This invention is directed to certain novel compounds, methods for producing them and methods for treating or ameliorating various diseases by using the lipid nanoparticles as drug delivery devices. More particularly, this invention is directed to oligonucleotide-lipid nanoparticles, methods for producing such compounds and methods for treating or ameliorating various diseases using such compounds.
Oligonucleotides, such as antisense deoxyribonucleotides (ODNs), micro RNAs (miRNAs), CpG ODNs, and small interfering RNAs (siRNAs), have shown considerable promise for therapeutic applications. However, these agents have relatively high molecular weights and charge densities, which renders them impermeable to the cellular membrane. In fact, in vitro biological activities of these oligonucleotides require the aid of transfection agents, such as Oligofectamine™ from Invitrogen, in order to be effective. Although free antisense deoxyribonucleotides are being studied in current clinical trials and have shown some efficacy against several types of cancer, there is still a need to further enhance their activity. There is a particular need to enhance the effective delivery of the antisense deoxyribonucleotides to the desired target sites with tissue specificity.
One area of concern is that unmodified oligonucleotides are rapidly degraded by nucleases in the body. Although various chemical modifications, such as a phosphorothioate backbone, have been used to increase the stability of the oligonucleotides, they still suffer from short circulation time due to binding to serum proteins and degradation by serum nucleases.
Other research has involved protamine sulfate, which is a polycation where antisense deoxyribonucleotides-protamine electrostatic complexes have been evaluated for in vivo delivery. However, these complexes lack sufficient colloidal stability and tend to aggregate over time, thereby limiting their usefulness.
Still other research has involved cationic liposomes which have been used to complex and encapsulate oligonucleotides. However, these complexes also lack sufficient colloidal stability, tend to increase in size over time, and are not very stable in the presence of serum, again thereby limiting their usefulness.
An improvement is therefore needed for an oligonucleotide formulation to make such formulation suitable for systemic in vivo administration without the above-described drawbacks.
There is also a need for therapeutic strategies based on the effective delivery of oligonucleotide compositions.
In one aspect, there is provided herein an oligonucleotide-lipid nanoparticle comprising at least one oligonucleotide, at least one lipid and at least one complexation agent for the oligonucleotide. In certain embodiments, the oligonucleotide-lipid nanoparticle further includes at least one targeting ligand and/or at least one additional functional component.
In another aspect, there is provided a method for protecting an oligonucleotide from degradation by nucleases and prolonging systemic circulation time in vivo. The method includes loading an oligonucleotide into a lipid nanoparticle, whereby the oligonucleotide-lipid nanoparticle is formed. The in vivo circulation time is further extended by grafting one or more PEG polymers onto the surface of the oligonucleotide-lipid nanoparticle through incorporation of PEG-grafted lipids.
The method can include a solvent removal step which can be accomplished by using a tangential-flow diafiltration method to exchange the nanoparticles into an aqueous buffer and to adjust the oligonucleotide-lipid nanoparticles to a desired concentration.
Various objects and advantages of this invention will become apparent to those skilled in the art from the following detailed description of the preferred embodiment, when read in light of the accompanying drawings.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
It is to be understood that various abbreviations used in the Figures, Specification, Examples and Claims can be used interchangeably: lipid nanoparticles are variously designated as “LN”, “LNP”, “LP”, “LPN”, and “lipopolyplex”; oligodeoxynucleotides are variously designated as “ODN”, “ON” and “oligonucleotides”; immunolipid nanoparaticles are varisously designated as “ILN”, “INP” and “IP.”
Lip, LN, Tf-Lip, Tf-LN or protamine-ODN complexes were stored in HBS buffer at 4° C. and particle sizes were measured by dynamic light scattering. The values in the plot represent the means of 3 separate experiments. Error bars were standard deviations, n=3. Lip, liposomes entrapping G3139; Tf-Lip, Tf-conjugated liposomes entrapping G3139.
Human KB cells (
Need
Need
(diamond) Mock+Ara-C;
(square) GTI-2040-Tf-LP+Ara-C;
(triangle) free GTI-2040+Ara-C; and
(floret) Scrambled-Tf-LP+Ara-C. Each point reflects the average of at least three independent experiments. Error bars indicate standard deviations.
In a first broad aspect, there is provided herein an oligonucleotide-lipid nanoparticle comprising at least one oligonucleotide, at least one lipid and at least one complexation agent for the oligonucleotide formed by: i) mixing at least one lipid and at least one complexing agent and one or more cationic polymers, in a water miscible organic solvent to form a first mixture; ii) dissolving one or mixing two or more oligonucleotides in an aqueous buffer to form a second mixture; and, iii) injecting the first mixture into the second mixture, or mixing the first mixture and the second mixture under pressure, to form a third mixture; and iv) removing the organic solvent from the third mixture.
In another broad aspect, there is provided herein an oligonucleotide-lipid nanoparticle comprising at least one oligonucleotide, at least one lipid and at least one complexation agent for the oligonucleotide formed by: i) mixing at least one complexing agent and at least one oligonucleotide in an aqueous buffer to form a first mixture; ii) dissolving at least one lipid in a water-miscible solvent to form a second mixture comprised of liposomes or liposome precursors; iii) mixing the second mixture with the first mixture under pressure to from a third mixture; and iv) removing solvent from the third mixture.
In certain embodiments, the complexing agent comprises a divalent cation. In certain embodiments, the complexing agent comprises one or more of: Ca2+, Mg2+, pentaethylenehexamine (PEHA), spermine, protamine, polylysine, chitosan, and polyethyleneimine (PEI).
In certain embodiments, the water miscible organic solvent comprises one or more of ethanol, isopropanol, and tert-butanol containing 0 to about 50% water.
In certain embodiments, the third mixture has a final organic solvent-to-water ratio ranging from about 30/70 to about 50/50.
In certain embodiments, the oligonucleotide-lipid nanoparticle further includes at least one targeting ligand.
In certain embodiments, the oligonucleotide-lipid nanoparticle further include at least one additional functional component.
