Patent Application
20100297168
The invention relates to the design of gene transfer vectors and especially provides lentiviral gene transfer vectors suitable for either a unique administration or, for iterative administration in a host, and to their medicinal application.
In a particular embodiment, the invention especially relies on the results obtained in pre-clinical trials conducted with lentiviral gene transfer vectors in a homologous model, with a follow-up over a period of more than 5 months, to design candidates for vaccination against Immunodeficiency Virus, especially suitable in human hosts.
The invention especially relates to the use of gene transfer vectors for unique or for multiple in vivo administration into a host in need thereof. The field of application of the present application concerns in particular animal treatment or treatment of human being (e.g. prophylactic or therapeutic or symptomatic or curative treatment).
The combination of lentiviral vectors according to the invention is in particular suitable for use in the field of gene therapy or vaccination in vivo. It is however also more generally suitable for any medicinal treatment which requires in vivo unique or multiple injections of the vectors.
The invention especially provides means suitable for use of the lentiviral vectors in iterative administration, either for prevention or for treatment of a disease in a mammalian host, especially in human beings. A particular application of these vectors is to elicit an immune response to prevent or to treat a pathogenic state, including virus infections, parasite and bacterial infections or cancers, and preferably to elicit a protective, long-lasting immune response. According to a particular embodiment of the present invention, the designed vectors are especially of interest in the field of treatment or prevention against Immunodeficiency Virus and especially against AIDS.
Another aspect of the invention is that the gene transfer vectors are either integrative or non-integrative (NI) vectors. The choice of either form of vectors should be dependent upon the purpose of their use.
Viruses, in particular RNA-viruses, and especially lentiviruses have been used in the past to design gene transfer vectors especially due to the ability of lentiviruses to achieve mitosis-independent nuclear import that enables them to replicate efficiently in non dividing target cells. Accordingly, lentivirus based vectors have been explored for various applications including prophylactic or therapeutic vaccination or with a view to use these vectors as tools for gene therapy.
When testing lentiviral vectors in vivo, it has however been observed that the number of in vivo injections is limited by the humoral response of the host elicited against the envelope protein used for pseudotyping the vector particles.
The response which is elicited in the host against the envelope of the pseudotyped vector particles is accordingly a drawback for the efficient use of such vectors, when in vivo multiple administrations are required.
The present invention proposes means that are intended to remedy, at least in part, to the drawbacks due to the immune response against the envelope of the pseudotyped vector particles, when administrated several times to a host in the context of prophylaxy or treatment.
The invention thus relates to different structures of lentiviral vectors, and also especially to their association in a combination of compounds (also designated as a kit of compounds), suitable for use in a host in need thereof, in conditions allowing either unique or iterative administration of said lentiviral vectors.
In particular, the invention takes advantage of the sequential use of different lentiviral vectors to deliver a transgene in a host.
The lentiviral vectors according to the invention and especially their combination, is in particular suitable for use in the field of medicinal treatment where especially an immune response, including a cellular immune response, elicited by endogenously expressed antigen is beneficial or necessary; accordingly, the invention provides tools for the design of vaccination protocols for use in hosts in need of preventive or curative treatment against intracellular pathogenic organisms, including viruses especially retroviruses, or more generally against a pathogenic state, including to perform gene therapy in vivo. It is in particular suitable for any medicinal treatment which requires in vivo multiple injections of the vectors.
The inventors have in particular provided evidence that the lentiviral vectors as defined herein, especially when used in a combination, are appropriate to elicit a cellular immune response in a non-human primate model, which may be protective in the context of viral challenge, when the lentiviral vectors express an antigen of said virus.
In a particular embodiment of the invention, the inventors have especially shown that a cellular protective immune response has been obtained in a non-human primate model in the context of viral challenge with Simian Immunodeficiency Virus. The inventors have especially shown in a prime-boost strategy using lentiviral vectors pseudotyped with a glycoprotein G from two non-cross reactive VSV serotypes that these vectors elicited robust and broad cellular immune responses against the vector-encoded antigen. This has been shown in a model consisting of cynomolgus macaque, and adapted vectors have thus been designed in particular with respect to the vector-encoded antigen, to provide vectors suitable for the application in human hosts especially.
In view of these results, the inventors have designed tools which would be suitable to elicit an efficient and preferably protective immune response when administered to a host, especially in situations of prevention or treatment of viral infections and in particular in human hosts, to provide an immune response against such viral infections, in particular retroviral, for example lentiviral including against Human Immunodeficiency Virus and possibly to prevent development of pathogenesis associated with the infection.
Accordingly, the combination of lentiviral vectors of the invention, provides especially an efficient prime-boost system for use for iterative administration, enabling successively priming and boosting the immune response in a host, especially after injections in a host in need thereof. “Iterative” means that the active principle, i.e., the heterologous polynucleotide contained in the lentiviral vector of the invention is administered twice or more, especially three times, to the host, as a result of the administration of lentiviral vectors disclosed herein.
The invention is accordingly directed to a combination of compounds comprising at least:
The polynucleotide encoded (contained) by the lentiviral vector particles is said “heterologous” because it is brought as an insert in the vector genome construct. In particular embodiments, the genome vector and the polynucleotide may originate from the same group of lentiviruses, even from the same type.
In a particular embodiment of the invention, the heterologous determined polynucleotide, encodes one or several polypeptides comprising at least one antigen derived from a GAG antigen of an Immunodeficiency Virus. Especially, the antigen is or comprises one or more immunogenic epitopes. The antigen derived from GAG is defined in the present application and illustrated in the examples. It encompasses in particular fragments of GAG. The GAG antigen illustrated in the examples originates from SIV, in accordance with the design of the model for assaying protection against SIV infection. When intended for the design of a vector suitable for a human host, the GAG antigen is derived from a GAG polyprotein of a Human Immunodeficiency Virus, especially HIV-1 or HIV-2.
In a particular embodiment of the invention, the heterologous determined polynucleotide which is a recombinant polynucleotide (or transgene) encoding one or several polypeptides does not encode a biologically active POL antigen of an Immunodeficiency Virus.
In a particular embodiment, the encoded antigen derived from GAG, especially immunogenic epitope(s) derived from GAG, is not a biological functional GAG antigen and does not comprise such a biologically functional GAG; in other words the antigen is a biologically non functional GAG.
The lentiviral vectors defined in the present invention are pseudotyped lentiviral vectors consisting of vector particles (accordingly also designated as “lentiviral vector particles”) bearing envelope protein or envelope proteins (of a particular polyprotein envelope), wherein said envelope protein(s) originate from a virus which is different from the particular lentivirus which provides the vector genome of the lentiviral vector. Accordingly, said envelope protein or envelope proteins, are so-called “heterologous viral envelope protein or viral envelope proteins”. In the following pages, reference will also be made to “envelope protein(s)” to encompass any type of envelope protein or envelope proteins suitable to perform the invention.
The lentiviral vectors according to the invention are replacement vectors, meaning that the sequences of the original lentivirus encoding the lentiviral proteins are essentially deleted from the genome of the vector or, when present, are modified, and especially prevent expression of biologically active POL antigen and optionally of further structural and/or accessory and/or regulatory proteins of the lentivirus.
The “vector genome” of the vector particles also comprises the polynucleotide or transgene of interest. In a particular embodiment, said transgene is also devoid of a polynucleotide encoding biologically active POL proteins. As a consequence, the vector genome does not enable to recover biologically active POL antigens. A biologically active POL antigen comprises the viral enzymes protease (RT), reverse tanscriptase (RT and RNase H) and integrase (IN) produced by cleavage of the GAG-POL polyprotein. The POL antigen is not biologically active, when the biological activity of at least one of these enzymes is not enabled. The biological activity is described with these enzymes in Fields (Virology—Vol 2 Chapter 60, pages 1889-1893 Edition 1996).
In a particular embodiment, the polynucleotide or transgene in the vector genome is devoid of the functional pol gene, and especially does not contain a complete pol gene.
The vector genome as defined herein contains, apart from the so-called heterologous polynucleotide of therapeutic interest placed under control of proper regulatory sequences, the sequences of the lentiviral genome which are non-coding regions of said genome, and are necessary to provide recognition signals for DNA or RNA synthesis and processing. These sequences are cis-acting sequences. The structure and composition of the vector genome used to prepare the lentiviral vectors of the invention are based on the principles described in the art. Examples of such lentiviral vectors are disclosed in (Zennou et al, 2000; Firat H. et al, 2002; VandenDriessche T. et al). Especially, minimum lentiviral gene delivery vectors can be prepared from a vector genome, which only contains, apart from the heterologous polynucleotide of therapeutic interest under control of proper regulatory sequences, the sequences of the lentiviral genome which are non-coding regions of said genome, necessary to provide recognition signals for DNA or RNA synthesis and processing.
Hence, a vector genome may be a replacement vector in which all the viral protein coding sequences between the 2 long terminal repeats (LTRs) have been replaced by the polynucleotide of interest.
Unless otherwise stated, or unless technically not relevant, the characteristics disclosed in the present application with respect to any of to the various features, embodiments or examples of the structure or use of the lentiviral vectors, especially regarding their envelope protein(s), or the heterologous polynucleotide, may be combined according to any possible combinations.
The expression “combination of compounds” or “kit of compounds” means that the lentiviral vectors constituting active ingredients of the kits or combinations, are provided as separate compounds in said kit or combination, and are intended for separate administration to a host, especially separate administration in time. Accordingly the invention enables to perform a prime-boost administration in a host in need thereof, where the first administration step elicits an immune, especially cellular, immune response and the later administration step(s) boost(s) the immune reaction.
The compounds of the kit thus are provided separately to the host in need thereof, especially to a mammalian host, in particular a human patient.
Accordingly, said lentiviral vectors can be provided in separate packages or can be presented in a common package for a separate use thereof.
Therefore, the notice included in the packages and comprising the directions for use, may indicate that said lentiviral vector particles which are pseudotyped with distinct envelope protein or envelope proteins are for separate administration in time, especially for priming and subsequently boosting an immune reaction in a host.
In accordance with the invention, it is provided lentiviral vector particles which are pseudotyped with a first determined heterologous viral envelope protein, or viral envelope proteins, and lentiviral viral vector particles which are pseudotyped with a second determined heterologous viral envelope protein or viral envelope proteins. Accordingly, said first and second heterologous viral envelope protein(s) are different and in particular are originating from different virus strains. Thus, the lentiviral vector particles of the kit of compounds of the invention are distinct, at least due to the particular envelope protein(s) used for pseudotyping the vector particles.
In a particular embodiment of the invention, the combination of compounds comprises a third or a further type of lentiviral vector particles wherein the envelope protein(s) of the third lentiviral vector is different from said first and second envelope protein(s) and especially originates from a different virus strain.
Apart from their pseudotyping envelope protein(s), the lentiviral vectors of the invention may be identical and especially may have identical vector genomes.
Alternatively, their vector genomes may be different, provided they carry the same heterologous determined polynucleotide (also designated as transgene), especially the same polynucleotide having a therapeutic interest.
In another embodiment of the invention, the vector genomes of the lentiviral vectors are different by having a different polynucleotide, provided said different polynucleotides encode polypeptides having common antigenic determinants, or common epitopes. Hence the different polynucleotides may be variants from each other.
As specified above, the expression “vector genome” refers to the nucleic acid i.e., the nucleic acid of lentiviral origin, which constitutes the genome of the lentiviral vector particles. Accordingly the expression relates to any appropriate nucleic acid, i.e., DNA or RNA, either double or single stranded, including in the form containing the DNA flap as a triplex sequence. The nature of the nucleic acid (DNA, RNA) and its organization depend upon the stage of the cycle of the particles, and includes the vector plasmid—used for cotransfection of cells with the encapsidation plasmid and the envelope plasmid—for expression of the particles, or the RNA genome of the particles when formed, or the various forms (including the genomic mRNA transcript, linear unintegrated DNA retrotranscript, or unintegrated one or two LTR DNA circular forms or integrated proviruses) (see in Fields Virology) of nucleic acid of this genome in the transduced cells of the host to whom particles are administered, including the vector pre-integration complex.
As a result of administration of particles to the host, the heterologous polynucleotide allows endogeneous expression of the polypeptides that it encodes in the cells of the host that are transduced by the lentiviral vectors.
Said first and second viral and if any said third and possibly further, envelope protein(s), are selected for their capacity not to sero-neutralize with each other (i.e., not to cross-react). Accordingly, each of said first and second viral and if any said third or further, envelope protein(s), used for pseudotyping the vector particles in the combination, does not react with and especially is not recognized by antibodies directed against the other of said first and second and if any said third or further, envelope protein(s). Accordingly, each of said first and second and if any said third or further, viral envelope protein(s), when administered within a lentiviral vector, does not elicit the production of antibodies, that recognize the other viral envelope protein(s) where such production of said anti-envelope antibodies (so-called antivector immunity) would result in a failure to elicit an immune response against the product expressed from the polynucleotide.
In a particular embodiment, in the kit of compounds, said first and second viral and if any said third or further, envelope protein(s) originate from human viruses, either DNA or RNA viruses.
In a particular embodiment of the kit of compounds of the invention, said first and second and if any said third or further, envelope protein(s) originate from viruses of the same virus family.
In accordance with a particular embodiment of the invention, said first and second envelope viral protein(s) originate from different strain types of the same virus, or from non cross-reactive serotypes of the same virus.
In another embodiment of said kit of compounds, said first and second and if any said third or further, envelope protein(s) originate from viruses of different genus.
In another embodiment of said kit of compounds, said first and second and if any said third or further, envelope protein(s) originate from the same genus or from the same serotype but from different strain types, or from non cross-reactive serotypes of the virus.
The invention especially relates to a kit of compounds, wherein said first and second and if any said third or further, viral envelope protein or viral envelope proteins originate from Rhabdoviridae (including Rabies), especially from a Vesiculovirus, including Vesicular Stomatitis Virus (VSV) from Paramyxoviridae, especially from Measles Virus (MV) Respiratory Syncytia Virus (RSV), or from non-human retroviruses or from Orthomyxoviridae such as Influenza virus.
The above-cited viruses are RNA-viruses, capable of infecting mammalian hosts, especially human hosts. Some of them, such as viruses of the order of Mononegavirales, and especially viruses of the family of Rabdoviridae in particular of the genus of Vesiculoviruses in particular VSV have been proposed to provide envelope protein(s), also designated as surface proteins, to pseudotype viral vectors, especially lentiviral vector particles.
The glycoprotein of the vesicular stomatisis virus (VSV-G) is a transmembrane protein that functions as the surface coat of the wild type viral particles. It is also a common coat protein for engineered lentiviral vectors. Presently, nine virus species are definitively classified in the VSV gender, and nineteen rhabdoviruses are provisionally classified in this gender (see hereafter), all showing various degrees of cross-neutralisation. When sequenced, the protein G genes indicate sequence similarities. The VSV-G protein presents a N-terminal ectodomain, a transmembrane region and a C-terminal cytoplasmic tail. It is exported to the cell surface via the transGolgi network (endoplasmic reticulum and Golgi apparatus).
The VSV strains include several serotypes that may provide envelope protein(s) for the preparation of the lentiviral vectors: The VSV-G glycoprotein may especially be chosen among species classified in the vesiculovirus genus: Carajas virus (CJSV), Chandipura virus (CHPV), Cocal virus (COCV), Isfahan virus (ISFV), Maraba virus (MARAV), Piry virus (PIRYV), Vesicular stomatitis Alagoas virus (VSAV), Vesicular stomatitis Indiana virus (VSIV) and Vesicular stomatitis New Jersey virus (VSNJV) and/or stains provisionally classified in the vesiculovirus genus as Grass carp rhabdovirus, BeAn 157575 virus (BeAn 157575), Boteke virus (BTKV), Calchaqui virus (CQIV), Eel virus American (EVA), Gray Lodge virus (GLOV), Jurona virus (JURY), Klamath virus (KLAV), Kwatta virus (KWAV), La Joya virus (LJV), Malpais Spring virus (MSPV), Mount Elgon bat virus (MEBV), Perinet virus (PERV), Pike fry rhabdovirus (PFRV), Porton virus (PORV), Radi virus (RADIV), Spring viremia of carp virus (SVCV), Tupaia virus (TUPV), Ulcerative disease rhabdovirus (UDRV) and Yug Bogdanovac virus (YBV).
Vesicular stomatitis Indiana virus (VSIV) and Vesicular stomatitis New Jersey virus (VSNJV) are preferred strains to pseudotype the lentiviral vectors of the invention, or to design recombinant envelope protein(s) to pseudotype the lentiviral vectors. However, Isfahan and SVCV envelopes provide also good candidates for the preparation of the pseudotyped particles. Cocal is also interested, to the extent where it is not used in the particles which would be administered first and especially would be preferred for a late or last administration in a prime-boost regimen. When particles are successively administered which have different pseudotyping envelopes, the following order of administration with respect to said envelopes could be preferred, Indiana; New Jersey; Isfahan; SVCV/Cocal. Because Cocal pseudotyped lentiviral vectors seroneutralize several other envelopes, it is preferable, in the vaccination chronology, when Cocal envelopes are to be used in the preparation of particles, to administer them as the last one.
The VSV strains of Indiana and New Jersey serotypes are particularly interesting to be used in the lentiviral vectors of the invention. Their VSV-G proteins are disclosed in Genebank, where several strains are presented. For VSV-G New Jersey strain reference is especially made to the sequence having accession number V01214.
Among VSV, Chandipura virus (CHPV), Cocal virus (COCV), Perinet virus (PERV), Piry virus (PIRYV), SVCV or Isfahan virus may be good candidates to design alternative envelope proteins, and especially to design a third envelope protein or third envelope proteins, or further envelope protein(s). However, it has been shown in the examples that Chandipura virus (CHPV) and Piry virus (PIRYV) provides envelope proteins having low pseudotyping ability when comparing the vector titers obtained with particles prepared with different envelopes. Therefore in a first approach these envelopes may be excluded from the choice of envelopes in order to prepare particles with an efficient transduction capacity.
According to another embodiment, the viral envelope protein(s) originate from other RNA-viruses, for example non-human retroviruses, such as murine retroviruses or from Influenza viruses.
Other examples of envelope protein(s) suitable for lentiviral pseudotyping are given later in the description, especially with a reference to their target cells in a host.
According to a particular embodiment, the kit of compounds of the invention makes use of first and second and if any said third or further, viral envelope protein(s), that originate from Rhabdoviridae, in particular VSV or from Paramyxoviridae wherein the first and second and if any said third or further, envelope protein(s) originate from viruses of different genus, or originate from different virus strains in the same serogroup, especially in the vesicular stomatitis serogroup or alternatively originate from different serotypes of the same genus.
In a particular embodiment of the invention, protein(s) or glycoprotein(s), suitable for use in the design of pseudotyped lentiviral vectors of the kit of compounds are especially produced as monomeric or multimeric protein(s).
In a particular embodiment of the invention, said first and second and if any said third or further, viral envelope protein(s) are capable of uptake by antigen presenting cells and especially by dendritic cells by mean of fusion and/or of endocytosis. In a particular embodiment, the efficiency of the uptake may be used as a feature to choose the envelope of a VSV for pseudotyping. In this respect the relative titer of transduction (Titer DC/Titer of other transduced cells e.g. 293T cells) may be considered and envelope having a relative good ability to fuse with DC would be preferred. Relative titers of transduction are illustrated in the examples.
Antigen Presenting Cells (APC) and especially Dentritic cells (DC) are proper target cells for pseudotyped lentiviral vectors which are used as vaccine compositions, either for a prophylactic or a therapeutic purpose.
The envelope protein(s) used to pseudotype the lentiviral vector particles may thus be selected with respect to the target cells in a host.
Polynucleotide encoding VSV envelope protein(s) (VSV-G) also targets splenocytes, in particular Antigen Presenting Cells (APC) or Dendritic Cells (DC), or liver cells including hepatocytes or non parenchymal cells.
Other target cells may be activated or proliferating cardiomyocytes.
Polynucleotides encoding envelope protein(s) suitable to target determined cells and to be used for pseudotyping the lentiviral vector of the invention are illustrated hereafter: polynucleotides encoding envelope protein(s) of VSV (VSV-G), LCMV (Lymphocytic choriomeningitis Virus), or RRV (Ross River Virus) may be used to prepare vectors suitable to target liver cells (Park 2003) (Kang et al, 2002).
Envelope protein(s) of Ebola or Marburg viruses may be used to target apical surface airway epithelium (Kobinger et al, 2001).
Envelope protein(s) of viruses of the Rhabdoviridae family (including Rabies or Rabies-related viruses like Mokola virus) or of the VSV family may provide neurotropic lentiviral vectors.
Envelope glycoprotein(s) of an Arenavirus such as Lymphocytic Choriomeningitis Virus (LCMV) may be used to transduce fibroblasts, epithelial cells, hematopoietic cells, neuroblastoma and glioma cell lines.
Alphaviruses envelope protein(s) such as the protein(s) of RRV or SFV (Semliki Forest Virus) may target Antigen Presenting Cells (APC), neurons or muscle cells.
Other envelope protein(s) may be used to pseudotype the lentiviral vector of the invention, such as HA protein (influenza hemaglutinin), RD114 protein, envelope protein(s) of Togaviridae, of Orthomyxoviridae (such as Influenza virus), Coronaviridae, Flaviridae, Filoviridae.
The envelope protein(s), also designated sometimes as surface protein in particular viruses, are said to “originate” from a different organism, and especially from different RNA virus strains, meaning that in said protein(s), essential features of the corresponding protein(s) expressed in a determined RNA virus are maintained. Said essential features, relate to the structure or to the function of the protein and are those which enable especially the obtained protein(s) to be expressed at the surface of the vector particles for pseudotyping said vectors. The envelope proteins are then capable of being recognized and internalized in the target cells of the hosts when present on the vector particles.
