IRE-1α inhibitors

Information

  • Patent Grant
  • 9241942
  • Patent Number
    9,241,942
  • Date Filed
    Wednesday, November 13, 2013
    11 years ago
  • Date Issued
    Tuesday, January 26, 2016
    8 years ago
Abstract
Compounds which directly inhibit IRE-1α activity in vitro, prodrugs, and pharmaceutically acceptable salts thereof. Such compounds and prodrugs are useful for treating diseases associated with the unfolded protein response and can be used as single agents or in combination therapies.
Description
FIELD OF THE INVENTION

The invention relates to IRE-1α inhibitors and their therapeutic uses.


BACKGROUND OF THE INVENTION

Protein folding stress in the endoplasmic reticulum of a cell initiates a signal transduction cascade termed the unfolded protein response or UPR. A key enzyme, inositol requiring enzyme 1 (IRE-1α), relieves protein folding stress by enhancing molecular chaperone activity and therefore protects cells from stress induced apoptosis. Inhibitors of IRE-1α are useful for treating at least B cell autoimmune diseases, certain cancers, and some viral infections.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1. Results of cell-based IRE-1α XBP-1-specific endoribonuclease inhibition by 6-bromo o-vanillin. 12 μL DMSO is 1.2%.



FIG. 2. Results of cell-based IRE-1α XBP-1-specific endoribonuclease inhibition in human myeloma cells.



FIG. 3. Scans of agarose gels displaying PCR products from cell-based assays of IRE-1α inhibitors, demonstrating dose-dependent inhibition of cellular XBP-1 splicing for various IRE-1α inhibitors. XBP-1u, unspliced XBP-1; XBP-1s, spliced SBP-1; EC50, concentration (μM) at which IRE-1α inhibitors inhibit DTT-induced cellular XBP-1 splicing by 50%. The numbers above the lanes indicate the concentration of each compound in μM. MM.1s myeloma cells were treated with active or inactive compounds for two hours and then treated with DTT for 1 hour. RT-PCR was performed using human XBP-1 specific primers flanking the intron region. DTT induced UPR stress (S) resulted in the removal of a 26 nucleotide fragment resulting in the appearance of the lower band compared to unstressed cells (U) (upper band). EC50 was determined as the 50 percent inhibition of spliced XBP-1 induced by DTT. The EC50 of compound 17-1 is approximately 2-3 μM.



FIG. 4. Graphs showing that an IRE-1α inhibitor reversibly inhibits the activated form of the IRE-1α in cells. Cellular inhibition of XBP-1 splicing was measured using 10 μM compound 2 in HEK 293 cells. FIG. 4A shows relative amounts of spliced XBP-1 using standard RT-PCR when 2 mM DTT is added and left in culture (▴) or after washing DTT out 30 minutes (♦) or 1 hour after induction (▪). The XBP-1 messenger RNA is rapidly converted to the spliced form when cells are stressed with DTT. Conversely, when the stress is removed, spliced XBP-1 is rapidly degraded by the cell and replaced by the unspliced form. FIG. 4B demonstrates that when compound 2 is added to DTT stressed cells 2 hours before (▪), or 1 hour after DDT induction (▴), the unspliced form rapidly accumulates similar to the removal of the DTT stress, suggesting the compound inhibits the activated form of the enzyme. When the compound is washed out while leaving the DDT stress on, spliced XBP-1 increases over several hours after complete inhibition suggesting the inhibition is reversible (▪, X, *). Percent splicing was determined by scanning gel for unspliced and spliced XBP-1 bands (as in FIG. 3). Enzyme activity is represented on the Y axis by the percent of spliced XBP-1 (calculated as the amount of spliced divided by the total amount of spliced and unspliced XBP-1).



FIG. 5. Graph showing inhibition of proliferation of multiple myeloma cells by IRE-1α inhibitor 11-28 (Example 11). RPMI-8226 multiple myeloma cells were seeded at 20,000 cells per well in RPMI culture medium containing 1% FBS and the required antibiotics. The plate was incubated overnight at 37° C., 95% air, 5% CO2. The following day, compound 11-28 or medium alone was added to wells, resulting in a final volume of 100 μl per well. The compound concentration ranged from 100 μM to 0 μM, with compounds diluted by a factor of 4. After addition of compound, the plate was incubated at 37° C., 95% air, 5% CO2 for 24 hours. Cell proliferation was measured using the CellTiter-Glo assay (Promega), following the manufacturer's instructions.



FIG. 6. Western blot (FIG. 6A) and agarose gel (FIG. 6B) demonstrating that 24 hour treatment of RPMI8226 cells with bortezomib (MG-341; VELCADE®) increases the levels of phosphorylated IRE-1α and XBP1-splicing. The numbers indicate the concentration of bortezomib in nM.



FIG. 7. Graphs showing potentiation of apoptosis in myeloma cells using the proteasome inhibitor MG-132 (N-[(phenylmethoxy)carbonyl]-L-leucyl-N-[(1S)-1-formyl-3-methylbutyl]-L-leucinamide) and an IRE-1α/XBP-1 specific inhibitor as reflected by relative caspase activity (the total of caspase 3 and caspase 7 activities). FIG. 7A, 100 nM MG-132; FIG. 7B, 200 nM MG-132.



FIG. 8. Results of in vivo assays of IRE-1α inhibitors in mouse tissues. FIG. 8A, protocol for tunicamycin and IRE-1α inhibitor treatment. FIG. 8B, agarose gel of RT-PCR products demonstrating that IRE-1α specific XBP-1 splicing is largely inactive in the kidney, liver, and spleen of adult NOD-SCID mice. FIG. 8C, treatment with tunicamycin for 6 hours resulted in significant levels of spliced XBP-1 (Wu et al., 2007) FIG. 8C, agarose gel of RT-PCR products demonstrating diminished levels of spliced XBP-1 in mice treated with IRE-1α inhibitors four hours after IP treatment with tunicamycin. FIG. 8D, graphical representation of the average relative percentage of spliced XBP-1 over total XBP-1 from the two mice per group in FIGS. 8B and 8C. The numbers above the brackets in FIG. 8B and FIG. 8C are mouse numbers (mouse 3, mouse 4, etc.). FIG. 8D, graphical representation of the average relative percentage of spliced XBP-1 over total XBP-1 from the two mice per group in FIGS. 8B and 8C.



FIG. 9. Inhibition of IgM secretion after LPS stimulation of primary murine B cells with selected IRE-1α inhibitors. Compound 17-1 blocked IgM secretion at all doses tested down to 100 nM when added at beginning of stimulation and again at 24 hours post stimulation. However, compounds had little effect when at added after 40 hours of stimulation; only slight inhibition at the highest dose. Methods were performed as previously described by Iwakoshi et al., Nature 4, 321-29, 2003 for B cell stimulation, plasma cell differentiation and IgM secretion. Primary B cells were Isolated from BALB/c splenocytes using mouse CD43 Microbeads (Miltenyi cat#130-049-801) with 1×106 cells per treatment. Purified B cells were stimulated in B Cell Media at a final density of 1×106/ml/well in 24-well plates with 20 μg/ml LPS (Sigma cat#L4391). IRE-1α inhibitor compound 17-1 was added at various concentrations (50 μM, 10 μM, 2 μM, 0.4 μM and 0.08 μM) at specified time points (t=0, t=24 hr, t=40 hr, etc.) Cells were incubated for 48 hr at 37° C. At end of the incubation, cells were spun in a plate at 1500 rpm/3 min. Supernatants were collected for quantitation for IgM secretion using a mouse IgM ELISA Kit (Bethyl Labs cat#E90-101). B Cell medium included RPMI+10% FBS supplemented with NEAA, HEPES, NaPyr, PSQ, and β-mercaptoethanol.





DETAILED DESCRIPTION OF THE INVENTION

The invention provides IRE-1α inhibitor compounds and prodrugs and pharmaceutically acceptable salts thereof. The invention also provides pharmaceutical compositions and methods of using the IRE-1α inhibitor compounds, prodrugs, and pharmaceutically acceptable salts thereof therapeutically to treat disorders associated with the unfolded protein response. Patients who can be treated include those with B cell autoimmune diseases, certain cancers, and some viral infections.


The present invention comprises numerous chemical compounds related by structure and by function, as well as methods for their use. Various groupings of these compounds comprising from one to any number of them, and their uses, can be defined and constitute individual embodiments of the invention. Some embodiments will specifically include certain compounds whereas others will specifically exclude certain compounds. Criteria for inclusion or exclusion include specific structures or structural features, levels or ranges of activity (for example, IC50s or EC50s), suitability for administration by a particular route of administration, disease treated, and the like.


IRE-1α Inhibitor Compounds


IRE-1α inhibitor compounds of the invention are aromatic and heteroaromatic hydroxyaldehydes which directly inhibit the enzyme. The compounds are understood to act through inhibition of the RNAse activity of enzyme. In particular embodiments of the invention this activity is detected as cleavage of a human mini-XBP-1 mRNA stem-loop substrate 5′-CAGUCCGCAGGACUG-3′ (SEQ ID NO:1) by IRE-1α in vitro by at least 10, 15, 20, 25, 30, 40, 50, 60, or 75%. Other substrates also can be used to detect cleavage. See US 20070105123.


In some embodiments, compounds inhibit IRE-1α in the in vitro assay with an average IC50 of approximately 20 μM (20,000 nM) or less (e.g., 20000, 15000, 10000, 7500, 7250, 7000, 6750, 6500, 6250, 6000, 5750, 5500, 5250, 5000, 4750, 4500, 4250, 4000, 3750, 3500, 3250, 3000, 2750, 2500, 2250, 2000, 1750, 1500, 1250, 1000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, 15, 10, 5, 2, or 1 nM or less). In some embodiments, compounds inhibit IRE-1α in an in vivo XBP-1 splicing assay (e.g., in myeloma cells) with an average EC50 of 80 μM (80,000 nM) or less (e.g., 80000, 75000, 70000, 65000, 60000, 55000, 50000, 45000, 40000, 35000, 30000, 25000, 20000, 15000, 10000, 7500, 7250, 7000, 6750, 6500, 6250, 6000, 5750, 5500, 5250, 5000, 4750, 4500, 4250, 4000, 3750, 3500, 3250, 3000, 2750, 2500, 2250, 2000, 1750, 1500, 1250, 1000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, 15, 10, 5, 2, or 1 nM or less). IRE-1α inhibitor compounds can meet either of both of these criteria.


As is well known in the art, the aldehyde group in these compounds can be represented by any of the three equivalent forms shown below:




embedded image


Compounds useful according to the invention are encompassed within structural formula (I):




embedded image


wherein:

    • the OH substituent is located ortho to the aldehyde substituent;
    • Q is selected from benzene, naphthalene, pyridine, pyridine N-oxide, thiophene, benzo[b]thiophene, benzo[c]thiophene, furan, pyrrole, pyridazine, pyrmidine, pyrazine, triazine, isoxazoline, oxazoline, thiazoline, pyrazoline, imidazoline, fluorine, biphenyl, quinoline, isoquinoline, cinnoline, phthalazine, quinazoline, quinoxaline, benzofuran, indole, isoindole, isobenzofuran, benzimidazole, 1,2-benzisoxazole, and carbazole;
    • Rx, Ry, and Rz can be present or absent and are independently selected from hydrogen, aryl, heterocyclic, -A″Ra, —OH, —OA″Ra, —NO2, —NH2, —NHA″Ra, —N(A″Ra)(A′″Rb), —NHCOA″Ra, —NHCOOA″Ra, —NHCONH2, —NHCONHA″Ra, —NHCON(A″Ra)(A′″Rb), halogen, —COOH, —COOA″Ra, —CONH2, —CONHA″Ra, —CON(A″Ra)(A′″Rb), and




embedded image




    • Ra and Rb are independently hydrogen, —COOH, —COOA, —CONH2, —CONHA, —CONAA′, —NH2, —NHA, —NAA′, —NCOA, —NCOOA, —OH, or —OA;

    • Y is C1-C10 alkylene or C2-C8 alkenylene, in which (a) one, two or three CH2 groups may be replaced by O, S, SO, SO2, NH, or NR and/or (b) 1-7H atoms may be independently replaced by F or Cl;

    • A and A′ are:
      • (a) independently C1-C10 alkyl or C2-C8 alkenyl, in which (i) one, two or three CH2 groups may be replaced by O, S, SO, SO2, NH, or NRc and/or (ii) 1-7H atoms may be independently replaced by F or Cl, aryl or heterocyclic; or
      • (b) A and A′ together are alternatively C2-C7 alkylene, in which one, two or three CH2 groups may be replaced by O, S, SO, SO2, NH, NRc, NCORc or NCOORc, to form, for example, an alkylenedioxy group;

    • A″, A′″ are independently (a) absent, (b) C1-C10 alkylene, C2-C8 alkenylene, or C3-C7 cycloalkyl in which one, two or three CH2 groups may be replaced by O, S, SO, SO2, NH or NRc and/or 1-7H atoms may be replaced by F and/or Cl; or (c) together are C2-C7 alkyl in which one, two or three CH2 groups may be replaced by O, S, SO, SO2, NH, NRc, NCORc or NCOORc,

    • Rc is C1-C10 alkyl, C3-C7 cycloalkyl, C4-C8 alkylenecycloalkyl, or C2-C8 alkenyl; in which one, two or three CH2 groups may be replaced by O, S, SO, SO2, NH, NMe, NEt and/or by —CH═CH— groups, 1-7H atoms may be replaced by F and/or Cl, and/or 1H atom may be replaced by Ra;

    • aryl is phenyl, benzyl, naphthyl, fluorenyl or biphenyl, each of which is unsubstituted or monosubstituted, disubstituted or trisubstituted by halogen, —CF3, —Rf, —ORd, —N(Rd)2, —NO2, —CN, —COORd, CON(Rd)2, —NRdCORe, —NRdCON(Re)2, —NRdSO2A, —CORd, —SO2N(Rd)2, —S(O)mRf, AA′ together, or —O(aryl),

    • Rd and Re are independently H or C1-C6 alkyl;

    • Rf is C1-C6 alkyl;

    • heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by carbonyl oxygen, halogen, Rf, —ORd, —N(Rd)2, —NO2, —CN, —COORd, —CON(Rd)2, —NRdCORe, —NRdCON(Re)2, —NRfSO2Re, —CORd, —SO2NRd and/or —S(O)mRf; and

    • m is 0, 1 or 2.





Groups of IRE-1α inhibitor compounds within formula (I) include the following, in which Rx, Ry, and Rz are as defined above:




embedded image


embedded image


embedded image


C1-C10 alkyl (i.e., alkyl having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms) and C1-C6 alkyl (i.e., alkyl having 1, 2, 3, 4, 5, or 6 carbon atoms) can be branched or unbranched and can be substituted or unsubstituted. Optional substituents include halogens (e.g., F, Cl, I, Br). Examples include methyl, ethyl, trifluoromethyl, pentafluoroethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, neopentyl, isopentyl, n-hexyl, and n-decyl. In some embodiments C1-C10 is methyl, ethyl, trifluoromethyl, propyl, isopropyl, butyl, n-pentyl, n-hexyl, or n-decyl.


C3-C7 cycloalkyl includes cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl. In some embodiments, C3-C7 cycloalkyl is cyclopentyl.


In some embodiments C2-C8 alkenyl is vinyl, allyl, 2-butenyl, 3-butenyl, isobutenyl, sec-butenyl, 4-pentenyl, isopentenyl or 5-hexenyl. In some embodiments C2-C8 alkenyl is 4-pentenyl, isopentenyl, or 5-hexenyl.


C1-C10 alkylene is preferably unbranched and in some embodiments is methylene or ethylene, propylene, or butylene.


In some embodiments C2-C8 alkenylene is ethenylene, or propenylene.


C2-C7 alkylene is preferably unbranched. In some embodiments, C2-C7 alkylene is ethylene, propylene, or butylene.


In some embodiments C4-C8 alkylenecycloalkyl is cyclohexylmethyl or cyclopentylethyl.


In some embodiments Rx, Ry, and Rz are independently —OH, —OA, —NO2, or —NAA′.


In some embodiments, Q is benzene, naphthalene, thiophene, benzo[b]thiophene, or benzo[c]thiophene, Rx and Ry are hydrogen, and Rz is hydrogen or —ORd, —NO2, pyridyl, or pyridyl N-oxide.


In some embodiments, Rx is hydrogen, ORd, NO2, —NH2, or —NHCOOA″Ra.


In some embodiments Ra is hydrogen, —COOH, —NHA, or —NAA′.


In some embodiments Rc is C1-C10 alkyl or C1-C6 alkyl.


In some embodiments Y is methylene, ethylene, propylene, or butylene.


In some embodiments A and A′ are independently C1-C10 alkyl; C1-C10 alkyl in which 1-7 hydrogen atoms are replaced by F and/or Cl; aryl; or heterocyclic.


In some embodiments A″ and A′″ are independently absent or are C1-C10 alkylene in which one CH2 group may be replaced by NH or NRc.


In some embodiments A″ and A′″ are together C2-C7 alkylene chain in which one CH2 group may be replaced by NH or NRc.


In some embodiments, aryl is monosubstituted, disubstituted or trisubstituted with methyl, ethyl, propyl, butyl, fluorine, chlorine, hydroxyl, methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyloxy, nitro, cyano, formyl, acetyl, propionyl, trifluoromethyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, sulfonamido, methylsulfonamido, ethylsulfonamido, propylsulfonamido, butylsulfonamido, dimethylsulfonamido, carboxyl, methoxycarbonyl, ethoxycarbonyl, or aminocarbonyl.


In some embodiments, heterocyclic is selected from 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 1-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 1-pyrrolyl, 3-pyrazolyl, 4-pyrazolyl, 5-pyrazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 3-isothiazolyl, 4-isothiazolyl, 5-isothiazolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-pyrmidinyl, 6-pyrimidinyl, 1,2,3-triazol-1-yl, 1,2,3-triazol-4-yl, or 1,2,3-triazol-5-yl, 1,2,4-triazol-1-yl, 1,2,4-triazol-3-yl, 1,2,4-triazol-5-yl, 1-tetrazolyl, 5-tetrazolyl, 1,2,3-oxadiazol-4-yl, 1,2,3-oxadiazol-5-yl, 1,2,4-oxadiazol-3-yl, 1,2,4-oxadiazol-5-yl, 1,3,4-thiadiazol-2-yl or 1,3,4-thiadiazol-5-yl, 1,2,4-thiadiazol-3-yl, or 1,2,4-thiadiazol-3-5-yl, 1,2,3-thiadiazol-4-yl, 1,2,3-thiadiazol-5-yl, 3-pyridazinyl, 4-pyridazinyl, pyrazinyl, 1-indolyl, 2-indolyl, 3-indolyl, 4-indolyl, 5-indolyl, 6-indolyl, 7-indolyl, 4-isoindolyl, 5-isoindolyl, 1-benzimidazolyl, 2-benzimidazolyl, 4-benzimidazolyl, 5-benzimidazolyl, 1-benzopyrazolyl, 3-benzopyrazolyl, 4-benzopyrazolyl, 5-benzopyrazolyl, 6-benzopyrazolyl, 7-benzopyrazolyl, 2-benzoxazolyl, 4-benzoxazolyl, 5-benzoxazolyl, 6-benzoxazolyl, 7-benzoxazolyl, 3-benzisoxazolyl, 4-benzisoxazolyl, 5-benzisoxazolyl, 6-benzisoxazolyl, 7-benzisoxazolyl, 2-benzothiazolyl, 4-benzothiazolyl, 5-benzothiazolyl, 6-benzothiazolyl, 7-benzothiazolyl, 2-benzisothiazolyl, 4-benzisothiazolyl, 5-benzisothiazolyl, 6-benzisothiazolyl, 7-benzisothiazolyl, 4-benz-2,1,3-oxadiazolyl, 5-benz-2,1,3-oxadiazolyl, 6-benz-2,1,3-oxadiazolyl, 7-benz-2,1,3-oxadiazolyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 6-quinolyl, 7-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 6-isoquinolyl, 7-isoquinolyl, 8-isoquinolyl, 3-cinnolinyl, 4-cinnolinyl, 5-cinnolinyl, 6-cinnolinyl, 7-cinnolinyl, 8-cinnolinyl, 2-quinazolinyl, 4-quinazolinyl, 5-quinazolinyl, 6-quinazolinyl, 7-quinazolinyl, 8-quinazolinyl, 5-quinoxalinyl, 6-quinoxalinyl, 2-2H-benz-1,4-oxazinyl, 3-2H-benz-1,4-oxazinyl, 5-2H-benz-1,4-oxazinyl, 6-2H-benz-1,4-oxazinyl, 7-2H-benz-1,4-oxazinyl, 8-2H-benz-1,4-oxazinyl, 1,3-benzodioxol-5-yl, 1,4-benzodioxan-6-yl, 2,1,3-benzothiadiazol-4-yl, 2,1,3-benzothiadiazol-5-yl, and 2,1,3-benzoxadiazol-5-yl.


The heterocyclic radicals may also be partially or completely hydrogenated. For example, in some embodiments heterocyclic is 2,3-dihydro-2-furyl, 2,3-dihydro-3-furyl, 2,3-dihydro-4-furyl, 2,3-dihydro-5-furyl, 2,5-dihydro-2-furyl, 2,5-dihydro-3-furyl, 2,5-dihydro-4-furyl, 2,5-dihydro-5-furyl, tetrahydro-2-furyl, tetrahydro-3-furyl, 1,3-dioxolan-4-yl, tetrahydro-2-thienyl, tetrahydro-3-thienyl, 2,3-dihydro-1-pyrrolyl, 2,3-dihydro-2-pyrrolyl, 2,3-dihydro-3-pyrrolyl, 2,3-dihydro-4-pyrrolyl, 2,3-dihydro-5-pyrrolyl, 2,5-dihydro-1-pyrrolyl, 2,5-dihydro-2-pyrrolyl, 2,5-dihydro-3-pyrrolyl, 2,5-dihydro-4-pyrrolyl, 2,5-dihydro-5-pyrrolyl, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, tetrahydro-1-imidazolyl, tetrahydro-2-imidazolyl, tetrahydro-4-imidazolyl, 2,3-dihydro-1-pyrazolyl, 2,3-dihydro-2-pyrazolyl, 2,3-dihydro-3-pyrazolyl, 2,3-dihydro-4-pyrazolyl, 2,3-dihydro-5-pyrazolyl, tetrahydro-1-pyrazolyl, tetrahydro-3-pyrazolyl, tetrahydro-4-pyrazolyl, 1,4-dihydro-1-pyridyl, 1,4-dihydro-2-pyridyl, 1,4-dihydro-3-pyridyl, 1,4-dihydro-4-pyridyl, 1,2,3,4-tetrahydro-1-, 1,2,3,4-tetrahydro-2-, 1,2,3,4-tetrahydro-3-pyridyl, 1,2,3,4-tetrahydro-4-pyridyl, 1,2,3,4-tetrahydro-5-pyridyl, 1,2,3,4-tetrahydro-6-pyridyl, 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-piperidinyl, 2-morpholinyl, 3-morpholinyl, 4-morpholinyl, tetrahydro-2-pyranyl, tetrahydro-3-pyranyl, tetrahydro-4-pyranyl, 1,4-dioxanyl, 1,3-dioxan-2-yl, 1,3-dioxan-4-yl, 1,3-dioxan-5-yl, hexahydro-1-pyridazinyl, hexahydro-3-pyridazinyl, hexahydro-4-pyridazinyl, hexahydro-1-pyrimidinyl, hexahydro-2-pyrimidinyl, hexahydro-4-pyrimidinyl, hexahydro-5-pyrimidinyl, 1-piperazinyl, 2-piperazinyl, 3-piperazinyl, 1,2,3,4-tetrahydro-1-, 1,2,3,4-tetrahydro-2-quinolyl, 1,2,3,4-tetrahydro-3-quinolyl, 1,2,3,4-tetrahydro-4-quinolyl, 1,2,3,4-tetrahydro-5-quinolyl, 1,2,3,4-tetrahydro-6-quinolyl, 1,2,3,4-tetrahydro-7-quinolyl, 1,2,3,4-tetrahydro-8-quinolyl, 1,2,3,4-tetrahydro-1-isoquinolyl, 1,2,3,4-tetrahydro-2-isoquinolyl, 1,2,3,4-tetrahydro-3-isoquinolyl, 1,2,3,4-tetrahydro-4-isoquinolyl, 1,2,3,4-tetrahydro-5-isoquinolyl, 1,2,3,4-tetrahydro-6-isoquinolyl, 1,2,3,4-tetrahydro-7-isoquinolyl, 1,2,3,4-tetrahydro-8-isoquinolyl, 2-3,4-dihydro-2H-benzo-1,4-oxazinyl, 3-3,4-dihydro-2H-benzo-1,4-oxazinyl, 5-3,4-dihydro-2H-benzo-1,4-oxazinyl, 6-3,4-dihydro-2H-benzo-1,4-oxazinyl, 7-3,4-dihydro-2H-benzo-1,4-oxazinyl, 8-3,4-dihydro-2H-benzo-1,4-oxazinyl, 2,3-methylenedioxyphenyl, 3,4-methylenedioxyphenyl, 2,3-ethylenedioxyphenyl, 3,4-ethylenedioxyphenyl, 3,4-(difluoromethylenedioxy)phenyl, 2,3-dihydrobenzofuran-5-yl, 2,3-dihydrobenzofuran-6-yl, 2,3-(2-oxomethylenedioxy)phenyl, 3,4-dihydro-2H-1,5-benzodioxepin-6-yl, 3,4-dihydro-2H-1,5-benzodioxepin-7-yl, 2,3-dihydrobenzofuranyl, or 2,3-dihydro-2-oxofuranyl.


In some other embodiments, heterocyclic is unsubstituted pyridyl, pyridyl N-oxide, thienyl, furyl, pyrrolyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, isoxazolinyl, oxazolinyl, thiazolinyl, pyrazolinyl, imidazolinyl, naphthyl, quinolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinazolinyl, or quinoxalinyl. In other embodiments, heterocyclic is pyridyl.


In some embodiments, heterocyclic is a monocyclic saturated or unsaturated heterocyclic ring having 1 to 2 N and/or O atoms, which may be monosubstituted or disubstituted by carbonyl, oxygen, OH or OA, such as 2-oxopiperidin-1-yl, 2-oxopyrrolidin-1-yl, 2-oxo-1H-pyridin-1-yl, 3-oxomorpholin-4-yl, 4-oxo-1H-pyridin-1-yl, 2,6-dioxopiperidin-1-yl, 2-oxopiperazin-1-yl, 2,6-dioxopiperazin-1-yl, 2,5-dioxopyrrolidin-1-yl, 2-oxo-1,3-oxazolidin-3-yl, 3-oxo-2H-pyridazin-2-yl, 2-caprolactam-1-yl (=2-oxoazepan-1-yl), 2-hydroxy-6-oxopiperazin-1-yl, 2-methoxy-6-oxopiperazin-1-yl, 2-azabicyclo[2.2.2]-octan-3-on-2-yl, or 2-oxopiperidin-1-yl. In some embodiments heterocyclic is 2-oxopiperidin-1-yl.


In other embodiments, heterocyclic is a monocyclic saturated heterocyclic radical having 1 to 2 N atoms, which may be mono-substituted or disubstituted by C1-C6 alkyl.


Groups of IRE-1α inhibitor compounds within formula (I) also include those having the structural formula (II)




embedded image


wherein:

    • R1 is hydrogen, halogen, —NO2, —OCH3, or —OCH2CH3; and
    • Ar is




embedded image



each of which may be unsubstituted or substituted with 1, 2, or 3 substitutents independently selected from halogen, —OH, —COOH, —CH2OCH3, C1-C3 alkyl, C1-C3 alkoxy, —CH2OH, phenyloxy, and phenyl-C1-C3 alkoxy. Alkoxys may be linear or branched.


In some embodiments R1 is —OCH3.


Representative IRE-1α inhibitor compounds of formula (II) include those listed in Tables 1 and 2.









TABLE 1









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image











Groups of IRE-1α inhibitor compounds within formula (I) also include those having the structural formula (III):




embedded image


wherein R2, R3, and R4 are independently selected from hydrogen, halogen, —OH, —COOH, —CH2OCH3, C1-C3 alkyl, C1-C3 alkoxy, —CH2OH, phenyloxy, and phenyl-C1-C3 alkoxy.


Representative IRE-1α inhibitor compounds of formula (III) include those listed in Table 2.









TABLE 2









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image











Groups of IRE-1α inhibitor compounds within formula (I) also include those having the structural formula (IV):




embedded image


wherein:

    • R1 is selected from hydrogen, —OH, —OCH3, —OCH2CH3, —C═O, or —NO2; and
    • R5 and R6 independently are hydrogen, halogen, C1-C3 alkyl, or —NO2.


In some embodiments, the IRE-1α inhibitor compounds have the structural formula (IV) with the exception of compounds in which:

    • R1, R5, and R6 are each hydrogen;
    • R1 is —OCH3, and R5 and R6 are both hydrogen;
    • R1 and R5 are both hydrogen and R6 is fluorine;
    • R1 and R6 are both —NO2 and R5 is hydrogen;
    • R1 and R5 are both hydrogen and R6 is —CH3;
    • R1 is —CH3 and R5 and R6 are both hydrogen;
    • R1 is —OCH3, R5 is




embedded image




    • and R6 is hydrogen;

    • R1 and R6 are both Cl, I, or F;

    • R1 is Br, and R6 is Cl;

    • R1 is —NO2, and R6 is Br;

    • R1 is carbonyl, and R6 is Cl or methyl;

    • R1 is methoxy, and R6 is —NO2, Br, methoxy, or Cl; and

    • R1 is methoxy, and R5 is Br.





Other IRE-1α inhibitor compounds have the following structural formula:




embedded image


wherein R3 is as defined above. Representative IRE-1α inhibitor compounds of Formula (V) include:




embedded image


Other IRE-1α inhibitor compounds have structural formula (VI):




embedded image


wherein R2 is as defined above. For example, IRE-1α inhibitor compounds in which R2 is phenyl can have the following structure:




embedded image


wherein R4 and R5 independently are selected from the substituents for R2 and R3 defined above.


Representative IRE-1α inhibitor compounds of Formula (VI) include:




embedded image


embedded image


Other useful IRE-1α inhibitor compounds are provided in Table 3, below.


