Patent Application
20210185869
Genus and species: Lantana camara L. (Lantana strigocamara R. W. Sanders).
Cultivar denomination: The present disclosure relates to Lantana camara cultivar ‘UF-1013-1’.
The present invention relates to a new and distinct cultivar of lantana, botanically known as Lantana camara, and hereinafter referred to by the name ‘UF-1013-1’. Lantana camara (L. camara) is a member of the family Verbenaceae. Plants of this species produce brightly-colored flowers, attract butterflies, tolerate harsh environmental conditions, have low maintenance requirements, and are easy to grow. Plants of L. camara are widely used in containers, hanging baskets, and landscapes. Commercial production of L. camara is widespread in the nursery industry, especially in the southern United States.
Lantana camara is native to Central and South Americas including the West Indies and was introduced to the United States in the 1800s. Since then, L. camara has escaped cultivation and become naturalized in thirteen U.S. states. In Florida, escaped L. camara has hybridized with Lantana depressa, a small and endangered Florida native species. Lantana camara has been listed as a Category I invasive species in Florida by the Florida Exotic Pest Plant Council (FLEPPC) (FLEPPC Invasive Plant Lists, 2019). The Georgia Exotic Pest Plant Council (GA-EPPC) has listed L. camara as a Category 3 exotic plant, a minor problem in the Georgia's natural areas or not yet known to be a problem in Georgia but known to be problem in adjacent states (GA-EPPC List of Non-native Invasive Plants in Georgia, 2019). There has been a strong need for the development of new infertile cultivars in L. camara to protect the environment and the native species and provide new introductions for the nursery and landscape industries.
The new lantana cultivar ‘UF-1013-1’ is a product of a planned breeding program at the University of Florida's Gulf Coast Research and Education Center (UF/GCREC) in Balm, Fla. The primary objective of the breeding program is to develop new infertile lantana cultivars with desirable plant stature, dense branching habits, and attractive flower colors.
The new lantana cultivar ‘UF-1013-1’ resulted from a planned cross between a proprietary breeding line DROP-25 (female parent) and cultivar ‘Landmark Flame Improved’ (male parent; ‘Balandimfla’, U.S. Plant patent application Ser. No. 11/015,489, now abandoned). The stated cross was made in fall 2010 in Balm, Fla. The new lantana cultivar was discovered and selected in Balm, Fla. in April 2012 as one flowering plant within the progeny of the stated cross.
Asexual propagation of the new lantana cultivar by vegetative cuttings in a controlled environment in Balm, Fla. since 2012 has shown that the unique features of this new lantana cultivar are stable and reproduce true to type plants in successive generations.
Plant Breeder's Rights for this cultivar have not been applied for. The new lantana cultivar ‘UF-1013-1’ has not been made publicly available more than one year prior to the filing of this application.
The new lantana cultivar has not been observed under all possible environmental conditions. The phenotype of the new cultivar may vary with variations in environment and cultural practices such as temperature, light intensity, shading, tipping, pruning, fertilization, irrigation, and application of plant growth regulators without any change in genotype.
The following traits have been repeatedly observed and are determined to be the unique characteristics of the new lantana cultivar. These characteristics in combination distinguish ‘UF-1013-1’ as a new and distinct cultivar of Lantana camara:
Plants of the new Lantana camara cultivar ‘UF-1013-1’ differ from plants of the female parent, DROP-25, in the following characteristics:
Plants of the new cultivar ‘UF-1013-1’ differ from plants of the male parent, ‘Landmark Flame Improved’, in the following characteristics:
Plants of the new Lantana camara cultivar ‘UF-1013-1’ differ from plants of its sibling cultivar, ‘UF-1013A-2A’ (Bloomify™ Red), U.S. Plant Pat. No. 29,292), in the following characteristics:
Plants of the new lantana cultivar ‘UF-1013-1’ can also be compared to the cultivar ‘Landscape Bandana Red Improved’ (commercial cultivar, not patented). In side-by-side comparisons conducted in Balm, Fla., plants of the new lantana cultivar differed from plants of ‘Landscape Bandana Red Improved’ in the following characteristics:
Plants of the new lantana cultivar ‘UF-1013-1’ can be compared to ‘Luscious® Citrus Blend’ (‘Balandusbi’, U.S. Plant Pat. No. 32,018). In side-by-side comparisons conducted in Balm, Fla., plants of the new lantana cultivar differed from plants of ‘Luscious® Citrus Blend’ in the following characteristics:
The accompanying photographs (as shown in
In the following description, color references are made to The Royal Horticultural Society (R.H.S.) Colour Chart, 1986 Edition, except where general terms of ordinary dictionary significance are used.