In a particular embodiment, protein(s) or glycoprotein(s), suitable for use in the design of pseudotyped lentiviral vectors of the kit of compounds are used as multimeric proteins, such as VSV-G protein which is trimeric.
The envelope protein(s) are expressed from a polynucleotide containing the coding sequence for said protein(s), which polynucleotide is inserted in a plasmid (envelope expression plasmid or pseudotyping env plasmid) used for the preparation of the lentiviral vector of the invention. The polynucleotide encoding the envelope protein(s) is under the control of regulatory sequences for the transcription and/or expression of the coding sequence (including optionally a polynucleotide such as WPRE sequence from Invitrogen).
The invention thus relates to a nucleic acid construct which comprises an internal promoter suitable for the use in mammalian, especially in human, cells, in vivo and the nucleic acid encoding the envelope protein under the control of said promoter. The invention also concerns a plasmid containing this construct. Promoters may in particular be selected for their properties as constitutive promoters, tissue-specific promoters, or inducible promoters. Examples of suitable promoters encompass the promoters of the following genes: EF1α, human PGK, PPI (preproinsulin), thiodextrin, HLA DR invariant chain (P33), HLA DR alpha chain, Ferritin L chain or Ferritin H chain, Beta 2 microglobulin, Chymosin beta 4, Chymosin beta 10, or Cystatin Ribosomal Protein L41.
The nucleotide sequence used for the expression of the envelope protein(s) required for pseudotyping the lentiviral vector particles may also be modified with respect to the nucleic acid encoding the native envelope protein(s) used as reference. The modification may be carried out to improve the codons usage (codon optimization) in the cells for the preparation of the vector particles and/or in the transduced cells of the host It may be modified to express a protein different from the native protein(s), especially one which has an improved pseudotyping capacity, an improved capacity in the level of production, or an improved capacity with respect to prevention of sero-neutralization with other envelope protein(s) used in the kit of compounds.
Such a modification of the envelope protein(s) may affect and especially improve their level of production in a cell host or their ability to pseudotype the vector particles possibly by improving the density of envelope protein(s) associated with pseudovirions. Said modification may derive from a mutation in the amino acid sequence of said protein(s), for instance by addition, deletion or substitution of one or several nucleotides or nucleotidic fragments or may relate to post translational modifications and in particular to the glycosylation status of said envelope protein(s).
The envelope protein(s) used to pseudotype the lentiviral vectors of the invention are indeed especially glycoproteins.
It has already been shown that pseudotyping viral vectors with Vesicular Stomatitis Virus glycoprotein (VSV-G) enables the transduction of a large range of cell types from different species. This VSV-G glycoprotein, in addition to its broad tropism, has an interesting stability when used for vector pseudotyping. Therefore, VSV-G have been used as a standard for evaluating the efficiency of other pseudotypes (Cronin J. et al, 2005). Accordingly, VSV-G is an appropriate candidate for pseudotyping the lentiviral vectors of the invention.
The invention especially relates to a kit of compounds as defined in the present application, wherein both said first and second and if any, said third or further viral envelope proteins are transmembrane glycosylated (G) proteins of a VSV virus, said G proteins having different VSV type-specificity in the lentiviral vectors of the kit.
In particular, said first G protein originates from a VSV-Indiana serotype and said second G protein originates from a VSV-New-Jersey serotype, or vice-versa.
It has been shown and reported in the following examples that having recourse in a kit, to pseudotyped viral particles wherein the envelope protein(s), are G proteins of respectively the VSV-Indiana serotype and the VSV-New Jersey serotype enables to prime and boost an immunological reaction when the lentiviral vectors pseudotyped with either of said G proteins are successively used to elicit a reaction in a host to whom they are administered. In such a case, it has been shown that no humoral response (no cross-reactive humoral response) or a low humoral response (low cross-reactive humoral response) is produced against the first envelope protein(s) used which could harm the response elicited in the host against the expression product of the polynucleotide, when said lentiviral vector peudotyped with a second, distinct, envelope protein(s) is administered. This is enabled by the fact that said distinct envelope protein(s) do not cross-neutralize or do not significantly cross-react with each other and accordingly does not give rise to an antivector immune response.
In a particular embodiment, the invention concerns a G protein originating from a VSV which is modified with respect to its native form, and/or is encoded by a nucleic acid molecule which is modified with respect to the natural one, in order to improve pseudotyping. It may be as a result of improvement of envelope protein(s) uptake by the lentiviral particles which allows improvement of transduction of the lentiviral particles by the cells of the host to whom they are administered.
A particular kit of compounds comprises lentiviral vectors wherein one or two or more of them is (are) pseudotyped with recombinant envelope protein(s) comprising domains or fragments originating from different envelope protein(s) of different viruses, especially of different genus of different species of VSV.
In a particular embodiment of the invention, at least one the first, second and if any third or further envelope protein(s) is (are) recombinant envelope protein(s) comprising the export determinant of the VSV-G of Indiana strain.
The export determinant of the VSV-G of the Indiana strain is a polypeptide encoded by the cytoplasmic fragment of the open reading frame of the envelope.
The export determinant of the VSV-G of the Indiana strain is a polypeptide comprising or having amino acid sequence YTDIE in the cytoplasmic tail (Nishimua N. et al. 2002).
Said recombinant envelope protein(s) may comprise the cytoplasmic tail of the VSV-G of an Indiana strain which is the intracellular portion of VSV-G delimited by a hydrophobic transmembrane domain.
A particular kit of compounds comprises lentiviral vectors wherein one or two or more of them is (are) pseudotyped with recombinant envelope protein(s) comprising the cytoplasmic domain of the indiana VSV and the ectodomain of a strain of a different VSV serotype. The transmembrane domain may also be the one of the Indiana VSV-G.
A particular kit of compounds comprises lentiviral vectors wherein one or both of them is (are) pseudotyped with recombinant envelope protein(s) comprising the transmembrane domain and the cytoplasmic domain of the Indiana VSV and the ectodomain of the New-Jersey VSV.
Appropriate other modifications encompass mutations, especially point mutations, that improve pseudotyping. Such mutations for the VSV-G proteins may be carried out in the transmembrane domain by substituting or deleting one or several amino acid residues. Other examples of appropriate mutations are disclosed in Fredericksen B. L. et al (1995) or Nishimura N. et al (2003).
When reference is made to “fragments” in the present description, it refers to polynucleotides or polypeptides having respectively a nucleotide sequence or an amino acid sequence of at least or longer than 6 nucleotides, respectively of at least or longer than 2 amino acid residues.
It is also especially possible to modify the glycosylation status of the VSV-G, in order to improve transduction efficiency of the lentiviral vector pseudotyped with these VSV-G proteins, when administered to a host.
VSV-G proteins from various strains of VSV are disclosed in the figures and their sequences can also be derived from databases, especially from Genebank.
Considering the glycoproteins of the New-Jersey and Indiana strains of VSV, it has been proposed that glycosylation at two asparagine residues (N180 and N336) favour the efficient pseudotyping of lentiviral vectors. This particular feature may be applied in the preparation of the lentiviral vectors of the invention.
The invention especially relates to the following constructs encoding VSV-G derived envelope proteins, and to their use in the preparation of the combination of lentiviral vector particles of the invention. The invention also relates to the envelope proteins encoded by said constructs:
A VSV-G Indiana gene codon optimized is disclosed in
A VSV-G New-Jersey gene codon optimized is disclosed in
Other envelope genes suitable to carry out the invention having codon optimized sequences are illustrated in
The invention is also directed to fusion envelope proteins, especially fusion proteins involving several different fragments of VSV-G proteins of different viruses and to the nucleic acid constructs encoding such proteins. A particular fusion envelope is the fusion between the ectodomain of the New-Jersey envelope protein and the transmembrane domain and cytoplasmic domain of the Indiana envelope protein as illustrated in the figures.
Another fusion envelope protein according to the invention comprises the ectodomain of one VSV-G protein selected among VSV-G Chandipura, VSV-G Cocal, VSV-G Pyri, VSV-G Isfahan, or VSV-G SVCV and the tranmembrane and cytoplasmic domains of VSV-G Indiana. The invention also relates to a nucleic acid molecule encoding said fusion protein illustrated in the figures, and especially a codon optimized nucleic acid encoding the fusion protein also described in the figures.
The invention also concerns the expression vectors, especially the plasmids containing the nucleic acid constructs encoding the fusion proteins.
Basic, essential features characterizing the vector genome used in the construction of the pseudotyped lentiviral vector particles of the invention have been described hereabove. Additional features for the preparation of suitable vector genome (also designated as transfer vector) are disclosed hereafter, including in the examples and in the drawings.
In a particular embodiment of the invention, the pseudotyped lentiviral vectors are human lentivirus based vectors. Accordingly their genome is derived from a human lentivirus, especially from the HIV lentivirus. In particular, the pseudotyped lentiviral vector is an HIV-based vector, such as an HIV-1, or HIV-2 based vector, in particular is derived from HIV-1M, for example from the BRU or LAI isolates.
In another embodiment, the pseudotyped lentiviral vectors are primate or feline lentivirus based vectors.
As stated above, when considering it apart from the transgene that it finally contains, the vector genome is a replacement vector in which the nucleic acid between the 2 long terminal repeats (LTRs) in the original lentivirus genome have been restricted to cis-acting sequences for DNA or RNA synthesis and processing, or at least are deleted or mutated for essential nucleic acid segments that would enable the expression of lentiviral structure proteins including biological functional GAG polyprotein and possibly POL and ENV proteins.
In a particular embodiment, the vector genome is defective for the expression of biologically functional Gag, and advantageously for biologically functional POL and ENV proteins.
The 5′ LTR and 3′ LTR sequences of the lentivirus are used in the vector genome, but the 3′-LTR at least is modified with respect to the 3′LTR of the original lentivirus at least in the U3 region. The 5′LTR may also be modified, especially in its promoter region.
In a particular embodiment the vector genome is accordingly devoid of the coding sequences for Vif-, Vpr, Vpu- and Nef-accessory genes (for HIV-1 lentiviral vectors), or of their complete or functional genes.
In a preferred embodiment, the vector genome of the lentiviral vector particles comprises, as an inserted cis-acting fragment, at least one polynucleotide consisting in the DNA flap or containing such DNA flap. In a particular embodiment, the DNA flap is inserted upstream of the polynucleotide of interest, advantageously but not necessarily to be located in an approximate central position in the vector genome. A DNA flap suitable for the invention may be obtained from a retrovirus, especially from a lentivirus, in particular a human lentivirus, or from a retrovirus-like organism such as retrotransposon. It may be alternatively obtained from the CAEV (Caprine Arthritis Encephalitis Virus) virus, the EIAV (Equine Infectious Anaemia Virus) virus, the VISNA virus, the SIV (Simian Immunodeficiency Virus) virus or the FIV (Feline Immunodeficiency Virus) virus. The DNA flap may be either prepared synthetically (chemical synthesis) or by amplification of the DNA providing the DNA Flap from the appropriate source as defined above such as by Polymerase chain reaction (FOR). In a more preferred embodiment, the DNA flap is obtained from an HIV retrovirus, for example HIV-1 or HIV-2 virus including any isolate of these two types.
The DNA flap (defined in Zennou V. et al., 2000, Cell vol 101, 173-185 or in WO 99/55892 and WO 01/27304), is a structure which is central in the genome of some lentiviruses especially in HIV, where it gives rise to a 3-stranded DNA structure normally synthesized during especially HIV reverse transcription and which acts as a cis-determinant of HIV genome nuclear import. The DNA flap enables a central strand displacement event controlled in cis by the central polypurine tract (cPPT) and the central termination sequence (CTS) during reverse transcription. When inserted in lentiviral-derived vectors, the polynucleotide enabling the DNA flap to be produced during reverse-transcription, stimulates gene transfer efficiency and complements the level of nuclear import to wild-type levels (Zennou et al., Cell, 2000).
Sequences of DNA flaps have been disclosed in the prior art, especially in the above cited patent applications. These sequences are also disclosed in the attached figures as SEQ ID NO 1 to SEQ ID NO 7. They are preferably inserted as fragment possibly with additional flanking sequences in the vector genome in a position which is near the centre of said vector genome. Alternatively they may be inserted immediately upstream from the promoter controlling the expression of the polynucleotide of the invention. Said fragments comprising the DNA flap, inserted in the vector genome may have a sequence of about 80 to about 200 bp, depending on its origin and preparation.
According to a particular embodiment, a DNA flap has a nucleotide sequence of about 90 to about 1.40 nucleotides.
In HIV-1, the DNA flap is a stable 99-nucleotide-long plus strand overlap. When used in the genome vector of the lentiviral vector of the invention, it may be inserted as a longer sequence, especially when it is prepared as a PCR fragment. A particular appropriate polynucleotide comprising the structure providing the DNA flap is a 178-base pair polymerase chain reaction (PCR) fragment encompassing the cPPT and CTS regions of the HIV-1 DNA (Zennou et al 2000).
This PCR fragment may especially be derived from infective DNA clone of HIV-1 LAI especially pLAI3 of HIV1, as a fragment corresponding to the sequence from nucleotide 4793 to 4971. If appropriate, restriction sites are added to one or both extremities of the obtained fragment, for cloning. For example, Nar I restriction sites may be added to the 5′ extremities of primers used to perform the PCR reaction.
Therefore, the DNA flap is used, in the present invention, deleted from the unnecessary 5′ and 3′ parts of the pol gene and is recombined with sequences of different origin. The DNA flap may be either prepared synthetically (chemical synthesis) or by amplification of the DNA providing the DNA flap from the appropriate source as defined above such as by Polymerase chain reaction (PCR). In a more preferred embodiment, the DNA flap is obtained from an HIV retrovirus, for example HIV-1 or HIV-2 virus including any isolate of these two types.
It is specified that the DNA flap used in the genome vector and the polynucleotides of the encapsidation plasmid encoding the GAG and POL polyproteins should originate from the same lentivirus sub-family or from the same retrovirus-like organism.
Preferably, the other cis-activating sequences of the genome vector also originate from the same lentivirus or retrovirus-like organism, as the one providing the DNA flap.
The vector genome may further comprise one or several unique restriction site(s) for cloning the polynucleotide of interest.
According to the invention, the pseudotyped lentiviral vector is a replication-incompetent lentiviral vector as a result of the fact that gag and pol functional genes are exclusively provided in trans and therefore not present on the vector genome. In such a case, when the lentiviral vector has been administered to the host, it is not capable of replicating in the host cells. Accordingly, it provides the polynucleotide of therapeutic interest into the host cells for expression but does not form further lentiviral vector particles. This replication-incompetent of the lentiviral vector status is achieved especially when the lentiviral gag, pol, env genes are not provided in the vector genome or are not provided as functional genes. By “functional” it is meant a gene that is correctly transcribed, and/or correctly expressed. Thus, the lentiviral vector genome of the invention in this embodiment contains at least one of the gag, pol and env genes that is either not transcribed or incompletely transcribed; the expression “incompletely transcribed” refers to the alteration in the transcripts gag, gag-pro or gag-pro-pol, one of these or several of these being not transcribed. Other sequences involved in lentiviral replication may also be mutated in the vector genome, in order to achieve this status.
In a preferred embodiment, in said vector genome, the 3′ LTR sequence of the lentiviral vector genome is devoid of at least the activator (enhancer) and possibly the promoter of the U3 region. In another particular embodiment, the 3′ LTR region is devoid of the U3 region (delta U3). In this respect, reference is made to WO 01/27300 and WO 01/27304.
In a particular embodiment, in the vector genome, the U3 region of the LTR 5′ is replaced by a non lentiviral U3 or by a promoter suitable to drive tat-independent primary transcription. In such a case, the vector is independent of tat transactivator.
The vector genome also comprises the psi (ψ) packaging signal. The packaging signal is derived from the N-terminal fragment of the gag ORF. In a particular embodiment, its sequence could be modified by frameshift mutation(s) in order to prevent any interference of a possible transcription/translation of gag peptide, with that of the transgene.
The vector genome may optionally also comprise elements selected among a splice donor site (SD), a splice acceptor site (SA) and/or a Rev-responsive element (RRE).
According to a particular embodiment, the vector plasmid (or added genome vector) comprises the following cis-acting sequences for a transgenic expression cassette:
In a particular embodiment, apart from the polynucleotide of therapeutic interest which may be derived from a coding region of a lentivirus, the vector plasmid disclosed with respect to the above-cited cis-acting sequences, is devoid from other lentiviral nucleotide sequences.
The lentiviral vector of the invention is non replicative i.e., the vector and lentiviral vector genome are not able to form new particles budding from the infected host cell. This may be achieved by the absence in the lentiviral genome of the gag, pol or env genes, as indicated in the above paragraph; this can also be achieved by deleting other viral coding sequence(s) and/or cis-acting genetic elements needed for particles formation. The absence of replication of the lentiviral vector should be distinguished from the replication of the lentiviral genome. Indeed, as described before, the lentiviral genome may contain an origin of replication ensuring the replication of the lentiviral vector genome without ensuring necessarily the replication of the vector (or particle).
In a further embodiment, particularly when the polynucleotide encoding the at least one antigenic polypeptide originates from a lentivirus, said lentiviral vector genome does not comprise a complete lentiviral gag, pol or env coding polynucleotide, meaning that said lentiviral vector genome comprises a polynucleotide shorter than the lentiviral gag, pol or env genes. Therefore, the gag coding sequence is shorter than 1500 by for HIV-1 or HIV-2; the pol coding sequence is shorter than 3000 by for HIV-1 and 3300 by for HIV-2; the env coding sequence is shorter than 2700 by for HIV-1 and 2500 by for HIV-2. This size refers to the longest continuous nucleotide sequence found as such in the native lentiviral genome. However, in another particular embodiment, the lentiviral genome is devoid of all endogenous coding lentiviral sequences.
In order to obtain lentiviral vectors according to the invention, the vector genome (as a vector plasmid) must be encapsidated in particles or pseudo-particles. Accordingly, lentiviral proteins, except the envelope proteins, have to be provided in trans to the vector genome in the producing system, especially in producing cells, together with the vector genome, having recourse to at least one encapsidation plasmid carrying the gag and pol lentiviral genes or integrative—incompetent pol gene, and preferably lacking the coding sequences for Vif-, Vpr, Vpu- and Nef-accessory genes (for HIV-1 lentiviral vectors).
A further plasmid is used, which carries a polynucleotide encoding the envelope protein(s) selected for pseudotyping each lentiviral vector.
In a preferred embodiment, the packaging plasmid encodes only the lentiviral proteins essential for viral particle synthesis. Accessory genes whose presence in the plasmid could raise safety concerns are accordingly removed. Viral proteins brought in trans are respectively as illustrated for HIV-1:
In order to avoid any packaging of the mRNA generated from the genes contained in the packaging plasmid in the viral particles, the ψ region is removed from the packaging plasmid. A heterologous promoter is inserted in the plasmid to avoid recombination issues and a poly-A tail is added 3′ from the sequences encoding the proteins.
The envelope plasmid encodes the envelope protein(s) for pseudotyping which are disclosed herein, under the control of an internal promoter.
Any or all the described plasmids for the preparation of the lentiviral vector particles of the invention may be codon optimized (CO) in the segment encoding proteins. Codon optimization according to the invention is preferably performed to improve translation of the coding sequences contained in the plasmids, in mammalian cells, especially human cells. According to the invention, codon optimization is especially suited to directly or indirectly improve the preparation of the vector particles or to improve their uptake by the cells of the host to whom they are administered, or to improve the efficiency of the transfer of the polynucleotide of interest (transgene) in the genome of the transduced cells of the host. Methods for optimizing codons are well known in the art and codon optimization is especially performed using available programs to that effect. Codon optimization is illustrated for the coding sequences contained in the described pTRIP plasmids and pThV plasmids of the invention illustrated in the figures.
In a particular embodiment of the invention, the pseudotyped lentiviral vector is also, or alternatively, integrative-incompetent. In such a case, the vector genome and thus the heterologous polynucleotide of therapeutic interest do not integrate into the genome of the transduced cells or in the cells of the host to whom it has been administered.
The present invention relates to the use of a lentiviral vector wherein the expressed integrase protein is defective and which further comprises a polynucleotide especially encoding at least one antigenic polypeptide, to produce an immunogenic composition suitable for eliciting an immune response against said at least one polypeptide, in a host in need thereof. The polynucleotide is one having the features disclosed herein.
Said polynucleotide (or lentiviral vector genome) comprises all the elements necessary for the nucleic import and the correct expression of the polynucleotide encoding at least one antigenic polypeptide. As examples of elements that can be inserted in the lentiviral genome of the lentiviral vector of the invention are at least one (preferably two) long terminal repeats (LTR), such as a LTR5′ and a LTR3′, a psi sequence involved in the lentiviral genome encapsidation, and optionally at least one DNA flap comprising a cPPT and a CTS domains. The lentiviral vector genome may also comprise elements selected among a splice donor site (SD), a splice acceptor site (SA) and/or a Rev-responsive element (RRE).
In a particular embodiment, said lentiviral vector is pseudotyped with a VSV-G protein, as described herein.
By “defective”, it is meant that the integrase, preferably of lentiviral origin, is devoid of the capacity of integration of the lentiviral genome into the genome of the host cells i.e., an integrase protein mutated to specifically alter its integrase activity.
