Joining DNA sequences using topoisomerase I

Abstract

Restriction Independent Cloning Events (RICE) are made by generating 5′ overhangs (sticky ends). The polynucleotides to be joined are reacted with a DNA polymerase, having 3′ to 5′ exonuclease activity and 5′ to 3′ polymerizing activity, less than all of the dNTPs, a kinase (optional) and a ligase. The complementary 5′ overhangs anneal and ligate. Further disclosed is a method of joining double stranded polynucleotides that includes joining a first DNA sequence and a second DNA sequence using topoisomerase I to form a first product, joining the second DNA sequence and a third DNA sequence using topoisomerase I to form a second product, and combining the first product and the second product in PCR reaction to generate a third product.

Description

BACKGROUND OF THE INVENTION

[0002] The present invention relates to a method of joining polynucleotides by reacting polynucleotides with a DNA polymerase, a DNA ligase and optionally a polynucleotide kinase. Complementary 5′ cohesive (sticky) ends are generated and subsequently anneal and are ligated all in the same reaction vessel. The method allows for the formation of Restriction Independent Cloning Events (RICE) or Restriction Independent Cohesive Ends (RICE) by reacting sticky ended polynucleotides, i.e., Sticky RICE.

[0003] U.S. Pat. No. 5,075,227 discloses methods for cloning cDNA and producing mRNA from the cloned c-DNA. The c-DNA is cloned in one orientation by using a vector containing a directional cloning site and primer-adapter sequences complementary to portions of the directional cloning site. U.S. Pat. No. 5,075,227 describes directional sticky end cloning where sticky end (5′ overhangs) are generated by treatment of linear double stranded (ds) DNAs with T4 DNA polymerase and only one dNTP. Sticky ends of 12-15 nucleotides are disclosed as being preferred in U.S. Pat. No. 5,075,227. However, the vector polynucleotides and insert polynucleotides in the U.S. Pat. No. 5,075,227 are reacted with DNA polymerase separately and cannot be co-treated and the T4 DNA polymerase activity must be inactivated before the vector and insert polynucleotides are combined.

[0004] The present invention provides an easy and quick method for joining multiple polynucleotides in a single tube or vessel and a mechanism for directional cloning without the requirement for restriction enzymes and minimal primer modification.

SUMMARY OF THE INVENTION

[0005] In accordance with the present invention, a method of joining double stranded polynucleotides includes joining a first DNA sequence and a second DNA sequence using topoisomerase I to form a first product, then joining the second DNA sequence and a third DNA sequence using topoisomerase I to form a second product. Next, the first product and the second product are combined in PCR reaction. During the PCR reaction, the first and second products are joined to generate a third larger product that may used in, for instance, expression, cloning, gene construction, or other applications.

[0006] Preferably, the joining steps for generating the first and second products are stopped prior to the combining step.

BRIEF DESCRIPTION OF THE DRAWINGS

[0007] FIG. 1 is a photograph of a gel that has been digitally inverted such that all dark areas are light and all light areas are dark to reveal the details of the banding displayed in the gel more clearly, and shows the results of experiments as described below in Example 1A, 1B, 1C and 1D, where lane 1 in FIG. 1 is Promega 100 bp DNA molecular weight ladder, lane 2 shows Example 1A reaction, lane 3 shows Example 1B reaction, lane 4 shows Example 1C reaction and lane 5 shows Example 1D reaction.

[0008] FIG. 2 is a diagram that represents Experiment 2A, 2B, 2C and 2D and shows plasmid pUC 19 and relative locations and directions of the primers used for amplification of pUC 19 by PCR for experiments in Examples 2A-2D. In the diagram, primers are represented by the solid arrows, 5′ prime (blunt end of arrow) to 3′ prime (point of arrow). Primers Seq ID NO: 18, Seq ID NO: 22, Seq ID NO: 26, and Seq ID NO: 30 hybridize to pUC 19 at the location identified by primer B in FIG. 2. Primers Seq ID NO: 19, Seq ID NO: 23, Seq ID NO: 27, and Seq ID NO: 31 hybridize to pUC 19 at the location identified by primer A in FIG. 2.

[0009] FIG. 3 is a photograph of a gel that has been digitally inverted such that all dark areas are light and all light areas are dark to reveal the details of the banding displayed in the gel more clearly, and indicates the results of experiments as described below in Example 2 showing Sticky RICE cloning of inserts into pUC using T4 DNA ligase.

[0010] FIG. 4 is a photograph of a gel that has been digitally inverted such that all dark areas are light and all light areas are dark to reveal the details of the banding displayed in the gel more clearly. The gel indicates the results of experiments as described below with respect to Example 3 showing Sticky RICE cloning of inserts into pUC using E. coli ligase.

[0011] FIG. 5 is a photograph of a gel that has been digitally inverted such that all dark areas are light and all light areas are dark to reveal the details of the banding displayed in the gel more clearly. FIG. 5 indicates the experimental results corresponding to Example 4 showing Sticky RICE cloning of GFP PCR product into SapI digested vector DNA--pLSB 1176.

[0012] FIG. 6 is a photograph of a gel that has been digitally inverted such that all dark areas are light and all light areas are dark to reveal the details of the banding displayed in the gel more clearly. The results indicated in FIG. 6 are explained in greater detail below in Example 5.

[0013] FIG. 7 is a photograph of a gel that has been digitally inverted such that all dark areas are light and all light areas are dark to reveal the details of the banding displayed in the gel more clearly. The results indicated in FIG. 7 are explained in greater detail below in Example 6.

[0014] FIG. 8A is a photograph of a gel that has been digitally inverted such that all dark areas are light and all light areas are dark to reveal the details of the banding displayed in the gel more clearly. FIG. 8 indicates results of directional joining of a 225 and 725 bp PCR product sharing a 3 bp overlap as described below in Example 7.

[0015] FIG. 8B is a flowchart showing the basic steps described in Example 7.

[0016] FIG. 9A is a photograph of a gel that has been digitally inverted such that all dark areas are light and all light areas are dark to reveal the details of the banding displayed in the gel more clearly. FIG. 9A indicates the results of Example 8, described in greater detail below.

[0017] FIG. 9B is a flowchart showing the basic steps described in Example 8.

[0018] FIG. 10A is a flowchart showing other embodiments of the methods for joining DNA fragments in accordance with the present invention.

[0019] FIG. 10B is a flowchart showing yet another embodiment of the methods for joining DNA fragments in accordance with the present invention.

[0020] FIG. 10C is a flowchart showing still another embodiment of the methods for joining DNA fragments in accordance with the present invention.

[0021] FIG. 10D is a flowchart showing still yet another embodiment of the methods for joining DNA fragments in accordance with the present invention.

[0022] FIG. 11 is a flowchart showing yet another embodiment of the present invention.

[0023] FIG. 12 is a flowchart showing yet another embodiment of the present invention.

[0024] FIG. 13 is a chart showing a partial sequence listing for pLSB 1176 that was assembled using the methods of the present invention, with key portions marked for discussion below.

[0025] FIG. 14 is a flowchart showing basic steps for converting PCR products into expressible elements without cloning in accordance with further embodiments of the present invention.

[0026] FIG. 15 is a flowchart that depicts a variety of combinations of steps for practicing the present invention in a two step process, the flowchart corresponding to Examples 9-16 of the present invention.

[0027] FIGS. 16A, 16B and 16C are flowcharts that depict a further variety of combinations of steps for practicing the present invention in a three step process, the flowcharts corresponding to Examples 17-33 of the present invention.

[0028] FIG. 17 is a flow chart that depicts a still more combinations of steps for practicing the present invention, the flowchart corresponding to Examples 34-41 of the present invention.

[0029] FIG. 18 is a block diagram depicting a computer and fluid handler for effecting the various procedures described herein in an automated fashion.

[0030] FIG. 19 is a flowchart, similar to FIG. 14, showing on the left hand side, the basic steps for forming expressible elements in a three-way reaction using topoisomerase I in accordance with TOPO® Tools methodology, and on the right hand side using a two-way joining process in accordance with a further embodiment of the present invention.

DETAILED DESCRIPTION OF THE INVENTION

[0031] In practicing the present invention, double stranded polynucleotides are joined by generating 5′ overhangs (cohesive or sticky ends) of defined length and sequence by employing a DNA polymerase having 3′ to 5′ exonuclease activity. This is accomplished by reacting the DNA polymerase with a linearized polynucleotide (ds DNA molecule) and a subset of at least one type of dNTP but not more than three of the four dNTPs (dATP, dTTP/dUTP, dCTP or dGTP). The dsDNA molecule can be blunt or non-blunt ended. After the 5′ overhang cohesive ends are generated the complementary cohesive ends are allowed to anneal whereby at least one of the ds DNA molecules has a 5′ phosphate group. The 5′ phosphate group can be present on the ds DNA molecule before the reaction or can be formed in situ during the reaction by addition of a polynucleotide kinase to the reaction mixture. After annealing, the cohesive ends are ligated in the presence of a DNA ligase.

[0032] The polynucleotides or ds DNA molecules to be joined according to the present invention can be any ds polynucleotides where it would be desirable to join them to make a longer polynucleotide molecule. The polynucleotides can be prepared using conventional techniques such as known DNA synthesis techniques, DNA polymerase chain reaction (PCR) or by restriction enzyme digestion, such as, for example, with a type IIS restriction enzyme, such as Sap I or Ear I. When a restriction endonuclease is used to make the starting polynucleotide the resulting polynucleotide can be blunt ended or can have either a 3′ or 5′ overhang. In a preferred embodiment, the polynucleotides to be joined comprise a vector and an insert polynucleotide wherein the insert includes the coding region for the expression of a desirable protein or RNA molecule. Once the vector and insert polynucleotides are joined forming a finished vector, the finished vector is used to transform a host cell whereby the host contains the desirable coding region and is capable of expressing the encoded protein or RNA molecule. The joined polynucleotide can be either linear or circular. The present process can be used to clone a single gene of interest or to clone a library of polynucleotides into a suitable vector. Another preferred embodiment includes cloning of DNA sequences which may or may not encode for protein or RNAs.

[0033] The 5′ overhangs, also referred to as sticky ends or cohesive ends, can be 1-15 nucleotides in length and are preferably 2-8 nucleotides in length. The 5′ overhangs are comprised of any of the nucleotides but can be comprised of the same nucleotide, i.e., all t's, all g's, etc.). When the ′5 overhang is comprised of mixed nucleotides it is preferred that the 5′ overhang is comprised of a's and t's together or g's and c's together. The complementary 5′ overhangs allow the polynucleotides to be joined in a directional orientation if desired. The 5′ overhang can also be self-complementary to an otherwise identical polynucleotide.

[0034] The following 5′ overhangs and their complementary sequence are useful in practicing the present invention (however, other 5′ overhangs can also be used):

5′ Overhang Complementary Sequence
5′ tt ttt   aaa aaa 5′
5′ gg gg    cc cc 5′
5′ cc       gg 5′
5′ aaaat    tttta 5′
5′ ggc      ccg 5′
5′ atg      tac 5′
5′ aaa      ttt 5′
5′ taa      att 5′
5′ cgg      gcc 5′
5′ gcc      cgg 5′
5′ aat      tta 5′

[0035] The length of the 5′ cohesive/sticky ends formed by the DNA polymerase activity is determined by the presence of one or more stop bases that occur consecutively in the polynucleotide sequence. The stop bases, in conjunction with the appropriate dNTPs, limit the 3′ to 5′ exonuclease activity of the DNA polymerase enzyme thereby limiting the length of the 5′ single stranded ends that are formed. The overhang sequences and/or stop bases are conveniently incorporated into the primers that are used in the PCR process when PCR is employed to make the starting polynucleotides. The overhang and stop bases can also overlap between the primer and original nucleotide. Alternatively, the stop bases and 5′ overhang are already in the polynucleotide when the polynucleotides are obtained without PCR.

[0036] The following reaction scheme illustrates the role of stop bases and dNTPs in the present invention. Fragment C and Fragment D represented below are to be joined according to the Sticky RICE process. The stop bases in Fragment C are “GG” and the stop bases in Fragment D are “CC.”

Fragment C             Fragment D
5′ - - - GG TTT TTT 3′ 5′ TTT TTT GG - - - 3′
3′ - - - CC AAA AAA 5′ 3′ AAA AAA CC - - - 5′
                       T4 DNA polymerase
                       dGTP + dCTP/kinase
5′ - - - GG            5′ TTT TTT GG - - - 3′
3′ - - - CC AAA AAA 5′ CC - - - 5′
Fragment C′            Fragment D′

[0037] The dNTPs employed in the Sticky RICE process for joining the above DNA fragments are dGTP and dCTP. The dGTP limits the exonuclease activity of T4 DNA polymerase on Fragment C resulting in Fragment C′ having the desired 5′ overhang. The dCTP limits the exonuclease activity of the T4 DNA polymerase on Fragment D resulting in Fragment D′ having a desired 5′ overhang. The 5′ overhangs of Fragments C′ and Fragment D′ are complementary.

[0038] The DNA polymerase, kinase and ligase enzymes used in the present process are those enzymes that are well known to one of ordinary skill in the art. The DNA polymerase will have 5′ to 3′ polymerase activity and also 3′ to 5′ exonuclease activity. Suitable DNA polymerases include but are not limited to T4 DNA polymerase, E. coli DNA polymerase 1, the Klenow fragment of E.-coli DNA polymerase and T7 DNA polymerase. The ligase is capable of creating a phosphodiester between the 3′ hydroxyl of one nucleotide and the 5′ phosphate of another nucleotide. Suitable ligases include, but are not limited to, T4 DNA ligase and E. coli DNA ligase. The kinase is capable of adding a phosphate group to the 5′ end of a polynucleotide. Suitable kinases include, but are not limited to, T4 polynucleotide kinase. The kinase is an optional component of the present method and is employed to place a phosphate group on the 5′ end of the polynucleotides if the polynucleotides do not already contain a 5′ phosphate group. The kinase conveniently adds the phosphate group in situ in the reaction mixture.

[0039] In one embodiment of the present invention the DNA polymerase, polynucleotide kinase and DNA ligase reactions are accomplished concurrently by incubating or reacting all of the components together for a time and under conditions sufficient to allow the generation of the complementary 5′ overhangs (cohesive ends), annealing of the complementary 5′ overhangs and their resulting ligation. Alternatively, the present process can be conducted sequentially where the DNA polymerase and/or kinase reaction is allowed to proceed to substantial completion before the DNA ligase and/or kinase reaction. The kinase reaction, if needed to add 5′ phosphate groups to the polynucleotides, is conducted either before the DNA ligase reaction or concurrently therewith. Alternatively the DNA polymerase and/or kinase reaction can be performed and then the DNA polymerase and/or kinase activities can be inactivated (by a high temperature incubation step, for example 75 C. for 10 minutes) which is known to inactivate the DNA polymerase and/or kinase enzymes used. Following this inactivation, ligase and/or kinase activities can be added to the reaction.

[0040] The present process or method is conducted employing standard reactants, procedures and equipment well known to one of ordinary skill art. Buffers when employed are also well known to the skilled artisan. The temperature at which the present reactions are conducted is not critical. Temperatures are advantageously from about 5° C. to about 50° C. and preferably from about 12° C. to about 37° C. The temperature of the different reactions can vary (DNA polymerase reaction conducted at a different temperature than the ligation reaction, for example) or they can be conducted at substantially the same temperature. One skilled in the art can easily determine the optimum temperature based on the particular reactants and reagents by conducting routine experiments at various temperatures.

[0041] Since enzymes are involved, the length of the reaction period will vary inversely with the temperature, i.e., in general the higher the temperature the quicker the reaction.

[0042] In one embodiment of the present invention a vector polynucleotide and an insert polynucleotide are reacted in the presence of a subset of dNTPs, T4 DNA polymerase, a kinase and T4 DNA ligase. The reaction mixture is incubated for 30 minutes at 37° C. and then allowed to further incubate at room temperature overnight. An alternative incubation period would be to allow the reactants to incubate at between 16° C. and ambient temperature overnight. Alternatively, the vector polynucleotide and the insert polynucleotide can be reacted with the subset of d NTPs and T4 DNA polymerase at 37° C. for 30 minutes followed by the addition of T4 DNA ligase and kinase after the reaction mixture has cooled to room temperature. This final reaction mixture is then allowed to incubate at room temperature for 12-16 hours or overnight. It is readily apparent that the present process allows the simultaneous treatment of both the vector polynucleotide and the insert polynucleotide with the DNA polymerase and dNTPs wherein the complementary 5′ overhangs are produced in situ. Additionally, the DNA polymerase does not need to be inactivated before the ligase reaction is allowed to proceed, but can be if so desired.

[0043] The following reaction scheme illustrates “Sticky RICE” joining of two ds polynucleotides where ds polynucleotide Fragment A and ds polynucleotides Fragment B are joined:

[0044] 1. Generate complementary sticky ends using a 3′ to 5′ exonuclease activity of the T4 DNA polymerase.

Fragment A                      Fragment B
5′ - - - GG TTT TTT 3′          5′ TTT TTT GG - - - 3′
3′ - - - CC AAA AAA 5′          3′ AAA AAA CC - - - 5′
|
|
|                               T4 DNA polymerase
|                               dGTP + dCTP/kinase
|
|
▾
5′ - - - GG                     5′ TTT TTT GG - - - 3′
3′ - - - CC AAA AAA 5′          CC - - - 5′
2. Allow complementary sticky ends to anneal.
5′ - - - GG TTT-TTT-GG - - - 3′ (Seq ID NO: 1)
3′ - - - CC-AAA-AAA CC - - - 5′ (Seq ID NO: 2)
3. Covalently join DNAs with ligase.
5′ - - - GG-TTT-TTT-GG - - - 3′ (Seq ID NO: 1)
3′ - - - CC-AAA-AAA-CC - - - 5′ (Seq ID NO: 2)
(ligase)

[0045] The method of the present invention is useful in constructing linear expression elements, in gene/vector assembly, for constructing gene fusions, for ligating into plasmids or phage or for any other procedures where a recombinant polynucleotide is the desired product. Single gene cloning or library construction can also be accomplished. The present method is adaptable, easy to use, cost effective from materials, time and labor perspectives and, efficient. The method allows directional cloning and is seamless, i.e., no restriction sites are required.

