.351), delta (B.1.617.2), and the most recent omicron (B.1.1.529) variants have emerged. Unfortunately, the omicron variant and its various subvariants, unlike other SARS-CoV-2 variants, carry more than thirty non-synonymous mutations in the spike protein, largely evading the antibodies generated from current vaccinations, which lost the ability to neutralize omicron and subvariants, resulting in a high incidence of breakthrough infections worldwide, thereby necessitating next-generation vaccination designs to overcome viral immune evasion.
The present invention provides a novel next-generation vaccine that elicits heterotypic immunity against sarbecoviruses via the enhancement of protective B and T cell immunity.
In one aspect of the present invention, there is provided a construct comprising a modified genome of a sarbecovirus, wherein the modified genome comprises a modified envelope gene and a nucleic acid encoding an interferon integrated into the genome. In some embodiments, the construct comprises a nucleic acid fragment inserted into the viral genome that encodes an interferon. In some embodiments, the nucleic acid encodes an interferon that replaces viral open reading frame 8 (ORF8). In some embodiments, the interferon is type I interferon. In some embodiments, the interferon is interferon-beta (IFNβ).
In some embodiments according to any of the constructs described above, the modified envelope gene comprises one or more stop codons. In some embodiments, the modified envelope gene comprises at least three stop codons. In some embodiments, at least one stop codon is present at the 5′-terminal 100 nucleic acids of the modified envelope gene. In some embodiments, the construct further comprises at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified genome to be deleted and/or inactivated by introducing a stop codon.
In some embodiments according to any of the constructs described above, the sarbecovirus is selected from the group consisting of SARS-CoV, SARS-CoV-2, SARS-CoV-2 B.1.1.7, SARS-CoV-2 B.1.351, SARS-CoV-2 B1.617.2, SAR-CoV-2 B.1.1.529, SC2r-CoV, RaTG13, SC2r-CoV GX-PSL, and SARS-CoV combined variants of concern (VOC). In some embodiments, the sarbecovirus is SARS-CoV-2.
In some embodiments according to any of the constructs described above, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene. In some embodiments, the variant spike gene is BA.2, BA.5, BA.2.75.2, BQ.1, BQ.1.1, or XBB.
In one aspect, there is provided a recombinant sarbecovirus comprising any of the constructs described herein.
In one aspect, there is provided a sarbecovirus vaccine comprising any of the recombinant sarbecovirus described herein.
In some embodiments according to any of the sarbecovirus vaccines described above, the sarbecovirus vaccine is formulated for mucosal administration. In some embodiments, the sarbecovirus vaccine is formulated as a nasal spray. In some embodiments, the sarbecovirus vaccine is formulated for parenteral administration, such as for intradermal or intramuscular administration.
In one aspect, there is provided a host cell (such as for producing any of the recombinant sarbecovirus described herein) comprising any of the constructs described herein. In some embodiments, the host cell is defective in interferon signaling. In some embodiments, the host cell comprises a mutation (e.g., knockout) in a gene selected from the group consisting of STAT1, IRF9, STAT2, IFNAR1, IFNAR2, type I interferon, and type III interferon. In some embodiments, the host cell comprises a mutation (e.g., knockout) in the STAT1 gene. Defective interferon signaling can also be accomplished, for example, by inhibiting the expression of any proteins involved in the interferon signaling pathway, which include, for example, STAT1, IRF9, STAT2, IFNAR1, IFNAR2, type I interferon, and type III interferons.
In some embodiments according to any of the host cells described above, the host cell further comprises a heterologous nucleic acid encoding a viral envelope protein. In some embodiments, the nucleic acid sequence of the heterologous nucleic acid encoding the viral envelope protein has less than about 60% sequence identity to the sequence of the modified or naturally existing viral envelope gene. In some embodiments, the nucleic acid sequence of the heterologous nucleic acid encoding the envelope protein has less than about 80% sequence identity to the sequence of the naturally existing viral envelope gene.
In one aspect, there is provided a method of making a recombinant sarbecovirus, comprising culturing any of the host cells described herein and isolating the recombinant sarbecovirus.
In one aspect, there is provided a method of vaccinating an individual (e.g., human) against a sarbecovirus, comprising administering any of the sarbecovirus vaccines described herein to the individual. In some embodiments, the method of vaccinating an individual comprises a method of prophylactically immunizing an individual. In some embodiments, the method of vaccinating an individual comprises a method of preventing an individual from contracting a sarbecovirus infection. In some embodiments, the method of vaccinating an individual comprises a method of reducing the severity of a sarbecovirus infection in an individual. In some embodiments, the method of vaccinating an individual further comprises a method of treating an individual having a sarbecovirus infection. In some embodiments, the method of vaccinating an individual comprises a method of eliciting an immune response in an individual.
In some embodiments according to any of the vaccinating methods described above, the sarbecovirus vaccine is administered intranasally.
In some embodiments according to any of the vaccinating methods described above, the sarbecovirus vaccine is administered once. In some embodiments, the sarbecovirus vaccine is administered more than once, optionally with an interval of about two weeks to about one year.
In some embodiments according to any of the vaccinating methods described above, the sarbecovirus vaccine is administered at a dose of about 105 PFU to about 1010 PFU.
In some embodiments according to any of the vaccinating methods described above, the individual is a human individual.
These and other aspects and advantages of the present invention will become apparent from the subsequent detailed description and the appended claims. It is to be understood that one, some, or all of the properties of the various embodiments described herein may be combined to form other embodiments of the present invention.
The disclosures of all publications, patents, patent applications and published patent applications referred to herein are hereby incorporated herein by reference in their entirety.
The rapid mutation rate of sarbecoviruses, such as SARS-CoV-2, presents a unique challenge to standard vaccination development models. For example, in the past year, SARS-CoV-2 has significantly evolved such that the omicron variant and its various subvariants largely evade the antibodies generated from current vaccinations, which have demonstrated reduced ability to neutralize omicron and its subvariants. Although the very recent introduction of the newly bivalent SARS-CoV-2 vaccine aims to overcome this problem for the omicron variant, invariably this approach requires continued production, testing, and approval of new vaccines that lag behind the speed of the evolution of new variants.
The present invention provides a novel universal sarbecovirus and universal sarbecovirus construct that comprises a nucleic acid encoding an interferon integrated into the viral genome in conjunction with the modification of the sarbecovirus envelope gene that inactivates the virus and makes it suitable to use safely for vaccination. This universal sarbecovirus vaccine acts to vaccinate, prophylactically immunize, prevent contraction, prevent transmission, reduce infection severity, ameliorate infection symptoms, treat infection, or elicit an immune response in an individual having or being exposed to a sarbecovirus infection of one or more heterotypic sarbecovirus species.
After extensive investigation, inventors of the present application discovered that the universal sarbecovirus construct encoding an interferon integrated into the viral genome and a modified envelope protein has several unexpected advantages compared to other vaccine constructs. Vaccination with the universal sarbecovirus construct described herein reduced SARS-CoV1 and SARS-CoV-2 infection and transmission. When provided after infection, vaccination reduced SARS-CoV-2 infection severity across multiple variants (i.e., alpha, delta, omicron). As well, integration of IFNβ in the universal vaccine construct preferentially enhanced mucosal immune response. This novel next-generation vaccine elicits heterotypic immunity against various species of sarbecoviruses via generation of protective B and T cell immunity (e.g., CD4+ T cells).
Also provided herein are host cells that comprise the novel universal sarbecovirus and/or universal sarbecovirus construct. These host cells optionally further comprise a sarbecovirus envelope gene and defective in interferon signaling for the generation and packaging of universal sarbecovirus vaccine, making them particularly suitable for packing recombinant sarbecovirus described herein.
Accordingly, in one aspect, the present invention provides a construct that comprises a modified genome of a sarbecovirus, wherein the modified genome comprises a modified envelope gene and a nucleic acid encoding an interferon integrated into the genome. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the construct comprises a nucleic acid that encodes an interferon that is inserted into the viral genome. In some embodiments, the nucleic acid encodes an interferon that replaces viral open reading frame 8 (ORF8). In some embodiments, the interferon is type I interferon, such as interferon β. In some embodiments, the modified envelope gene comprises one or more stop codons, such as at least three stop codons, which is present at the 5′-terminal 100 nucleic acids of the modified envelope gene. In some embodiments, the construct further comprises at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified genome to be deleted and/or inactivated by introducing a stop codon.
Thus, in one aspect, there is provided a recombinant sarbecovirus comprising the construct described herein. In another aspect, there is provided a sarbecovirus vaccine comprising the recombinant sarbecovirus.
Also provided are pharmaceutical compositions and kits comprising any of the IFN-producing sarbecovirus vaccines described herein, methods of preparing any of the IFN-producing sarbecovirus vaccines and the accompanying host cells described herein, and methods of use thereof for preventing or ameliorating viral infection, particularly SARS-CoV-2 viral infection.
The practice of the present invention will employ, unless indicated specifically to the contrary, conventional methods of virology, immunology, microbiology, molecular biology, and recombinant DNA techniques within the skill of the art, many of which are described below for the purpose of illustration. Such techniques are explained fully in the literature. See, e.g., Current Protocols in Molecular Biology or Current Protocols in Immunology, John Wiley & Sons, New York, N.Y. (2009); Ausubel et al., Short Protocols in Molecular Biology, 3rd ed., John Wiley & Sons, 1995; Sambrook and Russell, Molecular Cloning: A Laboratory Manual (3rd Edition, 2001); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); DNA Cloning: A Practical Approach, vol. I&II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., 1984); Nucleic Acid Hybridization (B. Hames & S. Higgins, eds., 1985); Transcription and Translation (B. Hames & S. Higgins, eds., 1984); Animal Cell Culture (R. Freshney, ed., 1986); Perbal, A Practical Guide to Molecular Cloning (1984) and other like references.
It will be understood by one of ordinary skill in the art that uracil and thymine can both be represented by ‘t’, instead of ‘u’ for uracil and T for thymine; in the context of a ribonucleic acid, it will be understood that T is used to represent uracil unless otherwise indicated.
The term “genomic RNA” as used herein refers to the heritable genetic information of an RNA virus. However, in the context of the present invention the term “genome” typically also refers to the genome of an RNA virus and hence an RNA genome having a ribonucleic acid sequence. The person skilled in the art will understand that the genome of an RNA virus may also be provided as a DNA sequence in a vector, such as a plasmid (or referred to as “DNA construct”). The RNA genome is then generated in a host cell following transfection of the host cell via transcription. Hence it will be understood that when referring to nucleic acid sequences of a positive-sense RNA virus, sequences in the “Sequence Listing” section can refer to RNA sequence (replacing “T” with “U”) or DNA sequence.
The term “gene” as used herein refers to a DNA or RNA locus of heritable genomic sequence which affects an organism's (e.g., RNA virus) traits by being expressed as a functional product or by regulation of gene expression. Genes and polynucleotides may include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs, such as an open reading frame (ORF), comprising a start codon (methionine codon) and a translation stop codon. Genes and polynucleotides can also include regions that regulate their expression, such as transcription initiation, translation, and transcription termination. Thus, also included are regulatory elements such as a promoter.
The terms “nucleic acid”, “nucleotide”, and “polynucleotide” as used herein are used interchangeably and refer to a single or double-stranded polymer of deoxyribonucleotide bases or ribonucleotide bases read from the 5′ to the 3′ end and include double stranded DNA (dsDNA), single stranded DNA (ssDNA), single stranded RNA (ssRNA, negative-sense and positive-sense), double stranded RNA (dsRNA), genomic DNA, cDNA, cRNA, recombinant DNA, or recombinant RNA and derivatives thereof, such as those containing modified backbones.
The term “ribonucleic acid”, “RNA” or “RNA oligonucleotide” as used herein describes a molecule consisting of a sequence of nucleotides, which are built of a nucleobase a ribose sugar, and a phosphate group. RNAs are usually single stranded molecules and can exert various functions.
The terms “upstream” and “downstream” refer to a relative position in DNA or RNA. Each strand of DNA or RNA possesses a 5′ end and a 3′ end, relating to the terminal carbon position of the deoxyribose or ribose units. By convention, “upstream” means towards the 5′ end of a polynucleotide, whereas “downstream” means towards the 3′ end of a polynucleotide. In the case of double stranded DNA, e.g., genomic DNA, the term “upstream” means towards the 5′ end of the coding strand, whereas “downstream” means towards the 3′ end of the coding strand.
The term “coding strand” or “positive-sense strand” refers to an RNA strand encoding for proteins.
The term “non-coding strand” “anti-sense strand” or “negative-sense strand” or “negative-strand” refers to an RNA strand that needs to be transcribed by an RNA-dependent RNA polymerase into a positive strand RNA prior to translation.
The term “encodes” and “codes for” refers broadly to any process whereby the information in a polymeric macromolecule is used to direct the production of a second molecule that is different from the first. The second molecule may have a chemical structure that is different from the chemical nature of the first molecule. For example, the term “encode” describes the process of semiconservative DNA replication, where one strand of a double-stranded DNA molecule is used as a template to encode a newly synthesized complementary sister strand by a DNA-dependent DNA polymerase. Further, a DNA molecule can encode an RNA molecule (e.g., by use of a DNA-dependent RNA polymerase) or an RNA molecule (negative stranded) can encode an RNA molecule (positive-stranded) (e.g., by use of an RNA-dependent RNA polymerase). Also, an RNA molecule (positive-stranded) can encode a polypeptide, as in the process of translation. When used to describe the process of translation, the term “encode” also extends to the triplet codon that encodes an amino acid. An RNA molecule can also encode a DNA molecule, e.g., by the process of reverse transcription using an RNA-dependent DNA polymerase. When referring to a DNA molecule encoding a polypeptide, a process of transcription and translation is referred to.
The term “heterologous polypeptide” or “heterologous protein” as used herein refers to a protein derived from a different organism or a different species from the recipient, e.g., the RNA virus or the host cell. In the context of the present invention the skilled person would understand that it refers to a protein not naturally expressed by the virus or the host cell. The term “heterologous” when used with reference to portions of a protein may also indicate that the protein comprises two or more amino acid sequences that are not found in the same relationship to each other in nature.
The term “expression” as used herein refers to transcription and/or translation of a heterologous nucleic acid sequence within a host cell. The level of expression of a gene product of interest in a host cell may be determined on the basis of either the amount of the corresponding mRNA (or positive-stranded RNA) that is present in the cell, or the amount of the polypeptide encoded by the selected sequence. For example, RNA transcribed from a selected sequence can be quantified by Northern blot hybridization, ribonuclease RNA protection, in situ hybridization to cellular RNA, or by PCR, such as qPCR. Proteins encoded by a selected sequence can be quantitated by various methods, e.g., by ELISA, by Western blotting, by radioimmunoassay, by immunoprecipitation, by assaying for the biological activity of the protein, by immunostaining of the protein followed by FACS analysis or by homogeneous time-resolved fluorescence (HTRF) assays. The level of expression of a non-coding RNA, such as a miRNA or shRNA may be quantified by PCR, such as qPCR.
A “reference strain” of a virus is a strain that does not comprise any of the human made mutations as described herein and is the viral strain on which all other versions thereof are compared. For example, the reference SARS-CoV-2 virus is the originally isolated strain from Wuhan, China (see SEQ ID NO: 1) and described by NIH GenBank Locus NC_045512 and as the hCoV-19 reference sequence by the Global Initiative on Sharing Avian Influenza Data (GISAID).
As used herein, the term “treatment” refers to clinical intervention designed to alter the natural course of the infection in an individual or cell being treated prophylactically or during the course of clinical pathology. Desirable effects of treatment include ameliorating or reducing the sarbecovirus infection and symptoms thereof and eliciting an immune response to induce the amelioration or reduction of the infection and symptoms thereof. For example, an individual is successfully “treated” if one or more symptoms associated with sarbecovirus infection are prevented, mitigated, or eliminated, including, but not limited to, increasing the quality of life of those suffering from the infection, decreasing the dose of other medications required to treat the infection, and/or prolonging survival of individuals.
As used herein, an “effective amount” refers to an amount of an agent or drug effective to vaccinate or treat a sarbecovirus infection in a subject. The “therapeutically effective amount” can vary depending on the compound or the cell, the disease and its severity and the age, weight, etc., of the subject to be treated.