Integration-incompetent lentiviral vectors are obtained by modifying the pol gene encoding the Integrase, resulting in a mutated pol gene encoding an integrative deficient integrase, said modified pol gene being contained in the encapsidation plasmid. Such integration-incompetent lentiviral vectors have been described in patent application WO 2006/010834. Accordingly the integrase capacity of the protein is altered whereas the correct expression from the encapsidation plasmid of the GAG, PRO and POL proteins and/or the formation of the capsid and hence of the vector particles, as well as other steps of the viral cycle, preceding or subsequent to the integration step, such as the reverse transcription, the nuclear import, stay intact. An integrase is said defective when the integration that it should enable is altered in a way that an integration step takes place less than 1 over 1000, preferably less than 1 over 10000, when compared to a lentiviral vector containing a corresponding wild-type integrase.
In a particular embodiment of the invention, the defective integrase results from a mutation of class 1, preferably amino acid substitutions (one-amino acid substitution) or short deletions fulfilling the requirements of the expression of a defective integrase. The mutation is carried out within the poi gene. These vectors may carry a defective integrase with the mutation D64V in the catalytic domain of the enzyme, which specifically blocks the DNA cleaving and joining reactions of the integration step. The D64V mutation decreases integration of pseudotyped HIV-1 up to 1/10,000 of wild type, but keep their ability to transduce non dividing cells, allowing efficient transgene expression.
Other mutations in the pol gene which are suitable to affect the integrase capacity of the integrase of HIV-1 are the following: H12N, H12C, H16C, H16V, S81 R, D41A, K42A, H51A, Q53C, D55V, D64E, D64V, E69A, K71A, E85A, E87A, D116N, D1161, D116A, N120G, N1201, N120E, E152G, E152A, D-35-E, K156E, K156A, E157A, K159E, K159A, K160A, R166A, D167A, E170A, H171A, K173A, K186Q, K186T, K188T, E198A, R199c, R199T, R199A, D202A, K211A, Q214L, Q216L, Q221 L, W235F, W235E, K236S, K236A, K246A, G247W, D253A, R262A, R263A and K264H.
In a particular embodiment, mutation in the pol gene is performed at either of the following positions D64, D116 or E152, or at several of these positions which are in the catalytic site of the protein. Any substitution at these positions is suitable, including those described above.
Another proposed substitution is the replacement of the amino acids residues RRK (positions 262 to 264) by the amino acids residues AAH.
In a particular embodiment of the invention, when the lentiviral vector is integration-incompetent, the lentiviral genome further comprises an origin of replication (ori), whose sequence is dependent on the nature of cells where the lentiviral genome has to be expressed. Said origin of replication may be from eukaryotic origin, preferably of mammalian origin, most preferably of human origin. It may alternatively be of viral origin, especially coming from DNA circular episomic viruses, such as SV40 or RPS. It is an advantageous embodiment of the invention to have an origin or replication inserted in the lentiviral genome of the lentiviral vector of the invention. Indeed, since the lentiviral genome does not integrate into the cell host genome (because of the defective integrase), the lentiviral genome is lost in cells undergoing frequent cell divisions; this is particularly the case in immune cells, such as B or T cells. The presence of an origin of replication ensures that at least one lentiviral genome is present in each cell, even after cell division, maximazing the efficiency of the immune response.
In a particular embodiment of the invention, the lentiviral vector genome is a HIV-based genome and has the sequence features represented on
The internal promoter contained in the transgene or in the expression cassette of the vector genome may be selected from the promoters of the following genes: EF1α, human PGK, PPI (preproinsulin), thiodextrin, HLA DR invariant chain (P33), HLA DR alpha chain, Ferritin L chain or Ferritin H chain, Beta 2 microglobulin, Chymosin beta 4, Chimosin beta 10, or Cystatin Ribosomal Protein L41.
The lentiviral vector genome of said lentiviral vectors of the invention may especially be derived from HIV-1 plasmid pTRIPΔ3.CMV-GFP deposited at the CNCM (Paris, France) on Oct. 11, 1999 under number 1-2330. The structure and restriction sites of the various sequences contained in the plasmid are shown on
In a particular embodiment of the invention, the lentiviral vector genome may be derived from HIV-1 plasmid pTRIP[delta]U3EF1[alpha]-GFP deposited at the CNCM on Oct. 11, 1999 under number 1-2328. A description of the constituting sequences of the plasmid is depicted in
When the vector genome is derived from these particular plasmids, a sequence of a heterologous polynucleotide as disclosed in the present application is inserted therein, in addition or in replacement of the GFP coding fragment. The GFP coding sequence may also be substituted by a different marker. The CMV promoter may also be substituted by another promoter, especially one of the promoters disclosed above, especially in relation to the expression of the transgene.
Other lentiviral vector genomes suitable to carry out the invention are those contained in the deposited material listed hereafter or are derived from these deposited plasmids, especially by substituting the transgene either for a different polynucleotide of interest and/or for a different internal promoter. The WPRE sequence also contained in the particular depositied pTRIP vectors may also be deleted.
The invention thus concerns the lentiviral vector genome provided by plasmid pTRIPDeItaU3-CMV-SIV-GAGco-WPRE deposited at the CNCM (Paris, France) on Oct. 10, 2007 under Number I-3841. The composition of the plasmid is disclosed in the figures and its sequence is provided. This plasmid expresses the GAG protein of SIV as a non-myristilated protein. The ORF of the transgene has been codon optimized for the expression in human cells.
The invention also concerns the lentiviral vector genome provided by plasmid pTRIPDelta U3-CMV-SIV-GAG-WPRE deposited at the CNCM (Paris, France) on Oct. 10, 2007 under Number I 3840. The composition of the plasmid is disclosed in the figures and its sequence is provided. This plasmid expresses the GAG protein of SIV as a non-myristilated protein. The ORF of the transgen is not codon optimized.
Vector particles may be produced after transfection of appropriate cells, such as 293 T cells, by said plasmids, or by other processes. In the cells used for the expression of the lentiviral particles, all or some of the plasmids may be used to stably express their coding polynucleotides, or to transiently or sem-stably express their coding polynucleotides.
The concentration of particles produced can be determined by measuring the P24 (capsid protein for HIV-1) content of cell supernatants.
The lentiviral vector of the invention, once administered into the host, infects cells of the host, possibly specific cells, depending on the envelope proteins it was pseudotyped with. The infection leads to the release of the lentiviral genome into the cytoplasm of the host cell where the retrotranscription takes place. Once under a triplex form (via the DNA flap), the lentiviral genome is imported into the nucleus, where the polynucleotide of interest is expressed via the cellular machinery. When non-dividing cells are transduced (such as DC), the expression may be stable. When dividing cells are transduced, such as B cells, the expression is temporary in absence of origin of replication in the lentiviral genome, because of nucleic acid dilution and cell division. The expression may be longer by providing an origin of replication ensuring a proper diffusion of the lentiviral genome into daughter cells after cell division. The stability and/or expression may also be increased by insertion of MAR (Matrix Associated Region) or SAR (Scaffold Associated Region) elements.
Indeed, these SAR or MAR regions are AT-rich sequences enable to anchor the lentiviral genome to the matrix of the cell chromosome, thus regulating the transcription of the polynucleotide encoding at least one antigenic polypeptide, and particularly stimulating gene expression of the transgene and improving chromatin accessibility.
If the lentiviral genome is non integrative, it does not integrate into the host cell genome. Nevertheless, the at least one polypeptide encoded by the transgene is sufficiently expressed and longer enough to be processed, associated with MHC molecules and finally directed towards the cell surface. Depending on the nature of the polynucleotide of interest, the at least one polypeptide epitope associated with the MHC molecule triggers a humoral or a cellular immune response. The preparation of integrative-incompetent lentiviral vector, has been disclosed herein: the encapsidation plasmid used to transcomplement the vector genome is mutated in the region of the integrase protein, in such a way that said integrase is not expressed or is not functionally expressed in the lentiviral vector when said vector is produced as pseudotyped particles in a cell host, after said lentiviral vector has been administered to a patient.
The expression “immunogenic composition” refers to a composition comprising at least the lentiviral vector of the invention as active principle, said composition being suitable for administration into a host. This composition may comprise further a pharmaceutically suitable excipient or carrier and/or vehicle, when used for systemic or local administration. A “pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any conventional type. A “pharmaceutically acceptable carrier” is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation; Suitable carriers include, but are not limited to, phosphate buffered saline solutions, distilled water, emulsions such as an oil/water emulsions, various types of wetting agents sterile solutions and the like, dextrose, glycerol, saline, ethanol, and combinations thereof.
The immunogenic composition of the invention has the capacity, despite the absence of integration of the transgene into the genome of the host cell, to elicit an immune response i.e., any reaction by the immune system of the host against said at least one polypeptide (encoded by said transgene).
The immune response can be a humoral response i.e., antibodies, elicited by said composition, are produced against said at least one polypeptide of the lentiviral vector. In a particular embodiment, said humoral response is a protective humoral response. The protective humoral response results mainly in maturated antibodies, having a high affinity for their antigen, such as IgG. In a particular aspect, the protective humoral response is T-cell dependent. In a particular embodiment, the protective humoral response induces the production of neutralizing antibodies.
The immune response can be a cellular immune response (T-cell immune response), particularly a CD8-mediated cellular immune response or a CD4-mediated cellular immune response i.e., an immune response which is mediated by activated cells harbouring CD8 or CD4 receptors, preferably Cytotoxic T lymphocytes (CTL).
In a particular embodiment of the invention, the lentiviral vector of the invention, despite the defective integrase, is able to elicit an early immune response. The expression “early immune response” refers to a protective immune response (protection against the pathogen or tumoral cell bearing said at least one polypeptide) that is conferred within about one week after the administration of the composition.
In another embodiment, the immune response conferred by the composition of the invention is a long lasting immune response i.e., said immune response can be still detected at least two months, preferably at least 3 months and most preferably at least 6 months after the administration of the composition. When the immune response is humoral, the long lasting response can be shown by the detection of specific antibodies, by any suitable methods such as ELISA, immunofluorescence (IFA), focus reduction neutralization tests (FRNT), immunoprecipitation, or Western blotting.
In another embodiment, independent of the above-embodiment, the strength of the immune response conferred by the composition of the invention is dependent upon the injected doses of the lentiviral vectors; the higher the dose, the higher the immune response strength.
Interestingly, said immune response, either humoral or cellular, early immune response and/or long lasting immune response, is elicited with the non-integrative gene transfer vector, after a single administration of the composition of the invention.
With a view to use the lentiviral vector particles and especially the kit of compounds in the design of medicinal treatment protocols, the lentiviral vectors of the invention carry in their vector genome, a heterologous polynucleotide (or transgene) having a therapeutic interest. By the expression “heterologous polynucleotide”, it is meant that the vector genome comprises, irrespective from the ci-acting sequences in the vector genome that originate from the lentivirus genome and which are necessary or useful for the vector activity, at least one polynucleotide which is not necessary or which is not useful for the vector activity but which is suitable to obtain a biological effect, especially a medicinal effect when it is expressed in a host especially a human host. In a preferred embodiment, the polynucleotide of interest encodes a polypeptide and is preferably included in an expression cassette.
The heterologous polynucleotide of the invention encodes one polypeptide or several polypeptides which is (are) suitable for eliciting an immune response in a host, said immune response being a cellular immune response and possibly a humoral response. The encoded polypeptide(s) (i.e. antigen) comprise(s) one or several epitopes or consist(s) in epitope(s) of an antigen. In a particular embodiment, it may be a polyepitope. It (they) may be processed in the cells of the host for presentation by the APC, especially the DC, of the host to give rise to an immune response, or it (they) may directly elicit an immune response. Accordingly, the polynucleotide of interest comprises or consists of sequences of B epitope(s) and/or T epitope(s) of one or several antigens, including association of both categories of epitopes, possibly giving rise to a chimeric (i., e., non natural) polypeptide.
The epitope may depend either from a specific three-dimensional antigenic conformation (conformational epitope), or may correspond to a simple primary sequence region (linear epitope). The size of the polypeptide ranges from at least 9 amino acids up to 500 amino acids, and is preferably less than 200 amino acids.
In a particular embodiment, the heterologous polynucleotide encodes an antigen or several antigens or fragments thereof including epitopes (B and/or T epitopes) of a pathogenic organism such as a virus, especially a retrovirus, lentivirus, flavivirus or corona virus, bacteria or parasite, or of a pathogenic agent or compound. It may encode an antigen of the pathogenic organism or recombinant antigens, to the extent that it does not enable expression of the pathogenic organism when the lentiviral vector is administered.
The heterologous polynucleotide may be expressed as endogenous antigen in the cells of the host especially after transfer of said polynucleotide in the genome of the host cells and processed in said cells for presentation in association with MHC molecules.
The polynucleotide of interest may be chosen so that the immune response elicited with the vector, possibly after presentation by APC, may especially encompass an elicitation of T lymphocytes response, including T helper or CTL cells (cytotoxic). A CD8+ T cell response, against the processed expression product of said polynucleotide, in a host is especially of interest.
A CD4+ T cell response may also be expressed (induced or elicited).
Particular cells targeted by the lentiviral vectors of the present invention either in integrative or in non-integrative version are cells involved in immune response, such as antigen presenting cells (APC), dendritic cells (DC), including conventional DC (cDC) or plasmacytoid (pDC), T cells, including CD4+or CD8+, B cells, monocytes, macrophages, Natural Killer cells, Natural Killer T cells, endothelial cells and epithelial cells. Interestingly, B cells have been recently shown to interact with circulating mature DC, thus activating these B cells, that in turn efficiently present antigens to naïve T cells (amplification of the mature APC population); therefore, this points out the critical role of B cells in priming cells involved in cellular immune response, and particularly naïve CD8+ T cells (Diaz de Durana; 2006).
The polynucleotide of interest may be chosen so that the lentivirus vector of the invention may also or alternatively be used to elicit a humoral immune response, especially a neutralizing humoral immune response, against the expression product of said polynucleotide, in a host.
In a particular embodiment of the invention wherein the lentiviral vector particles are intended for prevention or treatment of non lentiviral infections, the heterologous polynucleotide having a biological or a therapeutic interest is of a different origin than the polynucleotide constituting the vector genome. Especially, it is originating from a different organism than the lentivirus providing the sequences of the vector genome.
In a particular embodiment, where prevention or treatment of a lentiviral infection is sought, the heterologous polynucleotide may be originating from the same family or the same serotype of lentivirus providing the vector, especially when the lentiviral vector particles are HIV-based lentiviral vectors.
In a particular embodiment, the heterologous polynucleotide encodes an antigen derived from a lentiviral protein or an antigenic fragment thereof or a combination of such antigens. In such a case, said lentiviral protein antigen derived thereof or antigenic fragment thereof is used in conditions which prevent formation of native or replicative-competent lentiviral particles.
In a particular embodiment, it is used in conditions which also prevent the formation of lentivirus pseudo particles such as GAG or GAG-POL pseudo particles. These antigens may be derived from the same lentivirus, especially HIV, in particular HIV-1, as the one used for the design of the lentiviral vector.
Accordingly, the polynucleotide can be a coding sequence of one or several a HIV polypeptide(s) or polyepitopes, especially HIV-1 polypeptides or polyepitopes, suitable to elicit a cellular, especially a cytotoxic T-lymphocyte (CTL) response, and possibly T helper response in a host.
In a preferred embodiment of the invention, the lentiviral vectors comprise in their genome, a recombinant polynucleotide encoding one or several polypeptides comprising at least one antigen derived from a GAG antigen or polyprotein of an Immunodeficiency Virus, especially from HIV, SIV or Fly.
GAG polyprotein encompasses the Matrix protein (MA), the Capsid protein (CA), and the Nucleocapsid protein (NP). It may also comprise the p7 protein.
GAG derived antigens as defined above encompasses polypeptides derived from each of theses proteins, including fragments thereof or mutated (by deletion, substitution or addition) versions thereof. It also encompasses combinations of such polypeptides derived from each of these proteins.
In a particular embodiment, an antigen derived from GAG of an immunodeficiency virus has the amino acid sequence of the natural GAG antigens, especially of the GAG polyprotein or the Matrix protein or the Capsid protein or the nucleocapsid protein, or is a fragment of such polyprotein or of such protein, or is a GAG antigen which is modified with respect to the natural GAG antigen, especially by mutation, including by deletion, substitution or addition of one or several amino acid residues in the amino acid sequence, or which is modified by post translational modifications. The modified GAG antigen is selected to be either biologically functional or biologically non-functional.
In a particular embodiment, the recombinant polynucleotide encoding one or several polypeptides comprising at least one antigen derived from a GAG polyprotein of an Immunodeficiency Virus encodes a polypeptide which is a biologically non-functional GAG polypeptide (including an antigenic fragment of GAG) of SIV especially SIVMAC, or of FIV, or of HIV in particular HIV-1 or HIV-2, and which is not capable of forming biologically functional capsids proteins within cells transduced with the lentiviral vectors, and especially does not induce secretion of capsid proteins from these cells that would enable formation of GAG pseudo particles or GAG-POL pseudo-particles.
In a particular embodiment, the polynucleotide including the nucleic acid encoding the antigen derived from GAG does not enable the expression of POL biologically active polypeptides (polyprotein also designated as precursor) and thus does not comprise the pol native genes or an equivalent functional gene.
In a particular embodiment, the recombinant polynucleotide encoding one or several polypeptides comprising at least one antigen derived from a GAG antigen of an Immunodeficiency Virus also encodes a polypeptide derived from a NEF, TAT or REV antigens of an Immunodeficiency Virus, and/or optionally from a POL antigen of an Immunodeficiency Virus or a combination thereof. These polypeptides are especially antigenic fragments of said antigens.
Examples of recombinant polynucleotide encoding an antigen derived from GAG (of HIV-1) and further nucleotide fragments encoding other antigens of HIV-1 in a fusion protein, is one which encodes a GAG protein as illustrated in
In a preferred embodiment, the antigens derived from GAG and/or
NEF and/or POL antigens are derived from a Human Immunodeficiency Virus (HIV), in particular HIV-1 or HIV-2.
In a particular embodiment, the polypeptide derived from the GAG antigen is a GAGΔmyr protein which is not myristylated contrary to native GAG.
Non myristylated HIV-1 GAG may be obtained by mutating the coding sequence of GAG at codon 2 to change Gly residue [GGA] to Ala residue [GCA], or by deletion of said codon 2.
Other GAG derived antigen of interest for the invention are antigens formed of fragments of at least one of the Matrix, Capsid and Nucleocapsid proteins of GAG, especially are formed of a fusion of fragments of each of said proteins.
It is observed that the encoded derived antigen may be derived from GAG antigen of HIV-1, especially of HIV-1 subtype B or from HIV-1 group 0 (
The invention also relates to a lentiviral vector as defined herein which comprises in its genome, a recombinant polynucleotide which has a human codon optimized sequence encoding an antigen derived from a GAG polyprotein of a Human Immunodeficiency Virus (HIV), or encoding a fusion antigen including an antigen derived from GAG and from at least an antigenic fragment of NEF, TAT, REV or POL as disclosed herein.
A chimeric HIV-1 derived antigen of the invention is, in a particular embodiment, a fusion protein comprising or consisting in the combination of the GAG derived antigen having the sequence of
A particular fusion protein as disclosed above is one wherein POL derived antigen comprises or has the amino acid sequence of
A particular fusion protein as disclosed above is one wherein the NEF derived antigen comprises or has the amino acid sequence of
The antigens encoded by the polynucleotide of the vector genome, and especially the GAG derived antigen, may be of natural, synthetic or recombinant origin and accordingly expressed by any conventional methods.
The invention also relates to nucleotidic constructs encoding such fusion antigen, including in their codon optimized version for expression in mammalian, especially in human cells.
According to a particular embodiment, the recombinant polynucleotide encodes an antigen derived from the GAG polyprotein of HIV-1 consensus B strain.
In another particular embodiment, the recombinant polynucleotide encodes an antigen derived from a GAG polyprotein and a cluster of epitopes of NEF antigen of HIV and optionally a cluster of epitopes of POL polyprotein of HIV.
The invention relates to nucleic acid molecules encoding the antigen disclosed herein. It relates in particular to the nucleic acid molecules inserted in plasmids deposited at the CNCM and especially the plasmids pTRIPDelta U3-CMV-SIV-GAG-WPRE or pTRIPDelta U3-CMV-SIV-GAG co-WPRE, deposited at the CNCM or the plasmids pThV-VSV-G(IND-co), pThV-VSV-G(NJ-co), pThV-VSV-G(COCAL-co) pThV-VSV-G(ISFA-co) or pThV-VSV-G(SVCV-co) deposited at the CNCM, or to sequences hybridizing in stringent conditions with these nucleic acid molecules and especially having the same length or being shorter, Particular acid nucleics encode at least a GAG antigen or a fragment thereof and especially encodes a HIV-1 or HIV-2 GAG antigen or a fragment thereof.
The specificity of the cellular response is measured when comparing the response obtained with the lentivirus vector particles expressing a heterologous polynucleotide encoding an antigen of HIV or an antigen derived therefrom with the response obtained with particles not expressing said antigen. It is observed that the administration of the particles capable of expressing said HIV antigen or HIV-derived antigen elicit a T cell immune response which is not elicited with the particles not expressing the antigen.
This is illustrated in the examples with particles expressing an SIV derived antigen.
The response is advantageously protective which means that it enables to achieve a decrease in the viral load or to control the viral load measured in the plasma of the host infected with an Immunodeficiency Virus, who has received at least a prime and one or several boosting administrations of the compounds of the combination of compounds for a prophylactic or therapeutic use against infection by an immunodeficiency virus, especially by a HIV in a human host or by a SIVMAC in a non-human primate host.
In other words, when used for prophylactic or therapeutic treatment of an infection by an Immunodeficiency Virus, especially an HIV, the administered combination of compounds allows elimination of the virus from the body, or control of the viral load, for a long lasting period of time (over six months) and preferably enables protection against AIDS disease in vivo. The inventors have especially shown that, when administrated to a host who is infected to the Immunodeficiency Virus, the combination of compounds according to the invention enables the preservation of the Central Memory CD4+ T cell response during acute phase of the infection, which is a valuable correlation with protection against the pathogenesis of the retrovirus, i.e., against the development of AIDS in a human host (Letvin, N. L., et al, 2006).