In some embodiments, IRE-1α inhibitor compounds have structural formula (A), which falls within the scope of formula (I):




embedded image


wherein:

    • R1 is hydrogen, halogen, or a 5- or 6-membered heterocyclic containing one or two heteroatoms independently selected from nitrogen, oxygen, and sulfur;
    • R2 is hydrogen,




embedded image




    • phenyl, or a 5- or 6-membered heterocyclic containing 1 or 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic is optionally benzofused and wherein the heterocyclic is optionally substituted by 1, 2, or 3 substituents independently selected from







embedded image




    • C1-C3 linear or branched alkyl,







embedded image




    • C1-C3 phenylalkyl, C1-C3 alkoxyphenylalkyl,







embedded image




    • R3 is hydrogen, halogen, —NO2, C1-C3 linear or branched alkoxy, C1-C3 linear or branched hydroxyl alkyl,







embedded image




    • and

    • Q is a five- or six-membered heterocycle.





In some compounds of structural formula (A), R1 is selected from the group consisting of hydrogen,




embedded image



and Br.


In some compounds of structural formula (A) R2 is selected from the group consisting of hydrogen,




embedded image


embedded image


In some compounds of structural formula (A) R4 is selected from the group consisting of hydrogen,




embedded image


In some compounds of structural formula (A) R5 is selected from the group consisting of hydrogen,




embedded image


In some compounds of structural formula (A) R6 is selected from the group consisting of hydrogen,




embedded image


In some compounds of structural formula (A) R7 is selected from the group consisting of hydrogen,




embedded image


In some compounds of structural formula (A) R8 is selected from the group consisting of hydrogen,




embedded image



or, together with R9 and the nitrogen atom to which they are attached, is




embedded image


In some compounds of structural formula (A) R9 is hydrogen or, together with R8 and the nitrogen atom to which they are attached, is




embedded image


In some compounds of structural formula (A) R3 is selected from the group consisting of hydrogen, —F, —CF3, —NO2, —O, —OCH3, —CH2OH,




embedded image



and —OR10, wherein R10 is hydrogen, C1-C6 linear or branched alkyl, or




embedded image



wherein R8 and R9 are as defined above for structural formula (A).


In some embodiments compounds are represented by structural formula (A1), which falls within the scope of formula (A):




embedded image


wherein:

    • R1 is hydrogen or a six-membered heterocyclic containing 1 or 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur;
    • Q is an optionally benzofused five or six-membered heterocyclic ring;
    • R3 is hydrogen, halogen, —NO2, C1-C3 linear or branched alkoxy, C1-C3 linear or branched hydroxyl alkyl,




embedded image



and

    • R4, R5, and R6 are independently hydrogen, ═O, —CH3,




embedded image


In some compounds of structural formula (A1) R1 is selected from the group consisting of hydrogen,




embedded image


In some compounds of structural formula (1) Q is selected from the group consisting of




embedded image


embedded image



and


R4, R5, and R6 are independently selected from




embedded image



C1-C3 linear or branched alkyl,




embedded image



C1-C3 phenylalkyl, C1-C3 alkoxyphenylalkyl,




embedded image


In some compounds of structural formula (A1) R3 is selected from the group consisting of hydrogen, —F, —CF3, —NO2, and —OCH3.


In some embodiments compounds represented by structural formula (A2), which falls within the scope of formula (A):




embedded image


wherein:

    • R1 is hydrogen, halogen, or a 5- or 6-membered heterocyclic containing one or two heteroatoms independently selected from nitrogen, oxygen, and sulfur;
    • R3 is hydrogen, halogen, —NO2, C1-C3 linear or branched alkyl, C1-C3 linear or branched alkoxy, C1-C3 linear or branched hydroxyl alkyl,




embedded image



and

    • R4, R5, and R6 are independently selected from




embedded image



C1-C3 linear or branched alkyl,




embedded image



C1-C3 phenylalkyl, C1-C3 alkoxyphenylalkyl,




embedded image


In some embodiments compounds are represented by the structural formula (A3), which falls within the scope of formula (A):




embedded image


wherein:

    • Q is a five- or six-membered heterocyclic containing 1 or 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur;
    • R1 is hydrogen; and
    • R3 is hydrogen or C1-C3 alkyoxy.


In some compounds of structural formula (A3) Q is selected from the group consisting of




embedded image


In some compounds of structural formula (A3) R3 is




embedded image


In some embodiments compounds are represented by the structural formula (A4), which falls within the scope of formula (A4):




embedded image


wherein:

    • R1 is hydrogen;
    • R3 is hydrogen, —F, —NO2, or




embedded image




embedded image



or, together with R9 and the nitrogen atom to which they are attached, is




embedded image



and

    • R9 is hydrogen or, together with R8 and the nitrogen atom to which they are attached, is




embedded image


In some embodiments, compounds have one of the following structural formulae:




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


In some embodiments compounds are represented by structural formula (B), which falls within the scope of formula (I):




embedded image


wherein:

    • R1 and R2 independently are hydrogen, phenyl or an optionally benzofused five- or six-membered heterocycle, wherein the phenyl or the optionally benzofused five- or six-membered heterocycle is optionally substituted with




embedded image




    • —CH2OH, —CHO, —OCH3, halogen, —OH, —CH3,







embedded image


R3 is hydrogen, halogen, —NO2, C1-C3 linear or branched alkyl, C1-C3 linear or branched alkoxy, C1-C3 linear or branched hydroxyl alkyl,




embedded image



and

    • R4 is hydrogen,




embedded image


In some embodiments compounds have one of the following structural formulae:




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


In some embodiments compounds are represented by structural formula (C), which falls within the scope of formula (I):




embedded image


wherein:

    • R1 is hydrogen, —CH3, or —OH;
    • R2 and R3 independently are hydrogen, phenyl or an optionally benzofused five- or six-membered heterocycle, wherein the phenyl or the optionally benzofused five- or six-membered heterocycle is optionally substituted with




embedded image




    • —CH2OH, —CHO, —OCH3, halogen, —OH, —CH3,







embedded image



and

    • the hydroxy substitutent in ring A is located ortho to the aldehyde substituent.


In some embodiments compounds represented by structural formula (C) have one of the following structures:




embedded image


In some embodiments compounds are represented by structural formula (D), which falls within the scope of formula (I):




embedded image



wherein R1 is hydrogen, halogen, —NO2, C1-C3 linear or branched alkyl, C1-C3 linear or branched alkoxy, C1-C3 linear or branched hydroxyl alkyl,




embedded image



In one compound of structural formula (D), R1 is methyl.


Other useful compounds according to the invention are shown in Tables 11-42.


Pharmaceutically Acceptable Salts; Stereoisomers; Tautomers


IRE-1α inhibitor compounds include both the free form of the compounds and the pharmaceutically acceptable salts and stereoisomers thereof. Some of the specific IRE-1α inhibitor compounds described herein are the protonated salts of amine compounds. The term “free form” refers to the amine compounds in non-salt form. The encompassed pharmaceutically acceptable salts not only include the salts described for the specific compounds disclosed herein, but also all the typical pharmaceutically acceptable salts of the free form of IRE-1α inhibitor compounds of Formulas I-VII and A-D and of the prodrugs of formulas E and F (below).


The free form of the specific salt compounds described may be isolated using techniques known in the art. For example, the free form may be regenerated by treating the salt with a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate. The free forms may differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but the acid and base salts are otherwise pharmaceutically equivalent to their respective free forms for purposes of the invention.


The pharmaceutically acceptable salts of the disclosed IRE-1α inhibitor compounds can be synthesized from the compounds of this invention which contain a basic or acidic moiety by conventional chemical methods. Generally, the salts of the basic compounds are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Similarly, the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base.


Pharmaceutically acceptable salts of IRE-1α inhibitor compounds include the conventional non-toxic salts of the compounds as formed by reacting a basic compound with an inorganic or organic acid. For example, conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, benzenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.


When an IRE-1α inhibitor compound is acidic, suitable pharmaceutically acceptable salts include salts prepared form pharmaceutically acceptable non-toxic bases including inorganic bases and organic bases. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc and the like. Particular salts are the ammonium, calcium, magnesium, potassium and sodium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine caffeine, choline, N,N1-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine tripropylamine, tromethamine and the like. The preparation of the pharmaceutically acceptable salts described above and other typical pharmaceutically acceptable salts is more fully described by Berg et al., “Pharmaceutical Salts,” J. Pharm. Sci., 1977:66:1-19.


Some IRE-1α compounds or prodrugs are potentially internal salts or zwitterions, because under physiological conditions a deprotonated acidic moiety in the compound, such as a carboxyl group, may be anionic, and this electronic charge might then be balanced off internally against the cationic charge of a protonated or alkylated basic moiety, such as a quaternary nitrogen atom.


IRE-1α inhibitor compounds or prodrugs thereof may have asymmetric centers, chiral axes, and chiral planes (as described in: E. L. Eliel and S. H. Wilen, Stereochemistry of Carbon Compounds, John Wiley & Sons, New York, 1994, pages 1119-1190), and may occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers and mixtures thereof, including optical isomers, being included in the present invention.


An IRE-1α inhibitor compound or prodrug thereof may be of such a nature that its constituent atoms are capable of being arranged spatially in two or more ways, despite having identical bonds. As a consequence, this compound exists in the form of stereoisomers. Cis/trans isomerism is only one type of stereoisomerism. If the stereoisomers are image and mirror image which cannot be superimposed, they are enantiomers which have chirality or handedness since one or more asymmetric carbon atoms are present in the structure forming them. Enantiomers are optically active and therefore distinguishable since they rotate the plane of polarized light to an equal extent, but in opposite directions.


If two or more asymmetric carbon atoms are present in an IRE-1α compound, two possible configurations exist at each of these carbon atoms. If two asymmetric carbon atoms are present, four possible stereoisomers exist, for example. Furthermore, these four possible stereoisomers can be divided into six possible pairs of stereoisomers that differ from each other. In order for a pair of molecules with more than one asymmetric carbon to be enantiomers, they must have different configurations at each asymmetric carbon. Those pairs that do not behave as enantiomers have a different stereochemical relationship, which is known as a diastereomeric relationship. Stereoisomers that are not enantiomers are known as diastereoisomers, or, more frequently, diastereomers.


All of these well-known aspects of the stereochemistry of the compounds of the invention are considered to be part of the present invention. The present invention therefore covers IRE-1α inhibitor compounds which are stereoisomers, and, if these are enantiomers, the individual enantiomers, racemic mixtures of these enantiomers, and artificial, i.e. synthetic, mixtures comprising proportions of these enantiomers which are different from the proportions of these enantiomers observed in a racemic mixture. If an IRE-1α inhibitor compound has stereoisomers that are diastereomers, this compound includes the individual diastereomers as well as mixtures of any two or more of these diastereomers in any desired proportions.


The following is intended to serve for explanation: if a single asymmetric carbon atom exists in an IRE-1α inhibitor compound that results in the (−)(R) and (+)(S) enantiomers thereof, this an IRE-1α inhibitor compound includes all pharmaceutically acceptable salt forms, prodrugs and metabolites thereof which are therapeutically active and useful for the treatment of or preventing the diseases and conditions described further herein. If an IRE-1α inhibitor compound exists in the form of (−)(R) and (+)(S) enantiomers, this compound also includes the (+)(S) enantiomer alone or the (−)(R) enantiomer alone if all, substantially all or a predominant share of the therapeutic activity resides in only one of these enantiomers or undesired side effects reside in only one of these enantiomers. If essentially no difference exists between the biological properties of the two enantiomers, this compound of the invention furthermore includes the (+)(S) enantiomer and the (−)(R) enantiomer together as a racemic mixture or non-racemic mixture in any desired ratio of corresponding proportions.


The specific biological effects and/or physical and chemical properties of a pair or set of enantiomers of an IRE-1α inhibitor compound—if present—may make it obvious to use these enantiomers in certain ratios, for example to form a final therapeutic product. The following is intended to serve for illustration: if a pair of enantiomers exists, the enantiomers can be used in ratios such as 90% (R)-10% (S), 80% (R)-20% (S), 70% (R)-30% (S), 60% (R)-40% (S), 50% (R)-50% (S), 40% (R)-60% (S), 30% (R)-70% (S), 20% (R)-80% (S), and 10% (R)-90% (S). After evaluation of the properties of the various enantiomers of an IRE-1α inhibitor compound—if they exist—the corresponding amount of one or more of these enantiomers having certain desired properties which form the final therapeutic product can be determined in a simple manner.


For IRE-1α inhibitor compounds disclosed herein which may exist as tautomers, both tautomeric forms are encompassed within the invention, even though only one tautomeric structure is depicted. For example, a compound such as that below drawn as the keto tautomer includes the enol tautomer, and vice versa, as well as mixtures thereof.




embedded image


The invention also includes pharmaceutically usable stereoisomers, E/Z isomers, enantiomers, racemates, diastereomers, hydrates, and solvates of the disclosed compounds. “Solvates” are adductions of inert solvent molecules onto the compounds which form owing to their mutual attractive force. Solvates are, for example, monohydrates, dihydrates or alcoholates.


Prodrugs


The invention also provides prodrugs which are metabolized to active IRE-1α inhibitor compounds after administration. For example, IRE-1α inhibitor compounds disclosed herein can be modified, for example, with alkyl or acyl groups, sugars, or oligopeptides and which are rapidly cleaved in vivo to release the active IRE-1α inhibitor compounds.


Derivatives of the corresponding aromatic alcohols can serve as prodrugs for aromatic aldehydes because alcohols and aldehydes are metabolically interconvertible, according to the following general scheme:




embedded image



Scheline, 1972, Xenobiotica, 2, 227-36.


Examples of prodrugs of aldehydes, ketones, alcohols and other functional groups are described in Wermuth et al., 1996, Designing Prodrugs and Bioprecursors I: Carrier Prodrugs. In The Practice of Medicinal Chemistry, pp. 672-696; and in Wermuth, 1996, “Preparation of Water-Soluble Compounds by Covalent Attachment of Solubilizing Moieties,” in Wermuth, ed., The Practice of Medicinal Chemistry, pp. 756-776. Other general aldehyde derivatives and alcohol derivatives that can perform prodrug functions as well as methods for their preparation are described in Cheronis et al., 1965, Semimicro Qualitative Organic Analysis, New York: Interscience, pp. 465-518.


Prodrugs of the invention includes compounds having the structural formula AA, BB, or CC, below, in which Q′ is identical in all respects to Q as defined above, with the exception that the aldehyde substituent of Q is present in a prodrug form as shown below, and Ra and Rc are as defined above:




embedded image


In some embodiments, prodrugs of IRE-1α inhibitor compounds are represented by structural formula (E):




embedded image


wherein:

    • R1 is hydrogen or —OCH3; and




embedded image


In some embodiments prodrugs represented by structural formula (E) have one of the following structural formulae:




embedded image


embedded image


In some embodiments IRE-1α inhibitor prodrugs are represented by structural formula (F):




embedded image


wherein:

    • R1 is hydrogen or Br;
    • R2 is hydrogen, Br, or




embedded image



and

    • R3 is hydrogen, —OCH3, —COOH, or —OCH2CH3.


In some embodiments IRE-1α prodrugs represented by structural formula (F) have one of the following structural formulae:




embedded image


embedded image


Other examples of IRE-1α inhibitor prodrugs include:




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image



Provisos for Compound Claims


To the extent any of the following compounds are not novel, Applicants reserve the right to present compound and/or composition claims which include a proviso excluding the compounds and/or their pharmaceutically acceptable salts from the scope of the claims:




embedded image



in which W2 is halogen; an alkyl group having 1 to 4 carbon atoms; an alkoxy group having 1 to 4 carbon atoms; an acyloxy group having 2 to 4 carbon atoms; an acyl group having 2 to 4 carbon atoms; a carboxylic acid group; an ester group —COOW5, wherein W5 is a straight or branched chain alkyl radical having 1 to 4 carbon atoms; a nitrile group; an OH group; a —CHO group; an —NO2 group; or an acetamido group; W1 is hydrogen or one of the substituents defined under W2; W3 and W4, which may be identical or different, are each a hydrogen atom or one of the substituents defined under W2;




embedded image



in which T1, T2, T3, T4, and T5 are independently selected from hydroxyl groups, alkoxy groups containing from 1 to 6 carbon atoms; alkyl groups containing from 1 to 6 carbon atoms, a phenyl group, NO2, COOH, COH, sulfonic acids, ketones containing from 1 to 6 carbon atoms, F, Cl, Br, I, hydrogen, or the salts of any of the preceding acids or alcohols, wherein at least two of the above T groups are hydrogen; or phenolic mixtures thereof;




embedded image



in which each of U1, U2, U3, and U4 independently represents a hydrogen or halogen atom or an alkyl, cycloalkyl, aralkyl, aryl, alkaryl, alkoxy, aryloxy, acyl or hydroxy group;




embedded image



in which V1, V2, V3, and V4 represent hydrogen or halogen; or in which V2 and V4 are hydrogen and V1 and V3 are hydrogen or halogen;




embedded image



in which Z, Z1, Z2, and Z3, which may be the same or different, represent a hydrogen atom; an alkyl, aryl, or cycloalkyl group; an alkoxyl, hydroxyl or acylamino group; or halogen;


2-hydroxybenzaldehyde (salicylic aldehyde); 2-hydroxy-3-methylbenzaldehyde; 2-hydroxy-3-tert.butylbenzaldehyde; 2-hydroxy-3-tert.butyl-5-methylbenzaldehyde; 2-hydroxy-3,5-ditert.butylbenzaldehyde; 2-hydroxy-3-isopropyl-6-methylbenzaldehyde; 2-hydroxy-3-cyclohexylbenzaldehyde; 2-hydroxy-4-tert.butylbenzaldehyde; 2-hydroxy-4-chlorobenzaldehyde and 2-hydroxy-6-chlorobenzaldehyde; 2-hydroxy-3-phenylbenzaldehyde; 2-hydroxy-5-methoxybenzaldehyde; 2-hydroxy-3-nonylbenzaldehyde; 2,5-dihydroxybenzaldehyde; and 2-hydroxy-4-acetylaminobenzaldehyde;




embedded image



in which B1, B2, B3, and B4 are each a hydrogen atom, an alkyl, cycloalkyl, alkoxy or hydroxyl group or a halogen atom;




embedded image



in which n is 0 or 1, m+n is at most 4 or 3, and D is alkyl, alkoxy, hydroxyalkyl, cycloalkyl, aryl, alkoxyalkyl, hydroxy, nitro, or halogen;


salicylaldehyde, p-hydroxybenzaldehyde, 2,3-dihydroxybenzaldehyde, 2,6-dihydroxybenzaldehyde, 2-hydroxy-3-methoxybenzaldehyde (ortho-vanillin), 2,4-diformylphenol, 2,6-diformylphenol, 1,2-dihydroxy-3,5-diformylbenzene, 1,2-dihydroxy-4,6-diformylbenzene, 1-hydroxy-2-methoxy-4,6-diformylbenzene (4,6-diformylguaiacol), 1-hydroxy-2-ethoxy-4,6-diformylbenzene, 2,6-dihydroxybenzaldehyde, and ortho-hydroxy-para-vanillin;




embedded image


in which E1 represents a hydroxyl group, a halogen atom, an alkyl group, a cycloalkyl group, an aryl group, a heterocyclic group, an alkoxy group, an aryloxy group, an acylamino group, a sulfonylamino group, an unsubstituted amino group, a monoalkylamino group, a dialkylamino group, an arylamino group, or an alkylarylamino group; or E1s may bond together to represent a 5- or 6-membered ring; E is positioned in the ortho or the para position with respect to the formyl group and represents a methylene group substituted by at least one selected from the group consisting of a hydroxyl group, a halogen atom, an alkoxy group, an aryloxy group, an alkylthio group, an arylthio group, an acyloxy group, a chlorocarbonyloxy group, an alkoxycarbonyloxy group, and an aminocarbonyloxy group; r is an integer of 0 to 3; and when r is 2 or more, E1s are the same or different;




embedded image



in which E3 represents a hydroxyl group, an alkyl group, a cycloalkyl group, an aryl group, an alkoxy group, an aryloxy group, an acylamino group, a sulfonylamino group, an unsubstituted amino group, a monoalkylamino group, a dialkylamino group, an arylamino group, or an alkylarylamino group, or E3s may bond together to represent a 5- or 6-membered ring; —CH2— is positioned in the ortho or the para position with respect to the formyl group, E2 represents an alkylthio group, an arylthio group, a chlorocarbonyloxy group, an alkoxycarbonyloxy group, or an aminocarbonyloxy group; s is 0 to 3, and when s is 2 or more, E3s are the same or different;


2-hydroxybenzaldehyde, 3-methyl-2-hydroxybenzaldehyde, 3-ethyl-2-hydroxybenzaldehyde, 3-n-propyl-2-hydroxybenzaldehyde, 3-isopropyl-2-hydroxybenzaldehyde, 3-n-butyl-2-hydroxybenzaldehyde, 3-sec-butyl-2-hydroxybenzaldehyde, 3-tert-butyl-2-hydroxybenzaldehyde, 3-amyl-2-hydroxybenzaldehyde, 4-methyl-2-hydroxybenzaldehyde, 4-ethyl-2-hydroxybenzaldehyde, 4-n-propyl-2-hydroxybenzaldehyde, 4-isopropyl-2-hydroxybenzaldehyde, 4-n-butyl-2-hydroxybenzaldehyde, 4-sec-butyl-2-hydroxybenzaldehyde, 4-tert-butyl-2-hydroxybenzaldehyde, 4-amyl-2-hydroxybenzaldehyde, 5-methyl-2-hydroxybenzaldehyde, 5-ethyl-2-hydroxybenzaldehyde, 5-n-propyl-2-hydroxybenzaldehyde, 5-isopropyl-2-hydroxybenzaldehyde, 5-n-butyl-2-hydroxybenzaldehyde, 5-sec-butyl-2-hydroxybenzaldehyde, 5-tert-butyl-2-hydroxybenzaldehyde, 5-amyl-2-hydroxybenzaldehyde, 6-methyl-2-hydroxybenzaldehyde, 6-ethyl-2-hydroxybenzaldehyde, 6-n-propyl-2-hydroxybenzaldehyde, 6-isopropyl-2-hydroxybenzaldehyde, 6-n-butyl-2-hydroxybenzaldehyde, 6-sec-butyl-2-hydroxybenzaldehyde, 6-tert-butyl-2-hydroxybenzaldehyde, 6-amyl-2-hydroxybenzaldehyde, 3,5 dinitro-2-hydroxybenzaldehyde, 3,5 difluoro-2-hydroxybenzaldehyde, 3,4 diisobutyl-2-hydroxybenzaldehyde, 3,4 di-tert-butyl-2-hydroxybenzaldehyde, 3,6 di-tert-butyl-2-hydroxybenzaldehyde, 2-hydroxy-3,5-dichlorobenzaldehyde, 2,6-dihydroxybenzaldehyde, 2,4-dihydroxy-6-methylbenzaldehyde, 2,4,6-trihydroxybenzaldehyde, 5-chloro-2-hydroxybenzaldehyde, 2-hydroxy-5-bromobenzaldehyde, 2-hydroxy-3,5-diiodobenzaldehyde, 2,4-dihydroxy-3-methylbenzaldehyde, 2-hydroxy-3-methoxy-6-bromobenzaldehyde, 2,4-dihydroxy-5-propylbenzaldehyde, 2,4-dihydroxy-5-hexylbenzaldehyde, 2-formyl-3,6-dihydroxy-4,5-dimethylbenzaldehyde, 2,3,6-trihydroxybenzaldehyde, 2,4-dihydroxy-5-acetylbenzaldehyde, 2-formyl-3,6-dihydroxy-4,5-dipropylbenzaldehyde, 2-formyl-3-methoxy-4,5-dimethyl-6-hydroxybenzaldehyde, 2,3,5-trihydroxybenzaldehyde, 2-hydroxy-6-(oxy-4-methylpentanoic acid)benzaldehyde, 3-formyl-4,5-dihydroxybenzaldehyde, 2-ethyl-6-hydroxybenzaldehyde, 3-chloro-5-(3,7-dimethyl-2,6-octadienyl)-4,6-dihydroxy-2-methylbenzaldehyde, 2-hydroxy-6-(8-pentadecenyl)benzaldehyde, 2-4-dihydroxy-3-ethyl-6-(1-methylpentyl)benzaldehyde, 2-pentanoic acid-3-formyl-4,5-dihydroxy benzaldehyde, 2-propanoic acid-3-formyl-4,5-dihydroxy benzaldehyde, 2,3,4-trihydroxy-5-methyl-6-hydroxymethylbenzaldehyde, 2-hydroxy-4-methoxybenzaldehyde, 2-hydroxy-5-carboxybenzaldehyde, 3-carboxy-4-hydroxybenzaldehyde, 2,3-dihydroxy-4-methoxybenzaldehyde, 2-hydroxy-6-methoxybenzaldehyde, 2,5-dihydroxybenzaldehyde, 2,3,4-trihydroxy-6-hydroxymethylbenzaldehyde, 2,3-dihydroxybenzaldehyde, 2-hydroxy-5-acetylbenzaldehyde, 2-hydroxy-5-carboxyethylbenzaldehyde, 2-hydroxy-5-carboxypropylbenzaldehyde, 2-hydroxy-5-carboxybutylbenzaldehyde, 2-hydroxy-3-iodo-5-carboxymethylbenzaldehyde, and 2-formyl-3,4,5-trihydroxybenzaldehyde;




embedded image



wherein X is halogen;




embedded image


wherein G1, G2, G3, and G4 are independently hydrogen, straight-chain or branched C1-C10 alkyl, C3-C8 cycloalkyl, strain-chain or branched C1-C10 alkoxy, phenyl, or halogen, wherein alkyl or cycloalkyl may only be in the p-position to the hydroxyl group if they carry no a-H-atoms;




embedded image



in which J1 is NO2 and J2 is hydrogen; J1 and J2 are both chlorine; or J1 is hydrogen and J2 is fluorine;




embedded image



in which K1 and K4 are independently selected from the group consisting essentially of hydrogen; hydroxy; halo; nitro; cyano; trifluoromethyl; (C1-C6)alkyl; (C1-C6)alkoxy; (C3-C6)cycloalkyl; (C2-C6)alkenyl; —C(═O)OK7; —OC(═O)K7; —S(═O)2; —S(═O)2N(K7)(K9); —S(═O)2K7; —S(═O)2OK7; —C(═O)NK7K9; —C(═O)K9; and —N(K7)(K9), where K7 is hydrogen or (C1-C4)alkyl and K9 is (C1-C4)alkyl; wherein: said alkyl, cycloalkyl and alkenyl groups defining K1 and K4 may optionally be independently substituted by one or two substituents selected from the group consisting essentially of halo; hydroxy; (C1-C2)alkyl; (C1-C2)alkoxy; (C1-C2)alkoxy-(C1-C2)alkyl; (C1-C2)alkoxycarbonyl; carboxyl; (C1-C2)alkylcarbonyloxy; nitro; cyano; amino disubstituted by (C1-C2)alkyl; sulfonyl; and sulfonamido disubstituted by (C1-C2)alkyl; and DD and BB are independently N, or CHK2 or CHK3, respectively, where K2 and K3 are independently selected from the group consisting essentially of hydrogen; hydroxy; halo; nitro; cyano; trifluoromethyl; (C1-C6)alkyl; (C1-C6)alkoxy; (C3-C6)cycloalkyl; (C2-C6)alkenyl; —C(═O)OK11; —OC(═O)K11; —S(═O)2; —S(═O)2N(K11)(K13); and —N(K11)(K13), where K11 is hydrogen or (C1-C4)alkyl and K13 is (C1-C4)alkyl; and wherein said alkyl, cycloalkyl and alkenyl groups defining K2 and K3 may optionally be independently substituted by one or two substituents selected from the group consisting essentially of halo; hydroxy; (C1-C2)alkyl; (C1-C2)alkoxy; (C1-C2)alkoxy-(C1-C2)alkyl; (C1-C2)alkoxycarbonyl; carboxyl; (C1-C2)alkylcarbonyl-oxy; nitro; cyano; amino disubstituted by (C1-C2)alkyl; sulfonyl; and sulfonamido disubstituted by (C1-C2)alkyl; in which K and K4 are independently hydrogen; hydroxy; trifluoromethyl; (C1-C4)alkyl; (C1-C4)alkoxy-; —C(═O)OK7; or —N(K7)(K9), where K7 is hydrogen or (C1-C2)alkyl and K9 is (C1-C2); and more preferably K1 and K4 are independently hydrogen; hydroxy; (C1-C2)alkyl; (C1-C2)alkoxy; carboxyl or methylamino, in which case K7 is hydrogen and K9 is methyl; in which K1 and K4 are defined as alkyl and are substituted with a single substitutent selected from hydroxy; (C1-C2)alkoxy; carboxyl; amino disubstituted by (C1-C2)alkyl; and sulfonamido disubstituted by (C1-C2)alkyl; in which K1 and K4 are defined as alkyl and are substituted with a single substitutent selected from hydroxy, methoxy, and dimethylamino; in which one of DD or BB is N and the other is CHK2, or CHK3, respectively; in which DD is CHK2 and BB is CHK3, wherein K2 and K3 are independently hydrogen; hydroxy; halo; trifluoromethyl; (C1-C4)alkyl; (C1-C4)alkoxy; —C(═O)OK1; —S(═O)2N(K11)(K13); or —N(K11)(K13), where K11 is hydrogen or (C1-C2)alkyl and K13 is (C1-C2)alkyl; in which K2 and K3 are independently hydrogen; hydroxy; (C1-C2)alkyl; (C1-C2)alkoxy; carboxyl; or methylamino, K11 is hydrogen and K13 is methyl; and in which K2 and K3 are defined as alkyl and are substituted, there is a single substituent selected from hydroxy; (C1-C2)alkoxy; carboxyl; amino disubstituted by (C1-C2)alkyl; and sulfonamido disubstituted by (C1-C2)alkyl. o-vanillin; salicylaldehyde; 2,3-dihydroxybenzaldehyde; 2,6-dihydroxybenzaldehyde; 2-hydroxy-3-ethoxybenzaldehyde; and pyridoxal;




embedded image



in which L1 and L2 represent halogen atoms, especially chlorine, bromine, or iodine atoms, L3 represents a hydrogen or a halogen atom, especially chlorine, and L represents the hydroxyl group, an aryl or aralkyl residue which is substituted by at least one of the following substituents: a halogen atom, CF3, NO2, CN, alkyl, alkoxy, SCN, or a tertiary amino group;




embedded image


embedded image



in which L1 and L2 are both Cl, both Br, or both I;




embedded image



in which XX is halogen, n is 2 or 3, and YY and ZZ are identical or different lower alkyl radicals which may also form a heterocycle with the nitrogen atom and may contain another heteroatom of N,N, or S, as well as quaternary salts and metal chelates thereof; and




embedded image



in which M1, M4, Y′, and X′ are as defined below:

















M1
M4
X′
Y′
M2
M3







H
H
CHM2
CHM3
H
H


H
OH
CHM2
CHM3
H
H


OH
H
CHM2
CHM3
H
H


CF3
H
CHM2
CHM3
H
H


CH3
H
CHM2
CHM3
H
H


CH2CH3
H
CHM2
CHM3
H
H


OCH3
H
CHM2
CHM3
H
H


C(═O)OH
H
CHM2
CHM3
H
H


C(═O)OCH3
H
CHM2
CHM3
H
H


NHCH3
H
CHM2
CHM3
H
H


N(CH3)2
H
CHM2
CHM3
H
H


H
OH
CHM2
CHM3
H
H


H
CH3
CHM2
CHM3
H
H


H
CF3
CHM2
CHM3
H
H


H
CH2CH3
CHM2
CHM3
H
H


H
OCH3
CHM2
CHM3
H
H


H
C(═O)OH
CHM2
CHM3
H
H


H
C(═O)OCH3
CHM2
CHM3
H
H


H
NHCH3
CHM2
CHM3
H
H


H
N(CH3)2
CHM2
CHM3
H
H


OH
OH
CHM2
CHM3
H
H


CF3
CF3
CHM2
CHM3
H
H


CH3
CH3
CHM2
CHM3
H
H


CH2CH3
CH2CH3
CHM2
CHM3
H
H


OCH3
OCH3
CHM2
CHM3
H
H


C(═O)OH
C(═O)OH
CHM2
CHM3
H
H


C(═O)OCH3
C(═O)OCH3
CHM2
CHM3
H
H


NHCH3
NHCH3
CHM2
CHM3
H
H


N(CH3)2
N(CH3)2
CHM2
CHM3
H
H


H
H
CHM2
CHM3
OH
H


H
H
CHM2
CHM3
H
OH


H
H
CHM2
CHM3
OH
OH


H
H
CHM2
CHM3
CH3
H


H
H
CHM2
CHM3
H
CH3


H
H
CHM2
CHM3
CH3
CH3


H
H
CHM2
CHM3
OCH3
H


H
H
CHM2
CHM3
H
OCH3


H
H
CHM2
CHM3
OCH3
OCH3


H
H
CHM2
CHM3
NHCH3
H


H
H
CHM2
CHM3
H
NHCH3


H
H
CHM2
CHM3
NHCH3
NHCH3


H
H
CHM2
CHM3
N(CH3)2
H


H
H
CHM2
CHM3
H
N(CH3)2


H
H
CHM2
CHM3
N(CH3)2
N(CH3)2


CH3
H
CHM2
CHM3
CH3
H


H
CH3
CHM2
CHM3
H
CH3


OCH3
H
CHM2
CHM3
OCH3
H


OCH3
H
CHM2
CHM3
H
CH3


H
H
CHM2
CHM3
H
OH


H
OH
CHM2
CHM3
CH3
CH3


OCH3
H
CHM2
CHM3
OCH3
H


OH
H
CHM2
CHM3
OCH3
OCH3


OCH3
H
CHM2
CHM3
H
NHCH3


H
NHCH3
CHM2
CHM3
NHCH3
H


H
OH
CHM2
CHM3
H
NHCH3


H
OH
CHM2
CHM3
OH
H


H
OH
CHM2
CHM3
H
OH


N(CH3)2
H
CHM2
CHM3
OCH3
H


CH3
H
CHM2
CHM3
H
OCH3


H
CH3
CHM2
CHM3
N(CH3)2
H


H
N(CH3)2
CHM2
CHM3
CH3
H


OCH3
H
CHM2
CHM3
H
OCH3


OCH3
H
CHM2
CHM3
CH3
CH3


OCH3
H
N
CHM3

H


CH3
H
N
CHM3

CH3


H
N(CH3)2
N
CHM3

H


H
CH3
N
CHM3

CH3


OCH3
OCH3
N
CHM3

H


CH3
H
N
CHM3

NHCH3


CH3
OCH3
N
CHM3

H


CH3
CH2OH
N
CHM3

H


CH3
CH2OH
N
CHM3

CH3


OCH3
CH2OH
N
CHM3

H










Methods of Preparing IRE-1α Inhibitor Compounds and Prodrugs of the Invention


Some of the IRE-1α inhibitor compounds for use in the disclosed methods are available commercially, for example from Fluorochem Ltd., Aurora Fine Chemicals, TCI America Organic Chemicals, AKos Consulting and Solutions, or Maybridge. Others and their starting materials can be prepared by appropriate modification of methods known in the art as described in the literature, for example in standard works such as Houben-Weyl, Methoden der organischen Chemie, Georg-Thieme-Verlag, Stuttgart. Methods may also be found by computer search in The MDL® CrossFire Beilstein database, in which the reaction domain details the preparation of substances. See also the specific Examples, below.