[0046] In another embodiment of the present sticky RICE reaction, it may be desirable to purify the joined DNA reaction product from the buffers and/or enzymes used in the sticky RICE reaction. This can be accomplished by placing a suitable tag moiety (such as a biotin group, for example) on at least one of the starting material DNAs to be used in the sticky RICE reaction. The incorporation of biotin tags into synthetic DNAs is well known to the skilled artisan. Oligos containing one or more biotin groups are commercially available. Such biotinylated oligos can be used in polymerase chain reactions. After the “tagged” reaction products are formed then standard purification protocols relating to the “tagged” products are employed. For example, a ds DNA product comprising an open reading frame of interest is synthesized with a biotinylated “downstream” or reverse oligonucleotide is joined with a second ds DNA product which contains additional vector components, for example, a phage RNA polymerase promoter sequence (such as the T7, SP6 or T3 RNA polymerase promoters) according to the present Sticky RICE process resulting in the ligation of the two DNA fragments. The biotinylated DNA product is readily purified from the sticky RICE reaction components by a variety of known reagents, such as magnetic beads coated with avidin or streptavidin molecules. After collecting the magnetic beads to which the biotinylated DNAs are now bound, the beads are washed and ultimately transferred into a separate reaction, such as an in vitro transcription reaction, for example. Streptavidin coated magnetic beads and protocols for their use in purification of biotinylated DNAs are available from a number of commercial suppliers, including the Promega Corporation (Madison, Wis., USA), and Dynal (Lake Success, N.Y., USA).

[0047] The present invention can be employed to generate directional cloning kits using a desired vector. These kits would facilitate the use of the vectors for whatever their intended purpose (for example library construction, cloning genes for expression of proteins in animal, plant or bacterial cells, etc.) by making the cloning process easier and more efficient. A cloning kit would include:

[0048] a. a DNA polymerase

[0049] b. a polynucleotide kinase

[0050] c. a ligase and

[0051] d. a buffer, and optionally the following:

[0052] e. a linearized cloning vector

[0053] f. competent cells

[0054] g. dNTPs

[0055] h. PCR buffer

[0056] i. Taq DNA polymerase or other thermostable DNA polymerase

[0057] One or more control reactions may also be included in the cloning kit. The first three listed enzymes could be combined into a mixture.

[0058] A typical cloning kit is as follows:

[0059] Sticky RICE Enzyme mix (1 U T4 DNA polymerase; 1 U T4 Polynucleotide kinase; 0.25 U T4 DNA ligase)

[0060] Sticky RICE buffer mix

[0061] Linearized cloning vector

[0062] Competent Cells

[0063] Control primers

[0064] Control template

[0065] dNTPS

[0066] PCR Buffer

[0067] Taq DNA polymerase

[0068] 2 control reactions.

[0069] The present invention also allows for the generation of a fully automated or nearly fully automated cloning system. By using robotic liquid handlers, etc. an automated workflow for cloning PCR products into a plasmid vector capable of replicating in a bacterial cell (for example) could be set up:

[0070] Step 1—set up PCR reactions to amplify up polynucleotide sequences of interest.

[0071] Step 2—analyze PCR reactions on gel, destroy template (if desired), purify PCR product away from unincorporated dNTPs. Estimate DNA concentration of purified PCR products.

[0072] Step 3—set up Sticky RICE cloning reactions by combining Sticky RICE compatible vector with specific amounts of various PCR products.

[0073] Step 4. let Sticky RICE reaction proceed for appropriate length of time.

[0074] Step 5. transform all or a portion of Sticky RICE reaction into bacterial cells.

[0075] Step 6 plate bacteria, pick colonies, prep up DNA from colonies, or cultures thereof, continue with recombinant DNA in experiments as desired.

[0076] In another embodiment the generation of linear expression elements for gene discovery/functional genomics experiments, two hybrid interaction experiments, etc. without cloning genes (without propagating the recombinant DNA in cells, for example) can be accomplished with the present process. This work flow would be as follows and could be automated as well:

[0077] Step 1—set up PCR reactions to amplify up polynucleotide sequences of interest.

[0078] Step 2—analyze PCR reactions on gel, destroy template (if desired), purify PCR product away from unincorporated dNTPs. Estimate DNA concentration of purified PCR product.

[0079] Step 3—set up Sticky Rice cloning reactions by combining Sticky RICE compatible polynucleotide elements to 5′ and/or 3′ ends of PCR products.

[0080] These “elements” (described in Step 3) would generally be PCR products of polynucleotide sequences with specific useful features such as: promoters, 5′ untranslated leader sequences, poly adenylation signals, transcription terminators, stop codons, or open reading frames (ORFs) that could be ligated to a PCR product in frame with the ORF of the PCR product—this would allow the production of fusion proteins at either N or C terminus. Desirable proteins for this application would include Green fluorescent protein (GFP), polyhistidine (His) tag sequences, cellulose binding domains, streptavidin binding peptide sequences, epitope tags, etc. These fusions would be useful for detection of the recombinant protein, and/or aid in its purification and/or detection, etc.

[0081] Step 4: after attaching “elements” of interest to 5′ and/or 3′ end of your PCR product, an additional PCR step (to amplify up more of the newly constructed recombinant DNA) may be desired.

[0082] Step 5. clean up DNA as needed.

[0083] Step 6: use linear expression element in either in vitro or in vivo settings for transcription and/or translation of DNA of interest. For example, linear expression elements can be transfected into mammalian cells and be expressed transiently. Additionally, PCR products could be transcribed and translated in vitro using commercially available systems (Promega Corp, Ambion Corp, etc.).

[0084] The advantages of the present Sticky RICE process are flexibility and speed. In hours one can PCR up more of a DNA of interest for immediate use. In contrast, it takes days to transfect DNA into bacteria, let the bacteria grow, then purify recombinant DNA from bacterial culture. Also the original PCR product can be modified in different ways as desired, providing flexibility in expressing native or fusion proteins in vivo or in vitro.

[0085] The following is a first embodiment of a kit with instructions for using STICKY RICE™:

[0086] STICKY RICE™ DNA Cloning Kit.

[0087] For Directional Cloning of PCR products into Plasmids

[0088] Kit Contents and Materials List

[0089] Introduction

[0090] Overview

[0091] Experimental Outline

[0092] Methods

[0093] Primer Design for STICKY RICE

[0094] PCR Amplification of DNAs

[0095] Post-PCR Clean up of DNAs

[0096] STICKY RICE™ Ligation Reaction Protocol

[0097] Transformation of competent E. Coli cells

[0098] Analysis of transformants

[0099] Troubleshooting and Control Reactions

[0100] Technical Assistance

[0101] Contact information

[0102] Appendix

[0103] Kit Contents and Materials List

[0104] Kit Contents

[0105] The STICKY RICE™ Cloning kit contains the following reagents:

Item	Contents	Amount
Control Insert DNA	3 ng/ul 725 bp DNA	25	ul
STICKY RICE ™ Prepared	˜10 ng/ul	40	ul
Vector (pLSB 1200.bsr)
Sterile Water	dH2O	500	ul
5X STICKY RICE ™ Buffer	5X buffer	50	ul
STICKY RICE ™ Enzyme	10Xenzyme mix	30	ul
Mix
Control PCR Template	10 ng/ul	20	ul
Control Primer set 1	50 uM (each) Forward and	20	ul
	Reverse primer mix.
Store all kit components at −20° C.
Note: Control insert is GFPc3 ORF and will be cloned in frame with the N-terminal His-Patch thioredoxin ORF and C-terminal V5, 6XHis ORF in pLSB1200.bsr.

[0106] Materials Supplied by the User

[0107] Thermocycler (PCR) machine.

[0108] Gene Specific Primers

[0109] PCR reagents

[0110] PCR Clean up kit (Stratagene, Qiagen, etc.)

[0111] Competent Bacteria Cells (we recommend MaxEfficiency chemically competent DH5α)

[0112] Introduction

[0113] Overview:

[0114] This kit is designed to let you rapidly clone PCR products in a directional orientation into the bacterial expression vector pLSB 1200.bsr without the use of restriction enzymes. The vector is provided is ready to use, along with all other necessary reagents for the cloning reaction. The kit contains all the components needed to perform 10 independent

[0115] Kit Contents and Materials List

[0116] Kit Contents

[0117] The STICKY RICE™ Cloning kit contains the following reagents:

Item	Contents	Amount
Control Insert DNA	3 ng/ul 725 bp DNA	25	ul
STICKY RICE ™ Prepared	˜10 ng/ul	40	ul
Vector (pLSB 1200.bsr)
Sterile Water	dH2O	500	ul
5X STICKY RICE ™ Buffer	5X buffer	50	ul
STICKY RICE ™ Enzyme	10Xenzyme mix	30	ul
Mix
Control PCR Template	10 ug/ul	20	ul
Control Primer set 1	50 uM (each) Forward and	20	ul
	Reverse primer mix.
Store all kit components at −20° C.
Note: Control insert is GFPc3 ORF and will be cloned in frame with the N-terminal His-Patch thioredoxin ORF and C-terminal V5, 6XHis ORF in pLSB1200.bsr.

[0118] Materials Supplied by the User

[0119] Thermocycler (PCR) machine.

[0120] Gene Specific Primers

[0121] PCR reagents

[0122] PCR Clean up kit (Stratagene, Qiagen, etc.)

[0123] Competent Bacteria Cells (we recommend MaxEfficiency chemically competent DH5α)

[0124] Introduction

[0125] Overview:

[0126] This kit is designed to let you rapidly clone PCR products in a directional orientation into the bacterial expression vector pLSB 1200.bsr without the use of restriction enzymes. The vector is provided is ready to use, along with all other necessary reagents for the cloning reaction. The kit contains all the components needed to perform 10 independent cloning reactions. The Instant RICE™ Enzyme Mix provided allows for cloning of DNAs at room temperature (22° C.) in 30 minutes. Following the STICKY RICE™ reaction the DNA is transformed into chemically competent E. Coli cells. Approximately 95% of the transformants should contain inserts in the proper orientation.

[0127] The prepared pLSB 1200.bsr vector provided is a bacterial expression vector with the following features:

[0128] i T7 lac promoter for high level-inducible expression of the gene of interest.

[0129] ii. LacI gene encoding the lac repressor to tightly regulate gene expression.

[0130] iii. Ampicillin resistance for selection in E. coli

[0131] iv. pBR322 origin for low-copy replication and maintenance in E. coli.

[0132] v. Directional STICKY RICE™ compatable cloning sites.

[0133] vi. N-terminal His-Patch thioredoxin fusion protein production.

[0134] vii. C-terminal V5 6X His fusion, if desired.

[0135] To clone a gene of interest into pLSB 1200.bsr, the gene is simply amplified up by the polymerase chain reaction (PCR) and the PCR reaction product purified away from unincorporated nucleotides and primers. The cleaned up PCR product is then combined with STICKY RICE™ vector, buffer and enzyme mix.

[0136] If the PCR product is inserted in the proper orientation in pLSB 1200.bsr, a StuI site will be generated at the upstream vector:insert junction and a HindIII site will be generated at the 3′ Insert:vector junction. This provides an efficient way to screen for the presence and size of an insert.

[0137] Introduction

[0138] Methods

[0139] For efficient, directional joining of PCR products minor primer design constraints are necessary. The basic steps of the present invention described below are depicted in FIG. 11 and described below:

[0140] 1. Design Primers:

Forward Primer Design

[0141] The forward primer of your gene of interest must have the following 5′ terminal sequence:

[0142] 5′ ggC CTT X1X2X3 XXX XXX

[0143] Where X1X2X3 is the first codon of your gene of interest. These 6 nucleotides (5′ggCCTT) ensure that your gene of interest is cloned in frame with the upstream Thioredoxin gene.

Reverse Primer Design

[0144] The reverse primer of your gene of interest must have the following 5′ terminal sequence (of 4 nts):

Gene Sequence:
XXX XXX XiXiiXiii
Primer Sequence
X′X′X′ X′X′X′ X′X′X′ TTC g 5′

[0145] Where XiXiiXiii is a codon of the gene of interest and X′ is a nucleotide base complementary to X. NOTE: if XiXiiXiii is NOT a stop codon, then the gene will be cloned in frame with the downstream V5-6X His orf, resulting in a C-terminal V5-6XHis fusion to your protein.

[0146] 2. PCR Amplification of DNAs Using Properly Designed Primers

[0147] Set up a 100 ul PCR reaction using the following guidelines:

[0148] Follow manufacturer's recommendations.

[0149] Use the cycling parameters suitable for your primers and template.

[0150] Use a 7 minute final extension time to ensure that all PCR products are completely extended.

[0151] After cycling, place the tube on ice or at −20C. and proceed to Checking the PCR product, below.

[0152] Checking the PCR Product

[0153] Remove 5 ul from each PCR reaction and use agarose gel electrophoresis to verify the quality and quantity of your PCR product. Check for the following:

[0154] Be sure you have a single, discrete band of the correct size. If you do not have a single, discrete band, follow the manufacturer's recommendations for optimizing your PCR with the polymerase of your choice. Alternatively, you may gel-purify the desired product using the kit or method of your choice. We have successfully used Stratagene but have not tested other manufacturers.

[0155] Proceed to Post-PCR Clean up step.

[0156] Post-PCR Clean-up of DNAs

[0157] a. Prior to cleaning up your PCR product, it is recommended you destroy the PCR template. To do this add 20 units DpnI restriction enzyme to your 100 ul PCR reaction. (DpnI is active in PCR buffer.) Digest template for 1 hour at 37° C. Then proceed to step b, below.

[0158] b. Purify your PCR product away from unincorporated dNTPs and primers using a DNA clean up kit from the manufacturer of your choice.

[0159] Suitable kit manufacturers include: Stratagene PCR clean up kit, Qiaquick PCR clean up kit. (We have not yet tried other manufacturers kits).

[0160] Follow manufacturers instructions and elute final DNA product in sterile dH2O or 10 mM Tris pH 8.0.

[0161] Estimation of DNA Concentration

[0162] Estimation of the cleaned up PCR product DNA concentration can be done by agarose gel electrophoresis or UV absorption analysis.

[0163] Dilute (or concentrate) your cleaned up PCR product as needed. The recommended amounts of PCR product per STICKY RICE™ Cloning reaction is 0.015 pmoles. See Step 3, below for more details.

[0164] 3. STICKY RICE™ Ligation Reaction Protocol

[0165] Assemble the STICKY RICE™ Ligation Reaction as follows:

[0166] 2 ul 5× Reaction buffer

[0167] 2 ul STICKY RICE™ Vector DNA (˜10 ng/ul)

[0168] y ul PCR product (0.015 pmoles insert DNA 2)

[0169] 1 ul STICKY RICE™ Enzyme MIX (add last) volume to 10 ul with sterile water.

[0170] Mix gently by pipetting up and down.

[0171] Incubate reaction for 30 minutes at room temperature.

[0172] Note: Each 10 ul STICKY RICE™ Ligation reaction contains ˜20 ng, or 0.005? pmoles, of prepared vector. It is recommended you use 0.015 pmoles of insert per reaction. Use the table below to determine the amount of DNA (in nanograms) you need to add depending upon the size of the DNA fragment to be cloned. (In general multiply the insert size (in kb) by 10 to determine the number of nanograms needed per 10 ul STICKY RICE™ Ligation reaction.

	PCR Product Size		0.015 pmoles
	0.1	kb	1	ng
	0.5	kb	5	ng
	0.75	kb	7.5	ng
	1	kb	10	ng
	1.5	kb	15	ng
	2	kb	20	ng
	2.5	kb	25	ng
	3	kb	30	ng
	3.5	kb	35	ng
	4	kb	40	ng
	4.5	kb	45	ng
	5	kb	50	ng
	5.5	kb	55	ng
	6	kb	60	ng
	6.5	kb	65	ng

[0173] 4. Transformation of Competent E. coli Cells.

[0174] Thaw competent DH5a chemically competent cells on ice.

[0175] We have used Invitrogen Max Efficiency DH5α, E. coli (>1×109 transformation efficiency).

[0176] Place 14 ml polypropylene tube Falcon (35/2059) on ice to pre-chill.

[0177] Transfer 35 ul thawed cells to chilled 14 ml polypropylene tube

[0178] Add 1 ul STICKY RICE™ Ligation reaction to competent DH5a cells in 14 ml tube

[0179] Swirl gently to mix.

[0180] Incubate on ice 15 min.

[0181] Transfer to 42° C. water bath for 45 seconds.

[0182] Return to ice 2 minutes.

[0183] Add 400 ul SOC media (room temp) to cells.

[0184] Plate 50 or 150 ul per plate onto LB Amp plates (100 ug/ml Ampicillin)

[0185] Incubate plates at 37° C. overnight.

[0186] 5. Analysis of Transformants.

[0187] Using a toothpick, pick and inoculate 2 ml LB (100 ug/ml ampicillin) samples with individual colonies. Pick at least 6 independent colonies.

[0188] Grow liquid cultures overnight at 37° C. and shaking (300 rpm)

[0189] Prepare DNA from liquid cultures using Qiagen plasmid DNA miniprep kit. Screen plasmids for inserts by digestion with StuI and HindIII.

[0190] We recommend digesting 2 ul of miniprep DNA in a 15 ul reaction containing 0..5 ul (each) of StuI and HindIII restriction enzymes. Digest for 1 hour at 37C. Run restriction enzyme digested samples on 1% agarose gel to analyze.

[0191] After the StuI-HindIII digest, the pLSB 1200.bsr vector will be approximately 6.3 kb in length. Any additional fragments will be due to your insert.

[0192] 6. Expression of Protein in E. coli From pLSB1200.bsr Vector.

[0193] Transform plasmid DNA from isolates of interest into E. coli BL21 DE3 cells (Invitrogen) as per manufacturers instructions. To produce protein in E. coli follow instructions for induction and expression of protein(s).

[0194] Troubleshooting and Control Reactions:

[0195] The STICKY RICE™ reaction components and protocol are designed to maximize specific, directional joining of PCR products, while minimizing the amount of non-specific, non-directional joining of PCR products. Several elements contribute to this specificity, including:

[0196] 1. DNA concentration.

[0197] High concentrations of DNA facilitate blunt DNA ligation reactions. Increasing the DNA concentration above the amounts recommended in this manual may lead to non-specific (blunt) joining of PCR products.

[0198] 2. Enzyme concentration.

[0199] The STICKY RICE™ Enzyme Mix is specially formulated to limit the amount of non-specific joining of PCR fragments.

[0200] Appendix:

[0201] Appendix Table of Contents:

[0202] Control Primer Sequences:

[0203] Reagents and Supplies list

[0204] STICKY RICE™ Buffer recipe

[0205] STICKY RICE™ Enzyme mix recipe

[0206] Preparation of Vector

[0207] Preparation of Control Insert

[0208] Control STICKY RICE™ Ligation reaction and Results

[0209] Plasmid map of pLSB 1200.bsr

[0210] pLSB 1200.bsr cloning sites

[0211] Control Primer Sequences

Forward primer:
ggC CTT ATg gCT AgC AAA ggA gAA gAA C Seq ID NO: 3
(IDT Inc. Coralville, IA)
Reverse primer:
gCT TgT AgA gCT CAT CCA TgC CAT g Seq ID NO: 4
(IDT Inc. Coralville, IA)

[0212] Control PCR template: GFPc3 ORF in pUC-based cloning vector.