As used herein, an “individual” or a “subject” refers to a mammal, including, but not limited to, human, bovine, horse, feline, canine, rodent, or primate. In some embodiments, the individual is a human.
The term “vaccine” is used in the broadest sense and specifically covers any biological preparation that provides active acquired immunity to a particular infectious disease.
As used herein, the term “vaccinate” refers to clinical intervention designed to administer a therapeutically effective amount of a vaccine to an individual in need thereof in order to prevent infection, prophylactically immunize, prevent transmission, reduce severity, elicit an immune response, or treat an infection in an individual who has been or may be exposed to a pathogen such as viruses. For example, an individual who is effectively vaccinated may not contract or may contract only mild illness caused by an infection compared to an individual who is not vaccinated.
As used herein, “percent (%) amino acid sequence identity” and “homology” with respect to a peptide, polypeptide or antibody sequence are defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific peptide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or MEGALIGN™ (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
As used herein, “percent (%) nucleic acid sequence identity” and “homology” with respect to a nucleic acid, DNA, or RNA sequence are defined as the percentage of nucleic acid nucleotides in a candidate sequence that are identical with the nucleic acid nucleotides in the specific DNA or RNA sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or MEGALIGN™ (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
The term “vector,” as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as “expression vectors.”
The term “cell” includes the primary subject cell and its progeny.
It is understood that embodiments of the invention described herein include “consisting” and/or “consisting essentially of” embodiments.
Reference to “about” a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X”.
As used herein, reference to “not” a value or parameter generally means and describes “other than” a value or parameter. For example, the method is not used to treat cancer of type X means the method is used to treat cancer of types other than X.
The term “about X-Y” used herein has the same meaning as “about X to about Y.”
As used herein and in the appended claims, the singular forms “a,” “or,” and “the” include plural referents unless the context clearly dictates otherwise.
Sarbecovirus Vaccine Constructs
Sarbecovirus is a subgenus of the Betacoronavirus genus within the Coronaviridae family of viruses. Examples of sarbecoviruses include, but are not limited to, SARS-CoV/SARS-CoV-1, SARS-CoV-2, SC2r-CoV, SC2r-CoV GX-PSL, Bat CoV BtKY72, Bat CoV BM48-31, 16BO133, JTMC15, Bat SARS CoV Rf1, BtCoV HKU3, LYRa11, Bat SARS-CoV/Rp3, Bat SL-CoV YNLF_31C, Bat SL-CoV YNLF_34C, SHC014-CoV, WIV1, WIV16, Civet SARS-CoV, (Bat) Rc-o319, Bat SL-ZXC21, Bat SL-ZC45, Pangolin SARSr-CoV-GX, Pangolin SARSr-CoV-GD, Rs7327, Rs4231, Rs4084, Rf4092, JL2012, 273-2005, HeB2013, HuB2013, Rs4247, Longquan-140, HKU3-1, GX2013, Shaanxi2011, 279-2005, As6526, Yunnan2011, Rs4237, Rs4081, Bat RshSTT182, Bat RshSTT200, (Bat) RacCS203, (Bat) RmYN02, (Bat) RpYN06, YN2013, (Bat) RaTG13, (Bat) BANAL-52, and SARS-CoV-2 combined variants of concern (VOC) (for example, see Nature (2022) 603:913-918, hereby incorporated by reference in its entirety). A SARS-CoV-2 variant is defined as being a “variant of concern” (VOC) upon demonstration of the following: (i) an increase in transmissibility or other detrimental change in epidemiology, (ii) an increase in virulence or change in clinical disease presentation, (iii) escape from immunity derived from natural infection, and/or (iv) a decrease in effectiveness of public health or clinical counter-measures, such as vaccination, treatment in current clinical use, testing if the impact is such that it is not easily mitigated by standard, and laboratory quality and regulatory measures. Sarbecoviruses are generally understood to be enveloped, positive-sense single-stranded RNA viruses that enter host cells by binding to the angiotensin-converting enzyme 2 (ACE2) receptor. For example, SARS-CoV-2 binds both ACE2 and TMPRSS2, both of which are expressed by epithelial cells that can be found in various tissues, such as prostate, testis, ovary, uterus, breast, lung, oral, cardiac, nasal passageway, ileum, intestine, colon, stomach, thyroid, liver, gallbladder, pancreas, kidney, bladder, cornea, neural, placental, etc. Receptor expression levels are increased in various inflammatory disease states, including but not limited to, in hypertension, COPD, asthma, cardiovascular disease, diabetes, Crohn's disease (CD), inflammatory bowel disease (IBD), etc. As a result, individuals with any of these or similar diseases or with immunodeficiency diseases are at an increased risk for sarbecovirus infection and complications thereof.
The present invention provides a construct that comprises a modified genome of a sarbecovirus, wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) and a nucleic acid encoding an interferon integrated (e.g., inserted) into the genome. In some embodiments, the construct comprising a modified genome of a sarbecovirus is a viral RNA construct. In some embodiments, the construct is an RNA viral vector. In some embodiments, the construct is an RNA molecule. In some embodiments, the construct is a DNA vector, such as Bacterial artificial chromosome (BAC) construct. In some embodiments, the construct comprising a modified genome of a sarbecovirus is a DNA polynucleotide encoding the modified viral RNA genome, such as in a DNA plasmid. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the modified envelope gene does not produce any functional envelope protein. This can be accomplished, for example, by incorporating one or more stop codons into the envelope protein coding sequence, or by introducing mutations into the envelope protein coding sequence that makes the protein expressed therefrom non-functional. In some embodiments, the modified envelope gene comprises one or more stop codons. In some embodiments, the modified envelope gene comprises at least three, such as at least any of 4, 5, 6, 7, 8, 9, 10, or more stop codons. In some embodiments, at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleotides of the modified envelope gene, for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleotides of the modified envelope gene. In some embodiments when the modified envelope gene comprises two or more stop codons, the stop codons are clustered together or spread out (e.g., evenly or unevenly) over the entire gene sequence (e.g., viral RNA gene sequence, including an RNA sequence or a reverse-transcribed DNA sequence thereof). In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted and/or inactivated, for example by introducing one or more stop codons. In some embodiments, at least a functional portion of (e.g., the entirety of) ORF6 in the modified viral genome is deleted and/or inactivated, for example by introducing one or more stop codons. In some embodiments, at least a functional portion of (e.g., the entirety of) ORF7a in the modified viral genome is deleted and/or inactivated, for example by introducing one or more stop codons. In some embodiments, at least a functional portion of (e.g., the entirety of) ORF7b in the modified viral genome is deleted and/or inactivated, for example by introducing one or more stop codons. In some embodiments, at least a functional portion of (e.g., the entirety of) ORF8 in the modified viral genome is deleted and/or inactivated, for example by introducing one or more stop codons. In some embodiments, a functional portion of (e.g., the entirety of) each of 2, 3, or 4 of ORF6, ORF7a, ORF7b, and ORF8 in the modified viral genome is deleted and/or inactivated, for example by introducing one or more stop codons.
In some embodiments, the wildtype envelope gene (e.g., SARS-CoV-2 wildtype envelope gene, e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) comprises a nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the modified envelope gene comprises one or more mutations (e.g., frameshift, non-sense, missense, insertion, deletion, and/or substitution), such as in reference to SEQ ID NO: 12. In some embodiments, the modified envelope gene comprises a nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the nucleic acid encoding the modified envelope gene has at least about 80% (such as at least about any of 85%, 90%, 95%, 96%, 97%, 98%, 99%, or higher) nucleic acid sequence identity to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the modified envelope gene encodes a modified envelope protein comprising the sequence of SEQ ID NO: 13.
In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is Type III interferon. In some embodiments, the interferon is interferon (3 (IFNβ). In some embodiments, the IFNβ is encoded by a nucleic acid having the sequence of SEQ ID NO: 10 or 11, or a variant thereof having at least about 80% (such as at least about any of 85%, 90%, 95%, 96%, 97%, 98%, 99%, or higher) amino acid sequence identity to that of an interferon encoded by the nucleic acid having the sequence of SEQ ID NO: 10 or 11. In some embodiments, the nucleic acid encoding the interferon has at least about 80% (such as at least about any of 85%, 90%, 95%, 96%, 97%, 98%, 99%, or higher) nucleic acid sequence identity to the nucleic acid sequence of SEQ ID NO: 10 or 11. In some embodiments, the human IFNβ nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the mouse IFNβ nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 11.
In some embodiments, the nucleic acid encoding the interferon is inserted at a location between ORF6 and ORF9b of the sarbecovirus genome, such as at ORF6, ORF7a, ORF7b, or ORF8, or anywhere between these ORFs. In some embodiments, the nucleic acid encoding the interferon replaces any one of ORF6, ORF7a, ORF7b, or ORF8 (or functional portion thereof), or any sequences between these ORFs, in the modified viral genome. In some embodiments, the nucleic acid encoding the interferon replaces ORF8 (or functional portion thereof) in the modified viral genome.
Thus, in some embodiments, there is provided a construct comprising a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) and a nucleic acid encoding an interferon integrated into the genome. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a construct comprising a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof), wherein the modified envelope gene does not produce any functional envelope protein, and a nucleic acid encoding an interferon integrated into the genome. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a construct comprising a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises i) a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof), wherein the modified envelope gene comprises one or more stop codons (such as at least any of 3, 4, 5, 6, 7, 8, 9, 10, or more stop codons), and ii) a nucleic acid encoding an interferon integrated into the genome. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleotides of the modified envelope gene, for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleotides of the modified envelope gene. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a construct comprising a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) and a nucleic acid encoding an interferon inserted between ORF6 and ORF9b. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome. In some embodiments, the nucleic acid encoding the interferon replaces ORF8 in the modified viral genome. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a construct comprising a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises i) a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof), wherein the modified envelope gene does not produce any functional envelope protein, and ii) a nucleic acid encoding an interferon inserted between ORF6 and ORF9b. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome. In some embodiments, the nucleic acid encoding the interferon replaces ORF8. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a construct comprising a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises i) a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof), wherein the modified envelope gene comprises one or more stop codons (such as at least any of 3, 4, 5, 6, 7, 8, 9, 10, or more stop codons), and ii) a nucleic acid encoding an interferon inserted between ORF6 and ORF9b. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome. In some embodiments, the nucleic acid encoding the interferon replaces ORF8 in the modified viral genome. In some embodiments, the at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleic acids of the modified envelope gene, for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleic acids of the modified envelope gene. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted.
In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, the construct comprises a nucleic acid sequence of any one of SEQ ID NOs: 2-9. In some embodiments, the construct comprises a nucleic acid sequence of any one of SEQ ID NOs: 2-7. In some embodiments, the construct comprises a nucleic acid sequence of SEQ ID NO: 8 or 9.
The present invention also provides a recombinant sarbecovirus comprising any of the constructs described herein. Because the genome of the sarbecoviruses comprises a defective envelope gene (e.g., viral RNA gene), they can be packaged in a host cell supplementing a functional envelope gene but cannot replicate themselves. In some embodiments, the recombinant sarbecovirus comprising any of the constructs described herein are packaged in a host cell as a viral RNA construct. In some embodiments, the recombinant sarbecovirus comprising any of the constructs described herein are packaged in a host cell as a DNA polynucleotide encoding the modified viral RNA genome, such as in a DNA plasmid. In some embodiments, the recombinant sarbecovirus comprises a viral RNA construct.
In another aspect, there is provided a sarbecovirus vaccine comprising any of the recombinant sarbecovirus described herein. The vaccine can further comprise, for example, adjuvants or excipients suitable for vaccination. In some embodiments, the sarbecovirus vaccine is formulated for mucosal administration, including for example as a nasal spray or nasal drops.
Thus, for example, in some embodiments, there is provided a recombinant sarbecovirus (such as SARS-CoV-2) or a vaccine comprising the recombinant sarbecovirus, wherein the sarbecovirus comprises a construct comprising a modified genome of a sarbecovirus, wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) and a nucleic acid encoding an interferon integrated into the genome. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the vaccine is formulated for mucosal administration, such as intranasal administration. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a recombinant sarbecovirus (such as SARS-CoV-2) or a vaccine comprising the recombinant sarbecovirus, wherein the sarbecovirus comprises a construct comprising a modified genome of a sarbecovirus, wherein the modified genome comprises i) a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof), wherein the modified envelope gene does not produce any functional envelope protein, and ii) a nucleic acid encoding an interferon integrated into the genome. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the vaccine is formulated for mucosal administration, such as intranasal administration. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a recombinant sarbecovirus (such as SARS-CoV-2) or a vaccine comprising the recombinant sarbecovirus, wherein the sarbecovirus comprises a construct comprising a modified genome of a sarbecovirus, wherein the modified genome comprises i) a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof), wherein the modified envelope gene comprises one or more stop codons (such as at least any of 3, 4, 5, 6, 7, 8, 9, 10, or more stop codons), and ii) a nucleic acid encoding an interferon integrated into the genome. In some embodiments, the vaccine is formulated for mucosal administration, such as intranasal administration. In some embodiments, the at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleic acids of the modified envelope gene, for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleic acids of the modified envelope gene. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a recombinant sarbecovirus (such as SARS-CoV-2) or a vaccine comprising the recombinant sarbecovirus, wherein the sarbecovirus comprises a construct comprising a modified genome of a sarbecovirus, wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) and a nucleic acid encoding an interferon inserted between ORF6 and ORF9b. In some embodiments, the vaccine is formulated for mucosal administration, such as intranasal administration. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome. In some embodiments, the nucleic acid encoding the interferon replaces ORF8 in the modified viral genome. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a recombinant sarbecovirus (such as SARS-CoV-2) or a vaccine comprising the recombinant sarbecovirus, wherein the sarbecovirus comprises a construct comprising a modified genome of a sarbecovirus, wherein the modified genome comprises i) a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof), wherein the modified envelope gene does not produce any functional envelope protein, and ii) a nucleic acid encoding an interferon inserted between ORF6 and ORF9b. In some embodiments, the vaccine is formulated for mucosal administration, such as intranasal administration. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome. In some embodiments, the nucleic acid encoding the interferon replaces ORF8 in the modified viral genome. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon β. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a recombinant sarbecovirus (such as SARS-CoV-2) or a vaccine comprising the recombinant sarbecovirus, wherein the sarbecovirus comprises a construct comprising a modified genome of a sarbecovirus, wherein the modified genome comprises i) a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof), wherein the modified envelope gene comprises one or more stop codons (such as at least any of 3, 4, 5, 6, 7, 8, 9, 10, or more stop codons), and ii) a nucleic acid encoding an interferon inserted between ORF6 and ORF9b. In some embodiments, the vaccine is formulated for mucosal administration, such as intranasal administration. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome. In some embodiments, the nucleic acid encoding the interferon replaces ORF8 in the modified viral genome. In some embodiments, the at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleotides of the modified envelope gene, for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleotides of the modified envelope gene. In some embodiments, the interferon is Type I interferon. In some embodiments, the interferon is interferon R. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, the recombinant sarbecovirus or the vaccine comprising the recombinant sarbecovirus comprises a construct that comprises a nucleic acid sequence of any of SEQ ID NOs: 2-9. In some embodiments, the construct comprises a nucleic acid sequence of any of SEQ ID NOs: 2-7. In some embodiments, the construct comprises a nucleic acid sequence of SEQ ID NO: 8 or 9.
Sarbecovirus
In some embodiments, the sarbecovirus is selected from the group consisting of SARS-CoV, SARS-CoV-2, SARS-CoV-2 B.1.1.7, SARS-CoV-2 B.1.351, SARS-CoV-2 B1.617.2, SAR-CoV-2 B.1.1.529, SC2r-CoV, RaTG13, SC2r-CoV GX-PSL, and SARS-CoV combined VOC. In some embodiments, the sarbecovirus is SARS-CoV-2. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene. In some embodiments, the variant spike gene is BA.2, BA.5, BA.2.75.2, BQ.1, BQ.1.1, or XBB.