The ability of the combination of compounds to provide tools to elicit a protective specific cellular immune response in a human host, is derived from the experimental results which have been obtained in a macaque/SIVmac non-human primate model in conditions which essentially resemble those observed in the human/HIV-1 situation.
Accordingly, the invention relates to the use of a combination of compounds for the preparation of a medicinal product for sequential administration to a mammalian host, to elicit a protective specific cellular immune response against an Immunodeficiency Virus, especially HIV.
Particular lentiviral vectors have been designed according to the invention, to elicit a specific cellular immune response which is shown to be protective in the context of a virus challenge. Although for obvious reason, this demonstration has not yet been carried out in human being, the disclosed results on the non-human primate are highly in favour of similar expectation in human.
The particular lentiviral vectors obtained provide specific interesting candidates for therapeutic vaccination or for prophylactic vaccination against AIDS.
In a particular aspect of the invention, polynucleotides encoding B epitopes and/or T epitopes originating from a pathogenic organism are polynucleotides encoding the envelope E-glycoprotein (EWNV) of the West Nile Virus (WNV) or the envelope of the Yellow Fever Virus, or of the Dengue virus (DV), the Japanese encephalitis virus (JEV) or the SARS-associated coronavirus. Other interesting viral polypeptides are from the capsid of HIV.
In a particular embodiment, the at least one polypeptide is encoded by a polynucleotide of lentiviral origin (for example from gag as disclosed above or pol, or for example from env). In a particular embodiment, said coding polynucleotides are not the complete gag or pol gene or not the complete env gene, or are not a functional version of these genes i.e., a gene encoding a functional protein. For example, they have a size ranging from 30 to 1000, preferably from 30 to 500 bp, preferably 30 to 300 bp, more preferably 30 to 100 by or its soluble form or encoding epitopes thereof. Insertion of the coding sequence of the soluble E glycoprotein of WNV (sEWNV) may be achieved following the disclosure in Reimann et al. (J. Virol.; 2005), using sEWNV as described in Hel et al. (J. immunol.; 2006).
According to another particular aspect of the invention, the heterologous polynucleotide encodes a polypeptide which is a tumor associated antigen (TAA) or a fragment thereof.
Non-limiting known examples of TAA are especially:
More generally, these polynucleotides may be derived from the peptide sequences disclosed in the peptide database entitled Cancer Immunity. The polynucleotides may especially be selected among shared tumor-specific antigens, differenciation antigens, antigens overexpressed in tumors or tumor antigens resulting from mutations These polypeptides (or part thereof) may originate from the cell (self peptide) either in a wild type or mutated form.
In a particular embodiment, the polynucleotide of interest encodes human antigens.
In another embodiment of the invention, the polynucleotide of interest may encode a polypeptide whose expression or functional expression is harmed in the host affected with the considered pathology. In a particular embodiment, the lentiviral vectors of the invention are used to deliver the polynucleotide to target cells in the host to seek for genetic correction in a medicinal treatment of gene therapy, for example of genetic diseases that result in serum protein deficiencies, or for genetic vaccination strategies against cancer or infectious, viral or autoimmune diseases. In another embodiment, other pathologies such as diabetes may be treated with the kit of compounds of the invention.
Finally said at least one polypeptide may be an artificial (non-natural) polypeptide, preferably a multiepitope polypeptide. This multiepitope polypeptide encodes at least two epitopes, originating from a pathogenic organism, including viruses, and/or of tumoral-origin. In a particular embodiment, said at least two epitopes originate from the same virus or from the same tumor cell; in that case, said at least two epitopes may be selected for their different CMH(HLA) restriction. In another embodiment, said at least two epitopes originate from different viruses, or from different tumor cells. Said epitopes can be arranged consecutively, i.e., the 3′ end of the epitope is directly linked to the 5′ end of the second epitope (and so on), corresponding to a polynucleotide encoding a peptide sequence exclusively composed of consecutive epitopes. The at least two epitopes of the invention can alternatively be separated by a one-amino acid spacer or a peptide spacer i.e., meaning that the different polynucleotide units are separated by one or several codon(s) encoding respectively one or several amino acid(s). As spacers improving the processing of multiple epitopes, 4 amino acid-peptides composed of an arginine (R) in the C terminal position and hydrophilic residues (A, K, D and/or T) in other positions are preferred. Especially, 4 amino acid-peptides having a positively charged residue or an acidic residue in the C terminal position may be used, dependently or independently of hydrophilic residues (A, K, D and/or T) in other positions. In a particular embodiment, said spacers are internal processing sequences such as endosomal or lysosomal processing sequences, enabling the better processing of the multiple epitopes and avoiding the processing of new peptides resulting from overlapping cutting. Such a separation having recourse to a spacer can be used to separate all or part of the epitopes.
The heterologous polynucleotide is inserted in the vector genome, under the control of regulatory sequences for transcription and expression, including a promoter and for possibly an enhancer. In a particular embodiment, the regulatory sequences are not of lentiviral origin. Suitable promoters encompass CMV, also referred to as CMVie promoter, or EF1α promoter, CGA promoter, CD11c promoter and house keeping gene promoters such as PGK promoter, ubiquitin promoter, actin promoter, histone promoter, alpha-tubulin promoter, beta-tubulin promoter, superoxide dismutase 1 (SOD-1) promoter, dihydrofolate reductase (DHFR) promoter, hypoxanthine phosphorybosyltransferase (HPRT) promoter, adenosine deaminase promoter, thymidylate synthetase promoter, dihydrofolate reductase P1 promoter, glucose-6-phosphate dehydrogenase promoter or nucleolin promoter. Other suitable promoters encompass the promoters of the following genes: EF1α, human PGK, PPI (preproinsulin), thiodextrin, HLA DR invariant chain (P33), HLA DR alpha chain, Ferritin L chain or Ferritin H chain, Beta 2 microglobulin, Chymosin beta 4, Chymosin beta 10, or Cystatin Ribosomal Protein L41.
The kit of compounds of the invention is especially suited for use in a medicinal treatment, wherein said lentiviral vector pseudotyped with said first viral envelope protein(s) is administered separately in time from said lentiviral vector pseudotyped with said second viral envelope protein(s), and if appropriate said prime and first boost are followed by one or several boosting step(s), later in time.
Accordingly, the kit of compounds of the invention is especially suited for iterative administration of active principles, especially in a prime-boost(s) type reaction, possibly encompassing several boosting steps.
In particular, the compounds of the kit are such that said lentiviral vectors pseudotyped either with said first viral envelope protein(s) or with said second viral envelope proteins are respectively used for priming an immunogenic reaction or alternatively for boosting said immunogenic reaction in a host in need thereof. The immune reaction may be further boosted by using a lentiviral vector having a third envelope protein(s) as described herein, and optionally additional boosting steps with further envelope proteins which do not sero-neutralize with the one of the other lentiviral vectors.
In a particular embodiment, the lentiviral vector pseudotyped with the VSV-G of the Indiana strain is administered first, in order to prime the immunological reaction, and the lentiviral vector pseudotyped with the VSV-G of the New Jersey strain or with the recombinant or modified VSV-G as disclosed herein is administered in second instance, to boost the immunological reaction.
In another particular embodiment, the lentiviral vector pseudotyped with the VSV-G of the New Jersey strain or with the recombinant or modified VSV-G as disclosed herein is administered first, in order to prime the immunological reaction, and the lentiviral vector pseudotyped with the VSV-G of the Indiana strain is administered in second instance, to boost the immunological reaction.
The invention especially relates to an embodiment corresponding to an administration protocol with one round of administration of both compounds of the kit may be sufficient to elicit a strong response.
To possibly improve the intensity or the spectrum or the duration of the response, further administration steps may be performed. In particular, a lentiviral vector pseudotyped with an envelope chosen among VSV-G, Cocal, Perinet, SVCV or Isfahan viruses or a recombinant envelope comprising a domain of one of these envelopes, as described herein, may be used.
The kit of compounds of the invention is suitable for use in prophylactic treatment or therapeutic, including curative, treatment against a viral disease or against an infectious or tumoral disease, wherein said lentiviral vector comprises a polynucleotide encoding one or several viral antigens or fragments thereof suitable to elicit an immune response.
In addition to being suitable to prepare a combination of compounds for the therapeutic treatment of mammalian hosts infected with an Immunodeficiency Virus, in particular a human host infected with a HIV or a non-human primate host infected with a SIVMAC or an animal infected with FIV, the lentiviral vectors disclosed herein also provide tools for the design of a combination of compounds for a prophylactic use against infection by an immunodeficiency virus, especially by a HIV in a human host or by a SIVMAC in a non-human primate host or by FIV in an animal.
The combination of compounds disclosed herein may especially be used for the therapeutic treatment of human hosts infected with a HIV-1 or HIV-2.
The combination of compounds disclosed herein may especially be used for the prophylactic treatment of human hosts against infection by a HIV-1 or HIV-2.
The data provided in the experimental section hereafter provide indeed strong evidence of the relevancy of the designed lentiviral vector for transposition to medicinal applications in human. The level of protection achieved on the non-human primate model depicted in the examples is stronger than results reported in the literature with other vaccine candidates and it is noteworthy that it was obtained in the context of virus challenge with a particular high dose of infectious SIVmac virus.
From the experimental data obtained, it is even observed that the combination of compounds for the elicitation of a protective specific cellular immune response against an immunodeficiency virus may be prepared without adding an adjuvant of the immune response.
The skilled person may however decide to include in the combination of compounds, in association to all or part of the lentiviral vectors or/and as a further separate compound, an immunomodulating agent. For example, a cytokine such as II12 may be included in the combination.
The invention especially provides a combination of compounds wherein said lentiviral vectors are formulated in compositions suitable for injection to a host, especially for sub-cutaneous injection. In another embodiment, the administration of the compounds of the invention may be advantageously carried out by intramuscular route, especially by injection. The inventors have shown, in an experimental mouse model, that the immune response elicited when the compounds including the gene transfer vector particles expressing a SIV GAG antigen are administered through intramuscular route, is higher than when they are administered in the same model, by sub-cutaneous injection.
The combination of compounds is thus in particular for use in an administration regimen involving injection to the host and encompassing priming the immune response and subsequently boosting the immune response in a mammalian host, wherein said (i) lentiviral vector pseudotyped with said first viral envelope protein(s) is administered separately in time from said (ii) lentiviral vector pseudotyped with said second viral envelope protein(s), and if any from said (iii) lentiviral vectors pseudotyped with said third viral envelope protein(s), each of said lentiviral vectors (i) and (ii) and if any (iii) being administered either for priming or for boosting the immune response.
The choice of the administration regimen may be adapted by the skilled person in view of the intensity and spectrum of the response obtained with selected doses used and number of boosting steps carried out.
In a particular embodiment, the invention concerns a combination of compounds for sequential administration to a human host, to elicit a protective specific cellular immune response against a HIV and the administration regimen encompasses administering the same dose of lentiviral vector for prime and boost steps.
According to another embodiment, the kit of compounds is suitable for use in gene therapy in vivo. Examples of diseases that may be treated with the compounds of the kit of the invention for in vivo gene therapy are neurodegenerative diseases such as Parkinson disease, Amyotrophic lateral sclerosis (ALS), Spinal Muscular Atrophy (SMA) which are motor neurone diseases. Another example of disease that can be treated with the kits of compounds of the invention is the spinal cord'injury.
The kit of compounds of the invention is also suitable for the treatment of cancer, wherein iterative administration of the lentiviral vector may be necessary.
The invention also relates to an immunogenic composition compring a lentiviral particle as defined in the present application, suitable for inhibiting in vivo a HIV-1 or HIV-2 infection or a SIV or a HIV infection in a mammalian host.
The invention also relates to a method of treatment of a host or patient in need thereof, which comprises the successive administration to the host of:
(i) a lentiviral vector, pseudotyped with a first determined heterologous viral envelope protein or viral envelope proteins; followed by,
(ii) a lentiviral vector, pseudotyped with a second determined heterologous viral envelope protein or viral envelope proteins different from said first determined envelope protein or envelope proteins;
wherein said lentiviral vector of (i) and (ii) encodes a heterologous polynucleotide having a therapeutic interest.
In a particular embodiment, a third step of administration to the host of a lentiviral vector pseudotyped with a third envelope protein(s) as disclosed herein is carried out.
According to a particular embodiment of the invention, additional administration steps are performed in order to boost the immune reaction further.
The time left between the two first administration steps may be in the range of 3 to 12 weeks or more depending on the response to the prime. The time left between the first boost and the last boosting step may be in the range of a few weeks, especially more than 12 weeks, for example 6 months, and even may be one or even several years.
According to another embodiment, the gene transfer vectors of the invention may be used as a single active principle, i.e., for a single administration to a host.
Accordingly, the description of the embodiments of the invention, of the features of the gene transfer vectors or of their properties, apply to the vectors when used as a unique administered compound (in contrast to a combination), especially in their non-integrative version.
A treatment or a medicinal treatment according to the invention aims at improving the clinical condition of a patient, especially a human being, in need thereof, who has been diagnosed as infected (even at a stage of primo-infection) by a pathogen or as suffering from a pathological state, or this treatment aims at the elimination of the causative agent or organism of the disease, or at lowering said agent or organism. In a situation of viral infection, the treatment may result in a significant decrease of the viral load in the plasma of the host and possibly in a plasma viral load which is less than what can be detected when measured or, at lowering the size or the development of the tumor if any.
Medicinal treatment includes, when referring to a patient diagnosed with a pathological state, improving the clinical status of said patient and in a preferred embodiment, restoring to health.
It also encompasses a prophylactic treatment of a host in need thereof, especially vaccination to prevent the occurrence of a pathological state in a host.
The experimental results obtained by the inventors, enable to define specific uses for the combination of compounds, kits, methods and generally therapeutic or prophylactic applications disclosed in the present application, especially in the field of medical applications related to the Immunodeficiency Virus, especially HIV and in particular HIV-1 or HIV-2.
These specific uses according to the invention include, independently of each other, or in combination, the following indications, possibly associated with different stages of the infection by an Immunodeficiency Virus, especially by HIV or prior to said infection or prior to the exposure to the retrovirus:
These specific uses are beneficial for the development of an efficient immune response in a prophylactic or therapeutic application, in the field of infection by an Immunodeficiency Virus, They also allow targeting the applications of the invention to various categories of hosts, depending on their clinical profile, in relation to the stage of infection by the retrovirus (including prior to infection or to exposure to the retrovirus) or pathogenesis, because they impact on various compartments of the immune system, which are involved at different stages of the immune response depending on the stage of the infection.
Although it seems not to be necessary in the case of administering lentiviral vectors expressing SIV or HIV antigens, it may be decided, in other applications to further include in the combination of compounds, adjuvant and/or vehicle when used for systemic or local administration, or it may be devoid of such components.
In any cases suitable excipients for the formulation of the medicinal compositions may be added.
The compositions quoted above can be injected in a host via different routes: subcutaneous (s.c.), intradermal (i.d.), intramuscular (i.m.) or intravenous (i.v.) injection, oral administration and mucosal administration, especially intranasal administration or inhalation. The quantity to be administered (dosage) depends on the subject to be treated, including considering the condition of the patient, the state of the individual's immune system, the route of administration and the size of the host. Suitable dosages range expressed with respect to the content in equivalent p24 antigen of vector particles (for HIV-1 lentiviral vectors) and can be determined.
When used for a single administration, the vector of the invention may be administered in dosages which range from 1 to 100 μg, preferably 1 to 50 μg and most preferably 1 to 10 μg, and can be modified by one skilled in the art, depending on circumstances. When, formulated for subcutaneous injection, the immunogenic composition of the invention preferably comprises between 1 and 100 μg of the lentiviral vector per body weight of the host, more preferably from 1 to 30 μg/dose, especially around 10 μg/dose, in a sole injection.
Other examples and features of the invention will become apparent in the examples and figures.
The following abbreviations are used: U3, R and U5 represent the domains of the LTR; ΔU3: deletion of the U3 domain: RRE: Rev-responsive element; ψ: encapsidation signal; cPPT and CTS represent the DNA flap; CMVie: cytomegalovirus immediate early promoter.
Details on the construct and especially on the DNA flap and on its insertion in a HIV-1 based genome are available in (Zennou et al 2000).
A native GAG antigen of HIV-1 LAI isolate (sub type B) (D) and the corresponding nucleic acid sequence (E);
a modified HIV-1 GAG, which is a delta Myr-GAG antigen prohibiting myristilation, and derived from the consensus sequence of the B subtype (A);
an antigen derived from HIV-1 POL, which is a fragment of POL polyprotein (B);
an antigen derived from HIV-1 NEF, which is a fragment of NEF protein (C).
These antigens may be used in combination in a fusion protein. The POL and/or NEF fragments may be inserted 5′ or 3′ of the GAG derived antigen.
They may be contiguous to each other and inserted 5′ or 3′ from the GAG derived antigen.
They may be separated and inserted, one in 5′, the other in 3′ from the GAG derived antigen.
The POL, NEF and GAG derived antigens may be separated or not by a peptide, especially one enabling auto-cleavage. A suitable separating peptide is a 2A peptide from picronavirus having sequence: APVKQTLNFDLLKLAGDVESNPGP.
HIV-1 genome (A) is split into a vector plasmid (B), containing the cis-acting sequences (LTR, encapsidation signal, RRE, DNA Flap) and the gene of interest (antigen for vaccination) under the control of an heterologous promoter (CMV) or another promoter, a packaging plasmid (C) containing genes gag, pol, tat and rev, necessary for encapsidation (during vector particle production) and for the early step of viral replication cycle (in transduced cells) and an envelop plasmid (D), containing an Indiana serotype of the glycoprotein G from the VSV. Packaging plasmid and envelop plasmid have heterologous transcriptional regulation elements from CMV and are deleted in encapsidation sequence, in cPPT, and CTS.
During reverse transcription of viral single stranded RNA, there is a duplication of U3′ and U5′ sequences which allow then forming the 5′LTR and 3′LTR in the double stranded viral DNA. Transcription of viral DNA begins in the cell from the LTR 5′. If the U3′ region is deleted in vector plasmid (ΔU3), viral RNA is also ΔU3, consequently, after reverse transcription, viral DNA misses the U3 sequence in the 5′LTR, no transcription can begin from the viral LTR promoter. As a consequence, transcription is mediated only via the internal promoter of the transgene.
A: TRIP-SIVmac239 Gag. This vector plasmid contains the sequence encoding the antigen, SIVmac239 gag, deleted in the myristilation sequence. This allows to work only in L1, P1 bio-safety level because it abrogates protein secretion in transfected cells and in transduced cells.
B: TRIP-GFP. This vector plasmid contains the irrelevant antigen Green Fluorecent Protein (GFP).
Both vector plasmid contain upstream the CMV promoter for antigen expression and downstream the WPRE sequence to improve antigen expression. They also contain the viral sequences necessary for vector particle formation and early steps of viral replication. in transduced cells: Long Terminal Repeat (LTR), DNA Flap (cPPt, CTS), RRE, encapsidation signal ψ.
C. pTRIP DeltaU3-CMV-SIVGag-WPRE restriction map of the vector genome (C1) and its nucleic acid sequence (C2). The vector construct has been deposited at the CNCM under I-3840.
D. pTRIP DeltaU3-CMV-SIVGag co-WPRE restriction map of the vector genome (D1) and its nucleic acid sequence (D2). The vector construct has been deposited at the CNCM under I-3841;
The plasmids of the deposits are introduced in E. coli cells. The culture medium of the cell is LB Ampi 100 μg/ml and the incubation is at 37° C. Storage is in suspending fluid with 50% LB 50% Glycerol,
The SIV mac239 GAG protein is 511 Amino Acid long. This protein was divided into 125 peptides. These Peptides are 15 amino acids in length; there is 11 amino acids overlap between sequential peptides.
Peptides are dispatched into 11 pools named from letter M to W, containing 5 to 12 peptides.
FIG. 28(1): A prime/boost lentiviral vector-based vaccination strategy induces robust cellular immunity
The longitudinal follow-up of the SIVmac239 GAG specific T cells responses was performed at various time points post-prime, post-boost and post-challenge by IFN-γ ELISPOT assay after restimulation of whole PBMC with pools of overlapping peptides encompassing SIVmac239 GAG p55. The individual GAG-specific cumulative responses of all 6 vaccinated animals injected with TRIP-SIVmac239 GAG (low dose: 20022, 20089; medium dose: 20293, 20056; high dose, 20195 and 20158,
Briefly, 0.2 106 PBMC per well were restimulated in vitro for 40 hours with 11 pools of 5 to 12 overlapping 15-mers peptides (2 μg/ml of each peptide). The mean number of IFN-γ spots forming cells (SFC) per million PBMC was calculated from triplicate wells after subtracting the one from control wells (no peptide). The cumulative responses shown correspond to the sum of IFN-γ SFC/million PBMC obtained with each pool of peptides. The symbol+indicates an underestimation of the cumulative response due to saturated ELISPOT wells for at least one pool of peptides (see FIG. 29(2)). Two weeks post-challenge, it was not possible to quantify the number of spots in the control wells and thus to calculate the cumulative response for animal 20022 (noted ++) (nd, not determined).