In certain embodiments, the oligonucleotides include one or more of: antisense deoxyribonucleotides, small interfering RNAs (siRNAs), microRNAs (miRNAs), CpG ODNs, or antisense deoxyribonucleotides, including combinations of oligonucleotides of the same and of different classes. In certain embodiments, the oligonucleotides contain one or more chemical modifications configured to increase the stability and/or lipophilicity of the oligonucleotides. In certain embodiments, the chemical modifications comprises one or more of a phosphorothioate linkages between the nucleotides, a cholesterol or lipid conjugated to the oligonucleotide at the 5′ or 3′ end, and 2′O-methylation on the ribose moieties.
In certain embodiments, the lipid comprises one or more of: a) cationic or anionic lipids or surfactants; b) neutral lipids or surfactants; c) cholesterol; and d) PEGylated lipids or surfactants. In certain embodiments, the lipids are configured to promote electrostatic interaction directly or indirectly with anionic oligonucleotides.
In certain embodiments, the cationic lipid includes a titratable headgroup with pKa between 5 and 8. In certain embodiments, the cationic lipid comprises one or more of: 3 alpha-[N-(N′,N′-dimethylaminoethane)-carbamoyl] cholesterol hydrochloride (DC-Chol), or 1,2-dioleoyl-3-(dimethylamino)propane (DODAP). In certain embodiments, the cationic lipid is configured with a permanent cationic charge at physiological pH with pKa above 8. In certain embodiments, the cationic lipid comprises one or more of: 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) or dioctadecyldimethyl ammonium bromide (DDAB).
In certain embodiments, the neutral lipids are configured to increase bilayer stability. In certain embodiments, the neutral lipids comprises a phosphatidylcholine. In certain embodiments, the neutral lipid is configured to regulate endosomolytic activity of the nanoparticle. In certain embodiments, the neutral lipid comprises dioleoylphosphatidylethanolamine (DOPE), alpha-tocopherol, triolein, or diolein.
In certain embodiments, the nanoparticle includes cholesterol to enhance the bilayer stability.
In certain embodiments, the PEGylated lipid is configured to promote colloidal stability and/or to prolong in vivo circulation time. In certain embodiments, the PEGylated lipid comprises one or more of: methoxy-polyethyleneglycol-distearoylphosphatidyl-ethanolamine (mPEG-DSPE), TPGS, Tween-80 and other polysorbates, Brij series surfactants, and poly(oxyethylene) cholesteryl ethers (PEG-chol).
In certain embodiments, the nanoparticle further includes one or more anionic lipids. In certain embodiments, the anionic lipid comprises one or more of: cholesteryl hemisuccinate (CHEMS), dicetylphosphate, phosphatidylglycerol, alpha-tocopherol succinate, and oleic acid.
In certain embodiments, the targeting ligand is conjugated to a hydrophobic anchor with or without a linker. In certain embodiments, the hydrophobic anchor comprises one or more of: a lipid or a lipid-like molecule, an alpha-tocopherol derivative, or a cholesterol derivative.
In certain embodiments, the targeting ligand comprises one or more of: transferrin, folate, oligosaccharides, and tissue or cell-specific antibodies, and is conjugated to a hydrophobic anchor comprising one or more of: phosphatidylethanolamine derivative, a lipophilic molecule, and cholesterol.
In certain embodiments, the oligonucleotide-lipid nanoparticle includes one or more additional functional components, including fusogenic peptides, membrane lytic polymers, and nuclear localization signal peptides.
In another broad aspect, there is provided herein a method for protecting an oligonucleotide from degradation by nucleases and prolonging systemic circulation time in vivo, the method comprising loading an oligonucleotide into a lipid nanoparticle, whereby the oligonucleotide-lipid nanoparticle is formed.
In certain embodiments, the in vivo circulation time is further extended by grafting one or more PEG polymers onto a surface of the oligonucleotide-lipid nanoparticle.
In certain embodiments, the oligonucleotide-lipid nanoparticle is formed by: i) mixing at least one lipid and at least one complexing agent, including, but not limited to a divalent cation or one or more cationic polymers, in a water miscible organic solvent, with or without up to 50% water, to form a first mixture; ii) mixing one or more oligonucleotides in an aqueous buffer to form a second mixture; and, iii) injecting the first mixture into the second mixture or mixing the two under pressure to form a third mixture; and iv) removing solvent from the third mixture.
In certain embodiments, the oligonucleotide-lipid nanoparticle is formed by: i) mixing at least one complexing agent including, but not limited to a divalent cation or one or more cationic polymers, and at least one oligonucleotide in an aqueous buffer to form a first mixture; ii) dissolving at least one lipid in a water miscible solvent containing 0 to about 50% water to form a second mixture comprised of liposomes or a liposome precursor; iii) mixing the second mixture with the first mixture under pressure to from a third mixture; and iv) removing solvent from the third mixture.
In certain embodiments, the method includes an additional step of particle size reduction is added to make the nanoparticle size smaller and more uniform, and the removal step comprises diluting and/or dialyzing the third mixture. In certain embodiments, the additional step of particle size reduction is added by sonication to make the nanoparticle size smaller and more uniform, and the removal step comprises diluting and/or dialyzing the third mixture. In certain embodiments, the additional step of particle size reduction is added by high pressure homogenization to make the nanoparticle size smaller and more uniform, and the removal step comprises diluting and/or dialyzing the third mixture. In certain embodiments, the by high pressure homogenization comprises to make the particle size smaller and more uniform.
In certain embodiments, the removal step is accomplished by using tangential-flow diafiltration that leads to exchanging the nanoparticles into an aqueous buffer and adjusting the oligonucleotide-lipid nanoparticles to a desired concentration.
In certain embodiments, the method is configured for large-scale production for clinical applications.