The SARS-CoV-2 virus has a single-stranded RNA genome with about 29891 nucleotides that encode about 9860 amino acids. A SARS-CoV-2 selected RNA genome can be copied and made into a DNA by reverse transcription and formation of a cDNA. A linear SARS-CoV-2 DNA can be circularized by ligation of SARS-CoV-2 DNA ends.
As used herein, a “SARS-CoV-2 genome” refers to the 29903 nucleotide sequence described by NIH GenBank Locus NC_045512, or the hCoV-19 reference sequence described by the Global Initiative on Sharing Avian Influenza Data (GISAID). A DNA sequence for the SARS-CoV-2 genome, with coding regions, is available as accession number NC_045512.2 from the NCBI website (provided as SEQ ID NO: 1 herein). In some embodiments, the recombinant SARS-CoV-2 construct comprises SEQ ID NO: 1 or its encoded RNA sequence (i.e., substituting T with U), or a sequence comprising at least about 90% sequence identity (such as at least about any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) to the sequence of SEQ ID NO: 1 or its encoded RNA sequence.
Viral genomes comprise subunits known as open reading frames (ORFs) that may encode for viral proteins. Within the SARS-CoV-2 genome, these subunits may include ORF 1ab, RNA-dependent RNA polymerase, helicase, gene S, nsp3, nsp4B, nsp9, ORF3a, gene E, gene M/ORF5, ORF6, ORF7a, ORF7b, ORF8, gene N/ORF9, and ORF10. Each of these subunits corresponds to sections of SEQ ID NO:1 as described in Table 1 below.
ORF1ab encodes a large polyprotein that encompasses multiple of the proteins encoded by other ORFs described herein, as indicated in Table 1 below. Nsp3 encodes a protein that includes a transmembrane domain 1 (TM1), which has NCBI accession no. YP_009725299.1. The nsp3 protein has additional conserved domains including an N-terminal acidic (Ac), a predicted phosphoesterase, a papain-like proteinase, Y-domain, transmembrane domain 1 (TM1), and an adenosine diphosphate-ribose 1″-phosphatase (ADRP). Nsp4b encodes a protein that includes transmembrane domain 2 (TM2), which has NCBI accession no. YP_009725300. Nsp9 encodes a ssRNA-binding protein with NCBI accession number YP_009725305.1. Genes E, M, S, and N encode the envelope, membrane, spike, and nucleocapsid proteins, respectively. The viral envelope protein is a membrane protein that is involved in viral assembly, budding, and envelope formation. Viral membrane proteins attach the virus to the host cell and promote fusion between viral and host cell membranes for viral entry. The viral spike protein binds to specific receptors on the host cell to engage in viral entry of host cells and initiation of host cell infection. The viral nucleocapsid protein binds to and encapsulates the viral RNA. Together, these four proteins make up the integral structural proteins found in sarbecoviruses, e.g., in SARS-CoV-2.
In some embodiments, the recombinant SARS-CoV-2 construct does not comprise any portion of the nucleotide sequences for any one or more of ORF 1ab, RNA-dependent RNA polymerase, helicase, gene S, nsp3, nsp4B, nsp9, ORF3a, gene E, ORF5, ORF6, ORF7a, ORF7b, ORF8, ORF9, and ORF10. In some embodiments, the recombinant SARS-CoV-2 construct comprises a portion (e.g., no more than about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%) of the nucleotide sequence for any one or more of ORF 1ab, RNA-dependent RNA polymerase, helicase, gene S, nsp3, nsp4B, nsp9, ORF3a, gene E, ORF5, ORF6, ORF7a, ORF7b, ORF8, ORF9, and ORF10. In some embodiments, the recombinant SARS-CoV-2 construct comprises a full length or a portion (e.g., at least about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%) of the nucleotide sequence for any one or more of ORF 1ab, RNA-dependent RNA polymerase, helicase, gene S, nsp3, nsp4B, nsp9, ORF3a, gene E, ORF5, ORF6, ORF7a, ORF7b, ORF8, ORF9, and ORF10. In some embodiments, the recombinant SARS-CoV-2 construct comprises a full length or a portion (e.g., at least about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%) of the nucleotide sequence for any one or more of ORF 1ab, RNA-dependent RNA polymerase, helicase, gene S, nsp3, nsp4B, nsp9, ORF3a, gene E, ORF5, ORF6, ORF7a, ORF7b, ORF8, ORF9, and ORF10, wherein the full length or a portion of the nucleotide sequence comprises a frameshift mutation, a deletion, an insertion, a non-sense mutation, or a missense mutation, which may further render no protein translation at all or no translation of a functional viral protein.
In some embodiments, the foregoing nucleotide sequences are DNA sequences. In some embodiments, the foregoing nucleotide sequences are RNA sequences (e.g., replacing the “T” in DNA sequence with “U”. In some embodiments, the SARS-CoV-2 nucleic acids used in the recombinant SARS-CoV-2 constructs described herein are DNA sequences. In some embodiments, the SARS-CoV-2 nucleic acids used in the recombinant SARS-CoV-2 constructs described herein are RNA sequences. In some embodiments, the recombinant SARS-CoV-2 constructs described herein comprise both DNA and RNA sequences (e.g., SARS-CoV-2 DNA sequences and SARS-CoV-2 RNA sequences). It is to be understood that, when the SARS-CoV-2 construct is RNA, the nucleotide sequence of the construct would be the RNA sequence corresponding to the DNA sequences provided herein, e.g., replacing “T” with “U”.
In addition, the sarbecovirus genome, e.g., SARS-CoV-2 genome, can naturally have structural variations that are reflections of sequence variations that arise as the sarbecovirus genome mutates over time in response to evolutionary pressures. Thus, the sarbecovirus can be a variant sarbecovirus that has one or more mutations in the genomic sequence compared to the reference sarbecovirus (e.g., the SARS-CoV-2 virus of SEQ ID NO: 1), wherein the one or more mutations contribute to phenotypic differences, such as increased viral fitness, including for example, infectivity, virulence, and/or drug resistance. For example, the genomes of widespread variant SARS-CoV-2 viruses have shown an increase in transmissibility and infectiousness as well as a decrease in mortality. As a result, currently available vaccines and treatments have become less effective at vaccinating or treating individuals against the variants that are increasingly divergent in nucleic acid sequence identity from the reference SARS-CoV-2. A variant further can be termed a variant of interest, a variant of concern, or a variant of high consequence. In some embodiments, the sarbecovirus is a SARS-CoV-2 virus that further is a variant selected from the group consisting of a B.1.1.7 variant, a B.1.351 variant, a B.1.526 variant, a B1.526.1 variant, a B1.617 variant, a B.1.617.1 variant, a B.1.617.2 variant, a B1.617.3 variant, a P.2 variant, a P.1 (also known as B.1.1.28.1) variant, an A.23.1 variant, a CAL.20C variant, a B.1.427 variant, a B.1.429 variant, a B.1.525 variant, a BA.2, BA.5 variant, a BA.2.75.2 variant, a BQ.1 variant, a BQ.1.1 variant, an XBB variant, and a P.1.351 variant. Other variants of SARS-CoV-2 are known in the art. For example, see Gomez et al., Vaccines 9(3): 243, 2021 and Tang et al., Journal of Infection 82: e27-e28, 2021, which are incorporated herein by reference in their entirety.
Hence, the sarbecovirus used in the recombinant sarbecovirus vaccine or constructs described herein can, for example for SARS-CoV-2, have one or more nucleotide or amino acid differences from the sequences as indicated in Table 1 above. In some cases, the SARS-CoV-2 nucleic acids used in the recombinant sarbecovirus vaccine or constructs described herein can, for example, have two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty, twenty-five, thirty, or more nucleotide differences from the sequences as signified in reference to SEQ ID NO: 1 as shown in Table 1. In some embodiments, the recombinant SARS-CoV-2 construct can comprise a sequence that is at least about any of 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or higher homologous to a nucleotide sequence discussed above for one or more of ORF1ab, RNA-dependent RNA polymerase, helicase, gene S, nsp3, nsp4B, nsp9, ORF3a, gene E, ORF5, ORF6, ORF7a, ORF7b, ORF8, ORF9, ORF10, or a portion thereof. In some embodiments, the at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleotides of the modified envelope gene (e.g., viral RNA gene), for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleotides of the modified envelope gene. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene. In some embodiments, the recombinant sarbecovirus construct comprises a variant spike gene selected from any one of: BA.2, BA.5, BA.2.75.2, BQ.1, BQ.1.1, and XBB. In some embodiments, the recombinant sarbecovirus or recombinant sarbecovirus vaccine comprises a variant spike gene selected from any one of: BA.2, BA.5, BA.2.75.2, BQ.1, BQ.1.1, and XBB.
The recombinant SARS-CoV-2 constructs described herein can have portions of the SARS-CoV-2 genome, for example, the deletions of the genome can include at least about any of 5, 10, 20, 50, 100, 500, 1000, 1500, 2000, 2500, 3000, 4000, 5000 or more nucleotides of the SARS-CoV-2 genome. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene. In some embodiments, the recombinant sarbecovirus construct comprises a variant spike gene selected from any one of: BA.2, BA.5, BA.2.75.2, BQ.1, BQ.1.1, and XBB. In some embodiments, the recombinant sarbecovirus or recombinant sarbecovirus vaccine comprises a variant spike gene selected from any one of: BA.2, BA.5, BA.2.75.2, BQ.1, BQ.1.1, and XBB.
Exemplary SARS-CoV-2 variants and their properties are shown in the Table 2 below. The SARS-CoV-2 variants described herein are named according to the Phylogenetic Assignment of Named Global Outbreak (PANGO) Lineages software. It is understood that the same variants may be referred to using different naming systems and algorithms in the art. SARS-CoV-2 variant classifications and definitions, as well as a list of known SARS-CoV-2 variants can be found at worldwide web.cdc.gov/coronavirus/2019-ncov/variants/variant-info.html.
Interferons
Any suitable interferon can be used herein. Type-I and III interferon signaling provide key innate antiviral mechanisms against RNA virus infections (J Interferon Cytokine Res (2014) 34:649-58, hereby incorporated by reference in its entirety). Viral RNAs can be recognized by host pattern recognition receptors, such as RIG-I-like receptors and Toll-like receptors, which activate adaptors, kinases, and transcriptional factors, leading to induction of endogenous type-I/III interferons. Type-I interferons include 13 partially homologous IFNα subtypes in humans, IFNβ, IFNε, IFNτ, IFNκ, IFNω, IFNδ, and IFNζ (see, e.g., Immunol. Rev. (2004) 202, 8-32, hereby incorporated by reference in its entirety). The type III IFN family comprises IFNλ1, IFNλ2 and IFNλ3 (also called IL-29, IL-28A and IL-28B, respectively) and the recently identified IFNλ4 (see, e.g., J. Interferon Cytokine Res. (2014) 34, 829-838, hereby incorporated by reference in its entirety). The secreted interferons function as both paracrine and autocrine signals, protecting the neighboring uninfected cells and restricting virus replication in infected cells respectively. In addition, timely production of type-I interferons, such as IFNβ, by infected cells could optimally activate adaptive immune responses, shaping the effector and memory T cells (Immunology (2011) 132: 466-474, hereby incorporated by reference in its entirety). However, delayed type-I interferon signaling is the hallmark of coronavirus infections, including but not limited to SARS-CoV-1, MERS-CoV, and SARS-CoV-2 (Cell Host Microbe (2016) 19:181-193; J Clin Invest (2019) 129:3625-3639; Nat Commun (2021) 12:7092, hereby all incorporated by reference in their entirety). When compared to SARS-CoV-1, SARS-CoV-2 almost fully suppresses both type-I and type-III interferons in vitro (Clin Infect Dis (2020) 71:1400-1409, hereby incorporated by reference in its entirety). A handful of SARS-CoV-2 viral proteins function as potent interferon antagonists (Med Microbiol Immunol (2022) 1-7; Emerg Microbes Infect (2020) 9:1418-1428, hereby both incorporated by reference in their entirety). Thus, it is suggested that coronaviruses, especially SARS-CoV-2, can manipulate cellular induction of interferon signaling not only to escape the host antiviral response, but also to dampen host innate immunity and in turn lead to sub-optimal adaptive immunity. In some embodiments, the interferon is type I interferon, such as IFNβ.
SARS-CoV-2 encodes more than ten viral interferon antagonists for the inhibition of interferon signaling during early infection (see, e.g., Med Microbiol Immunol 2022 1-7; Emerg Microbes Infect. 2020 9:1418-1428, hereby both incorporated by reference in their entirety). The functional redundance of different antagonists suggests the importance of suppressing interferon signaling for successful infection. This is also supported by the evident that infection of SARS-CoV-2, as well as SARS-CoV-1, in ex vivo human lung tissues did not induce production of endogenous interferons (see, e.g., Clin Infect Dis 2020 71:1400-1409, hereby incorporated by reference in its entirety). In addition, early studies of SARS-CoV-1 have demonstrated that delayed type-I interferon is one of the key features contributing to viral pathogenesis in mouse models (see, e.g., Cell Host Microbe 2016 19:181-193, hereby incorporated by reference in its entirety), while blockade of interferon signaling impairs MERS-CoV-specific T cell responses and delays viral clearance (see, e.g., J Clin Invest. 2019 129:3625-3639, hereby incorporated by reference in its entirety).
In some embodiments, the IFNβ nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 10 or 11. In some embodiments, the human IFNβ nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the mouse IFNβ nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the production of integrated IFNβ depends on the sarbecovirus Transcriptional Regulatory Sequence (TRS).
Also provided herein are host cells for packaging and producing the recombinant sarbecoviruses described herein.
Suitable host cells can include, without limitation, higher eukaryotic cells such as mammalian cells. Suitable higher eukaryotic cells include, without limitation, invertebrate cells and insect cells, and vertebrate cells. In some embodiments, the present application provides methods of making the host cell, wherein the host cell is modified using standard genome or RNA editing techniques including, but not limited to, CRISPR/Cas (e.g., paired with homologous recombination-mediated repair), Bacterial Artificial Chromosome (BAC) recombineering, viral transduction, TALENS, zinc finger nuclease system (ZFN), or LEAPER (leveraging endogenous ADAR for programmable editing of RNA leveraging endogenous ADAR for programmable editing of RNA; see, e.g., Qu et al., Nat Biotechnol. 2019 September; 37(9):1059-1069, the content of which is incorporated herein by reference in its entirety), to generate host cells that express engineered sarbecovirus envelope protein and are deficient in IFN signaling. Standard methods for genome editing of host cells for expression of a viral envelope protein and deletion of STAT1 or other modulators of IFN signaling are well known in the art.
The host cell can be transfected as part of the standard methods of genome editing using any suitable methods known in the art, including, but not limited to, DEAE-dextran mediated delivery, calcium phosphate precipitate method, cationic lipids mediated delivery, liposome mediated transfection, electroporation, lentiviral transduction, microprojectile bombardment, receptor-mediated gene delivery, delivery mediated by polylysine, histone, chitosan, and peptides. Standard methods for transfection and transformation of cells for expression of a vector of interest are well known in the art.
In some embodiments, the host cell is deficient in IFN signaling. In some embodiments, the host cell comprises a mutation (such as a deletion) in a gene (e.g., host cell DNA gene) selected from the group consisting of STAT1, IRF9, STAT2, IFNAR1, IFNAR2, and type I and III interferons, which expresses no corresponding protein or renders the encoded protein non-functional. In some embodiments, the host cell is knocked out for any of IRF9, STAT2, IFNAR1, IFNAR2, and type I and III interferons. In some embodiments, the host cell is knocked out for STAT1. In some embodiments, the host cell is knocked out for STAT1 using the CRISPR/Cas genome editing technique. In some embodiments, the host cell is knocked out for STAT1 using CRISPR/Cas9.
“CRISPR” or “CRISPR gene editing” as used herein refers to a set of clustered regularly interspaced short palindromic repeats, or a system comprising such a set of repeats. “Cas”, as used herein, refers to a CRISPR-associated protein. A “CRISPR/Cas” system refers to a system derived from CRISPR and Cas, which can be used to silence, knock out, or mutate a target gene. The CRISPR system further comprises Cas proteins, including but not limited to, Cas9, Cas3, Csn2, Cas4, Cas12, Cas12a (Cpfl), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f, Cas12 g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, and Cas13d.