FIG. 28(2): Subcutaneous injection of lentiviral vector did not result in systemic inflammation
The presence of IFN-α (PBL Biomedical Laboratories) (FIG. 28(2)a), IL-6(U-Cytech Bioscience) (FIG. 28(2)b) and TNF-α (U-Cytech Bioscience) (FIG. 28(2)c) in the plasma shortly after subcutaneous injection was measured by ELISA. The absence of either significant (IFN-α and TNF-α) or major (IL-6) increase in their level suggested there was not systemic inflammation induced by the in vivo administration of lentiviral vector particles, even at high dose (2.5 108 TU/animal). These data did not exclude a local inflammation likely triggered by intrinsic PAMP (Brown B, D et al, 2007; Pichlmair A et al, 2007; Georgel P. et al, 2007).
FIG. 29(1): Vaccinated macaques have an improved control of viremia compared to unvaccinated and control animals
Plasma viral loads were followed for 5 months post-challenge, twice a week during the first 3 weeks, then once a week during the next 3 weeks and finally once a month. Viremia of unvaccinated (
Briefly, viral RNA was isolated from plasma (200 μl) with TRI Reagent BD (Molecular Research Center). The number of RNA copies was determined in a quantitative one-step RT-PCR using the Taqman EZ RT-PCR (Applied Biosystem) and the Mastercycler ep realplex (Eppendorf). The primers were respectively at position 389 and 456 of SIVmac251 GAG mRNA genome (forward, TGTCCACCTGCCATTAAGCCCGA; reverse, GCAGAGGAGGAAATTACCCAGTAC). The Taqman quantification method was chosen with an internal probe containing the Fam and Tamra fluorophores respectively in 5′ and 3′ (TGTCCACCTGCCATTAAGCCCGA). The quantity of viral RNA copies was assessed by extrapolation of treshold fluorescence values onto an internal standard curve prepared from serial dilutions in dH2O of RNA obtained by in vitro transcription with the MAXIscript kit (Ambion) of a SpeI linearized pGEM-5Zf(+) GAG plasmid. The threshold of detection was 375 RNA copies/ml (2.57 log 10 RNA copies/ml).
FIG. 29(2): Saturation of the ELISPOT assay
An IFN-γ ELISPOT assay was performed using serial dilutions of PBMC to determine the saturation curve of the ELISPOT reader (280 spots/well corresponding to 1400 spots/million PBMC since 200,000 cells are used) FIG. 29(2)a). When the frequency of specific T cells was high and spots overlapped (acquisition), the number of IFN-γ SFC/million was therefore underestimated to 1400 before substracting the background (analysis). The example of PBMC from animal 20056 restimulated with the peptide pools covering SIVmac339 GAG:385-443 and SIVmac339 GAG:443-491 2 weeks post-challenge is given (FIG. 29(2)b).
FIG. 30(1): The central memory CD4+ T cells compartment is well preserved in vaccinated macaques.
Changes in the numbers of central memory (CM) CD4+ T cells in the peripheral blood, a strong correlate of progression, were followed for 5 months post-challenge. Dynamics of other cell compartments (total CD4+, naive CD4+total CD8, naive CD8+, CM CD8+, and effector memory (EM) CD8+ T cells) are available on FIG. 32(2).
The % of baseline CM CD4+ T cells of naive (
The quantifications of absolute lymphocyte counts, proportions of CD3+CD4+ T cells and of naive, EM and CM T cells (defined as CD28+CD95−, CD28+CD95+ and CD28− CD95+ cells) were described previously (Karlsson I et al 2007).
FIG. 30(2): Vaccine-induced T cells responses were broad and they recognized antigen derived from AT2-inactivated SIV
The diversity and the relative contribution of the proteins encoded by GAG (matrix MA, capsid CA, nucleocapsid NC and p6) to the vaccine-induced, virus-induced and virus-recalled GAG-specific T cells responses were studied by IFN-γ ELISPOT assay at the peak of the primary responses (2 weeks post-prime, FIG. 30(2)a), a week after the boost (FIG. 30(2)b) and during the acute phase of infection (3 weeks post-challenge, FIG. 30(2)c). AT-2 inactivated SIVmac251 (5 μg/ml of total viral proteins) was also used to restimulate GAG-specific CD4+ and CD8+ T cells 2 weeks post-boost in a whole PBMC IFN-γ ELISPOT assay (FIG. 30(2)d). Background after coculture with the control microvesicles was substracted. Saturated responses were indicated with +. AT-2-inactivated SIVmac 251 and its control microvesicles were obtained from JD Lifson (Frederick, Mass.) through the EU Program EVA Centralized Facility for AIDS Reagents (NIBSC, Potters Bar, UK)
FIG. 31(1): Immune correlates of protection
Control of plasma viral loads at the peak of primo-infection was tested for correlation (Spearman's rank) with GAG-specific T cell responses. A high frequency of IFN-γ secreting T cells after the prime injection (
FIG. 31(2): Injected animals develop humoral responses toward the glycoprotein G from VSV used to pseudotype the vector particles
The presence of neutralizing antibody against the envelope used for pseudotyping was measured with an in vitro transduction assay. P4 cells (HeLa derived) were cultured in the presence of lentiviral vectors encoding GFP pseudotyped with VSV-G Indiana (FIG. 31(2)a) or VSV-G New Jersey (FIG. 31(2)b) pre-incubated with plasma diluted at 1:20 from immunized animals collected at various time points. The transduction efficacy was assessed by flow cytometry. In the absence of plasma and at the dose of vector used, 61% and 23% of P4 cells were GFP+ after transduction with lentiviral vectors encoding GFP pseudotyped with VSV-G Indiana and New Jersey respectively.
Comparison of gag specific lytic activities induced by TRIP.NI gagΔmyr LV versus TRIP.NI gagΔmyr CO LV immunization. CTL activity was measured 10 days after immunization using a 20 hours in vivo CTL assay as described in Materials and Methods. Mean+/−SD of three mice is shown.
To determine if lentivirus vectors harbouring an envelope protein originating from a VSV virus could be modified to allow boosting of immune responses, we developed a new vector strategy based on lentiviral vectors expressing the glycoprotein from different VSV serotypes expected not to be cross-reactive.
Isolates of Vesicular stomatitis virus (VSV) are enveloped, non segmented, negative-strand RNA viruses that belong to the genus Vesiculovirus in the Rhabdoviridae family.VSV infects domestic animals such as cattle, swine, and horses, causing vesicular lesions in the tongue, oral tissues, udders, and hooves. The VSV genome is delivered to the cytoplasm of host cells, where replication occurs, via receptor-mediated endocytosis of viral particles and subsequent pH-induced fusion of the viral envelope with the endosomal membrane. The VSV G protein, the sole viral surface glycoprotein, is required for attachment and fusion. There are two major serotypes of VSV, Indiana and New Jersey, which are distinguished by neutralizing antibodies against the G glycoprotein. In addition to their antigenic structures, the Indiana and New Jersey glycoproteins also differ in the number (511 and 517, respectively) and composition of amino acids (only 50% identity), in posttranslational modifications, and in folding. Correspondingly, Indiana and New Jersey strains are not equally important regarding VSV pathogenesis.
Outbreaks caused by New Jersey strains are more frequent and more severe than those caused by Indiana strains.
Mice. Female C57B1J6 mice (élevage Janvier, France) were bred at the Pasteur Institute facilities.
Cell culture. HeLa (human cervical adenocarcinoma) available at the ECACC) and human embryonic kidney 293T cells (available at the ATCC), used for lentiviral vector production, were grown in Dulbecco's modified Eagle medium (DMEM) Glutamax (GIBCO) supplemented with 10% heat-inactivated fetal calf serum (FCS) and antibiotics (penicillin-streptomycin).
Vector Construction and Production
The vector plasmid pTRIP.ΔU3.CMV.SIVmac239gagΔmyr contain a non myristoylated form of SIVmac239 gag sequence under the control of the cytomegalovirus immediate early promoter (CMVie).
Vector particles were produced by transient calcium phosphate co-transfection of 293T cells with the vector plasmid, an encapsidation plasmid (p8.7) and a VSV-G envelope expression plasmid, Indiana serotype (pHCMV-G) (10) vs New Jersey serotype (pcDNA3.1(−) NJ-G) (derived from commercialized pcDNA3.1 plasmid available from Invitrogen). The protein sequence is disclosed on
Cloning strategy encompassed the following steps:
A plasmid containing the gene from the glycoprotein from the New Jersey VSV serotype (pBS VSV-G NJ) has been used.
It was cloned into a pcDNA 3.1 (−) vector (Invitrogen) after XhoI/NotI digestion. The plasmid derived by this method was designated pcDNA3.1(−) VSV-G NJ. The WPRE sequence (Woodchuck hepatitis virus postregulatory element) (11) is a posttranscriptional regulatory element known to significantly increase gene expression. It was cloned into a TOPO® Cloning vector (Invitrogen).
The WPREsequence was cloned into the pcDNA3.1(−) VSV-G NJ after EcoRI digestion and dephosphorylation. The plasmid derived by this method was designated pcDNA3.1(−) VSV-G NJ WPRE.
WPRE Quantification of p24 antigen content of concentrated vector particles was done with a commercial HIV-1 p24 ELISA kit (Perkin-Elmer Life Sciences). For vector stock titration, 293T cells were transduced with different vector concentrations for 72 h, and lysed. Lysats were treated with Rnase and proteinase K and then used for quantitative PCR (Lightcycler).
In vitro transduction inhibition assay. HeLa cells were plated at 10,000 cells per 96wells-plates. A day later, cells were transduced with lentiviral vectors encoding eGFP (enhanced G FP) and pseudotyped with the glycoprotein from VSV Indiana or New Jersey serotype, after 30 min preincubation with decomplemented mouse serum diluted at 1:6. Mice were either naive mice or mice immunized once with 0.25 107 transduction units (TU) of lentiviral vector coding for a non myristoylated form of SIVmac239 Gag and pseudotyped with the glycoprotein from VSV Indiana serotype and bled 14 days post-immunization. After 72 h, transduction was assayed by flow cytometry. The percentage of transduction neutralization was calculated in comparison to transduction in the absence of serum.
Mice immunization. All animal experiments were conducted in accordance with the guidelines of the Office Laboratory of Animal Care at the Pasteur institute. Nine-weeks-old mice were intrapritoneally (i.p.) inoculated with 0.25 107 transduction units (TU) of pTRIP.ΔU3.CMV.SIVmac239gagΔmyr vector particles in 0.2 ml Dulbecco's PBS twice on day 0 and then on day 21. Mice were bled on day 14. Immune responses were analyzed on day 28.
For the prime, a lentiviral vector encoding a non myristoylated form of SIVmac239 Gag and pseudotyped with the glycoprotein from VSV Indiana serotype was administered, whereas for the boost, the same vector but pseudotyped with the glycoprotein from VSV New Jersey serotype was injected.
The comparison was done with the homologous prime/boost strategy using two subsequent injections of lentiviral vector pseudotyped with the glycoprotein from VSV Indiana serotype. As controls, the primary (day 7) and memory (day 28) responses were characterized after a single injection of lentiviral vector pseudotyped with the glycoprotein from VSV Indiana serotype. The primary (day 7) response of mice immunized only once with lentiviral vector pseudotyped with the glycoprotein from VSV New Jersey serotype was also assayed.
IFN-γ Elispot Assay
Nitrocellulose microplates (MAHA S4510, Millipore) were coated overnight with capture antibody (Mouse IFN-γ Elispot pair, BD Pharmingen) and blocked with complete medium composed of RPMI1640 Glutamax supplemented with 10% FCS, antibiotics, hepes, non essential amino-acids, b-mercaptoethanol and sodium pyruvate. Splenocytes from vector-immunized mice were added to the plates in triplicates at 0.25×106 cells/well and stimulated with SIVmac239 gag peptides (NIH AIDS Research and Reference Reagent Program), concanavalin A (1 μg/ml). Forty hours later, spots were revealed with the biotine-conjugated antibody (Mouse IFN-γ Elispot pair, BD Pharmingen) followed by streptavidin-AP (Roche) and BCIP/NBT substrate solution (Promega). Spots were counted using a Bioreader 2000 (Biosys, Karben, Germany) and results were expressed as IFN-g spot-forming cells (SFC) per million splenocytes.
In-vivo cytotoxicity assay
For target cell preparation, splenocytes from naïve mice were labelled with various concentrations (high, 5 μM; medium, 1 μM; low, 0.2 μM) of CFSE (carbosyfluorescein-diacetate succinimidyl ester, Vybrant CFDA-SE cell-tracer kit, Molecular Probes) Splenocytes were then pulsed with peptides at 5 μg/ml. Each mouse received 107 CFSE-labelled cells of a mix containing an equal number of cells from each fraction, through the retroorbital vein. After 15-18 h, single-cell suspensions from spleens were analyzed by flow cytometry (Becton Dickingson, CellQuest software). The disappearance of peptide-pulsed cells was determined by comparing the ratio of pulsed (high/medium CFSE fluorescence intensity) to non-pulsed (low CFSE fluorescence intensity) populations in immunized versus naïve mice. The percentage of specific killing was established according to the following calculation:
[1−[(CFSElownaïve/CFSEhigh/mediumnaive)/(CFSElowimmunized/CFSEhigh/mediumimmunized)]]×100.
We first showed that mice immunized only once and with a low dose (0.25 10e7 TU/mouse, corresponding to 650 ng p24 for this batch) of lentiviral vector pseudotyped with the glycoprotein from VSV Indiana serotype do develop strong humoral response which neutralize the in vitro transduction of cells with a lentiviral vector pseudotyped with the same envelope. On the contrary, there was only a low sero-neutralization of transduction by vector pseudotyped with the glycoprotein from VSV New Jersey serotype detectable.
A preliminary dose response experiment using the lentiviral vector encoding a non myristoylated form of SIVmac239 Gag and pseudotyped with the glycoprotein from VSV Indiana serotype allowed us to characterize the immune responses and identify peptides containing an immunodominant CD8 epitope (SIVmac239 gag: 309-323 (QTDAAVKNWMTQTLL)) as well as a subdominant CD8 epitope (SIVmac239 gag: 73-97 (ENLKSLYNTVCVIWC) (data not shown). A dose as low as 0.45 107 TU/mouse was sufficient to reach a plateau of 100% responding mice with a specific lysis of almost 100% for the immunodominant CD8 epitope-containing peptide. In contrast, even high doses (up to 23 107 TU/mouse) were non enough to stimulate an in vivo cytolytic activity of 100% in the case of the subdominant-CD8 epitope-containing peptide.
In parallel, a recently published paper using adenoviral vectors coding for the same antigen characterized a peptide containing a CD4 epitope (SIVmac239 gag: 297-311 (YVDRFYKSLRAEQTD)).
Therefore, we choosed to monitor immunity directed against these 3 peptides and to immunize mice with a sub-optimal dose of vector (0.25 107 TU/mouse) in order to be able to detect a boosting effect both in terms of number of responding mice and amplitude of the responses.
Introduction
Since the first cases of acquired immunodeficiency syndrome (AIDS) were reported in 1981, the global spread of Human Immunodeficiency Virus (HIV) has reached pandemic proportions and represents now a global developmental and public health threat (Girard et al., 2006). Indeed, the number of people living with HIV throughout the world is nowadays around 39.5 million and is still growing exponentially, with 4.3 million people infected in the previous year and an estimated 14,000 people becoming infected every day (http//www.unaids.org).
The physiopathology of the infection is directly correlated with the characteristics of the HIV. This virus belongs to the family of Retroviridae, genus lentivirus. It is an enveloped virus of around 110 to 120 nm in diameter. The gp120 glycoprotein is responsible for the virus tropism; indeed it allows the fixation to the cellular receptor CD4 and co-receptors CCR5 or CXCR4, making thus CD4+ lymphocytes its major target cells. Once virus attaches to CD4+ lymphocytes, the viral cycle is divided in 2 major steps: early and late step. In the cytoplasm, viral RNA is reverse transcribed into double stranded DNA inside the viral capsid and actively imported to the nucleus where it can integrate in the cell genome (Arhel et al., 2007). Transcription of viral DNA and translation of viral mRNA allows the formation of new viral particles.
Most studies of AIDS pathogenesis are carried-out in non-human primates with an HIV simian equivalent: SIV. Indeed, SIV viral structure and biology are closely related to HIV ones.
1.1.3 Physiopathology of HIV infection
Disease progression is accurately defined by combined measurement of plasma HIV-1 RNA and CD4+lymphocytes. Natural HIV infection can be divided into 3 major phases: primo infection or acute infection, characterized by a peak in viral load (around 106 copies RNA/ml of blood) and by a rapid but transient decrease in circulating T CD4+(Weber, 2001). Moreover, at this early stage of infection, HIV specific CD4+ T cells are the major targets of the virus and are preferentially destroyed in the absence of any treatment (Rosenberg et al., 2000). However, this increase in viral load is generally well controlled by a specific immune response, principally cellular. Indeed, there is evidence for a temporal correlation between the appearance of HIV-specific CD8+ T cells and the decline of primary viremia (Koup et al., 1994). As a consequence, T CD4+number gets back to a higher level (inferior to the one prior to infection) and viremia stabilizes (between 103 and 106 RNA copies/ml): the set-point (SP) is reached; its level often correlates with the evolution of the disease (Mellors, 1996). The infected individual then enters an asymptomatic period, which can last anything from months to years. This period is characterized by a slow and linear decrease in the number of circulating CD4+, due to an equilibrium between the immune system and HIV replication. In absence of treatment, this asymptomatic phase is followed by AIDS. At this point, viremia progressively returns to a high level and an inflection in the CD4+ T cells depletion slope is observed (CD4 count inferior to 200 cells/mm3 of blood). Eventually, the immune system collapses and disease causing agents that are usually either completely controlled or easily cleared become potentially lethal.
2.1 From Monotherapy to HAART
In order to slow-down the progression of the disease to AIDS, new medications were put on the market in 1986. They were called antiretroviral drugs, their goal was to prevent HIV replication and thus to postpone CD4+ T cells depletion. The most famous of these drugs was certainly AZT (Zidovudine), an inhibitor of the virus Reverse Transcriptase (RT). However, this monotherapeutic approach was eventually found to be of limited effectiveness, as HIV is a virus that has the potential to quickly develop a resistance (through mutations) to any antiretroviral medication. In 1996, new inhibitors of RT were commercialized; they were chemically different from AZT-like inhibitors. Eventually, a new class of HIV medication appeared in 1995, protease inhibitors (PI). The combination that is nowadays the “standard” in anti-HIV therapy, called Highly Active Antiretroviral Therapy (HAART), consists of an association of 3 classes of antiretroviral medications, usually 2 different inhibitors of RT and one of PI. HAART allows a powerful long-lasting viral load decrease (
2.2 HAART limits
Although HAART success is irrefutable, it presents some limits and questions can be raised concerning its long-term use. First of all, HAART treatment is really expensive and is still non accessible to developing countries. Then, the toxicity of these medications is relatively high, they often triggers major side effects (diabetes, lipodystrophia, diarrhoea, headaches . . . ). Moreover, it has been shown that HIV was capable of developing resistances against HAART treatment. Mutations often appear in regions of HIV constrained by the treatment. HAART treatment also limits the production of HIV antigens, apparently to a threshold below what is needed to stimulate HIV-specific effector T cells or to expand HIV-specific naïve T cells. Immune memory to HIV still persists however, as indicated by the transient restoration of CD4 and CD8 immune responses to HIV when the immune system is re-exposed to the virus after treatment interruptions (Autran et al., 2004).
Because the efficacy of drugs is still limited and because HAART should become a lifelong therapy, too expensive and difficult to administer in most Third World settings, other strategies have to be found to durably prevent the onset of AIDS. The development of an HIV vaccine may represent the only way to slow the pandemic. Two different strategies of vaccination are being tested. On the one hand, a prophylactic vaccine should be capable of inducing sterilizing immunity, and would prevent both infection and its complications. Such a vaccine should be able to operate at the time of virus entry and at the very early stage of infection, before the virus can disseminate to lymphoid organs. On the other hand, a therapeutic vaccine is designed for chronically infected patients under HAART treatment (Autran et al., 2004). It would consist of first treating patients with HAART to restore immune competence, and then immunize them to subsequently boost their rested immune responses to HIV before interrupting treatment. Eventually, if immune control of the virus could be enhanced, disease progression would be attenuated, allowing treatment interruptions, and consequently a limitation in the use of HAART, thus minimizing their toxicity and cost.
Whatever strategy is chosen, vaccine development is facing huge scientific challenges, such as high genetic variability of the virus, lack of immune correlates of protection and limitations in the existing animal models. Until now, more than fifty vaccine candidates have been tested in phase I/II clinical trials (www.iavi.orq) (See appendix 1 for a summary of anti HIV-1 on going trials). Multiple vaccination strategies have been tested so far (Tonks, 2007). At first, traditional live attenuated vaccines were tested because of their past success against small pox, polio or measles. A live attenuated virus with a deletion in the Nef gene (SIV-Δnef) has been the most effective vaccine in the SIV/macaque model. However, its application is restricted since the vaccine virus persists at a low level indefinitely in vaccinated macaques and can be pathogenic to neonates. In addition SIV-Δnef can cause disease in adults several years after vaccination. Nevertheless these live attenuated vaccines provide a critical proof of principle for the feasibility of HIV vaccine development and allow the characterization of the nature of protective immunity (Koff et al., 2006). Another traditional vaccine strategy was to induce broad and long-lasting neutralizing antibodies to disable viral entry and prevent infection. To this end, subunit vaccines were developed. They were composed of HIV proteins or peptides, often recombinant. We can cite here the VaxGen trial, evaluated in phase II in the USA, with a vaccine based on a monomeric gp120 administered in alum. However, none of these subunits vaccine trials showed a statistically significant reduction of the HIV infection in the vaccinees. As vaccines eliciting humoral responses failed to give encouraging results, researchers have turned instead to the cell-mediated arm. Indeed, it was shown previously that CD8+ cytotoxic effector T cells could clear infected cells displaying viral peptides on their class I MHC molecules. Moreover, CD8+ T cells are known to be important in controlling SIV and HIV infection because (i) the depletion of CD8+ T cells during chronic SIV infection in monkeys increases the viral load (Jin et al., 1999), (ii) HIV-positive patients who are heterozygous at class I HLA loci have slower rates of disease progression (Carrington et al., 1999) and (iii) the virus accumulates mutations in CM8+ T cells epitopes (Goulder and Watkins, 2004). A vaccine stimulating T cell responses would not prevent infection in the traditional way but could at least suppress it long enough to prevent the onsets of AIDS. Among T cell vaccines are found the DNA vaccines, currently in phase I trials, using isolated HIV genes encoded by plasmids, but which face problems of immunogenicity. The most commonly used strategy to elicit T cells responses is the one of recombinant vectors. It consists of using viral vectors (derived from pox, vaccinia or adenovirus) to transport isolated HIV genes into human cells.