In certain embodiments, the method further includes one or more steps: complexing or conjugating a targeting ligand to a lipid bilayer for “ligand conjugation”, or adding a lipid-conjugated targeting ligand followed by incubation for “post-insertion” of the ligand; sterilizing the lipid nanoparticles by filtration; and lyophilizing the oligonucleotide-lipid formulation in the presence of a lyoprotectant to achieve long term stability under mild storage conditions and easy reconstitution of the aqueous formulation at the point of use.
In certain embodiments, the filtration of the lipid nanoparticles is through a sterile filter of ˜0.2 μM. In certain embodiments, the lyoprotectant comprises a disaccharide. In certain embodiments, the lyoprotectant comprises about 5 to about 20% sucrose.
In another broad aspect, there is provided herein a method for delivering oligonucleotides to a solid tumor, the method comprising using long-circulating oligonucleotide/lipid-nanoparticles, wherein the oligonucleotide/lipid-nanoparticle exhibits an enhanced permeability and retention (EPR) effect, which results in increased accumulation in tumor tissues relative to normal tissues.
In another broad aspect, there is provided herein an oligonucleotide-lipid nanoparticle, formed by a microfluidic focusing process which produces nanoparticle having a substantially uniform size and structure, increased oligonucleotide loading efficiency and with better transfection efficiency and less cytotoxicity.
In another broad aspect, there is provided herein a microfluidic hydrodynamic focusing method for preparing lipopolyplex containing one or more antisense oligodeoxynucleotides configured for targeting one or more antiapoptotic proteins under- or over-expressed in a cancer-associated disorder.
In another broad aspect, there is provided herein a lipopolyplex composition comprising one or more oligonucleotides, one or more protamines, and one or more lipids, present in about oligonucleotide:protamine:lipids (1:0.3:12.5 wt/wt ratio).
In another broad aspect, there is provided herein a lipopolyplex composition comprising one or more oligonucleotides, one or more protamines, and one or more lipids, wherein the lipids include DC-Chol:egg PC:PEG-DSPE present in about 40:58:2 mol/mol %.
In another broad aspect, there is provided herein a microfluidic process for making nanoparticle comprising substantially controlling flow conditions and mixing process of reagents at a micrometer scale to synthesize nanoparticles having a substantially uniform and well-defined size, structure, and pharmacological functions.
In another broad aspect, there is provided herein nanoparticles useful for efficient delivery of single stranded or duplexed DNA or RNA oligonucleotide compounds to cancer cells.
In certain embodiments, the nanoparticles comprise one or more of: a first component configured for stabilizing one or more oligonucleotides in serum and for increasing delivery efficiency; a second component configured for shielding lipopolyplexes (LPs) from the serum proteins and for targeting cell surface receptors; and a third component configured for further stabilizing the LPs against plasma protein adsorption and clearance by the reticuloendothelial system of a subject, thereby achieving prolonged blood circulation time.
In another broad aspect, there is provided herein a stable lipopolyplex formulation that yields nanoparticles of medium diameters of less than about 250 nm, high ODN entrapment efficiency, colloidal stability, long circulation time, and specific targeting to cancerous cells.
In another broad aspect, there is provided herein a microfluidic device for making nanoparticles, comprising multiple channels, wherein the channel widths are varied.
In another broad aspect, there is provided herein a method for making a microfluidic device, comprising: laminating a PMMA film to form closed microchannels having inlets and outlets by passing a PMMA/film sandwich through a thermal laminator; sonicating the PMMA plates; drying the PMMA plates; and bonding fluidic connectors onto the inlets and outlet on the PMMA plate by applying a UV curing adhesive around a perimeter of each of the connectors, wherein the connectors are aligned over inlet/outlet openings; and curing the adhesive by exposure to UV irradiation.
In another broad aspect, there is provided herein a microfluidic device for making oligonucleotide-lipid nanoparticles, comprising at least three inlet ports and at least one outlet port, each inlet port being connected to a separate injection device; the device being configured such that: i) when a first fluid stream is introduced into each of the first and second inlet ports, the first fluid stream is split into two side microchannel streams at the third inlet port; and ii) when a second fluid stream is introduced in the third inlet port, a product stream is formed that is collected at the outlet port.
In another broad aspect, there is provided herein a microfluidic device for making oligonucleotide-lipid nanoparticles, comprising at least five inlet ports and at least one outlet port, each inlet port being connected to a separate injection device; the device being configured such that: i) when a first fluid stream is introduced into the first inlet port and a second fluid stream is introduced into the second inlet port, the first fluid stream is split into two side microchannel streams at the third inlet port; ii) when a third fluid stream is introduced in the third inlet port, a first product stream is formed at a first junction; iii) when a fourth fluid stream is introduced into the fourth inlet port and a fifth fluid stream is introduced into the fifth inlet port at a point downstream of the first junction, the fourth fluid stream and the fifth fluid stream contact the first product stream to form a second product stream at a second junction; the second product stream being collected at the outlet port.
In certain embodiments, the injection device comprises a syringe pump configured to deliver one or more of: protamine or lipids or protamine/lipids or ODN solution.
In another broad aspect, there is provided herein a method of oligonucleotide-lipid nanoparticles, comprising: i) introducing a first fluid stream into a first inlet port; ii) introducing a second fluid stream into a second inlet port and a third fluid stream into a third inlet port, the second and third inlet ports being positioned on opposing sides of the first inlet port, the second and third fluid streams hydrodynamically focusing the first fluid stream into a narrow stream to form a first product stream at a first junction; and iii) introducing downstream of the first junction a fourth fluid stream into a fourth inlet port and a fifth fluid stream into a fifth inlet port, the fourth and fifth inlet ports being positioned downstream to and on opposing sides of the first junction, the fourth and fifth fluid streams hydrodynamically focusing the first product stream into a narrow stream to form a second product stream.
In certain embodiments, the first fluid stream comprises an oligonucleotide (ODN) solution; the second fluid comprises a protamine sulfate solution stream; the third fluid comprises a protamine sulfate solution stream; the first product stream comprises ODN/protamine nanoparticles formed via electrostatic interaction between negatively charged ODN and positively charged protamine sulfate; the fourth fluid stream comprises a lipid stream; the fifth fluid stream comprises a lipid stream; and the second product stream comprises ODN/protamine/lipids nanoparticles or lipopolyplexes.