Plants used for the description were grown in the fall and winter of 2019 and early spring of 2020 in Balm, Fla. for 24 weeks from when terminal cuttings were made. Cuttings were dipped into a commercial rooting hormone solution (Dip & Grow®, Dip'N Grow, Inc., Clackamas, Oreg.) on 30 August 2019; rooted cuttings were potted up in gallon containers on 26 Sep. 2019. Plants in gallon containers were pinched on 10 Oct. 2019. Plants were grown in the greenhouse until 24 Feb. 2020. Plant data was taken and plant, foliage, and flower descriptions were made. During the production of the plants in the greenhouse, temperatures ranged from about 22.2° C. to about 35.5° C.
Table 1 shows fruit production of the new Lantana cultivar ‘UF-1013-1’ and two checks (‘UF-1013A-2A’ and ‘Pink Caprice’ (commercial cultivar, not patented)) in two replicated field trials in Florida.
The two field trials were conducted at the University of Florida (UF)'s Gulf Coast Research and Education Center (GCREC) in Balm, Fla. (southwest Florida, USDA hardiness zone 9a, and AHS heat zone 10) and at UF's Indian River Research and Education Center (IRREC) in Ft. Pierce, Fla. (southeast Florida, USDA hardiness zone 9b, and AHS heat zone 9-10). The experimental design used in the Balm trial was a randomized complete block with three blocks and two plants per plot. Ground beds at the GCREC were raised about 20 cm, fumigated with Pic-Clor 60™ (Trical, Inc., Hollister, Calif.; active ingredients 1,3-dichloropropene and chloropicrin) at 448 kg per hectare in February 2015, and covered with white-on-black plastic. The experimental design used in the Ft. Pierce trial was a randomized complete block with four blocks and single-plant plots. Ground beds at the IRREC were not fumigated but treated with a pre-emergent herbicide (Sandea®, 75.0% ai (halosulfuron-methyl), Gowan Company, L.L.C., Yuma, Ariz.) at a rate of 0.1056 grams L−1 and a 2% solution of glyphosate (Roundup WeatherMAX®, 48.8% ai, Monsanto Technology LLC, Saint Louis, Mo.) and covered with black ground cover. Plants in the two trials were grown in full sun.
At each site, ‘Pink Caprice’ and ‘UF-1013A-2A’ were included as controls. ‘Pink Caprice’ is very prolific in fruit (and seed) production (Czarnecki et al., 2012), while ‘UF-1013A-2A’ is highly infertile (Deng et al., 2017). In addition, 21 commercial cultivars with various levels of male and female fertility were randomly placed in each block at both sites.
Fruit production data were collected from each plant in the Balm and Ft. Pierce trials. The four data collections in Balm were made on 17 Aug., 14 Sep., 16 Oct., and 18 Nov., 2015, respectively. The four data collections in Ft. Pierce were made on 12 Aug., 10 Sep., 14 Oct., and 11 Nov. 2015, respectively. In each collection, 20 peduncles were randomly sampled from each plant; thus, approximately 120 peduncles were sampled for each cultivar grown in Balm, and 80 peduncles were sampled for each cultivar grown in Ft. Pierce. Fruit on all harvested peduncles were counted, regardless of maturity. An analysis of variance and separation of mean fruit production values was conducted using JMP® Pro 13.2.0 (SAS Institute Inc., Cary, N.C.) to compare the fruit production of the new Lantana cultivar ‘UF-1013-1’ with that of ‘UF-1013A-2A’ and ‘Pink Caprice’. Mean values with the same letter within columns in Table 1 are not significantly different by the Tukey's HSD procedure at P<0.05.
As shown in Table 1 and reported previously (Deng et al., 2017), ‘Pink Caprice’ produced the largest number of fruit (drupes) among all the cultivars in the two replicated trials. Each peduncle had an average of 7.941 drupes in Ft. Pierce and 10.313 drupes in Balm, averaged to 9.127 drupes per peduncle across the two sites and four harvests. The number of drupes per peduncle for the sterile cultivar ‘UF-1013A-2A’ ranged from 0 to 0.050 and averaged to 0.015 across the two sites over the 4 months. The number of drupes the new Lantana cultivar TF-1013-1′ produced per peduncle ranged from 0 to 0.038 and averaged to 0.009 across two experimental sites and over 4 months. This level of fruit production in the new cultivar ‘UF-1013-1’ represented greater than 99% reduction from the fruit production of ‘Pink Caprice’.