The CRISPR/Cas system is based on two elements. The first element is an endonuclease, or Cas, (e.g., Cas9 and MAD7) that has a binding site for the second element, which is the guide polynucleotide (e.g., guide RNA or gRNA). The guide polynucleotide (e.g., guide RNA) directs the Cas protein to double stranded DNA templates based on sequence homology. The Cas protein then cleaves that DNA template. By delivering the Cas protein and appropriate guide polynucleotides (e.g., guide RNAs) into a cell, the organism's genome is cut at a desired location. Following cleavage of a targeted genomic sequence by a Cas/gRNA complex, one of two alternative DNA repair mechanisms can restore chromosomal integrity: 1) non-homologous end joining (NHEJ), which generates insertions and/or deletions of a few base-pairs (bp) of DNA at the gRNA cut site, or 2) homology-directed repair (HDR), which can correct the lesion via an additional “bridging” DNA template that spans the gRNA cut site. CRISPR/Cas systems are classified by class and by type. Class 2 systems currently represent a single interference protein that is categorized into three distinct types (types II, V, and VI). Any class 2 CRISPR/Cas system suitable for gene editing, for example a type II, a type V, or a type VI system, is envisaged as within the scope of the instant disclosure. Exemplary Class 2 type II CRISPR systems include Cas9, Csn2, and Cas4. Exemplary Class 2, type V CRISPR systems include Cas12, Cas12a (Cpfl), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f, Cas12 g, Cas12h, Cas12i, and Cas12k (C2c5). Exemplary Class 2 Type VI systems include Cas13, Cas13a (C2c2), Cas13b, Cas13c, and Cas13d.
The CRISPR sequence, sometimes called a CRISPR locus, comprises alternating repeats and spacers. In a naturally-occurring CRISPR, the spacers usually comprise sequences foreign to the bacterium such as a plasmid or phage sequence. As described herein, spacer sequences may also be referred to as “targeting sequences.” In CRISPR/Cas systems for genetic engineering, the spacers are derived from the target gene sequence (the gRNA).
The targeting sequence can be designed or chosen using computer programs known to persons of ordinary skill in the art. The computer program can use variables, such as predicted melting temperature, secondary structure formation, predicted annealing temperature, sequence identity, genomic context, chromatin accessibility, % GC content, frequency of genomic occurrence (e.g., of sequences that are identical or are similar but vary in one or more spots as a result of mismatch, insertion, or deletion), methylation status, presence of single nucleotide polymorphisms (SNPs), and the like. Available computer programs can take as input NCBI gene IDs, official gene symbols, Ensembl Gene IDs, genomic coordinates, or DNA sequences, and create an output file containing sgRNAs targeting the appropriate genomic regions designated as input. The computer program may also provide a summary of statistics and scores indicating on- and off-target binding of the sgRNA for the target gene (Doench et al. (2016) Nat Biotechnol. 34: 184-191, hereby incorporated by reference in its entirety).
The target sequence is complementary to, and hybridizes with, the targeting sequence of the gRNA. The target nucleic acid sequence can comprise 20 nucleotides. The target nucleic acid can comprise less than 20 nucleotides. The target nucleic acid can comprise more than 20 nucleotides. The target nucleic acid can comprise at least about any of: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target nucleic acid can comprise at most about any of: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides.
The CRISPR/Cas system can thus be used to edit a target gene, such as a gene targeted for editing in the cells described herein, by adding or deleting a base pair, introducing a premature stop codon, or introducing a frame-shift mutation which thus decreases expression of the target, in part or completely. The CRISPR/Cas system can alternatively be used like RNA interference, turning off a target gene in a reversible fashion. In a mammalian cell, for example, the RNA can guide the Cas protein to a target gene promoter, sterically blocking RNA polymerases. Further aspects of the CRISPR/Cas system known to those of ordinary skill are described in PCT Publication Nos. WO 2017/049266 and WO 2017/223538, the entire contents of which are hereby incorporated by reference.
Defective interferon signaling can also be accomplished, for example, by inhibiting the expression of any proteins involved in the interferon signaling pathway, which include, for example, STAT1, IRF9, STAT2, IFNAR1, IFNAR2, and type I interferon, type II interferon, and type III interferons. Examples of technologies to prevent or inhibit protein expression include, but are not limited to, antisense oligonucleotides (ASO), short hairpin RNA (shRNA), small interfering RNA (siRNA), and microRNA (miRNA). Antisense oligonucleotides are short, synthetic, chemically modified chains of nucleotides that have the potential to target any gene product of interest. These ASOs act by binding to specific RNA molecules, which prevents protein translation from occurring for those bound RNA molecules. Short hairpin RNAs (shRNA) are short sequences of RNA that make tight hairpin turns and can be used to silence gene expression by RNA interference (RNAi), which targets the corresponding complementary RNA molecule for degradation. shRNAs can be stably integrated into a host cell via virus-mediated transduction. Small interfering RNAs are short double stranded RNAs (dsRNAs) or short duplexes of about 20-24 base pairs (bps) with two-nucleotide 3′ end overhangs that are transiently expressed in cells, such as host cells, following standard transfection methods (e.g., chemical transfection, electroporation, lipid-mediated cell membrane diffusion). These siRNA molecules activate the RNAi pathway, leading to the degradation of mRNAs in a sequence-specific manner dependent upon complementary binding of the target mRNA. miRNAs are small, single-stranded RNA molecules of about 18-25 bps. Similarly to RNAi, cells, such as host cells, use miRNAs to negatively regulate gene expression by repressing protein translation or directing sequence-specific degradation of target mRNAs.
In some embodiments, the host cell (e.g., VeroE6 cell or BHK21 cell) comprises a heterologous nucleic acid encoding a viral envelope protein. To avoid integration of the heterologous nucleic acid into the viral genome, in some embodiments, the nucleic acid sequence of the heterologous nucleic acid encoding the envelope protein has less than about 80% (such as less than about any of 75%, 70%, 65%, 60%, 55%, 50%, 45%, or 40%) sequence identity to the sequence of the modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) described herein (e.g., SEQ ID NO: 14). In some embodiments, the nucleic acid sequence of the heterologous nucleic acid encoding the envelope protein has less than about 80% (such as less than about any of 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 30%, 20%, 10%, or less) sequence identity to the sequence of the naturally existing viral envelope gene (e.g., SEQ ID NO: 12). In some embodiments, the heterologous nucleic acid encoding the envelope protein comprises the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the amino acid sequence translated from the heterologous nucleic acid comprises the amino acid sequence of SEQ ID NO: 16. In some embodiments, the heterologous nucleic acid encoding the envelope protein comprises at least about 30 (e.g., at least about any of 40, 50, 60, 70, 80, 90, or more) synonymous nucleotide substitutions to minimize the chance of recombination between the envelope transgene and viral genome. In some embodiments, the heterologous nucleic acid is cloned into a lentivirus vector cassette and transduced into the host cell. In some embodiments, the lentivirus vector cassette with the heterologous nucleic acid further comprises a human elongation factor-1 alpha (EF1α) promoter with the first EF1α intron, a puromycin resistance gene (PuroR) driven by an internal ribosomal entry site (IRES), and a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). In some embodiments, the expression of the heterologous nucleic acid is driven by the human EF1α promoter. In some embodiments, the expression of the heterologous nucleic acid is enhanced by the WPRE element that is located at the 3′ end of the heterologous nucleic acid. In some embodiments, the transfected host cell expresses the heterologous nucleic acid. In some embodiments, the transfected host cell produces the protein translated from the heterologous nucleic acid.
Thus, in some embodiments, there is provided a host cell (e.g., VeroE6 cell or BHK21 cell) comprising a construct, wherein the construct comprises a modified genome of a sarbecovirus (such as SARS-Cov-2), wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) and a nucleic acid encoding an interferon (such as Type I interferon, for example interferon β) integrated into the viral genome. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the modified envelope gene does not produce any functional envelope protein. In some embodiments, the modified envelope gene comprises one or more stop codons (such as at least any of 3, 4, 5, 6, 7, 8, 9, 10, or more stop codons). In some embodiments, the at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleotides of the modified envelope gene, for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleotides of the modified envelope gene. In some embodiments, the nucleic acid encoding the interferon is inserted between ORF6 and ORF9b of the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome, such as ORF8. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene, (e.g., BA.2, BA.5, BA.2.75.2, BQ.1, BQ.1.1, or XBB). In some embodiments, the host cell is knocked out for STAT1.
In some embodiments, there is provided a host cell (e.g., VeroE6 cell or BHK21 cell) comprising a construct, wherein the construct comprises a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) and a nucleic acid encoding an interferon (such as Type I interferon, for example interferon β) integrated into the viral genome, and wherein the host cell is defective in interferon signaling. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the host cell is knocked out for STAT1. In some embodiments, the modified envelope gene does not produce any functional envelope protein. In some embodiments, the modified envelope gene comprises one or more stop codons (such as at least any of 3, 4, 5, 6, 7, 8, 9, 10, or more stop codons). In some embodiments, the at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleotides of the modified envelope gene, for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleotides of the modified envelope gene. In some embodiments, the nucleic acid encoding the interferon is inserted between ORF6 and ORF9b of the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome, such as ORF8. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene.
In some embodiments, there is provided a host cell (e.g., VeroE6 cell or BHK21 cell) comprising a construct, wherein the construct comprises a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) and a nucleic acid encoding an interferon (such as Type I interferon, for example interferon β) integrated into the viral genome, and wherein the host cell further comprises a heterologous nucleic acid encoding a viral envelope protein. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the nucleic acid sequence of the heterologous nucleic acid encoding the envelope protein has less than about 80% (such as less than about any of 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 30%, 20%, 10%, or less) sequence identity to the sequence of the modified envelope gene (e.g., SEQ ID NO: 14). In some embodiments, the nucleic acid sequence of the heterologous nucleic acid encoding the envelope protein has less than about 80% sequence identity to the naturally occurring envelope gene, (e.g., SEQ ID NO: 12). In some embodiments, the modified envelope gene does not produce any functional envelope protein. In some embodiments, the modified envelope gene comprises one or more stop codons (such as at least any of 3, 4, 5, 6, 7, 8, 9, 10, or more stop codons). In some embodiments, the at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleotides of the modified envelope gene, for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleotides of the modified envelope gene. In some embodiments, the nucleic acid encoding the interferon is inserted between ORF6 and ORF9b of the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome, such as ORF8. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene. In some embodiments, the host cell is knocked out for STAT1.
In some embodiments, there is provided a host cell (e.g., VeroE6 cell or BHK21 cell) comprising a construct, wherein the construct comprises a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) and a nucleic acid encoding an interferon (such as Type I interferon, for example interferon β) integrated into the viral genome, wherein the host cell is defective in interferon signaling, and wherein the host cell further comprises a heterologous nucleic acid encoding a viral envelope protein. In some embodiments, the host cell is knocked out for STAT1. In some embodiments, the nucleic acid encoding the interferon is inserted in the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the viral genome. In some embodiments, the nucleic acid sequence of the heterologous nucleic acid encoding the envelope protein has less than about 80% (such as less than about any of 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 30%, 20%, 10%, or less) sequence identity to the sequence of the modified envelope gene (e.g., SEQ ID NO: 14). In some embodiments, the nucleic acid sequence of the heterologous nucleic acid encoding the envelope protein has less than about 80% (such as less than about any of 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 30%, 20%, 10%, or less) sequence identity to the naturally occurring envelope gene, (e.g., SEQ ID NO: 12). In some embodiments, the modified envelope gene does not produce any functional envelope protein. In some embodiments, the modified envelope gene comprises one or more stop codons (such as at least any of 3, 4, 5, 6, 7, 8, 9, 10, or more stop codons). In some embodiments, the at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) stop codon is present at the 5′-terminal 100 nucleic acids of the modified envelope gene, for example at the 5′-terminal 10, 20, 30, 40, 50, 60, 70, 80, 90 nucleic acids of the modified envelope gene. In some embodiments, the nucleic acid encoding the interferon is inserted between ORF6 and ORF9b of the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome, such as ORF8. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene. In some embodiments, the modified envelope gene comprises the sequence of SEQ ID NO: 13. In some embodiments, the heterologous nucleic acid encoding the viral envelope protein comprises the sequence of SEQ ID NO: 15.
In some embodiments, there is provided a host cell (e.g., VeroE6 cell or BHK21 cell) comprising a construct, wherein the construct comprises a modified genome of a sarbecovirus (such as SARS-CoV-2), wherein the modified genome comprises i) a modified envelope gene (e.g., viral RNA gene, including an RNA sequence or a reverse-transcribed DNA sequence thereof) comprising the sequence of SEQ ID NO: 13, and ii) a nucleic acid encoding an interferon (such as Type I interferon, for example interferon β) integrated (e.g., inserted) into the viral genome, wherein the host cell is defective in interferon signaling, and wherein the host cell further comprises a heterologous nucleic acid (e.g., SEQ ID NO: 15) encoding a viral envelope protein. In some embodiments, the nucleic acid encoding the interferon comprises the sequence of SEQ ID NO: 10 or 11. In some embodiments, the host cell is knocked out for any of STAT1, IRF9, STAT2, IFNAR1, IFNAR2, and type I and III interferons, such as STAT1. In some embodiments, the nucleic acid encoding the interferon is inserted between ORF6 and ORF9b of the viral genome. In some embodiments, the nucleic acid encoding the interferon replaces a portion of the virus genome, such as ORF8. In some embodiments, at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified viral genome is deleted. In some embodiments, the modified genome comprises a wild-type spike gene. In some embodiments, the modified genome comprises a variant spike gene (e.g., BA.2, BA.5, BA.2.75.2, BQ.1, BQ.1.1, or XBB).
Any suitable host cells for viral packaging or virus production can be used here. Host cells can include but are not limited to, BHK21 cells, VeroE6 cells, L929 cells, CHO cells, BHK cells, MDCK cells, C3H 10T1/2 cells, FLY cells, Psi-2 cells, BOSC 23 cells, PA317 cells, WEHI cells, COS cells, BSC 1 cells, BSC 40 cells, BMT 10 cells, VERO cells, W138 cells, MRCS cells, A549 cells, HT1080 cells, 293 cells, 293T cells, B-50 cells, 3T3 cells, NIH3T3 cells, HepG2 cells, Saos-2 cells, Huh7 cells, HeLa cells, W163 cells, 211 cells, NS0 cells, PerC6 cells, Sp2/0 cells, BHK cells, C127 cells, 211 A cells, and any host cells derived from any of these cells. In some embodiments, the suitable host cell is genetically modified to delete or inactivate STAT1. In some embodiments, the suitable host cell is genetically modified to express an engineered sarbecovirus envelope protein. In some embodiments, the suitable host cell is genetically modified both to delete STAT1 and to express an engineered sarbecovirus envelope protein (e.g., SEQ ID NO: 16).
In some embodiments, the host cell is a VeroE6 cell. In some embodiments, the VeroE6 cell is genetically modified to delete or inactivate STAT1. In some embodiments, the VeroE6 cell is genetically modified to express an engineered sarbecovirus envelope protein. In some embodiments, the VeroE6 cell is genetically modified both to delete STAT1 and to express an engineered sarbecovirus envelope protein (e.g., SEQ ID NO: 16), thereby generating Vero-A9B21 cells.
In some embodiments, the host cell is a BHK21 cell. In some embodiments, the BHK21 cell is genetically modified to express an engineered sarbecovirus envelope protein (e.g., SEQ ID NO: 16), thereby generating BHK21-eE cells. In some embodiments, the BHK21 cell is further genetically modified to delete or inactivate STAT1.
The IFN-producing (e.g., IFNβ-producing) universal sarbecovirus vaccine described herein may be prepared by any of the known nucleic acid expression and virion purification methods in the art. For example, see Example 1. DNA sequences encoding the modified sarbecovirus can be fully synthesized. After obtaining such sequence, it is transfected into a suitable host cell (for example, into BHK21 cells expressing an engineered sarbecovirus envelope transgene). The transfected host cells are cultured (for example, co-cultured with Vero-A9B21 cells), and the virus is plaque-purified and further expanded in suitable host cells (for example, in Vero-A9B21 cells). Once viral titers reach a threshold level for plaque forming units (PFU; for example, 4.4×107 PFU), then the IFN-producing universal sarbecovirus of the present invention is obtained and prepared into vaccine for vaccination administration.