In certain embodiments, the second product stream comprises nanoparticles having a final weight ratio of ODN:protamine:lipids of about 1:0.3:12.5 and an ethanol concentration about 30 to about 70%. In certain embodiments, the flow rates for ODN, protamine, and lipids streams are about 20, about 20, and about 450 μL/min, respectively, and, optionally, are controlled independently. In certain embodiments, the ODN and protamine were prepared in sodium citrate buffer (20 mM, pH 4), and the lipids mixture was in 100% ethanol.
In certain embodiments, the first fluid stream comprises a protamine/lipids mixture stream; the second fluid comprises a first oligonucleotide (ODN) stream; the third fluid comprises a second oligonucleotide (ODN) stream; the first product stream comprises ODN/protamine/lipids stream; the fourth fluid stream comprises a protamine/lipids stream; the fifth fluid stream comprises a protamine/lipids stream; and the second product stream comprises ODN/protamine/lipids nanoparticles or lipopolyplexes.
In certain embodiments, the second product stream comprises nanoparticles having a final weight ratio of ODN:protamine:lipids of about 1:0.3:12.5 and an ethanol concentration about 30 to about 70%. In certain embodiments, the flow rates for protamine/lipids, ODN, and protamine/lipids streams are about 200, about 20, and about 200 μL/min, respectively, and, optionally, are controlled independently.
In certain embodiments, the method includes where protamine (delivered via the second and third inlet ports, and lipids, delivered via the fourth and fifth inlet ports, or protamine/lipids streams, delivered via the second, third, fourth and fifth inlet ports, are injected first and thereafter the ODN stream is injected via the first inlet port.
In certain embodiments, the method includes where after the ODN stream has entered and the hydrodynamic focusing established, the products are flowed for a further period of time to allow for achieving a steady state before being collected at the outlet port.
In certain embodiments, the method includes where the magnitude of the hydrodynamic focusing is controlled by altering the flow rate ratio (FR) of the second and third streams to the first stream, wherein FR is the ratio of total flow rate to the first stream flow rate.
In certain embodiments, the method includes where programmable syringe pumps are used to control the fluid flow rates independently.
In certain embodiments, the method further includes treating the second product stream by vortexing and sonicating, followed by dialyzing against a buffer to raise the pH to neutral in order to remove unbound ODN, reduce ethanol, and to partially neutralize cationic DC-Chol.
A schematic illustration of one embodiment of an oligonucleotide-lipid nanoparticle 10 is shown in
The combinations of different types of oligonucleotides (e.g., combinations of two of more siRNA and/or miRNA), including different classes of oligonucleotides (e.g., antisense ODN combined with siRNA) in the same oligonucleotide-lipid nanoparticle provides a very effective delivery mechanism, which, until now, has never before been proposed.
The delivery of oligonucleotide combinations via co-loading into the lipid nanoparticles is especially useful and provides a synergistic interplay of the oligonucleotides. Using the oligonucleotide-lipid nanoparticles, there can now be formulated siRNA combinations that are effective in gene silencing in vitro that can be delivered using a single delivery mechanism.
The oligonucleotide-lipid nanoparticles are also useful for gene silencing since cholesterol-modified oligonucleotides can be used for gene silencing when incorporated as a component of the oligonucleotide-lipid nanoparticles.
The modified oligonucleotides have a very high (−100%) incorporation into oligonucleotide-lipid nanoparticles and the resulting particles are very compact in size (<200 nm in diameter).
In another broad aspect, there is provided herein a method for the synthesis of lipid nanoparticle compositions. The solvent injection/self assembly method of oligonucleotide-lipid nanoparticles synthesis is tunable and scalable and is uniquely suitable for large-scale production. The mechanism of oligonucleotide-lipid nanoparticles formation is based on electrostatic complexation and recruitment of lipids as surfactants.
The method described herein provides a synthetic strategy that successfully produces oligonucleotide-lipid nanoparticles with a desired particles size distribution and colloidal stability in the presence of serum. The tangential flow diafiltration method of removing solvent from the oligonucleotide-lipid nanoparticles formulation allows the process to be adapted to large-scale production of oligonucleotide-lipid nanoparticles for commercialization. By varying injection fluid velocity (or fluidic pressure), the process and the particle size can bed adjusted.
In one particular embodiment, the method includes: 1) dissolving one or more oligonucleotides in an aqueous buffer to form a first solution; 2) codissolving at least one lipid and at least one cationic polymer in a water miscible organic solvent, such as ethanol and tert-butanol with 0-40% of water, for forming a second solution; 3) injecting the second solution into the first solution under relatively high pressure to obtain a final solvent-to-water ratio ranging from about 30/70 to about 50/50 to form a third solution; whereby the oligonucleotide-lipid nanoparticles are formed; and, 4) removing solvent from the third solution. In certain embodiments, the removal step can be accomplished by using a tangential-flow diafiltration, for exchanging into an aqueous buffer and for adjusting the oligonucleotide-lipid nanoparticles to a desired concentration. The solvent injection and diafiltration method can be readily scaled up. Another advantage is that the method for making such oligonucleotide-lipid nanoparticles has a high recovery yield and a high encapsulation efficiency of the oligonucleotides by the lipids.
After the formation of the oligonucleotide-lipid nanoparticles, the lipid nanoparticles can be sterilized by filtration, for example, through a 0.2 micron membrane. Also, the process can include lyophilizing the oligonucleotide-lipid formulation. In certain embodiments, lyoprotectant, typically a disaccharide solution, such as 10-20% sucrose, can be included in the vehicle solution.
The oligonucleotide-lipid nanoparticles are useful when used in complexing or conjugating a targeting ligand to a lipid bilayer for “ligand conjugation,” or adding a lipid-conjugated targeting ligand followed by incubation for “post-insertion” of the ligand.