Finally, it is also worth mentioning the technique of dendritic cell-based vaccination, whose results against SIV challenges were very encouraging. It consists of immunizing macaques with autologous dendritic cells (DC) pulsed with chemically in activated SIV (inactivation with aldrithiol-2, AT-2). The inactivated virus is not capable of reverse transcription but the viral particles conserve their structure intact and most of all fusion capacity. This technique was even tested with success in chronically infected and non-treated humans, with autologous DC pulsed with inactivated autologous HIV (Andrieu and Lu, 2007). Despite its efficiency, this technique is rather expensive and time-consuming.
Although many types of vaccines have been and are still being tested, none of them has been completely successful until now. Indeed, no long-term effect on viral load has ever been observed with DNA vaccines, even if CTL specific responses were stimulated. Vaccines eliciting a humoral response suffer from the huge variability of the virus and even if antibodies were generated, they were never versatile enough to cope with HIV genetic diversity. Even passive immunization of HIV-infected individuals with neutralizing monoclonal antibodies failed, underlining the limits of humoral immunity in controlling HIV-1 infection (Trkola et al., 2005). Pox vectors succeeded in eliciting specific CD4+ and CD8+ T cells responses, but did not allow a better control of viral load after many weeks of HAART interruption. Consequently, other vaccination strategies need to be tested. We propose here to test a new HIV-1 vaccine strategy, based on the use of a Lentiviral Vectors (LV) derived from HIV-1 as candidate vaccine.
3. Lentiviral Vectors as candidates for HIV vaccination
LV were described for the first time 20 years ago (Poznansky et al., 1991). As a recombinant vector, a LV is capable of integrating a transgene (until 8-10 kb) into the DNA of the host cell. The unique particularity of HIV-1 derived vectors and of all LV is their ability to transduce non-dividing cells. Indeed, LV like lentiviruses, are able to integrate independently of the cell mitosis. This capacity derives from an active nuclear-import of the viral DNA (or vector DNA) through the nuclear membrane of the host cell. One explanation for this active nuclear import is the formation of an unique triple-stranded DNA, called DNA Flap or Triplex via two cis-active sequences in the pol sequence: cPPT (central Polypurine Tract) and CTS (Central Termination Sequence) discovered in the laboratory (Zennou et al., 2000).
Our vaccination project uses an HIV-1 derived LV commonly named TRIP (because it contains the central DNA Flap/Triplex structure). This vector, belonging to the third generation of LV, has been optimized in term of design, production, transduction efficiency and bio-safety parameters (Delenda, 2004).
One major interest for using HIV-1 as a gene transfer vector is that retroviruses, contrary to RNA positive or DNA viruses are not directly infectious. Indeed a RNA positive genome needs reverse transcription and many accessory proteins to begin viral replication and pathogenesis in vivo. However, in order to be used as a gene transfer vector, HIV-1 genome has been reduced to the minimal viral sequences necessary for transgene expression and packaging (
The LTR sequence (Long-Terminal Repeat) is required for reverse transcription, viral DNA integration and transcription. This 3′LTR has been deleted in the U3 region, without perturbing the functions necessary for gene transfer, for two major reasons: first, to avoid trans-activation of a host gene, once the DNA integrated in the genome and secondly to allow self-inactivation of the viral cis-sequences after. retrotranscription. Thus, in target cells only sequences from the internal promoter will be transcribed (transgene) (
The ψ region is necessary for viral RNA encapsidation.
The RRE sequence (REV Responsive Element) allows export of viral messenger RNA from the nucleus to the cytosol after binding of the Rev protein.
The DNA flap sequence (cPPT/CTS, normally contained in Pol) facilitates nuclear import.
The WPRE cis-active sequence (Woodchuck hepatitis B virus Post-Responsive Element) is also added to optimize stability of mRNA (Zufferey et al., 1999). WPRE is not translated.
The gene of interest (i.e. encoding the antigen) is inserted in the transfer vector plasmid under the control of a strong and often ubiquitous promoter.
In order to generate viral particles (RNA, capsid and envelope), certain HIV-1 helper packaging proteins have to be brought concomitantly within producer cells. They are encoded by two additional plasmids called the packaging or encapsidation plasmid and the envelope expression plasmid. The packaging plasmid encodes only the viral proteins essential for viral particle synthesis. Accessory genes whose presence in the plasmid could raise safety concerns were removed. Viral proteins brought in trans are respectively:
Gag proteins for building of the matrix (MA, p17), the capsid (CA, p24) and nucleocapsid (NC, p6).
Pol encoded enzymes: integrase, protease and reverse transcriptase.
Tat and Rev coding regulatory proteins, Tat is necessary for the initiation of LTR-mediated transcription.
In order to avoid any packaging of these generated mRNA in the viral particles, the ψ region was removed. An heterologous promoter was chosen to avoid recombination issues.
The envelope expression plasmid does not encode the HIV-1 natural env proteins (gp120, gp41). Indeed, these proteins are too labile to allow an efficient production and concentration by ultracentrifugation of vector particles. Moreover, the env proteins of HIV-1 have a limited tropism (CD4, CCR5, CXCR4). To counter these issues, LV production uses a process called pseudotyping. It consists in generating viral particles with an heterologous envelope glycoprotein. Among the first and still most widely used glycoproteins for pseudotyping LV is the Vesicular Stomatitis Virus Glycoprotein G (VSV-G) from the Indiana serotype. LV pseudotyped with VSV-G offer significant advantages in that VSV-G interacts with an ubiquitous cellular receptor on cells, endowing the vector with a broad host cells range. Moreover, VSV-G confers high vector particle stability allowing downstream processing of viral particles: principally concentration by ultracentrifugation.
LV were initially used in gene therapy and their unique capacities as gene-transfer system are today undeniable.
First and contrary to adenovirus and vaccinia virus-derived vectors, there is no pre-existing immunity in humans against lentiviral viruses. Since their emergence, LV have been tested with success in vitro in a large variety of cells and tissues of therapeutic importance, including liver, brain and dendritic cells (DC) in the context of gene therapy protocols.
DC are a heterogeneous group of Antigen Presenting Cells (APC) which plays a crucial role in innate immunity as well as in initiating adaptive immune responses. DC act as sentinels of the immune system by continuously capturing antigens in peripheral tissues. Once activated by microbial products or inflammatory signals, they undergo maturation, migrate to draining lymphoid tissues where they subsequently process and present the captured antigens in the context of MHC I and 11 to CD8+ and CD4+ T cells. Interestingly, among the cell types that could be efficiently transduced by LV were found the mitotically hypoactive human CD34+- and monocyte-derived DC as well as mouse bone marrow derived DC. In vitro, transduction by LV did not affect their viability. Eventually, stable transduction of DC allows an endogenous presentation of the antigen during the whole lifespan of the cells. Thus, it makes LV good candidate vaccines.
Besides efficient expression of a transgenic protein, DC transduced in vitro with LV were shown to efficiently process and present peptides derived from the protein. Indeed, both human and murine lentivirally transduced DC were capable of restimulating specific T cell lines or clones in vitro. More importantly, several groups reported in vitro priming of naïve T cells against relevant antigens when using human DC.
Many groups then evaluated the use of lentivirally transduced DC as immunotherapeutic agents in vivo, principally in mouse models but also more recently in a primate model. It has consisted in immunizing animals with ex vivo lentivirally transduced DC, and in analyzing the resulting CD8+ T cells responses in vitro. When possible the capacity of protection was also tested in vivo in the context of a challenge. The majority of these studies used tumor antigens as models and tested the capacity of induced CTL responses to eliminate tumor cells. Very few research teams have proved the pertinence of ex vivo lentivirally transduced DC against viral infections. Zarei et al. for example demonstrated the capacity of protection against a LCMV challenge in mice immunized with DC transduced with LV encoding the virus glycoprotein (Zarei et al., 2004).
However, this technique seemed to be difficult to apply in a human vaccination protocol, consequently LV were rapidly tested via direct in vivo administration. Many groups have demonstrated the efficacy of in vivo injection of LV in mice in order to elicit a transgene-specific immune response. Once again, tumor antigens were principally used. For example, it was shown by the lab that direct in vivo inoculation of melanoma poly-epitope encoding lentiviruses in HLA-A*0201 transgenic mice could elicit vigorous CTL responses against most of the melanoma epitopes encoded (Firat et al., 1999). It has even been demonstrated that injection of LV was superior to the ex vivo transduced DC injection, both in terms of amplitude and longevity of the CTL response (Esslinger et al., 2003). Furthermore, a functional CD8′ T cells memory response could be generated after direct in vivo immunization with the TRIP vector even in the absence of CD4′ T cells, undeniable advantage towards HIV vaccination (Iglesias et al., 2007). Many research teams are now investigating the intricate mechanisms that could contribute to the high potential of LV as vaccination tools. The sustained antigenic expression, particularly in DC, as well as the activation of innate immunity might play a critical role (Breckpot et al., 2003).
In the laboratory, immunogenicity studies have demonstrated the potential of anti-SIV specific T cells responses in inbred mice immunized with TRIP vector encoding a non-myristoylated form of SIVmac239 Gag (above). These murine models allowed to underline the potential of TRIP vectors as candidates for vaccination against HIV. However, they did not permit to test the capacity of protection of TRIP vector immunizations in the context of a viral challenge.
For this purpose, a non-human primate model was chosen for protective efficacy studies, more particularly the Cynomolgus macaque. The human/HIV-1 model was translated to the macaque/SIVmac non human primate model. Macaques are highly susceptible to SIVmac infection and progressively develop an immunodeficiency syndrome, which mimics human AIDS. Interestingly, plasma viral loads during primary and chronic infection parallel those observed in humans, as in HIV-1 infected people long-term non-progressors as well as rapid progressors can be observed. As in humans infected with HIV-1 the cellular immune responses to SIVmac during primary and chronic infection differ significantly and evidence of immune escape is readily documented. As in HIV-1 infected individuals, gut-associated lymphoid tissues is the major site of viral replication and CD4+ T cell depletion.
Nowadays, AIDS vaccine/challenge data are essentially generated in 3 main macaque species: mainly rhesus macaques of Indian origin, but also rhesus macaques of Chinese origin and Cynomolgus macaques. Each species model presents advantages and drawbacks for studying responses to viral infection. Cynomolgus macaques were chosen for our trial because they are more readily available in Europe than rhesus macaques. Reinman et al. showed that the pathogenicity of SIV was attenuated in Cynomolgus macaques compared to Indian rhesus (lower plasma viremia, preservation of CD4+ T cells number, increased survival time). This attenuated pathogenicity was associated with earlier and stronger IFN-γ ELISPOT responses to GAG and ENV than in rhesus species. These observations support thus a role of early T cells immune responses. Finally, despite lower plasma viral load, viremia after challenge can be significantly used as experimental endpoint in Cynomolgus macaques, assuming that the dose of virus used for the challenge is high enough and that the naïve group is big enough to limit the statistical significance of spontaneous controllers. Interestingly, Cynomolgus macaques display viral loads more similar to those seen in the human infection. (Reimann et al., 2005).
In the context of a vaccinal trial in non-human primates, the question of the choice of the antigen has to be raised. The GAG SIVmac239 non myristyllated protein was chosen as antigen. Previous results and observations, as well as data concerning natural HIV-1 infection and viral structure could justify the choice of this protein as potentially efficient antigen. First of all, the important variability in HIV-1 strains constrained us to choose a protein well conserved among the different HIV-1/SIV strains. Only GAG, POL and NEF could fulfil this criteria. However, it has been shown that CTL recognise principally epitopes located on gag and nef (Addo et al., 2003). More recently, it was demonstrated that of the HIV-1 proteins targeted, only GAG specific responses were associated with lowering viremia and that independently of the particular HLA-type (Kiepiela et al., 2007). In addition, the more diversified the GAG specific responses were, the lower was the plasma viremia. Moreover, as it composes the viral matrix, GAG is the first protein to be processed and presented by MHC class I (Sacha et al., 2007), because entry/capture is sufficient and that there is no need of virus replication. GAG is also the most represented among HIV-1 proteins (1000-1500 CA) (Briggs et al., 2004). All these data justified the choice of this protein as relevant antigen for our first vaccinal trial. In addition, this trial was designed to give the proof of concept of the efficiency of TRIP vectors as vaccination tools. To this end, a simple antigen was voluntarily chosen in order to highlight the protective role played by the vector itself (gene transfer efficacy). Moreover, having the simple GAG protein as antigen allows to make comparisons with previous vaccine studies.
A prime-boost strategy was chosen in order to strengthen primary responses. A second injection is supposed to increase the number of responders, the frequency and avidity of antigen specific T cells and the intensity of T cells responses. It should also improve the diversity of responses as well as T cells functions such as killing or migration to the periphery.
For the prime, 3 groups of 2 macaques were immunized with the LV vector TRIP-SIVmac239 Gag pseudotyped with an Indiana serotype VSV-G, at 3 different doses. Two animals received a TRIP-GFP vector pseudotyped with Indiana serotype VSV-G as irrelevant vector. For the boost, 3 months after the prime, all immunized animals received a similar dose of TRIP-SIVmac239 Gag or TRIP-GFP pseudotyped with an Indiana non cross-reactive serotype VSV-G.
In order to test the capacities of protection triggered by this TRIP vector based vaccine, two months after the boost the 8 animals were challenged intra-rectally with 500 Animal Infectious Dose 50 (AID50) of SIVmac251. The inoculation route and the very high dose of virus for the challenge were justified by the size of the cohort, indeed by increasing the infectious dose, we hoped to limit the number of spontaneous controllers in the naïve animals arm of the study composed only of 4 macaques.
A longitudinal follow-up of the cellular immune response after prime, boost and challenge by IFN-γ ELISPOT on PBMC has been performed.
Materials and Methods
The SIVmac239 GAGΔmyr protein was chosen as antigen. It is a 511 amino-acid protein. The protein myristylation domain was deleted to permit manipulations in biosafty levels L1, labs, and to promote class I presentation by APC. The complete sequence of the GAG polyprotein from SIV mac239 can be found via the protein ID: AAA47632. The GFP protein was chosen as irrelevant antigen.
All plasmids used for transfections were produced in strain JM109 E. coli K12 bacteria (F′ traD36 proA+B+ laclq Δ(lacZ)M15/Δ(lac-proAB) glnV44 e14− gyrA96 recA1 relA1 endA1 thi hsdR17), grown in LB medium supplemented with ampicillin and extracted with the Maxi-prep Nucleobound kit from Macherey-Nagel (Hoerdt, France).
Three plasmid constructs were used to generate the particles of TRIP-ΔU3-CMV-Gag Δmyr-WPRE (named here TRIP-SIVmac239 Gag,
A packaging plasmid (encapsidation plasmid), containing the HIV-1 genes gag, pol, tat and rev, necessary for building of viral particles in the production cell line, which can be designed as p. 8.7.1 in Zufferey et al, 1998.
An envelope plasmid (envelope expression plasmid), encoding the Glycoprotein G from Vesicular Stomatitis Virus (VSV-G) serotype Indiana (ph CMV VSV-G) (Yee J. et al, 1994, Genebank AJ318514) or Indiana non cross reactive serotype such as serotype New-Jersey (pcDNA3.1(−)NJ-G WPRE). pcDNA 3.1(−)NJG is derived from pcDNA3.1 plasmid available from Invitrogen. Especially, to construct the pcDNA3.1(−)NJ WPRE, pBS-NJG (Genebank V01214)17 was digested with XhoI and NotI and cloned into the pcDNA3.1(−) vector (Invitrogen). To increase expression, a WPRE (woodchuck post-transcriptional regulatory element) sequence, pre-amplified by PCR and cloned into a TOPO TA Cloning vector was added by EcoRI digestion.
Packaging and envelope plasmids have heterologous transcriptional elements (CMV promoter, and polyadenylation signal). All plasmids contain the ampicillin resistance gene to ease growth selection in bacteria.
The human embryonic kidney cell line (human 293T) was used for TRIP vector production. For inhibition of transduction assays, the P4 cell line, a HeLa derived cell line, was used.
These cells were grown in complete medium composed of Dulbecco's modified Eagle's Medium containing glutamine (DMEM, GlutaMAX-I Supplement, GIBCO), supplemented with 10% heat-inactivated Fetal Calf Serum (FCS) (PAA Laboratories GmbH, Pasching, Austria) and penicillin, streptomycin (100 Units/ml of penicillin G (sodium salt) and 100 U/ml of streptomycin sulphate, GIBCO, Invitrogen). Macaques primary cells were cultured in RPMI GlutaMAX-I complete medium (10% FCS and antibiotics, similar concentrations as in DMEM).
Twelve adult Cynomolgus macaques (Macaca fascicularis), males from the Indian Ocean Island of Mauritius were included in the vaccination trial. They were negative for SIV Herpes Virus B, filovirus, STLV-1, SRV-1, SRV-2, measles, hepatitis B-HbsAg, and hepatitis B-HBcAb before inclusion in this study. Immunizations, challenge and blood collection were handled, in accordance to the EC guidelines for experiments using non human primates.
The SIVmac251 strain (complete proviral genome and flanking sequence: accession number: M19499) was used for challenge.
PBMC in vitro restimulation in ELISPOT were carried out with either a SIV mac239 GAG or SIVmac251 NEF peptide sets containing 125 peptides or 64 peptides respectively (NIH AIDS Research and Reference Reagent Program). Peptides were 15 amino acids in length, with 11 amino acids overlaps between sequential peptides. GAG peptides were dispatched into 11 pools containing 5 to 12 consecutive and overlapping peptides, named in order from letter M to W and recovering the SIVmac239 GAG protein (
Vector particles were produced by transcient calcium phosphate transfection of 293T cells (CaCl2 0, 125 mM, 1× HEPES-buffered saline pH 7.10, 70 mM NaCl, 0.75 mM Na2HPO4 2H2O, 25 mM HEPES). Ten μg of vector plasmid encoding either GAGΔmyr or GFP was required with 5 to 10 μg of the plasmid encoding the VSV-G glycoprotein envelope, and 10 μg of the packaging plasmid as described previously by Zennou et al 2000 (Zennou et al., 2000) Cells were seeded in 10 cm2 polystyrene-treated tissue culture Petri dishes (Falcon) at 6.106 in complete medium 24 h before transfection, and medium was changed prior to transfection. Cells were at least 80% confluent. Twenty-four hours after transfection, complete medium without FCS was added to the cells at a smaller volume to concentrate the particles. Forty-eight hours post-transfection, supernatants were collected from Petri-dishes, centrifuged to pellet floating cells (2500 rpm, 5 min) and treated 15 min at 37° C. with DNAse I (Roche Boehringer, 20 U) and MgCl2 (Sigma, 1 mM) in order to eliminate residual plasmids DNA. Vectors were collected after ultracentrifugation of the supernatant (22 000 rpm; 1 hour) and resuspended in cold PBS. Vectors were conserved at −80° C. in aliquots of small volume.
Vectors HIV-1 p24 GAG antigen contents were determined by Enzymed-Linked-Immunosorbent Assay (Perkin-Elmer Life Sciences, Paris, France). p24 concentrations were given in ng/ml of vector.
Titration was performed by transduction of 293T cells (seeded 24 h prior to transduction at 5.105 cells/well in 6 well-Petri dishes) with 3 different volumes of vector. Cells were also transduced with the same amount of vector previously heat inactivated at 70° C. Seventy-two hours after transduction, cells were lysed with a lysing-buffer 1× (Tris 20 mM pH=8.8; NP40 0.1%; Tween 0.1% final) containing RNAse, Dnase-free (Roche Boehringer, 50 μg/ml final). Cellular proteins were degraded by addition of Proteinase K (Proteinase K stabilised 100 μg/ml final, Eurobio).
Vector titers were assessed by performing a real-time PCR on cells lysates, using the Light Cycler Instrument (Roche Diagnostics, Meylan France). Total HIV-1 DNA copy number was determined by detection of a viral DNA sequence, localized in the LTR U5 region (primers AASM reverse and M667 forward). Two hybridization probes were used for each PCR run, one probe labelled with Fluorescein (FL) as 3′ end donor and the other labelled with the LightCycler Red 640 (FC) as 5′ acceptor. Normalization to cell number was done by detecting the CD3 sequence (house keeping gene), with primers CD3 in 3′ and CD3 in 5′ and probes FL and FC. For PCR, 5μL of lysate were tested in duplicates for each condition, in a 15 μL PCR-mix (Jumpstart taq readmix for Q-PCR, Sigma 1×, MgCl2 1.9 mM, 1.5 U of Taq polymerase (Invitrogen),1.5 μM forward and reverse primers and 0.2 μM fluorogenic hybridization probes). Copy number was determined in reference to a standard curve prepared by amplification of 10 2 to 108 of cloned plasmid diluted in mouse cells lysate (3T3) with matching sequences (U5R and CD3) (
Macaques were divided into four groups of 2 animals (Table A) and were sub-cutaneously injected in 2 points with TRIP-SIVmac239 Gag pseudotyped with the VSV-G envelope serotype Indiana, at 3 different doses (high dose 2.5.108 Transduction Unit (TU), 6863 ng p24; medium dose 1.108 TU, 2745 ng p24 or low dose 2.5 107 TU, 686 ng p24) or with TRIP-GFP at the same p24 dose than the high dose of TRIP-SIVmac239 Gag (6863 ng p24).