In some embodiments, the present application provides isolated nucleic acids encoding one or more of the constructs comprising a modified genome of a sarbecovirus described herein, the recombinant sarbecovirus described herein, or the IFN-producing (e.g., IFNβ-producing) universal sarbecovirus vaccines described herein. In some embodiments, the isolated nucleic acid comprises the nucleic acid sequence of any of SEQ ID NOs: 2-9. In some embodiments, the isolated nucleic acid for vaccinating a human individual comprises the nucleic acid sequence of any of SEQ ID NOs: 2-7. In some embodiments, the isolated nucleic acid for vaccinating a mouse or a hamster comprises the nucleic acid sequence of SEQ ID NO: 8 or 9. The isolated nucleic acids may be DNA or RNA.
In some embodiments, the recombinant sarbecovirus construct as described herein may be introduced into a host cell to allow expression of the nucleic acid within the host cell. The recombinant sarbecovirus construct may contain a variety of elements for controlling gene expression, including without limitation, promoter sequences, transcription initiation sequences, enhancer sequences, selectable markers, and signal sequences. These elements may be native to the virus or may be further selected as appropriate by a person of ordinary skill in the art. For example, the promoter sequences for the inserted IFNβ gene may be selected to promote the transcription of the polynucleotide. Suitable promoter sequences include, without limitation, T7 promoter, T3 promoter, SP6 promoter, beta-actin promoter, EF1α promoter, CMV promoter, SV40 promoter, or any Transcriptional Regulatory Sequence (TRS) of sarbecoviruses. Enhancer sequences may be selected to enhance the transcription of the nucleic acids. Selectable markers may be chosen to allow selection of the host cells inserted with the recombinant sarbecovirus or construct thereof from those not, for example, the selectable markers may be genes that confer antibiotic resistance. Signal sequences may be selected to allow the expressed IFNβ polypeptide to be transported outside of the host cell.
The recombinant sarbecovirus construct can be introduced to the host cell using any suitable methods known in the art, including, but not limited to, DEAE-dextran mediated delivery, calcium phosphate precipitate method, cationic lipids mediated delivery, liposome mediated transfection, electroporation, lentiviral transduction, microprojectile bombardment, receptor-mediated gene delivery, delivery mediated by polylysine, histone, chitosan, and peptides. Standard methods for transfection and transformation of cells for expression of a vector of interest are well known in the art.
In some embodiments, the present application provides methods of making any of the IFN-producing recombinant sarbecovirus or the IFN-producing universal sarbecovirus vaccines described herein, comprising culturing an isolated host cell comprising any of the isolated nucleic acid constructs described herein, under a condition suitable for the expression of any of the vaccines described herein, and obtaining the expressed recombinant sarbecovirus or vaccines from said host cell (e.g., from the cell culture). The isolated host cells are cultured under conditions that allow expression of the recombinant sarbecovirus nucleic acids transfected into the host cell. Suitable conditions for expression may include, without limitation, suitable medium, suitable density of host cells in the culture medium, presence of necessary nutrients, presence of supplemental factors, suitable temperatures and humidity, and absence of microorganism contaminants. A person with ordinary skill in the art can select the suitable conditions as appropriate for the purpose of the expression.
Further provided by the present application are pharmaceutical compositions comprising any one of the IFN-producing universal sarbecovirus vaccines described herein, and optionally a pharmaceutically acceptable carrier.
The pharmaceutical compositions may be suitable for a variety of modes of administration described herein, including for example systemic or localized administration. In some embodiments, the pharmaceutical composition is formulated for mucosal administration. In some embodiments, the pharmaceutical composition is formulated for administration by nasal spray. In some embodiments, the pharmaceutical composition is formulated for administration by nasal drops. In some embodiments, the pharmaceutical composition is administered parenterally, such as by intramuscular or intradermal administration. In some embodiments, the pharmaceutical composition is administered as a single dose. In some embodiments, the pharmaceutical composition is administered as multiple doses. In some embodiments, the individual (such as a human) is 65 years of age or older, for example any of 65, 70, 75, 80, 85, 86, 87, 88, 89, 90 years or older. In some embodiments, the individual (such as a human) has a medical condition, a pre-existing condition, or a condition that reduces heart, lung, brain, or immune system function. In some embodiments, the individual (such as a human) is immunocompromised.
Micro- and nanocarrier-based delivery systems as nasal vaccines induce humoral, cellular, and mucosal immunity. The nasal route of vaccination could also offer immunity at several distant mucosal sites (e.g., oral, rectal, vaginal, and pulmonary). Nasal vaccine delivery blocks pathogen entry at the mucosal site by inducing local immunity, displays increased bioavailability to other administration routes, demonstrates swift uptake to the blood circulatory system via mucosal absorption, and encourages better patient compliance that other administration routes, e.g., parenteral (see, e.g., Ramvikas et al. (2016) Micro and Nanotechnology in Vaccine Development 2017: 279-301, hereby incorporated by reference in its entirety). Nasal vaccine delivery formulations can include, but are not limited to, form of microparticulates, nanoparticulates, and liposomes. Therefore, in some embodiments, the pharmaceutical composition is formulated for mucosal administration. In some embodiments, the pharmaceutical composition is formulated for administration by nasal spray or nasal drops. In some embodiments, the pharmaceutical composition is administered as a single dose. In some embodiments, the pharmaceutical composition is administered as multiple doses. In some embodiments, the individual (such as a human) is 65 years of age or older, for example any of 65, 70, 75, 80, 85, 86, 87, 88, 89, 90 years or older. In some embodiments, the individual (such as a human) has a medical condition, a pre-existing condition, or a condition that reduces heart, lung, brain, or immune system function. In some embodiments, the individual (such as a human) is immunocompromised.
In some cases, a subject method involves administering to an individual in need thereof an effective amount of a recombinant sarbecovirus vaccine or construct (or pharmaceutical composition thereof). In some embodiments, an “effective amount” of a subject vaccine is an amount that, when administered to an individual in one or more doses, in monotherapy or in combination therapy, is effective to prevent sarbecovirus infection or transmission or to reduce symptoms of a sarbecovirus infection in the individual by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 5-fold, at least about 10-fold, or greater than 10-fold, compared to the individual in the absence of treatment with the vaccine.
“Carriers” as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or individual being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).
In some embodiments, the pharmaceutical composition is formulated to have a pH in the range of about 4.5 to about 9.0, including for example pH ranges of about any one of 5.0 to about 8.0, about 6.5 to about 7.5, or about 6.5 to about 7.0. In some embodiments, the pharmaceutical composition is formulated to have a pH in the range of about 4.5 to about 6.5. In some embodiments, the pharmaceutical composition can also be made to be isotonic with blood by the addition of a suitable tonicity modifier.
The pharmaceutical compositions to be used for in vivo administration are generally formulated as sterile, substantially isotonic, and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration. Sterility is readily accomplished by filtration through sterile filtration membranes. In some embodiments, the composition is free of pathogens. For parenteral administration, the pharmaceutical composition can be in the form of liquid solutions, for example in physiologically compatible buffers such as Hank's solution or Ringer's solution. In addition, the pharmaceutical composition can be in a solid form and re-dissolved or suspended, e.g., in water, immediately prior to use. Lyophilized compositions are also included. Injectable solutions and suspensions can be prepared from sterile powders, granules, and tablets, as described herein.
An aerosol formulation suitable for administration via inhalation also can be made. The aerosol formulation can be placed into a pressurized acceptable propellant, such as dichlorodifluoromethane, propane, nitrogen, and the like.
In some embodiments, the pharmaceutical composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for mucosal administration, in particular for intranasal administration. In some embodiments, the pharmaceutical composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for parenteral administration, such as for intramuscular or intradermal administration.
In some embodiments, the pharmaceutical composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for injection intravenously, intraperitoneally, subcutaneously, intramuscularly, or intravitreally. In some embodiments, a subject delivery system comprises a device for delivery to nasal passages or lungs. For example, the compositions described herein can be formulated for delivery by a nebulizer, an inhaler device, or the like.
In some embodiments, the pharmaceutical composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for mucosal administration, such as intranasal administration. Intranasal administration can be achieved via nasal powders, nasal drops, nasal aerosols, nasal gels, etc. In some embodiments, the pharmaceutical composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for injection intravenously, intraperitoneally, subcutaneously, intramuscularly, or intravitreally. Typically, compositions for injection are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered, it can be reconstituted as needed accordingly.
In some embodiments, the pharmaceutical composition is suitable for administration to a human. In some embodiments, the pharmaceutical composition is suitable for administration to a rodent (e.g., mice, rats) or non-human primates (e.g., Cynomolgus monkey). In some embodiments, the pharmaceutical composition is contained in a single-use vial, such as a single-use sealed vial. In some embodiments, the pharmaceutical composition is contained in a multi-use vial. In some embodiments, the pharmaceutical composition is contained in bulk in a container. In some embodiments, the pharmaceutical composition is cryopreserved.
Also provided are unit dosage forms of any of the vaccines described herein, or compositions (such as pharmaceutical compositions) thereof. For example, in some embodiments, the sarbecovirus vaccine is administered at a dose of about 105 PFU to about 1010 PFU. The term “unit dosage form” refers to a physically discrete unit suitable as unitary dosages for an individual, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical carrier, diluent, or excipient. These unit dosage forms can be stored in a suitable packaging in single or multiple unit dosages and may also be further sterilized and sealed.
The present application further provides articles of manufacture comprising the compositions (such as pharmaceutical compositions) described herein in suitable packaging. Suitable packaging for compositions (such as pharmaceutical compositions) described herein are known in the art, and include, for example, vials (such as sealed vials), nasal spray or nasal drop bottles, vessels, ampules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and/or sealed.
The present application also provides kits comprising compositions (such as pharmaceutical compositions) described herein and may further comprise instruction(s) on methods of using the composition, such as uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, spray bottles, nebulizers, inhaler devices, needles, syringes, and package inserts with instructions for performing any methods described herein.
One aspect of the present application provides a method of vaccinating against a viral infection (e.g., sarbecovirus infection, such as SARS-CoV-2 infection) in an individual (such as a human), comprising administering to the individual an effective amount of any of the IFN-producing universal sarbecovirus vaccines described herein, or a composition (such as pharmaceutical composition) thereof. In some embodiments, the method of vaccinating an individual comprises a method of prophylactically immunizing an individual. In some embodiments, the method of vaccinating an individual comprises a method of preventing an individual from contracting a sarbecovirus infection. In some embodiments, the method of vaccinating an individual comprises a method of preventing sarbecovirus transmission from a vaccinated individual to an unvaccinated individual. In some embodiments, the method of vaccinating an individual comprises a method of reducing the severity of a sarbecovirus infection in an individual. In some embodiments, the method of vaccinating an individual further comprises a method of treating an individual having a sarbecovirus infection. In some embodiments, the method of vaccinating an individual comprises a method of eliciting an immune response in an individual. In some embodiments, the method of vaccinating an individual comprises a method of enhancing the T cell response in an individual. In some embodiments, the method of eliciting an immune response, such as enhancing the T cell response, in an individual further comprises a method of activating CD4+ T cells. In some embodiments, the method of vaccination comprises administering the sarbecovirus vaccine described herein wherein the vaccine further provides heterosubtypic protection against different sarbecovirus species. In some embodiments, the individual is a mammal, for example, a human, bovine, horse, feline, canine, rodent, or primate. In some embodiments, the individual is a human. In some embodiments, the individual is at risk of contracting or has contracted a sarbecovirus infection. In some embodiments, the individual is at elevated risk of mortality upon contraction of a sarbecovirus infection. In some embodiments, the individual (such as a human) is 65 years of age or older, for example any of 65, 70, 75, 80, 85, 86, 87, 88, 89, 90 years or older. In some embodiments, the individual (such as a human) has a medical condition, a pre-existing condition, or a condition that reduces heart, lung, brain, or immune system function. In some embodiments, the individual (such as a human) is immunocompromised. In some embodiments, the individual has a compromised adaptive immune system and/or a compromised innate immune system. In some embodiments, the individual has a weakened immune system. In some embodiments, the individual has a weakened adaptive immune system and/or a weakened innate immune system. In some embodiments, the individual is administered one or more courses of immunosuppresants. In some embodiments, the individual had been administered one or more courses of immunosuppresants.
In some embodiments, symptoms of a sarbecovirus infection, e.g., a SARS-CoV-2 infection, include any one of fever, cough, sore throat, nasal congestion, malaise, headache, muscle pain, malaise, shortness of breath, mild pneumonia, severe pneumonia, acute pneumonia, sepsis, septic shock, or any combination thereof. Signs of infection include altered mental status, difficult or fast breathing, low oxygen saturation, reduced urine output, fast heart rate, weak pulse, cold extremities or low blood pressure, skin mottling, or laboratory evidence of coagulopathy, thrombocytopenia, acidosis, high lactate, or hyperbilirubinemia. In some embodiments, sarbecovirus infection, e.g., SARS-CoV-2 infection, significantly elevates levels of inflammatory cytokines in an infected individual. In some embodiments, elevated levels of inflammatory cytokines, i.e., cytokine storm, triggers excessive, uncontrolled systemic inflammation. In some instances, uncontrolled systemic inflammation leads to pneumonitis, respiratory failure, shock, organ failure, secondary bacterial pneumonia, and potentially death in an individual infected with a sarbecovirus.
In some embodiments, the severity of a sarbecovirus infection in an individual is reduced following vaccination with any one of the IFN-producing universal sarbecovirus vaccines described herein. In some embodiments, an immune response in an individual is elicited following vaccination with any one of the IFN-producing universal sarbecovirus vaccines described herein. In some embodiments the elicited immune response comprises a T cell response, such as T cell activation, in an individual. In some embodiments, the enhanced the T cell response in an individual further comprises a method of activating CD4+ T cells. In some embodiments, progression of a sarbecovirus infection in an individual is delayed by vaccination with any one of the IFN-producing universal sarbecovirus vaccines described herein. In some embodiments, mortality caused by infection with a sarbecovirus infection in an individual is prevented by vaccination with any one of the IFN-producing universal sarbecovirus vaccines described herein. In some embodiments, an individual vaccinated with any one of the IFN-producing universal sarbecovirus vaccines described herein who becomes or already is infected with a sarbecovirus infection is prevented from transmitting the sarbecovirus infection to an unvaccinated individual.
Efficacy of the treatments described herein can be evaluated, for example, by measuring viral load (e.g., via detection of viral DNA), duration of individual's survival, quality of life, viral protein expression and/or activity, detection of serological antibodies against the coronavirus, assessment of respiratory functions, and/or Computerized Tomography (CT) imaging.
Efficacy of the IFN-producing universal sarbecovirus vaccine can be evaluated, for example, by levels of neutralizing antibodies against one or more proteins of the sarbecovirus (such as SARS-CoV-2) in serum or other bodily fluid (such as but not limited to bronchoalveolar lavage fluids), or by the neutralizing activity of serum or other bodily fluid against one or more strains of the sarbecovirus (such as SARS-CoV-2).
In some embodiments, wherein the method comprises administrating to the individual an effective amount of any one of the IFN-producing universal sarbecovirus vaccines described herein, the individual displays increased neutralizing antibody level in serum against SARS-CoV-2 spike RBD (receptor binding domain of spike protein) as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the individual displays increased neutralizing antibody level in serum against a SARS-CoV-2 variant spike RBD as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments according to any one of the methods described herein, the individual displays an increase in the neutralizing antibody level by about any one of 10%, 20%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 500-fold, or 1000-fold or more, as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the neutralizing antibody level is determined at about any one of 1, 7, 14, 21, 30, 45, 60, 90, 120, 180, 240, 360, 480, or 720 days after administration of the IFN-producing universal sarbecovirus vaccine.