The formation of the oligonucleotide-lipid nanoparticles in this process is believed by the inventors herein to be based on electrostatic complexation and interfacial free energy reduction. The particle size is, at least in part, dependent on the velocity of liquid stream during the injection of the second solution into the first solution, as well as on the concentrations of the first and second solutions. At the time of the injection, the cationic polymer and/or cationic lipid rapidly form electrostatic complexes with the oligonucleotides (which carry anionic charges). These electrostatic complexes have diameters in the nanometer ranges, and possess high interfacial free energy (γ). In this process, the recruitment of neutral and PEGylated lipids (which are surfactants that can adsorb to the interface and reduce the high interfacial free energy (γ)) thus forming substantially uniform and stable lipid-coated nanoparticles of oligonucleotides.
The oligonucleotide-lipid nanoparticles have a greatly desired small particle size and excellent colloidal stability. The oligonucleotide-lipid nanoparticles have a low toxicity, a desirably long circulation time in vivo, and have a high target cell uptake and transfection efficiency.
These advantages will now be illustrated by the following non-limiting examples. The present invention is further defined in the following Examples, in which all parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. All publications, including patents and non-patent literature, referred to in this specification are expressly incorporated by reference.
The following examples are intended to illustrate certain preferred embodiments of the invention and should not be interpreted to limit the scope of the invention as defined in the claims, unless so specified.
Oligonucleotide-lipid nanoparticles were formed, as shown in Table 1 below.
Oligonucleotide-lipid nanoparticles were formed, as shown in Table 2 below.
A study of the cytotoxicity of the oligonucleotide-lipid nanoparticles was conducted.
A study of the colloidal stability of the oligonucleotide-lipid nanoparticles was conducted.
A study of the pharmacokinetics of the oligonucleotide-lipid nanoparticles that were loaded with fluorescent ODNs was conducted.
A study of the biodistribution of the oligonucleotides in the oligonucleotide-lipid nanoparticles in nude mice carrying K562 xenograft tumors was conducted.
A study of the biodistribution of the oligonucleotides in the oligonucleotide-lipid nanoparticles in the plasma levels of nude mice carrying K562 xenograft tumors was conducted.
While not wishing to be held merely to the following, the Examples of Uses herein provide evidence of the wide applicability of the present invention.
Antisense oligonucleotide G3139-mediated down-regulation of Bcl-2 is a potential strategy for overcoming chemoresistance in leukemia. However, the limited efficacy shown in recent clinical trials calls attention to the need for further development of novel and more efficient delivery systems. In order to address this issue, transferrin receptor (TfR)-targeted, protamine-containing lipid nanoparticles (Tf-LNs) were synthesized as delivery vehicles for G3139. The LNs were produced using an ethanol dilution method and a lipid-conjugated Tf ligand was then incorporated by a post-insertion method.
The resulting Tf-LNs had a mean particle diameter of −90 nm, G3139 loading efficiency of 90.4%, and showed a spherical structure with one to several lamellae when imaged by cryogenic transmission electron microscopy. Antisense delivery efficiency of Tf-LNs was evaluated in K562, MV4-11 and Raji leukemia cell lines. The results showed that Tf-LNs were more effective than non-targeted LNs and free G3139 (p<0.05) in decreasing Bcl-2 expression (by up to 62% at the mRNA level in K562 cells) and in inducing caspase-dependent apoptosis. In addition, Bcl-2 down-regulation and apoptosis induced by Tf-LN G3139 were shown to be blocked by excess free Tf and thus were TfR-dependent. Cell lines with higher TfR expression also showed greater Bcl-2 down-regulation. Furthermore, up-regulation of TfR expression in leukemia cells by iron chelator deferoxamine resulted in a further increase in antisense effect (up to 79% Bcl-2 reduction in K562 at the mRNA level) and in caspase-dependent apoptosis (by ˜3-fold) by Tf-LN. Tf-LN mediated delivery combined with TfR up-regulation by deferoxamine appears to be a potentially promising strategy for enhancing the delivery efficiency and therapeutic efficacy of antisense oligonucleotides.
Antisense oligonucleotides, typically of 15-20 nucleotides in length, are designed to target specific mRNA sequences through Watson-Crick hybridization, resulting in the destruction or disablement of the target mRNA. G3139 (oblimersen sodium, Genasense™) is an 18-mer phosphorothioate oligonucleotide targeting the anti-apoptotic protein Bcl-2. Since Bcl-2 is frequently overexpressed in tumor cells and is implicated in drug resistance, down-regulation of Bcl-2 using G3139 can potentially restore chemosensitivity in leukemia cells. Combinations of G3139 with chemotherapeutics have recently been studied for the treatment of acute myelogenous leukemia (AML) and chronic lymphocytic leukemia (CLL). However, clinical efficacy of G3139 has been shown to be limited, believed to be due to the rapid clearance of G3139 from blood circulation by metabolism and excretion, as well as the low permeability of the drug across the cellular membrane. Although the phosphorothioate backbone of G3139 renders it less sensitive to nucleases, other remaining obstacles in the G3139 delivery pathway still need to be overcome.
Example A, describes a oligonucleotide carrier, Tf-LNs, which incorporated Tf as targeting ligand and protamine as an oligonucleotide complexing agent. The Tf-LNs show excellent physiochemical properties and oligonucleotide delivery efficiency. The Tf-LNs, loaded with G3139, were evaluated for Bcl-2 downregulation and pro-apoptotic activities in leukemia cell lines. Tf-LNs were shown to have high efficiency and TfR specificity in delivery of G3139 and effectively reduced Bcl-2 expression and increased cell apoptosis among leukemia cells. Furthermore, the delivery efficiency via Tf-LNs was further enhanced by deferoxamine, which up-regulated TfR expression on leukemia cells.