Pharmaceutical Preparations


Any of the IRE-1α inhibitor compounds and prodrugs disclosed herein can be formulated as pharmaceuticals using methods well known in the art. Pharmaceutical formulations of the invention typically comprise at least one IRE-1α inhibitor compound or prodrug thereof mixed with a carrier, diluted with a diluent, and/or enclosed or encapsulated by an ingestible carrier in the form of a capsule, sachet, cachet, paper or other container or by a disposable container such as an ampoule.


A carrier or diluent can be a solid, semi-solid or liquid material. Some examples of diluents or carriers which may be employed in the pharmaceutical compositions of the present invention are lactose, dextrose, sucrose, sorbitol, mannitol, propylene glycol, liquid paraffin, white soft paraffin, kaolin, microcrystalline cellulose, calcium silicate, silica polyvinylpyrrolidone, cetostearyl alcohol, starch, gum acacia, calcium phosphate, cocoa butter, oil of theobroma, arachis oil, alginates, tragacanth, gelatin, methyl cellulose, polyoxyethylene sorbitan monolaurate, ethyl lactate, propylhydroxybenzoate, sorbitan trioleate, sorbitan sesquioleate and oleyl alcohol.


Pharmaceutical compositions of the invention can be manufactured by methods well known in the art, including conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.


For injection, the agents of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art. If desired, any of the IRE-1α inhibitor compounds or prodrugs thereof disclosed herein can be provided in a pyrogen-free pharmaceutically acceptable vehicle.


For oral administration, an IRE-1α inhibitor compound or prodrug thereof can be combined with pharmaceutically acceptable carriers or vehicles which enable the IRE-1α inhibitor compound or prodrug thereof to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like. Fillers can be used, such as gelatin, sugars (e.g., lactose, sucrose, mannitol, or sorbitol); cellulose preparations (e.g., maize starch, wheat starch, rice starch, potato starch, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose); and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.


Dragee cores can be provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification.


Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, an IRE-1α inhibitor compound or prodrug thereof may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration preferably are in dosages suitable for such administration.


For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.


For administration by inhalation, pharmaceutical preparations of the invention can be delivered in the form of an aerosol sprays from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. If desired, a valve can be used to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator, may be formulated containing a powder mix of an IRE-1α inhibitor compound or prodrug thereof and a suitable powder base such as lactose or starch.


IRE-1α inhibitor compounds or prodrugs thereof can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.


Pharmaceutical formulations for parenteral administration include aqueous solutions of an IRE-1α inhibitor compound or prodrug thereof. Additionally, a suspension of an IRE-1α inhibitor compound or prodrug thereof may be prepared as an appropriate oily injection suspension. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of an IRE-1α inhibitor compound or prodrug thereof to allow for the preparation of highly concentrated solutions.


Alternatively, an IRE-1α inhibitor compound or prodrug thereof may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.


IRE-1α inhibitor compounds or prodrugs thereof may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.


In addition to the formulations described previously, an IRE-1α inhibitor compound or prodrug thereof can also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, an IRE-1α inhibitor compound or prodrug thereof may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.


The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.


In addition to the common dosage forms set out above, an IRE-1α inhibitor compound or prodrug thereof can be administered by controlled release means and/or delivery devices including ALZET® osmotic pumps, which are available from Alza Corporation. Suitable delivery devices are described in U.S. Pat. Nos. 3,845,770; 3,916,899; 3,536,809; 3,598,123; 3,944,064 and 4,008,719.


Therapeutic Methods


IRE-1α inhibitor compounds or prodrugs thereof can be administered to a patient, preferably a human patient, in pharmaceutical preparations as disclosed above, preferably with a pyrogen-free pharmaceutically acceptable vehicle, at doses effective to treat or ameliorate a symptom of a disorder associated with the unfolded protein response.


Disorders Associated with UPR


A fine balance exists between a cell's life and death depending on how protein folding stress is managed by the cell (proteostasis). Imbalances in proteostasis lead to many metabolic, oncological, neurodegenerative, inflammatory, cardiovascular disorders and infectious disease (Balch et al., Science 319, 916, 2008). The UPR relates specifically to the proteostasis of the endoplasmic reticulum where all secreted and membrane proteins are translated, folded and processed for delivery to their individual site of action. Therefore, activation of the UPR enhances protein folding in the ER allowing the cell to survive. If protein folding stress is not managed in the ER, the cells will initiate apoptosis.


Protein folding stress may be a natural hallmark of the type of cell for example insulin secreting β-islet cells or antibody secreting plasma cells. In both cases, the cell has fine tuned the machinery to deal with the stress by activating the UPR. Depending on the disease type, it may be therapeutically beneficial to induce or inhibit the UPR. For example, in type II diabetes or Alzheimer's disease, it may be therapeutically beneficial to activate the UPR in such a way where β-islet cells survive the stress of over producing insulin or neurons survive the apoptotic effects due to unfolded aggregates of β-amyloid protein. Diseases such as cancer, inflammation, and viral infection may be therapeutically modulated by inhibition of the UPR. In these types of conditions, cellular survival due to corruption of the UPR may be impacted. Protein folding in the ER is negatively impacted by such conditions in the tumor microenvironment as hypoxia, glucose starvation, amino acid deprivation, acidosis and mutant malfolded and oncgenic proteins. Additionally chemo-, bio-, and radiotherapy can lead to protein folding stress. It may be possible to induce apoptosis in these conditions by inhibiting the anti-apoptotic effects of the UPR. Myeloma derived from neoplastic antibody secreting plasma cells provides an example of a condition in which this approach can be applied.


Lastly, enveloped viruses must use and corrupt this system to ensure production of progeny from infected cells. Viruses often produce vast quantities of viral membrane glycoproteins which are folded and modified in the ER. Therefore, activation of the UPR by the virus for this purpose as a survival mechanism is entirely conceivable. It is therefore logical that inhibition of the UPR during viral infection can impact the outcome of the disease in a beneficial way.


Only specialized secretory cells and diseased cells activate the UPR for their own benefit. Most cells are not under such protein folding stress and therefore would not be impacted by a UPR inhibitor. Thus, “disorders associated with the UPR” as used herein means conditions for which pathogenesis can be advantageously impacted by inhibition of the UPR. In various embodiments of the invention such inhibition of the UPR is accomplished through inhibition of IRE-1α.


In some embodiments, the IRE-1α inhibitor compounds or prodrugs thereof are useful to treat or ameliorate a symptom of a B cell autoimmune disease, certain cancers, and infections of enveloped viruses that use the endoplasmic reticulum as a viral factory for expressing viral surface and spike proteins for budding and infection. IRE-1α inhibitors and prodrugs thereof can be used as single agents or in combination therapies, as described below.


B-cell autoimmune diseases which can be treated include, but are not limited to, Addison's disease, antiphospholipid syndrome, aplastic anemia, autoimmune hemolytic anemias, autoimmune hepatitis, autoimmune hypophysitis, autoimmune lymphoproliferative disorders, autoimmune myocarditis, Churg-Strauss syndrome, epidermolysis bullosa acquisita, giant cell arteritis, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome. Hashimoto's thyroiditis, idiopathic thrombocytopenic purpura, IgA nephropathy, myasthenia gravis, pemphigus foliaceous, pemphigus vulgaris, polyarteritis nodosa, polymyositis/dermatomyositis, rheumatoid arthritis, scleroderma, Sjögren's syndrome, systemic lupus erythematosus, Takayasu's arteritis, and Wegener's granulomatosis.


Cancers which can be treated include solid tumors, such as tumors of the breast, bone, prostate, lung, adrenal gland (e.g., adrenocortical tumors), bile duct, bladder, bronchus, nervous tissue (including neuronal and glial tumors), gall bladder, stomach, salivary gland, esophagus, small intestine, cervix, colon, rectum, liver, ovary, pancreas, pituitary adenomas, and secretory adenomas. Methods of the invention are particularly useful for treating drug- or radiation-resistant solid tumors.


Cancers of the blood (e.g., lymphomas and leukemias) also can be treated including, but not limited to, multiple myeloma, Hodgkin's lymphoma, non-Hodgkin's lymphomas (e.g., cutaneous T cell lymphomas such as Sezary syndrome and Mycosis fungoides, diffuse large cell lymphoma, HTLV-1 associated T cell lymphoma, nodal peripheral T cell lymphoma, extranodal peripheral T cell lymphoma, central nervous system lymphoma, and AIDS-related lymphoma). Leukemias include acute and chronic types of both lymphocytic and myelogenous leukemia (e.g, acute lymphocytic or lymphoblastic leukemia, acute myelogenous leukemia, acute myeloid leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, T cell prolymphocytic leukemia, adult T cell leukemia, and hairy cell leukemia). Monoclonal gammopathy of undetermined significance (MGUS), the precursor of myeloma, also can be treated.


Viral infections which can be treated include infections of enveloped viruses which utilize the unfolded protein response pathway when they replicate and form infectious progeny (e.g., measles, pox viruses, Ebola, etc.). Infections also include those of Epstein Barr virus (EBV), cytomegalovirus (CMV), Flaviviruses (e.g., Japanese Encephalitis Virus and West Nile Virus), and Hepatitis C virus (HCV).


Combination Therapies


Various types of physiological stress induce the unfolded protein response including, but not limited to, hypoxia, nutrient starvation, acidosis, and genetic damage resulting in mutant or over-expressed misfolded proteins (oncogenic stress). One or more of these conditions are manifest in cancer cells, which may in part be mediated by the microenviroment of the tumor. It is likely the cytoprotective arm of the unfolded protein response (UPR) plays an anti-apototic role in tumor survival. In addition, bio- and chemotherapeutic drugs and radiation treatments may further impact the protein folding and degradation cycle in the ER thereby inducing the UPR as a protective resistance mechanism. Patients succumb to cancer because either the tumor is resistant to conventional therapies or returns in a resistant form after an initial response to treatment and, therefore, new treatments and treatment combinations are needed.


Angiogenesis inhibitors block tumor growth by inhibiting new blood vessel formation, a process that would enhance the stress effects of the tumor microenvironment. A promising approach to further reduce tumor burden would be to administer anti-angiogenesis agents in combination with IRE-1α/XBP-1 inhibitors to obtain a similar effect as that demonstrated by RNAi knockdown of GRP78, the major chaperone of the ER and target of XBP-1s (Dong et al., Cancer Res. 2007 Jul. 15; 67 (14):6700-7). In addition, IRE-1α itself regulates angiogensis by influencing the expression of VEGF.


Proteasome inhibitors and Hsp90 inhibitors are thought to act in part by blocking protein degradation and folding, respectively, inducing apoptosis (Davenport et al., Blood 2007 Oct. 1; 110 (7):2641-9). Although it is clear that Hsp90 inhibitors induce XBP-1 splicing and activation of the UPR, it is less clear that proteasome inhibitors activate IRE-1α. Current scientific literature suggest that IRE-1α is not or is only minimally activated by proteasome inhibitors such as bortezomib or MG-132 (Davenport et al., Blood 2007 Oct. 1; 110(7):2641-9). However, the data shown in FIG. 6 demonstrates activation of this pathway in bortezomib-resistant RPMI8226 cells.


Interference with UPR may sensitize cancer cells to various chemotherapeutics that elevate the cellular stress and thus, IRE/XBP-1 inhibitors may become important therapies in conjunction with current and future standard of care in cancer.


Although the level of activation IRE-1α in solid tumors is currently not known, clearly, induction of the UPR in patient biopsies of drug resistant tumors is evidenced by induction of GRP78 (Moenner et al., Cancer Res. 2007 Nov. 15; 67 (22):10631-4; Lee, Cancer Res. 2007 Apr. 15; 67 (8):3496-9).


Inhibition of XBP-1 splicing may have a greater effect than anticipated as the un-spliced form of XBP-1 may act as a dominant negative to XBP-1 and ATF-6 transcriptional activity. Further inhibitors which block the RNAse activity but not kinase activity of IRE-1α may have the added benefit of signaling through the JNK pathway, a signal that can have pro-apoptotic consequences.


In some embodiments an IRE-1α inhibitor compound or prodrug thereof is administered in combination with a therapeutic agent that induces or up-regulates IRE-1α expression (e.g., Hsp90 and or HDAC inhibitors, both of which induce IRE-1α activation and XBP-1 splicing) or a therapeutic agent which is less effective when IRE-1α is expressed (e.g., 17-AAG (TANESPIMYCIN® and suberoylanilide hydroxamic acid (SAHA)).


In some embodiments an IRE-1α inhibitor compound or prodrug thereof is administered in combination with a cancer therapeutic agent, for example radiation therapy or a cancer therapeutic agent (e.g., a chemotherapeutic agent or a biotherapeutic agent) as described below. The cancer therapeutic agent can be administered separately or together with the IRE-1α inhibitor compound. The cancer therapeutic agent can be administered at essentially the same time as the IRE-1α inhibitor compound or can be administered either before or after the IRE-1α inhibitor compound.


Cancer therapeutic agents which can be used according to the invention include, but are not limited to, agents in the following categories (which may overlap):

    • a. proteasome inhibitors, such as bortezomib ([(1R)-3-methyl-1-[[(2S)-1-oxo-3-phenyl-2-[(pyrazinylcarbonyl)amino]propyl]amino]butyl]boronic acid; MG-341; VELCADE®), MG-132 (N-[(phenylmethoxy)carbonyl]-L-leucyl-N-[(1S)-1-formyl-3-methylbutyl]-L-leucinamide);
    • b. antimetabolites, such as:
      • i. pyrimidine analogs (e.g., 5-fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine);
      • ii. purine analogs,
      • iii. folate antagonists and related inhibitors (e.g., mercaptopurine, thioguanine, pentostatin and 2-chlorodeoxyadenosine [cladribine]);
      • iv. folic acid analogs (e.g., methotrexate);
    • c. antimitotic agents, including:
      • i. natural products such as vinca alkaloids (e.g., vinblastine, vincristine, and vinorelbine);
      • ii. alkylating agents such as nitrogen mustards (e.g., mechlorethamine, cyclophosphamide and analogs, melphalan, chlorambucil), ethylenimines and methylmelamines (e.g., hexamethylmelamine and thiotepa), alkyl sulfonates-busulfan, nitrosoureas (e.g., carmustine (BCNU) and analogs, streptozocin), trazenes-dacarbazinine (DTIC);
    • d. microtubule disruptors such as taxane (paclitaxel, docetaxel), vincristin, vinblastin, nocodazole, epothilones and navelbine, and epidipodophyllotoxins (e.g., teniposide);
    • e. DNA damaging agents, such as actinomycin, amsacrine, anthracyclines, bleomycin, busulfan, camptothecin, carboplatin, chlorambucil, cisplatin, cyclophosphamide, Cytoxan, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, hexamethylmelamineoxaliplatin, iphosphamide, melphalan, merchlorethamine, mitomycin, mitoxantrone, nitrosourea, paclitaxel, plicamycin, procarbazine, teniposide, triethylenethiophosphoramide and etoposide (VP 16);
    • f. antibiotics, such as dactinomycin (actinomycin D), daunorubicin, doxorubicin (adriamycin), idarubicin, anthracyclines, mitoxantrone, bleomycins, plicamycin (mithramycin) and mitomycin;
    • g. enzymes, such as L-asparaginase;
    • h. antiplatelet agents;
    • i. platinum coordination complexes (e.g., cisplatin, carboplatin), procarbazine, hydroxyurea, mitotane, aminoglutethimide;
    • j. hormones, hormone analogs (e.g., estrogen, tamoxifen, goserelin, bicalutamide, nilutamide);
    • k. aromatase inhibitors (e.g., letrozole, anastrozole);
    • l. anticoagulants (e.g., heparin, synthetic heparin salts and other inhibitors of thrombin);
    • m. fibrinolytic agents (such as tissue plasminogen activator, streptokinase and urokinase), aspirin, COX-2 inhibitors, dipyridamole, ticlopidine, clopidogrel, abciximab;
    • n. antimigratory agents;
    • o. antisecretory agents (e.g., breveldin); immunosuppressives (e.g., cyclosporine, tacrolimus (FK-506), sirolimus (rapamycin), azathioprine, mycophenolate mofetil);
    • p. anti-angiogenic compounds (e.g., TNP-470, genistein) and growth factor inhibitors (e.g., vascular endothelial growth factor (VEGF) inhibitors, fibroblast growth factor (FGF) inhibitors, epidermal growth factor (EGF) inhibitors);
    • q. angiotensin receptor blockers;
    • r. nitric oxide donors;
    • s. anti-sense oligonucleotides;
    • t. antibodies (e.g., trastuzumab (HERCEPTIN®), AVASTIN®, ERBITUX®);
    • u. cell cycle inhibitors and differentiation inducers (e.g., tretinoin);
    • v. mTOR (mammalian target of rapamycin) inhibitors (e.g., everolimus, sirolimus);
    • w. topoisomerase inhibitors (e.g., doxorubicin (adriamycin), amsacrine, camptothecin, daunorubicin, dactinomycin, eniposide, epirubicin, etoposide, idarubicin, irinotecan (CPT-11) and mitoxantrone, topotecan, irinotecan);
    • x. corticosteroids (e.g., cortisone, dexamethasone, hydrocortisone, methylpednisolone, prednisone, and prenisolone);
    • y. growth factor signal transduction kinase inhibitors;
    • z. mitochondrial dysfunction inducers;
    • aa. caspase activators; and
    • bb. chromatin disruptors.


In some embodiments the cancer therapeutic agent is selected from the group consisting of alemtuzumab, aminoglutethimide, amsacrine, anastrozole, asparaginase, beg, bevacizumab, bicalutamide, bleomycin, bortezomib, buserelin, busulfan, campothecin, capecitabine, carboplatin, carmustine, CeaVac, cetuximab, chlorambucil, cisplatin, cladribine, clodronate, colchicine, cyclophosphamide, cyproterone, cytarabine, dacarbazine, daclizumab, dactinomycin, daunorubicin, dienestrol, diethylstilbestrol, docetaxel, doxorubicin, edrecolomab, epirubicin, epratuzumab, erlotinib, estradiol, estramustine, etoposide, exemestane, filgrastim, fludarabine, fludrocortisone, fluorouracil, fluoxymesterone, flutamide, gemcitabine, gemtuzumab, genistein, goserelin, huJ591, hydroxyurea, ibritumomab, idarubicin, ifosfamide, IGN-101, imatinib, interferon, irinotecan, ironotecan, letrozole, leucovorin, leuprolide, levamisole, lintuzumab, lomustine, MDX-210, mechlorethamine, medroxyprogesterone, megestrol, melphalan, mercaptopurine, mesna, methotrexate, mitomycin, mitotane, mitoxantrone, mitumomab, nilutamide, nocodazole, octreotide, oxaliplatin, paclitaxel, pamidronate, pentostatin, pertuzumab, plicamycin, porfimer, procarbazine, raltitrexed, rituximab, streptozocin, sunitinib, suramin, tamoxifen, temozolomide, teniposide, testosterone, thalidomide, thioguanine, thiotepa, titanocene dichloride, topotecan, tositumomab, trastuzumab, tretinoin, vatalanib, vinblastine, vincristine, vindesine, and vinorelbine.


Routes of Administration


Pharmaceutical preparations of the invention can be administered locally or systemically. Suitable routes of administration include oral, pulmonary, rectal, transmucosal, intestinal, parenteral (including intramuscular, subcutaneous, intramedullary routes), intranodal, intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, intraocular, transdermal, topical, and vaginal routes. As described in more detail above, dosage forms include, but are not limited to, tablets, troches, dispersions, suspensions, suppositories, solutions, capsules, creams, patches, minipumps and the like. Targeted delivery systems also can be used (for example, a liposome coated with target-specific antibody).


Dosage


A pharmaceutical composition of the invention comprises at least one active ingredient (an IRE-1α inhibitor compound or prodrug thereof) in a therapeutically effective dose. A “therapeutically effective dose” is the amount of an IRE-1α inhibitor compound or prodrug thereof which, when administered to a patient over a treatment period, results in a measurable improvement in a characteristic of the disease being treated (e.g., improved laboratory values, retarded development of a symptom, reduced severity of a symptom, or improved levels of an appropriate biological marker).


Determination of therapeutically effective doses is well within the capability of those skilled in the art. A therapeutically effective dose initially can be estimated from in vitro enzyme assays, cell culture assays and/or animal models. For example, a dose can be formulated in an animal model to achieve a circulating concentration range at least as concentrated as the IC50 as determined in an in vitro enzyme assay or in a cell culture (i.e., the concentration of the test compound which achieves a half-maximal inhibition of IRE-1α activity). Such information can be used to more accurately determine useful doses in humans. See the FDA guidance document “Guidance for Industry and Reviewers Estimating the Safe Starting Dose in Clinical Trials for Therapeutics in Adult Healthy Volunteers” (HFA-305), which provides an equation for use in calculating a human equivalent dose (HED) based on in vivo animal studies.


Appropriate animal models for the relevant diseases are known in the art. See, e.g., Lupus. 1996 October; 5 (5):451-5 (antiphospholipid syndrome); Blood. 1974 July; 44 (1):49-56 (aplastic anemia); Autoimmunity. 2001; 33 (4):265-74 (autoimmune hypophysitis); Methods. 2007 January; 41 (1): 118-22 (autoimmune myocarditis); Clin Exp Rheumatol. 2003 November-December; 21 (6 Suppl 32):S55-63 (Churg-Strauss syndrome, Wegener's granulomatosis); J Clin Invest. 2005 April; 115 (4):870-8 (epidermolysis bullosa acquisita); Circulation. 2005 Jun. 14; 111 (23):3135-40. Epub 2005 Jun. 6 (giant cell arteritis; Takayusu's arteritis); Int J Immunopathol Pharmacol. 2005 October-December; 18 (4):701-8 (IgA nephropathy); Vet Rec. 1984 May 12; 114 (19):479 (pemphigus foliaceous); J. Neuroimmunol. 98, 130-35, 1999 (polymyositis); Am. J. Pathol. 120, 323-25, 1985 (dermatomyositis); Cell. Mol. Immunol. 2, 461-65, 2005 (myasthenia gravis); Arthritis Rheum. 50, 3250-59, 2004 (lupus erythymatosus); Clin. Exp. Immunol. 99, 294-302, 1995 (Grave's disease); J. Clin. Invest. 116, 961-973, 2006 (rheumatoid arthritis); Exp Mol. Pathol. 77, 161-67, 2004 (Hashimoto's thyroiditis); Rheumatol. 32, 1071-75, 2005 (Sjögren's syndrome); Brain Pathol. 12, 420-29, 2002 (Guillain-Barré syndrome); Vet. Pathol. 32, 337-45, 1995 (polyarteritis nodosa); Immunol. Invest. 3, 47-61, 2006 (pemphigus vulgaris); Arch. Dermatol. Res. 297, 333-44, 2006 (scleroderma); J. Exp. Med. 191, 899-906, 2000 (Goodpasture's syndrome); Clin. Exp. Immunol. 99, 294-302, 1995 (Grave's disease); J. Clin. Invest. 91, 1507-15, 1993 (membranous nephropathy); J. Immunol. 169, 4889-96, 2002 (autoimmune hepatitis); Surgery 128, 999-1006, 2000 (Addison's disease); Eur. J. Immunol. 32, 1147-56, 2002 (autoimmune hemolytic anemia); and Haematologica 88, 679-87, 2003 (autoimmune thrombocytopenic purpura).


LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population) can be determined by standard pharmaceutical procedures in cell cultures and/or experimental animals. Data obtained from cell culture assays or animal studies can be used to determine initial human doses. As is known in the art, the dosage may vary depending upon the dosage form and route of administration used.


Usual dosages for systemic administration to a human patient range from 1 μg/kg to 100 mg/kg (e.g., 1-10 μg/kg, 20-80 μg/kg, 5-50 μg/kg, 75-150 μg/kg, 100-500 μg/kg, 250-750 μg/kg, 500-1000 μg/kg, 1-10 mg/kg, 5-50 mg/kg, 25-75 mg/kg, 50-100 mg/kg, 5 mg/kg, 20 mg/kg, or 50 mg/kg). In some embodiments, the treatment schedule can require that a plasma concentration of an IRE-1α inhibitor compound be maintained for a period of time (e.g., several days or a week) and then allowed to decay by ceasing administration for a period of time (e.g., 1, 2, 3, or 4 weeks). The amount of composition administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the disorder, the manner of administration and the judgment of the prescribing physician.


All patents, patent applications, and references cited in this disclosure are expressly incorporated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples, which are provided for purposes of illustration only and are not intended to limit the scope of the invention.


EXAMPLE 1
IRE-1α Assay

A fusion protein comprising glutathione S transferase (GST) and human IRE-1α (GST-IRE-1α) was obtained from a 500 ml baculovirus-infected insect cell culture and used to measure IRE-1α activity in vitro.


Five μl of a reaction mixture comprising 1× reaction buffer (5× reaction buffer is 100 mM Hepes pH 7.5, 250 mM KOAc, 2.5 mM MgCl2), 3 mM DTT, and 0.4% polyethylene glycol water were added to each well of 384 well plates. Twenty-five nanoliters of a 1 mM test compound solution were added to test wells. Three μl of a 128 ng/ml IRE-1α preparation were added to each test well and to positive control wells (final concentration 5.82 ng/well). Negative control wells contained only reaction mixture and test compound.


After spinning the plates at 1200 rpm for 30 seconds, 3 μl of an IRE-1α human mini-XBP-1 mRNA stem-loop substrate 5′-CAGUCCGCAGCACUG-3′ (SEQ ID NO:1), labeled with the fluorescent dye Cy5 at the 5′ end and Black Hole Quencher 2 (BH2) at the 3′ end, were added to each well of a control plate. The plates were again spun at 1200 rpm for 30 seconds. Final concentrations for the assay were: 63 nM IRE-1α substrate, 5.82 ng IRE-1α protein, and 2.5 μM test compound.


The plates were covered with lids and incubated for one hour at 30° C. The plates were then transferred to an ACQUEST™ microplate reader. Data was analyzed using data analysis software, and the percent activity of IRE-1α was calculated.


EXAMPLE 2
Identification of IRE-1α Inhibitor Compounds

Compounds from the Maybridge library (Fisher) were screened using the assay described in Example 1. Approximately 60 compounds were selected as confirmed hits and repurified. These compounds were aryl imines or the Schiff base adduct of 2-hydroxy benzaldehyde analogues. There was no observable SAR relative to the R group. Upon re-purification by HPLC, however, it was noted that the compounds were breaking down into their constituent components: 2-hydroxy benzaldehyde derivatives and a primary amine linked to an R group, which suggested that the aldehyde derivative may be the active component of the compound.