[0213] Reagents and Supplies List:

[0214] DNA purification Reagents:

[0215] Successful results have been obtained with the following kits.

[0216] QIAGEN plasmid DNA prep system

[0217] Stratagene plasmid DNA prep system

[0218] Stratagene PCR clean up kit.

[0219] Zymoclean Gel Purification kit.

[0220] Restriction Enzymes

[0221] New England Biolabs (NEB) Sap I (Cat # R0569) 2 U/ul

[0222] NEB SnaB I (Cat # R0130) 5 U/ul

[0223] NEB Hind III (Cat # R0104) 20U/ul

[0224] NEB Stu I (Cat # R0187) 10U/ul

[0225] NEB Dpn I (Cat # R0176) 20U/ul

[0226] DNA Modification Enzymes:

[0227] T4 DNA polymerase. Novagen LIC qualified (Cat # 70099-3) 2.5U/ul

[0228] T4 polynucleotide kinase: NEB (Cat # M0201) 10U/ul

[0229] T4 DNA ligase (Invitrogen Cat # 15224-017) 1U/ul

[0230] dNTPs

[0231] Promega (Cat # U1330) set of 4 individual dNTPs each at 100 mM

[0232] Buffers:

[0233] NEB Restriction enzyme buffers 2 and 4

[0234] NEB T4 DNA ligase buffer

[0235] Composition of 10× buffer:

[0236] 500 mM Tris-HCl (pH 7.5)

[0237] 100 mM MgCl2

[0238] 100 mM DTT

[0239] 10 mM rATP

[0240] 250 ug/ml BSA

[0241] PCR Reagents:

[0242] Pfu Turbo DNA polymerase. (Stratagene Cat # 600250) 2.5 U/ul

[0243] 10× cloned Pfu buffer (Stratagene)

[0244] STICKY RICE™ Buffer Mix:

[0245] 50 ul 2 mM (each) dATP/dTTP

[0246] 50 ul NEB 10× T4 DNA ligase buffer.

[0247] Result: 100 ul of 5× STICKY RICE™ Buffer

[0248] STICKY RICE™ Enzyme Mix:

[0249] 10 ul Novagen T4 DNA pol (2.5U/ul)

[0250] 5 ul NEB T4 polynucleotide kinase (10U/ul)

[0251] 50 ul Gibco (Invitrogen) T4 DNA ligase (1U/ul)

[0252] Result: 65 ul of 10× STICKY RICE™ enzyme mix.

[0253] Preparation of pLSB 1200.bsr Vector for STICKY RICE™ Cloning.

[0254] NOTE: This is HOW the supplied vector has been prepared. A user of the present invention does not need to prepare the supplied vector.

[0255] A. Purify pLSB 1200.bsr vector from DH5a E. coli cultures using Stratagene or QIAGEN plasmid DNA purification systems.

[0256] B. Digest pLSB 1200.bsr vector DNA as follows:

[0257] 10 ul 10× NEB 4 buffer

[0258] 1 ug pLSB 1200.bsr DNA

[0259] 1 ul 100× BSA (NEB)

[0260] 5 ul Sap I Restriction enzyme

[0261] Volume to 100 ul with dH2O.

[0262] Digest at 37° C. for about 16 hours (ex, 5 pm to 8 am)

[0263] Add 1 ul SapI (2U/ul stock) and 1 ul SnaBI (5 U/ul stock) to 100 ul digest

[0264] Return to 37° C. 1 hour.

[0265] C. Purify digested DNA with Stratagene or QIAGEN PCR clean up systems as per manufacturers instruction with the following modification: Perform one extra column wash than suggested by protocol. Elute in 50 ul dH2O.

[0266] D. Run 2 ul of purified DNA on 1% agarose gel to estimate quality and/or quantity of DNA.

[0267] Alternatively, record A260/A280 readings of DNA (100 ul of a 1:20 dilution) to estimate DNA concentration.

[0268] Adjust cut vector DNA concentration to about 5 ng/ul in dH2O. Store at −20° C.

[0269] Preparation of Control Insert:

[0270] NOTE: This is HOW the supplied control insert has been prepared. A user of the present invention does not need to prepare control insert, unless he so desires.

[0271] Set up a PCR of the (ca. 725 bp) GFP control insert as follows:

[0272] 10 ul 10× cloned Pfu buffer (Stratagene)

[0273] 50 pmoles F primer (SEQ ID NO: 3)*

[0274] 50 pmoles R primer (SEQ ID NO: 4)

[0275] 10 ng template (GFP gene in pUC based plasmid)

[0276] 2 ul dNTP mix (dATP, dTTP, dGTP, dCTP) each at 10 mM

[0277] 2 ul Pfu Turbo DNA Polymerase

[0278] Volume to 100 ul with dH2O

[0279] * 50 pmoles=1 ul of 50 uM stock.

[0280] Cycling conditions (MJ Research PTC 200)

[0281] 1. 95° C. 2 min

[0282] 2. 94° C. 30 sec

[0283] 3. 55° C. 30 sec (steps 2-4 for 25 cycles)

[0284] 4. 72° C. 1 min

[0285] 5. 72° C. 7 min

[0286] 6. 4 ° C. hold

[0287] Add 20 U Dpn I to PCR reaction when completed.

[0288] Incubate at 37° C. 1 hour (to destroy template DNA)

[0289] Run 2 ul of PCR reaction on 1.5% agarose gel to check.

[0290] Clean up PCR product with Stratagene or QIAGEN PCR clean up kits, according to manufacturers instructions.

[0291] Elute in 50 ul dH2O

[0292] Run 2 ul cleaned up PCR product on gel to check.

[0293] Record A260/A280 of cleaned up PCR product (1:50 dil) to estimate DNA concentration

[0294] Adjust concentration of cleaned up PCR product to approximately 3-4 ng/ul, for use as test insert.

[0295] Control STICKY RICE™ Ligation Reaction and Results

Reagent	Control Lig	Test Lig
5X Buffer	2	ul	2	ul
Vector	10	ng	10	ng
Control Insert	—		7.5	ng
Water	up to 9	ul vol	up to 9	ul vol
STICKY RICE ™ Enzyme Mix	1	ul	1	ul
Final vol	10	ul	10	ul

[0296] Mix gently by pipetting.

[0297] Let incubate at room temp for 30 min.

[0298] Transform 1 ul each reaction into 35 ul DH5a, plate cells etc. as described in protocol.

[0299] Incubate overnight at 37° C.

[0300] Record the number of colonies per plate next day.

[0301] NOTE: A decent vector prep should give about 10×-40× more colonies on the ligation reaction than on the re-ligation control reaction. Re-ligation control should have 20-50 colonies, for example per 50 ul plated

[0302] Expected results: > or=to 95% of transformants contain plasmids with inserts.

[0303] The following is a second embodiment of a kit with instructions for using STICKY RICE™:

[0304] STICKY RICE™ Linear DNA Recombination Kit.

[0305] For Construction of linear recombinant DNAs in vitro.

[0306] Kit Contents and Materials List

[0307] Introduction

[0308] Overview

[0309] Experimental Outline

[0310] Methods

[0311] Primer Design for STICKY RICE

[0312] PCR Amplification of DNAs

[0313] Post-PCR Clean up of DNAs

[0314] STICKY RICE™ Reaction Protocol

[0315] Gel Analysis of Reaction products

[0316] Troubleshooting and Control Reactions

[0317] Technical Assistance

[0318] PCR Control Reaction

[0319] STICKY RICE Control Reaction

[0320] Appendix

[0321] Recipes

[0322] Technical Service

[0323] References

[0324] Kit Contents and Materials List

[0325] Kit Contents The STICKY RICE™ Linear Recombination kit contains the following reagents:

Item	Composition	Amount
Control DNA-1	8 ng/ul 225 bp frag	25	ul
Control DNA-2	25 ng/ul 725 bp frag	25	ul
Control DNA-3	10 ng/ul 300 bp frag	25	ul
Sterile Water		500	ul
5X STICKY RICE ™ Buffer	5X buffer	50	ul
STICKY RICE ™ Enzyme	10Xenzyme mix	30	ul
Mix
Control Template	10 ng/ul	20	ul
Control Primer Set 1	50 uM Each primer	20	ul
Control Primer Set 2	50 uM Each primer	20	ul
Control Primer Set 3	50 uM Each primer	20	ul
Primer Seq ID NO:6 (F)	50 uM Seq ID NO:6 primer	20	ul
Primer Seq ID NO:13 (R)	50 uM Seq ID NO:13 primer	20	ul

[0326] Materials Supplied by the User

[0327] Thermocycler (PCR) machine

[0328] PCR Reagents

[0329] PCR Clean up kit

[0330] Introduction

Overview

[0331] This kit is designed to let you rapidly join linear DNA (PCR) products in a directional orientation. The STICKY RICE™ Enzyme Mix facilitates joining of linear DNAs at room temperature (22° C.) in 60 minutes. Greater than 50% of the control reaction substrates should be directionally joined in a 60 minute STICKY RICE™ joining reaction.

[0332] For efficient, directional joining of PCR products minor primer design constraints are necessary (for complete description see Methods section). The provided control PCR reaction products of 225 (DNA-1) and 725 Dp (DNA-2) for example, are joined (at their overlapping GCC sequence termini) to generate a product of about 950 bp. See FIG. 12. Alternatively template and primers are provided to allow you to amplify up these two PCR products for use in control reactions. Instructions for primer design will allow you to generate your own PCR products for use in a STICKY RICE™ joining procedure. You may also set up a 3 way STICKY RICE™ reaction by adding in equimolar amounts of control DNA-3. The basic steps of the method described here are depicted in FIG. 12.

[0333] FIG. 12 depicts the joining of 225 and 725 bp PCR products by STICKY RICE™

5′ - - - 225 - - - GCC3′ (DNA-1 in kit)
3′ - - - 225 - - - CGG5′
5′ GCC - - - 725 bp - - - 3′   (DNA-2 in kit)
3′ CGG - - - 725 bp - - - 5′
5′ - - - 225 bp - - - GCC - - - 725 bp - - - 3′
3′ - - - 225 bp - - - CGG - - - 725 bp - - - 5′

[0334] The STICKY RICE™ joining procedure is useful forjoining PCR products for the construction of chimeric genes, gene fusions, or other linear recombinant DNAs of interest.

[0335] Introduction

[0336] SEE FIG. 12 for Experimental Steps

[0337] Methods

[0338] Design Primers for STICKY RICE™

[0339] During the STICKY RICE™ Ligation reaction, 5′ complementary (sticky) overhangs are generated and guide the directional assembly of DNA molecules. The efficiency and rate of the joining reaction correlates with the calculated melting temperature of the generated 5′ overhangs. The higher the estimated melting temperature of the sticky ends, the faster the reaction progress.

[0340] For this reason, G/C rich sticky ends are preferred over A/T rich sticky ends, though both types of sticky ends work. The sequence and length of the 5′ sticky ends to be generated is determined by primer design prior to PCR. For example if two DNA fragments (left) and (right) are to be joined the following design is suggested.

[0341] Left Fragment, Reverse primer (5′ GGC W-gene of interest sequence)

[0342] Example:

[0343] DNA Sequence:

[0344] Primer Sequence:

NNN NNN
NNN NNN W CGG5′

[0345] where W=A or T

[0346] The forward direction primer for the Left fragment is a gene specific primer.

[0347] Right fragment, forward primer (5′ GCC W-gene of interest sequence)

[0348] Example:

[0349] DNA Sequence: gene of interest—

[0350] Primer Sequence:

ATG GGC ATT (Seq ID NO: 5)
5′ GCC ATG GGC ATT

[0351] Reverse primer for the Right fragment is a gene specific primer.

[0352] PCR Amplification of DNAs

[0353] Set up a 100 μl PCR reaction using the following guidelines:

[0354] Follow manufacturer's recommendations.

[0355] Use the cycling parameters suitable for your primers and template.

[0356] Use a 7 minute final extension time to ensure that all PCR products are completely extended.

[0357] It is recommended to set up the control fragments in the following manner:

Pfu turbo(2.5 U/ul)        2 μl
10X cloned Pfu buffer      10 μl
10 mM dNTPs                2 μl
Control primers set 1 or 2 1 μl
control template           2 μl
sterile water              83 μl

[0358] Using an MJ research thermocycler (use of a different PCR machine will require optimization of the cycling conditions), the reaction is heated to 95° C. for 2 minutes then cycled for 25 times through the following three temperatures: 95° C., 30 seconds; 55° C., 30 seconds; 72° C. 1 minute. After the final cycle, the reaction is incubated at 72° C. for 7 minutes and then held constant at 4° C. until ready for next step.

[0359] After cycling, place the tube on ice or at −20C. and proceed to Checking the PCR product, below.

[0360] Checking the PCR Product

[0361] Remove 2-5 ul from each PCR reaction and use agarose gel electrophoresis to verify the quality and quantity of your PCR product. Check for the following:

[0362] Be sure you have a single, discrete band of the correct size. If you do not have a single, discrete band, follow the manufacturer's recommendations for optimizing your PCR with the polymerase of your choice. Alternatively, you may gel-purify the desired product using the method of your choice. We have used Stratagene based kits

[0363] Proceed to Post-PCR Clean up step.

[0364] Post-PCR Clean-up of DNAs

[0365] Before cleaning up PCR fragments, add 20 units DpnI per 100 ul reaction to remove template background. Incubate DpnI treated sample for 1 hour at 37 degrees celcius. Heat kill enzyme for 20 minutes at 80 degrees celcius. Proceed with purification of PCR products.

[0366] Purify your PCR product away from unincorporated dNTPs and primers using a DNA clean up kit from the manufacturer of your choice.

[0367] Suitable kit manufacturers include: Stratagene PCR clean up kit, Qiaquick PCR clean up kit.

[0368] Follow manufacturers instructions and elute final DNA product in sterile dH2O

[0369] Estimation of DNA Concentration

[0370] Estimation of the cleaned up PCR product DNA concentration can be done by agarose gel electrophoresis or UV absorption analysis.

[0371] Dilute (or concentrate) your cleaned up PCR product as needed. The recommended amounts of PCR products per STICKY RICE™ joining reaction are approximately 0.05 pmoles each fragment per 15 ul reaction (for 2-way ligation reactions). When joining two PCR products equimolar amounts of each PCR product are recommended. For 3-way ligations, it is recommended that the middle fragment be in excess of the other two fragments. A 1:3:1 molar ratio is recommended- 0.025 pmoles of each outside fragment and 0.075 pmols of the inside fragment.

[0372] Control PCR products of 225 bp, 725 bp and 300 bp are supplied with the kit at 8 ng, 25 ng, and 10 ng/ul respectively. One microliter of each fragment is 0.05 pmoles.

[0373] 3. Set up STICKY RICE™ Ligation Reaction.

[0374] Assemble the STICKY RICE™ Reaction as follows:

[0375] 3 ul 5× Reaction buffer

[0376] x ul DNA 1 (0.05 pmoles DNA 1 or 1 μl of control DNA-1)

[0377] y ul DNA 2 (0.05 pmoles DNA 2 or 1 μl of control DNA-2)

[0378] 1 ul STICKY RICE™ Enzyme Mix (added last) volume to 15 ul with sterile water.

[0379] Mix by pipetting up and down gently or vortexing very gently

[0380] Incubate reaction for 60 minutes at room temperature (22° C.).

[0381] NOTE: Alternatively, if you wish to try a 3-way STICKY RICE™ Ligation Reaction, add 0.025 pmoles (0.5 μl of DNA-1 and DNA-3) of the 225 bp and 300 bp (provided) and 0.075 pmoles of (1.5 ul of DNA-2) to the above recipe and make adjustments accordingly to the amount of water added to the reaction. In the 3 way STICKY RICE™ Ligation the final product will be approximately 1300 bp in length. The fragments should assemble in the following orientation:

[0382] DNA1 (225 bp): DNA2 (725 bp): DNA3 (300 bp)

[0383] Table 1: Amount of DNA (in nanograms) 0.05 pmoles

	PCR Product Size		0.05 pmoles
	0.1	kb	3.3	ng
	0.5	kb	16	ng
	0.75	kb	25	ng
	1	kb	33	ng
	1.5	kb	50	ng
	2	kb	66	ng
	2.5	kb	83	ng
	3	kb	99	ng

[0384] 4. Gel Analysis of Reaction

[0385] Stop Reaction:

[0386] Incubate the STICKY RICE™ Ligation Reaction at 75° C. for 15 minutes. This step is important to ensure you will have sharp bands on your gel.

[0387] Use agarose gel electrophoresis to examine the progress of each STICKY RICE™ Reaction. Run 10 ul of STICKY RICE™ Ligation Reaction on the appropriate concentration agarose gel, with the appropriate DNA size markers. Stain with EtBr and visualize fragments with UV illumination.

[0388] For the control reaction provided with this kit, a 1.5% agarose gel is recommended for the analysis of the control reaction. The user should see a 225 and 725 bp band in addition to a 950 bp band from the joining of control DNAs 1 and 2.

[0389] 5. Linear Recombinant for use in your application of interest.

[0390] If desired, you may wish to PCR amplify up the assembled 1.3 kb recombinant DNA from the 3 way STICKY RICE™. To do this, use oligos Seq ID NO: 15 (225 F.) and Seq ID NO: 13 and 1 ul of your STICKY RICE™ ligation reaction in the following PCR set-up

Pfu turbo (2.5 U/ul)  2 μl
10X cloned Pfu buffer 10 μl
10 mM dNTPs           2 μl
50 μM Seq ID NO:15    1 μl
50 μM Seq ID NO:13    1 μl
ligation product      1 μl
sterile water         83 μl

[0391] Using an MJ research thermocycler (use of a different PCR machine will require optimization of the cycling conditions), the reaction is heated to 95° C. for 2 minutes then cycled for 20-25 times through the following three temperatures: 95° C., 30 seconds; 50° C., 30 seconds; 72° C. 1 minute, 30 seconds. After the final cycle, the reaction is incubated at 72° C. for 7 minutes and then held constant at 4° C. until ready for next step. Check 2 ul on a 1.2-1.5% agarose gel. You should only see the ligation product band as a result of PCR.

[0392] Troubleshooting and Control Reactions:

[0393] The STICKY RICE™ reaction components and protocol are designed to maximize specific, directional joining of PCR products, while minimizing the amount of non-specific, non-directional joining of PCR products. Several elements contribute to this specificity, including:

[0394] 1. DNA Concentration.