Reagents. 3β-[N-(N′,N′-dimethylaminoethane)-carbamoyl] cholesterol (DC-chol), egg phosphatidylcholine (egg PC) and distearoyl phosphatidylethanolamine-N-[maleimide-polyethylene glycol, MW 2000] (Mal-PEG2000-DSPE) were purchased from Avanti Polar Lipids (Alabaster, Ala.). Methoxy-PEG2000-DSPE (PEG2000-DSPE) was purchased from Genzyme Corporation (Cambridge, Mass.). Human holo-transferrin (Tf), 2-iminothiolane (Traut's reagent), protamine sulfate, and other chemicals were purchased from Sigma Chemical Co. (St. Louis, Mo.). All tissue culture media and supplies were purchased from Invitrogen (Carlsbad, Calif.).
Antisense oligonucleotides. All oligonucleotides used in this example were fully phosphorothioated. G3139 (5′-TCT CCC AGC GTG CGC CAT-3′) [SEQ ID NO: 1] and its fluorescence-labeled derivative, G4243 (FITC-G3139).
Cell culture. All leukemia cell lines were cultured in RPMI 1640 media supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen), 100 U/mL penicillin, 100 μg/mL streptomycin, and L-glutamine at 37° C. in a humidified atmosphere containing 5% CO2.
Preparation of Tf-conjugated G3139-containing LNs (Tf-LNs). The ethanol dilution method illustrated in
The pre-LN complexes were then dialyzed against citrate buffer (20 mM, pH 4) at room temperature for 2 hours and then against HEPES-buffered saline (HBS, 20 mM HEPES, 145 mM NaCl, pH 7.4) overnight at room temperature, using a MWCO 10,000 Dalton Spectra/Por Float-A-Lyzer (Spectrum Labs, Rancho Dominguez, Calif.) to remove free G3139 and to adjust the pH to the physiological range.
A post-insertion method was used to incorporate lipid-conjugated Tf ligand into G3139-loaded LNs. Briefly, holo-(diferric)Tf in HEPES-buffered saline (HBS, pH 8, containing 5 mM EDTA) was reacted with 5× Traut's reagent to yield holo-Tf-SH. Free Traut's reagent was removed by dialysis using a MWCO 10,000 Dalton Float-A-Lyzer and against MS. Holo-Tf-SH was coupled to micelles of Mal-PEG2000-DSPE at a protein-to-lipid molar ratio of 1:10. The resulting Tf-PEG2000-DSPE micelles were then incubated with the G3139-loaded LNs for 1 hour at 37° C. at Tf-PEG2000-DSPE-to-total lipid ratio of 1:100. For synthesis of fluorescence-labeled LNs, G3139 was spiked with 10% fluorescent oligonucleotide FITC-G3139. As a reference control, protamine-free liposomal G3139 (Lip-G3139) and Tf-Lip-G3139 were also prepared using essentially the same procedure except for omission of protamine from the formulation and an increase in DC-Chol content to maintain the overall cationic/anionic charge ratio.
The number of bound Tf per LN (molecules per vesicle) was calculated on the basis of the equation (A/B)C, where A, B and C represent the total number of Tf molecules in a LN suspension, the total number of lipid molecules in a LN suspension, and the number of lipid molecules per LN, respectively. The particle size of Tf-LNs was analyzed on a NICOMP Particle Sizer Model 370 (Particle Sizing Systems, Santa Barbara, Calif.). The zeta potential (ξ) of the LNs was determined on a ZetaPALS (Brookhaven Instruments Corp., Worcestershire, N.Y.). All measurements were carried out in triplicates.
G3139 entrapment efficiency. G3139 concentration was determined by dissolution of the LNs using 0.5% SDS followed by fluorometry to determine fluorescence derived from FITC-G3139, using excitation at 488 nm and emission at 520 nm. G3139 concentration was calculated based on a standard curve of fluorescence intensity versus oligonucleotide concentration. Loading efficiency of G3139 in the LNs was calculated based on the ratio of G3139 concentration in the LN preparation before and after dialysis.
Cryogenic transmission electron microscopy (cryo-TEM). Vitrified specimens for cryo-TEM imaging were prepared in a controlled environment vitrification system (CEVS) at 25° C. and 100% relative humidity. A drop of the liquid to be studied was applied onto a perforated carbon film, supported by a copper grid and held by the CEVS tweezers. The sample was blotted and immediately plunged into liquid ethane at its melting point (−183° C.). The vitrified sample was then stored under liquid nitrogen (−196° C.) and examined in a Philips CM120 YEM microscope (Eindhoven, The Netherlands), operated at 120 kV, using an Oxford CT-3500 cooling-holder (Abingdon, England). Specimens were equilibrated in the microscope at about −180° C., examined in the low-dose imaging mode to minimize electron beam radiation damage, and recorded at a nominal underfocus of 4-7 μm to enhance phase contrast. Images were recorded digitally by a Gatan 791 MultiScan CCD camera, and processed using the Digital Micrograph 3.1 software package. Further image processing was performed using the Adobe PhotoShop 5.0 package.
Colloidal and serum stability of Tf-LNs. The colloidal stability of Tf-LNs was evaluated by monitoring changes in the mean particle diameter during storage at 4° C. To evaluate the ability of the Tf-LNs to retain G3139 and protect it against nuclease degradation, the formulation was mixed with FBS at a 1:4 (v/v) ratio and incubated at 37° C. At various time points, aliquots of each sample were loaded onto a urea-polyacrylamide gel (Invitrogen). Electrophoresis was performed and G3139 bands were visualized by SYBR Gold (Invitrogen) staining. The densities of G3139 band were measured and analyzed by the ImageJ software.