Three purified 2-hydroxy benzaldehydes having halogens at the 3 and 5 positions (either Cl, Br or I) were then tested in the IRE-1α assay. All three were active. The most potent was 3, 5 iodo 2-hydroxy benzaldehyde (IC50 0.35 μM), followed by 3, 5 bromo 2-hydroxy benzaldehyde (IC50 0.46 μM) and last 3, 5 chloro 2-hydroxy benzaldehyde (1.05 μM).


Approximately 20 benzaldehyde derivatives were then purchased and tested in the IRE-1α assay. The results of this testing indicated that compounds required the hydroxyl group at the ortho position relative to the aldehyde group but also required hydrophobic electron withdrawing groups at the 3, 5, or 6 positions of the benzene ring. Positions 3 and 5 can be a halogen or a methoxy or ethoxy. A nitro group is active at the 3 or 5 position but not both. The most potent compounds were the o-vanillins with a bromine substituent at the 5 or 6 position. Without wishing to be bound by the following explanation, the hydrogen of the ortho hydroxyl likely participates in hydrogen binding with the aldehyde oxygen which stabilizes the conformation.


EXAMPLE 3
Examples of o-Vanillins with SAR and Selectivity for IRE-1α in In Vitro Enzyme Assays

IRE-1α, T1 RNase, and RNase A assays carried out in vitro with several o-vanillin derivatives to demonstrate selectivity of the derivatives for IRE-1α. IRE-1α assays were carried out as described in Example 1.


T1 RNase was assayed as follows. Five μl of a reaction mixture comprising 1× reaction buffer (5× reaction buffer is 100 mM Hepes pH 7.5, 250 mM KOAc, 2.5 mM MgCl2), 3 mM DTT, and 0.4% polyethylene glycol water were added to each well of 384 well plates. Twenty-five nanoliters of a 1 mM test compound solution were added to test wells. Three μl of a 1/48,000 dilution of an approximately 200,000 U/ml RNase T1 (Worthington) preparation were added to each test well and to positive control wells (final concentration 49.5 pg/well). Negative control wells contained only reaction mixture and test compound.


After spinning the plates at 1200 rpm for 30 seconds, 3 μl of the mini-XBP-1 mRNA stem-loop substrate described in Example 1 were added to each well of a control plate. The plates were again spun at 1200 rpm for 30 seconds. Final concentrations for the assay were: 63 nM substrate, 49.5 pg RNase T1, and 2.5 μM test compound.


The plates were covered with lids and incubated for one hour at 30° C. The plates were then transferred to an ACQUEST™ microplate reader. Data was analyzed using data analysis software. The percent activity of RNase T1 was calculated.


RNase A was assayed as described for RNase T1. Final concentrations for the assay were: 63 nM substrate, 0.4 pg RNase A (Qiagen; 100 mg/ml or 7000 U/ml), and 2.5 μM test compound.


The tested compounds were selective for IRE-1, with IC50 of 3 μM (o-vanillin), 1 μM (3-ethoxy o-vanillin), and 30 nm (6-bromo o-vanillin).


EXAMPLE 4
Cell-Based IRE-1α XBP-1-Specific Endoribonuclease Inhibition by 6-Bromo o-Vanillin

Initial cell-based XBP-1 mRNA splicing assays confirmed IRE-1α inhibition with several potent 5-bromo and 6 bromo o-vanillins. HEK293 cells were incubated with compound either overnight or for 2 hours prior to IRE-1α activation with the UPR inducing reagent thapsigargin. IRE-1α mediated XBP-1 splicing was measured by RT-PCR using XBP-1 specific primers flanking the 26 bp intron excised by IRE-1α. The results are shown in FIG. 1. It can be observed that at the higher concentrations, there is relatively more of the unspliced XBP-1 (upper band: substrate) compared to the spliced form (lower band: product).


Without wishing to be bound by this explanation, the aldehyde apparently forms a reversible Schiff base with the primary amine of a lysine in the active site of the enzyme. The ortho-hydroxyl may accelerate and stabilize the Schiff base. In addition, the unpaired pair of electrons may act as a hydrogen bond acceptor with an additional amino acid of IRE-1α. The benzene ring and the various R groups may reside in a hydrophobic pocket of the enzyme linked via a Schiff base of the aldehyde moiety. The electron withdrawing and hydrophobic nature of the 3 and 5 position substitutes greatly facilitated potency. Due to the hydrophobic nature of the o-vanillins, these compounds may fit in a hydrophobic pocket in addition to forming Schiff bases.


EXAMPLE 5
Determination of IC50 for Inhibition of IRE-1α

IC50 for inhibition of IRE-1α of the compounds identified in Table 3 was measured as described in Example 1.












TABLE 3








IC50



IRE-1α inhibitor compound
(μM)





















embedded image


0.03









embedded image


0.03









embedded image


0.04









embedded image


0.07









embedded image


0.08









embedded image


0.1









embedded image


0.11









embedded image


0.12









embedded image


0.17









embedded image


0.17









embedded image


0.24









embedded image


0.24









embedded image


0.25









embedded image


0.27









embedded image


0.28









embedded image


0.3









embedded image


0.35









embedded image


0.38









embedded image


0.38









embedded image


0.39









embedded image


0.4









embedded image


0.4









embedded image


0.4









embedded image


0.41









embedded image


0.44









embedded image


0.51









embedded image


0.54









embedded image


0.55









embedded image


0.57









embedded image


0.58









embedded image


0.72









embedded image


0.75









embedded image


0.75









embedded image


0.79









embedded image


0.99









embedded image


1.01









embedded image


1.07









embedded image


1.1









embedded image


1.28









embedded image


1.28









embedded image


1.3









embedded image


1.3









embedded image


1.31









embedded image


1.33









embedded image


1.38









embedded image


1.4









embedded image


1.48









embedded image


1.59









embedded image


1.64









embedded image


1.75









embedded image


1.83









embedded image


1.92









embedded image


1.95









embedded image


2.26









embedded image


2.37









embedded image


2.7









embedded image


2.85









embedded image


3.06









embedded image


3.12









embedded image


4.04









embedded image


5.5









embedded image


5.55









embedded image


5.75









embedded image


6.34









embedded image


6.6









embedded image


6.83









embedded image


7.55









embedded image


8.2









embedded image


8.47









embedded image


8.85









embedded image


9.27









embedded image


9.4









embedded image


9.75









embedded image


17.71









embedded image


20.25










EXAMPLE 6
Kinase Selectivity Assays

The compounds shown below:




embedded image



were assayed for their ability to inhibit 86 different kinases at a concentration of 10 μM, which is well above the IC50 of each compound (3.71 and 0.027 μM, respectively). The results of the assays demonstrated that these compounds are selective for IRE-1α.


EXAMPLE 7
Synthesis of 2′-chloro-4-hydroxy-5-methoxybiphenyl-3-carbaldehyde



embedded image


In a 5 ml microwave vial was added 2-chlorophenylboronic acid (54.73 mg, 0.35 mmol, 1.16 equiv), tetrakis(triphenylphosphine)palladium(0) (7 mg, 0.006 mmol, 2 mol %) as a catalyst and solution of 5-bromo-2-hydroxy-3-methoxy-benzyldehyde (69.3 mg, 0.3 mmol, 1 equiv) in 1 ml of MeCN. To the resulting solution was added 1M solution K2CO3 (0.6 ml, 0.6 mmol, 2 equiv), followed by sealing. The reaction mixture was heated at 150° C. for 360 seconds in a Personal Chemistry Smith Creator Microwave. After completion, the organic layer was transferred to one well of a 96 well plate. The solvents were evaporated, and the residue was dissolved in 0.6 ml of 0.5% solution of TFA in DMSO and purified.


EXAMPLE 8
Synthesis of 2′-chloro-3-hydroxy-4-methoxybiphenyl-2-carbaldehyde



embedded image


In a 5 ml microwave vial was added 2-chlorophenylboronic acid (54.73 mg, 0.35 mmol, 1.16 equiv), tetrakis(triphenylphosphine)palladium(0) (7 mg, 0.006 mmol, 2 mol %) as a catalyst and solution of 6-bromo-2-hydroxy-3-methoxy-benzyldehyde (69.3 mg, 0.3 mmol, 1 equiv) in 1 ml of MeCN. To the resulting solution was added 1M solution K2CO3 (0.6 ml, 0.6 mmol, 2 equiv), followed by sealing. The reaction mixture was heated at 150° C. for 360 seconds in a Personal Chemistry Smith Creator Microwave. After completion, the organic layer was transferred to one well of a 96 well plate. The solvents were evaporated, and the residue was dissolved in 0.6 ml of 0.5% solution of TFA in DMSO and purified.


EXAMPLE 9
Synthesis of 4-Bromo-2-{[(E)-4-fluoro-phenylimino]-methyl}-phenol



embedded image


In a 20 ml scintillation vial was added 5-bromosalicaldehyde (100 mg, 0.50 mmol), toluene (5 ml), and activated molecular sieves (200 mg). To the resulting solution was added 4-fluoroaniline (56 mg, 0.50 mmol, 2 equiv). The reaction mixture was heated at 100° C. for 16 hours, after which the molecular sieves were filtered from solution and washed with dichloromethane. The product precipitated was collected by filtration and washed with hexane. After drying, the identity was confirmed by NMR and TLC.


EXAMPLE 10
Cell-Based Assays

Human myeloma MM.1s cells were incubated with the indicated amounts of compound for 1.25 hours before stressing with 2 mM dithiothreitol (DTT). After an additional 45 minutes (2 hours total) with compound and DTT, the cells were harvested with TRIZOL® (a mono-phasic solution of phenol and guanidine isothiocyanate), and total RNA was prepared as directed by the manufacturer (Invitrogen). Human XBP-1 was amplified by RT-PCR with the following primers, which flank the 26 base unconventional intron excised by IRE-1α:











(SEQ ID NO: 2)



CCTGGTTGCTGAAGAGGAGG (forward)



and







(SEQ ID NO: 3)



CCATGGGGAGATGTTCTGGAG (reverse).






The results are shown in FIG. 2. In unstressed cells, IRE-1α is inactive and hence, the 26 base intron is left in the XBP-1 mRNA. RT-PCR of unstressed (U) cells then generates the upper band. When cells are stressed (S) with the endoplasmic reticulum (ER) stressing agent DTT, IRE-1α is activated due to accumulating unfolded protein and the resulting RT-PCR product is 26 base pairs shorter (lower band). Increasing amounts of compound block IRE-1α mediated XBP-1 splicing as demonstrated by the shift from the lower band to the upper band. Compound potency reflects SAR in the in vitro enzyme assay.


Determination of Cellular ED50 for IRE-1α Inhibitors


Compounds which pass specificity assays are assayed for cellular EC50 using endogenous XBP-1 splicing in myeloma cells. XBP-1 is regulated through the excision of a 26 nucleotide intron from the XBP-1 mRNA by the highly specific endoribonuclease activity of IRE-1α. This splicing event induces a frame shift in the ORF of the C-terminus of XBP-1 leading to the translation of the larger 54 kD active transcription factor rather than the inactive 33 kD form. This splicing event is used to measure IRE-1α activity on XBP-1 mRNA in cells and tissues.


Briefly, compounds are incubated in the presence or absence of an ER stress agent (e.g., DTT), and the ratio of XBP-1u (unspliced) to XBP-1s (spliced) is quantified by RT-PCR. The ED50 is determined as the 50% XBP-1s to total XPB-1 levels (FIG. 3). Compounds which have EC50s equal to or below 10 μM are used in standard apoptosis assays, including Annexin V staining and CASPASE-GLO® (FIG. 5 and FIG. 7).


Proliferation assays using myeloma cell lines (U266, RPMI8226 and MM.1s) are used to determine ED50. Compounds are used as single agents and in combination with other chemotherapeutic drugs. As shown in FIG. 5, IRE-1α inhibitor 11-28 compound inhibits the proliferation of RPMI8226 myeloma cells, which have endogenous activation of the pathway and are further induced by the addition of bortezomib (FIG. 6). When IRE-1α inhibitor compound 2 is used in combination with MG-132, increased apoptosis is observed with U266 myeloma cells (FIG. 7).


EXAMPLE 11
Synthesis of 3′-formyl-4′-hydroxy-5′-methoxybiphenyl-3-carboxylic acid



embedded image


5-bromo-2-hydroxy-3-methoxybenzaldehyde (3.00 g, 13.0 mmol), 3-carboxy-phenylboronic acid (2.37 g, 14.3 mmol), sodium carbonate (8.27 g, 78.0 mmol), and tetrakis(triphenylphosphine)palladium (0.728 g, 0.65 mmol) were dissolved in a mixture of 200 mL DMF and 200 mL water. The reaction was stirred at 105° C. under argon for 5 h. 200 mL 1N sodium hydroxide was added, and the solution was extracted with dichloromethane (3×100 mL). The aqueous layer was acidified with 6N hydrochloric acid and the precipitated material was filtered off, washed with water then diethyl ether to afford 11-1 (1.70 g, 6.25 mmol, 48%). 1H NMR (400 MHz, DMSO-d6) δ ppm 13.07 (br. s, 1H), 10.34 (s, 1H), 10.44 (br. s, 1H), 8.18 (t, J=1.6 Hz, 1H), 7.90-7.97 (m, 2H), 7.59 (t, J=7.8 Hz, 1H), 7.55 (s, 2H), 3.97 (s, 3H).


The following compounds were made by the above procedure using the corresponding aryl bromide and aryl boronic acid and characterized by LC/MS using a Waters UPLC/MS with UV detector (220 nM) and MS detector (ESI). HPLC column: Acquity BEH C18 1.7 μm (Waters) 2.1 mm×50 mm. HPLC Gradient: 0.6 mL/min, from 95:5 20 mM ammonium formate buffer (brought to pH 7.4 with ammonium hydroxide): acetonitrile to 20:80 ammonium formate buffer:acetonitrile in 1.5 min, maintaining for 1.3 min.













TABLE 4





No.
CHEMISTRY
MW
MH+
Rt



















11-2 


embedded image


229.1
230.2
0.95





11-3 


embedded image


232.1
233.2
0.96





11-4 


embedded image


199.1
200.1
1.03





11-5 


embedded image


217.1
218.2
0.86





11-6 


embedded image


229.1
230.2
1.01





11-7 


embedded image


259.1
260.3
1.26





11-8 


embedded image


235.1
236.3
1.02





11-9 


embedded image


267.1
268.3
1.13





11-10


embedded image


264.0
265.11
1.00





11-11


embedded image


247.1
248.3
1.21





11-12


embedded image


276.0
277.2
1.20





11-13


embedded image


274.1
275.3
0.84





11-14


embedded image


279.1
280.3
1.22





11-15


embedded image


267.1
268.3
1.14





11-16


embedded image


294.1
295.3
0.86





11-17


embedded image


279.1
280.3
1.23





11-18


embedded image


267.1
268.3
1.21





11-19


embedded image


294.1
295.3
0.90





11-20


embedded image


317.1
318.3
1.43





11-21


embedded image


220.1
221.2
0.99





11-22


embedded image


248.1
248.2
1.54





11-23


embedded image


299.0
299.2
1.21





11-24


embedded image


268.1
268.2
1.56





11-25


embedded image


206.0
205.1
1.26





11-26


embedded image


218.1
217.97
0.86









The following compounds were made by the above procedure using the corresponding aryl bromide and aryl boronic acid and characterized by NMR.











TABLE 5





No.
CHEMISTRY
NMR







11-27


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.30 (s, 1H), 10.28 (br. s, 1H), 7.55 (d, J = 1.5 Hz, 1H), 7.41-7.45 (m, 2H), 7.39 (dd, J = 8.3, 2.3 Hz, 1H), 6.82 (d, J = 8.5 Hz, 1H), 4.56 (t, J = 8.6 Hz, 2H), 3.94 (s, 3H), 3.23 (t, J = 8.7 Hz, 2H).






11-28


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.05 (s, 1H), 9.96 (s, 1H), 7.39 (d, J = 2.0 Hz, 1H), 7.31 (d, J = 2.0 Hz, 1H), 7.28 (dd, J = 5.1, 1.1 Hz, 1H), 7.24 (dd, J = 3.6, 1.1 Hz, 1H), 7.09 (dd, J = 5.0, 3.5 Hz, 1H), 3.98 (s, 3H).






11-29


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.03 (br. s, 1H), 10.32 (s, 1H), 9.14 (s, 1H), 9.10 (s, 2H), 8.06 (d, J = 2.5 Hz, 1H), 7.97 (dd, J = 8.5, 2.5 Hz, 1H), 7.16 (d, J = 8.8 Hz, 1H).






11-30


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.55 (br. s, 1H), 10.34 (s, 1H), 9.12-9.22 (m, 3H), 7.67 (d, J = 2.3 Hz, 1H), 7.65 (d, J = 2.3 Hz, 1H), 3.98 (s, 3H).






11-31


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.25 (s, 1H), 8.98-9.04 (m, 3H), 8.26 (d, J = 3.0 Hz, 1H), 7.89 (d, J = 3.0 Hz, 1H).






11-32


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.40 (br. s, 1H), 10.30 (s, 1H), 7.22 (d, J = 2.3 Hz, 1H), 7.19 (d, J = 2.0 Hz, 1H), 3.89 (s, 3H), 2.39 (s, 3H), 2.22 (s, 3H).






11-33


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.08 (br. s, 1H), 10.31 (s, 1H), 7.89 (dd, J = 12.0, 2.3 Hz, 1H), 7.68 (dd, J = 2.3, 1.3 Hz, 1H), 7.54 (dd, J = 5.0, 1.3 Hz, 1H), 7.51 (dd, J = 3.6, 1.1 Hz, 1H), 7.13 (dd, J = 5.1, 3.6 Hz, 1H).






11-34


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.76 (br. s, 1H), 10.31 (s, 1H), 8.45 (d, J = 2.5 Hz, 1H), 8.22 (d, J = 2.5 Hz, 1H), 7.60-7.66 (m, 2H), 7.17 (dd, J = 5.0, 3.5 Hz, 1H).






11-35


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.78 (s, 1H), 10.00 (s, 1H), 7.67 (dd, J = 5.0, 1.3 Hz, 1H), 7.33 (d, J = 8.3 Hz, 1H), 7.21 (dd, J = 3.5, 1.3 Hz, 1H), 7.17 (dd, J = 5.0, 3.5 Hz, 1H), 6.99 (d, J = 8.3 Hz, 1H), 3.86 (s, 3H).






11-36


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.31 (s, 1H), 8.54 (d, J = 2.5 Hz, 1H), 8.35 (d, J = 2.5 Hz, 1H), 8.06 (dd, J = 2.9, 1.4 Hz, 1H), 7.69 (dd, J = 5.0, 3.0 Hz, 1H), 7.64 (dd, J = 5.2, 1.5 Hz, 1H).






11-37


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.56 (br. s, 1H), 10.34 (s, 1H), 7.96 (d, J = 7.8 Hz, 1H), 7.87 (s, 1H), 7.82 (d, J = 7.0 Hz, 1H), 7.66 (d, J = 2.3 Hz, 1H), 7.54 (d, J = 2.3 Hz, 1H), 7.39 (td, J = 7.7, 1.4 Hz, 1H), 7.34 (td, J = 7.7, 1.4 Hz, 1H).






11-38


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.36 (s, 1H), 10.40 (br. s, 1H), 8.07 (dd, J = 7.2, 2.3 Hz, 1H), 7.92 (dd, J = 7.2, 2.3 Hz, 1H), 7.84 (s, 1H), 7.41-7.50 (m, 4H), 3.95 (s, 3H).






11-39


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.30 (s, 1H), 10.26 (br. s, 1H), 7.85 (dd, J = 2.9, 1.4 Hz, 1H), 7.63 (dd, J = 5.0, 3.0 Hz, 1H), 7.52-7.60 (m, 3H), 3.94 (s, 3H).






11-40


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.85 (br. s, 1H), 10.30 (s, 1H), 7.79 (dd, J = 12.3, 2.3 Hz, 1H), 7.70 (s, 1H), 7.55 (s, 1H), 7.39 (dd, J = 8.3, 1.8 Hz, 1H), 6.82 (d, J = 8.3 Hz, 1H), 4.56 (t, J = 8.7 Hz, 2H), 3.22 (t, J = 8.7 Hz, 2H).






11-41


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.28 (s, 1H), 7.79-7.88 (m, 2H), 7.72-7.77 (m, 1H), 7.61 (dd, J = 5.0, 2.8 Hz, 1H), 7.52 (dd, J = 5.0, 1.5 Hz, 1H).






11-42


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.29 (s, 1H), 10.24 (br. s, 1H), 8.18 (dd, J = 2.0, 1.0 Hz, 1H), 7.72 (t, J = 1.6 Hz, 1H), 7.46 (d, J = 2.1 Hz, 1H), 7.44 (d, J = 2.1 Hz, 1H), 6.96 (dd, J = 2.0, 1.0 Hz, 1H), 3.92 (s, 3H).






11-43


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.37 (br. s, 1H), 10.31 (s, 1H), 7.71 (d, J = 1.3 Hz, 1H), 7.53 (dd, J = 14.1, 2.0 Hz, 2H), 6.92 (d, J = 3.0 Hz, 1H), 6.58 (dd, J = 3.5, 1.8 Hz, 1H), 3.93 (s, 3H).






11-44


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.45 (br. s, 1H), 10.30 (s, 1H), 8.46 (d, J = 2.5 Hz, 1H), 8.36 (t, J = 1.0 Hz, 1H), 8.25 (d, J = 2.5 Hz, 1H), 7.78 (t, J = 1.8 Hz, 1H), 7.08 (dd, J = 2.0, 1.0 Hz, 1H).






11-45


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.90 (br. s, 1H), 10.29 (s, 1H), 8.21 (s, 1H), 7.84 (dd, J = 12.3, 2.3 Hz, 1H), 7.68-7.75 (m, 2H), 6.98 (dd, J = 1.9, 0.9 Hz, 1H).






11-46


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.27 (br. s, 1H), 10.34 (s, 1H), 8.03 (dd, J = 11.8, 2.3 Hz, 1H), 7.97 (d, J = 7.8 Hz, 1H), 7.88 (s, 1H), 7.83 (d, J = 7.0 Hz, 1H), 7.78-7.81 (m, 1H), 7.34-7.43 (m, 2H).






11-47


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.62 (br. s, 1H), 10.17 (s, 1H), 8.29 (d, J = 2.3 Hz, 1H), 8.10 (d, J = 2.0 Hz, 1H), 7.57-7.65 (m, 2H), 7.17 (dd, J = 5.1, 3.6 Hz, 1H).






11-48


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.93 (br. s, 1H), 10.32 (s, 1H), 8.86 (br. s, 1H), 8.54 (d, J = 3.8 Hz, 1H), 8.02-8.07 (m, 1H), 7.98 (d, J = 2.5 Hz, 1H), 7.91 (dd, J = 8.5, 2.5 Hz, 1H), 7.46 (dd, J = 7.8, 4.0 Hz, 1H), 7.14 (d, J = 8.5 Hz, 1H).






11-49


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.36 (br. s, 1H), 10.33 (s, 1H), 8.00 (br. s, 1H), 7.96 (d, J = 8.5 Hz, 2H), 7.78 (d, J = 8.5 Hz, 2H), 7.60 (d, J = 2.0 Hz, 1H), 7.58 (d, J = 2.0 Hz, 1H), 7.35 (br. s, 1H), 3.97 (s, 3H).






11-50


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.06 (s, 1H), 9.99 (s, 1H), 7.58-7.64 (m, 2H), 7.48 (t, J = 7.7 Hz, 1H), 7.37-7.42 (m, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.33 (d, J = 1.8 Hz, 1H), 3.99 (s, 3H), 3.15 (br. s, 3H), 3.03 (br. s, 3H).






11-51


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.08 (s, 1H), 10.00 (s, 1H), 7.57-7.63 (m, 2H), 7.50-7.55 (m, 2H), 7.40 (d, J = 2.0 Hz, 1H), 7.33 (d, J = 2.0 Hz, 1H), 4.00 (s, 3H), 3.14 (br. s, 3H), 3.05 (br. s, 3H).






11-52


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.09 (s, 1H), 10.00 (s, 1H), 7.62 (d, J = 1.8 Hz, 1H), 7.61-7.65 (m, 1H), 7.50 (t, J = 8.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.36 (ddd, J = 7.7, 1.4, 1.3 Hz, 1H), 7.33 (d, J = 2.0 Hz, 1H), 4.00 (s, 3H), 3.67 (br. s, 8H).






11-53


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.39 (s, 1H), 10.35 (s, 1H), 8.14 (t, J = 1.6 Hz, 1H), 8.13 (br. s, 1H), 7.81-7.88 (m, 2H), 7.59 (dd, J = 10.0, 2.3 Hz, 2H), 7.53 (t, J = 7.7 Hz, 1H), 7.45 (br. s, 1H), 3.98 (s, 3H).






11-54


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.16 (s, 1H), 10.03 (s, 1H), 8.01-8.05 (m, 2H), 7.74-7.78 (m, 2H), 7.44 (d, J = 2.3 Hz, 1H), 7.33 (d, J = 2.0 Hz, 1H), 4.02 (s, 3H), 3.11 (s, 3H).






11-55


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.06 (br. s, 1H), 10.34 (s, 1H), 8.17 (s, 1H), 8.11 (br. s, 1H), 7.98 (dd, J = 12.3, 2.3 Hz, 1H), 7.88 (s, 1H), 7.81- 7.88 (m, 2H), 7.54 (t, J = 7.7 Hz, 1H), 7.42 (br. s, 1H).






11-56


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.66 (br. s, 1H), 10.19 (s, 1H), 8.45 (d, J = 2.3 Hz, 1H), 8.21 (d, J = 2.3 Hz, 1H), 8.03 (br. s, 1H), 7.97-8.01 (m, 2H), 7.82-7.87 (m, 2H), 7.39 (br. s, 1H).






11-57


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 10.96 (s, 1H), 10.00 (d, J = 2.0 Hz, 1H), 7.58-7.63 (m, 4H), 7.51 (t, J = 7.5 Hz, 1H), 7.39 (dt, J = 7.8, 1.3 Hz, 1H), 3.73 (br. s, 6H), 3.48 (br. s, 2H).






11-58


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.71 (s, 1H), 10.03 (s, 1H), 8.04 (d, J = 2.0 Hz, 1H), 7.96 (d, J = 2.3 Hz, 1H), 7.60-7.65 (m, 1H), 7.63 (d, J = 1.8 Hz, 1H), 7.53 (t, J = 7.8 Hz, 1H), 7.41 (dt, J = 7.8, 1.3 Hz, 1H), 3.67 (br. s, 6H), 3.51 (br. s, 2H).






11-59


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 12.93 (br. s, 1H), 10.46 (br. s, 1H), 10.34 (s, 1H), 7.96-8.04 (m, 1H), 7.80-7.85 (m, 2H), 7.61 (d, J = 2.3 Hz, 1H), 7.59 (d, J = 2.3 Hz, 1H), 3.98 (s, 3H).






11-60


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.70 (s, 1H), 10.03 (s, 1H), 8.04 (d, J = 2.5 Hz, 1H), 7.97 (d, J = 2.5 Hz, 1H), 7.63 (t, J = 1.5 Hz, 1H), 7.58-7.62 (m, 1H), 7.51 (t, J = 7.7 Hz, 1H), 7.43 (ddd, J = 7.7, 1.4, 1.3 Hz, 1H), 3.15 (br. s, 3H), 3.03 (br. s, 3H).






11-61


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.10 (s, 1H), 9.93 (s, 1H), 7.87 (dd, J = 7.8, 1.0 Hz, 1H), 7.55 (td, J = 7.5, 1.5 Hz, 1H), 7.45 (td, J = 7.5, 1.3 Hz, 1H), 7.36 (dd, J = 7.5, 1.0 Hz, 1H), 7.14 (d, J = 2.0 Hz, 1H), 7.08 (d, J = 2.0 Hz, 1H), 4.15 (q, J = 7.0 Hz, 2H), 3.92 (s, 3H), 1.11 (t, J = 7.2 Hz, 3H).






11-62


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.09 (s, 1H), 10.01 (s, 1H), 8.24 (t, J = 1.5 Hz, 1H), 8.03 (dt, J = 7.8, 1.4 Hz, 1H), 7.75 (ddd, J = 7.7, 1.9, 1.1 Hz, 1H), 7.53 (td, J = 7.8, 0.5 Hz, 1H), 7.43 (d, J = 2.3 Hz, 1H), 7.35 (d, J = 2.0 Hz, 1H), 4.01 (s, 3H), 3.97 (s, 3H).






11-63


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.13 (s, 1H), 9.97 (s, 1H), 7.76 (d, J = 3.8 Hz, 1H), 7.45 (d, J = 2.0 Hz, 1H), 7.32 (d, J = 2.0 Hz, 1H), 7.23 (d, J = 4.0 Hz, 1H), 4.38 (q, J = 7.0 Hz, 2H), 3.99 (s, 3H), 1.40 (t, J = 7.0 Hz, 3H).






11-64


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.91 (br. s, 1H), 10.33 (s, 1H), 7.90-8.04 (m, 5H), 7.72 (d, J = 8.5 Hz, 2H), 7.34 (br. s, 1H), 7.12 (d, J = 8.5 Hz, 1H).






11-65


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 10.99 (br. s, 1H), 10.02 (d, J = 1.8 Hz, 1H), 8.13 (d, J = 8.8 Hz, 2H), 7.60-7.66 (m, 4H), 3.95 (s, 3H).






11-66


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 10.97 (s, 1H), 10.03 (d, J = 2.0 Hz, 1H), 8.23 (t, J = 1.5 Hz, 1H), 8.05 (dd, J = 7.8, 1.8 Hz, 1H), 7.73 (dd, J = 7.8, 2.0 Hz, 1H), 7.62-7.67 (m, 2H), 7.55 (t, J = 7.8 Hz, 1H), 3.97 (s, 3H).






11-67


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 13.03 (br. s, 1H), 11.20 (br. s, 1H), 10.33 (s, 1H), 8.18 (t, J = 1.6 Hz, 1H), 7.92-7.98 (m, 3H), 7.81-7.85 (m, 1H), 7.59 (t, J = 7.8 Hz, 1H).






11-68


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.87 (br. s, 1H), 10.34 (s, 1H), 8.13 (t, J = 1.6 Hz, 1H), 8.10 (br. s, 1H), 8.02 (d, J = 2.5 Hz, 1H), 7.92 (dd, J = 8.5, 2.5 Hz, 1H), 7.83 (dt, J = 7.8, 1.0 Hz, 1H), 7.79 (ddd, J = 7.8, 2.1, 1.3 Hz, 1H), 7.53 (t, J = 7.8 Hz, 1H), 7.40 (br. s, 1H), 7.12 (d, J = 8.5 Hz, 1H).