For the second immunization performed 87 days post prime, animals were injected sub-cutaneously in 4 points with a vector pseudotyped with an Indiana non cross-reactive VSV-G glycoprotein serotype (VSV-G serotype New-Jersey). Macaques received either 1.108 TU of TRIP-SIVmac239 Gag, 60185 ng p24 when primed with the GAGdeltamyr antigen, or 60185 ng p24 of TRIP-GFP vector when primed with the G FP antigen.
2.5. SIV mac251 Challenge
Immunized and naïve macaques (12 macaques in total) were challenged intra-rectally 57 days post-boost (ie 136-days post prime) with a single dose of 500 AID50 in 1 ml (Animal Infectious dose sufficient to infect 50% of the animals) of pathogenic SIVmac 251 (stock from A.M. AUBERTIN, Université Louis Pasteur, Strasbourg, France distributed by ANRS- or equivalent stock available from NIH). Animals were anaesthetized with 10 to 20 mg/kg of Ketamine (Imalgène, Rhône-Mérieux) and the whole procedure was done according to the EU regulations and guidelines of Animal Care and Use. After inoculation macaques were housed separately with precautions bound to a Level 3 bio security animal house.
Animals were anaesthetized with 10 to 20 mg/Kg of Ketamine (Imalgène, Rhone-Mérieux) for blood collection. 8 ml of blood were collected for each macaque in Cell Preparation Tubes with Sodium Citrate (BD Vacutainer™ CPT™) for PBMC and citrate-plasma collection and 3 ml in serum separator tube (Vacuette®) for serum collection. After centrifugation (10 min, 2500 rpm for Vacuette® tubes and 30 min, 3000 rpm, no brake, for CPT™), and red blood cells lysis with 3 to 5 ml 1× lysis buffer (IOtest 10× lysis buffer, Beckman-Coulter), PBMC were pelleted by a 10 min 1600 rpm centrifugation, and then numerated in a Kova's chamber Hycor®, and distributed to 96-well ELISPOT plates in triplicates at 2.105 cells/well if enough cells were available.
96-well plates with Immobilon®-P (Polyvinylidene Fluoride, PVFD) membrane (MultiScreen HTS Assay System, MSIP; Millipore), were prewetted (ethanol 35%) and coated overnight at 4° C. with capture antibody (mouse IgG1 anti-human-monkey-IFN-γ monoclonal antibody GZ-4 purified (Mabtech), 10 μg/ml final in PBS; 50μL per well). Plates were washed 4 times in Dulbecco's PBS 1× and blocked with complete RPMI.
Cells were restimulated either by addition of one pool of peptides (2 μg/ml of each peptide), AT-2 inactivated SIVmac251 (5 μg/ml of total viral proteins), (or PMA-iono (0.1 μM PMA and 1 μM ionomycin) as positive control (4000 cells/well), or mocked stimulated with DMSO/RPMI.
After 40 hours, spots were revealed with a biotin-conjugated antibody (mouse IgG1 anti-human-monkey interferon-γ monoclonal antibody 7-B6-1 purified (Mabtech); 1 μg/ml final in PBS 0.5% FCS; 100 μL per well 2 h at 37° C.), followed by streptavidin-AP (1 h, 1/5000 in PBS 0.5% FCS, 100μL per well, 1 h, 37° C.) and BCIP/NBT substrate solution (Ready to use mixture, 60μL per well; 15 min, RT, in the dark). Spots were numerated using a Bioreader 4000 (Biosys, Karben, Germany). Results were expressed as IFN-γ Spot-Forming-Cells (SFC) per million PBMC. The IFN-γ SFC/million PBMC resulting from a 5% DMSO/RPMI stimulation were subtracted from the results as a background signal.
Quantification of innate cytokines (IL6; TNF-α and IFN-α was performed via ELISA using commercial kits (Monkey IL-6 and TNF-α ELISA kit from U-Cytech Bioscience (Utrech, Netherlands), human IFN-α kit from PBL Biomedical Laboratories (New Jersey, United States)). Plasma were tested for each animal 40 days before prime injection, 1 hour, 6 hours, 24 hours and 7 days post prime injection.
P4 cells were seeded at 1.105/well in 96-well plates in complete medium 24 h prior to transduction. On the day of transduction, cells were cultured with TRIP-GFP (pseudotyped with an Indiana serotype VSV-G or with an Indiana non cross-reactive VSV-G such as New-Jersey VSV-G) preincubated with different dilutions of plasma. Cells were mocked transduced with the same volume of complete medium. Seventy-two hours after transduction, efficiency of transduction was assessed by analysing the GFP fluorescence by flowcytometry using a FACScalibur (BD).
2.9 Viral load determination
Briefly, viral RNA was isolated from citrate-plasma (200μL in total) with the High Pure Viral RNA Kit from Roche. Elution was carried out in 50μL elution buffer (Nuclease-free, sterile, double distilled water). The number of SIV-RNA isolated from plasma was determined in a quantitative single-step RT-PCR using the Platinium qRT-PCR from Invitrogen Reactions were performed in duplicates in the Mastercycler ep realplex (Eppendorf) in 96-well plates from ABgene (AB1100) in a final volume of 25μL (10μL RNA extract and 15 μL Mix). The Taqman quantification method was chosen, with an internal probe (500 nM final) containing the Fam and Tamra fluorophores respectively in 5′ and 3′. The primers (450 nM final) were respectively at position 389 and 456 of SIVmac 251 GAG mRNA genome (Table B).
The quantity of viral RNA copies initially presents was assessed by extrapolation of threshold fluorescence values onto an internal standard curve prepared from serial dilutions in dH2O of a virus stock SIVmac251 previously titered by the technique of “branched DNA”. As positive control for PCR, the TRIP-SIVmac239 Gag vector plasmid was used (104 copies/μL).
Many studies have highlighted the critical role played by CD8+ T cells in controlling HIV infection and suggested that an effective vaccine should induce vigorous, broad and long-lasting CD8+ T cell responses. Yet, several viral vectors shown to elicit specific SIV CD8+ T cell responses have subsequently failed to control viremia in SIV/macaques models (Schoenly, K. A. & Weiner, 2007). Since we and others have demonstrated that lentiviral vectors are very potent to induce cellular immunity (reviewed by He, Y. & Falo, L. D., 2007 and by Breckpot, K, Aerts, J. L. & Thielemans, K., 2007), we assessed whether they could confer protective cellular immunity against SIV infection and simian AIDS. We opted for the model of SIVmac251 infection of cynomolgus macaques which displays viral load levels and a variety of progression rates similar to those seen in HIV-1 infection in humans (Karlsson, I. et al, 2007 and Reimann, K. A., et al, 2005).
Six cynomolgus macaques were immunized twice by subcutaneous injections of HIV-1 derived lentiviral vectors encoding a non-secreted SIVmac239 GAG protein in its native sequence (TRIP-SIVmac239 GAG). This single and non-optimized antigen was chosen to highlight the potential of the lentiviral vector system for vaccination. In order to circumvent the presence of neutralizing anti-vector antibodies, and hence to allow an efficient boost effect, a strategy of envelope exchange was designed. Indeed, preparatory experiments in mice had shown that a prime-boost regimen using TRIP-SIVmac239 GAG particles pseudotyped with VSV-G from two non-cross reactive serotypes, Indiana followed by New Jersey, was more efficient than a homologous prime-boost. The immunization groups and experimental design are summarized in Table 1 hereafter.
A single injection of lentiviral vector was sufficient to induce robust cellular immunity in every immunized animal, regardless of the dose received (
Animals also developed neutralizing humoral responses against VSV-serotype Indiana (FIG. 31(2)a), but importantly, sera from vaccinated animals did not neutralize vectors pseudotyped with VSV-G New Jersey in vitro (FIG. 31(2)b). Macaques were therefore then injected with a medium dose of TRIP-SIVmac239 GAG particles pseudotyped with VSV-G New Jersey 11 weeks post-prime. SIVmac239GAG(15-mers) Peptides-Complete Set was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH. SIVmac239 GAG-specific T cell responses were efficiently restimulated by the second injection (FIG. 28(1)a). The magnitude of responses was increased with kenetics typical of secondary responses, that is faster onset and longer persistence. IFN-γ secreting cells were detected as early as one week following the second immunization and up to 2 months and more. The breadth of the cellular responses was not improved (FIG. 30(2)b or Table 2b). To mimic more closely the processing and trafficking steps that occur in infected cells for antigen presentation but which are bypassed by peptide pulsing, A T-2 inactivated SIVmac251 was also used as antigen. Weak (macaque 20089) to strong (macaques 20022, 20195 and 20056) responses were observed (FIG. 30(2)d). Intracellular stainings performed 10 weeks post-boost indicated that both CD4+ and CD8+ T cells contributed to IFN-γ production in response to peptide pools (data not shown).
Given the robust and broad cellular immune responses induced by the vaccine, we tested its protective efficacy against SIV infection. Macaques were challenged 11 weeks post-boost by intra-rectal inoculation of a high dose of SIVmac251 (500 AID50) (Table 1). Massive anamnestic SIV GAG specific responses were observed in the peripheral blood of immunized animals shortly after challenge (within a week) in contrast to unvaccinated and control animals. These responses peaked earlier and more vigourously (more than 4,000 SIV GAG specific IFN-γ SFC/million PBMC) (
Although viral challenge led to infection in all animals, immunization conferred strong protection against viral replication and depletion of the central memory CD4+ T cells during the acute phase. TRIP GFP injected control animals had a course of infection very comparable to unvaccinated macaques and were therefore gathered as a single group. In the plasma of these naïve and control animals, the peak of viral replication was high with a mean of 1.02 107 RNA copies/ml. Viral loads then decreased in all 6 unvaccinated and control animals to reach low to moderate set-point plasma viral RNA levels (days 70 to 154) with a mean of 3.44 105 RNA copies/ml (FIGS. 29(1)a and 29(1)c). In contrast, viremia at the peak of primo-infection of all 6 immunized animals were lower than in naïve and control animals by at least two orders of magnitude with a mean of 9.25 104 RNA copies/ml (FIGS. 29(1)b and 29(1)c). From the 6 vaccinated macaques, 4 suppressed peak viremia by more than 2 log 10 fold (20022, 20293, 20158), 2 by more than 3 log 10 fold (20293 and 20158) and 1 by more than 4 log 10 fold (20195) (FIG. 29(1)e). After resolution of peak viremia, viral loads decreased and remained persistently below those of unvaccinated and control animals by around a 10 fold factor, and statistically lower at day 49 post-infection (FIG. 29(1)c). When the cumulative replications during the first 154 days of infection (expressed as area under the curve of viral load as a function of time) were compared, the benefit provided by vaccination was statistically significant (FIG. 29(1)f).
We also monitored the evolution of CD4+ T cells in the peripheral blood during the course of infection, and more particularly the central memory (CM) CD4+ T cells, because their depletion correlates with plasma viral loads (Karlsson, I. et al, 2007) and their preservation during acute and chronic SIV infection predicts long-term survival of vaccinated monkeys, betten than set-point viral load levels (Mattapallil, J. J. et al, 2006 and Letvin, N. L., et al, 2006).
During acute infection, there was a rapid and profound decline of CM CD4− T cells in the peripheral blood of the unvaccinated and control animals (
In contrast, vaccinated animals showed full preservation or only low depletion of their CM CD4+ T cells during peak viremia and all rapidly recovered their CM CD4+ T lymphocytes, except macaque 20089 (FIGS. 30(1)b and 30(1)c).
All naïve and control animals experienced a profound CM CD4+ T cell loss and high viremia at the peak of primo-infection, but half of them rapidly recovered their CM CD4+ T cell compartment whereas the other half on contrary showed slow decline of CM CD4+ T cell number. These two subgroups demonstrated low and moderate post-acute viremia correspondingly and were therefore classified as non-progressor (15661-15885-14468) and progressor animals (14184-21544-20456). Importantly, viremia of vaccinated animals at late time points was reduced by around a 2 log10 fold factor when compared to progressor unvaccinated animals, whereas post-acute viremia and CM CD4+ T cell counts were similar between vaccines and non-progressor unvaccinated animals (
Correlations between the vaccine-induced immune responses and viral loads were found despite the under-evaluation of cellular responses due to saturation of some ELISPOT wells (FIG. 29(2)). Importantly, there was an inverse correlation between the level of peak viremia and the magnitude of GAG specific IFN-γ responses measured 2 weeks post-prime, 1 week post-boost and 1 week post-challenge (
In summary, this study provides evidence that a lentiviral vector-based prime/boost vaccination regimen elicits strong and broad cellular immunity in cynomologus macaques and confers efficient protection against massive SIVmac251 infection by lowering viremia and by entirely preventing loss of CD4+ T cells and CM CD4+ T cells at the peak of primo-infection.
A long-term follow-up will tell whether or not viral escape from immune pressure can happen in this macaque cohort. After 5 months follow-up, the stability of the CD4− T cell numbers and the tendency for decrease of viral loads in vaccinated animals argue for long-term control. This first preclinical trial in an albeit limited macaque cohort is very encouraging given that protection relied solely on responses directed against a non-optimized GAG antigen. We expect an improvement of the control of replication by increasing antigen expression and immunogenicity by codon-optimization (Deml, L. et al, 2001 and zur Megede, J. et al, 2000), and by increasing the diversity of the cellular responses by fusing other SIV antigens with GAG (Wilson, N. A. et al, 2006 and Hel, Z. et al, 2006). In this respect some results are presented hereafter on a mouse model, and nn optimised version of this vaccination strategy, with complete fulfillment of both efficacy and safety requirements, will thereafter enter therapeutic vaccination clinical trials in humans.
indicates data missing or illegible when filed
The diversity and the relative contribution of the proteins encoded by GAG (matrix MA, capsid CA, nucleocapsid NC and p6) to the vaccine-induced, virus-induced and virus-recalled GAG-specific T cell responses were studied by IFN-γ ELISPOT assay at the peak of the primary responses (2 weeks post-prime, Supplementary Table 1a), a week after the boost (Supplementary Table 1b) and during the acute phase of infection (3 weeks post-challenge, Supplementary Table 1c) using 11 pools of peptides shown in the second line of the tables. The first 2 columns indicate the animal identifier. The numbers correspond to IFN-v SFC/million PBMC. The underscore indicates saturated ELISPOT wells. The light grey-shaded boxes correspond to positive responses (>375 IFN-g SFC/million PBMC) and the dark grey-shaded boxes represent the strongest response in an individual animal. The far-right column shows the number of pools of peptides recognized by each animal, whereas the bottom row represents the number of animal of the cohort which mounted a response against each individual pool of peptides.
Comparison of the Immune Response Obtained in Mice Immunized with a Lentiviral Vector Encoding a Gag Antigen or a Codon Optimized Form of Said Antigen
1. Codon Optimization of the Polynucleotide Encoding the Antigen Improves The CTL Response
Naïve mice (n=3/group) were immunized i.p. with a single injection of various doses of TRIP.NI gag delta myr or TRIP.NI LV coding for a codon-optimized form of gag delta myr (TRIP.NI gagΔmyr CO).At 10 days post immunization, gag-specific cellular immune responses against the immunodominant gag CD8+ T cell epitope were assessed (
The obtained results show that codon optimization critically improves the CTL response induced by TRIP.NI LV-based vaccines.
2. Lentiviral Vector Particles Encoding Codon Optimized Antigen Induce a Strong and Durable Cellular Immune Response after Even a Single Injection
The obtained results show that codon optimization critically improves the CTL response induced by TRIP.NI LV-based vaccines.
The Memory T cell responses induced by non integrative lentiviral vectors were assayed in mice, after a single injection of TRIP.NI gag Δmyr or TRIP.NI gag Δmyr CO particles.
3. Prime-Boost Strategy Based on TRIP.NI gagΔmyr CO Particles Pseudotyped with a Glycoprotein G from Non Cross Reactive VSV Serotypes Enhances the Cellular Immune Response
Mice were immunized with TRIP.NI GAGΔmyr CO or TRIP.I GAG wild-type particles pseudotyped with VSV-G Indiana and 13 weeks later were boosted with respectively TRIP.NI GAGΔmyr CO or TRIP.I GAG wild-type particles pseudotyped with VSV-G New Jersey, Control groups for the prime-boost protocol include mice injected only one time with TRIP particles pseudotyped with VSV-G Indiana (grey diagrams) or TRIP particles pseudotyped with VSV-G New Jersey (blue diagrams). All the mice were sacrified at 10 days post-immunization, and the cellular immune response against GAG was evaluated by IFN-γ ELISPOT (A) or tetramer staining (B) (
The data obtained on mice show that codon optimization of the polynucleotide encoding the antigen in the lentiviral vector particles provides improvement in the level of the cellular immune response and especially the CTL response in the host, after a single injection or after a prime-boost injection. In addition, the obtained response is strong and durable.
Several groups of two different types of mice were vaccinated with lentiviral vector particles encoding SIVmac239GagΔ. The elicited immune response was analyzed in each group 10 days after a single injection of the particles performed either intramuscularly (i.m.), intradermally (i.d.), intraperitoneally (i.p.), subcutaneously (s.c.) or transcutaneously (t.c.i.).
Especially the response was analyzed in an in vivo cytotoxicity assay (
In the groups of mice (C57BI/6j) where the injection was performed through the intramuscular route a stronger response was elicited than when the injection was carried out through another route.
Non-Integrative Lentiviral Vectors for Use to Elicit Immune Response when administered for protection in a vaccine Regimen.
Materials and Methods
Cell Culture and Virus Preparations
Hela cells (ATCC CCL-2), Human 293T cells and African green monkey kidney Vero cells (ATCC CCL-81) were cultured in Dulbecco modified Eagle medium (DMEM) supplemented with 10% (Hela cells, 293T cells) or 5% (Vero cells) heat-inactivated fetal calf serum (FCS), penicillin, streptomycin and Glutamax (GIBCO). West Nile Virus (WNV) strain IS-98-ST1 (GenBank accession number AF 481 864), a closely related variant of NY99 strain10, was propagated in mosquito Aedes pseudoscutellaris AP61 cell monolayers. Purification in sucrose gradients and virus titration on AP61 cells (Aedes pseudoscutellaris cells) by focus immunodetection assay (FIA) using anti-WNV hyperimmune mouse ascitic fluid (HMAF) were performed as previously described. Infectivity titers were expressed as focus forming units (FFU).
Lentiviral Vector Production
The TRIPsEWNV (
Preparation of Bone Marrow-Derived DCs
Bone marrow cells were isolated by flushing mice femurs and tibiae with RPMI supplemented with 10% FCS. Cells were then passed through a 45μm cell strainer, centrifuged and resuspended in 10Test® 3 lysing solution (an erythrocyte lysing solution, mixture of ammonium chloride, potassium bicarbonate and ethylenediamine tetraacetic acid (EDTA); Beckman Coulter) and incubated at 4DC for 5 min to lyze red blood cells. The cells were centrifuged and cultured for 8 days at 1×106 cells/ml in culture medium consisting of RPMI with 10% FCS, L-glutamine, penicillin, streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, and 50 μM 2-mercaptoethanol supplemented with 100 ng/ml of recombinant mouse FLT3 ligand (R&D Systems).
Transduction Experiments and Flow Cytometry Analysis
For transduction experiments on non-dividing cells, Hela cells were seeded in 48 wells plates at 40,000 cells/well in the presence of 8 μM of aphidicolin (Sigma). Cells were transduced with lentiviral vectors at a concentration ranging from 1 to 100 ng/ml, 24 hours after the aphidicolin block, which was replenished in the medium at the time of transduction. At 2 days post-transduction, cells were harvested and eGFP expression was analyzed by flow cytometry.
For DC transduction experiments, 500,000 FLT3L-generated-bone marrow-derived DC (FL-DC) were transduced at day 6 of the differentiation, with lentiviral vectors at a concentration ranging from 50 to 300 ng/ml. At 2 days post-transduction, FL-DC were harvested and resuspended in PBS with 2% FCS and 0.01% sodium azide (staining buffer). Cells were strained with an APC(allophycocyanine)-conjugated anti-CD11c antibody and a PerCP(Peridinin chlorophyll protein)-conjugated anti-B220 antibody, washed twice and analyzed by flow cytometry on a FACSCalibur (BD biosciences, Franklin Lakes, N.J.).
Mice Immunization
All animal experiments were conducted in accordance with the guidelines of the Office Laboratory of Animal Care at the Pasteur Institute. Six-week-old C57/Bl6 mice were intraperitoneally (i.p.) inoculated with varying doses of TRIP/sE WNV vector particles (from 1 to 100 ng/ml) in 0.1 ml Dulbecco's phosphate-buffered saline (DPBS; pH 7.5) supplemented with buffered 0.2% bovine serum albumin (DPBS/0.2% BSA, Sigma).
Measurement of Serum Antibody Responses
Mice were bled via the periorbital route and serum samples were heat-inactivated 30 min at 56° C. Anti-WNV antibodies were detected by ELISA, by use of microtitration plates coated with sucrose-purified WNV IS-98-ST1. Peroxydase goat anti-mouse immunoglobulin (H+L) (Jackson Immuno Research) was used at a 1:4,000 dilution as secondary antibodies. The endpoint titer was calculayed as the reciprocal of the last dilution eliciting twice the optical density (OD) of sera from nonimmunized mice.