[0395] High concentrations of DNA facilitate blunt DNA ligation reactions. Increasing the DNA concentration above the amounts recommended in this manual may lead to non-specific (blunt) joining of PCR products.

[0396] 2. Enzyme Concentration.

[0397] The Instant RICE™ Enzyme Mix is specially formulated to limit the amount of non-specific joining of PCR fragments.

[0398] 3. Primer Design.

[0399] Palidromic sticky ends can lead to non-directional annealing and joining of DNA fragments. To ensure that joining is directional design your primers so that non-palindromic sticky 5′ overhangs will result.

[0400] Appendix:

[0401] Primer pairs for 3 way STICKY RICE™ PCR products:

[0402] 225 bp PCR product: (from pUC:GFP template)

F primer
(Seq ID NO: 6)
5′ gac tct tca agc qca aga gcq ccc aat acg ca 3′
R primer
(Seq ID NO: 7)
5′ ggc tta gct gtt tcc tgt gtg aaa ttg tt 3′
225 bp fragment sequence:
(Seq ID NO: 8)
GACTCTTCAAGCGCAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGC
GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAA
GCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGC
ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTG
TGAGCGGATAACAATTTCACACAGGAAACAGCTAAGCC

[0403] 725 bp PCR product (from pUC:GFP template)

F primer
(Seq ID NO: 9)
5′ gcc atg gct agc aaa gga gaa gaa c 3′
R primer
(Seq ID NO: 10)
5′ cgg tta ttt gta gag ctc atc cat gcc a 3′
726 bp fragment sequence:
(Seq ID N): 11)
GCCATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCT
TGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAG
AGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGC
ACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTC
TTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATG
ACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATA
TCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGA
AGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAG
AAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACAC
AATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTT
CAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATT
ATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAAC
CATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCG
TGACCACATGGGCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATG
GCATGGATGAGCTCTACAAATAACCG

[0404] 300 bp PCR product (from pUC:GFP template DNA)

F primer
(Seq ID NO: 12)
5′ ccg ttt taa gcc agc ccc gac cac ccg cca 3′
R primer
(Seq ID NO: 13)
5′ gat gag cgg ata cat att tga atg 3′
300 bp fragment sequence:
(Seq ID N): 14)
CCGTTTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGA
CGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTC
CGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGA
GACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATA
ATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGG
AACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCA
TC

EXAMPLES

[0405] The following examples illustrate the practice of the present invention but should not be construed as limiting its scope.

Example 1

Preparation of Oligos

[0406] The oligonucleotides listed in Table 1 below were prepared for use in the following examples.

TABLE
Oligonucleotides
SEQ ID NO: 15 gac tct tca agc gca aga gcg ccc aat acg ca
SEQ ID NO: 16 AAT ggC TAg CAA Agg AgA AgA AC
SEQ ID NO: 17 TAA ggT TAT TTg Tag AgC TCA TCC ATg C
SEQ ID NO: 18 ATT ggT AgC TgT TTC CTg TgT gAA ATT gT
SEQ ID NO: 19 TTA ggT TAA gCC AgC CCC gAC ACC CgC CA
SEQ ID NO: 20 ggC ATg gCT AgC AAA ggA gAA gAA C
SEQ ID NO: 21 Cgg TTA TTT gTA gAg CTC ATC CAT gCC A
SEQ ID NO: 22 gCC TTA gCT gTT TCC TgT gTg AAA TTg TT
SEQ ID NO: 23 CCg TTT TAA gCC AgC CCC gAC ACC CgC CA
SEQ ID NO: 24 AAA ATg gCT AgC AAA ggA gAA gAA C
SEQ ID NO: 25 TTA ggT TAT TTg Tag AgC TCA TCC ATg CC
SEQ ID NO: 26 ATT TTC gAg CTg TTT CCT gTg TgA AAT Tg
SEQ ID NO: 27 TAA CCT TAA gCC AgC CCC gAC ACC CgC CA
SEQ ID NO: 28 CCA Tgg CTA gCA AAg gAg AAg AAC
SEQ ID NO: 29 gCC TTA TTT gTA gAg CTC ATC CAT gCC AT
SEQ ID NO: 30 ggT TAg CTg TTT CCT gTg TgA AAT TgT T
SEQ ID NO: 31 ggC TTT TAA gCC AgC CCC gAC ACC CgC CA

Example 1A

Ligation of Two Linear DNAs (PCR Reaction Products) by Sticky RICE

[0407] A 225 bp fragment of pUC 19 was amplified by the PCR using oligos Seq ID NO: 15 and Seq ID NO: 18, in a 100 ul reaction containing 1× Taq DNA polymerase buffer with MgCl2 (Promega), 100 pmoles each oligo, 0.2 mM final concentration of each dNTP (dGTP, dCTP, dATP, dTTP), 50 pg pUC 19 (Invitrogen) and 5U Taq DNA polymerase (Promega catalog # M1661). The reaction was heated to 94° C. for 3 minutes then cycled for 30 times through the following three temperatures: 94° C., 15 sec; 50° C. 30 sec; 72° C. 20 sec. After the final cycle, the reaction was incubated at 72° C. for 5 minutes.

[0408] A 770 bp DNA fragment of the GFP gene was amplified from the plasmid p30BGFPc3 (Shivprasad S., Pogue, G P, Lewandowski D J, Hidalgo J, Donson J, Grill L K, Dawson W O. 1999. Heterologous sequences greatly affect foreign gene expression in tobacco mosaic virus-based vectors. Virology 255(2) 312-323.) by the PCR using oligos Seq ID NO: 16 and Seq ID NO: 17, in a 100 ul reaction containing 1× Taq DNA polymerase buffer with MgCl2 (Promega), 100 pmoles each oligo, 0.2 mM final concentration of each dNTP (dGTP, dCTP, dATP, dTTP), and 5U Taq DNA polymerase (Promega catalog # M1661). The reaction was heated to 94° C. for 3 minutes then cycled for 30 times through the following three temperatures: 94° C., 20 sec; 50° C. 30 sec; 72° C. 45 sec.. After the final cycle, the reaction was incubated at 72° C. for 5 minutes.

[0409] Following PCR the PCR products were purified from unincorporated dNTPs, oligonucleotides, buffer, etc using the StrataPrep PCR purification kit (Stratagene) using the manufacturers instructions. The purified PCR products were eluted from StrataPrep columns with dH2O.

[0410] Approximately 50 ng of the two purified PCR reaction products were combined in a 10 ul reaction containing: 133 New England Biolabs (NEB) ligase buffer, 1.25 U T4 DNA pol (Novagen, LIC qualified), and 0.2 mM (each) dGTP and dCTP. The reaction was incubated at 37° C. for 30 minutes. Following the 37° C. treatment 0.5 ul of a mixture of 0.2 Units/ul Gibco T4 DNA ligase and 1 Unit/ul T4 polynucleotide kinase (Novagen) in 1× NEB ligase buffer was added, the reaction mixed by pipetting. The reaction was then allowed to proceed for approximately 1 hour at room temperature.

[0411] The T4 DNA polymerase and dNTP treatment generated 5′ overhangs on the two PCR products as described in the table below:

	225 bp PCR Product	770 bp PCR Product
PCR primers used	308-351	349-350
ds PCR prod	5′gac tct - - - cc aat	5′aat ggc - - - acc tta
	ctg aga - - - gg tta	tta ccg - - - tgg aat
Post T4 pol treat	5′gac tct - - - cc	5′aat ggc - - - acc
with dGTP/dCTP	ctg aga - - - gg tta	ccg - - - tgg aat

[0412] The 5′ overhangs of the two polynucleotides in bold are complementary to each other.

[0413] After incubating at room temperature, the reaction was analyzed by electrophoresis through a 2% Agarose gel in 1× TAE buffer, stained with EtBr and photographed under UV light.

Example 1B

[0414] Example 1B was performed using the substantially the same procedures of Example 1A with the following exceptions: The 225 bp product from pUC 19 was generated with oligos Seq ID NO: 15 and Seq ID NO: 22. The 770 bp product (GFP gene) was amplified with PCR primers Seq ID NO: 20 and Seq ID NO: 21. And the T4 DNA polymerase treatment contained 0.2 mM (each) dATP and dTTP, in place of dGTP and dCTP.

[0415] The T4 DNA polymerase and dNTP treatment generated 5′ overhangs on the two PCR products as described in the table below:

	225 bp PCR Product	770 bp PCR Product
PCR primers used	308-355	353-354
ds PCR prod	5′gac tct - - - taa ggc	5′ggc atg - - - taa ccg
	ctg aga - - - att ccg	ccg tac - - - att ggc
Post T4 pol treat	5′gac tct - - - taa	5′ggc atg - - - taa
with dATP/dTTP	tg aga - - - att ccg	tac - - - att ggc

[0416] The 5′ overhangs of the two polynucleotides in bold are complementary to each other.

[0417] After incubating at room temperature, the reaction was analyzed by electrophoresis through a 2% Agarose gel in 1× TAE buffer, stained with EtBr and photographed under UV light.

Example 1C

[0418] Example 1C was performed using substantially the same procedures of Example 1A with the following exceptions: The 225 bp product from pUC 19 was generated with oligos Seq ID NO: 15 and Seq ID NO: 26. The 770 bp product (GFP gene) was amplified with PCR primers Seq ID NO: 24 and Seq ID NO: 25

[0419] The T4 DNA polymerase and dNTP treatment generated 5′ overhangs on the two PCR products as described in the table below:

	225 bp PCR Product	770 bp PCR Product
PCR primers used	308-359	357-358
Ds PCR prod	5′gac tct - - - gaa aat	5′aaa atg g - - - acc taa
	ctg aga - - - ctt tta	ttt tac c - - - tgg att
Post T4 pol treat	5′gac tct - - - g	5′aaa atg g - - - acc
with dGTP/dCTP	ctg aga - - - ctt tta	c c - - - tgg att

[0420] The 5′ overhangs in bold will be complementary to each other.

[0421] After incubating at room temperature, the reaction was analyzed by electrophoresis through a 2% Agarose gel in 1× TAE buffer, stained with EtBr and photographed under UV light.

Example 1D

[0422] Example 1D was performed using substantially the same procedures of Example 1B with the following exceptions: The 225 bp product from pUC 19 was generated with oligos Seq ID NO: 15 and Seq ID NO: 30. The 770 bp product (GFP gene) was amplified with PCR primers Seq ID NO: 28 and Seq ID NO: 29.

[0423] The T4 DNA polymerase and dNTP treatment generated 5′ overhangs on the two PCR products as described in the table below:

	225 bp PCR Product	770 bp PCR Product
PCR primers used	308/363	361-362
ds PCR prod	5′gac tct - - - aa cc	5′cc atg - - - taa ggc
	ctg aga - - - tt gg	gg tac - - - att ccg
Post 14 pol treat	5′gac tct - - - aa	5′cc atg - - - taa
with dATP/dTTP	tg aga - - - tt gg	tac - - - att ccg

[0424] The 5′ overhangs of the two polynucleotides in bold are complementary to each other.

[0425] After incubating at room temperature, the reaction was analyzed by electrophoresis through a 2% Agarose gel in 1× TAE buffer, stained with EtBr and photographed under UV light.

Results of Examples 1A-1D

[0426] In each of the examples 1A-1D (depicted in FIG. 1), the desired result would be for the ligation of the 225 and 770 bp products to generate a DNA fragment of about 1000 bp in size. In FIG. 1, Lane 1=Promega 100 bp DNA molecular weight ladder; lane 2=Ex 1A reaction, lane 3=Ex 1B reaction; lane 4=Ex 1C reaction; lane 5=Ex 1D reaction.

[0427] FIG. 1 is a photograph of a gel that shows the relative efficiency of ligation under these conditions and is as follows: B=C>D>>A. The relative ligation efficiency in this experiment paralleled the calculated melting temperature (Tm) for the predicted sticky ends, using the formula Tm=2(A/T)+4 (G/C), where Tm is in degrees C. Using this formula the predicted Tms for the various sticky ends are: Ex 1B (12° C.), Ex 1C (10° C.), Ex 1D (8° C.), Ex 1A (6° C.).

[0428] If desired the ligation reaction step of the sticky RICE reaction can be performed at 16° C. and/or for extended periods of time to increase the final yield of ligated product.

Example 2

Construction of a Recombinant Plasmid Using Sticky RICE

[0429] Vector Preparation.

[0430] Several modifications of pUC 19 were generated using the polymerase chain reaction. Primer pairs were designed so that an “inverse PCR” reaction of the pUC 19 DNA template would generate a ds DNA of about 2.6 kb in size. The 5′ end of one primer of each pair will sit just upstream of the ATG start codon of the lac alpha peptide ORF, with its 3′ end proximal to the Lac promoter. The 5′ end of the other primer of each pair will sit just downstream of the stop codon of the lac alpha peptide with the 3′ end proximal to the promoter for the ampicillin resistance gene. FIG. 2 shows the plasmid pUC 19 and the relative locations and directions of the primers used for amplification of pUC 19 by PCR for experiments 2A-2D. Primers are represented by the solid arrows, 5′ (blunt end of arrow) to 3′ (point of arrow). Primers (Seq ID NOS:) 18, 22, 26 and 30 hybridize to pUC 19 at the location identified by primer B in FIG. 2. Primers (Seq ID NOS:) 19, 23, 27 and 31 hybridize to pUC 19 at the location identified by primer A in FIG. 2.

[0431] Specifically, FIG. 2 shows the plasmid pUC 19 and the relative locations and directions of the primers used for amplification of pUC 19 by PCR for experiments 2A-2D. Primers are represented by the solid arrows, 5′ prime (blunt end of arrow) to 3 prime (point of arrow). Primers (Seq ID NOS:) 18, 22, 26 and 30 hybridize to pUC 19 at the location identified by primer B in figure above. Primers (Seq ID NOS:) 19, 23, 27 and 31 hybridize to pUC 19 at the location identified by primer A in FIG. 2.

[0432] The pUC 19 plasmid was amplified by the PCR using oligos Seq ID NO: 18 and Seq ID NO: 19, in a 100 ul reaction using the 1× buffer described by Barnes (Barnes WM. 1994. PCR amplification of up to 35 kB DNA with high fidelity and high yield from lambda bacteriophage templates. PNAS 91(6) 2216-20). 100 pmoles each oligo, 0.2 mM final concentration of each dNTP (dGTP, dCTP, dATP, dTTP), 100 pg pUC 19 (Invitrogen) and 3.5U Taq DNA polymerase (Promega catalog # M1661) and 0.035 Units Pfu Turbo DNA polymerase (Stratagene) were combined to form a reaction mixture. The reaction was heated to 94° C. for 3 minutes then cycled for 30 times through the following three temperatures: 94° C., 30 sec; 50° C. 1 min; 72° C. 3 min. After the final cycle, the reaction was incubated at 72° C. for 5 minutes.

[0433] Separate PCR reactions of pUC 19 DNA template were set up as above, using the following primer pairs: SEQ ID NO: 22 and SEQ ID NO: 23; SEQ ID NO: 26 and SEQ ID NO: 27; SEQ ID NO: 30 and SEQ ID NO: 31.

[0434] The PCR reactions were then cooled to 37° C. and 20 units of the restriction endonuclease DpnI (New England Biolabs) was added to digest the dam methylated pUC 19 template DNA and the reaction incubated at 37° C. for 90 minutes.

[0435] Following the DpnI treatment, the PCR products were purified from unincorporated dNTPs, oligonucleotides, buffer, etc., using the StrataPrep PCR purification kit (Stratagene) using the manufacturers instructions. Each purified PCR product was eluted from StrataPrep columns with dH2O.

[0436] The various 2.6 kb pUC 19 PCR products were used in sticky RICE reactions with GFP PCR products from experiments 1A-1D (Examples 1A, 1B, 1C and 1D) as described below:

Example 2A

[0437] Approximately 20 ng purified pUC 19 PCR product and 12 ng of a 770 bp GFP PCR product were combined in a 10 ul reaction containing 1× NEB ligase buffer, 0.2 mM (each) dGTP and dCTP, 0.8 Units T4 DNA pol (Novagen LIC qualified), 0.06 Units Gibco T4 DNA ligase and 0.6 Units T4 polynucleotide kinase (Novagen). The reaction was incubated at room temperature for approximately 2.5 hours and then 1 ul was transformed into DH5a chemically competent E. coli cells (Gibco). Approximately ⅕th of the transformed cells were then plated onto individual LB Agar plates containing 100 ug/ml of Ampicillin and plates were incubated overnight at 37° C.

[0438] The following day, individual colonies were picked into 2 ml samples of LB broth containing 100 ug/ml Ampicillin, and grown overnight in an incubator-shaker at 37° C. at approx 250-300 rpm. Plasmid DNA was prepared from these overnight liquid cultures using the StrataPrep Plasmid Miniprep kit (Stratagene) according to the manufacturer's instructions.

[0439] To screen for the presence of a GFP sized DNA insert in plasmids, individual DNA samples of 2 ul were digested with the restriction endonuclease AflIII (NEB) according to manufacturers suggestions. AflIII will cleave once in the pUC 19 backbone, and once in the GFP insert, to release a DNA fragment of approximately 700 bp. AflIII digested DNA samples were analyzed by electrophoresis through a 1% agarose gel in 1× TAE buffer. The gel was then stained with Ethidium bromide staining and photographed under UV light. The presence of a insert band of about 700 bp indicated the presence of an insert in a plasmid.

[0440] The T4 DNA polymerase and dNTP treatment generated 5′ overhangs on the two PCR products as described in the table below:

	pUC 19 PCR Product	770 bp PCR Product
PCR primers used	351-352	349-350
ds PCR prod	5′tta ggt - - - cc aat	5′aat ggc - - - acc tta
	aat cca - - - gg tta	tta ccg - - - tgg aat
Post T4 pol treat	5′tta ggt - - - cc	5′aat ggc - - - acc
with dGTP/dCTP	cca - - - gg tta	ccg - - - tgg aat

Example 2B

[0441] The sticky RICE reaction of Ex 2B was set up using substantially the same procedures of 2A except that 0.2 mM (each) dATP and dTTP were used in place of 0.2 mM dGTP and dCTP, and PCR products of oligos (SEQ ID NO: 22)/(SEQ ID NO: 23) and (SEQ ID NO: 20)/(SEQ ID NO: 21) were used.

[0442] The T4 DNA polymerase and dNTP treatment generated 5′ overhangs on the two PCR products as described in the table below:

	pUC 19 PCR product	770 bp PCR Product
PCR primers used	355-356	353-354
ds PCR prod	5′ccg ttt - - - taa ggc	5′ggc atg - - - taa ccg
	ggc aaa - - - att ccg	ccg tac - - - att ggc
Post 14 pol treat	5′ccg ttt - - - taa	5′ggc atg - - - taa
with dATP/dTTP	aaa - - - att ccg	tac - - - att ggc

[0443] The 5′ overhangs in bold are complementary to each other. The 5′ overhangs underlined are complementary to each other.