11-69


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.01 (s, 1H), 9.98 (s, 1H), 7.78 (d, J = 2.3 Hz, 1H), 7.62 (t, J = 1.5 Hz, 1H), 7.58-7.61 (m, 1H), 7.48 (td, J = 7.7, 0.5 Hz, 1H), 7.37-7.41 (m, 2H), 7.09 (d, J = 9.5 Hz, 1H), 3.14 (br. s, 3H), 3.03 (br. s, 3H).






11-70


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 13.11 (br. s, 2H), 10.33 (br. s, 1H), 8.47 (d, J = 2.5 Hz, 1H), 8.27 (d, J = 2.8 Hz, 1H), 8.19-8.22 (m, 1H), 7.91- 8.00 (m, 3H).






11-71


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.40 (s, 1H), 10.50 (s, 1H), 8.61 (d, J = 2.5 Hz, 1H), 8.38 (d, J = 2.5 Hz, 1H), 8.16 (d, J = 8.8 Hz, 2H), 7.67 (d, J = 8.8 Hz, 2H), 3.96 (s, 3H).






11-72


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 12.99 (br. s, 1H), 10.34 (s, 1H), 8.58 (d, J = 2.5 Hz, 1H), 8.40 (d, J = 2.5 Hz, 1H), 8.04 (d, J = 8.5 Hz, 2H), 7.89 (d, J = 8.5 Hz, 2H).






11-73


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 13.07 (br. s, 1H), 11.02 (br. s, 1H), 10.33 (s, 1H), 8.15 (t, J = 1.6 Hz, 1H), 7.97 (d, J = 2.3 Hz, 1H), 7.88-7.95 (m, 4H), 7.58 (t, J = 7.8 Hz, 1H).






11-74


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.11 (br. s, 1H), 10.11 (s, 1H), 9.17 (s, 1H), 8.79 (s, 2H), 7.36 (d, J = 8.3 Hz, 1H), 6.89 (d, J = 8.3 Hz, 1H), 3.90 (s, 3H).






11-75


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.01 (s, 1H), 9.98 (s, 1H), 8.42 (d, J = 2.5 Hz, 1H), 7.70 (dd, J = 8.8, 2.8 Hz, 1H), 7.29 (d, J = 2.0 Hz, 1H), 7.25 (d, J = 2.0 Hz, 1H), 6.72 (d, J = 8.8 Hz, 1H), 3.98 (s, 3H), 3.83-3.88 (m, 4H), 3.56-3.60 (m, 4H).






11-76


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 12.93 (br. s, 1H), 11.16 (br. s, 1H), 10.33 (s, 1H), 7.97-8.04 (m, 3H), 7.88 (dd, J = 2.4, 1.1 Hz, 1H), 7.83 (d, J = 8.8 Hz, 2H).






11-77


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 10.95 (s, 1H), 10.00 (d, J = 2.0 Hz, 1H), 7.56-7.63 (m, 4H), 7.49 (t, J = 7.7 Hz, 1H), 7.41 (td, J = 7.5, 1.3 Hz, 1H), 3.14 (br. s, 3H), 3.03 (br. s, 3H).






11-78


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.03 (s, 1H), 10.00 (s, 1H), 8.24 (t, J = 1.6 Hz, 1H), 8.03 (dd, J = 9.4, 1.1 Hz, 1H), 7.78-7.84 (m, 2H), 7.75 (dd, J = 7.8, 2.0 Hz, 1H), 7.53 (t, J = 7.8 Hz, 1H), 7.10 (d, J = 9.8 Hz, 1H), 3.96 (s, 3H).






11-79


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.89 (br. s, 1H), 10.32 (s, 1H), 7.98 (d, J = 2.5 Hz, 1H), 7.90 (dd, J = 8.7, 2.6 Hz, 1H), 7.70 (d, J = 8.5 Hz, 2H), 7.48 (d, J = 8.5 Hz, 2H), 7.12 (d, J = 8.5 Hz, 1H), 2.98 (br. s, 6H).






11-80


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 12.97 (br. s, 1H), 11.10 (br. s, 1H), 10.33 (s, 1H), 7.98-8.04 (m, 3H), 7.92 (dd, J = 8.5, 2.5 Hz, 1H), 7.77 (d, J = 8.5 Hz, 2H), 7.13 (d, J = 8.5 Hz, 1H).






11-81


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.25 (br. s, 1H), 10.33 (s, 1H), 9.10-9.23 (m, 3H), 8.09 (dd, J = 12.1, 2.3 Hz, 1H), 7.93 (dd, J = 2.4, 1.1 Hz, 1H).






11-82


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 10.96 (s, 1H), 10.01 (d, J = 2.0 Hz, 1H), 7.59-7.63 (m, 2H), 7.56- 7.59 (m, 2H), 7.51-7.54 (m, 2H), 3.14 (br. s, 3H), 3.04 (br. s, 3H).






11-83


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 13.64 (br. s, 1H), 9.95 (br. s, 1H), 8.60 (dd, J = 4.4, 1.6 Hz, 2H), 8.06 (d, J = 10.8 Hz, 1H), 7.33 (dd, J = 4.4, 1.6 Hz, 2H), 6.81 (d, J = 7.8 Hz, 1H), 6.27 (d, J = 7.8 Hz, 1H), 3.73 (s, 3H).










EXAMPLE 12
Synthesis of N-cyclohexyl-3′-formyl-4′-hydroxy-5′-methoxybiphenyl-3-carboxamide



embedded image


N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (42 mg, 0.22 mmol), 1-hydroxybenzotriazole (30 mg, 0.22 mmol), triethylamine (140 μL, 1 mmol) and cyclohexylamine (50 μL, 0.44 mmol) were added to a solution of 11-1 (54 mg, 0.2 mmol) in 2 mL THF at room temperature. After 2 h, the reaction was diluted with 2 mL 2N hydrochloric acid and stirred for 2 h, then evaporated to dryness. The residue was dissolved in 2 mL chloroform, and extracted with water (1×1.5 mL), 1N hydrochloric acid (1×1.5 mL), water (1×1.5 mL), satd. sodium bicarbonate (1×1.5 mL) and water (1×1.5 mL). The organic phase was evaporated, and the crude product was purified with prep. HPLC, then recrystallized from diethyl ether to give 12-1 (16 mg, 0.05 mmol, 25%). 1H NMR (400 MHz, CDCl3) δ ppm 11.07 (s, 1H), 10.00 (s, 1H), 8.00 (t, J=1.8 Hz, 1H), 7.64-7.69 (m, 2H), 7.50 (t, J=7.8 Hz, 1H), 7.42 (d, J=2.3 Hz, 1H), 7.35 (d, J=2.0 Hz, 1H), 6.01 (d, J=7.8 Hz, 1H), 3.97-4.06 (m, 4H), 2.03-2.11 (m, 2H), 1.73-1.82 (m, 2H), 1.63-1.71 (m, 1H), 1.40-1.51 (m, 2H), 1.23-1.32 (m, 3H).


The following compounds were made by the above procedure, using the corresponding aryl acid and amine and characterized by NMR.











TABLE 6





No.
CHEMISTRY
NMR







12-2 


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.03 (br. s, 1H), 9.99 (s, 1H), 7.99 (d, J = 3.3 Hz, 1H), 7.78-7.82 (m, 2H), 7.64-7.69 (m, 2H), 7.50 (t, J = 7.7 Hz, 1H), 7.09 (d, J = 8.5 Hz, 1H), 5.98 (d, J = 6.5 Hz, 1H), 4.27- 4.38 (m, 1H), 1.29 (d, J = 6.5 Hz, 6H).






12-3 


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.03 (br. s, 1H), 9.98 (s, 1H), 8.01 (t, J = 1.6 Hz, 1H), 7.77-7.82 (m, 2H), 7.66-7.72 (m, 2H), 7.50 (t, J = 7.5 Hz, 1H), 7.09 (d, J = 8.5 Hz, 1H), 6.20 (br. s, 1H), 3.46 (td, J = 7.1, 5.9 Hz, 2H), 1.62-1.72 (m, 2H), 1.01 (t, J = 7.4 Hz, 3H).






12-4 


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.02 (br. s, 1H), 9.98 (s, 1H), 8.04 (t, J = 1.8 Hz, 1H), 7.76-7.81 (m, 2H), 7.71 (d, J = 7.8 Hz, 1H), 7.68 (d, J = 7.8 Hz, 1H), 7.50 (t, J = 7.8 Hz, 1H), 7.28-7.40 (m, 5H), 7.09 (d, J = 8.0 Hz, 1H), 6.47 (br. s, 1H), 4.68 (d, J = 5.5 Hz, 2H).






12-5 


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 10.96 (br. s, 1H), 10.01 (d, J = 2.0 Hz, 1H), 7.99 (t, J = 1.6 Hz, 1H), 7.67-7.70 (m, 1H), 7.61-7.67 (m, 3H), 7.51 (t, J = 7.9 Hz, 1H), 5.98 (d, J = 6.5 Hz, 1H), 4.27-4.38 (m, 1H), 1.30 (d, J = 6.5 Hz, 6H).






12-6 


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.95 (br. s, 1H), 10.71 (br. s, 1H), 10.35 (s, 1H), 9.02 (t, J = 5.5 Hz, 1H), 8.19 (t, J = 1.6 Hz, 1H), 8.03 (d, J = 2.5 Hz, 1H), 7.96 (dd, J = 8.5, 2.5 Hz, 1H), 7.88 (d, J = 8.3 Hz, 1H), 7.82 (d, J = 8.5 Hz, 1H), 7.56 (t, J = 7.8 Hz, 1H), 7.16 (d, J = 8.8 Hz, 1H), 3.93-4.03 (m, 2H), 3.76-3.86 (m, 2H), 3.72 (q, J = 6.1 Hz, 2H), 3.50-3.61 (m, 2H), 3.36-3.40 (m, 2H, overlapped), 3.08-3.20 (m, 2H).






12-7 


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.91 (br. s, 1H), 10.35 (s, 1H), 8.96 (br. s, 1H), 8.17 (br. s, 1H), 8.03 (d, J = 2.5 Hz, 1H), 7.95 (dd, J = 8.8, 2.5 Hz, 1H), 7.86 (d, J = 8.0 Hz, 1H), 7.82 (d, J = 8.5 Hz, 1H), 7.56 (t, J = 7.8 Hz, 1H), 7.16 (d, J = 8.5 Hz, 1H), 3.66 (br. s, 2H), 3.08 (br. s, 6H), 1.75 (br. s, 4H), 1.49 (br. s, 2H).






12-8 


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.01 (br. s, 1H), 10.34 (s, 1H), 9.09 (t, J = 5.9 Hz, 1H), 8.16 (t, J = 1.6 Hz, 1H), 7.97 (dd, J = 12.3, 2.3 Hz, 1H), 7.82-7.90 (m, 3H), 7.55 (t, J = 7.8 Hz, 1H), 7.27 (d, J = 8.8 Hz, 2H), 6.90 (d, J = 8.8 Hz, 2H), 4.45 (d, J = 6.0 Hz, 2H), 3.73 (s, 3H).






12-9 


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.03 (s, 1H), 9.99 (s, 1H), 7.98 (t, J = 1.6 Hz, 1H), 7.77-7.83 (m, 2H), 7.67-7.69 (m, 2H), 7.50 (t, J = 7.9 Hz, 1H), 7.09 (d, J = 8.5 Hz, 1H), 6.01 (d, J = 8.0 Hz, 1H), 3.96-4.07 (m, 1H), 2.02-2.11 (m, 2H), 1.73-1.82 (m, 2H), 1.63-1.72 (m, 1H), 1.39-1.51 (m, 2H), 1.17-1.32 (m, 3H).






12-10


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.07 (br. s, 1H), 10.00 (s, 1H), 7.59-7.65 (m, 2H), 7.49 (t, J = 7.5 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.36 (dt, J = 7.5, 1.4 Hz, 1H), 7.33 (d, J = 2.0 Hz, 1H), 4.00 (s, 3H), 3.83 (br. s, 2H), 3.59 (br. s, 2H), 2.52 (br. s, 2H), 2.43 (br. s, 2H), 2.36 (s, 3H).






12-11


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.40 (s, 1H), 10.49 (s, 1H), 8.60 (d, J = 2.3 Hz, 1H), 8.38 (d, J = 2.5 Hz, 1H), 8.04 (t, J = 1.6 Hz, 1H), 7.77 (d, J = 6.8 Hz, 1H), 7.72 (d, J = 8.5 Hz, 1H), 7.56 (t, J = 7.3 Hz, 1H), 6.26 (br. s, 1H), 3.43-3.52 (m, 2H), 1.65-1.74 (m, 2H), 1.02 (t, J = 7.4 Hz, 3H).






12-12


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.07 (s, 1H), 9.99 (s, 1H), 8.06 (s, 1H), 7.70 (t, J = 7.2 Hz, 2H), 7.51 (t, J = 7.7 Hz, 1H), 7.29- 7.43 (m, 7H), 6.49 (br. s, 1H), 4.69 (d, J = 5.5 Hz, 2H), 3.99 (s, 3H).






12-13


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 10.97 (br. s, 1H), 10.00 (d, J = 2.0 Hz, 1H), 7.57-7.63 (m, 4H), 7.50 (t, J = 7.5 Hz, 1H), 7.39 (dt, J = 7.5, 1.4 Hz, 1H), 3.83 (br. s, 2H), 3.48 (br. s, 2H), 2.50 (br. s, 2H), 2.39 (br. s, 2H), 2.33 (s, 3H).






12-14


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 10.48 (s, 1H), 8.57 (d, J = 2.3 Hz, 1H), 8.35 (d, J = 2.5 Hz, 1H), 7.60-7.69 (m, 2H), 7.53 (t, J = 7.5 Hz, 1H), 7.43 (dt, J = 7.8, 1.4 Hz, 1H), 3.85 (br. s, 2H), 3.48 (br. s, 2H), 2.51 (br. s, 2H), 2.40 (br. s, 2H), 2.34 (s, 3H).










EXAMPLE 13
Synthesis of 6-bromo-2-hydroxy-3-(morpholine-4-carbonyl)benzaldehyde



embedded image


4-Bromo-3-formyl-2-hydroxybenzoic acid (122 mg, 0.5 mmol) was dissolved in 5 mL of dry THF. Phosphorus pentachloride (115 mg, 0.55 mmol) was added at 0° C., and the mixture was stirred for 20 minutes. This mixture was added dropwise to a solution of morpholine (433 μL, 5 mmol) in 20 mL of dry THF at −10° C. The reaction was warmed to room temperature and stirred for 30 min. The volatiles were evaporated and the residue taken up in 15 mL of 1N hydrochloric acid and extracted with ethyl acetate. The organic layer was evaporated and the resulting crude product was purified by column chromatography to afford 13-1 (25 mg, 0.08 mmol, 16%). 1H NMR (400 MHz, CDCl3) δ ppm 12.33 (s, 1H), 10.34 (s, 1H), 7.41 (d, J=8.0 Hz, 1H), 7.25 (d, J=8.0 Hz, 1H), 3.78 (br. s, 4H), 3.66 (br. s, 2H), 3.32 (br. s, 2H).


The following compound was made by the above procedure and characterized by LC/MS.













TABLE 7





No.
CHEMISTRY
MW
MH+
Rt







13-2


embedded image


243.0
244.08
0.77









EXAMPLE 14
Synthesis of 5-(1,3-dimethyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidin-5-yl)-2-hydroxy-3-methoxybenzaldehyde



embedded image


5-bromo-2-hydroxy-3-methoxybenzaldehyde (3.00 g; 13.0 mmol), bis-pinacolato-diboron (3.63 g; 14.3 mmol), potassium acetate (3.80; 39.0 mmol) and Pd(dppf)C12 (1.10 g; 1.50 mmol) were dissolved in dioxane and heated at reflux under argon for 4 h. The reaction mixture was cooled, filtered, and the filtrate was evaporated to dryness under reduced pressure. The solid residue was purified by column chromatography on silica with dichloromethane as eluent. The collected light yellow solid was triturated with diisopropyl ether to give the 14a (1.45 g, 5.22 mmol, 40%). 1H NMR (400 MHz, CDCl3) δ ppm 11.36 (s, 1H), 9.93 (s, 1H), 7.69 (d, J=1.3 Hz, 1H), 7.49 (s, 1H), 3.96 (s, 3H), 1.36 (s, 12H).


5-bromo-1,3-dimethyluracil (88 mg, 0.4 mmol), 14a (117 mg, 0.4 mmol) and anhydrous sodium carbonate (254 mg, 2.4 mmol) were dissolved in a mixture of 6 mL of DMF and 6 mL of water. Tetrakis(triphenylphosphine)palladium (22 mg, 0.02 mmol) was added, and the reaction heated to 110° C. under argon for 1 h. 40 mL satd. sodium chloride solution was added, and the mixture was extracted with chloroform (2×40 mL). The organic layer was dried, evaporated, and the residue purified with column chromatography to give 14-1 (37 mg, 0.13 mmol, 32%). 1H NMR (400 MHz, CDCl3) δ ppm 11.00 (s, 1H), 9.95 (s, 1H), 7.35 (d, J=1.8 Hz, 1H), 7.33 (dd, J=9.3, 2.0 Hz, 2H), 3.96 (s, 3H), 3.51 (s, 3H), 3.44 (s, 3H).


The following compounds was made by the above procedure using the corresponding aryl bromide and characterized by LC/MS.













TABLE 8





No.
CHEMISTRY
MW
MH+
Rt







14-2


embedded image


229.1
230.2
1.09









The following compound was made by the above procedure using the corresponding aryl bromide and characterized by NMR.











TABLE 9





No.
CHEMISTRY
NMR







14-3


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.10 (s, 1H), 9.98 (s, 1H), 7.67 (d, J = 1.8 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 6.80 (s, 1H), 4.16 (s, 3H), 3.99 (s, 3H).










EXAMPLE 15
Synthesis of 2-hydroxy-3-methoxy-5-(pyridin-3-ylethynyl)benzaldehyde



embedded image


2-Hydroxy-5-iodo-3-methoxybenzaldehyde (2.08 g; 7.5 mmol), ethynyl-trimethylsilane (2.65 mL, 1.8 mmol), Pd(PPh3)2Cl2 (158 mg; 0.23 mmol) and copper(I) iodide (43 mg; 0.23 mmol) were dissolved in 40 mL triethylamine and was heated at 60° C. for 4 h. The mixture was cooled to room temperature, filtered, and the filtrate was evaporated. The solid residue was purified by column chromatography on silica with toluene as eluent to give 15a (0.7 g, 3.9 mmol, 49%). 1H NMR (400 MHz, CDCl3) δ ppm 11.20 (s, 1H), 9.87 (s, 1H), 7.35 (d, J=1.8 Hz, 1H), 7.16 (d, J=1.8 Hz, 1H), 3.92 (s, 3H), 0.26 (s, 9H).


Compound 15a (2.00 g; 8.06 mmol) was dissolved in 150 mL of methanol. Sodium carbonate (2.3 g, 21.7 mmol) was added and the mixture was stirred overnight at room temperature. The reaction was evaporated and the residue partitioned between water and dichloromethane. The organic layer was dried, evaporated and the solid residue was chromatographed on silica with toluene as the eluent to give 15b as a white powder (0.70 g, 4 mmol, 50%). 1H NMR (400 MHz, CDCl3) δ ppm 11.22 (s, 1H), 9.88 (s, 1H), 7.37 (d, J=1.8 Hz, 1H), 7.18 (d, J=1.8 Hz, 1H), 3.92 (s, 3H), 3.04 (s, 1H).


Compound 15b (70 mg, 0.4 mmol), 3-iodopyridine (90 mg, 0.44 mmol), Pd(dppf)Cl2 (15 mg, 0.02 mmol) and copper(I) iodide (5 mg, 0.02 mmol) were dissolved in 5 mL triethylamine and 5 mL DMF, and heated to 80° C. After 4 h, 20 mL 1N hydrochloric acid was added, and the mixture was extracted with dichloromethane. The organic layer was evaporated, and the solid residue was purified by column chromatography to afford 15-1 (9 mg, 0.04 mmol, 9%). 1H NMR (400 MHz, CDCl3) δ ppm 11.24 (s, 1H), 9.93 (s, 1H), 8.77 (s, 1H), 8.57 (d, J=3.5 Hz, 1H), 7.81 (ddd, J=7.9, 1.9, 1.8 Hz, 1H), 7.44 (d, J=2.0 Hz, 1H), 7.30 (dd, J=7.9, 4.9 Hz, 1H), 7.24 (d, J=1.8 Hz, 1H), 3.97 (s, 3H).


The following compound was made by the above procedure, using the corresponding aryl bromide and characterized by LC/MS.













TABLE 10





No.
CHEMISTRY
MW
MH+
Rt







15-2


embedded image


223.1
224.2
1.21









The following compound was made by the above procedure using the corresponding aryl bromide and characterized by NMR.











TABLE 11





No.
CHEMISTRY
NMR







15-3


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 11.23 (s, 1H), 9.90 (s, 1H), 7.39 (d, J = 1.8 Hz, 1H), 7.31 (dd, J = 5.1, 1.1 Hz, 1H), 7.28 (dd, J = 3.6, 1.1 Hz, 1H), 7.21 (d, J = 1.8 Hz, 1H), 7.02 (dd, J = 5.3, 3.5 Hz, 1H), 3.95 (s, 3H).










EXAMPLE 16
Synthesis of 6-bromo-2-hydroxy-1-naphthaldehyde



embedded image


A solution of titanium tetrachloride (231 μL, 2.1 mmol) and dichloromethyl methyl ether (97 μL, 1.1 mmol) in 1 mL of dichloromethane was stirred at 0° C. for 15 min. A solution of 6-bromo-2-hydroxy-naphthalene (223 mg, 1 mmol) in 3 mL of dichloromethane was added dropwise, the solution was allowed to warm up to room temperature, and stirred for 12 hours. 10 mL of 1 N hydrochloric acid was added, and the mixture was extracted with dichloromethane. The organic layer was washed with water, dried, and evaporated to give 16-1 (206 mg, 0.82 mmol, 82%). 1H NMR (400 MHz, DMSO-d6) δ ppm 11.90 (s, 1H), 10.76 (s, 1H), 8.92 (d, J=9.3 Hz, 1H), 8.16 (d, J=2.0 Hz, 1H), 8.10 (d, J=9.3 Hz, 1H), 7.72 (dd, J=9.0, 2.3 Hz, 1H), 7.30 (d, J=9.0 Hz, 1H).


The following compound was made by the above procedure and characterized by NMR.











TABLE 12





No.
CHEMISTRY
NMR







16-2


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.88 (br. s, 1 H), 10.82 (s, 1 H), 8.80 (d, J = 8.5 Hz, 1 H), 7.81 (dd, J = 7.9, 1.4 Hz, 1 H), 7.67 (s, 1 H), 7.47 (ddd, J = 8.5, 7.0, 1.5 Hz, 1 H), 7.40 (ddd, J = 8.3, 7.0, 1.3 Hz, 1 H), 3.98 (s, 3 H).










EXAMPLE 17
Synthesis of 4-(5-formyl-6-hydroxynaphthalen-2-yl)-N,N-dimethylbenzamide



embedded image


Compound 16-1 (251 mg, 1 mmol), 4-(N,N-dimethylaminocarbonyl)phenylboronic acid (222 mg, 1.2 mmol) and anhydrous sodium carbonate (424 mg, 4 mmol) were dissolved in a mixture of 20 mL of DMF and 12 mL of water. Tetrakis(triphenylphosphine)palladium (56 mg, 0.05 mmol) was added, and the reaction was heated at 105° C. under argon, for 25 min. 50 mL satd. sodium chloride solution and 900 μL of acetic acid were added, and the mixture was extracted with chloroform. The organic layer was evaporated, and the crude product was purified with column chromatography to afford 17-1 (186 mg, 0.58 mmol, 58%). 1H NMR (400 MHz, CDCl3) δ ppm 13.15 (s, 1H), 10.85 (s, 1H), 8.44 (d, J=9.0 Hz, 1H), 8.05 (d, J=9.0 Hz, 1H), 8.01 (d, J=2.0 Hz, 1H), 7.88 (dd, J=8.8, 2.0 Hz, 1H), 7.71-7.75 (m, 2H), 7.56 (d, J=8.5 Hz, 2H), 7.19 (d, J=9.0 Hz, 1H), 3.15 (br. s, 3H), 3.07 (br. s, 3H).


The following compounds were made by the above procedure using the corresponding aryl boronic acid and characterized by NMR.











TABLE 13





No.
CHEMISTRY
NMR







17-2


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.99 (br. s, 1H), 10.83 (s, 1H), 9.04 (d, J = 9.0 Hz, 1H), 8.30 (d, J = 2.0 Hz, 1H), 8.23 (d, J = 9.0 Hz, 1H), 7.97- 8.08 (m, 4H), 7.90 (d, J = 8.5 Hz, 2H), 7.37 (br. s, 1H), 7.30 (d, J = 9.0 Hz, 1H).






17-3


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.16 (s, 1H), 10.86 (s, 1H), 8.96 (d, J = 1.8 Hz, 1H), 8.65 (dd, J = 4.8, 1.3 Hz, 1H), 8.47 (d, J = 9.3 Hz, 1H), 8.07 (d, J = 9.0 Hz, 1H), 8.01 (d, J = 2.0 Hz, 1H), 7.98 (dt, J = 7.8, 2.0 Hz, 1H), 7.86 (dd, J = 8.8, 2.0 Hz, 1H), 7.42 (dd, J = 7.5, 4.5 Hz, 1H), 7.22 (d, J = 9.3 Hz, 1H).






17-4


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.20 (s, 1H), 10.86 (s, 1H), 9.26 (s, 1H), 9.07 (s, 2H), 8.52 (d, J = 9.3 Hz, 1H), 8.09 (d, J = 9.3 Hz, 1H), 8.02 (d, J = 2.0 Hz, 1H), 7.85 (dd, J = 8.8, 2.0 Hz, 1H), 7.25 (d, J = 9.3 Hz, 1H).






17-5


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.15 (s, 1H), 10.85 (s, 1H), 8.44 (d, J = 9.3 Hz, 1H), 8.38 (t, J = 1.6 Hz, 1H), 8.01-8.10 (m, 3H), 7.90 (td, J = 8.5, 2.0 Hz, 2H), 7.57 (t, J = 7.8 Hz, 1H), 7.20 (d, J = 9.3 Hz, 1H), 3.98 (s, 3H).






17-6


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.15 (s, 1H), 10.85 (s, 1H), 8.44 (d, J = 9.3 Hz, 1H), 8.04 (d, J = 9.3 Hz, 1H), 8.01 (d, J = 2.0 Hz, 1H), 7.87 (dd, J = 8.8, 2.0 Hz, 1H), 7.73-7.78 (m, 2H), 7.54 (t, J = 8.3 Hz, 1H), 7.40 (dt, J = 7.5, 1.4 Hz, 1H), 7.20 (d, J = 9.0 Hz, 1H), 3.40-4.02 (m, 8H).






17-7


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 12.90 (br. s, 1H), 12.11 (br. s, 1H), 10.83 (s, 1H), 9.05 (d, J = 9.0 Hz, 1H), 8.33 (s, 1H), 8.24-8.30 (m, 2H), 8.06 (d, J = 7.8 Hz, 1H), 7.98 (t, J = 9.0 Hz, 1H), 7.99 (d, J = 9.0 Hz, 1H), 7.64 (t, J = 7.8 Hz, 1H), 7.29 (d, J = 9.0 Hz, 1H).






17-8


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.08 (s, 1H), 10.82 (s, 1H), 8.35 (d, J = 9.0 Hz, 1H), 7.98 (d, J = 9.0 Hz, 1H), 7.87 (d, J = 1.8 Hz, 1H), 7.83 (s, 1H), 7.75 (dd, J = 8.8, 2.0 Hz, 1H), 7.53 (t, J = 1.6 Hz, 1H), 7.16 (d, J = 9.0 Hz, 1H), 6.80 (d, J = 1.0 Hz, 1H).






17-9


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.13 (s, 1H), 10.84 (s, 1H), 8.41 (d, J = 9.3 Hz, 1H), 8.04 (d, J = 9.0 Hz, 1H), 7.99 (d, J = 1.8 Hz, 1H), 7.88 (dd, J = 8.8, 2.0 Hz, 1H), 7.69 (d, J = 8.5 Hz, 2H), 7.50 (d, J = 8.5 Hz, 2H), 7.18 (d, J = 9.3 Hz, 1H), 4.78 (d, J = 5.3 Hz, 2H), 1.72 (t, J = 5.8 Hz, 1H).






17-10


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.13 (s, 1H), 10.84 (s, 1H), 8.49 (dd, J = 2.8, 0.8 Hz, 1H), 8.43 (d, J = 9.3 Hz, 1H), 8.04 (d, J = 9.0 Hz, 1H), 7.92 (d, J = 2.0 Hz, 1H), 7.89 (dd, J = 8.7, 2.6 Hz, 1H), 7.81 (dd, J = 8.5, 2.0 Hz, 1H), 7.19 (d, J = 9.0 Hz, 1H), 6.87 (dd, J = 8.7, 0.6 Hz, 1H), 4.01 (s, 3H).






17-11


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.10 (s, 1H), 10.83 (s, 1H), 8.38 (d, J = 9.3 Hz, 1H), 8.01 (d, J = 9.3 Hz, 1H), 7.99 (d, J = 2.0 Hz, 1H), 7.88 (dd, J = 8.8, 2.0 Hz, 1H), 7.56 (dd, J = 2.9, 1.4 Hz, 1H), 7.50 (dd, J = 5.0, 1.5 Hz, 1H), 7.45 (dd, J = 5.0, 3.0 Hz, 1H), 7.17 (d, J = 9.0 Hz, 1H).






17-12


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.20 (s, 1H), 10.91 (s, 1H), 9.33 (br. s, 1H), 8.58 (br. s, 1H), 8.51 (d, J = 9.3 Hz, 1H), 8.05-8.12 (m, 2H), 7.96 (d, J = 2.0 Hz, 1H), 7.92 (d, J = 7.5 Hz, 1H), 7.80 (dd, J = 8.7, 1.9 Hz, 1H), 7.64-7.73 (m, 2H), 7.24 (d, J = 9.3 Hz, 1H).