Cellular uptake of Tf-LN G3139. Cellular uptake of Tf-targeted LNs and non-targeted control LNs, loaded with G3139 spiked with 10% fluorescent oligonucleotide FITC-G3139, was evaluated in MV4-11 cells. For the studies, 4×105 cells were incubated with 1 μM G3139 entrapped in Tf-LNs at 37° C. After 4-hour incubation, the cells were washed three times with PBS, by pelleting of the cells at 1,000×g for 3 minutes, aspiration of the supernatant, followed by re-suspension of the cells in PBS. The cells were examined on a Nikon fluorescence microscope (Nikon, Küsnacht, Switzerland), or stained by 4′,6-diamidino-2-phenylindole (DAPI), a nuclear counterstain, and then examined on a Zeiss 510 META Laser Scanning Confocal microscope (Carl Zeiss Inc., Germany). G3139 uptake in leukemia cells was measured by flow cytometry on a FACSCalibur flow cytometer (Becton Dickinson, Franklin Lakes, N.J.).
Measurement of TfR expression on cell surface. TfR expression levels in leukemia cell lines were analyzed based on cellular binding of FITC-Tf determined by flow cytometry. Briefly, 4×105 leukemia cells were washed with RPMI media containing 1% BSA and then incubated with 200 μg/ml FITC-Tf at 4° C. for 30 minutes. The cells were then washed twice with cold PBS (pH 7.4) containing 0.1% BSA, by pelleting of the cells at 1,000×g for 3 minutes, aspiration of the supernatant, followed by re-suspension of the cells in PBS. Finally, cellular fluorescence was then measured by flow cytometry.
Transfection studies. Leukemia cells were plated in 6-well tissue culture plates at 106/well in RPMI 1640 medium containing 10% FBS. An appropriate amount of Tf-LNs or control formulations was added into each well to yield a final G3139 concentration of 1 μM. After 4-hour incubation at 37° C. in a CO2 incubator, the cells were transferred to fresh medium, incubated for another 48 hours, and then analyzed for Bcl-2 mRNA level by real-time RT-PCR, for Bcl-2 protein level by Western blot, and for apoptosis by measuring caspase-9 activity, respectively.
Quantification of Bcl-2 mRNA level by Real-time RT-PCR. The bcl-2 mRNA level in leukemia cells was evaluated using real time RT-PCR, as previously described.27 Briefly, total RNA was extracted using Trizol reagent (Invitrogen) and cDNA was synthesized by incubating RNA with random hexamer primer (Perkin Elmer, Boston Mass.), and then with reverse transcriptase (Invitrogen), reaction buffer, dithiothreitol, dNTPs and RNAsin, followed by incubation at 42° C. for 60 minutes and 94° C. for 5 minutes in a thermal cycler (Applied Biosystems, Foster City, Calif.). The resulting cDNA was amplified by real-time PCR (ABI Prism 7700 Sequence Detection System, Applied Biosystems) using bcl-2 primers and probes (forward primer CCCTGTGGATGACTGAGTACCTG [SEQ ID NO:2]; reverse primer CCAGCCTCCGTTATCCTGG [SEQ ID NO:3]; probe CCGGCACCTGCACACCTGGA [SEQ ID NO:4]). Housekeeping gene ABL mRNAs were also amplified concurrently and to which Bcl-2 mRNA were normalized.
Quantification of Bcl-2 protein by Western blot. Western blot was carried out. Briefly, untreated and G3139-treated cells were harvested at 24 or 48 hours after transfection and whole cellular lysates were prepared by lysing the cell in 1× cell lysis buffer containing a protease inhibitor cocktail (CalBiochem, San Diego, Calif.). Approximately 20 μg of cellular protein was used for immunoblotting using a monoclonal murine anti-human Bcl-2 (Dako, Carpinteria, Calif.) antibody. Bcl-2 protein expression levels were quantified by ImageJ software and were normalized to the β-actin levels from the same samples.
Analysis of apoptosis by caspase activation. To analyze cellular apoptosis, caspase-9 activities were measured on untreated and Tf-LN-G3139-treated cells using the caspase Glo-9 assay kit (Promega). Briefly, 5×103 cells were plated in a white-walled 96-well plate, and the Z-DEVD reagent, a luminogenic caspase-9 substrate, was added with a 1:1 ratio of reagent to cell solution. After 90 minutes at room temperature, the substrate was cleaved by activated caspase-9, and the intensity of a luminescent signal was measured by a Fluoroskan Ascent FL luminometer (Thermo Electron Corp.). Differences in caspase-9 activity in Tf-LN-G3139-treated cells compared with untreated cells were determined by fold-change in luminescence.
Statistical analysis. Data obtained were represented as mean±standard deviations (S.D.). Comparisons between groups were made by 2-tailed Student's t-tests using the MiniTAB software (Minitab Inc., State College, Pa.). p<0.05 was used as the cutoff for defining statistically significant differences.
Physical chemical properties of the Tf-LNs. In order to increase the efficiency and specificity of G3139 delivery, Tf-LNs were synthesized.
Particle size values, zeta potential values, and G3139 entrapment efficiencies of LN formulations are presented in Table 3. The particle size and zeta potential of LNs with protamine were 78.1 nm and 5.7 mV and those of G3139-entrapping liposomes without protamine (Lips) were 112.5 nm and 2.0 mV, respectively. This showed that addition of protamine into the formulation resulted in a reduced particle size. Incorporation of Tf into LNs by post-insertion increased the particle size to 90.2 nm but did not significantly alter the zeta potential. The density of Tf on the resulting Tf-LN was estimated to be ˜46 Tf molecules per particle. The G3139 entrapment efficiencies of the formulations were also determined. The G3139 entrapment efficiency of LN and Tf-LN were 95.9±0.1% and 90.4±0.7%, respectively. These values were significantly greater than those for Lips and Tf-Lips without protamine, which were 76.1±0.2% and 71.9±1.1%, respectively. These results indicated that the incorporation of protamine in the formulation also increased the G3139 entrapment efficiency, whereas the insertion of Tf had only a minor effect on the G3139 entrapment efficiency.