Seed germination: Seeds were extracted from mature drupes collected from the above experiments. Seeds were cleaned, air-dried, and germinated. A subsample of seeds of ‘Pink Caprice’ were sent to Mid-West Seed Services in Brookings, S.Dak., a commercial seed testing laboratory, for seed viability tests. The new Lantana cultivar ‘UF-1013-1’ and ‘UF-1013A-2A’ produced few or no seeds at either site and were therefore not tested for viability. Seeds of ‘Pink Caprice’ showed an average of 65.0% viability, germinated readily, with an average germination percentage of 45.0% in 60 days. For ‘UF-1013A-2A’, no mature drupes were collected from Balm or Ft. Pierce. For the new Lantana cultivar ‘UF-1013-1’, three mature drupes were collected from the Ft. Pierce trial over four months. Three seeds were extracted, but all were abnormal when visually examined. Thus, there were no seeds from the new Lantana cultivar ‘UF-1013-1’ and ‘UF-1013A-2A’ for seed viability or germination tests.
Female Fertility Index (FFI): Fruit (seed) production per peduncle and seed germination are the primary factors determining lantana' s female fertility. Female fertility index (FFI) was calculated by multiplying fruit production per peduncle and seed germination. The FFI for ‘Pink Caprice’ was 4.107. Because of the lack of seed germination data, it was not possible to calculate the FFI for the new Lantana cultivar ‘UF-1013-1’. However, based on its triploidy and extremely low fruit production, it was expected that the FFI for the new Lantana cultivar ‘UF-1013-1’ would be close to zero.
Table 2 shows pollen stainability of the new Lantana cultivar ‘UF-1013-1’ and two checks (‘UF-1013A-2A’ (Bloomify™ Red) and ‘Pink Caprice’) when their plants were grown in Balm and Ft. Pierce, Fla. in full sun in 2015. Two pollen staining experiments were conducted. In Experiment 1, newly opened flowers were collected from plants grown in Balm, Fla. in late July 2015, and anthers were extracted from the flowers and collected into 1.5-mL Eppendorf tubes. The collected anthers were stained with 10−6 M fluorescein diacetate (FDA) (Sigma-Aldrich, St. Louis, Mo.) in 0.22 M sucrose at room temperature in the dark for 1 hour (Czarnecki et al., 2014). Stained anthers were transferred onto a microscope slide and covered with a coverslip. Pollen grains in the anthers were released by gently tapping and pressing the coverslip and then examined under a fluorescent microscope. Plump, round pollen grains fluorescing bright yellowish green light were considered stainable, while misshaped, non-fluorescing, or unevenly, lightly fluorescing pollen grains were counted as non-stainable. In Experiment 2, flowers were collected from lantana plants grown in Ft. Pierce, Fla. in mid-August 2015. Anther staining and pollen examination were performed as described in Experiment 1. The number of pollen grains examined for each lantana cultivar in each staining experiment was between 1,094 and 2,122. Pollen stainability data (in percentage) were arcsine-transformed before analysis of variance was performed. Means with the same letter within the column of Table 2 are not significantly different by the LSD procedure at P<0.05. The analysis of variance and mean separation were conducted using the software JMP® Pro 13.2.0.
As shown in Table 2, the average pollen stainability of the new Lantana cultivar ‘UF-1013-1’ was 2.2%, comparable to the average pollen stainability of sterile cultivar ‘UF-1013A-2A’. The average pollen stainability of ‘Pink Caprice’ was 73.1%. The pollen stainability (or male fertility) of the new Lantana cultivar ‘UF-1013-1’ was reduced substantially (95%) from that of ‘Pink Caprice’.
Assessment of Hybridization Potential With Lantana depressa
Table 3 shows the hybridization potential of the new Lantana cultivar ‘UF-1013-1’ with L. depressa as compared to ‘UF-1013A-2A’ and ‘Pink Caprice’.
Hand pollination experiments were performed in a greenhouse at GCREC in Balm, Fla. in June and July 2015 to assess the hybridization potential of the new Lantana cultivar ‘UF-1013-1’, as a male or female parent, with L. depressa. ‘UF-1013A-2A’ and ‘Pink Caprice’ were included in the pollination experiments as an infertile and a fertile check, respectively. Stock plants of all lantana cultivars and L. depressa were grown in 1-gallon plastic containers and arranged into three blocks and in each block, they were randomly placed on the benches. The experimental unit consisted of two containerized plants. Air temperature inside the greenhouse was from 21° C. to 33° C. No supplemental lighting was provided. Plants were drip-irrigated twice per day. Fresh anthers were collected from mature unopened flowers of male parents and applied immediately to emasculated flowers of female parents. At maturity, fruit produced by the pollinated flowers were collected and counted, and seeds were extracted and sown to determine seedling emergence.
Fruit set data (in percentage) were arcsine-transformed before analysis of variance was performed in JMP® Pro 13.2.0. Mean values with the same letter within the column are not significantly different by the LSD procedure at P<0.05.