17-13


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.19 (s, 1H), 10.91 (s, 1H), 8.96 (dd, J = 4.1, 1.4 Hz, 1H), 8.49 (d, J = 9.0 Hz, 1H), 8.24 (d, J = 8.5 Hz, 1H), 8.18 (d, J = 8.5 Hz, 1H), 8.05 (d, J = 9.0 Hz, 1H), 7.91 (d, J = 2.0 Hz, 1H), 7.81 (dd, J = 8.5, 7.0 Hz, 1H), 7.75 (dd, J = 8.5, 1.8 Hz, 1H), 7.59 (dd, J = 7.0, 1.0 Hz, 1H), 7.38 (dd, J = 8.7, 4.1 Hz, 1H), 7.24 (d, J = 9.0 Hz, 1H).






17-14


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.12 (s, 1H), 10.84 (s, 1H), 8.40 (d, J = 9.0 Hz, 1H), 8.03 (d, J = 9.0 Hz, 1H), 7.93 (d, J = 1.8 Hz, 1H), 7.82 (dd, J = 8.8, 2.0 Hz, 1H), 7.48-7.52 (m, 1H), 7.43-7.48 (m, 1H), 7.18 (d, J = 9.0 Hz, 1H), 7.11 (t, J = 9.0 Hz, 1H), 2.38 (d, J = 1.8 Hz, 3H).






17-15


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.13 (s, 1H), 10.84 (s, 1H), 8.41 (d, J = 9.0 Hz, 1H), 8.04 (d, J = 9.0 Hz, 1H), 7.96 (d, J = 1.8 Hz, 1H), 7.83 (dd, J = 8.8, 2.0 Hz, 1H), 7.55 (s, 1H), 7.45 (d, J = 1.3 Hz, 2H), 7.18 (d, J = 9.0 Hz, 1H), 2.48 (s, 3H).






17-16


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.13 (s, 1H), 10.84 (s, 1H), 8.41 (d, J = 9.0 Hz, 1H), 8.03 (d, J = 9.0 Hz, 1H), 7.96 (d, J = 1.8 Hz, 1H), 7.84 (dd, J = 8.8, 2.0 Hz, 1H), 7.68 (d, J = 2.0 Hz, 1H), 7.48 (dd, J = 7.8, 1.8 Hz, 1H), 7.34 (d, J = 8.0 Hz, 1H), 7.18 (d, J = 9.0 Hz, 1H), 2.44 (s, 3H).






17-17


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 12.00 (br. s, 1H), 10.83 (s, 1H), 9.05 (d, J = 9.0 Hz, 1H), 8.32 (d, J = 2.0 Hz, 1H), 8.24 (d, J = 8.8 Hz, 1H), 8.08 (d, J = 8.5 Hz, 2H), 8.03 (dd, J = 8.9, 2.1 Hz, 1H), 7.97 (d, J = 8.8 Hz, 2H), 7.30 (d, J = 9.0 Hz, 1H), 3.89 (s, 3H).






17-18


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.99 (br. s, 1H), 10.84 (s, 1H), 9.05 (d, J = 8.8 Hz, 1H), 8.30 (t, J = 1.6 Hz, 1H), 8.29 (d, J = 2.0 Hz, 1H), 8.24 (d, J = 9.0 Hz, 1H), 8.11 (br. s, 1H), 8.03 (dd, J = 8.8, 2.0 Hz, 1H), 7.96 (ddd, J = 7.8, 1.8, 1.3 Hz, 1H), 7.89 (ddd, J = 7.5, 1.5, 1.0 Hz, 1H), 7.59 (t, J = 7.8 Hz, 1H), 7.44 (br. s, 1H), 7.30 (d, J = 9.0 Hz, 1H).






17-19


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.14 (s, 1H), 10.85 (s, 1H), 8.43 (d, J = 9.3 Hz, 1H), 8.04 (d, J = 9.0 Hz, 1H), 8.01 (d, J = 2.0 Hz, 1H), 7.88 (dd, J = 8.8, 2.0 Hz, 1H), 7.68-7.77 (m, 2H), 7.50-7.54 (m, 1H), 7.35-7.46 (m, 1H), 7.19 (d, J = 9.0 Hz, 1H), 3.16 (br. s, 3H), 3.05 (br. s, 3H).






17-20


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 12.97 (br. s, 1H), 12.05 (br. s, 1H), 10.82 (s, 1H), 9.07 (d, J = 9.0 Hz, 1H), 8.31 (d, J = 2.0 Hz, 1H), 8.23 (d, J = 9.0 Hz, 1H), 8.06 (d, J = 8.8 Hz, 2H), 8.02 (dd, J = 8.9, 2.1 Hz, 1H), 7.94 (d, J = 8.8 Hz, 2H), 7.37 (d, J = 9.0 Hz, 1H).






17-21


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.11 (s, 1H), 10.84 (s, 1H), 8.56 (d, J = 1.8 Hz, 1H), 8.41 (d, J = 9.3 Hz, 1H), 8.02 (d, J = 9.3 Hz, 1H), 7.91 (d, J = 2.0 Hz, 1H), 7.79-7.86 (m, 2H), 7.17 (d, J = 9.0 Hz, 1H), 6.75 (d, J = 8.8 Hz, 1H), 3.86-3.89 (m, 4H), 3.58-3.62 (m, 4H).










EXAMPLE 18
Synthesis of 6-(5-formyl-6-hydroxynaphthalen-2-yl)picolinic acid



embedded image


Compound 16-1 (5.00 g; 19.9 mmol) bis-pinacolatodiboron (5.57 g; 21.9 mmol), potassium acetate (5.86 g; 59.8 mmol) and Pd(dppf)Cl2 (1.75 g; 2.39 mmol) were heated at reflux in dioxane under argon for 4 h. The reaction mixture was cooled to room temperature, filtered, and the filtrate was evaporated to dryness under reduced pressure. The solid residue was purified by column chromatography on silica with dichloromethane as the eluent. The collected light yellow solid was triturated with diisopropyl ether to give 18a (3.56 g; 11.9 mmol, 60%). 1H NMR (400 MHz, CDCl3) δ ppm 13.23 (s, 1H), 10.82 (s, 1H), 8.33 (d, J=8.8 Hz, 1H), 8.29 (s, 1H), 8.02 (d, J=9.0 Hz, 1H), 7.98 (dd, J=8.5, 1.3 Hz, 1H), 7.13 (d, J=9.0 Hz, 1H), 1.39 (s, 12H).


6-bromopicolinic acid (81 mg, 0.4 mmol), 18a (119 mg, 0.4 mmol) and anhydrous sodium carbonate (339 mg, 3.2 mmol) were dissolved in a mixture of 8 mL of DMF and 8 mL of water. Tetrakis(triphenylphosphine)palladium (22 mg, 0.02 mmol) was added and the reaction was stirred under argon for 3 h at 110° C. 40 mL 1N sodium hydroxide solution was added, and the aqueous layer was extracted with chloroform (2×40 mL). The aqueous layer was acidified with 6N hydrochloric acid to pH 5, the white precipitate was filtered, washed with water, dried under vacuum, and recrystallized from diethyl ether to give 100 mg 18-1 (0.34 mmol, 84%). 1H NMR (400 MHz, DMSO-d6) δ ppm 13.15 (br. s, 1H), 12.08 (br. s, 1H), 10.84 (s, 1H), 9.07 (d, J=9.0 Hz, 1H), 8.73 (d, J=2.0 Hz, 1H), 8.44 (dd, J=9.0, 2.0 Hz, 1H), 8.33 (dd, J=7.9, 0.9 Hz, 1H), 8.28 (d, J=9.0 Hz, 1H), 8.11 (t, J=7.8 Hz, 1H), 8.02 (dd, J=7.8, 0.8 Hz, 1H), 7.34 (d, J=9.0 Hz, 1H).


The following compound was made by the above procedure using the corresponding aryl boronic acid and characterized by LC/MS.















TABLE 14










IC50
EC50


No.
CHEMISTRY
MW
MH+
Rt
(nM)
(nM)







18- 2


embedded image


283.0
283.6
1.59
5616










The following compound was made by the above procedure using the corresponding aryl boronic acid and characterized by NMR.











TABLE 15





No.
CHEMISTRY
NMR







18-3


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.14 (s, 1H), 10.82 (s, 1H), 8.38 (d, J = 9.3 Hz, 1H), 8.05 (d, J = 2.0 Hz, 1H), 8.01 (d, J = 9.0 Hz, 1H), 7.88 (dd, J = 8.8, 2.0 Hz, 1H), 7.80 (d, J = 3.8 Hz, 1H), 7.39 (d, J = 3.8 Hz, 1H), 7.20 (d, J = 9.3 Hz, 1H), 4.39 (q, J = 7.3 Hz, 2H), 1.41 (t, J = 7.2 Hz, 3H).










EXAMPLE 19
Synthesis of 6-(5-formyl-6-hydroxynaphthalen-2-yl)-N-(2-morpholinoethyl)picolinamide



embedded image


N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (42 mg, 0.22 mmol), 1-hydroxybenzotriazole (30 mg, 0.22 mmol), triethylamine (140 μL, 1 mmol) and 1-(2-aminoethyl)morpholine (57 μL, 0.44 mmol) were added to a solution of 18-1 (59 mg, 0.2 mmol) in 2 mL THF at room temperature. After 2 h, 2 mL 2N hydrochloric acid was added, and the reaction was stirred for 2 h. The mixture was evaporated, and the residue was dissolved in 2 mL chloroform and washed with satd. sodium bicarbonate (1×1.5 mL) and water (1×1.5 mL). The organic phase was evaporated and the crude product was purified by column chromatography to give 7 mg of 19-1 (0.02 mmol, 9%). 1H NMR (400 MHz, CDCl3) δ ppm 13.20 (br. s, 1H), 10.89 (s, 1H), 8.71 (br. s, 1H), 8.49 (d, J=8.8 Hz, 1H), 8.46 (d, J=2.0 Hz, 1H), 8.38 (dd, J=8.8, 2.0 Hz, 1H), 8.19 (dd, J=7.2, 1.6 Hz, 1H), 8.10 (d, J=9.0 Hz, 1H), 8.01 (dd, J=8.0, 1.5 Hz, 1H), 7.97 (t, J=7.8 Hz, 1H), 7.23 (d, J=9.0 Hz, 1H), 3.78-3.86 (m, 4H), 3.66 (q, J=6.0 Hz, 2H), 2.69 (t, J=6.1 Hz, 2H), 2.56-2.65 (m, 4H).


The following compounds were made by the above procedure, using the corresponding aryl acid and amine and characterized by NMR.











TABLE 16





No.
CHEMISTRY
NMR







19-2


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.18 (br. s, 1H), 10.86 (s, 1H), 8.44-8.49 (m, 2H), 8.30 (dd, J = 8.9, 1.9 Hz, 1H), 8.09 (d, J = 9.0 Hz, 1H), 7.92 (s, 1H), 7.91 (d, J = 1.9 Hz, 1H), 7.60-7.66 (m, 1H), 7.20 (d, J = 9.0 Hz, 1H), 3.85-3.95 (m, 2H), 3.73-3.81 (m, 2H), 2.55-2.62 (m, 2H), 2.47-2.54 (m, 2H), 2.37 (s, 3H).






19-3


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.19 (s, 1H), 10.87 (s, 1H), 8.50 (d, J = 9.3 Hz, 1H), 8.40 (d, J = 2.0 Hz, 1H), 8.29 (dd, J = 8.8, 2.0 Hz, 1H), 8.21 (dd, J = 5.1, 3.6 Hz, 1H), 8.12 (d, J = 9.0 Hz, 1H), 7.97 (s, 1H), 7.96 (d, J = 1.5 Hz, 1H), 7.90 (d, J = 5.5 Hz, 1H), 7.22 (d, J = 9.3 Hz, 1H), 4.34 (s, 1H), 1.35 (d, J = 6.5 Hz, 6H).






19-4


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.19 (s, 1H), 10.86 (s, 1H), 8.41-8.51 (m, 1H), 8.29 (dd, J = 8.8, 2.0 Hz, 1H), 8.09 (d, J = 9.0 Hz, 1H), 7.92 (d, J = 4.3 Hz, 2H), 7.67 (t, J = 4.3 Hz, 1H), 7.18-7.23 (m, 2H), 3.83-3.92 (m, 4H), 3.75-3.83 (m, 4H).






19-5


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.14 (s, 1H), 10.85 (s, 1H), 8.43 (d, J = 8.8 Hz, 1H), 8.04 (d, J = 9.0 Hz, 1H), 8.01 (d, J = 2.0 Hz, 1H), 7.88 (dd, J = 8.8, 2.0 Hz, 1H), 7.70-7.76 (m, 2H), 7.51 (t, J = 7.8 Hz, 1H), 7.39 (dt, J = 7.5, 1.3 Hz, 1H), 7.19 (d, J = 9.3 Hz, 1H), 3.76 (br. s, 2H), 3.42 (br. s, 2H), 1.70 (br. s, 4H), 1.56 (br. s, 2H).






19-6


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.15 (br. s, 1H), 10.85 (s, 1H), 8.44 (d, J = 9.0 Hz, 1H), 8.04 (d, J = 8.8 Hz, 1H), 8.01 (d, J = 2.0 Hz, 1H), 7.88 (dd, J = 8.7, 2.1 Hz, 1H), 7.72-7.76 (m, 2H), 7.53 (t, J = 7.5 Hz, 1H), 7.40 (dt, J = 7.8, 1.3 Hz, 1H), 7.19 (d, J = 9.0 Hz, 1H), 3.85 (br. s, 2H), 3.48 (br. s, 2H), 2.50 (br. s, 2H), 2.41 (br. s, 2H), 2.34 (s, 3H).






19-7


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.14 (s, 1H), 10.84 (s, 1H), 8.39 (br. s, 1H), 7.94-8.07 (m, 1H), 7.70-7.90 (m, 3H), 7.45-7.54 (m, 2H), 7.30-7.42 (m, 4H), 7.16-7.27 (m, 3H), 4.80 (br. s, 1H), 4.60 (br. s, 1H), 3.03 (br. s, 3H).






19-8


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.15 (s, 1H), 10.85 (s, 1H), 8.43 (d, J = 8.8 Hz, 1H), 8.12 (t, J = 1.8 Hz, 1H), 8.02-8.08 (m, 2H), 7.90 (dd, J = 8.8, 2.0 Hz, 1H), 7.81 (d, J = 7.8 Hz, 1H), 7.71 (d, J = 7.8 Hz, 1H), 7.54 (t, J = 7.7 Hz, 1H), 7.19 (d, J = 9.3 Hz, 1H), 6.01 (br. s, 1H), 4.27- 4.41 (m, 1H), 1.31 (d, J = 6.5 Hz, 6H).






19-9


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.14 (s, 1H), 10.85 (s, 1H), 8.43 (d, J = 8.8 Hz, 1H), 8.04 (d, J = 9.0 Hz, 1H), 8.00 (br. s, 1H), 7.88 (br. s, 1H), 7.71 (br. s, 2H), 7.59 (d, J = 8.3 Hz, 2H), 7.29-7.42 (m, 4H), 7.17-7.25 (m, 2H), 4.70 (br. s, 2H), 3.01 (br. s, 3H).






19-10


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.15 (s, 1H), 10.85 (s, 1H), 8.44 (d, J = 9.3 Hz, 1H), 8.01 (d, J = 2.0 Hz, 1H), 8.05 (d, J = 9.3 Hz, 1H), 7.87 (dd, J = 8.8, 2.0 Hz, 1H), 7.74 (d, J = 8.5 Hz, 2H), 7.55 (d, J = 8.5 Hz, 2H), 7.20 (d, J = 9.0 Hz, 1H), 3.74 (br. s, 8H).










EXAMPLE 20
Synthesis of 2-hydroxy-6-(5-(morpholine-4-carbonyl)thiophen-2-yl)-1-naphthaldehyde



embedded image


Compound 18-3 (804 mg; 2.57 mmol) was dissolved in a mixture of 25 mL of dioxane and 25 mL of 1N sodium hydroxide. This mixture was stirred for 30 min, at room temperature. 75 mL of 1N sodium hydroxide was added and the solution was washed with chloroform (2×25 mL). The aqueous layer was acidified with 6N hydrochloric acid, and the yellow precipitate was filtered, washed with water, then diethyl ether to give 666 mg 20-1 (2.3 mmol, 91%). 1H NMR (400 MHz, DMSO-d6) δ ppm 13.09 (br. s, 1H), 12.08 (s, 1H), 10.78 (s, 1H), 9.04 (d, J=8.8 Hz, 1H), 8.28 (d, J=2.0 Hz, 1H), 8.20 (d, J=9.0 Hz, 1H), 7.98 (dd, J=8.8, 2.0 Hz, 1H), 7.76 (d, J=3.8 Hz, 1H), 7.67 (d, J=3.8 Hz, 1H), 7.41 (d, J=9.0 Hz, 1H).


N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (42 mg, 0.22 mmol), 1-hydroxybenzotriazole (30 mg, 0.22 mmol), triethylamine (140 μL, 1 mmol) and morpholine (38 μL, 0.44 mmol) were added to a solution of 20-1 (54 mg, 0.2 mmol) in 2 mL THF at room temperature. After 2 h, 2 mL 2N hydrochloric acid was added, and the reaction was stirred for 2 h. The mixture was evaporated to dryness, the residue dissolved in 2 mL chloroform, and extracted with water (1×1.5 mL), 1N hydrochloric acid (1×1.5 mL), water (1×1.5 mL), satd. sodium bicarbonate (1×1.5 mL), and water (1×1.5 mL). The organic phase was evaporated and the crude product was purified by column chromatography to afford 20-2 (20 mg, 0.05 mmol, 27%). 1H NMR (400 MHz, CDCl3) δ ppm 13.13 (s, 1H), 10.82 (s, 1H), 8.38 (d, J=9.0 Hz, 1H), 7.96-8.06 (m, 2H), 7.86 (dd, J=8.8, 2.0 Hz, 1H), 7.34 (d, J=3.8 Hz, 1H), 7.32 (d, J=3.8 Hz, 1H), 7.19 (d, J=9.3 Hz, 1H), 3.80-3.85 (m, 4H), 3.74-3.79 (m, 4H).


The following compounds were made by the above procedure using the corresponding aryl ester and amine, if present, and characterized by NMR.











TABLE 17





No.
CHEMISTRY
NMR







20-3


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.13 (br. s, 1H), 10.82 (s, 1H), 8.37 (d, J = 9.0 Hz, 1H), 7.97-8.05 (m, 2H), 7.86 (dd, J = 8.8, 2.0 Hz, 1H), 7.30-7.35 (m, 2H), 7.19 (d, J = 9.0 Hz, 1H), 3.78-3.88 (m, 4H), 2.45-2.55 (m, 4H), 2.35 (s, 3H).






20-4


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 13.46 (br. s, 1H), 10.95 (br. s, 1H), 10.30 (s, 1H), 7.70 (d, J = 4.0 Hz, 1H), 7.56 (d, J = 4.0 Hz, 1H), 7.47-7.55 (m, 2H), 3.95 (s, 3H).










EXAMPLE 21
Synthesis of 3-hydroxyquinoline-4-carbaldehyde



embedded image


3-hydroxyquinoline (145 mg, 1 mmol) was added to a well stirred mixture of 5 mL chloroform, water (72 μL, 4 mmol), sodium hydroxide (100 mg, 2.5 mmol) and tetrabutylammonium hydroxide (50 μL, 20% in water) at room temperature. The resulting suspension was heated to 60° C. and stirred for 3 h. Sodium hydroxide was added hourly in 100 mg portions. The reaction mixture was diluted with 5 mL chloroform, acidified to pH 6 with 10 mL 1N hydrochloric acid and extracted with chloroform (3×10 mL). The combined organic phases were dried and evaporated. The crude material was purified by column chromatography to afford 21-1 (24 mg, 0.14 mmol, 14%). 1H NMR (400 MHz, DMSO-d6) δ ppm 10.70 (s, 1H), 9.06 (s, 1H), 8.75 (d, J=6.3 Hz, 1H), 8.43 (d, J=6.0 Hz, 1H), 8.16 (d, J=8.8 Hz, 1H), 7.23 (d, J=9.3 Hz, 1H).


The following compounds were made by the above procedure and characterized by NMR.











TABLE 18





No.
CHEMISTRY
NMR







21-2


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.05 (s, 1H), 10.77 (s, 1H), 8.85 (dd, J = 4.3, 1.5 Hz, 1H), 8.68 (d, J = 8.5 Hz, 1H), 8.27 (d, J = 9.3 Hz, 1H), 7.53 (dd, J = 8.8, 4.3 Hz, 1H), 7.40 (d, J = 9.5 Hz, 1H).






21-3


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 13.15 (s, 1H), 11.25 (s, 1H), 8.90 (dd, J = 4.3, 1.8 Hz, 1H), 8.08 (dd, J = 8.0, 1.8 Hz, 1H), 7.94 (d, J = 9.3 Hz, 1H), 7.37 (dd, J = 8.3, 4.3 Hz, 1H), 7.22 (d, J = 9.3 Hz, 1H).






21-4


embedded image



1H NMR (400 MHz, DMSO- d6) δ ppm 11.72 (br. s, 1H), 11.54 (br. s, 1H), 10.68 (s, 1H), 7.49 (d, J = 9.0 Hz, 1H), 7.20 (d, J = 9.0 Hz, 1H), 6.51 (s, 1H), 2.43 (s, 3H).










EXAMPLE 22
Synthesis of 3-hydroxy-2-methylquinoline-4-carbaldehyde



embedded image


2-methyl-3-hydroxyquinoline-4-carboxylic acid (1.016 g, 5 mmol) was dissolved in 10 mL methanol. Thionyl chloride (730 μL, 10 mmol) was added at −10° C., and the mixture was heated at reflux for 20 h, with additions of 365 μL thionyl chloride (5 mmol) every 4 h. The reaction mixture was evaporated, taken up in satd. sodium bicarbonate and the mixture was extracted with ethyl acetate. The organic layer was evaporated and the crude product recrystallized from hexane to give 22a (258 mg, 1.1 mmol, 24%), ESI MS m/e 218 ([M+H]+).


Compound 22a (0.163 mg, 0.75 mmol) was dissolved in 3 mL dry THF, and a 1M solution of DIBAL in THF (3.3 mL, 3.3 mmol) was added at −10° C. After 2 h, 5 mL of a 1M potassium dihydrogen phosphate solution was added, and the mixture was extracted with chloroform to afford 22b (59 mg, 0.3 mmol, 42%) %), ESI MS m/e 191 ([M+H]+).


3-hydroxy-4-hydroxymethylquinoline, 22b, (63 mg, 0.33 mmol) was added to a suspension of manganese dioxide (86 mg, 1 mmol) in 12 mL acetone. The mixture was stirred at room temperature for 48 h, with additional portions (86 mg, 1 mmol) of manganese dioxide added at 12 h intervals. The suspension was filtered, evaporated, and the crude product was purified with column chromatography to give 22-1 (15 mg, 0.08 mmol, 24%). 1H NMR (400 MHz, CDCl3) δ ppm 12.57 (s, 1H), 10.91 (s, 1H), 8.28-8.34 (m, 1H), 8.00-8.08 (m, 1H), 7.58-7.64 (m, 2H), 2.73 (s, 3H).


EXAMPLE 23
Synthesis of ethyl 2-(2-hydroxy-3-methoxy-5-(thiophen-2-yl)phenyl)thiazolidine-4-carboxylate



embedded image


Compound 11-28 (120 mg, 0.5 mmol), L-cysteine ethyl ester hydrochloride (90 mg, 0.5 mmol) and diisopropylethylamine (85 μL, 0.5 mmol) were dissolved in 3 mL ethanol and stirred at room temperature for 1 h. The mixture was filtered to give 23-1 as a yellow solid (147 mg, 0.4 mmol, 80%). 1H NMR (400 MHz, DMSO-d6, stereoisomers) δ ppm 9.43 (s, 0.4H), 9.26 (s, 0.6H), 7.44 (dd, J=5.0, 1.0 Hz, 0.4H), 7.42 (dd, J=5.0, 1.0 Hz, 0.6H), 7.39 (dd, J=3.5, 1.3 Hz, 0.4H), 7.37 (dd, J=3.5, 1.3 Hz, 0.6H), 7.30 (d, J=2.0 Hz, 0.4H), 7.24 (d, J=2.0 Hz, 0.6H), 7.15 (d, J=2.0 Hz, 0.4H), 7.11 (d, J=2.0 Hz, 0.6H), 7.07-7.10 (m, 1H), 5.87 (d, J=11.5 Hz, 0.6), 5.72 (d, J=11.5 Hz, 0.4), 4.32-4.39 (m, 0.6H), 4.19 (qd, J=2.0, 7.0 Hz, 0.4H), 4.17 (q, J=7.0 Hz, 0.6H), 3.92-4.01 (m, 0.6+0.4H), 3.87 (s, 1.2H), 3.87 (s, 1.8H), 3.76 (t, J=11.3), 3.33 (m, 0.4H, overlapped), 3.26 (dd, J=7.0, 10.3 Hz, 0.6H), 3.08 (dd, J=4.8, 10.3 Hz, 0.6H), 3.04 (dd, J=8.8, 10.0 Hz, 0.4H), 1.24 (t, J=7.0 Hz, 1.2H), 1.23 (t, J=7.0 Hz, 1.8H).


The following compounds were made by the above procedure and characterized by NMR.











TABLE 19





No.
CHEMISTRY
NMR







23-2


embedded image



1H NMR (400 MHz, DMSO-d6, stereoisomers) δ ppm 9.47 (s, 0.4H), 9.31 (s, 0.6H), 7.25 (s, 0.4H), 7.11 (s, 0.6H), 7.06 (s, 0.4H), 7.02 (s, 0.6H), 5.82 (d, J = 9.3 Hz, 0.6H), 5.67 (d, J = 11.3 Hz, 0.4H), 4.23- 4.30 (m, 0.6H), 4.11- 4.21 (m, 2H), 3.86-4.01 (m, 0.6 + 0.4H), 3.80 (br.s, 3H), 3.71 (t, J = 11.3 Hz, 0.4H), 3.28- 3.31 (m, 0.4 H, overlapped), 3.18- 3.25 (m, 0.6H), 2.98-3.06 (m, 1H), 1.16-1.32 (m, 3H).






23-3


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 9.39 (br. s, 1H), 7.11 (d, J = 2.0 Hz, 1H), 7.00 (d, J = 2.3 Hz, 1H), 5.65 (s, 1H), 3.79 (s, 3H), 2.99-3.17 (m, 1H), 2.83-2.97 (m, 3H).






23-4


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 10.50 (br. s, 1H), 7.58 (d, J = 8.3 Hz, 1H), 6.77 (d, J = 8.5 Hz, 1H), 6.00 (s, 1H), 3.93- 4.05 (m, 1H), 3.42-3.52 (m, 1H), 3.36 (ddd, J = 18.7, 10.0, 6.9 Hz, 2H).






23-5


embedded image



1H NMR (400 MHz, DMSO-d6, stereoisomers) δ ppm 11.8 (br. s, 1H), 7.64 (d, J = 8.3 Hz, 0.6H), 7.61 (d, J = 8.5 Hz, 0.4H), 7.02 (d, J = 8.5 Hz, 0.6H), 6.95 (d, J = 8.5 Hz, 0.4H), 6.17 (s, 0.4H), 6.05 (s, 0.6H), 5.01 (dd, J = 6.4, 2.6 Hz, 0.4H), 4.23 (t, J = 7.5 Hz, 0.6H), 3.43-3.57 (m, 1.2H), 3.18 (t, J = 9.5 Hz, 0.8H).






23-6


embedded image



1H NMR (400 MHz, CDCl3, stereoisomers) δ ppm 7.08 (s, 0.3H), 7.03 (s, 0.7H), 6.24 (s, 0.7H), 6.20 (s, 0.3H), 4.06-4.10 (m, 0.3 H, overlapped), 4.46 (dd, J = 6.1, 3.1 Hz, 0.7H), 4.24-4.33 (m, 2H), 3.99-4.10 (m, 2H), 3.49 (dd, J = 11.3, 6.0 Hz, 0.7H), 3.41 (td, J = 6.5, 1.0 Hz, 0.3H), 3.38 (dd, J = 11.3, 3.0 Hz, 0.7H), 3.26 (td, J = 9.5, 1.0 Hz, 0.3H), 1.45 (t, J = 6.9 Hz, 0.9H), 1.46 (t, J = 6.9 Hz, 2.1H), 1.32 (t, J = 7.0 Hz, 0.9H), 1.33 (t, J = 7.0 Hz, 2.1H).






23-7


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 9.43 (br. s, 1H), 7.42 (dd, J = 5.1, 1.1 Hz, 1H), 7.35 (dd, J = 3.5, 1.3 Hz, 1H), 7.23 (d, J = 1.8 Hz, 1H), 7.08 (d, J = 3.5 Hz, 1H), 7.09 (t, J = 3.0 Hz, 1H), 5.70 (s, 1H), 3.86 (s, 3H), 3.35- 3.42 (m, 1H), 2.98- 3.11 (m, 1H), 2.88- 2.96 (m, 2H).






23-8


embedded image



1H NMR (400 MHz, DMSO-d6, stereoisomers) δ ppm 9.53 (br. s, 1H), 7.43 (t, J = 5.3 Hz, 1H), 7.38 (dd, J = 14.1, 3.5 Hz, 1H), 7.28 (d, J = 2.0 Hz, 0.4H), 7.22 (d, J = 1.8 Hz, 0.6H), 7.15 (d, J = 1.8 Hz, 0.4H), 7.11 (d, J = 2.0 Hz, 0.6H), 7.07-7.10 (m, 1H), 5.88 (s, 0.6H), 5.71 (s, 0.4H), 4.25 (t, J = 5.9 Hz, 0.6H), 3.83-3.91 (m, 0.4 H, overlapped), 3.83- 3.91 (m, 3H), 3.34 (dd, J = 9.9, 6.9 Hz, 0.6H), 3.24 (dd, J = 10.3, 6.8 Hz, 0.6H), 3.05 (dd, J = 10.3, 5.3 Hz, 0.4H), 3.01 (t, J = 9.3 Hz, 0.4H).






23-9


embedded image



1H NMR (400 MHz, DMSO-d6, stereoisomers) δ ppm 12.71 (br. s, 1H), 7.23 (s, 0.6H), 7.18 (s, 0.4H), 6.13 (s, 0.4H), 5.98 (s, 0.6H), 4.54 (br. s, 0.4H), 3.93-3.99 (m, 0.6 H, overlapped), 3.94- 4.12 (m, 2H), 3.32- 3.40 (m, 1.6H), 3.07 (t, J = 9.5 Hz, 0.8H), 1.23-1.38 (m, 3H).