Example 2C

[0444] The sticky RICE reaction of Ex 2C was set up using substantially the same procedures of 2A except that the PCR products of (SEQ ID NO: 26)/(SEQ ID NO: 27) and (SEQ ID NO: 24)/(SEQ ID NO: 25) were used.

[0445] The T4 DNA polymerase and dNTP treatment generated 5′ overhangs on the two PCR products as described in the table below:

	pUC 19 PCR Product	770 bp PCR Product
PCR primers used	359-360	357-358
ds PCR prod	5′taa cct - - - gaa aat	5′aaa atg g - - - acc taa
	att gga - - - ctt tta	ttt tac c - - - tgg att
Post T4 pol treat	5′taa cct - - - g	5′aaa atg g - - - acc
with dGTP/dCTP	gga - - - ctt tta	c c - - - tgg att

[0446] The 5′ overhangs in bold will be complementary to each other. The 5′ overhangs underlined will be complementary to each other.

Example 2D

[0447] The sticky RICE reaction of Ex 2D was set up using substantially the same procedures of 2B except that PCR products of oligos (SEQ ID NO: 30)/(SEQ ID NO: 31) and (SEQ ID NO: 28)/(SEQ ID NO: 29) were used.

[0448] The T4 DNA polymerase and dNTP treatment generated 5′ overhangs on the two PCR products as described in the table below:

	pUC 19 PCR product	770 bp PCR Product
PCR primers used	353-364	361-362
ds PCR prod	5′ggc ttt - - - aa cc	5′cc atg - - - taa ggc
	ccg aaa - - - tt gg	gg tac - - - att ccg
Post T4 pol treat	5′ggc ttt - - - aa	5′cc atg - - - taa
with dATP/dTTP	aaa - - - tt gg	tac - - - att ccg

[0449] The 5′ overhangs in bold are complementary to each other. The 5′ overhangs underlined are complementary to each other.

Results of Examples 2A-2D:
	Rxn	# colonies/plate	% colonies with inserts
	2A	6	2/8	(25%)
	2B	ca. 250	23/24	(96%)
	2C	>700	23/32	(72%)
	2D	>700	21/32	(66%)

[0450] FIG. 3 is a photograph of a gel of the experimental results of Example 2 (Sticky RICE cloning of inserts into pUC using T4 DNA ligase). Plasmids from the cloning reactions described in examples 2A-2D were digested with AflIII to screen for the presence of a GFP insert. Plasmids with the GFP PCR product insert are expected to release a DNA fragment of approx. 700 bp after digestion with AflIII. Lanes of gel are numbered from left to right. The far right and left lanes of both top and bottom half of gel contain 1 Kb DNA ladders from New England Biolabs. The bottom half of the gel contains 8 isolates of clones from experiment 2A (lanes 2,4,6,8,10,12,14 and 16). Isolates of experiment 2B cloning are in the bottom of the gel, odd numbered lanes 3-17, and lanes 18-33 (24 isolates total). Isolates of experiment 2C are in lanes 34-49 in the bottom of the gel, and lanes 2-17 in the top of the gel (32 isolates total). Isolates of experiment 2D are in lanes 18-49 in the top of the gel (32 isolates total). The approx 700 bp band is the lower of the two bands in lane 3 in the bottom of gel.

Experiment 3

[0451] Sticky RICE with E. coli DNA Ligase

[0452] Rxns 3A-3D were performed as described for 2A-2D, respectively, with the following modifications:

[0453] 1. The reactions were performed in 1× E. coli DNA ligase buffer (New England Biolabs) supplemented with rATP to a final concentration of 1 mM.

[0454] 2. Each 10 ul sticky RICE reaction contained 0.7 Units T4 DNA pol (Novagen LIC qualified), 6.6 Units E. coli DNA ligase (NEB) and 1.1 Units T4 polynucleotide kinase (NEB).

[0455] 3. Reactions proceeded at room temperature overnight. One microliter of each sticky RICE reaction (3A-3D) was transformed in to DH5a chemically competent E. coli cells (Gibco), according to manufacturers instructions. Approximately ½ of the entire sample of transformed cells were plated on LB Agar plates containing 100 ug/ml Ampicillin and plates were incubated overnight at 37° C.

[0456] The following day, individual colonies were picked into 2 ml samples of LB broth containing 100 ug/ml Ampicillin, and grown overnight in an incubator-shaker at 37° C. at approx 250-300 rpm. Plasmid DNA was prepared from these overnight liquid cultures using the StrataPrep Plasmid Miniprep kit (Stratagene) according to the manufacturer's instructions.

[0457] To screen for the presence of a GFP sized DNA insert in plasmids, individual DNA samples of 2 ul were digested with the restriction endonuclease AflIII (NEB) according to manufacturers suggestions. AflIII will cleave once in the pUC 19 backbone, and once in the GFP insert, to release a DNA fragment of approximately 700 bp. AflIII digested DNA samples were analyzed by electrophoresis through a 1% agarose gel in 1× TAE buffer. The gel was then stained with Ethidium bromide staining and photographed under UV light. The presence of a insert band of about 700 bp indicated the presence of an insert in a plasmid.

Results of transformation reaction.
	Reaction	# colonies	% clones with insert
	3A	0	NA
	3B	>500	8/8 (100%)
	3C	0	NA
	3D	>500	7/8 (88%)

[0458] FIG. 4 is a photograph of a gel of the experimental results of Example 3, (Sticky RICE cloning of inserts into pUC using E. coli ligase). Lanes of gel are numbered left to right. Lanes 1 and 18 contain a 1 Kb DNA ladder from New England Biolabs. Lanes 2-9 contain 8 isolates of Exp 3B. Lanes 10-17 contain 8 isolates of Exp 3D. The approximately 700 bp band released upon digestion with AflIII is the lower of the two bands in lane 4, for example. The AflIII restriction digest did not go to completion in all samples due to the large amount of DNA contained in some samples. This resulted in a partial DNA digest for many samples, though the unique 700 bp band can still be detected.

Example 4

Sticky RICE Cloning of PCR Fragments into a SapI Cut Vector

[0459] A tobacco mosaic virus based plant expression vector (Shivrasad et al 1999) was modified to contain 2 unique SapI restriction sites.

[0460] The typeII S restriction enzyme SapI, cleaves ds DNA to leave 3nt 5′ overhangs. A TMV based CDNA clone in a plasmid was generated with two SapI sites, such that SapI digested plasmid would be compatible with a sticky RICE cloning strategy of PCR products. This was accomplished as follows:

[0461] Mutation of the SapI Site in the pUC DNA Backbone of a p30BGFPc3 Vector (pCLONE5).

[0462] Since the desired plasmid will only have SapI sites in the TMV cDNA insert, the SapI site, which exists in the pUC plasmid backbone, must first be mutated. This was accomplished by using the PCR to amplify a portion of pCLONE5 DNA with oligos SEQ ID NO: 15 and 30B7093F, spanning from near the 3′ end of the virus cDNA insert, to just downstream of the SapI site in the pUC backbone. The resulting PCR product was digested with the restriction enzymes KpnI and Earl, electrophoresed thru an agarose gel, and a ds DNA fragment of approximately 300 bp was isolated from the gel. This DNA fragment was then ligated to the approximately 10 Kb DNA fragment of a pCLONE5 digested with SapI and KpnI. The resulting plasmid was named pC5DSapI.

[0463] pC5DSapI was digested with NcoI and PmlI (which cleave at nts 5459 and 6536, respectively, in pC5DSapI). The resulting 9.3 kb fragment was gel isolated.

[0464] Using pCLONE5 template DNA, a DNA fragment of approximately 700 bp was amplified using oligos SEQ ID NO: 34 and 30B5123F. Oligo SEQ ID NO: 34 will generate a SapI site fused to TMV cDNA vector sequences.

[0465] A cDNA insert of human thymosin cDNA was amplified and cloned into pcDNA3.1 V5 His topo cloning vector (Invitrogen). The thymosin insert and V5 His6 sequence was PCR amplified from this plasmid with oligos SEQ ID NO: 32 and a thymosin specific (forward) primer containing a PacI site near its 5′ end. This PCR product was digested with PacI and SalI and ligated into PacI-XhoI digested pCLONE5, in order to insert the V5 epitope and His6 coding sequence into the TMV cDNA. From this plasmid, the V5 His6 sequence and downstream TMV vector sequence was amplified by PCR with oligos SEQ ID NO: 35 and 30B6543R (a fragment of about 200 bp). Oligo SEQ ID NO: 35 will generate a SapI site just upstream of the V5 epitope coding sequence.

[0466] These two PCR fragments were joined together in a sticky RICE reaction by combining approximately equamolar amounts of PCR products with T4 DNA polymerase and dGTP/dCTP blocking nucleotides, T4 polynucleotide kinase, and T4 ligase in 1× NEB ligase buffer, under conditions similar to those described in Example 1.

[0467] After the Sticky RICE reaction, the reaction was extracted with phenol and chloroform and the DNA precipitated with ammonium acetate and ethanol using standard conditions. The precipitated DNA was washed with 70% EtOH, briefly dried and ultimately resuspended in dH2O. This DNA was then digested with the restriction endonucleases NcoI and PmlI. The digested DNA was electrophoresed through an agarose gel and the approx 570 bp fragment gel isolated. This approx. 570 bp fragment was then ligated into the approximately 10 Kb fragment of NcoI-PmlI digested pC5DSapI. This generated the plasmid pLSB 1176 (see FIG. 13), which has the following (relevant) polylinker sequence:

StsI
BstY I                                       Fok I
Dra I  Bgl II                                       BstF5 I
|      |                                            |
TCGTTTTAAATAgatcttacaGTATCACTACTCCatctcagttcgtgttcttgtcaggat
AGCAAAATTTATctagaatgtCATAGTGATGAGGtagagtcaagcacaagaacagtccta
|    . |       .         .         .         .      |  .
5705   5712                                       5757 5760
5712                                       5757
5757
Sap I                               Mbo II                     EcoR V   TspR I
Mbo II       Nhe I                 Ear I                  Sfc I      Msl I
Ear I        AceII      BceF I    Sap I                   Pst I     BstX I
|            |          |         |||                     |    |    ||  |
gagaagagcTTTTTTGCTAGCGCGGAGCCGTTTTTTgctcttcaaaaccccaagacaattctgcagatatccagCACAGT
ctcttctcgAAAAAACGATCGCGCCTCGGCAAAAAAcgagaagttttggggttctgttaagacgtctataggtcGTGTCA
|      .     |   .      |  .      |||.         .         .|    |   .||  |    .
5763         5776       5787      5797                    5821      5831     5840
Note the position of the 2 SapI sites (at approx nt 5763 and 5797). The SapI site
at 5763 cuts to its left, leaving an TAC5′ overhang on the bottom strand and
the SapI site at 5797 cuts to its right, leaving a 5′ AAA overhang on the
top strand.

[0468] For pLSB 1176, the following Oligos were used:

gactcttcaa gcgcaagagc gcccaatacg ca SEQ ID NO: 15
CggCTggTCg ACgCGggTTT A          SEQ ID NO: 32
AACTCAATgg TgATg                 SEQ ID NO: 33
AAAAAAgCTC TTCTCATCCT gACAAgAACA CgAACTgAgA T SEQ ID NO: 34
TTTTTTgCTC TTCAAAACCC CAAgACAATT CTgCAgATAT CCAg SEQ ID NO: 35
TTTTTTgCTA gCgCggAgCC gTTTTTTgCT CTTCAAAACC CCAAgACA SEQ ID NO: 36
(30B 5123F) TgTTTAgCCg gTTTggTCgT SEQ ID NO: 37
(30B 7093F) TTgATCCgTT gATCACggCg T SEQ ID NO: 38
(30B 6543R) CACTATgCgT TATCgTACgC A SEQ ID NO: 39

[0469] After digestion with SapI, the vector pLSB 1176 was electrophoresed thru a 1% agarose in 1× TAE gel and isolated from the gel.

[0470] An insert was prepared for this vector by PCR of the GFPc3 gene from pCLONE5 with the oligos:

SEQ ID NO: 46
ATg CCC gCT AgC AAA ggA gAA gAA CTT TTC and
SEQ ID NO: 47
TTT CCC TTT gTA gAg CTC ATC CAT gCC ATg

[0471] (SEQ ID NO: 46 is the Forward direction oligo for GFP and SEQ ID NO: 47 is the Reverse direction oligo for GFP) which would generate a PCR product of about 770 bp which, when treated with dGTP would give sticky ends compatible with the approximately 10 kb SapI digested pLSB 1176 vector fragment (see table below).

	Insert DNA ends (SEQ ID NO: 40)	SapI cut Vector DNA ends
Treat with T4	atg ccc GCT AGC--- tac aaa ggg aaa	--cagg aaa ccc---
DNA pol and	tac ggg cga tcg -- atg ttt ccc ttt	--gtcc tac ggg---
dGTP
post T4+	atg ccc GCT AGC--- tac aaa ggg	--cagg aaa ccc---
dGTP treat	ggg cga tcg -- atg ttt ccc ttt	--gtcc tac ggg--
Note that in FIG. 13 the sticky ends of the SapI cut vector are unchanged by the T4 + dGTP treatement. 24 ng of SapI cut pLSB 1176 vector and 4 ng of PCR product were combined in a 10 ul rxn containing 0.2 mM dGTP in 1 × NEB ligase buffer and 1.25 Units Novagen LIC qualified T4 DNA pol.
Reaction was incubated at 37° C. for about 30-40 min, and 0.5 Units of Gibco DNA ligase added to the reaction.
The reaction was then mixed by pipetting and incubated at 16° C. overnight. One microliter of the overnight ligation mix was transformed into DH5a chemically competent E. coli cells (Gibco).
After transformation the cells were plated on LB agar plates containing 100 ug/ml ampicillin. Plates were incubated overnight at 37° C.
The next day 12 colonies were picked from the plates and used to inoculate 2 ml samples of LB broth with 100 ug/ml ampicillin. DNA was prepared from liquid cultures using the strataprep plasmid DNA purification system (Stratagene).
DNA samples were screened for the presence of the GFP based PCR insert by digestion with the restriction endonuclease HindIII followed by agarose gel electrophoresis of the digested DNAs. Of 12 plasmids screened in this manner, all 12 had inserts.

[0472] FIG. 5 is a photograph of a gel of the experimental results for Example 4 (Sticky RICE cloning of GFP PCR product into SapI digested vector DNA—pLSB 1176). The lanes of gel are numbered from left to right. Lane 1 contains a 1 Kb DNA ladder from New England Biolabs. Lane 2 contains HindIII digested pCLONE 5 control DNA (which already contains the GFP insert). Clones of interest from the experiment will generate the same HindIII restriction enzyme digestion pattern as the pCLONE 5 control DNA. Lanes 3-14 contain isolates 1-12 of Experiment 4. Note all show HindIII restriction enzyme digestion patterns equivalent to the control.

Example 5

The effect of Relative Polymerase, Kinase and Ligase Concentrations on Sticky RICE Reactions

[0473] Experiments were conducted to examine the effect of relative polymerase and kinase and ligase concentrations on the efficiency of the Sticky RICE reaction. Various concentrations of kinase and polymerase were assembled, keeping the T4 DNA ligase (Gibco/BRL) concentration constant at 0.25 units per reaction. Concentrations of T4 DNA polymerase (Novagen LIC qualified) from 2.5 U to 0 U were tested. T4 DNA kinase (New England Biolabs) concentrations between 2.5 and 0 U were also tested. Each reaction consisted of 7.8 ng of a 225 bp PCR product, 25 ng of a 725 bp PCR product, 1 ul 10× ligase buffer (New England Biolabs), 1 ul 2 mM dATP/dTTP stock solution in a final volume of 12.4 ul. Sources of enzymes were as follows: T4 DNA polymerase (Novagen, LIC qualified), T4 polynucleotide kinase (New England Biolabs), T4 DNA ligase (Gibco/BRL).

[0474] Two different temperatures were tested in this Sticky RICE experiment. Reactions were either incubated at 37° C. for 10 minutes followed by 2 hours at room temp, or were treated only at room temperature for 2 hours. The Sticky RICE reactions were terminated by incubation at 75° C. for 10 minutes. Reactions were then electrophoresed on a 1.5% agarose gel (in 1× TAE buffer, Sambrook et al Molecular cloning manual). After electrophoresis DNA was visualized by staining the gel with ethidium bromide (EtBr) and photographed under long wave UV light, as per standard conditions (Sambrook et al.). To estimate the efficiency of the Sticky RICE reaction the staining intensity of the approx 950 bp band (formed by the joining of the 225 and 725 bp DNA fragments, for example the “top” band in Lane 10 of FIG. 6) relative to the staining intensity of the 725 pb product was compared.