As shown in Table 3, ‘Pink Caprice’, as a male parent, caused an average of 8.6% fruit set on L. depressa. When pollinated with L. depressa, ‘Pink Caprice’ flowers showed 19.9% fruit set. Seeds from crosses between ‘Pink Caprice’ and L. depressa or vice versa showed 11.1% or 15.8% seedling emergence. As a male parent, ‘UF-1013A-2A’ did not cause any fruit set on L. depressa flowers, nor did it set any fruit after hand-pollination with L. depressa. A total of 389 L. depressa flowers were pollinated with the new cultivar, and none of the pollinated flowers set fruit, resulting in 0% fruit set (Table 3). When the new cultivar was used as the female parent, it did not set any fruit after it was hand-pollinated with L. depressa. Thus, the new cultivar did not hybridize with L. depressa (Table 3). These data confirm the high level of male and female infertility in the new cultivar.
L.
depressa as the female parent
L.
depressa as the male parent
As shown in Table 4, the new cultivar ‘UF-1013-1’ has an average nuclear DNA content of 4.82 pg/2C and is a triploid. The nuclear DNA content was determined using a CyFlow® Cube 6 flow cytometer (Sysmex Partec GmbH, Munster, Germany) and the procedure described by Dolz̆el et al. (Estimation of Nuclear DNA Content in Plants Using Flow Cytometry, Nat. Protoc. 2:2233-2244 (2007)) and modified by Cao et al. (2014). Pea cultivar ‘Ctirad’ (Pisum sativum) with a nuclear content of 9.09 pg/2C was used as the internal reference for this determination in this study. The new cultivar ‘UF-1013-1’ has 6.2% higher nuclear DNA content than ‘UF-1013A-2A’ does (4.82 pg/2C vs. 4.54 pg/2C). The ploidy level of ‘UF-1013-1’ was determined by comparing its nuclear DNA content with the DNA content of known diploid, triploid and tetraploid lantana cultivars.
As shown in Table 5, the new cultivar ‘UF-1013-1’ carries two alleles (152 and 160 base pairs (bp)) at the Lantana11 SSR marker locus, three alleles (135, 143 and 147 bp) at the Lantana12 SSR marker locus, and one allele (93 bp) at the Lantana20 SSR marker locus.
This DNA fingerprint analysis was performed using three pairs of lantana-specific SSR primers. Lantana genomic DNA was isolated from lantana leaves in Balm, Fla. Primers were developed as described by Gong and Deng (Development and Characterization of Microsatellite Markers for Caladiums (Caladium Vent.), Plant Breeding 130(5) (2011)) from SSR-enriched lantana genomic sequences (Gong and Deng, unpublished). Nucleotide sequences of the three pairs of primers are: Lantana11F: (M13 tail sequence)-TGCAATTGGAGGCTTTTTCT, and Lantana11R: AAAGCAGCTTCAAGTTTGTGC; Lantana12F: (M13 tail sequence)-GGATGAGATGATAAGGTAGGGTGT, and Lantana12R: TTGGTGGTGATGACTTTGATTC. Lantana20F: (M13 tail sequence)-AGAATCAGGGTTTGGGGTTG, and Lantana20R: TCGTAGCCACCACTCCTCAC. The M13 tail sequence was 5′-CCCAGTCACGACGTTG-3′. Polymerase chain reaction (PCR) amplification, capillary electrophoresis, and allele scoring were performed at the United State Department of Agriculture/Agricultural Research Services Fruit and Tree Nut Research Laboratory, Byron, Ga., using a procedure previously described by Chen et al. (Genome-wide Characterization and Selection of Expressed Sequence Tag Simple Sequence Repeat Primers for Optimized Marker Distribution and Reliability in Peach, Tree Genet. Genome 10:1271-1279 (2014)) with minor modifications.
As shown in Table 5, the female parent of the new cultivar, breeding line DROP-25, carries three alleles (150, 152 and 160 bp) at the Lantana11 marker locus, four alleles (135, 143, 145 and 147 bp) at the Lantana12 marker locus, and two alleles (93 and 109 bp) at the Lantana20 marker locus.
This Application is related to and claims the benefit of U.S. Provisional Patent Application Ser. No. 62/946,666, filed on Dec. 11, 2019, entitled LANTANA CAMERA PLANT NAMED ‘UF-1013-1’, the entirety of which is incorporated herein by reference.
This invention was made with government support under FLA-GCR-005065 and FLA-GCR-005507 awarded by the National Institute of Food and Agriculture, USDA, the USDA/Tropical and Subtropical Agriculture Research (TSTAR) program, and the Florida Department of Agriculture and Consumer Service (FDACS) Specialty Crop Block Grant program. The United States government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62946666 | Dec 2019 | US |