EXAMPLE 24
Synthesis of 2-methoxy-6-((4-methoxybenzylimino)methyl)-4-(thiophen-2-yl)phenol



embedded image


Compound 11-28 (117 mg; 0.50 mmol) and 4-methoxybenzylamine (65 μl; 0.50 mmol) were dissolved in 4 mL ethanol and stirred at room temperature for 4 h. The mixture was filtered to give 24-1 (113 mg, 0.32 mmol, 64%). 1H NMR (400 MHz, DMSO-d6) δ ppm 13.82 (br. s, 1H), 8.70 (s, 1H), 7.43 (ddd, J=14.3, 4.3, 1.3 Hz, 2H), 7.25-7.32 (m, 4H), 7.10 (dd, J=5.1, 3.6 Hz, 1H), 6.92-6.97 (m, 2H), 4.75 (s, 2H), 3.84 (s, 3H), 3.75 (s, 3H).


The following compounds were made by the above procedure and characterized by NMR.











TABLE 20





No.
CHEMISTRY
NMR







24-2


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 13.63 (br. s, 2H), 8.62 (s, 2H), 7.42 (ddd, J = 16.7, 4.3, 1.1 Hz, 4H), 7.29 (d, J = 2.3 Hz, 2H), 7.25 (d, J = 2.3 Hz, 2H), 7.09 (dd, J = 5.0, 3.5 Hz, 2H), 3.92 (t, J = 6.4 Hz, 4H), 3.85 (s, 6H), 3.11 (t, J = 6.4 Hz, 4H).






24-3


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 12.89 (br. s, 1H), 8.75 (s, 1H), 7.46 (dd, J = 5.1, 1.1 Hz, 1H), 7.42 (dd, J = 3.6, 1.1 Hz, 1H), 7.29 (d, J = 2.0 Hz, 1H), 7.26 (d, J = 2.0 Hz, 1H), 7.10 (dd, J = 5.1, 3.6 Hz, 1H), 3.86 (s, 3H), 3.15 (tt, J = 6.9, 3.4 Hz, 1H), 0.97-1.06 (m, 2H), 0.85-0.90 (m, 2H).






24-4


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 13.96 (br. s, 1H), 8.53 (s, 1H), 7.42 (dd, J = 5.1, 1.1 Hz, 1H), 7.38 (dd, J = 3.5, 1.1 Hz, 1H), 7.27 (d, J = 2.3 Hz, 1H), 7.21 (d, J = 2.0 Hz, 1H), 7.09 (dd, J = 5.0, 3.5 Hz, 1H), 4.84 (br. s, 1H), 3.84 (s, 3H), 3.66 (s, 4H).






24-5


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 11.07 (br. s, 1H), 9.57 (s, 1H), 7.75 (d, J = 1.8 Hz, 1H), 7.50 (dd, J = 7.4, 1.6 Hz, 2H), 7.52 (br. s, 1H), 7.14 (t, J = 4.5 Hz, 1H), 3.96 (s, 3H).






24-6


embedded image



1H NMR (400 MHz, DMSO-d6) δ ppm 13.20 (br. s, 1H), 9.54 (s, 1H), 8.55 (d, J = 3.5 Hz, 1H), 7.94 (td, J = 7.7, 1.8 Hz, 1H), 7.66 (d, J = 2.0 Hz, 1H), 7.46-7.52 (m, 3H), 7.34-7.42 (m, 2H), 7.12 (t, J = 4.0 Hz, 1H), 3.92 (s, 3H).










EXAMPLE 25
Synthesis of 3-hydroxy-4-(morpholinomethyl)-2-naphthaldehyde



embedded image


3-hydroxy-2-naphthaldehyde (20 mg, 0.12 mmol), morpholine (63 μL, 0.72 mmol), and formaldehyde (37 μL, 37% in water) were dissolved in 2 mL acetic acid. After evaporation the solid residue was partitioned between chloroform and saturated sodium bicarbonate solution. The organic layer was washed with water and dried over sodium sulfate. The solvent was removed and the solid residue was recrystallized from diisopropyl ether to give 25-1 (18 mg, 0.07 mmol, 55%). 1H NMR (400 MHz, CDCl3) δ ppm 11.79 (br. s, 1H), 10.41 (s, 1H), 8.22 (s, 1H), 7.96 (d, J=8.8 Hz, 1H), 7.87 (d, J=8.3 Hz, 1H), 7.57 (ddd, J=8.5, 7.0, 1.4 Hz, 1H), 7.36 (td, J=7.5, 1.0 Hz, 1H), 4.11 (s, 2H), 3.76 (t, J=4.5 Hz, 4H), 2.66 (t, J=4.5 Hz, 4H).


The following compounds were made by the above procedure and characterized by NMR.











TABLE 21





No.
CHEMISTRY
NMR







25-2


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 8.25 (s, 1H), 7.85 (d, J = 8.3 Hz, 1H), 7.80 (d, J = 8.8 Hz, 1H), 7.48- 7.55 (m, 1H), 7.28-7.33 (m, 1H), 4.13 (s, 2H), 2.63 (br. s, 4H), 1.65- 1.75 (m, 4H), 1.55 (br. s, 2H).






25-3


embedded image



1H NMR (400 MHz, CDCl3) δ ppm 10.52 (s, 1H), 8.25 (s, 1H), 7.87 (d, J = 9.5 Hz, 2H), 7.52-7.57 (m, 1H), 7.30-7.36 (m, 1H), 4.15 (s, 2H), 2.73 (br. s, 4H), 2.53 (br. s, 4H), 2.33 (s, 4H).










EXAMPLE 26
Activities of Compounds

Results of IC50 and EC50 assays are shown in Tables 26-42.











TABLE 26






IC50_avg
EC50_avg


compound
(nM)
(nM)



















embedded image


104
70000







embedded image


772
30000







embedded image


>20000
80000







embedded image


147
80000







embedded image


163
80000







embedded image


149
30000







embedded image


743
50000







embedded image


168
80000







embedded image


97
30000







embedded image


346
70000







embedded image


932
70000







embedded image


305
80000







embedded image


333
70000







embedded image


100
50000







embedded image


74
30000







embedded image


2369
80000







embedded image


82
80000







embedded image


994
80000







embedded image


190
80000







embedded image


800
80000







embedded image


46
80000







embedded image


104
50000







embedded image


754
80000







embedded image


164
50000







embedded image


310
80000







embedded image


236
80000







embedded image


535
80000


















TABLE 27






IC50_avg
EC50_avg


compound
(nM)
(nM)



















embedded image


102
70000







embedded image


143
80000







embedded image


7344
80000







embedded image


80
30000







embedded image


22
30000







embedded image


170
80000







embedded image


39
30000







embedded image


331
80000







embedded image


1112
80000







embedded image


34
70000







embedded image


42
70000







embedded image


351
30000







embedded image


401
50000







embedded image


3906
50000







embedded image


1472
70000







embedded image


199
30000







embedded image


699
70000







embedded image


1011
80000







embedded image


3059
80000







embedded image


1797
80000







embedded image


381
80000







embedded image


74
80000







embedded image


>20000
80000







embedded image


4503
80000







embedded image


441
80000







embedded image


114
80000







embedded image


51
30000







embedded image


223
80000







embedded image


81
80000







embedded image


420
80000







embedded image


88
80000







embedded image


1622
80000







embedded image


704
70000







embedded image


141
80000







embedded image


461
50000







embedded image


82
80000







embedded image


413
80000







embedded image


162
80000







embedded image


795
80000







embedded image


173
80000







embedded image


379
80000







embedded image


46
80000







embedded image


235
80000







embedded image


1202
80000







embedded image


2795
80000







embedded image


410
80000







embedded image


348
80000







embedded image


540
80000







embedded image


3670
80000







embedded image


3309
80000







embedded image


192
80000







embedded image


736
80000







embedded image


4784
80000







embedded image


1711
80000







embedded image


230
80000







embedded image


131
30000







embedded image


213
80000







embedded image


471
50000







embedded image


495
60000







embedded image


197
50000







embedded image


147
50000







embedded image


132
80000







embedded image


21
60000







embedded image


32
80000







embedded image


54
80000







embedded image


1242
80000







embedded image


101
80000







embedded image


371
80000







embedded image


351
30000







embedded image


20111
80000







embedded image


223
80000







embedded image


367
30000







embedded image


214
60000







embedded image


85
60000







embedded image


633
60000







embedded image


421
3000







embedded image


420
60000







embedded image


657
60000







embedded image


398
50000







embedded image


172
no







embedded image


79
80000







embedded image


455
80000







embedded image


10000
80000







embedded image


800
30000

















TABLE 28






IC50_avg


compound
(nM)









embedded image


1940







embedded image


 491







embedded image


 158







embedded image


 100







embedded image


 106







embedded image


 253







embedded image


 84







embedded image


 66







embedded image


 40







embedded image


 19







embedded image


 396







embedded image


 94







embedded image


  6







embedded image


 645







embedded image


 389







embedded image


 393


















TABLE 29





compound
IC50_avg (nM)
EC50_avg (nM)









embedded image


 5665
 10000







embedded image


  23
 5000







embedded image


  66
 4000







embedded image


  74
 5000







embedded image


  79
 10000







embedded image


  36
 3000







embedded image


 4202
 7000







embedded image


 2016
 10000







embedded image


 8737
 30000







embedded image


 9371
 20000







embedded image


 12122
 15000







embedded image


 6277
 30000







embedded image


>20000
 50000







embedded image


>20000
>80000







embedded image


>20000
>80000







embedded image


>20000
no







embedded image


  878
 10000







embedded image


  26
 1000







embedded image


  125
 3000







embedded image


  594
 30000







embedded image


>20000
 50000



















TABLE 30







compound
IC50_avg (nM)











embedded image


5616


















TABLE 31






IC50_avg


compound
(nM)









embedded image


15564







embedded image


 125


















TABLE 32





compound
IC50_avg (nM)
EC50_avg (nM)



















embedded image


1345
50000







embedded image


157
50000







embedded image


2806
50000







embedded image


3
5000







embedded image


3797
30000







embedded image


47
50000







embedded image


645
60000







embedded image


67
60000







embedded image


48
60000







embedded image


389
60000







embedded image


157
60000







embedded image


5
60000







embedded image


15564
80000







embedded image


125
10000

















TABLE 33






IC50_avg


compound
(nM)









embedded image


151







embedded image


157







embedded image


 5




















TABLE 34







compound
IC50_avg (nM)
EC50_avg (nM)











embedded image


 170
 7000









embedded image


 45
60000









embedded image


1240
10000



















TABLE 35





compound
IC50_avg (nM)
EC50_avg (nM)









embedded image


427
 20000







embedded image


915
>80000


















TABLE 36






IC50_avg
EC50_avg


compound
(nM)
(nM)









embedded image


8796
>80000







embedded image


17662
>80000







embedded image


4146
>80000







embedded image


>20000
>80000







embedded image


>20000
>80000







embedded image


>20000
>80000







embedded image


>20000
>80000







embedded image


>20000
>80000







embedded image


>20000
>80000







embedded image


>20000
>80000


















TABLE 37






IC50_avg
EC50_avg


compound
(nM)
(nM)









embedded image


155
>80000







embedded image


303
 70000







embedded image


799
>80000


















TABLE 38





compound
IC50_avg (nM)
EC50_avg (nM)









embedded image


 2117
50000







embedded image


  221
50000







embedded image


  110
50000







embedded image


 1348
50000







embedded image


  34
50000







embedded image


  23
50000







embedded image


  15
30000







embedded image


 9523
ND







embedded image


>20000
ND







embedded image


  587
75000







embedded image


  157
70000







embedded image


  154
80000







embedded image


  641
80000







embedded image


>20000
ND







embedded image


>20000
30000







embedded image


>20000
ND







embedded image


>20000
ND


















TABLE 39





compound
IC50_avg (nM)
EC50_avg (nM)









embedded image


 1523
80000







embedded image


11375
70000







embedded image


12217
no



















TABLE 40







compound
IC50_avg (nM)











embedded image


 47









embedded image


526



















TABLE 41






IC50_avg
EC50_avg


compound
(nM)
(nM)



















embedded image


108
60000







embedded image


221
>80000







embedded image


1581
50000







embedded image


128
30000


















TABLE 42





compound
IC50_avg (nM)
EC50_avg (nM)



















embedded image


102








embedded image


19








embedded image


509
10000







embedded image


36
3000







embedded image


125








embedded image


48








embedded image


15564








embedded image


157








embedded image


45
60000







embedded image


427
20000







embedded image


36370
50000







embedded image


22
19365







embedded image


>20000








embedded image


303








embedded image


1348
50000







embedded image


1523
80000







embedded image


526








embedded image


1581
50000









EXAMPLE 27
Optimization Assay Strategy

A series of in vitro ADME assays (Absorption-Distribution-Metabolism-Excretion assays, testing properties such as plasma stability, liver microsome stability, solubility, CaCo2 permeability) are used to optimize IRE-1α inhibitor compounds for pharmacological characteristics. The strategy is executed in a sequential pattern of assays in stages depending on the activity of compound analogs. In early stage optimization, in vitro potency, cellular on-target XBP-1 mRNA splicing, apoptosis Caspase 3 and 7, and proteasome inhibitor potentiation assays are employed with a set of compound characteristics assays: solubility, serum stability, and log P. Activity assays are used together with assays for pharmacological characteristics, such as serum protein binding, membrane permeability, cellular permeability, and microsome stability. Finally, in vitro toxicology and pharmacokinetic assays are employed, such as P450, AMES, hERG, and receptor profiling assays.


EXAMPLE 28
Animal Model/Preclinical Validation Studies

The preclinical validation strategy employs a set of animal models representing normal tissues under chemical stress and multiple myeloma xenographs. The normal animal model is employed as a surrogate model where dose-related on-target activity of compounds can be confirmed in tissues sensitive to standard UPR inducing agents such as tunicamycin (Wu et al., Dev Cell. 2007 September; 13 (3):351-64). As demonstrated in FIG. 8, normal mouse tissues are not under ER stress, and therefore the XBP-1 mRNA remains as the inactive, unspliced form. Upon induction with tunicamycin, tissues induce active XBP-1 mRNA splicing, and this activity is suppressed by IRE-1α inhibitors. This on-target ER stress animal model is a useful screening and early pharmacokinetic tool.


Antibody production is evaluated in a second surrogate model. However, in cell-based models, IRE-1α inhibitors have been shown to potently inhibit antibody production.


Final efficacy studies are performed in myeloma xenograft models, as described below.


EXAMPLE 29
RPMI8226 Xenograft Efficacy Model

SCID mice are evaluated for their ability to support implantation of desired tumor cells in support of model development and characterization. Mice are injected intravenously (IV) or implanted either subcutaneously (SC) or intraperitoneally (IP). To generate a relevant animal model mimicking human disease, it is desirable that all three approaches are evaluated for improved implantation rates and relevant disease progression, as is well known in the art. SC injections provide an easy way to measure tumor growth and efficacy, and IV and IP injections represent a more physiologically relevant model of human tumor spread. SC injections are given primarily in the flank, while IV injections are administered in the tail vein. Mice are manually restrained for SC and IP injections, and a Broome mouse restrainer is used for IV injections.


EXAMPLE 30
Evaluation of IRE-1α Inhibitor Compounds in a Xenograft Efficacy Model

SCID mice are implanted with tumor cells (human RPMI8226 myeloma cells) via IP, IV or SC routes based on the results from the xenograft model development studies (above). Mice are treated with compound or mock treated (vehicle) for a period of up to 4-5 weeks. Compound administration can be via IV, IP, PO or SC routes. In some cases, tunicamycin is administered via IP injection in order to stimulate stress in the animal. This stress mimics the stress an animal may undergo during times of tumor growth. The tunicaymycin injection mimics tumor growth during times of stress and permits evaluation of biomarkers which indicate the effectiveness of a compound (such as XBP-1 splicing) by RT-PCR, immunohistochemistry, or Western blots.


Mice are monitored for tumor growth, regression and general health. Tumors are collected and characterized by immunohistochemistry and/or FACS analysis. Tumor growth is measured by calipers, ultrasound, or by abdominal lavage. Biomarkers in the blood or tumor can evaluated (primarily XBP-1 splicing).


In some experiments, blood samples are collected at various time points during the dosing (i.e., day 1 or week 4 etc.) to evaluate the pharmacokinetic profile. The time points of blood collection vary depending on the pharmacokinetic properties of the drug being tested. The volume of blood sample is 100 microliters/per time point, and mice are bled twice after drug administration within a 24 hour period via retro-orbital sinus. If the same mouse is used, blood samples are collected once from each eye during 24 hours.


Tumor cells are cultured and injected IP, IV (tail vein) or SC (flank) in the mouse using a 21G needle in a volume of approx 100 μL. Mice are treated with compounds or vehicle alone as a control by IV, IP, SC or PO routes 5 days per week for up to 4-5 weeks. Blood is collected via retroorbital bleed (100 μl) at 2 time points (different eyes). The endpoint of the study depends on the overall health of the mice: while mice are euthanized at the end of 4-5 weeks in most studies, mice are maintained until day 40 in a few studies if their general health will allow. The reason for maintaining studies for 40 days is to determine if the tested compounds have a long term effect on inhibiting tumor growth. Euthanization of mice in which tumor regression is observed will depend on the experimental design. In screening mode, the experiment will end with tumors in the control/untreated group reach 1.5 cm, are ulcerated or when loss of motility is observed in that group. In follow up experiments, mice in which tumor regression is observed may be maintained longer, until they show signs of tumor growth of ill health.


Therapeutic dosing with bortezomib 0.75 mg/kg IV twice weekly of SCID mice bearing human myeloma RPMI8226 tumor xenografts resulted in suppression of tumor growth. However, after cessation of bortezomib therapy, tumors often recurred and grew into large masses. Therefore, mice will be treated in combination as with both bortezomib (as indicated) and twice daily with 10-60 mg/kg IRE-1α/XBP-1 inhibitors such as compound 17-1 by oral, IP or IV administration. Compounds which reduce the incidence of tumor recurrence are identified.


EXAMPLE 31
Combination Therapies

The spliced form of XBP-1, as a homodimer and heterodimer with ATF-6, transcriptionally regulates genes involved in adapting to ER stress (Wu et al., Dev Cell. 2007 September; 13 (3):351-64). Many of these downstream targets are major chaperones, co-chaperones and ERAD components of the ER. Chaperones such as GRP78 and GRP94 are stable and long lived proteins with half lives on the order of days (Wu et al., Dev Cell. 2007 September; 13 (3):351-64). Therefore, treatment of cancer with an IRE-1α/XBP-1 inhibitor may require up to 5 to 6 days of treatment in each cycle.


In some embodiments, combination therapy given in cycles such as with proteasome inhibitors involves giving the patient 2 days of pretreatment with IRE-1α/XBP-1 inhibitor and then simultaneously with the chemotherapeutic agent until a pharmacodynamic effect is achieved (typically 24 hours post bortezomib infusion). Bortezomib is typically administered on three week cycles, every 1, 4, 8 and 11 days (of 21). Dosing is 1.3 mg/m2 by IV administration. IRE-1α/XBP-1 inhibitors can be administered 2 day prior and 24 hours post infusion of bortezomib at 10 to 100 mg/kg by the IV or oral route once, twice or three times daily depending on the PK/PD relationship.


A similar protocol can be employed with Hsp90 and or HDAC inhibitors. Alternatively, both agents are administered simultaneously for the duration of each cycle depending on the PK/PD relation of the inhibitor. IRE-1α/XBP-1 inhibitors can be given to breast cancer patients in combination with Tamoxifen (Gomez et al., FASEB J. 2007 December; 21 (14):4013-27) or in combination with Sorafinib to various other cancers including kidney carcinoma and hepatocellular carcinoma (Rahmani et al., Mol Cell Biol. 2007 August; 27 (15):5499-513).


In general, because many kinase inhibitors often are not selective on their targeted kinase and often affect many additional kinases; they may cause non-specific cellular stress which may activate the UPR. Therefore, combination approaches may be useful using IRE-1α/XBP-1 inhibitors as sensitizing agents.

Claims
  • 1. A compound or a pharmaceutically acceptable salt thereof, wherein the compound is represented by structural formula (E):
  • 2. A compound or a pharmaceutically acceptable salt thereof, wherein the compound is represented by structural formula (X):
  • 3. The compound of claim 2 or the pharmaceutically acceptable salt thereof, wherein the compound is represented by the structural formula:
  • 4. The compound of claim 2 or the pharmaceutically acceptable salt thereof, wherein the compound is represented by the structural formula:
  • 5. The compound of claim 2 or the pharmaceutically acceptable salt thereof, wherein the compound is represented by the structural formula:
  • 6. The compound of claim 2 or the pharmaceutically acceptable salt thereof, wherein the compound is represented by the structural formula:
  • 7. A pharmaceutical composition comprising: a compound of claim 1 or a pharmaceutically acceptable salt thereof; anda pharmaceutically acceptable carrier.
  • 8. A method of inhibiting IRE-1α activity, comprising administering to a subject a compound of claim 2 or a pharmaceutically acceptable salt of the compound.
  • 9. A method of inhibiting IRE-1α activity, comprising administering to a subject a compound of claim 1.
  • 10. The method of claim 8, wherein the compound is represented by the structural formula:
  • 11. The method of claim 8, wherein the compound is represented by the structural formula:
  • 12. The method of claim 8, wherein the compound is represented by the structural formula:
  • 13. The method of claim 8, wherein the compound is represented by the structural formula:
  • 14. The method of claim 8 wherein cells of the subject have an activated unfolded protein response.
  • 15. The method of claim 8, wherein the subject has cancer.
  • 16. The method of claim 15, wherein the cancer is myeloma.
  • 17. The method of claim 8, further comprising administering to the subject an agent that induces or up-regulates IRE-1α expression.
  • 18. The method of claim 8, further comprising administering to the subject a biotherapeutic agent, a chemotherapeutic agent, radiation, or a proteasome inhibitor.
  • 19. The compound of claim 4 or the pharmaceutically acceptable salt thereof, wherein R1, R3 and R4 are hydrogen, R2 is a five-membered heterocycle substituted with
  • 20. The compound of claim 19 or the pharmaceutically acceptable salt thereof, wherein R2 is thiophene.
  • 21. The compound of claim 20 or the pharmaceutically acceptable salt thereof, wherein the substituted aryl is phenyl, substituted with —ORd, wherein Rd is C1-C6 alkyl.
  • 22. The compound of claim 21 or the pharmaceutically acceptable salt thereof, wherein Rd is methyl.
  • 23. The compound of claim 2, wherein Rx, Ry, and Rz are present or absent and are independently selected from hydrogen, aryl, heterocyclic, -A″Ra, —OH, —OA″Ra, —NH2, —NHA″Ra, —N(A″Ra)(A′″Rb), —NHCOA″Ra, —NHCOOA″Ra, —NHCONH2, —NHCONHA″Ra, —NHCON(A″Ra)(A′″Rb), halogen, and
  • 24. The compound of claim 2, wherein Rg is hydrogen, —NH2, —NHA, —NAA′, —NCOA, or optionally substituted aryl.
  • 25. The compound of claim 23, wherein Rg is hydrogen, —NH2, —NHA, —NAA′, —NCOA, or optionally substituted aryl.
  • 26. The compound of claim 2, wherein the heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by oxygen, halogen, Rf, —ORd, —N(Rd)2, —NRdCORe, —NRdCON(Re)2, or —NRfSO2Re.
  • 27. The compound of claim 23, wherein the heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by oxygen, halogen, Rf, —ORd, —N(Rd)2, —NRdCORe, —NRdCON(Re)2, or —NRfSO2Re.
  • 28. The compound of claim 24, wherein the heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by oxygen, halogen, Rf, —ORd, —N(Rd)2, —NRdCORe, —NRdCON(Re)2, or —NRfSO2Re.
  • 29. A pharmaceutical composition, comprising: a compound of claim 1 or a pharmaceutically acceptable salt thereof; anda pharmaceutically acceptable carrier.
  • 30. The pharmaceutical composition of claim 7, wherein the compound is represented by the structural formula:
  • 31. The pharmaceutical composition of claim 7, wherein the compound is represented by the structural formula:
  • 32. The pharmaceutical composition of claim 7, wherein the compound is represented by the structural formula:
  • 33. The pharmaceutical composition of claim 7, wherein the compound is represented by the structural formula:
  • 34. The pharmaceutical composition of claim 31, wherein R1, R3 and R4 are hydrogen, R2 is a five-membered heterocycle substituted with
  • 35. The pharmaceutical composition of claim 34 or the pharmaceutically acceptable salt thereof, wherein R2 is thiophene.
  • 36. The pharmaceutical composition of claim 35 or the pharmaceutically acceptable salt thereof, wherein the substituted aryl is phenyl, substituted with —ORd, wherein Rd is C1-C6 alkyl.
  • 37. The pharmaceutical composition of claim 36 or the pharmaceutically acceptable salt thereof, wherein Rd is methyl.
  • 38. The pharmaceutical composition of claim 7, wherein Rx, Ry, and Rz are present or absent and are independently selected from hydrogen, aryl, heterocyclic, -A″Ra, —OH, —OA″Ra, —NH2, —NHA″Ra, —N(A″Ra)(A′″Rb), —NHCOA″Ra, —NHCOOA″Ra, —NHCONH2, —NHCONHA″Ra, —NHCON(A″Ra)(A′″Rb), halogen, and
  • 39. The pharmaceutical composition of claim 7, wherein Rg is hydrogen, —NH2, —NHA, —NAA′, —NCOA, or optionally substituted aryl.
  • 40. The pharmaceutical composition of claim 38, wherein Rg is hydrogen, —NH2, —NHA, —NAA′, —NCOA, or optionally substituted aryl.
  • 41. The pharmaceutical composition of claim 7, wherein the heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by oxygen, halogen, Rf, —ORd, —N(Rd)2, NRdCORe, —NRdCON(Re)2, or —NRfSO2Re.
  • 42. The compound of claim 38, wherein the heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by oxygen, halogen, Rf, —ORd, —N(Rd)2, —NRdCORe, —NRdCON(Re)2, or —NRfSO2Re.
  • 43. The pharmaceutical composition of claim 39, wherein the heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by oxygen, halogen, Rf, —ORd, —N(Rd)2, NRdCORe, —NRdCON(Re)2, or —NRfSO2Re.
  • 44. The method of claim 11, wherein R1, R3 and R4 are hydrogen, R2 is a five-membered heterocycle substituted with
  • 45. The method of claim 44, wherein R2 is thiophene.
  • 46. The method of claim 45, wherein the substituted aryl is phenyl, substituted with —ORd, wherein Rd is C1-C6 alkyl.
  • 47. The method of claim 46, wherein Rd is methyl.
  • 48. The method of claim 8, wherein Rx, Ry, and Rz are present or absent and are independently selected from hydrogen, aryl, heterocyclic, -A″Ra, —OH, —OA″Ra, —NH2, —NHA″Ra, —N(A″Ra)(A′″Rb), —NHCOA″Ra, —NHCOOA″Ra, —NHCONH2, —NHCONHA″Ra, —NHCON(A″Ra)(A′″Rb), halogen, and
  • 49. The method of claim 8, wherein Rg is hydrogen, —NH2, —NHA, —NAA′, —NCOA, or optionally substituted aryl.
  • 50. The method of claim 48, wherein Rg is hydrogen, —NH2, —NHA, —NAA′, —NCOA, or optionally substituted aryl.
  • 51. The method of claim 8, wherein the heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by oxygen, halogen, Rf, —ORd, —N(Rd)2, —NRdCORe, —NRdCON(Re)2, or —NRfSO2Re.
  • 52. The method of claim 48, wherein the heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by oxygen, halogen, Rf, —ORd, —N(R)2, —NRdCORe, —NRdCON(Re)2, or —NRfSO2Re.
  • 53. The method of claim 49, wherein the heterocyclic is a monocyclic or bicyclic saturated or unsaturated heterocyclic ring having 1 to 2 N, O and/or S atoms, which may be unsubstituted or monosubstituted or disubstituted by oxygen, halogen, Rf, —ORd, —N(R)2, —NRdCORe, —NRdCON(Re)2, or —NRfSO2Re.
  • 54. The method of claim 9, wherein cells of the subject have an activated unfolded protein response.
  • 55. The method of claim 9, wherein the subject has cancer.
  • 56. The method of claim 55, wherein the cancer is myeloma.
  • 57. The method of claim 9, further comprising administering to the subject an agent that induces or up-regulates IRE-1α expression.
Parent Case Info

This application is a division of Ser. No. 12/941,530 filed on Nov. 8, 2010, which is a continuation of Ser. No. 12/135,571 filed on Jun. 9, 2008, now U.S. Pat. No. 7,858,666, which claims the benefit of Ser. No. 60/942,743 filed Jun. 8, 2007. Each of these applications is incorporated herein by reference in its entirety.