[0475] The 225 and 725 bp DNA fragments used in this Sticky RICE experiment were obtained by amplifying portions of the plasmid pUC 19 (using Pfu DNA polymerase from Stratagene Corp. and standard PCR reaction conditions, as suggested by the manufacturer) with the following primers:

[0476] PCR primers used:

SEQ ID NO: 15
5′ gactcttcaa gcgcaagagc gcccaatacg ca 3′
SEQ ID NO: 42
5′ ggcttagctg tttcctgtgt gaaattgtt 3′
SEQ ID NO: 43
5′ gccatggcta gcaaaggaga agaa c 3′
SEQ ID NO: 21
5′ cggttatttg tagagctcat ccatgcca 3′

[0477] The sequences of the 225 and 725 bp DNAs is presented below (225 Seq and 775 Seq)

225 Seq:
SEQ ID NO: 44
GACTCTTCA AGCGCAAGAGCG CCCAATACGCAA ACCGCCTCTCCC CGCGCGTTGGCC GATTCATTAATG CAGCTG
GCACGACAG GTTTCCCGACTG GAAAGCGGGCAG TGAGCGCAACGC AATTAATGTGAG TTAGCTCACTCA TTAGGC
ACCCCAGGC TTTACACTTTAT GCTTCCGGCTCG TATGTTGTGTGG AATTGTGAGCGG ATAACAATTTCA CACAGG
AAACAGCTA AGCC
725 Seq:
SEQ ID NO: 45
GCCATGAGT AAAGGAGAAGAA CTTTTCACTGGA GTTGTCCCAATT CTTGTTGAATTA GATGGTGATGTT AATGGG
CACAAATTT TCTGTCAGTGGA GAGGGTGAAGGT GATGCAACATAC GGAAAACTTACC CTTAAATTTATT TGCACT
ACTGGAAAA CTACCTGTTCCA TGGCCAACACTT GTCACTACTTTC TCTTATGGTGTT CAATGCTTTTCA AGATAC
CCAGATCAT ATGAAACGGCAT GACTTTTTCAAG AGTGCCATGCCC GAAGGTTATGTA CAGGAAAGAACT ATATTT
TTCAAAGAT GACGGGAACTAC AAGACACGTGCT GAAGTCAAGTTT GAAGGTGATACC CTTGTTAATAGA ATCGAG
TTAAAAGGT ATTGATTTTAAA GAAGATGGAAAC ATTCTTGGACAC AAATTGGAATAC AACTATAACTCA CACAAT
GTATACATC ATGGCAGACAAA CAAAAGAATGGA ATCAAAGTTAAC TTCAAAATTAGA CACAACATTGAA GATGGA
AGCGTTCAA CTAGCAGACCAT TATCAACAAAAT ACTCCAATTGGC GATGGCCCTGTC CTTTTACCAGAC AACCAT
TACCTGTCC ACACAATCTGCC CTTTCGAAAGAT CCCAACGAAAAG AGAGACCACATG GTCCTTCTTGAG TTTGTA
ACAGCTGCT GGGATTACACAT GGCATGGATGAA CTATACAAATGA CCG

[0478] During the Sticky RICE reaction the 3′ ends of the PCR products will be removed by the 3′ to 5′ exonuclease activity of the DNA polymerase, until the appropriate template nucleotide is reached. In this example the DNA is treated with T4 DNA polymerase in the presence of dATP and dTTP so that 5′ overhangs consist of only of G and C residues as described below:

	225 bp PCR product	726 bp PCR product
	from pUC19	from p30BGFPc3
PCR primers used:	308-397	398-354
ds 9CR product:	5′ gac tct ----- taa gcc	5′ gcc atg ----- taa ccg
	ctg aga ----- att cgg	cgg tac ----- att ggc
Post T4 pol treat	5′ gac tct ----- taa	5′ gcc atg ----- taa
with dATP/dTTP	tg aga ----- att cgg	tac ----- att ggc
*The 5′ overhangs in bold will be complementary to each other.

[0479] The amounts of polymerase, kinase and ligase in each reaction, and the gel loading is presented in Table 1. The gel image is shown in FIG. 6, below.

[0480] Note that not all combinations of polymerase, kinase and ligase resulted detectable amounts of recombinant DNA joining in this experiment. The experimental results demonstrate that “too much” or “too little” kinase or polymerase can result in inefficient DNA joining reactions. For example in Lane 1 a reaction with 2.5 U Pol, 2.5 U kinase and 0.25 U ligase did not result in any detecable DNA joining, but the reaction in Lane 5 which had 1.5 U Pol, 2.5 Kinase and 0.25 U ligase did result in detectable levels of DNA joining. Similarly the reaction in Lane 13 (0.1 U Pol, 2.5 U kinase and 0.25 U ligase) did not produce any detectable DNA joining, but the reaction in lane 63 (0.1 U Pol, 0.1 U kinase and 0.25 U ligase) did generate detectable levels of DNA joining. These results demonstrate that the relative levels of these three enzymatic activities dramatically effects the Sticky RICE reaction and that not all enzyme ratios lead to efficient joining of DNAs in vitro.

TABLE 1
Description of loading of gel shown in FIG. 6:
Bottom Row, Left to Right.	Middle Row, Left to Right	Top Row, Left to Right
Lane	Pol (U)	Kinase (U)	Ligase (U)	Lane	Pol (U)	Kinase (U)	Ligase (U)	Lane	Pol (U)	Kinase (U)	Ligase (U)
1	2.5	2.5	0.25 U	51	2.5	0.1	0.25 U	101	2.5	0.5	0.25 U
2	2.5	2	0.25 U	52	2.5	0	0.25 U	102	2.5	0.25	0.25 U
3	2	2.5	0.25 U	53	2	0.1	0.25 U	103	2	0.5	0.25 U
4	2	2	0.25 U	54	2	0	0.25 U	104	2	0.25	0.25 U
5	1.5	2.5	0.25 U	55	1.5	0.1	0.25 U	105	1.5	0.5	0.25 U
6	1.5	2	0.25 U	56	1.5	0	0.25 U	106	1.5	0.25	0.25 U
7	1	2.5	0.25 U	57	1	0.1	0.25 U	107	1	0.5	0.25 U
8	1	2	0.25 U	58	1	0	0.25 U	108	1	0.25	0.25 U
9	0.5	2.5	0.25 U	59	0.5	0.1	0.25 U	109	0.5	0.5	0.25 U
10	0.5	2	0.25 U	60	0.5	0	0.25 U	110	0.5	0.25	0.25 U
11	0.25	2.5	0.25 U	61	0.25	0.1	0.25 U	111	0.25	0.5	0.25 U
12	0.25	2	0.25 U	62	0.25	0	0.25 U	112	0.25	0.25	0.25 U
13	0.1	2.5	0.25 U	63	0.1	0.1	0.25 U	113	0.1	0.5	0.25 U
14	0.1	2	0.25 U	64	0.1	0	0.25 U	114	0.1	0.25	0.25 U
15	0	2.5	0.25 U	65	0	0.1	0.25 U	115	0	0.5	0.25 U
16	0	2	0.25 U	66	0	0	0.25 U	116	0	0.25	0.25 U
17	100 bp ladder	67	100 bp ladder	117	100 bp ladder (Promega)
18	2.5	1.5	0.25 U	68	2.5	2.5	0.25 U	118	2.5	0.1	0.25 U
19	2.5	1	0.25 U	69	2.5	2	0.25 U	119	2.5	0	0.25 U
20	2	1.5	0.25 U	70	2	2.5	0.25 U	120	2	0.1	0.25 U
21	2	1	0.25 U	71	2	2	0.25 U	121	2	0	0.25 U
22	1.5	1.5	0.25 U	72	1.5	2.5	0.25 U	122	1.5	0.1	0.25 U
23	1.5	1	0.25 U	73	1.5	2	0.25 U	123	1.5	0	0.25 U
24	1	1.5	0.25 U	74	1	2.5	0.25 U	124	1	0.1	0.25 U
25	1	1	0.25 U	75	1	2	0.25 U	125	1	0	0.25 U
26	0.5	1.5	0.25 U	76	0.5	2.5	0.25 U	126	0.5	0.1	0.25 U
27	0.5	1	0.25 U	77	0.5	2	0.25 U	127	0.5	0	0.25 U
28	0.25	1.5	0.25 U	78	0.25	2.5	0.25 U	128	0.25	0.1	0.25 U
29	0.25	1	0.25 U	79	0.25	2	0.25 U	129	0.25	0	0.25 U
30	0.1	1.5	0.25 U	80	0.1	2.5	0.25 U	130	0.1	0.1	0.25 U
31	0.1	1	0.25 U	81	0.1	2	0.25 U	131	0.1	0	0.25 U
32	0	1.5	0.25 U	82	0	2.5	0.25 U	132	0	0.1	0.25 U
33	0	1	0.25 U	83	0	2	0.25 U	133	0	0	0.25 U
34	100 bp ladder (Promega)	84	100 bp ladder (Promega)	134	100 bp ladder (Promega)
35	2.5	0.5	0.25 U	85	2.5	1.5	0.25 U
36	2.5	0.25	0.25 U	86	2.5	1	0.25 U
37	2	0.5	0.25 U	87	2	1.5	0.25 U
38	2	0.25	0.25 U	88	2	1	0.25 U
39	1.5	0.5	0.25 U	89	1.5	1.5	0.25 U
40	1.5	0.25	0.25 U	90	1.5	1	0.25 U
41	1	0.5	0.25 U	91	1	1.5	0.25 U
42	1	0.25	0.25 U	92	1	1	0.25 U
43	0.5	0.5	0.25 U	93	0.5	1.5 0.25 U
44	0.5	0.25	0.25 U	94	0.5	1	0.25 U
45	0.25	0.5	0.25 U	95	0.25	1.5	0.25 U
46	0.25	0.25	0.25 U	96	0.25	1	0.25 U
47	0.1	0.5	0.25 U	97	0.1	1.5	0.25 U
48	0.1	0.25	0.25 U	98	0.1	1	0.25 U
49	0	0.5	0.25 U	99	0	1.5	0.25 U
50	0	0.25	0.25 U	100	0	1	0.25 U
Samples* in lanes 1-67 were treated at 37 C. 10 min, then 2 hrs at room temp.
Samples* in lanes 68-134 were treated 2 hrs at room temp
*Excludes 100 bp ladder samples (Lanes 17, 34, 67, 84, 117, 134).

[0481] As can be seen from the data in FIG. 6, the Sticky RICE reaction efficiently joined the two DNA molecules over a wide range of polymerase, kinase and ligase levels. The most efficient reactions are in bold in the table above. Also the Sticky RICE reaction works either at a single temp (room temperature only) or when treated first at 37C. and then later shifted to room temperature.

Example 6

Effects of Temperature and Enzyme Levels on the Sticky RICE Reaction Efficiency

[0482] Sticky RICE reactions were assembled as follows: The final volume of each reaction was 12.4 ul. Each reaction contained 1 ul 10× NEB ligase buffer, 25 ng of the 775 bp fragments described in Example 5 and 8 ng of the 225 bp fragment described in Example 5, as well as 1 ul 2 mM dTTP/dATP. Various amounts of polymerase (T4 DNA polymerase, Novagen, LIC qualified), ligase (Gibco) and kinase (NEB T4 polynucleotide kinase) were added to various reactions and the final volume brought to 12.4 ul with dH2O, as needed.

TABLE 2
Reaction Conditions For Example 6
Rxn #:	Pol (U)	Kinase (U)	Ligase	37 C.	RT
1	1 unit	2 Units	0	10 min	60 min
2	1	2	0.1	10 min	60 min
3	1	2	0.25	10 min	60 min
4	1	2	0.5	10 min	60 min
5	1	2	0.75	10 min	60 min
6	1	2	1	10 min	60 min
7	1	2	2	10 min	60 min
8	1	2	0.25	10 min	60 min
9	0.25	0.5	0	10 min	60 min
10	0.25	0.5	0.1	10 min	60 min
11	0.25	0.5	0.25	10 min	60 min
12	0.25	0.5	0.5	10 min	60 min
13	0.25	0.5	0.75	10 min	60 min
14	0.25	0.5	1	10 min	60 min
15	0.25	0.5	2	10 min	60 min
16	0.25	0.5	0.75	10 min	60 min

[0483] All three enzyme activities were added to all reactions, except for the control reactions (1 and 9), which had no ligase added. Reactions were incubated at 37C. for 10 minutes, then left at room temperature for 1 hour with the following exceptions: For reactions 8 and 16 only the polymerase and kinase activities were added, the reaction incubated at 37C. for 10 minutes, then incubated at 75C. for 10 minutes to inactivate kinase and polymerase. Reactions 8 and 16 were then cooled to room temp. and ligase added at the levels described above. Finally the reactions (8 and 16) were incubated at room temp for 1 hour after the addition of ligase. All reactions were incubated at 75 C. for 10 minutes prior to being loaded onto a 1.5% agarose gel in 1× TAE. DNA bands were visualized by staining gel with EtBr and UV as described for Example 1 and is shown in FIG. 7, below. Note that the presence and intensity of the 1 Kb band demonstrates the efficiency of the sticky RICE reaction. The Sticky RICE reaction can be performed by treating the DNAs with kinase and polymerase and then inactivating the polymerase and kinase activities before adding the ligase (reactions 8 and 16).

[0484] In FIG. 7, the lanes are numbered left to right. Lane 1: Promega 100 bp ladder. Lanes 2- 17, reactions 1-16, respectively. Lane 18, Promega 100 bp ladder.

Example 7

Joining of PCR Products: Sticky RICE Cloning System

[0485] Directional Cloning System

[0486] Directional joining of PCR products using novel sticky RICE technology allows fast and efficient construction of recombinant DNAs from PCR products generated with proofreading or non-proofreading polymerases.

[0487] Features and benefits

[0488] Join PCR products in less than 1 hour

[0489] Requires less primer design than sequence overlap extension (SOE)

[0490] High specificity directional joining of PCR products

[0491] Single temperature reaction

[0492] No restriction enzymes required

[0493] Principle

[0494] Sticky RICE, like the PCR-based technique of sequence overlap extension (SOE) can be used to directionally join double stranded DNA molecules without the use of restriction enzymes.

[0495] Using the Sticky RICE enzyme mixture, sticky ends are generated, annealed and DNAs joined in a single temperature reaction in less time than an SOE reaction. Since primer design is less complex than with SOE the reaction is both easier and less expensive, and DNAs are joined without the use of error prone DNA polymerases or thermocycling steps.

[0496] Specific Recombination in Less Than 1 Hour

[0497] Sticky RICE Recombination

[0498] FIG. 8A shows the results of directional joining of a 225 and 725 bp PCR product sharing a 3 bp overlap. PCR products were combined with various amounts of sticky rice enzyme mixture and incubated at room temperature for 1 hour. Reactions were analyzed on a 1.5% agarose gel. Lanes 1-4, sticky RICE reactions with 0.5, 0.25, 0.1 or 0 ul of sticky RICE enzyme mix; M, 100 bp Marker. FIG. 8B depicted the basic steps of Sticky RICE Recombination in accordance with the present invention.

Example 8

Cloning of PCR Products: Sticky RICE Cloning System

[0499] Directional Cloning System

[0500] Directional ligation of PCR products using novel sticky RICE technology allows fast and efficient ligation of PCR products, generated using either proofreading or non-proofreading polymerases, into plasmids.

[0501] Features and benefit

[0502] No restriction enzymes needed

[0503] Directional cloning

[0504] Clone PCR products of proofreading or non-proofreading polymerases

[0505] Rapid ligation time

[0506] High cloning efficiency

[0507] Principle

[0508] Use the Sticky RICE technique to directionally ligate PCR products into a vector of choice without using restriction enzymes. PCR products amplified with any polymerase (proofreading or non-proofreading) can be directly cloned.

[0509] Using the sticky RICE enzyme mixture sticky ends are generated, annealed and DNAs joined in a single temperature reaction in less time than a typical restriction enzyme digestion. Recombinant plasmids are generated in a simple room temperature reaction.

[0510] High Efficiency Directional Cloning into a 10 kb Plasmid

[0511] Sticky RICE Cloning Kit Procedure

[0512] FIG. 9A depicts results of an experiment where a 0.8 kb PCR product was ligated into a 10 kb TMV expression vector plasmid using Sticky RICE. DNA samples from 12 isolates (lanes 1-12) were digested with HindIII and compared to HindIII digested positive control DNA (C). All 12 isolates gave the expected restriction enzyme digestion pattern. Lane M; MW marker. FIG. 9B shows the basic steps of a Sticky RICE Cloning Kit Procedure in accordance with the present invention.

[0513] In FIG. 10A, the basic steps of the Sticky RICE methodology are represented showing alternative ways to perform Sticky RICE and thereby joining DNA fragments. Specifically, multiple double stranded DNA fragments A and B, shown in steps S1a and S1b, respectively, in FIG. 10A, are treated with DNA polymerase and the appropriate blocking dNTPs (and optional DNA kinase activity) in separate reactions, as represented at steps S2a and S2b, respectively. In steps S2a and S2b, DNA kinase activity is optional and is therefore shown in parenthesis. Thereafter, there are two alternatives. First, following DNA polymerase treatment in the presence of blocking dNTP(s), the fragments can be directly combined, as indicated at step S3. Next, as shown at step S4, DNA ligase activity, DNA polymerase and blocking dNTP are added to the combined fragments, resulting in the annealing and covalent joining of fragments A and B. The addition of kinase is also optional in step S4

[0514] Alternatively, after steps S2a and S2b, as shown in FIG. 10A, the fragments are inactivated at steps S5a and S5b by chemical means (clean up of DNA using DNA purification kits such as Stratagene PCR clean up kit, or Qiaquick DNA clean up kit, etc.) or heat treatment (for example 75° C. for 10 min) of the reactions, or the DNA can be separated from the enzymes (pol and kinase) by physical separation (for example use of a CentriSep spin column, Princeton Separations, will remove unincorporated dNTPs, and proteins, from the reaction). Next, as indicated at step S6, the fragments are combined with ligase, DNA polymerase and blocking dNTP. Use if kinase in step S6 is optional.

[0515] To more clearly represent the two embodiments depicted in FIG. 10A, FIGS 10B and 10C are provided with the two alternative embodiments separated. Specifically, in FIG. 10B, multiple double stranded DNA fragments A and B, shown in steps S1a and S1b, respectively in FIG. 10B, are treated with DNA polymerase and the appropriate blocking dNTPs (and optional DNA kinase activity) in separate reactions, as represented at steps S2a and S2b, respectively. In steps S2a and S2b, kinase activity is optional and is therefore shown in parenthesis. Thereafter, the fragments are directly combined, as indicated at step S3. Next, as shown at step S4, DNA ligase activity, DNA polymerase and blocking dNTPs are added to the combined fragments, resulting in the annealing and covalent joining of fragments A and B. The addition of kinase is also optional in step S4

[0516] As shown in FIG. 10C, after steps S2a and S2b, the enzymes are inactivated at steps S5a and S5b by chemical means (clean up of DNA using DNA purification kits such as Stratagene PCR clean up kit, or Qiaquick DNA clean up kit, etc.) or heat treatment (for example 75° C. for 10 min) of the reactions, or the DNA can be separated from the enzymes (pol and kinase) by physical separation (for example use of a CentriSep spin column, Princeton Separations, will remove unincorporated dNTPs, and proteins, from the reaction). Next, as indicated at step S6, after the separation of enzymes from the DNA fragments, or inactivation of the enzymes, the fragments are then combined and DNA ligase added to the combined DNAs, allowing the DNA fragments to anneal and become covalently joined. Alternatively, DNA polymerase and additional blocking dNTPs, if needed, and kinase activities can be added in addition to DNA ligase activity at this step.

[0517] In another embodiment of the present invention, shown in FIG. 10D, the fragments A and B in steps S10a and S10b, respectively, are combined in a vessel, as indicated at step S11, then DNA polymerase, blocking dNTPs, kinase if needed, and DNA ligase is added to the combined DNAs allowing the DNA fragments to anneal and become covalently joined, as indicated at step S12.

[0518] FIG. 14 shows generically a variety of alternative combination of steps for practicing the present invention that are expanded on and further explained with respect to FIGS. 15, 16A, 16B, 16C and 17. Specifically, FIG. 14 shows two alternative processing paths for the construction of linear expression elements, and more specifically gene expression without cloning using the methods of the present invention, that are herein referred to as the Sticky RICE methodology. As shown in FIG. 14, a promoter element P, a gene of interest I and a terminator element T are PCR amplified. Thereafter, two differing processing paths may be followed, in accordance with different embodiments of the present invention.