In some embodiments, wherein the method comprises administrating to the mucosa of the individual an effective amount of any one of the IFN-producing universal sarbecovirus vaccines described herein, the individual displays increased mucosal immunity against SARS-CoV-2 as compared to before administration of the chimeric protein. In some embodiments, the individual displays induction of lung resident memory B cells subsequent to administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the individual displays induction of follicular helper T cells subsequent to administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the individual displays increased neutralizing antibody level in bronchoalveolar lavage (BAL) fluids against SARS-CoV-2 as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the individual displays increased neutralizing antibody level in BAL fluids against a SARS-CoV-2 variant spike RBD as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the neutralizing antibody comprises IgA. In some embodiments according to any one of the methods described herein, the individual displays an increase in the neutralizing antibody level by about any one of 10%, 20%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 500-fold, or 1000-fold or more, as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the neutralizing antibody level is determined at about any one of 1, 7, 14, 21, 30, 45, 60, 90, 120, 180, 240, 360, 480, or 720 days after administration of the IFN-producing universal sarbecovirus vaccine.
In some embodiments, wherein the method comprises administrating to the individual an effective amount of any one of the IFN-producing universal sarbecovirus vaccine described herein, the individual displays increased neutralizing activity in serum against SARS-CoV-2 as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the individual displays increased neutralizing activity in serum against a SARS-CoV-2 variant as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the neutralizing activity is quantitatively determined by focus reduction neutralization assay against the virus strain. In some embodiments according to any one of the methods described herein, the individual displays an increase in the neutralizing activity by about any one of 10%, 20%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 500-fold, or 1000-fold or more, as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the neutralizing activity is determined at about any one of 1, 7, 14, 21, 30, 45, 60, 90, 120, 180, 240, 360, 480, or 720 days after administration of the IFN-producing universal sarbecovirus vaccine.
In some embodiments, wherein the method comprises administrating to the mucosa of the individual an effective amount of any one of the IFN-producing universal sarbecovirus vaccine described herein, the individual displays increased mucosal immunity against SARS-CoV-2 as compared to before administration of the chimeric protein. In some embodiments, the individual displays increased neutralizing activity in bronchoalveolar lavage fluids (BAL) fluids against SARS-CoV-2 as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the individual displays increased neutralizing activity in BAL fluids against a SARS-CoV-2 variant as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the neutralizing activity is quantitatively determined by focus reduction neutralization assay against the authentic live virus. In some embodiments according to any one of the methods described herein, the individual displays an increase in the neutralizing activity by about any one of 10%, 20%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 500-fold, or 1000-fold or more, as compared to before administration of the IFN-producing universal sarbecovirus vaccine. In some embodiments, the neutralizing activity is determined at about any one of 1, 7, 14, 21, 30, 45, 60, 90, 120, 180, 240, 360, 480, or 720 days after administration of the IFN-producing universal sarbecovirus vaccine.
In some embodiments, there is provided a method of vaccinating against a viral infection (e.g., sarbecovirus infection, such as SARS-CoV-2 infection) in an individual (such as a human), comprising administering to the individual an effective amount of the IFN-producing universal sarbecovirus vaccine (or a pharmaceutical composition thereof), wherein the sarbecovirus vaccine or pharmaceutical composition thereof is administered at a dose of about 105 PFU to about 1010 PFU. For example, in some embodiments, the sarbecovirus vaccine or pharmaceutical composition thereof is administered at a dose of any of about 105 PFU to about 106 PFU, about 105 PFU to about 107 PFU, about 105 PFU to about 108 PFU, about 105 PFU to about 109 PFU, about 105 PFU to about 1010 PFU, about 106 PFU to about 107 PFU, about 106 PFU to about 108 PFU, about 106 PFU to about 109 PFU, about 106 PFU to about 1010 PFU, about 107 PFU to about 108 PFU, about 107 PFU to about 109 PFU, about 107 PFU to about 1010 PFU, about 108 PFU to about 109 PFU, about 108 PFU to about 1010 PFU, or about 109 PFU to about 1010 PFU. The doses described herein may refer to a suitable dose for mice, a human equivalent dose thereof, a human dose, or an equivalent dose for the specific species of the individual.
In some embodiments, the sarbecovirus vaccine or the composition (such as pharmaceutical composition) thereof is administered intranasally. In some embodiments, the sarbecovirus vaccine or the composition (such as pharmaceutical composition) thereof is administered parenterally, such as by intramuscular or intradermal administration. In some embodiments, the sarbecovirus vaccine or the composition (such as pharmaceutical composition) thereof is administered once. In some embodiments, the sarbecovirus vaccine or the composition (such as pharmaceutical composition) thereof is administered more than once, for example with an interval of about 2 weeks to about 1 year. In some embodiments, the sarbecovirus vaccine or the composition (such as pharmaceutical composition) thereof is administered with an interval of about any of every 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, or 1 year.
In some embodiments, the method is used to vaccinate an individual (such as human) who has previously been vaccinated. Any of the methods of vaccination provided herein may be used to vaccinate an individual (such as a human) who has not previously been vaccinated. In some embodiments, the method is used to prophylactically immunize an individual (such as a human). In some embodiments, the method is used to prevent sarbecovirus transmission from a vaccinated individual (such as a human) to an unvaccinated individual. In some embodiments, the method is used to treat a sarbecovirus infection in an individual (such as a human). In some embodiments, the method further ameliorates or reduces the infection and associated symptoms in an infected individual (such as a human). In some embodiments, the method is used to elicit an immune response (such as activation of lymphocytes, such as B cells or T cells, including CD4+ T cells and/or CD8+ T cells; and myeloid cells, including but not limited to monocytes, macrophages, neutrophils, granulocytes, mast cells, dendritic cells, and/or eosinophils) in an individual (such as a human). In some embodiments, the method is used as a prophylactic vaccine. In some embodiments, the method is used to enhance T cell response in an individual (such as a human). In some embodiments, the method is used as a first- or second-line therapy to ameliorate or otherwise reduce the sarbecovirus infection and associated symptoms thereof. In some embodiments, the individual (such as a human) is 65 years of age or older, for example any of 65, 70, 75, 80, 85, 86, 87, 88, 89, 90 years or older. In some embodiments, the individual (such as a human) has a medical condition, a pre-existing condition, or a condition that reduces heart, lung, brain, or immune system function. In some embodiments, the individual (such as a human) is immunocompromised.
The methods described herein are suitable for vaccinating against a variety of sarbecoviruses, and/or treating a disease associated with a variety of sarbecoviruses. The methods are applicable to all sarbecoviruses, including SARS-CoV/SARS-CoV-1, SARS-CoV-2, SC2r-CoV, SC2r-CoV GX-PSL, Bat CoV BtKY72, Bat CoV BM48-31, 16BO133, JTMC15, Bat SARS CoV Rf1, BtCoV HKU3, LYRa11, Bat SARS-CoV/Rp3, Bat SL-CoV YNLF_31C, Bat SL-CoV YNLF_34C, SHC014-CoV, WIV1, WIV16, Civet SARS-CoV, (Bat) Rc-o319, Bat SL-ZXC21, Bat SL-ZC45, Pangolin SARSr-CoV-GX, Pangolin SARSr-CoV-GD, Rs7327, Rs4231, Rs4084, Rf4092, JL2012, 273-2005, HeB2013, HuB2013, Rs4247, Longquan-140, HKU3-1, GX2013, Shaanxi2011, 279-2005, As6526, Yunnan2011, Rs4237, Rs4081, Bat RshSTT182, Bat RshSTT200, (Bat) RacCS203, (Bat) RmYN02, (Bat) RpYN06, YN2013, (Bat) RaTG13, (Bat) BANAL-52, and SARS-CoV combined variants of concern (VOC) (for example, see Nature (2022) 603:913-918, hereby incorporated by reference in its entirety). In one aspect, there is provided a recombinant sarbecovirus comprising the construct described herein. In one aspect is described a sarbecovirus vaccine comprising the recombinant sarbecovirus. In some embodiments, the sarbecovirus is selected from the group consisting of SARS-CoV, SARS-CoV-2, SARS-CoV-2 B.1.1.7, SARS-CoV-2 B.1.351, SARS-CoV-2 B1.617.2, SAR-CoV-2 B.1.1.529, SC2r-CoV, RaTG13, SC2r-CoV GX-PSL, and SARS-CoV combined variants of concern (VOC). In some embodiments, the sarbecovirus is SARS-CoV-2.
The methods described herein may be used as a vaccination, a viral transmission preventative, or a treatment to reduce disease, wherein the treatment may act as a first therapy, second therapy, third therapy, or combination therapy with other types of anti-viral therapies known in the art, such as therapeutic agents selected from the group consisting of a corticosteroid, an anti-inflammatory signal transduction modulator, a β2-adrenoreceptor agonist bronchodilator, an anticholinergic, a mucolytic agent, an antiviral agent, an anti-fibrotic agent, hypertonic saline, an antibody, a vaccine, and mixtures thereof or the like, in an adjuvant setting or a neoadjuvant setting. For example, the antiviral agent can be further selected from the group consisting of remdesivir, lopinavir/ritonavir, IFN-α, lopinavir, ritonavir, penciclovir, galidesivir, disulfiram, darunavir, cobicistat, ASC09F, disulfiram, nafamostat, griffithsin, alisporivir, chloroquine, nitazoxanide, baloxavir marboxil, oseltamivir, zanamivir, peramivir, amantadine, rimantadine, favipiravir, laninamivir, ribavirin, umifenovir, and any combinations thereof. In one aspect, there is provided a method of vaccinating an individual against a sarbecovirus, comprising administering a sarbecovirus vaccine to the individual. In some embodiments, the method of vaccinating an individual comprises a method of prophylactically immunizing an individual. In some embodiments, the method of vaccinating an individual comprises a method of preventing an individual from contracting a sarbecovirus infection. In some embodiments, the method of vaccinating an individual comprises a method of preventing transmission of a sarbecovirus from a vaccinated individual to an unvaccinated individual. In some embodiments, the method of vaccinating an individual comprises a method of reducing the severity of a sarbecovirus infection in an individual. In some embodiments, the method of vaccinating an individual further comprises a method of treating an individual having a sarbecovirus infection. In some embodiments, the method of vaccinating an individual comprises a method of eliciting an immune response in an individual. In some embodiments, the method of vaccinating an individual comprises a method of enhancing the T cell response in an individual. In some embodiments, the method of eliciting an immune response, such as enhancing the T cell response, in an individual further comprises a method of activating CD4+ T cells. In some embodiments, the method of vaccination comprises administering the sarbecovirus vaccine described herein wherein the vaccine further provides heterosubtypic protection against different sarbecovirus species. In some embodiments, the individual (such as a human) is 65 years of age or older, for example any of 65, 70, 75, 80, 85, 86, 87, 88, 89, 90 years or older. In some embodiments, the individual (such as a human) has a medical condition, a pre-existing condition, or a condition that reduces heart, lung, brain, or immune system function. In some embodiments, the individual (such as a human) is immunocompromised.
Exemplary routes of administration of any of the IFN-producing universal sarbecovirus vaccines described herein (or pharmaceutical composition thereof) include, but are not limited to, oral, intravenous, intracavitary, intratumoral, intraarterial, intramuscular, subcutaneous, parenteral, transmucosal, transdermal, ocular, topical, intraperitoneal, intracranial, intrapleural, and epidermal routes, or be delivered into lymph glands, body spaces, organs or tissues known to be virally infected cells. In some embodiments, the sarbecovirus vaccine (or pharmaceutical composition thereof) is administered mucosally, such as by nasal spray or nasal drops. In some embodiments, the sarbecovirus vaccine (or pharmaceutical composition thereof) is administered parenterally, such as by intramuscular or intradermal administration. In some embodiments, the sarbecovirus vaccine or pharmaceutical composition thereof is administered intranasally.
The dosing regimen of the vaccine (or pharmaceutical composition thereof) administered to the individual (such as human) may vary with the particular vaccine composition, the method of administration, and the particular type and stage of viral infection being treated. In some embodiments, that effective amount of the vaccine is below the level that induces a toxicological effect (i.e., an effect above a clinically acceptable level of toxicity) or is at a level where a potential side effect can be controlled or tolerated when the composition is administered to the individual.
Embodiment 1: A construct comprising a modified genome of a sarbecovirus, wherein the modified genome comprises a modified envelope gene and a nucleic acid encoding an interferon integrated into the genome.
Embodiment 2: The construct of embodiment 1, wherein the nucleic acid encoding an interferon is inserted into the viral genome.
Embodiment 3: The construct of embodiment 1, wherein the nucleic acid encoding an interferon replaces ORF8.
Embodiment 4: The construct of embodiment 1, wherein the modified envelope gene comprises one or more stop codons.
Embodiment 5: The construct of embodiment 4, wherein the modified envelope gene comprising at least three stop codons.
Embodiment 6: The construct of embodiment 4 or 5, wherein at least one stop codon is present at the 5′-terminal 100 nucleic acids of the modified envelope gene.
Embodiment 7: The construct of any one of embodiments 1-6, wherein at least a functional portion of ORF6, ORF7a, ORF7b, and/or ORF8 in the modified genome is deleted and/or inactivated by introducing stop codon.
Embodiment 8: The construct of any one of embodiments 1-7, wherein the sarbecovirus is selected from the group consisting of SARS-CoV, SARS-CoV-2, SARS-CoV-2 B.1.1.7, SARS-CoV-2 B.1.351, SARS-CoV-2 B1.617.2, SAR-CoV-2 B.1.1.529, SC2r-CoV, RaTG13, SC2r-CoV GX-PSL, and SARS-CoV combined variants of concern (VOC).
Embodiment 9: The construct of embodiment 8, wherein the sarbecovirus is SARS-CoV-2.
Embodiment 10: The construct of embodiment 9, wherein the modified genome comprises a wild-type spike gene.
Embodiment 11: The construct of embodiment 9, wherein the modified genome comprises a variant spike gene.
Embodiment 12: The construct of embodiment 11, wherein the variant spike gene is BA.2, BA.5, BA.2.75.2, BQ.1, BQ.1.1, or XBB.
Embodiment 13: The construct of any one of embodiments 1-12, wherein the interferon is type I interferon.
Embodiment 14: The construct of embodiment 13, wherein the interferon is interferon β.
Embodiment 15: A recombinant sarbecovirus comprising the construct of any one of embodiments 1-14.
Embodiment 16: A sarbecovirus vaccine comprising the recombinant sarbecovirus of embodiment 15.
Embodiment 17: The sarbecovirus vaccine of embodiment 16, wherein the sarbecovirus vaccine is formulated for mucosal administration.
Embodiment 18: The sarbecovirus vaccine of embodiment 16, wherein the sarbecovirus vaccine is formulated as a nasal spray.
Embodiment 19: The sarbecovirus vaccine of embodiment 16, wherein the sarbecovirus vaccine is formulated for parenteral administration.
Embodiment 20: The sarbecovirus vaccine of embodiment 19, wherein the sarbecovirus vaccine is formulated for intradermal or intramuscular administration.
Embodiment 21: A host cell for producing the recombinant sarbecovirus, comprising the construct of any one of embodiments 1-14.
Embodiment 22: The host cell of embodiment 21, wherein the host cell is defective in interferon signaling.
Embodiment 23: The host cell of embodiment 22, wherein the host cell comprises a mutation in a gene selected from the group consisting of STAT1, IRF9, STAT2, IFNAR1, IFNAR2, and type I and III interferons.
Embodiment 24: The host cell of embodiment 23, wherein the host cell is knocked out for STAT1.
Embodiment 25: The host cell of embodiment 24, further comprises a heterologous nucleic acid encoding a viral envelope protein.
Embodiment 26: The host cell of embodiment 25, wherein the nucleic acid sequence of the heterologous nucleic acid encoding the envelope protein has less than about 60% sequence identity to the sequence of the modified or naturally existing viral envelope gene.
Embodiment 27: The host cell of embodiment 26, wherein the nucleic acid sequence of the heterologous nucleic acid encoding the envelope protein has less than about 80% sequence identity to the sequence of the naturally existing viral envelope gene.
Embodiment 28: A method of making a recombinant sarbecovirus, comprising culturing the host cell of any one of embodiments 21-27 and isolating the recombinant sarbecovirus.