US Referenced Citations (171)
Number Name Date Kind
675543 Eichengrun Jun 1901 A
2282907 Ter Horst May 1942 A
2346662 Chenicek Apr 1944 A
2649444 Barrett Aug 1953 A
2712031 Huffman Jun 1955 A
2771391 Backstahler Nov 1956 A
2778853 Schultz Jan 1957 A
3080372 Janssen Mar 1963 A
3148997 Hemwall Sep 1964 A
3151124 Huebner Sep 1964 A
3203962 Huebner Aug 1965 A
3211613 Clark Oct 1965 A
3249606 Pellegrini May 1966 A
3252996 Huebner May 1966 A
3305562 Heffe Feb 1967 A
3325521 Elslager Jun 1967 A
3357883 Pilln Dec 1967 A
3364210 Safir et al. Jan 1968 A
3417087 Campaigne Dec 1968 A
3507963 Menasse Apr 1970 A
3574837 Pacheco Apr 1971 A
3651085 Lunsford Mar 1972 A
3652770 Rohr Mar 1972 A
3681445 Ruyle et al. Aug 1972 A
3703527 Saucy Nov 1972 A
3714226 Ruyle et al. Jan 1973 A
3721741 Rohr et al. Mar 1973 A
3753983 Raabe Aug 1973 A
3806526 Carr Apr 1974 A
3816433 Hernestam Jun 1974 A
3873539 Houlihan et al. Mar 1975 A
3895030 Lafon Jul 1975 A
3912755 Booher Oct 1975 A
3931197 Carr et al. Jan 1976 A
3962459 Kathawala Jun 1976 A
3969356 Milkowski et al. Jul 1976 A
3992546 Huebner Nov 1976 A
3995047 Morita et al. Nov 1976 A
4015014 Vatne et al. Mar 1977 A
4028366 Zenitz Jun 1977 A
4054570 Huebner Oct 1977 A
4066788 Blohm et al. Jan 1978 A
4072582 Rosenberg Feb 1978 A
4119671 Bauer et al. Oct 1978 A
4145427 Langbein et al. Mar 1979 A
4148895 Lattrell et al. Apr 1979 A
4151201 Casnati et al. Apr 1979 A
4169892 Robba et al. Oct 1979 A
4176198 Nuss, Jr. et al. Nov 1979 A
4183553 Petitpierre Jan 1980 A
4219570 Inazuka et al. Aug 1980 A
4230727 Nuss, Jr. et al. Oct 1980 A
4231967 Matsuda et al. Nov 1980 A
4239759 Gante et al. Dec 1980 A
4277474 Kohda et al. Jul 1981 A
4311841 Thompson et al. Jan 1982 A
4333941 Baratz et al. Jun 1982 A
4341794 Royer et al. Jul 1982 A
4381308 Schnur Apr 1983 A
4435601 Formanek et al. Mar 1984 A
4454358 Kummer et al. Jun 1984 A
4465678 Knops et al. Aug 1984 A
4495184 Knops et al. Jan 1985 A
4507268 Kordosky et al. Mar 1985 A
4524032 Misaki et al. Jun 1985 A
4528299 Uno et al. Jul 1985 A
4544663 Manning et al. Oct 1985 A
4638009 Itho et al. Jan 1987 A
4661636 Englert et al. Apr 1987 A
4686235 Chang et al. Aug 1987 A
4695652 Seng et al. Sep 1987 A
4705795 Lafon Nov 1987 A
4755522 Lafon Jul 1988 A
4758560 Lafon Jul 1988 A
4847429 Lentz et al. Jul 1989 A
4912116 Itoh et al. Mar 1990 A
4927956 Vicari et al. May 1990 A
4997850 Kimura et al. Mar 1991 A
5025006 Dininno et al. Jun 1991 A
5025036 Carson et al. Jun 1991 A
5057535 Shiozawa et al. Oct 1991 A
5130493 Schnatterer et al. Jul 1992 A
5149858 Desmurs et al. Sep 1992 A
5198422 Clark et al. Mar 1993 A
5202355 Nakatsu Apr 1993 A
5354920 Cox et al. Oct 1994 A
5413892 Matsuura et al. May 1995 A
5420362 Lim et al. May 1995 A
5565416 Wu Oct 1996 A
5571886 Zampini Nov 1996 A
5593994 Batt et al. Jan 1997 A
5599974 Abraham et al. Feb 1997 A
5654260 Wu Aug 1997 A
5668182 Abraham et al. Sep 1997 A
5705501 DeBernardis et al. Jan 1998 A
5763496 Holland Jun 1998 A
5843966 Armour et al. Dec 1998 A
5861435 Yokoi et al. Jan 1999 A
6005009 Murad et al. Dec 1999 A
6013841 Pansegrau Jan 2000 A
6040484 Costantini et al. Mar 2000 A
6124507 Wilson et al. Sep 2000 A
6136826 Fujioka et al. Oct 2000 A
6184421 Metivier Feb 2001 B1
6214994 DeBernardis et al. Apr 2001 B1
6245936 Metivier et al. Jun 2001 B1
6251927 Lai et al. Jun 2001 B1
6288276 Dimmit et al. Sep 2001 B1
6307087 Buchwald et al. Oct 2001 B1
6329129 Yamazaki Dec 2001 B1
6340685 Mavunkel et al. Jan 2002 B1
6355661 Lai et al. Mar 2002 B1
6380229 Yoneda et al. Apr 2002 B1
6420610 Nakamura et al. Jul 2002 B1
6462064 Pfahl et al. Oct 2002 B1
6486342 Abraham et al. Nov 2002 B1
6521641 Klein et al. Feb 2003 B1
6521643 Tomishima et al. Feb 2003 B1
6528529 Brann et al. Mar 2003 B1
6605620 Kodama et al. Aug 2003 B1
6613803 Wang et al. Sep 2003 B1
6638947 Wang et al. Oct 2003 B2
6656967 Gerusz et al. Dec 2003 B2
RE38425 Dimmock et al. Feb 2004 E
6764993 Shalaev et al. Jul 2004 B2
6903239 Peilstocker et al. Jun 2005 B2
7009079 Kamitamari et al. Mar 2006 B2
7105577 Holzl et al. Sep 2006 B2
7250521 Kraatz et al. Jul 2007 B2
7858666 Patterson et al. Dec 2010 B2
8614253 Patterson et al. Dec 2013 B2
20010020100 Manning et al. Sep 2001 A1
20010049354 Shalaev et al. Dec 2001 A1
20020004618 Kamitamari et al. Jan 2002 A1
20020052003 Alberte et al. May 2002 A1
20030022923 Lai et al. Jan 2003 A1
20030100774 Gross May 2003 A1
20030114390 Washburn et al. Jun 2003 A1
20030124157 Engles et al. Jul 2003 A1
20030125528 Hay et al. Jul 2003 A1
20030157154 Fuller et al. Aug 2003 A1
20030162836 Holzl et al. Aug 2003 A1
20030187007 Cao et al. Oct 2003 A1
20030199570 Coghlan et al. Oct 2003 A1
20030229149 Baschong et al. Dec 2003 A1
20040010147 Kodama et al. Jan 2004 A1
20040034064 Kuduk et al. Feb 2004 A1
20040044041 Kuduk et al. Mar 2004 A1
20040063761 Kuduk et al. Apr 2004 A1
20040092754 Schafer et al. May 2004 A1
20040157801 Safo et al. Aug 2004 A1
20040186174 Holzl et al. Sep 2004 A1
20040223909 Montalto et al. Nov 2004 A1
20040235877 Ishizuka et al. Nov 2004 A1
20050049306 Harper et al. Mar 2005 A1
20050113567 Onishi et al. May 2005 A1
20050165025 Leonardi et al. Jul 2005 A1
20050203179 Banowski et al. Sep 2005 A1
20050209199 Safo et al. Sep 2005 A1
20050215783 Yang et al. Sep 2005 A1
20060094747 Van Zandt et al. May 2006 A1
20060194805 Bakthavatchalam et al. Aug 2006 A1
20060199806 Failli et al. Sep 2006 A1
20060246157 Kim et al. Nov 2006 A1
20060258644 Failli et al. Nov 2006 A1
20060258645 Failli et al. Nov 2006 A1
20060258672 Barbosa et al. Nov 2006 A1
20060287337 Reiss et al. Dec 2006 A1
20070140960 Siclovan et al. Jun 2007 A1
20070189967 Siclovan et al. Aug 2007 A1
20080051445 Surolia et al. Feb 2008 A1
Foreign Referenced Citations (220)
Number Date Country
209910 May 1909 DE
1989548 Jul 1968 DE
1679900 Apr 1971 DE
2142245 Mar 1973 DE
44 44 244 Jun 1996 DE
19631131 Feb 1998 DE
102005009705 Sep 2006 DE
0 033 702 Aug 1981 EP
435827 Jul 1991 EP
464900 Jan 1992 EP
467434 Jan 1992 EP
533266 Mar 1993 EP
548798 Jun 1993 EP
564333 Oct 1993 EP
599688 Jun 1994 EP
620216 Oct 1994 EP
658807 Jun 1995 EP
690046 Jan 1996 EP
702012 Mar 1996 EP
749964 Dec 1996 EP
938025 Aug 1999 EP
1085013 Mar 2001 EP
1195166 Apr 2002 EP
1233016 Aug 2002 EP
1834642 Sep 2007 EP
2745285 Aug 1997 FR
2745287 Aug 1997 FR
2756279 May 1998 FR
2768728 Mar 1999 FR
2768729 Mar 1999 FR
2857010 Jan 2005 FR
2868417 Oct 2005 FR
2874611 Mar 2006 FR
2276162 Sep 1994 GB
63243085 Oct 1988 JP
2-056469 Feb 1990 JP
2264946 Oct 1990 JP
10-045733 Feb 1998 JP
2000026438 Jan 2000 JP
2001215669 Aug 2001 JP
2001335476 Dec 2001 JP
2002275165 Sep 2002 JP
2004189599 Jul 2004 JP
2005127330 May 2005 JP
2005127335 May 2005 JP
2006135153 May 2006 JP
2006151946 Jun 2006 JP
2007084415 Apr 2007 JP
2007084454 Apr 2007 JP
2009149797 Jul 2009 JP
4331954 Sep 2009 JP
9313096 Jul 1993 WO
9321184 Oct 1993 WO
9420473 Sep 1994 WO
9425430 Nov 1994 WO
9501326 Jan 1995 WO
9501426 Jan 1995 WO
9504049 Feb 1995 WO
9506044 Mar 1995 WO
9515954 Jun 1995 WO
9517398 Jun 1995 WO
9517401 Jun 1995 WO
9522992 Aug 1995 WO
9526328 Oct 1995 WO
9529907 Nov 1995 WO
9539675 Nov 1995 WO
9532967 Dec 1995 WO
9607079 Mar 1996 WO
9611934 Apr 1996 WO
9619477 Jun 1996 WO
9621661 Jul 1996 WO
9623783 Aug 1996 WO
9630333 Oct 1996 WO
9631492 Oct 1996 WO
9631508 Oct 1996 WO
9633723 Oct 1996 WO
9705131 Feb 1997 WO
9710824 Mar 1997 WO
9711930 Apr 1997 WO
9717350 May 1997 WO
9719070 May 1997 WO
9720815 Jun 1997 WO
9734900 Sep 1997 WO
9735861 Oct 1997 WO
9735862 Oct 1997 WO
9737989 Oct 1997 WO
9748786 Dec 1997 WO
9801132 Jan 1998 WO
9804508 Feb 1998 WO
9816504 Apr 1998 WO
9845269 Oct 1998 WO
9932465 Jul 1999 WO
9966927 Dec 1999 WO
0002887 Jan 2000 WO
0015603 Mar 2000 WO
0019990 Apr 2000 WO
0021954 Apr 2000 WO
0042026 Jul 2000 WO
0059506 Oct 2000 WO
0105774 Jan 2001 WO
0107031 Feb 2001 WO
0114314 Mar 2001 WO
0116122 Mar 2001 WO
01016123 Mar 2001 WO
01027068 Apr 2001 WO
0160821 Aug 2001 WO
01056563 Aug 2001 WO
0183451 Nov 2001 WO
0198296 Dec 2001 WO
0204433 Jan 2002 WO
0210143 Feb 2002 WO
0212178 Feb 2002 WO
0224642 Mar 2002 WO
0224645 Mar 2002 WO
0224654 Mar 2002 WO
0241882 May 2002 WO
02055497 Jul 2002 WO
02057044 Jul 2002 WO
02072543 Sep 2002 WO
02083134 Oct 2002 WO
02083678 Oct 2002 WO
02083680 Oct 2002 WO
02083682 Oct 2002 WO
02089781 Nov 2002 WO
02096867 Dec 2002 WO
03002533 Jan 2003 WO
03013509 Feb 2003 WO
03020703 Mar 2003 WO
03026587 Apr 2003 WO
03033510 Apr 2003 WO
03065789 Aug 2003 WO
03066577 Aug 2003 WO
03080545 Oct 2003 WO
03086394 Oct 2003 WO
03086397 Oct 2003 WO
03086403 Oct 2003 WO
2004006922 Jan 2004 WO
2004006923 Jan 2004 WO
2004006924 Jan 2004 WO
2004024060 Mar 2004 WO
2004037816 May 2004 WO
2004050631 Jun 2004 WO
2004050637 Jun 2004 WO
2004052488 Jun 2004 WO
2004052859 Jun 2004 WO
2004056727 Jul 2004 WO
2004077885 Sep 2004 WO
2004083189 Sep 2004 WO
2004083190 Sep 2004 WO
2004084824 Oct 2004 WO
2004084890 Oct 2004 WO
2004092140 Oct 2004 WO
2004094379 Nov 2004 WO
2004094395 Nov 2004 WO
2004098582 Nov 2004 WO
2004110974 Dec 2004 WO
2005009539 Feb 2005 WO
2005009954 Feb 2005 WO
2005009993 Feb 2005 WO
2005016862 Feb 2005 WO
2005023960 Mar 2005 WO
2005026120 Mar 2005 WO
2005034953 Apr 2005 WO
2005042498 May 2005 WO
2005044007 May 2005 WO
2005053048 Jun 2005 WO
2005063222 Jul 2005 WO
2005121152 Dec 2005 WO
2006002099 Jan 2006 WO
2006008316 Jan 2006 WO
2006014413 Feb 2006 WO
2006071538 Jul 2006 WO
2006074919 Jul 2006 WO
2006084773 Aug 2006 WO
2006092430 Sep 2006 WO
2006093353 Sep 2006 WO
2006107115 Oct 2006 WO
2006122186 Nov 2006 WO
2006124780 Nov 2006 WO
2006124865 Nov 2006 WO
2006124897 Nov 2006 WO
2006135687 Dec 2006 WO
2007017143 Feb 2007 WO
2007020888 Feb 2007 WO
2007023430 Mar 2007 WO
2007027878 Mar 2007 WO
2007031507 Mar 2007 WO
2007031529 Mar 2007 WO
2007033781 Mar 2007 WO
2007034277 Mar 2007 WO
2007036701 Apr 2007 WO
2007051408 May 2007 WO
2007056155 May 2007 WO
2007062028 May 2007 WO
2007063522 Jun 2007 WO
2007063523 Jun 2007 WO
2007064773 Jun 2007 WO
2007067593 Jun 2007 WO
2007075387 Jul 2007 WO
2007077457 Jul 2007 WO
2007078523 Jul 2007 WO
2007079186 Jul 2007 WO
2007081091 Jul 2007 WO
2007082713 Jul 2007 WO
2007087066 Aug 2007 WO
2007092930 Aug 2007 WO
2007101224 Sep 2007 WO
2007115408 Oct 2007 WO
2007121389 Oct 2007 WO
2007137107 Nov 2007 WO
2008002246 Jan 2008 WO
2008007900 Jan 2008 WO
2008021927 Feb 2008 WO
2008021928 Feb 2008 WO
2008021936 Feb 2008 WO
2008022286 Feb 2008 WO
2008024963 Feb 2008 WO
2008030752 Mar 2008 WO
2008037266 Apr 2008 WO
2008042892 Apr 2008 WO
Non-Patent Literature Citations (84)
Entry
Ito N, Tamano S, Shirai T. A medium-term rat liver bioassay for rapid in vivo detection of carcinogenic potential of chemicals. Cancer Sci. Jan. 2003;94(1):3-8.
Biradar et al., “Binulear complexes of dinnethylsilane and Copper (II) salicyladoximates,” Inorganica Chimica Acta, Jan. 1983, vol. 77, No. 1, pp. 107-110.
Ei-Sonbati et al., “Stereochemistry of New Nitrogen Containing Heterocyclic Aldehyde. VII. Potentiometric, Conductometric and Thermodynamic Studies of Novel Quinoline Azodyes and Their Metal Complexes with Some Transition Metals,” Chemical and Pharmaceutical Bulletin, 2001, No. 49, vol. 10, pp. 1308-1313.
Fiedler and Kaben, “Antimykotische und antibakterielle Wirksamkeit von 8-Hydropxychinolinen und Nicotinsaureestern,” Die Pharmazie, 1966, vol. 21, No. 4, pp. 233-238; structures on p. 234.
Gupta et al., “Corylinal: A new isoflavone from seeds of Psoralea Corylipolia,” Phytochemistry, 1978, vol. 17, p. 164.
Krumbiegel, “Die Autoxydation ungesaettigter Fettsaeureester in Gegenwart von Protonen und Methanol,” Zeitschrfit fur Chemie 3, 1963, p. 27, compound I.
Lin et al., “Synthesis of alkynylated photo-luminescent Zn(II) and Mg(II) Schiff base complexes,” Dalton Transactions, 2007, vol. 7, pp. 781-791.
Morris and Nguyen, “A general route to pyridine-modified salicylaldehydes via Suzuki coupling,” Tetrahedron Letters, 2001, vol. 42, pp. 2093-2096.
Ocheskey et al., “Metalloantimalarials: synthesis and characterization of a novel agent possessing activity against Plasmodium falciparum,” Chemical Communications, 2005, vol. 12, pp. 1622-1624.
Przystal and Phillips, “7-Formyl-8-quinolinols,” Journal of Heterocyclic Chemistry, 1967, vol. 4, No. 1, pp. 131-132.
Registry (STN) Tokyo, Entered Nov. 16, 1984, RN 1927-94-2.
Registry (STN) Tokyo, Entered Nov. 16, 1984, 20035-41-0.
Registry (STN) Tokyo, Entered Nov. 16, 1984, 5274-70-4.
Registry (STN) Tokyo, Entered Nov. 16, 1984, 1829-34-1.
Registry (STN) Tokyo, Entered Nov. 16, 1984, 492-88-6.
Registry (STN) Tokyo, Entered Nov. 16, 1984, 394-50-3.
Registry (STN) Tokyo, Entered Nov. 16, 1984, 148-53-8.
Registry (STN) Tokyo, Entered Nov. 16, 1984, 90-02-8.
Ward et al., “Discovery of an Orally Bioavailable NK1 Receptor Antagonist, (2S,3S)-(2-Methoxy-5-tetrazol-1-ylbenzyl) (2-phenylpiperidin-3-yl)amine (GR203040), with Potent Antlemetic Activity,” Journal of Medicinal Chemistry, 1995, vol. 38, pp. 4985-4992.
Rodriguez et al., “Equilibrium constants and thermodynamic parameters in coordination compounds,” Boletin del Instituto de Quimica de la Universidad Nacional Autonoma de Mexico, 20, pp. 56-67, 1968 (abstract).
Supsana et al., “DMF-Catalysed Thermal Dehydration of Aldoximes: A Convenient Access to Functionalized Aliphatic and Aromatic Nitriles,” Synlett, 2007, No. 17, Oct. 1, 2007, pp. 2671-2674.
Satou et al., “Proteasorne inhibitor, bortezomib, potently inhibits the growth of adult T-cell leukemia cells both in vivo and in vitro,” Leukemia, Aug. 2004, vol. 18, No. 8, pp. 1357-1363.
Testa, “Prodrug research: futile or fertile?,” Biochem Pharmacol., Dec. 1, 2004, vol. 68, No. 11, pp. 2097-2106.
Taylor & Nobles, “Some Ketonic Mannich Bases,” J. Am. Pharmaceutical Assoc. 49, 317-19, 1960.
Tsumaki et al., “Coordinate valency rings. XXI. Some derivatives of salicylaldimine and hydrosalicylamide,” Database CA (Online) Chemical Abstracts Service, 2001, XP-002684372, Database Accession No. 28:32534, pp. 1-2.
van De Waterbeemd H, Smith DA, Beaumont K, and Walker DK, “Property-based design: optimization of drug absorption and pharmacokinetics,” Journal of Medicinal Chemistry, Apr. 2001,44(9), 1313-1333.
Volkmann et al., “Potent and selective inhibitors of the inositol-requiring enzyme 1 endoribonuclease,” J. Biol. Chem. 286, 12743-55, 2011.
Weigel et al., “The Influence of Substitutents on the Photochemical Generation and Stability of 2-Morpholinocyclopropanols,” Tetrahedron Letters 34, 6737-40, 1993.
Weigel et al., “Stereoselective Photocyclization to 2-Aminocyclopropanols by Photolysis of beta-Aminoketones and Oxidative Ring Opening to Enaminones,” Tetrahedron 53, 7855-66, 1997.
Weng et al., “Chiral N-salicylidene vanadyl carboxylate-catalyzed enantioselective aerobic oxidation of .alpha.-hydroxy esters and amides,” Proc. Natl. Acad. Sci. USA 103, 3522-27, 2006.
Wireko & Abraham, “X-ray diffraction study of the binding of the antisickling agent 12C79 to human hemoglobin,” Proc. Natl. Acad. Sci. USA 88, 2209-11, 1991.
Wissner et al., “Synthesis and Structure-Activity Relationships of 6,7-Disubstituted 4-Anilinoquinoline-3-carbonitriles. The Design of an Orally Active, Irreversible Inhibitor of the Tyrosine Kinase Activity of the Epidermal Growth Factor Receptor (EGFR) and the Human Epidermal Growth Factor Receptor-2 (HER-2),” J. Med. Chem. 46, 49-63, 2003.
Yoo et al., “Three naphthalenes from root bark of Hibiscus syriacus,” Phytochemistry, Mar. 1998, vol. 47, No. 5, pp. 799-802.
Zhang et al., “Anti-sickling effect of MX-1520, a prodrug of vanillin: an in vivo study using rodents,” Br. J. Haematol. 125, 788-95, 2004.
Acosta-Alvear et al., “XBP1 Controls Diverse Cell Type- and Condition-Specific Transcriptional Regulatory Networks,” Mol. Cell. 6, 53-66, 2007.
Ashram et al., “Synthesis of Hexahomotrioxacalix[3]naphthalenes and a Study of Their Alkali-Metal Cation Binding Properties,” J. Org. Chem. 66, 1473-79, Oct. 23, 2001.
Back et al., “Cytlplasmic IRE1alpha-mediatee XBP1 mRA Splicing in the Absence of Nuclear Processing and Endoplasmic Reticulum Stress,” J. Biol. Chem. 281, 18691-706, 2006.
Baiocchi & Bonanomi, “Aromatization of aliphatic compounds. IX. Benzofuranones from (4-substituted 2-oxo-3-cyclohexen-l-yl)acetic acids,” Gazzetta Chimica Italiana 199, 441-43, 1989.
Balch et al., “Adapting Proteostasis for Disease Intervention,” Science 319, 916-18, 2008.
Baluja, “Acoustical studies of some Schiff bases in 1,4-dioxane and dimethylformamide at 318.15 K′,” Russian Journal of Physical Chemistry, vol. 80, No. 7, Jul. 1, 2006, pp. 1056-1060.
Bazarbachi et al., “New therapeutic approaches for adult T-cell leukaemia,” Lancet Oncol. 5, 664-72, 2004.
Birch et al., “N-Substituted (2,3-dihydro-1,4-benzodioxin-2-yl)methylamine Derivatives as D2 Antagonists/5-HY1A Partial Agonists with Potential as Atypical Antipsychotic Agents,” J. Med. Chem. 42, 3342-55, Jan. 1, 1999.
Brown et al., “Crystal Structures of Interleukin-2 Tyrosine Kinase and Their Implications for the Design of Selective Inhibitors,” J. Biol. Chem. 279, 18727-32, 2004.
Brown et al., “Naphthyl Ketones: A New Class of Janus Kinase 3 Inhibitors,” Bioorganic & Medicinal Chemistry Letters 10, 575-79, 2000.
Calinescu et al., “Spectral and magnetic studies on mixed-ligand complexes of Co(II) and Cu(II) with 2-hydroxy-1-naphthaldehyde dimethylhydrazone,” Database CA (Online) Chemical Abstracts Service, 2004, XP-002684376, Database Accession No. 140:263004.
Carrasco et al., “The Differentiation and Stress Response Factor XBP-1 Drives Multiple Myeloma Pathogenesis,” Cancer Cell 11, 349-60, Apr. 2007.
Chauhan et al., “A novel orally active proteasome inhibitor induces apoptosis in multiple myeloma cells with mechanisms distinct from Bortezomib,” Cancer Cell 8, 407-19, 2005.
Chawla et al, “Agents Activing on the Central Nervous System. XII. 3-t-Aminopropiophenones as Central Muscle Relaxants and Diuretics,” J. Med. Chem. 13, 480-88, 1970.
Choubal et al., “The action of hexamethylenetetramine on phenols and the methyl esters of phenolcarboxylic acids. VI. The synthesis and study of the arylamides of 1-formyl-2-hydroxy-3-naphthoic acid,” Journal of the Indian Chemical Society, 35, pp. 860-864, 1958 (abstract).
Cory & Cory, “Phenolic compounds, sodium salicylate and related compounds, as inhibitors of tumor cell growth and inducers of apoptosis in mouse leukemia L1210 cells,” In Vivo, Jan.-Feb. 2005, vol. 19, No. 1, pp. 31-35.
Crich & Grant, “Synthesis of a 4,6-Disubstituted Dibenzofuran .beta.-Sheet Initiator by Reductive Radical Arylation of Benzene,” J. Org. Chem. 70, 2384-86, 2005.
Cross et al., “The molecular basis for selective inhibition of unconventional mRNA splicing by an IRE1-binding small molecule,” Proc. Natl. Acad. Sci. USA, Apr. 10, 2012; 109(15): E869-E878, published online Feb. 6, 2012.
Cupertino et al., “Synthesis of cobalt(II) complexes of derivatised salicylaldoxime ligands; X-ray crystal structures of DMSO adducts of bis(3-nitro-5-methylsalicylaldoximato)cobalt(II) and bis(3-nitro-5-phenylsalicylaldoximato)cobalt(II),” Polyhedron, vol. 20, No. 26-27, Dec. 1, 2001, pp. 3239-3247.
Davenport et al., “Heat shock protein inhibition is associated with activation of the unfolded protein response pathway in myeloma plasma cells,” Blood 110, 2641-49, 2007.
Ding et al., “Linking of autophagy to ubiquitin-proteasome system is important for the regulation of endoplasmic reticulum stress and cell viability,” Am. J. pathol. 171, 413-24, 2007.
El-Sonbati, “Stereochemistry of Uranyl Complexes of New Heterocyclic Nitrogen Containing Aldehydes.I. Novel Relationship for 0-U-0 Frequencies Center,” Spectroscopy Letters, vol. 30, No. 3, Jan. 1, 1997, pp. 459-472.
European Search Report for Application No. 12 17 1202, dated Oct. 1, 2012.
Fiedler, “Synthesis of 8-hydroxyquinoline-7-aldehydes,”Database CA (Online) Chemical Abstracts Service, 2001, XP-002684377, Database Accession No. 60:60787, pp. 1-2.
Fitzharris et al., “The effects in volunteers of BW12C, a compound designed to left-shift the blood-oxygen saturation curve,” Br. J. Clin. Pharmac. 19, 471-81, 1985.
Ginsburg, “The Action of t-Butyl Hypochloride on Organic Compounds. II. Aromatic Aldehydes,” J. Am. Chem. Soc. 73, 702-04, 1951.
Gomez et al., “Human X-box binding protein-1 confers both estrogen independence and antiestrogen resistance in breast cancer cell lines,” FASEB J. 21, 4013-27, 2007.
Graux et al., “Cytogenetics and molecular genetics of T-cell acute lymphoblastic leukemia: from thymocytes to lymphoblast,” Leukemia 20, 1496-1510, 2006.
Grozinger et al., “Identification of a Class of Small Molecule Inhibitors of the Sirtuin Family of NAD-dependent Deacetylases by Phenotypic Screening,” J. Biol. Chem. 276, 38837-43, Aug. 1, 2001.
Hayden et al., “Type 2 Diabetes Mellitus as a Conformational Disease,” J. Pancrease (Online) 6, 287-302, 2005.
Hoyer et al., “Formation of intramolecular hydrogen bonds by hindrance of the rotation of the proton,” Chem. Abstracts 64, Dec. 31, 1966.
Iwakoshi et al., “Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-1,” Nature Immunology 4, 321-29, 2003.
Iwawaki et al., “A transgenic mouse model for monitoring endoplasmic reticulum stress,” Nat. Med. 10, 98-102, 2004 (e-pub Dec. 14, 2003) (abstract).
Jiang & Wek, “Phosphorylation of the alpha-subunit of the eukaryotic initiation factor-2 (elF2alpha) reduces protein synthesis and enhances apoptosis in response to proeasome inhibition,” J. Biol. Chem. 280, 14189-202, 2005.
Kehoe et al., “Tyrosylprotein Sulfotransferase Inhibitors Generated by Combinatorial Target-Guided Ligand Assembly.” Bioorganic & Medicinal Chemistry Letters, vol. 12, No. 3, Feb. 1, pp. 329-332.
Klemke et al., “New insights into the molecular biology and targeted therapy of cutaneous T-cell lymphomas,” JJDG 4, 395-406, 2006.
Kulkarni et al., “Synthesis and antiradiation activity of thiazolidines,” Current Science, Indian Academy of Sciences 41, 637, Sep. 5, 1972.
Lawless et al., “Activation of Endoplasmic Reticulum-Specific Stress Responses Associated with the Conformational Disease Z alpha1-Antitrypsin Deficiency,” J. Immunol. 172, 5722-26, 2004.
Lee et al., “Proteasome inhibitors disrupt the unfolded protein response in myeloma cells,” Proc. Natl. Acad. Sci. USA 100, 9946-51, 2003.
Liu et al., “The Protein Kinase/Endoribonuclease IRE1alpha That Signals the Unfolded Protein Response Has a Luminal N-terminal Ligand-independent Dimerization Domain,” J. Biol. Chem. 277, 18346-56, 2002.
Lo et al., “Heterobimetallic Zn(II)-Ln(III) Phenylene-Bridged Schiff Base Complexes, Computational Studies, and Evidence for Singlet Energy Transfer as the Main Pathway in the Sensitization of Near-Infrared Nd3+ Luminescence,” Inorganic Chemistry, vol. 45, No. 23, Nov. 13, 2006, pp. 9315-9325.
Mao et al., “Crystal Structure of Bruton's Tyrosine Kinase Domain Suggests a Novel Pathway for Activation and Provides Insights into the Molecular Basis of X-linked Agammaglobulinemia,” J. Biol. Chem. 276, 41435-43, 2001.
Marvel & Tarkoy, “Heat Stability Studies on Chelates from Schiff Bases of Salicylaldehyde Derivatives,” J. Am. Chem. Soc. 79, 6000-02, 1957.
Merrett et al., “Characterization of the binding of the anti-sickling compound, BW12C, to haemoglobin,” Biochem. J. 239, 387-92, 1986.
Nakamura et al., “Activation of the endoplasmic reticulum stress pathway is associated with survival of myeloma cells,” Leukemia & Lymphoma 47, 531-39, 2006.
Papandreou et al., “Identification of an Ire1 alpha endonuclease specific inhibitor with cytotoxic activity against human multiple myeloma,” Blood 117, 1311-14, 2011.
Pathak & Singh, “Studies in Fluorinated Mannich Bases,” Pharmazie 35, H. 7, 1980.
Pittelkow et al., “Carbocations in Action. Design, Synthesis, and Evaluation of a Highly Acid-Sensitive Naphthalene-Based Backbone Amide Linker for Solid-Phase Synthesis,” Org. Lett. 8, 5817-20, 2006.
Propper et al., “Phase II study of the oxygen saturation curve left shifting agent BW12C in combination with the hypoxia activated drug mitomycin C in advanced colorectal cancer,” Br. J. ancer 82, 1776-82, 2000.
Rahmani et al., “The kinase inhibitor sorafenib induces cell death through a process involving induction of endoplasmic reticulum stress,” Mol. Cell. Biol. 27, 5499-513, 2007.
Related Publications (1)
Number Date Country
20140080832 A1 Mar 2014 US
Provisional Applications (1)
Number Date Country
60942743 Jun 2007 US
Divisions (1)
Number Date Country
Parent 12941530 Nov 2010 US
Child 14078792 US
Continuations (1)
Number Date Country
Parent 12135571 Jun 2008 US
Child 12941530 US