[0519] For example, on the right hand side of FIG. 14, the promoter P and a quantity of the gene of interest I may be joined in a 2-way Sticky RICE reaction, and simultaneously another quantity of the gene of interest I may be joined with the terminator T. Thereafter, the reactions are combined and the DNA purified using a column based purification method. Next, the promoter P and terminator T are PCR amplified using specific primers resulting in a desired construct that includes the promoter P, the gene of interest I and the terminator T. Various combinations of treatments represented on the right hand side of FIG. 14 are further embellished and described with respect to FIGS. 15, 16A, 16B and 16C and Examples 9-33.

[0520] On the left hand side of FIG. 14, the promoter P, the gene of interest I and the terminator T are combined in a single 3 way reaction. The resulting DNA is then purified using column based purification methods and then PCR amplified with promoter and terminator specific primers. Various combinations of treatments represented on the left hand side of FIG. 14 are further embellished and explained with respect to FIG. 17 and Examples 34-41.

[0521] The plurality of embodiments presented below include various combinations of reactions where the individual reactions have already been described above. Therefore, Embodiments 9-41 are presented below in a concise tabular manner to more clearly demonstrate the variations in the combinations of treatments used to practice the present invention, along with comments on the various combinations of treatments.

[0522] FIGS. 15, 16A, 16B, 16C and 17 show a variety of combination of steps that are used to practice the present invention. The basic steps and embodiments represented in FIGS. 15, 16A, 16B and 16C are tallied in the tables below:

Step Treatment
A1   Kinase treatment
A2   Phosphatase/no treatment
A3   Polymerase + blocking dNTPs and ligase (optional kinase)
B1   Phosphatase/no treatment
B2   Kinase Treat
B3   Polymerase + blocking dNTPs and ligase (optional kinase)
C1   Phosphatase/no treatment
C2   Phosphatase/no treatment
C3   Polymerase + blocking dNTPs and ligase and kinase
D1   Kinase and Polymerase + blocking dNTPs treat
D2   Kinase and Polymerase + blocking dNTPs treat
D3   Ligase (Optional polymerase and blocking dNTPs, optional
     kinase)
E1   Kinase and Polymerase + blocking dNTPs treat
E2   Polymerase + blocking dNTPs treat
E3   Ligase (optional polymerase and blocking dNTPs optional
     kinase)
F1   Polymerase + blocking dNTPs treat
F2   Kinase and Polymerase + blocking dNTPs treat
F3   Ligase (optional polymerase and blocking dNTPs, optional
     kinase)
G1   Polymerase and blocking dNTPs treatement
G2   Polymerase and blocking dNTPs treatement
G3   Kinase and ligase treatment (optional polymerase and
     blocking dNTPS
H1   Kinase treatment
H2   Kinase treatment
H3   Polymerase and blocking dNTPs, ligase, (optional kinase)

[0523]

Figure	Embodiment	Steps	Treatment Of:
15	9	A1, A2& A3	P, I and P & I respectively
15	10	B1, B2& B3	P, I and P & I respectively
15	11	C1, C2& C3	P, I and P & I respectively
15	12	D1, D2& D3	P, I and P & I respectively
15	13	E1, E2& E3	P, I and P & I respectively
15	14	F1, F2& F3	P, I and P & I respectively
15	15	G1, C2& C3	P, I and P & I respectively
15	16	H1, H2& H3	P, I and P & I respectively
16A	17	A1, A2& A3	P, I and P & I respectively
16A	18	B1, B2& B3	P, I and P & I respectively
16A	19	C1, C2& C3	P, I and P & I respectively
16A	20	D1, D2& D3	P, I and P & I respectively
16A	21	E1, E2& E3	P, I and P & I respectively
16A	22	F1, F2& F3	P. I and P & I respectively
16A	23	C1, G2& C3	P, I and P & I respectively
16A	24	H1, H2& H3	P, I and P & I respectively
16B	25	A1, A2& A3	I, T and I & T respectively
16B	26	B1, B2& B3	I, T and I & T respectively
16B	27	C1, C2& C3	I, T and I & T respectively
16B	28	D1, D2& D3	I, T and I & T respectively
16B	29	E1, E2& E3	I, T and I & T respectively
16B	30	F1, F2& F3	I, T and I & T respectively
16B	31	G1, G2& C3	I, T and I & T respectively
16B	32	H1, H2& H3	I, T and I & T respectively
16C	33	PCR	P & I and I & T

[0524] Comments on Treatments:

[0525] Sticky RICE joining of DNA molecules is accomplished through the use of multiple enzymatic activities, either in a concurrent or step-wise fashion. Examples of how the individual or co-enzymatic treatments can be accomplished are described below. Permutations of the described treatments can also be performed to accomplish the desired treatment outcome.

[0526] Phosphatase Treatment/ No Treatment

[0527] If one wishes to remove 5′ phosphate groups from a DNA (as in FIG. 15 A2) this can be accomplished by incubating a DNA molecule in the presence of shrimp alkaline phosphatase (Boehringer-mannheim) or Calf alkaline phosphatase (New England Biolabs) according to the manufacturers instructions (of buffer, time, temperature, DNA concentration, etc) using either the buffer supplied by the manufacturer or other suitable buffer/reaction conditions which allow the enzyme to effectively remove 5′ phosphates from DNA.

[0528] If desired the phosphatase treatement can be terminated by high temperature incubation of the reaction (for example shrimp alkaline phosphatase is inactivated by 15 min treatment at 65° C.), or purifying the DNA using a commercial DNA clean up kit according to the manufacturers instructions.

[0529] If the DNA does not have 5′ phosphate groups (because of a previous treatment with phosphatase, or the DNA fragment was amplified using PCR and primers without 5′ phosphate groups, for example), the phosphatase treatment is not necessary.

[0530] The phosphatase/No treatment applies to steps (A2, B1, C1, C2, AA1, AA2, AA3, AB1, AB3, AC2 in FIGS. 15-17)

[0531] Kinase Treatment:

[0532] If one wishes to add, or ensure that a DNA molecule has 5′ phosphate groups, this can be accomplished by incubating a DNA molecule in the presence of rATP and a nucleotide kinasing enzyme such as polynucleotide kinase which is available from a number of sources (including New England Biolabs, Promega, Invitrogen, etc.), according to the manufacturers instructions of buffer, time, temperature, DNA concentration, etc.

[0533] If desired the phosphatase treatement can be terminated by high temperature incubation of the reaction (for example T4 polynucleotide kinase from New England Biolabs is inactivated by treatement at 65C for 20 minutes), or by purifying the DNA using a commercial DNA clean up kit according to the manufacturers instructions.

[0534] The Kinase treatment step applies to steps (A1, B2, H1, H2, AB2, AC1, AC3, AH1, AH2, AH3 in FIGS. 15-17)

[0535] Polymerase Treatment With Blocking NTPs

[0536] If one wishes to generate 5′ overhangs on a DNA molecule, this can be accomplished by incubating a DNA molecule in the presence of a DNA polymerase activity with 3′ to 5′ exonuclease activity using the manufacturers instructions as a guideline. For example T4 DNA polymerase from New England Biolabs can function under a variety of temperature and buffer conditions and the concentration of blocking dNTPs to be used are suggested to be 100 mM.

[0537] If desired the polymerase+blocking dNTP reaction can be terminated by high temperature incubation of the reaction (for example T4 DNA polymerase from New England Biolabs is inactivated by treatment at 75° C. for 10 minutes), or by purifying the DNA using a commercial DNA clean up kit according to the manufacturers instructions.

[0538] The polymerase with blocking dNTP(s) step applies to steps (E2, F1, G1, G2, AD2, AE1, AE2, AE3, AG1, AG3 in FIGS. 15-17).

[0539] Polymerase+Blocking dNTP(s) and Kinase Co-treatment.

[0540] If one desires to ensure that the 5′ ends of a DNA molecule contain 5′ phosphate groups and also to generate or maintain 5′ overhangs on a DNA molecule during the same step a DNA molecule can be incubated in the presence of DNA polymerase (with 3′ to 5′ exonuclease activity and the appropriate blocking dNTPs) and a polynucleotide kinase activity in the presence of rATP (manufacturers of polynucleotide kinase generally suggest that the final rATP concentration by 1 mM) in a buffer in which both enzyme activities are active. For example both T4 DNA polymerase and T4 polynucleotide kinase have been demonstrated to function in T4 DNA ligase buffer (New England Biolabs) supplemented with the appropriate blocking dNTPs. (FIG. 6).

[0541] If desired the polymerase+blocking dNTP and coupled kinase treatement reaction can be terminated by high temperature incubation of the reaction (for example 75° C. for 20 minutes would inactivate both T4 DNA polymerase and T4 polynucleotide kinase activities), or by purifying the DNA using a commercial DNA clean up kit according to the manufacturers instructions.

[0542] The polymerase+blocking dNTP(s) and kinase co-treatment applies to steps (D1, D2, E1, F2, AD1, AD3, AF1, AF2, AF3, AG2 in FIGS. 15-17).

[0543] Polymerase+Blocking dNTP(s) and DNA Ligase Co-treatment.

[0544] If one desires to generate or maintain 5′ overhangs on a DNA molecule and also allow complementary 5′ overhangs to anneal and become ligated in a single reaction, this can be accomplished by treating multiple DNA molecules in the presence of a DNA ligase activity and a DNA polymerase activity (with 3′ to 5′ exonuclease activity) in the presence of the appropriate blocking dNTPs.

[0545] For example T4 DNA polymerase and T4 DNA ligase from New England Biolabs are both active in 1× T4 DNA ligase buffer (New England Biolabs) supplemented to blocking dNTPs.

[0546] If desired the polymerase+blocking dNTP and coupled ligase treatement reaction can be terminated by high temperature incubation of the reaction (for example 75° C. for 20 minutes would inactivate both T4 DNA polymerase and T4 DNA ligase activities), or by purifying the DNA using a commercial DNA clean up kit according to the manufacturers instructions.

[0547] The polymerase+blocking dNTP(s) and DNA ligase co-treatment (with or without the optional components described) applies to steps (A3, B3, C3, H3, AA4, AB4, AC4, AH4) in FIGS. 15-17.

[0548] Kinase and Ligase Co-treatment of DNAs.

[0549] If one desires to ensure that DNA molecules have 5′ phosphate groups and that DNA fragments can be ligated together in a single step, this can be accomplished by treating multiple DNA molecules in the presence of polynucleotide kinase and DNA ligase activities under suitable reaction conditions. For example T4 polynucleotide kinase and T4 DNA ligase from New England Biolabs are both functional in 1× T4 DNA ligase buffer from New England Biolabs, at a variety of temperatures.

[0550] If desired the kinase and coupled ligase treatment reaction can be terminated by high temperature incubation of the reaction (for example 75° C. for 20 minutes would inactivate both T4 DNA polymerase and T4 DNA ligase activities), or by purifying the DNA using a commercial DNA clean up kit according to the manufacturers instructions.

[0551] The kinase and ligase co-treatment applies to steps G3, AE4, in FIGS. 15-17.

[0552] Ligase Treatment

[0553] If one wishes to covalently join DNA molecules together this can be accomplished by treating multiple DNAs in the presence of a DNA ligase activity under the appropriate conditions. See manufacturers suggested reaction conditions of buffer, DNA concentration, reaction temperature, etc. Optionally appropriate amounts of kinase and or polymerase in the presence of blocking dNTPs can be also added to the ligase treatment.

[0554] The ligase (with optional kinase and or optional polymerase+blocking dNTPs) treatment applies to steps D3, E3, F3, AD4, AF4, AG4) in FIGS. 15-17.

[0555] Polymerase+Blocking dNTPs, and Ligase and Kinse Co-treatment:

[0556] If one wishes to maintain or generate 5′ single stranded overhangs on multiple DNA molecules, generate 5′ phosphate groups on DNA molecules, and allow multiple DNA molecules to be joined, this can be accomplished by incubating multiple DNAs in the presence of polymerase activity (+the appropriate blocking dNTPs), DNA kinase activity and DNA ligase activity in a single reaction, using the buffer and enzyme ratios described in FIG. 6, for example.

[0557] The Polymerase+blocking dNTPs, and ligase and Kinse co-treatment step applies to steps (C3 and AA4) in FIGS. 15-17.

[0558] As presented in FIG. 6, it is important to note that not all combinations of polymerase, kinase and ligase activities can function to generate recombinant DNA molecules. The ratio of the multiple enzyme activities must be balanced to ensure that all enzyme activities function at a rate consistent with the desired output in terms of quality and quantity of recombinant DNA produced in the desired time frame. The in vitro DNA joining assay in FIG. 6 demonstrates that “too much” or “too little” of one or more enzyme activities can dramatically effect the DNA joining reaction rate. Using the assay and conditions similar or identical to those described for FIG. 6 a researcher can readily identify the enzyme mixture(s) which can accomplish the desired output.

[0559] Multiple Applications for the Sticky RICE Workflow in FIG. 15.

[0560] Using the various combinations of work flow outlined in FIG. 15, sticky RICE can be used to generate recombinant DNAs for a variety of applications including, but not limited to, manual or automated cloning of DNAs into plasmids, production of recombinant RNAs for in vitro or in vivo transcription and/or translation and production of double stranded RNA for RNAi applications.

[0561] Cloning Applications:

[0562] The work flow outlined in FIG. 15 can also be used for cloning an insert DNA fragment (I) into a plasmid (P) DNA fragment. In this scenario the desired outcome is a circular recombinant DNA molecule which can replicate in a cell such as bacterial, plant, animal, fungal or insect cells, for example. A circular molecule will result from the work flow outlined in FIG. 15, if both ends of the DNA fragment P become ligated to opposite ends of fragment I. This can be readily accomplished by appropriately designing the nucleotide sequence on the ends of fragments P and I so that a circular molecule will result during sticky RICE joining of fragments P and I.

[0563] The work flow in FIG. 15 is designed to be modular in nature, to allow the user to treat fragments P and I independently, if desired. This also allows the user to control the treatments of fragments P and I separately, if desired by altering the amount of time, enzyme amounts, etc. in the separate treatments. Enzymatic treatments of the DNAs can be stopped by inactivation of enzymes (by heat treatment, for example) or by separation of the DNA from the enzymes (by purification of DNA by precipitation, or use of commercial DNA “clean up kits” such as Qiagen PCR clean up kits, Stratagene PCR clean up kits, etc.).

[0564] In an automated cloning system, for example, it would be possible to pre-treat multiple aliquots (in a 96 well plate, for example) of plasmid vector (fragment P) with a phosphatase enzyme (such as calf alkaline or shrimp alkaline phosphatase) to remove phosphates from the 5′ ends of DNA P (FIG. 15, I1). After adequate phosphatase treatment the phosphatase enzyme can be inactivated by incubating the plate at an elevated temperature. For example shrimp alkaline phosphatase is inactivated by a heat treatment for 15 minutes at 65 C., Boehringer-mannheim. The present invention may be automated using, for instance, a computer controlled liquid handler, such as that marketed and sold by TECAN, Zurich Switzerland.

[0565] In a separate plate, aliqouts of various insert DNAs (the I fragments in FIG. 15 workflow) can be pre-treated with a kinase enzyme for, example (FIG. 15, I2). After adequate kinase treatment of a plate of I fragments, the kinase reaction can be terminated by heat inactivation. For example T4 polynucleotide kinase is inactivated by 20 minute treatment at 65 C. (New England Biolabs).

[0566] The pretreated P and I samples can then be combined (FIG. 15 I3) and treated with DNA ligase, DNA polymerase+the appropriate blocking dNTPs to allow for the joining of fragments P and I.

[0567] In a similar manner, each of the other work flows outlined in FIG. 15 can be readily adapted to an automated cloning system.

[0568] Using the guidelines described earlier in this patent, it is possible to design plamsid vector DNAs (P fragments in FIG. 15) and insert DNAs (I fragments in FIG. 15) which can be joined in either a directional or a non-directional orientation via sticky RICE techniques.

[0569] RNAi/dsRNA applications:

[0570] The work flows outlined in FIG. 15 can also be used to generate linear recombinant DNAs which can be useful for generating RNAs.

[0571] For example, if one is interested in generating ds RNA molecules (for RNAi applications, for example) the work flow outlined in FIG. 15 can be applied as follows. If fragment I is designed to have identical 5′ single stranded overhangs on each end, and fragment P has complementary 5′ single stranded overhangs, then fragment P can be joined to either or both ends of fragment I to generate the three different linear recombinant DNA molecules represented at the bottom of FIG. 15.

[0572] This can be of interest, in particular, if the researcher is interested in generating double stranded RNA molecules in vitro or in vivo. For example, if fragment P contains a functional promoter sequence then transcription of the resulting population of recombinant DNAs with functional promoters attached to the “Left” end only and “Right” end only of fragment I will generate RNA molecules of complementary sequence. These RNA molecules may hybridize and form ds RNA. Similarly transcription of a recombinant DNA with functional promoters on both ends will also result in complementary RNA molecules, which may hybridize to form ds RNA.

[0573] If the researcher is interested in generating RNAs which will form hairpins, then fragment I must have a nucleotide sequence which upon transcription will generate an RNA molecule with self complementarity to form a hairpin. One way in which this can be accomplished is by synthesizing an oligonucleotide which is capable of readily forming a primer dimer. For example the oligo nucleotide of the sequence:

[0574] 5′ CT TAC gTA CTT gCA CCA TCC ATg gA (Seq ID No.: 48)

[0575] has 8 nt of self complementarity on its 3′ end. Because of this tendency to dimerize at its 3′ end (see below):

5′CT TAC gTA CTT gCA CCATCC ATg gA (Seq ID No.:49)
AGG TAC CT ACc ACG TTC ATG CAT TC5′ (Seq ID No.:50)

[0576] when this oligo is allowed to anneal to itself (the estimated Tm of the 8 nts which are complementary would be about 24° C.) in the presence of the appropriate buffer, dNTPs and DNA polymerase enzyme (such as T7-, T4-, or E. coli/Klenow DNA polymerase) a ds inverted repeat DNA (of the following sequence) will be generated:

5′CT TAC gTA CTT gCA CCA TCC ATg gA tgg tgc aag tac gta ag (Seq ID No.:51)
ga atg cat gaa cgt ggt agg TAC CT ACc ACG TTC ATG CAT TC5′ (Seq ID No.:52)

[0577] Note that the critical feature in this example is the self complementarity at the 3′ end of the oligonucleotide and not the oligonucleotide sequence per se; the sequence of the oligonucleotide can be changed. The generated inverted repeat DNA molecule, if transcribed, would generate a double stranded RNA molecule, which could be used for applications such as RNAi for example. To join a DNA promoter element via sticky RICE to one or both ends of the inverted repeat DNA one may treat the inverted repeat DNA sequence with polymerase with 3′ to 5′ exonuclease activity in the presence of dATP and dTTP blocking nucleotides to generate single 5′ nt C overhangs on both ends of the inverted repeat DNA. This can then be joined to a DNA molecule (such as a promoter, for example) with a complementary 5′ G overhang. This joining process can be accomplished using sticky RICE and any of the work flows outlined in FIG. 15.