Embodiment 29: A method of vaccinating an individual against sarbecovirus, comprising administering a sarbecovirus vaccine of any one of embodiments 15-20 to the individual, wherein the method further comprises:
Embodiment 30: The method of embodiments 29, wherein the sarbecovirus vaccine is administered intranasally.
Embodiment 31: The method of embodiments 30, wherein the sarbecovirus vaccine is administered once.
Embodiment 32: The method of embodiments 30, wherein the sarbecovirus vaccine is administered more than once, with an interval of about 2 weeks to about 1 year.
Embodiment 33: The method of any one of embodiments 29-32, wherein the sarbecovirus vaccine is administered at a dose of about 105 PFU to about 1010 PFU.
Embodiment 34: The method of any one of embodiments 29-33, wherein the individual is a human individual.
The examples below are intended to be purely exemplary of the invention and should therefore not be considered to limit the invention in any way. The following examples and detailed description are offered by way of illustration and not by way of limitation. For the embodiments in which details of the experimental methods are not described, such methods are carried out according to conventional conditions such as those described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as suggested by the manufacturers.
The purpose of this Example is to demonstrate whether (i) the restoration of early interferon signaling would help promote optimal induction of adaptive immunity; (ii) the secretion of interferon directly produced by a vaccine could protect the neighboring epithelial cells from any natural upper respiratory tract infection; and (iii) minimization of the chance of viral co-infection upon interferon secretion.
A novel mucosal vaccine was designed by integrating interferon-beta (IFNβ) into a defective SARS-CoV-2 genome, in which the envelope gene was inactivated by the insertion of three pre-mature stop codons using two-step red recombination into the Bacterial artificial chromosome (BAC) construct of the wildtype SARS-CoV-2 HKU-001a clone (
To rescue the SARS-CoV-2 mutated envelope (SARS2-mE) and IBIS virus, the BACs were transfected with Lipofectamine 2000 into BHK21-eE (engineered Envelope) cells. Transfected BHK21-eE were trypsin-dissociated and co-cultured with VeroE6-eE or Vero-A9B21 cells 6-8 hr post-transfection. Recombinant viruses generated were plaque-purified, further propagated in Vero-A9B21 cells, and quantitated by plaque assay in VeroE6-eE or Vero-A9B21 stable cells. The recombinant viruses were then concentrated by ultra-centrifugation at 28000 rpm, 4° C. for 4 hr against a 25% sucrose bed on Optima XPN-100 ultracentrifuge. Absence of replicative virus in the SARS2-mE and IBIS virus stock was confirmed by plaque assay using parental VeroE6 cells, which showed complete absence of plaques and cytopathic effect (CPE).
The possibility for IFNβ to be produced by the vaccine in the host cell and thereby activated interferon signaling was a potential concern because it could lead to suppression of viral replication by the host cell. To prevent this possibility, the host cells VeroE6-eE were engineered to further knockout the STAT1 gene by CRISPR-Cas9 genome editing, which is a key signaling molecule essential for interferon signaling. Clonal STAT1 knockout (STAT1 KO) cells were selected and the VeroE6-eE STAT1-K0 clone Vero-A9B21 was chosen for vaccine production. The knockout of STAT1 and loss of interferon signaling were confirmed by the treatment of interferon and Western blotting (
As a result, the IBIS vaccine, as well as the defective SARS-CoV-2 virus with mutated envelope (SARS2-mE), could only replicate in Vero-A9B21 cells but not in parental VeroE6 cells (
To test the efficacy of IBIS against SARS-CoV-2 infection, L929-hACE2 cells were generated in-house by stable transduction with lentivirus encoding a human ACE2 transgene, followed by puromycin selection. Prior to vaccination or infection, animals were anesthetized with intraperitoneal injection of ketamine and xylazine. For IBIS vaccination, 1×106 PFU/mouse in 20 μL PBS, or 3×106 PFU/hamster in 50 μL PBS was intranasally inoculated into the nostril of each anesthetized animal if not specified. For mRNA vaccination, 1 μg of BioNTech mRNA vaccine was intramuscularly injected into the hind-limb muscle of mice. 14-days after vaccination, a booster of the same strength was given in the same route as first vaccination. Blood was collected from the facial vein of mice or gingival vein of hamsters under anesthesia. Animals were infected by intranasal inoculation of SARS-CoV-1 or SARS-CoV-2 virus diluted in 20 μl (mouse) or 50 uL (hamster) PBS. Body weight and disease of infected animals were monitored for 14 days. Tissues were harvested at the indicated time points. For tissue homogenization, tissues were homogenized in 1 mL cold PBS using TissueRuptor II. Homogenate was then centrifuged at 3220 g, 4° C. for 10 min. Clear supernatant was aliquoted and stored at −80° C. in for future assays. For histology, tissues were fixed in 4% paraformaldehyde (PFA) in PBS for >24 hr, followed by paraffin embedding, sectioning, and H&E staining or IHC staining.
Examination of IBIS, SARS2-mE, and wild-type SARS-CoV-2 (SARS2-wt) infection in these hACE2-expressing mouse L929 (L929-hACE2) cells demonstrated that both IBIS and SARS2-mE, which lack functional envelope protein expression, could only establish single round infection, contrary to the multiple round infection of SARS2-wt that caused cytopathic effects (
The anti-viral function of interferon produced by IBIS was examined. Plaque-purified IBIS was inoculated into Vero-A9B21 cells, and culture supernatant was collected during serial passages and tested by ELISA: mouse IFNβ and TNFα protein were quantitated using mIFNβ and mTNFα Quantikine ELISA kits respectively according to manufacturer's instructions. Anti-RBD and anti-N antibodies were quantitated by in-house ELISA. Briefly, high-binding ELISA plates were coated with recombinant RBD or N protein, BSA-blocked and loaded with 1:100 diluted animal sera. After washing, biotin-conjugated anti-mouse IgG, anti-mouse IgM or anti-hamster IgG antibodies were added, followed by HRP-Streptavidin. After thorough washing, TMB-substrate was then added to allow color development and sulphuric acid for termination of reaction. Absorbance at 450 nm was measured using a Varioskan LUX multimode microplate reader.
IFNβ ELISA results showed that more than 1500 pg/mL of IFNβ was produced in supernatant obtained from passages 1, 6, and 10, indicating that a significant amount of IFNβ was secreted during the productive infection of IBIS in Vero-A9B21 cells (
The function of IBIS-encoded IFNβ was then determined by a classical interferon bioassay. Briefly, samples were diluted in MEM with 10% FBS according to the indicated dilution. 1 ml of diluted sample was treated onto L929 cells in 12-well plate. 24 hr post-treatment, the inoculum was removed and the L929 cells were further infected with vesicular stomatitis virus containing a GFP reporter (VSV-GFP). Infected cells were fixed with 4% PFA and GFP was observed using fluorescence microscope. Absence of GFP indicates the presence of functional mouse IFNβ protein in a concentration high enough to protect treated cells from VSV-GFP infection.
Treatment with 1:1000 diluted supernatant obtained from IBIS-infected Vero-A9B21 cells during passages 1, 6, and 10 was found to completely protect cells from VSV-GFP infection in L929-hACE2 cells (
The in vivo production of IFNβ by IBIS also was evaluated. A significant amount of IFNβ was detected in the lung homogenate of mice infected with IBIS, but not in the SARS2-wt-infected nor recombinant IFNβ-treated mouse lungs (
The protective efficacy and antibody response elicited by the IBIS vaccination were evaluated (
On average, above 1000 FRNT50 titer could be detected in mouse sera 28-days post-vaccination, suggesting that IBIS vaccination could induce high serum neutralizing antibody titers in mice. The anti-spike RBD-specific IgG and IgM, as well as anti-nucleoprotein IgG and IgM antibodies by ELISA were quantitated (
The protective efficacy of IBIS vaccination against homotypic SARS-CoV-2 infection was analyzed. All IBIS-vaccinated mice survived from lethal infection and no weight loss was observed (
Histological examination also showed the intact structures of bronchi, bronchioles and alveoli, and the absence of hemorrhage in IBIS-vaccinated mice at day-2 post-infection. Whole lung anti-nucleoprotein immunostaining indicated that no viral replication was observed in IBIS-vaccinated mice (
Golden Syrian hamsters were used to test the pre-clinical evaluation of the IBIS vaccine for preventing transmission of SARS-CoV-2 (illustrated in
First, anti-spike RBD and anti-nucleoprotein IgG antibodies were induced in serum at 14- and 28-days post IBIS-vaccination (
The lowest dose of IBIS vaccine that is sufficient to protect hamsters against homotypic SARS-CoV-2 infection was then tested. Groups of hamsters were vaccinated with a single decreasing dose of IBIS (ranging from 3×106 to 3×102 PFU/hamster) for 14 days, followed by SARS-CoV-2 intranasal infection. Surprisingly, 3×102 PFU of IBIS was already enough to protect vaccinated hamsters from SARS-CoV-2-induced weight loss (
IBIS vaccination elicited a potent antibody response and completely protected mice and hamsters from homotypic SARS-CoV-2 infection/transmission. Whether IBIS could also elicit heterosubtypic protection against other sarbecoviruses in both animal models was further examined.
In a SARS-CoV-1 mouse model, IBIS vaccination completely protected K18-hACE2 mice from SARS-CoV-1 lethal infection. No weight-loss was observed in any vaccinated mice (
Hamsters were vaccinated with 2 doses of IBIS, followed by intranasal inoculation of the same titer of SARS-CoV-1 used in mice at 28-days post-vaccination. Lungs, nasal turbinate, and trachea were harvested at day 2 and day 5 post-infection for determination of viral burden. No virus was detected in the lungs of vaccinated hamsters at either day 2 or day 5 (
Since IBIS vaccination protected animals from SARS-CoV-1 infection, IBIS was then tested for its protection against infection of recent emerging SARS-CoV-2 variants such as Delta and Omicron. The hamster transmission model was applied for the study of Delta and Omicron variants because of their enhanced transmissibility and high viral load measured in the upper respiratory tract (see, e.g., Science. 2022 377:428-433, hereby incorporated by reference in entirety). In the same hamster co-housing model as was used for wild-type SARS-CoV-2 transmission, IBIS-vaccinated hamsters did not exhibit weight loss after co-housing with index hamsters pre-infected with either omicron (
Type-I interferons have been shown to facilitate CD4+ T cell expansion and survival (see, e.g., J Immunol 2006 176:3315-9; Immunity 2014 40:961-73; Immunity 2014 40:949-60), and to inhibit T regulatory cell-mediated suppression of antigen-specific CD4+ T cells (see, e.g., J Exp Med 2014 211:961-74; PLoS Pathog 2018 14:e1006985). Therefore, it was possible that the expression of IFNβ by IBIS could strengthen the vaccine-induced SARS-CoV-2-specific T-cell response.
To compare the T-cell response elicited by the vaccine with or without the integrated IFNβ cassette, an identical vaccine was generated (i.e., SARS2-mE) that did not carry the ORF8 replacement by IFNβ (
When compared with the SARS2-mE group, no significant enhancement of lung and BAL CD8+ T-cell activation was observed in the IBIS vaccination group (
Mouse IFNβ was able to activate interferon signaling in mouse L929 and monkey Vero cells, but not in human cells. To evaluate the function of IFNβ encoded by IBIS in human cells, a human version of IBIS (hIBIS) that encoded human IFNβ was generated. Activation of interferon signaling was known to promote a host antiviral response. Therefore, expression of IFNβ by IBIS could help to prevent SARS-CoV-2 infection when adaptive immunity had yet to be mounted by the vaccines. Thus, A549-hACE2-hTMPRSS2 cells were infected with SARS-CoV-2 (Omicron BA.2) with or without pre-, co-, or post-treatment of hIBIS (
All references mentioned in the present invention are incorporated herein by reference as if each of those references has been incorporated by reference individually. Although the description referred to particular embodiments, it will be clear to a person skilled in the art that the present invention may be practiced with variation of these specific details. Hence this invention should not be construed as limited to the embodiments set forth herein.
tgctctcctgttgtgcttctccactacagctctttccatgagctacaacttgcttggattcctacaaagaagcagcaattttcagtgtcagaagctcctgtggcaattgaatgggaggcttgaatact
gcctcaaggacaggatgaactttgacatccctgaggagattaagcagctgcagcagttccagaaggaggacgccgcattaccatctatgagatgctccagaacatctttgctattttcagac
aagattcatctagcactggctggaatgagactattgttgagaacctcctggctaatgtctatcatcagataaaccatctgaagacagtcctggaagaaaaactggagaaagaagatttcaccag
gggaaaactcatgagcagtctgcacctgaaaagatattatgggaggattctgcattacctgaaggccaaggagtacagtcactgtgcctggaccatagtcagagtggaaatcctaaggaactt
ttacttcattaacagacttacaggttacctccgaaactgaGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTGAT
ttgtgcttctccactacagctctttccatgagctacaacttgcttggattcctacaaagaagcagcaattttcagtgtcagaagctcctgtggcaattgaatgggaggcttgaatactgcctcaagg
acaggatgaactttgacatccctgaggagattaagcagctgcagcagttccagaaggaggacgccgcattgaccatctatgagatgctccagaacatctttgctattttcagacaagattcatct
agcactggctggaatgagactattgttgagaacctcctggctaatgtctatcatcagataaaccatctgaagacagtcctggaagaaaaactggagaaagaagatttcaccaggggaaaactc
atgagcagtctgcacctgaaaagatattatgggaggattctgcattacctgaaggccaaggagtacagtcactgtgcctggaccatagtcagagtggaaatcctaaggaacttttacttcattaa
cagacttacaggttacctccgaaactgaGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGA
acagctctttccatgagctacaacttgcttggattcctacaaagaagcagcaattttcagtgtcagaagctcctgtggcaattgaatgggaggcttgaatactgcctcaaggacaggatgaacttt
gacatccctgaggagattaagcagctgcagcagttccagaaggaggacgccgcattgaccatctatgagatgctccagaacatctttgctattttcagacaagattcatctagcactggctgga
atgagactattgttgagaacctcctggctaatgtctatcatcagataaaccatctgaagacagtcctggaagaaaaactggagaaagaagatttcaccaggggaaaactcatgagcagtctgc
acctgaaaagatattatgggaggattctgcattacctgaaggccaaggagtacagtcactgtgcctggaccatagtcagagtggaaatcctaaggaacttttacttcattaacagacttacaggt
tacctccgaaactgaGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCCAAAA
ctgtggcaattgaatgggaggcttgaatactgcctcaaggacaggatgaactttgacatccctgaggagattaagcagctgcagcagttccagaaggaggacgccgcattgaccatctatga
gatgctccagaacatctttgctattttcagacaagattcatctagcactggctggaatgagactattgttgagaacctcctggctaatgtctatcatcagataaaccatctgaagacagtcctggaa
gaaaaactggagaaagaagatttcaccaggggaaaactcatgagcagtctgcacctgaaaagatattatgggaggattctgcattacctgaaggccaaggagtacagtcactgtgcctgga
ccatagtcagagtggaaatcctaaggaacttttacttcattaacagacttacaggttacctccgaaactgaGACGTTCGTGTTGTTTTAGATTTCATCTAAACGA
ccaacaagtgtctcctccaaattgctctcctgttgtgcttctccactacagctctttccatgagctacaacttgcttggattcctacaaagaagcagcaattttcagtgtcagaagctcctgtggcaa
ttgaatgggaggcttgaatactgcctcaaggacaggatgaactttgacatccctgaggagattaagcagctgcagcagttccagaaggaggacgccgcattgaccatctatgagatgctcca
gaacatctttgctattttcagacaagattcatctagcactggctggaatgagactattgttgagaacctcctggctaatgtctatcatcagataaaccatctgaagacagtcctggaagaaaaactg
gagaaagaagatttcaccaggggaaaactcatgagcagtctgcacctgaaaagatattatgggaggattctgcattacctgaaggccaaggagtacagtcactgtgcctggaccatagtcag
agtggaaatcctaaggaacttttacttcattaacagacttacaggttacctccgaaactgaGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAAC
ctccaaattgctctcctgttgtgcttctccactacagctctttccatgagctacaacttgcttggattcctacaaagaagcagcaattttcagtgtcagaagctcctgtggcaattgaatgggaggct
tgaatactgcctcaaggacaggatgaactttgacatccctgaggagattaagcagctgcagcagttccagaaggaggacgccgcattgaccatctatgagatgctccagaacatctttgctatt
ttcagacaagattcatctagcactggctggaatgagactattgttgagaacctcctggctaatgtctatcatcagataaaccatctgaagacagtcctggaagaaaaactggagaaagaagattt
caccaggggaaaactcatgagcagtctgcacctgaaaagatattatgggaggattctgcattacctgaaggccaaggagtacagtcactgtgcctggaccatagtcagagtggaaatcctaa
ggaacttttacttcattaacagacttacaggttacctccgaaactgaGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTC
ctgcgttcctgctgtgcttctccaccacagccctctccatcaactataagcagctccagctccaagaaaggacgaacattcggaaatgtcaggagctcctggagcagctgaatggaaagatca
acctcacctacagggcggacttcaagatccctatggagatgacggagaagatgcagaagagttacactgcctttgccatccaagagatgctccagaatgtctttettgtcttcagaaacaatttc
tccagcactgggtggaatgagactattgttgtacgtctcctggatgaactccaccagcagacagtgtttctgaagacagtactagaggaaaagcaagaggaaagattgacgtgggagatgtc
ctcaactgctctccacttgaagagctattactggagggtocaaaggtaccttaaactcatgaagtacaacagctacgcctggatggtggtccgagcagagatcttcaggaactttctcatcattc
gaagacttaccagaaacttccaaaactgaGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGG
agctcctggagcagctgaatggaaagatcaacctcacctacagggcggacttcaagatccctatggagatgacggagaagatgcagaagagttacactgcctttgccatccaagagatgct
ccagaatgtctttcttgtcttcagaaacaatttctccagcactgggtggaatgagactattgttgtacgtctcctggatgaactccaccagcagacagtgtttctgaagacagtactagaggaaaa
gcaagaggaaagattgacgtgggagatgtcctcaactgctctccacttgaagagctattactggagggtgcaaaggtaccttaaactcatgaagtacaacagctacgcctggatggtggtcc
gagcagagatcttcaggaactttctcatcattcgaagacttaccagaaacttccaaaactgaGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAA
This application claims the benefit of, and priority to, U.S. Provisional Application No. 63/382,009, filed on Nov. 2, 2022, the content of which is incorporated herein by reference in its entirety.