WNV challenge
WNV challenge was performed by i.p. inoculation of neurovirulent WNV strain IS-98-ST1 (i.p. LD 50=10 FFU) as previously described, either one week or two months after lentiviral vector vaccination. The challenged mice were monitored daily for signs of morbidity or mortality, for up to 21 days after the WNV strain inoculation.
Results
Transduction of nondividing cells with TRIP vectors deficient for Integration results in high transgene expression levels
To test the hypothesis that integration deficient LV (TRIP.NI vectors) could be efficient tools to deliver antigen (Ags) to nondividing APC such as DC, we initially evaluated their transduction efficiency of growth-arrested cells. For this purpose, HeLa cells treated with aphidicolin, a specific inhibitor of cell cycle, were exposed to graded doses of TRIP.NI or TRIP.I particles encoding eGFP. The transduction efficiency was then determined by flow cytometry. As shown in
TRIP Nonintegrative Lentiviral Vector Transduction Leads to Effective Antigen Expression Both in Conventional and in Plasmacytoid Dendritic Cells
We next studied the ability of TRIP.NI vectors to transduce DC. DC are categorized as conventional (cDC) (CD11c+B220−) and plasmacytoid (pDC)
(CD11c+B220+) and both these DC subtypes are able to stimulate Ag-specific immune responses. We then investigated the transduction of bone marrow-derived DC differentiated in presence of Flt3L (FL-DC), which allows the generation of large numbers of pDC and cDC. FL-DC were exposed to graded doses of TRIP.NIGFP or TRIP.IGFP particles. As shown in
We next gated on CD11c+B220+dendritic cells and CD11c+B220− dendritic cells to evaluate the capacity of LV to transduce each DC subset. As shown in
Transduction efficiency with TRIP.NI particles was dose dependent and slightly but insignificantly lower than those obtained with TRIP.I particles. Interestingly, we observed that transduction with TRIP.I vectors led to a small proportion of DC expressing high levels of the transgene, whereas exposure of DC to TRIP.NI vectors did not (
TRIP Nonintegrative Lentiviral Vectors Induce the Production of Ag-Specific Antibodies
Taking into account that TRIP.NI could efficiently deliver a foreign gene to DC, we next explored their ability to mount a specific immune response. In a recent study, we have designed TRIP.I vectors coding for a secreted form of WNV envelope (TRIP.I EWNV) which possesses neutralizing epitopes and we have demonstrated that TRIP.I EWNV could stimulate an antibody-based protective immunity in a mouse model of WNV infection. To investigate the ability of TRIP.NI vectors to initiate a B cell response, animals were immunized with various doses of TRIP.NI EWNV particles ranging from 1 to 100 ng of p24 antigen per mouse. As a control, mice were inoculated with 100 ng of TRIP.NI EWNV particles inactivated by heating (HI) to abrogate their transduction capacities. Three weeks after immunization, mice were bled periorbitally and individual or pooled sera were tested by ELISA for anti-WNV total antibodies. As expected, immunizations with heat-inactivated TRIP.NI EWNV vectors were not followed by the production of Abs (
We next compared the strength of the immune response elicited by TRIP.NI EWNV and TRIP.I EWNV vectors. As shown in
Taken together, these results demonstrated that a single immunization with TRIP.NI vectors was sufficient to elicit a humoral specific immune response with a strength comparable to that obtained with TRIP.I vectors, above a threshold dose of particles. Interestingly and surprisingly, use of non-integrative vectors enable to obtain an immune response whose strength is dependent upon the dose of injected lentiviral vectors.
Immunizations of mice with a single dose of TRIP.NisEwnv give the following antibody titers:
As shown on
Immunization with TRIP.NI EWNV vectors confers early protection against WNV challenge
We have previously shown that TRIP.I EWNV confers an early protective immunity against a WNV challenge. To determine if the immune response elicited by TRIP.NI vectors could also lead to a rapid protection, mice were immunized with 100 ng of TRIP.NI EWNV particles and challenged 7 days after with 10,000 FFU of the highly virulent WNV strain IS-98-ST1 (thousand times the dose required to kill 50% of infected animals). We included also in this challenge experiment a group of mice immunized with 100 ng of TRIP.I EWNV as a positive control of protection and another group of mice inoculated with D-PBS as a negative control. As expected, all mice that received D-PBS died within 12 days post-challenge (
Mice protected from WNV challenge did not develop clinical signs of illness during the 3-weeks post-challenge observation period. These results demonstrated that an early protective immunity against WNV was achieved with a single administration of TRIP. EWNV defective for integration.
TRIP.NI EWNV Induces Long-Lasting Protection
As demonstrated earlier, immunization of mice with TRIP.I EWNV resulted in the establishment of long-term protective immunity against WNV challenge. To evaluate the duration of the protective immunity elicited by TRIP.NI EWNV, and the minimum dose of particles required to induce long-term protection, mice were immunized with different amounts of particles (1, 3, 10, 30 and 100 ng of p24 antigen) and were challenged after 2-month waiting period after immunization. As shown in
Thus, TRIP.NI EWNV vectors induced long-lasting immunity against WNV infection
Discussion
An important result of the present experiments is the demonstration that vaccination with TRIP.NI particles can provide an efficient and strong immune response that is both an early and long lasting immune response, and further antigen dose-dependent, despite the absence of integration of the lentiviral genome administered. Therefore, a fully protection against a challenge with a lethal dose of WNV was demonstrated.
As expected, memory protective immunity was directly correlated to the titer of anti WNV antibodies induced by TRIP.NI particles (
Kinetic challenge experiments on vaccinated mice revealed that TRIP.NI vaccines not only conferred a long term protective immunity but elicited also protection as early as one week after a single injection of particles. Although the exact mechanisms involved in this early protection are not fully understood, we have detected specific WNV antibodies one week after immunizations with TRIP.NI and TRIP.I particles. We have previously shown that this early wave of antibodies were exclusively composed of specific IgM, derived from mice 4 days after injection, completely protected mice against WNV infection.
In our study, a vaccination regimen based on a direct injection of a single dose of TRIP.NI particles elicited a robust, rapid and long term specific immune response, achieving fully protection against WNV. Thus, TRIP.NI based vaccine strategy represents a safe and efficacious platform for the development of vaccines against pathogens agents such as flaviviruses that require B cell immunity.
Codon Optimization Enables to Improve the Cellular Immune Response of Non Integrative Vectors. Further Improvement is Obtained with a Prime-Boost Regimer
Intracellular staining of gag p27. 293 T cells were cotransfected with TRIP vector plasmids containing either a wild-type sequence or a codon-optimized sequence of gagΔmyr, the encapsidation plasmid p8.7 D64V and the VSV-G Indiana expression plasmid. 48 hours later, cells were washed and permeabilized for 20 min in Cytofix-Cytoperm solution (BD Pharmingen). After two washes with PermWash buffer (BD Pharmingen), permeabilized cells were incubated with Anti-gagSIV p27 antibody (55-2F12, AIDS Research and Reference Reagent Program) for 30 min at 4° C. at a 1:3 dilution in PermWash buffer. Cells were washed twice and incubated with FITC-conjugated rat IgG2b kappa monoclonal antibody (553988, BD Biosciences) for 30 min at 4° C. at a 1:30 dilution in PermWash buffer. After two additional washes, cells were analyzed by flow cytometry.
Mice immunization. For prime experiments, groups of mice were intraperitoneally inoculated with various doses of TRIP.NI gagΔmyr wild-type or codon optimized (CO) particles pseudotyped with the glycoprotein from VSV Indiana serotype. For prime-boost experiments, groups of mice were intraperitoneally inoculated with 100 ng of p24 of TRIP.NI gagΔmyr codon optimized (CO) or 100 ng of p24 of TRIP.I gagΔmyr particles pseudotyped with the glycoprotein from VSV indiana serotype. 13 weeks later, mice primed with TRIP.NI gagΔmyr CO particles were boosted with 100 ng of p24 of TRIP.NI gagΔmyr CO particles pseudotyped with the glycoprotein from VSV New Jersey serotype. In parallel, mice primed with TRIP.I gagΔmyr particles were boosted with 100 ng of p24 of TRIP.I gagΔmyr particles pseudotyped with the glycoprotein from VSV New Jersey serotype.
Elispot Assay. Nitrocellulose microplates (MAHA S4510, Millipore) were coated with capture antibody (Mouse IFNg Elispot pair, BD Pharmingen) and blocked with complete medium composed of RPMI 1640 Glutamax supplemented with 10% FCS, antibiotic, Hepes, non-essential amino-acids, b-mercaptoethanol and sodium pyruvate. Splenocytes from vector-immunized mice were added to the plates in triplicates at 0.25×106 cells/well and stimulated with SIVmac 239 gag peptides (NIH AIDS Research and Reference Reagent Program). Forty hours later, spots were revealed with the biotine-conjugated antibody (Mouse IFNg Elispot pair, BD Pharmingen) followed by streptavidin-AP (Roche) and BCIP/NB substrate solution (Promega). Spots were counted using a Bioreader 2000 (Biosys, Karben, Germany) and results were expressed as IFNg spot-forming cells (SFC) per million splenocytes.
In vivo cytotoxic assay. For target cell preparation, splenocytes from naive mice were labelled with various concentrations (high, 5 μM; Low, 1 μM) of CFSE (carbosyfluorescein-diacetate succinimydel ester, Vybrant CFDA-SE cell-tracer kit, Molecular Probes). Splenocytes labelled with high concentrations of CFSE were pulsed with peptides at 5 μg/ml. The control population stained with low doses of CFSE was incubated in medium without peptides. Each mouse received 107 CFSE-labelled cells of a mix containing an equal number of cells from each fraction, through the retroorbital vein. After 15-18 h, single-cell suspensions from spleen were analyzed by flow cytometry (Becton Dickinson, CellQuest software). The disappearance of peptide-pulsed cells was determined by comparing the ratio of pulsed (High CFSE fluorescence intensity) to unpulsed (Low CFSE fluorescence intensity) populations in immunized versus naive mice. The percentage of specific killing was established according to the following calculation: (1−((CFSElow naive/CFSEhigh naive)/(CFSElow immunized/CFSEhigh immunized)))*100.
Tetramer staining. 2×106 splenocytes from immunized mice were stained at room temperature for 5 min with anti-CD3-FITC (Becton Dickinson), an anti-CD8-APC (Becton Dickinson) and a PE-tetramer specific of the immunodominant peptide of GAGSIV. Data was collected using FACSCalibur and analyzed using CellQuest.
The invention provides a solution to improve the cellular immune response induced with nonintegrative lentiviral vectors by the use of:
1. a codon-optimized form of the transgene coding for the antigen and/or
2. a prime-boost regimen
1. We have demonstrated that nonintegrative lentiviral vectors coding for the gagdmyrSIV wild-type antigen are far less potent at inducing specific T cell responses than integrative lentiviral vectors coding for the same antigen. More importantly, we have demonstrated that this poor immunogenicity can be overcome by the use of a codon-optimized form of the trangene coding for GagdmyrSIV. The absolute requirement of a codon-optimized antigen with nonintegrative lentiviral vectors to induce strong T cell responses could not be anticipated. This result was unexpected since we have demonstrated that nonintegrative lentiviral vectors could efficiently transduce nondividing cells and especially dendritic cells, the most efficient antigen-presenting cells, as well as integrative lentiviral vectors. However, the expression of a non-codon-optimized transgene was lower by a 2-fold factor in transduced cells with nonintegrative lentiviral vectors compared to cells transduced with integrative lentiviral vectors. This result suggested that in vivo, the response induced by nonintegrative lentiviral vectors could be less strong by a 2-fold factor compared to the response induced by integrative lentiviral vectors and it could be anticipated that the injection of twice more nonintegrative lentiviral vectors could give similar responses to that obtained with integrative lentiviral vectors. This was absolutely not the case, since specific T cell responses elicited by nonintegrative lentiviral vectors are 5 to 10 fold lower than that observed with integrative lentiviral vectors. Moreover, the induction of specific T cell responses responses with nonintegrative lentiviral vectors could only be achieved with high doses of injected particles (the minimal dose required to induce a quantifiable T cell response with nonintegrative lentiviral vectors is at least 10-fold higher than the minimal dose required with integrative lentiviral vectors). Codon-optimization(CO) overcomes this poor immunogenicity. Thus, at a dose of 100 ng, nonintegrative lentiviral vectors bearing a codon-optimized form of gagdmyrSIV induced memory T cell responses against the antigen, whereas vectors bearing the wild-type form did not. However, the response elicited by TRIP.NI gagdmyrSIV CO is still lower by a 2-fold factor than that elicited by TRIP.I gagdmyrSIV wild-type.
2. A prime-boost regimen based on TRIP.NI gagdmyrSIV CO elicits similar response in term of intensity than a prime-boost regimen based on TRIP.I gagdmyrSIV wild-type. In prime-boost experiments, mice were immunized with 100 ng of TRIP.NI gagdmyrSIV CO or 100 ng of TRIP.I gagdmyrSIV wild-type. Lentiviral vectors were pseudotyped with the VSV-G Indiana envelope. 13 weeks later, mice immunized with TRIP.NI particles were boosted with 100 ng of TRIP.NI gagdmyrSIV CO particles pseudotyped with the noncrossreactive VSV-G New Jersey envelope. In parallel, mice primed with TRIP.I particles were boosted with 100 ng of TRIP.I gagdmyrSIV wild-type pseudotyped with the VSV-G New Jersey envelope. Analysis of GagdmyrSIV specific immune response (IFNg ELISPOT, tetramer staining) performed on splenocytes from immunized mice revealed that a prime-boost regimen based on TRIP.NI gagdmyrSIV CO elicits at least similar responses in term of amplitude than a prime-boost regimen based on TRIP.I gagdmyrSIV wild-type particles. This result has never been published and could not be anticipated since a single injection with TRIP.NI gagdmyrSIV CO particles induced lower responses compared to a single injection of TRIP.I gagdmyrSIV wild-type particles.
The G glycoprotein of the vesicular stomatisis virus (VSV-G) of the Indiana serotype is a transmembrane protein commonly used as a coat protein for engineering lentiviral vector vectors.
Presently, nine virus species are definitively classified in the VSV gender, and nineteen rhabdoviruses provisionally classified in this gender, all showing various degrees of cross-neutralisation. When sequenced, the protein G genes indicate sequence similarities. The VSV-G protein presents a N-terminal ectodomain, a transmembrane region and a C-terminal cytoplasmic tail. It is exported to the cell surface via the transgoigi network (endoplasmic reticulum and Golgi apparatus).
A codon optimized gene have been generated, and cloned between the BamH1 and EcoR1 sites of the pThV vector, generating the pThV-VSV.G (IND-CO) (
When further VSV-G serotypes are required to design a suitable combination for use in the vaccine assay including at least one a boost injection, other VSV-G serotypes have been tested for particles coating. The first one used was the VSV-GNewJersey serotype. A codon optimized gene have been synthesized, and cloned between the BamH1 and EcoR1 sites of the pThV-plasmid, generating the pThV-VSV.G (NJ CO) vector (
Presently, five other VSV-G genes are sequenced (Chandipura, Cocal, Piry, Isfahan and spring viremia of carp virus,
Materials and Methods
1. Materials 1.1 Plasmids
Codon optimized genes have been generated by Gene Art AG (Germany) for the five characterized VSV-G serotypes. The genes were cloned between the BamH1 and EcroR1 sites of the pThV plasmid, generating the following vectors: pThV-VSV.G (CHANDI-CO;
2. Methods 2.1 Cross neutralization assays
Mice C57BI/6 mice (haplotype H2b, between 12 and 23 weeks old) were intraperitoneally injected with the lentiviral vector particles pseudotyped with the VSV-G serotypes (Indiana, New Jersey, Isfahan, Cocal and SVCV, 6 mice per group, 450μL/mouse). 4 weeks later, the mice were boosted with the same particles (500 μL/mouse). A first retro orbital blood collection (in Capiject tubes) is done 15 days post boost, and a second 21 days post boost. The blood is centrifuged 6 min at 3500 rpm and the serum is collected and kept at −20° C.
Transduction assays were made in presence of various dilutions of these sera.
2.2 Generation of Human Monocyte-Derived DCs
Buffy coats were obtained from French Blood Bank (EFS-Rungis) with informed consent from all subjects and according to ethical guidelines. PBMCs are isolated by Ficoll density centrifugation. Monocytes cells are enriched by adhesion on tissue-culture-treated plates. After the adhesion step cells are cultured in RPMI media containing 10% FCS, Peni strptomycine, Pyruvate 0.1 mM+Hepes 1 mM and supplemented with granulocyte-macrophage rhGM-CSF (50 ng/ml, R&D systems) and rIL-4 (20 ng/ml, R&D systems). This medium was replaced with fresh media containing rhGM-CSF (50 ng/ml) and rhIL-4 (20 ng/ml) four days after. On day 7, cells were phenotyped and transduced with lentilentiviral vector vectors. Two hours after transductions RPMI (INVITROGEN) media containing rhGM-CSF and rhIL-4 was added. Cells were harvested 5 days after transduction and were analyzed by LSR II flow cytometry (Becton Dickinson). Expression of GFP by DCs, was examined directly by flow cytometry in the fluorescein isothiocyanate channel.
2.3 Phenotypic Analysis of Human Monocyte-Derived DCs
For phenotypic analysis, DCs (1×106 cells in 100 μl) were incubated for 5 min at room temperature with anti CD14, CD86, CD1a and HLA-dr antibody labeled with FITC- or PE at a concentration of 0.1 μg/μl (Becton Dickinson). Stained cells were analyzed by LSR II flow cytometry (Becton Dickinson).
1. Evaluation of the Pseudotyping Abilities of the Different VSV-G Serotypes
Human codon-optimized genes have been generated for the five characterized VSV-G serotypes, and cloned inside the pThV plasmid, generating the following vectors: pThV-VSV.G (CHANDI-CO), pThV-VSV.G (COCAL-CO), pThV-VSV.G (PIRY-CO), pThV-VSV.G (ISFA-CO) and pThV-VSV.G (SVCV-CO), (
The Chandipura and Piry VSV-G serotypes both give rise to only 0.07% of the Indiana titer. It appears that their very low fusion activity would prevent their effective use to pseudotype our lentiviral vector particles, as they won't be able to transduce enough target cells. This low efficiency of the Chandipura VSV-G protein can explain its reported lack of ability to boost an immune response in the context of VSV-G pseudotyped replication-defective human immunodeficiency virus particles (Baliga CS, at al, Molecular Therapy, 2006).
2. Cross Neutralization Assays
Characterizing the aptitude of our VSV-G proteins to generate neutralizing antibodies and checking whether these antibodies potentially cross neutralize heterologous VSV-G serotypesmay be of help to settle on a preferred order in which the pseudotyped vectors should be injected in vaccination trials.
Lentiviral vector particles pseudotyped with the efficient VSV-G proteins (Indiana, New Jersey, Cocal, Isfahan and SVCV) were injected twice in C57Bl/6 mice, with a four week interval between injections. 15 days after the second injection, blood was collected from mice and its ability to neutralize lentiviral vector particles pseudotyped with various VSV-G proteins was tested. As shown in
3. Antibody Prevalence in Monkeys and Human Sera
The presence in human sera of antibodies able to neutralize the VSV-G proteins should be determined prior to use them for pseudotyping our vector particles. In order to evaluate the intensity of the neutralizing responses that may be obtained with human sera, we first decided to test our particles pseudotyped with the selected VSV-G proteins in presence of various monkey sera, obtained from the animals used in our trial. Hence we collected sera from four monkeys (one not vaccinated, three vaccinated with various doses of particles pseudotyped with VSV-G Indiana—low, medium and high doses—and boosted with a unique dose of VSV-G New jersey pseudotyped particles), at various time (before injection, post prime and post boost). The ability of these monkey sera to neutralize particles pseudotyped with the selected VSV-G proteins (Indiana, New Jersey, Cocal, Isfahan and SVCV) has then been tested and the results are shown in
The presence in human serum of antibodies able to neutralize the VSV-G proteins has been determined in 96 human sera randomly selected. Transduction experiments with lentiviral vector particles pseudotyped with the selected VSV-G proteins were done in presence of human sera (heated and not heated). Results summarized in
4. Transduction of Human Monocyte-Derived Dendritic Cells with Vector Particles Pseudotyped by Different VSV-G Envelopes
In a proposed vaccination protocol of the invention, the lentiviral vector pseudotyped with the Indiana VSV-G pseudotype is injected first to prime the immunological reaction. In order to boost the immunological reaction, a lentiviral vector pseudotyped with one of the previously described VSV-G serotype is used for the second injection of lentiviral vector particles. Dendritic cells play central role in innate and adaptive immunities. Hence we characterized the capacity of vector particles pseudotyped by different VSV-G proteins to fuse with human DCs. Therefore, human monocytes derived dendritic cells (mDCs) were transduced with lentiviral vectors pseudotyped with various VSV-G proteins (New Jersey, Isfahan, SVCV, Cocal or Chandipura), leading to the determination of the titers (TU/mL) for the different particles, which correlates directly with the fusogenicity of each VSV-G. Besides, the titer of vector particles classically done on 293 T cells was also characterized to establish the relative titer of transduction (Titer DC/Titer 293T). The experiments demonstrated that all the VSV-G envelopes tested presented a relative ability to fuse with mDCs with the notable exception of the Chandipura serotype of VSV-G (
| Number | Date | Country | Kind |
|---|---|---|---|
| 07290979.9 | Aug 2007 | EP | regional |
| 07290980.7 | Aug 2007 | EP | regional |
| 07291251.2 | Oct 2007 | EP | regional |
| 08156405.6 | May 2008 | EP | regional |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/IB2008/002930 | 8/1/2008 | WO | 00 | 4/22/2010 |