[0578] Because the promoter element can go on either or both ends of the inverted repeat DNA sequence the possible DNA products could be:

[0579] P---I

[0580] I---P

[0581] P---I---P

[0582] as represented at the bottom of FIG. 15.

[0583] All of these recombinant DNAs (or the appropriate PCR products thereof) can be transcribed (either in vitro and/or in vivo, depending upon the functionality of the promoter in DNA fragment P) to generate ds (hairpin) RNA molecules useful in applications such as RNAi.

[0584] Applications for the Work Flow of FIGS. 16A-16C:

[0585] The work flows outlined in FIGS. 16A and B can be used to construct primarily a single recombinant DNA molecule. For example if fragments P and I (FIG. 16A) are designed (using the guidelines described earlier in this patent) for sticky RICE joining in a directional orientation, the primary recombinant molecule produced would be the linear recombinants DNA pictured at the bottom of FIG. 16A

[0586] If fragment P has promoter activity (either in vitro and/or in vivo) the resulting linear recombinant (or the appropriate PCR product thereof) can be transcribed under the appropriate conditions to generate an RNA molecule.

[0587] The recombinant “P--I” molecule can be used for many applications by itself, including in vitro transcription and/or translation applications for producing proteins in vitro or in vivo, for example. The recombinant “P--I” molecule can be used in applications directly or can be amplified up using the polymerase chain reaction and suitable primers. The amplified recombinant molecule can then be used in applications as desired.

[0588] In a separate set of reactions, a second fragment “T” (see FIG. 16B) can be designed to be joined to only the “right” end of the same fragment I as in FIG. 16A, to produce the linear recombinant molecule represented in the bottom of FIG. 16B.

[0589] If fragment T has promoter activity (either in vitro and/or in vivo) the resulting linear recombinant (or the appropriate PCR product thereof) can be transcribed under the appropriate conditions to generate an RNA molecule.

[0590] When the transcripts from the recombinant DNA produced from the work flow in FIG. 16A are in the presence of transcripts from the recombinant DNA produced from the work flow in FIG. 16B, the two populations of RNA molecules may hybridize (because they are complementary in sequence) to generate a ds RNA molecule. This ds RNA generated can be useful for applications such as RNAi for example.

[0591] The product of FIG. 16A and FIG. 16B can be transcribed in the same tube, vessel or cell, or in seperate tubes and then combined to generate ds RNAs.

[0592] Similar to the description for FIG. 15, the work flows in FIGS. 16A and 16B can also be automated. Fragments P and I and T, for example can be seperately treated in 96 well plates for example and then combined as desired to generate the desired recombinant molecules.

[0593] Other applications of the workflows outlined in FIGS. 16A and 16B include the production of gene fusions by joining of multiple DNA fragments. For example a recombinant DNA product of two reading frames encoded by fragments P and I can be joined using the work flow outlined in FIGS. 16A or 16B.

[0594] For some applications it may be of interest to generate a recombinant DNA molecule of three or more DNAs joined in a directional manner. This can be accomplished using the work flows outlined in FIGS. 16A-16C. For example the output from FIG. 16C is a recombinant DNA of DNAs P, I and T, joined to generate a recombinant of the following orientation “P-I-T” as represented in FIG. 16C. Applications of such a recombinant molecule include in vitro transcription, in vitro transcription and translation and in vivo transcription/and or translation applications.

[0595] For example, if one desires to construct a linear recombinant DNA which can be transcribed in vitro or in vivo, it may be of interest to attach a promoter P fragment to one specific end of DNA fragment I and a DNA fragment T, which has transcription termination/polyadenylation functions, etc. to the other end of fragment I. This can be accomplished in a step wise fashion following the work flows outlined in FIGS. 16A-C. To construct the 3-way recombinant DNA molecule described in FIG. 16C, the product of the work flow of FIG. 16A (P-I recombinant) and the product of the work flow from FIG. 166B (the I-T recombinant) can be combined in a single reaction vessel and subjected to polymerase chain reaction (PCR) conditions using primers that anneal specifically to fragments P and T, as represented by the arrows in FIG. 16C. During the polymerase chain reaction the P-I-T recombinant DNA molecule will be generated.

[0596] The P-I-T recombinant molecule produced can be used in applications such as protein production, if fragment P has promoter activity, and fragments I and or T contain an open reading frame. The P-I-T recombinant DNA can be used to program in vitro transcription and or transcription/translation reactions to product recombinant protein(s). Similarly the P-I-T recombinant molecule can be introduced into living cells by microinjection, transfection, etc. to allow the P-I-T recombinant to be transcribed in vivo and the RNA potentially translated to produce protein(s) in living cells.

[0597] In FIG. 17, various combinations of treatments are depicted in the workflows. The table below sets forth the various steps and the portion of the sequence being treated.

Table Of Various Steps Shown In FIG. 17
Step Treatment
AA1  Phosphatase/no treatment
AA2  Phosphatase/no treatment
AA3  Phosphatase/no treatment
AA4  Polymerase + blocking dNTPs and ligase and kinase treat
AB1  Phosphatase/no treatment
AB2  Kinase Treat
AB3  Phosphatase/no treatment
AB4  Polymerase + blocking dNTPs and ligase (optional kinase)
AC1  Kinase treat
AC2  Phosphatase/no treatment
AC3  Kinase treat
AC4  Polymerase + blocking dNTPs and ligase (optional kinase)
AD1  Kinase and Polymerase + blocking dNTPs treat
AD2  Polymerase + blocking dNTPs treat
AD3  Kinase and Polymerase + blocking dNTPs treat
AD4  Ligase (Optional polymerase and blocking dNTPs, optional
     kinase)
AE1  Polymerase + blocking dNTPs treat
AE2  Polymerase + blocking dNTPs treat
AE3  Polymerase + blocking dNTPs treat
AE4  Ligase and Kinase (optional polymerase and blocking
     dNTPs)
AF1  Kinase and Polymerase + blocking dNTPs treat
AF2  Kinase and Polymerase + blocking dNTPs treat
AF3  Kinase and Polymerase + blocking dNTPs treat
AF4  Ligase (optional kinase, optional polymerase and blocking
     dNTPs)
AG1  Polymerase + blocking dNTPs treatement
AG2  Kinase and Polymerase + blocking dNTPs treatement
AG3  Polymerase + blocking dNTPs treatement
AG4  Ligase treatment (optional polymerase + blocking dNTPS,
     optional kinase)
AH1  Kinase treatment
AH2  Kinase treatment
AH3  Kinase treatment
AH4  Polymerase and blocking dNTPs, ligase, (optional kinase)

[0598]

Figure	Example	Steps	Treatment Of:
17	34	AA1, AA2, AA3 & AA4	P, I, T
			and P, I & T respectively
17	35	AB1, AB2, AB3 & AB4	P, I, T
			and P, I & T respectively
17	36	AC1, AC2, AC3 & AC4	P, I, T
			and P, I & T respectively
17	37	AD1, AD2, AD3 & AD4	P, I, T
			and P, I & T respectively
17	38	AE1, AE2, AE3 & AE4	P, I, T
			and P, I & T respectively
17	39	AF1, AF2, AF3 & AF4	P, I, T
			and P, I & T respectively
17	40	AG1, AG2, AG3 & AG4	P, I, T
			and P, I & T respectively
17	41	AH1, AH2, AH3 & AH4	P, I, T
			and P, I & T respectively

[0599] The various individual treatment steps outlined in workflows in FIG. 17 and referred to in the tables have all been described above. To avoid duplicative text, comments will not be repeated.

[0600] FIG. 18 shows a computer and a TECAN fluid handler for effecting an automated process for practicing the present invention. Specifically, the computer is programmed to control fluid manipulating aspects of the TECAN in order to add the respective sequences, P, I and/or T along with appropriate reagents, enzymes, etc., for effecting the various methods set forth in the drawings and the description above.

[0601] The two way joining workflow of the reactions of the present invention described above and depicted on the right side of FIG. 14, is also applicable to commercially available technology such as TOPO® Tools manufactured and sold by Invitrogen, Carlsbad Calif. The TOPO® Tools technology includes the use of the enzyme topoisomerase I, as is described in literature published by Invitrogen, and described in greater detail below.

[0602] Invitrogen corporation, markets a technology called TOPO® Tools for directionally joining functional elements, such as promoters, polyA signal sequences/transcription terminators, epitope tag coding sequences, etc., to the ends of PCR products, for the purpose of facilitating the construction of linear recombinant DNAs which can be used for in vitro or in vivo gene expression studies.

[0603] The TOPO® Tools Technology manual from Invitrogen (TOPO® Tools Technology, Version B, base manual, Invitrogen Cat. No T00101) describes methods for constructing linear recombinant DNAs using TOPO®-adapted elements. Included in the TOPO® Tools manual are recommended reaction conditions and trouble shooting suggestions. For example, page 12 of the manual recommends:

[0604] “. . . using a 1:2:1 molar ratio of TOPOS Tools 5′ element :PCR product: TOPO® Tools 3′ element to obtain the highest joining efficiency. In general the concentration of the PCR product should be approximately 2-3 fold higher than the concentration of the TOPO® Tools element, although this will vary depending on the size of your PCR product . . . ”

[0605] TOPO® Joining reaction times are suggested to be performed for 5 to 15 minutes before secondary PCR amplification of the assembled product. For example, on page 15 of the manual it states:

[0606] “Note: In general, a 5 minute incubation will yield a sufficient amount of TOPO® Joined linear product to use as a template for secondary amplification. Depending on the size of the TOPO® Tools 5′ and 3′ elements and your PCR product, the length of the TOPO® Joining reaction can be varied form 5 minutes to 15 minutes. You may increase the length of the TOPO® Joining reaction as the length of the linear DNA template increases. However, incubating the TOPO® Joining reaction for longer than 15 minutes does not increase the efficiency of TOPO® Joining.”

[0607] In addition to recommended reaction conditions, the manual also provides experimental data demonstrating what the secondary PCR reactions may look like from successful and non-successful TOPO® joining reactions.

[0608] For example, on page 18 of manual, expected results are shown when three elements were joined using the TOPO® methods in a 1:2:1 molar ratio, using the protocol described in page 15 of the manual. The gene of interest was present in the reaction at a 2-fold molar excess over the 5′ and 3′ TOPOA Tools elements. The manual describes these results on page 18 as follows: “Agarose gel analysis of the secondary PCR reaction (lane 2) shows a single, prominent band of the expected size corresponding to the linear DNA construct. Some smaller, non-specific bands are visible, but these constitute minor PCR products. From a visual comparison to the molecular weight standards (lane 1), we determine that the amount of PCR product obtained (approximately 150 ng/ul) is sufficient for us to proceed to the application of choice (e.g. transfection into mammalian cells).”

[0609] On page 19 of the TOPO® Tools manual, sub-optimal results are shown. These results were obtained when a 1:1:1 molar ratio of DNAs were used in the joining, using the protocol described on page 15 of the manual. Page 19 of the manual states:

[0610] “Agarose gel analysis of the secondary PCR reaction (lane 2) shows multiple bands, including a faint band from the expected PCR product and more prominent smaller bands corresponding to non-specific PCR products. An insufficient amount of the expected PCR product was produced. In this case, the efficiency of optimized TOPO® Joining was suboptimal and the TOPO® Joining reaction must be optimized and repeated. For more information on how to optimize the TOPO® Joining reaction, see troubleshooting, pages 24-25”.

[0611] The trouble shooting guide on pages 24 and 25 suggest that no or low yield of the expected sized product and/or multiple non-specific bands can be addressed by using a suitable molar ratio of PCR product in the TOPO® Joining reaction. For example, in the suboptimal result shown on pg 19 of the manual, a 1:1:1 molar ratio was used in the TOPO® Joining reaction and the secondary PCR amplification of this reaction resulted in very little of the expected sized product and prominent smaller bands, of non-specific PCR products. The manual suggests using 2 or 3 fold molar excess of PCR product to TOPO® 5′ or 3′ elements would be a possible solution to this problem. Slight errors in pipetting and/or estimation of the concentration of PCR reaction product make it very possible to set up a TOPO® Joining reaction which uses less than the optimal 1:2:1 or 1:3:1 molar ratios of TOPOA 5′ element to PCR product to TOPO® 3′ element, respectively. As shown in the TOPO Tools Technology manual, a 1:1:1 molar ratio of TOPO® 5′ element to PCR product to TOPO® 3′ element, instead of the suggested 1:2:1 molar ratio can result in poor results, which then require extensive trouble shooting analysis, resulting in increased costs in terms of both time, labor and materials.

[0612] Under certain conditions, Sticky RICE™ joining of three DNAs can be performed and the joined DNA then be used in a secondary PCR amplification reaction, and the secondary PCR reaction product can appear similar to that obtained from a suboptimal TOPO® Joining reaction (Compare Lane2 in StickyRICE FIG. 19 with lane 2 in figure on page 19 of the TOPO® Tools Technology publication).

[0613] To solve this problem we have taken a different approach than the trouble shooting suggestions proposed in the TOPO® Tools Technology publication. The left side of FIG. 19, depicts the basic steps of a three way joining methodology set forth in the TOPO® Tools Technology publication. Specifically, a promoter (P), gene of interest (I) and a terminator (T) are joined together in a single reaction as shown on the left hand side of FIG. 19 using the enzyme topoisomerase I.

[0614] In accordance with another embodiment of the present invention, as shown on the right side of FIG. 19, the enzyme topoisomerase I may be used in a two way reaction methodology. Specifically, in a first joining reaction, a promoter (P) and a gene of interest (I) are joined. In a second separate joining reaction, the gene of interest (I) and a terminator (T) are joined using topoisomerase I. In other words, the 5′ element to the PCR reaction product are in one reaction vessel and the PCR reaction product to the 3′ element are in a separate reaction vessel. The products of the individual reactions are then combined and used in a secondary PCR reaction, to produce primarily the desired reaction product, as shown in FIG. 19. If desired (and in fact it is preferable) the individual reactions can be terminated prior to being combined and use in the secondary PCR reaction. The agarose gel image in FIG. 19 is representative of the results anticipated by the inventors but is not from an experiment that used topoisomerase I.

[0615] In other words, in accordance with this embodiment of the present invention, as shown on the right side of FIG. 19, the inventors have conceived a method of joining double stranded polynucleotides where a first DNA sequence (a promoter P) and a second DNA sequence (the gene of interest I) are joined using topoisomerase I to form a first product. In a separate reaction, the second DNA sequence and a third DNA sequence (a terminator element T) are joined using topoisomerase I to form a second product. Finally, the first product and the second product are joined in a PCR reaction. It may be advantageous to stop any ongoing reactions for generating the first and second products prior to the PCR or combining step of the process, in a manner similar to that described above with respect to the embodiment of the present invention depicted in FIG. 14.

[0616] The reactions can be terminated by a number of means including high temperature treatment to inactivate the enzymes involved in the DNA joining reaction and/or separation of the DNAs from the enzymes involved in the joining reaction. The DNA and enzymes can be separated by a variety of methods including phenol: CHCl3 extraction of the reaction (to remove proteins) followed by precipitation of DNAs in the presence of alcohol and salt(s), or by purification of DNAs by column purification methods (such as Qiaquick PCR clean up kit, Stratagen PCR clean up kit, Zymoclean DNA clean up kit, etc.) or by passing the reaction mix through a column which will separate DNA and proteins (Centrisep column, Centricep, Princeton N.J.).

[0617] These protocol modifications resulted in the production of the product of interest, as shown in FIG. 19. This method is more reliable and robust than the 3-way joining method (depicted on the left side of FIG. 19) since it is not as likely to generate non-specific joining of 5′ and 3′ elements, for example which could be amplified during secondary PCR amplification reactions.

[0618] As FIG. 19 demonstrates, under 3-way joining conditions, in which the secondary PCR amplification generates non-specific PCR products, one potential solution to this problem is to perform the 5′ and 3′ element to PCR product joining reactions in separate reaction vessels and then combine these two reactions (generally after or during inactivation of the enzymes which perform the joining reaction) and then perform the secondary PCR amplification reaction.

[0619] Because the complexity of DNAs in the joining reactions is reduced, the number of non-specific joining reaction products will also be reduced, leading to a decreased chance of non-specific PCR reaction products during the secondary PCR amplification. Instead, the full length product of interest is generated during the secondary PCR reaction, as seen in FIG. 19.

[0620] This methodology can also be applied to other linear recombinant DNA construction methods such as TOPO® Tools (Invitrogen). This protocol modification will result in fewer failed reactions and will result in fewer reactions which must be subjected to troubleshooting. For example the TOPO®-adapted 5′ element and PCR product could be joined in one reaction vessel and the TOPO®-adapted 3′ element and the same PCR product could be joined in a separate reaction vessel. The two reaction products could then be combined and used in a PCR amplification reaction, resulting in the production of the full length product of interest. Because the two joining reactions are performed separately, prior to being combined and amplified by PCR, the reaction should not be as sensitive to minor alterations in PCR product concentration as the TOPO® Tools Technology Manual describes.

[0621] As shown in FIG. 19, the 5′ element was a PCR product of about 650 bp, containing the functional CMV promoter. The 3′ element was a PCR product of about 400 bp, containing the functional SV40 3′/PolyA signal sequence. The PCR product was the hrGFP gene of about 750 bp. All three DNA products used in FIG. 19 were PCR products from pIRES hrGFP 1a template DNA (Stratagene). 24 ng of 5′ element, 75 ng of 750 bp element, and 15 ng of 3′ element were used in joining reactions).

[0622] Various details of the present invention may be changed without departing from its spirit or its scope. Furthermore, the foregoing description of the embodiments according to the present invention are provided for illustration only, and not for the purpose of limiting the invention as defined by the appended claims and their equivalents.

Claims

1. A method of joining double stranded polynucleotides comprising: joining a first DNA sequence and a second DNA sequence using topoisomerase I to form a first product; joining the second DNA sequence and a third DNA sequence using topoisomerase I to form a second product; combining the first product and the second product in PCR reaction.

2. A method as set forth in claim 1, further comprising the step of: stopping said joining steps for generating the first and second products prior to said combining step.