| Number | Name | Date | Kind |
|---|---|---|---|
| 7429481 | Bergman | Sep 2008 | B2 |
| 20080063664 | Hsiao | Mar 2008 | A1 |
| 20210290756 | Sullivan | Sep 2021 | A1 |
| 20220325279 | Ellis | Oct 2022 | A1 |
| 20240024461 | Kok | Jan 2024 | A1 |
| Number | Date | Country |
|---|---|---|
| 2006136448 | Dec 2006 | WO |
| 2017049266 | Mar 2017 | WO |
| 2017223538 | Dec 2017 | WO |
| WO-2022184287 | Sep 2022 | WO |
| 2023168880 | Sep 2023 | WO |
| 2024094050 | May 2024 | WO |
| Entry |
|---|
| Zhang, et al., Expression of Interferon-g by a Coronavirus Defective-Interfering RNA Vector and Its Effect on Viral Replication, Spread, and Pathogenicity, Virology, Jul. 7, 1997; vol. 233, No. (2):327-38. doi: 10.1006/viro.1997.8598. PMID: 9217056. (Year: 1997). |
| Kumar, et al., Deletion in the C-terminal region of the envelope glycoprotein in some of the Indian SARS-COV-2 genome, Virus Research, Jan. 2, 2021;291:198222. doi: 10.1016/j.virusres.2020.198222. Epub Nov. 6, 2020. PMID: 33166565. (Year: 2021). |
| Konishi K, Yamaji T, Sakuma C, Kasai F, Endo T, Kohara A, Hanada K, Osada N. Whole-Genome Sequencing of Vero E6 (Vero C1008) and Comparative Analysis of Four Vero Cell Sublines. Front Genet. Mar. 22, 2022;13:801382. doi: 10.3389/fgene.2022.801382. PMID: 35391802; PMCID: PMC8981525. (Year: 2022). |
| Channappanavar, R. et al. (Feb. 10, 2016). “Dysregulated Type I Interferon and Inflammatory Monocyte-Macrophage Responses Cause Lethal Pneumonia in SARS-COV-Infected Mice,” Cell Host Microbe. 19(2):181-193. |
| Channappanavar, R. et al. (Jul. 29, 2019). “IFN-I Response Timing Relative to Virus Replication Determines MERS Coronavirus Infection Outcomes,” J Clin Invest. 129(9):3625-3639. |
| Chu, H. et al. (Sep. 15, 2020). “Comparative Replication and Immune Activation Profiles of SARS-COV-2 and SARS-COV in Human Lungs: An Ex Vivo Study with Implications for the Pathogenesis of COVID-19,” Clin Infect Dis. 71:1400-1409. |
| Crouse, J. et al. (Jun. 19, 2014). “Type I Interferons Protect T Cells Against NK Cell Attack Mediated by the Activating Receptor NCR1,” Immunity 40:961-973. |
| Doench, J. G. et al. (Feb. 2016). “Optimized SgRNA Design to Maximize Activity and Minimize Off-target Effects of CRISPR-Cas9,” Nat Biotechnol. 34(2):184-191, 35 pages. |
| Fehr, A. R. et al. (2020). “Bacterial Artificial Chromosome-Based Lambda Red Recombination with the I-Scel Homing Endonuclease for Genetic Alteration of MERS-COV,” Methods Mol Biol. 2099:53-68. |
| Gangaplara, A. et al. (Apr. 19, 2018). “Type I Interferon Signaling Attenuates Regulatory T Cell Function in Viral Infection and in the Tumor Microenvironment,” PLOS Pathogens 14(4): e1006985, 27 pages. |
| GenBank Accession No. NC045512.2 last updated Jul. 18, 2020, located at a href=“https://www.nobi.nim.nih.gov/nuccore/NC_045512.2/” target=“_blank”https://www.nobl.nim.nih.gov/nuccore/NC_045512.2//a, last visited on Jan. 25, 2023, 16 pages. |
| GenBank Accession No. NM002176.4, last updated Jan. 22, 2023, located at a href=“https://www.ncbi.nlm.nih.gov/nuccore/NM_002176.4/” target=“_blank”https://www.ncbi.nim.nih.gov/nuccore/NM_002176.4/a, last visited on Jan. 26, 2023, 4 pages. |
| GenBank Accession No. NM010510.2, last updated Jan. 1, 2023, located at a href=“https://www.ncbi.nim.nih.gov/nuccore/NM_010510.2/” target=“_blank”https://www.nobl.nim.nih.gov/nuccore/NM_010510.2//a, last visited on Jan. 26, 2023, 3 pages. |
| GenBank Accession No. YP009725299.1, last updated Jul. 18, 2020, located at a href=“https://www.ncbi.nim.nih.gov/protein/YP_009725299.1/” target=“_blank”https://www.ncbi.nim.nih.gov/protein/YP_009725299.1//a, last visited on Jan. 25, 2023, 3 pages. |
| GenBank Accession No. YP009725300.1, last updated Jul. 18, 2020, located at a href=“https://www.ncbi.nim.nih.gov/protein/YP_009725300.1/” target=“_blank”https://www.ncbi.nim.nih.gov/protein/YP_009725300.1//a, last visited on Jan. 25, 2023, 2 pages. |
| GenBank Accession No. YP009725305.1, last updated Jul. 18, 2020, located at a href=“https://www.ncbi.nim.nih.gov/protein/YP_009725305.1/” target=“_blank”https://www.ncbi.nim.nih.gov/protein/YP_009725305.1//a, last visited on Oct. 9, 2002, 2 pages. |
| GISAID Sequence No. EPL_ISL_13777658, last updated Jul. 12, 2022, located at a href=“https://gisaid.org/” target=“_blank”https://gisaid.org//a, last visited on Jan. 26, 2023, 1 page. |
| GISAID Sequence No. EPI_ISL_9845731, last updated Feb. 14, 2022, located at a href=“https://gisaid.org/” target=“_blank”https://gisaid.org//a, last visited on Jan. 26, 2023, 1 page. |
| Gomez, C. E. et al.(Mar. 11, 2021). “Emerging SARS-COV-2 Variants and Impact in Global Vaccination Programs against SARS-COV-2/COVID-19,” Vaccines 9(3):243, 13 pages. |
| Hatton, C. F. et al. (Dec. 7, 2021). “Delayed Induction of Type I and III Interferons Mediates Nasal Epithelial Cell Permissiveness to SARS-COV-2,” Nat Commun. 12:7092, 17 pages. |
| Havenar-Daughton, C. et al. (Mar. 15, 2006). “Cutting Edge: The Direct Action of Type I IFN on CD4 T Cells Is Critical for Sustaining Clonal Expansion in Response to a Viral but Not a Bacterial Infection,” J Immunol 176(6): 3315- 3319. |
| Huber, J. P. et al.(Apr. 2011, e-pub Mar. 10, 2011). “Regulation of Effector and Memory T-cell Functions by Type I Interferon,” Immunology 132(4):466-474. |
| Lee, J. H. et al. (e-pub Apr. 2, 2022). “Interferon Antagonists Encoded by SARS-COV-2 at a Glance,” Med Microbiol Immunol. 1-7. |
| O'Brien, T. R. et al. (Nov. 1, 2014). “IFN-Lambda4: The Paradoxical New Member of the Interferon Lambda Family,” J Interferon Cytokine Res. 34(11):829-838. |
| Pestka, S. et al. (Dec. 2004). “Interferons, Interferon-like Cytokines, and Their Receptors,” Immunol Rev. 202:8-32. |
| Public Health England (Apr. 1, 2021). “SARS-COV-2 Variants of Concern and Variants Under Investigation in England: Technical Briefing 8,” Briefing, 50 pages. |
| Ramvikas, M. et al. (e-pub Oct. 7, 2016). “Nasal Vaccine Delivery,” Micro and Nanotechnology in Vaccine Development 2017:279-301. |
| Reid, E. et al. (e-pub Sep. 2, 2014). “Type I and III Interferon Production in Response to RNA Viruses,” J Interferon Cytokine Res 34(9):649-658. |
| Srivastava, S. et al. (May 5, 2014). “Type | Interferons Directly Inhibit Regulatory T Cells to Allow Optimal Antiviral T Cell Responses During Acute LCMV Infection,” J Exp Med. 211(5):961-974. |
| Starr, T. N. et al. (Feb. 3, 2022). “ACE2 Binding is an Ancestral and Evolvable Trait of Sarbecoviruses,” Nature 603:913-918. |
| Tang, J.W. et al. (Apr. 2021). “Emergence of a New SARS-COV-2 variant in the UK,”Journal of Infection 82(4):e27-e28. |
| Trimpert, J. et al. (Aug. 3, 2021). “Development of Safe and Highly Protective Live-Attenuated SARS-COV-2 Vaccine Candidates by Genome Recoding,” Cell Rep 36(5):109493, 20 pages. |
| Xu, H. C. et al. (Jun. 19, 2014). “Type I Interferon Protects Antiviral CD8 T Cells from NK Cell Cytotoxicity,” Immunity 40:949-960. |
| Ye, Z. W. et al. (Mar. 29, 2022). “Intranasal Administration of a Single Dose of a Candidate Live Attenuated Vaccine Derived from an NSP16-deficient SARS-COV-2 Strain Confers Sterilizing Immunity in Animals,” Cell Mol Immunol 19:588-601. |
| Yuan, S. et al. (Jun. 23, 2022). “Pathogenicity, Transmissibility, and Fitness of SARS-COV-2 Omicron in Syrian Hamsters,” Science 377(6604):428-433, 5 pages. |
| Yuen, C. K. et al. (2020, e-pub Jun. 20, 2020). “SARS-COV-2 nsp13, nsp14, nsp15 and orf6 Function as Potent Interferon Antagonists,” Emerging Microbes and Infections 9(1):1418-1428. |
| Zhang, X. et al. (Apr. 15, 2021). “A Trans-Complementation System for SARS-COV-2 Recapitulates Authentic Viral Replication without Virulence,” Cell 184(8): 2229-2238. |
| Qu, L. et al. (Sep. 30, 2019, e-pub. Jul. 15, 2019). “Programmable RNA Editing By Recruiting Endogenous ADAR Using Engineered RNAs,” Nature Biotechnology 37:1059-1069. |
| U.S. Appl. No. 18/542,741, filed Aug. 21, 2023, for Kin Hang Kok et al. (U.S. Patent Application is not submitted herewith pursuant to the waiver of 37 C.F.R. §1.98(a)(2)(iii) issued by the Office on Sep. 21, 2004.). |
| Hoffmann, M. et al. (Apr. 16, 2020). “SARS-COV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor,” Cell 181(2):271-280. |
| Li, F. et al. (Sep. 16, 2005). “Structure of SARS Coronavirus Spike Receptor-Binding Domain Complexed with Receptor,” Science 309(5742):1864-1868. |
| Millet, J. K. et al. (Apr. 16, 2015). “Host Cell Proteases: Critical Determinants of Coronavirus Tropism and Pathogenesis,” Virus Res. 202:120-134. |
| Walls, A. C. et al. (Apr. 16, 2020). “Structure, Function, and Antigenicity of the SARS-COV-2 Spike Glycoprotein,” Cell 180(2):281-292, 38 pages. |
| Wang, Q. et al. (May 14, 2020). “Structural and Functional Basis of SARS-COV-2 Entry by Using Human ACE2,” Cell 181(4):894-904. |
| Zhou, P. et al. (Mar. 12, 2020, e-pub. Feb. 3, 2020). “A Pneumonia Outbreak Associated With A New Coronavirus Of Probable Bat Origin,” Nature 579:270-273. |
| U.S. Appl. No. 63/382,009, filed Nov. 2, 2022, for Kin Hang Kok et al. (U.S. Patent Application is not submitted herewith pursuant to the waiver of 37 C.F.R. §1.98(a)(2)(iii) issued by the Office on Sep. 21, 2004.). |
| Bracci, L. et al. (2005, e-pub. Dec. 31, 2004). “Type I IFN is a Powerful Mucosal Adjuvant for a Selective Intranasal Vaccination Against Influenza Virus in Mice and Affects Antigen Capture at Mucosal Level,” Vaccine 23:2994-3004. |
| Faul, E. J. et al. (Dec. 20, 2008, e-pub. Oct. 21, 2008). “Interferon-beta Expressed by a Rabies Virus-based HIV-1 Vaccine Vector Serves as a Molecular Adjuvant and Decreases Pathogenicity,” Virology 382(2): 226-238, 22 pages. |
| International Search Report and Written Opinion, mailed Feb. 16, 2024, for PCT Application No. PCT/CN2023/129016, filed Nov. 1, 2023, 12 pages. |
| Jimenez-Guardeno, J. M. et al. (Oct. 2015, e-pub.Oct. 29, 2015). “Identification of the Mechanisms Causing Reversion to Virulence in an Attenuated SARS-COV for the Design of a Genetically Stable Vaccine,” PLoS Pathog. 11(10):e10055215, 36 pages. |
| Proietti, E. et al. (Jul. 1, 2002). “Type I IFN as a Natural Adjuvant for a Protective Immune Response: Lessons from the Influenza Vaccine Model,” 169(1):375-383. |
| Regla-Nava, J. A. et al. (Apr. 1, 2015). “Severe Acute Respiratory Syndrome Coronaviruses with Mutations in the E Protein Are Attenuated and Promising Vaccine Candidates,” J Virol. 89(7):3870-3887. |
| Sosa, J. P. et al. (Jun. 2021, e-pub. Jun. 17, 2021). “Effects of Interferon Beta in COVID-19 Adult Patients: Systematic Review,” Infect Chemother. 53(2):247-260. |
| Number | Date | Country | |
|---|---|---|---|
| 20240139307 A1 | May 2024 | US |
| Number | Date | Country | |
|---|---|---|---|
| 63382009 | Nov 2022 | US |