78.1 ± 3.4
aData represent the mean ± SD;
bp < 0.05 vs LN group
The morphology of Tf-LNs was determined by cryoTEM. As shown in
Colloidal and serum stability of Tf-LNs. The colloidal stability of G3139-loaded Tf-LNs was evaluated by monitoring changes in the mean diameter during storage in HBS buffer at 4° C. It was found that the LNs and Tf-LNs remained stable and no significant particle size changes were observed for 12 weeks at 4° C. (
To evaluate the ability of the Tf-LNs both to retain G3139 and to protect it from degradation by nucleases, the formulations were incubated in FBS at 37° C. At various time points, samples were collected and analyzed by urea-polyacrylamide gel electrophoresis. As shown in
Cellular uptake of Tf-LN-G3139. Cellular uptake of Tf-LN-G3139, containing 10% fluorescent FITC-G3139, was evaluated in MV4-11 cells. By confocal microscopy, it was found that, after 15-minute incubation, most of the G3139 was bound to the cellular membrane. At 1 hour, the Tf-LNs were mostly internalized (
Tf-LN G3139 was efficiently internalized by the cells and the level of uptake was much higher than that of free G3139 (
As a non-targeted control, delivery of G3139 via LNs was also evaluated. LN G3139 exhibited lower uptake compared to the Tf-LNs, showing that the enhancement of G3139 cellular uptake via Tf-LN was due to the presence of Tf ligands on the surface of LNs. In addition, Tf-LN mediated delivery was shown to be blocked by excess free holo-Tf (
Tf-LN-G3139 mediated Bcl-2 down-regulation. TfR expression on leukemia cell lines K562, MV4-11 and Raji, with or without deferoxamine treatment are shown in
As shown in
Tf-LNs containing G3139 exhibited pronounced effect on cell apoptosis. Having demonstrated knockdown of the anti-apoptotic protein Bcl-2, we next sought to determine the effect of Tf-LNs containing G3139 on cellular apoptosis. Leukemia K562 cells were treated with the Tf-LNs. We observed, by confocal microscopy, that G3139 accumulated inside the cells after 1-hour treatment. At 240 minutes, nuclei in some of the cells were fragmented, indicating the occurrence of apoptosis in these cells (
TfR-targeted LNs exhibit colloidal stability and have high efficiency and selectivity in G3139 delivery to leukemia cells. The LNs incorporated both protamine and lipids. Tf was incorporated to provide TfR-mediated leukemia cell targeting. These nanoparticles were shown to efficiently deliver G3139 to TfR-positive leukemia cells, as shown by effective down-regulation of Bcl-2.
The lipid composition used in Example A was egg PC/DC-Chol/PEG2000-DSPE (molar ratio 65/30/5). The utilizations of both protamine and DC-Chol as positive charged components ensured high G3139 loading efficiencies. During LN assembly, G3139 was mixed with protamine and cationic lipids. The faster diffusion rate and charge density of protamine compared to Lips, allows the ODN to first interact with protamine, to form the pre-LN complexes, which resulting complexes are then stabilized by a further coating of the lipids to form the lipid oligonucleotide nanoparticles (LNs). The targeting ligand formed as micelles of Tf-PEG-DSPE, which are introduced by post-insertion, are then distributed on the surface of the nanoparticles. In this process, the micelles are disassembled and their components are incorporated into the bilayers of the LNs.
When the pH is adjusted to 7.5 upon removal of EtOH by dialysis, the head group of DC-Chol became partially deprotonated. The zeta potential of the resulting LNs following dialysis was low (5.7 mV).
The resulting LNs have excellent colloidal stability, which is believed by the inventors herein to be due to the high DNA binding activity of protamine and surfactant characteristics of the lipids. In this example, the PEG2000-DSPE in the formulation provides steric stabilization of the LNs. Also, Tf conjugate may also contribute to LN stability in serum by shielding them from interactions with plasma proteins.
Pre-mixing of the complexing agent (here protamine) with the lipids provides the desired small particle formation. It is to be noted that G3139/protamine complexes in the absence of lipids undesirably aggregate over time. In addition, pre-mixing of protamine with G3139 and then adding this mixture into the lipids also resulted in unstable particles that aggregated over time. Using the process described herein, the G3139 encapsulation efficiencies were 95.9% and 90.4% for LN and Tf-LN, respectively. Therefore, the LN formulation is much superior to protamine-oligonucleotide and lipid-oligonucleotide complexes both in terms of DNA loading efficiency and colloidal stability.
To investigate G3139 delivery efficiency via Tf-LNs, Bcl-2 down-regulation was evaluated in 3 different leukemia cell lines (K562, MV4-11 and Raji), followed by the measurement of caspase-dependent apoptosis in K562 cells. TfR expression level was found to be an important factor in determining the efficiency of G3139 delivery by Tf-LNs. Deferoxamine, a clinically used iron chelator for the treatment of secondary iron overload, is known to up-regulate TfR expression in cells. Therefore, deferoxamine should increase TfR-targeting efficiency of the Tf-LNs. This was confirmed by the enhanced Bcl-2 down regulatory activities of the deferoxamine-treated leukemia cells by Tf-LNs. Positive correlation between Bcl-2 down-regulation by Tf-LN and enhancement of TfR expression by deferoxamine suggests a potentially promising novel strategy for enhancing delivery and therapeutic efficacy of antisense oligonucleotides.
Example A thus shows that a stable, TfR-targeted LN formulation encapsulating antisense G3139 exhibits excellent G3139 loading efficiency and colloidal stability and the G3139 is protected against degradation by serum nucleases. Tf-LNs showed efficient delivery of G3139 to TfR-positive leukemia cells, which can be blocked by excess free Tf. Deferoxamine treatment increased TfR expression and enhanced the transfection activity of Tf-LNs. Combining defeoxamine pretreatment with Tf-LN mediated delivery is a promising strategy for targeted delivery of G3139 and other antisense drugs to leukemia cells.
In Example B, lipid nanoparticles (LNPs) encapsulating G3139 were synthesized and evaluated in mice bearing L1210 subcutaneous tumors. Intravenous injection of G3139-LNPs into mice led to increased serum levels of IL-6 and IFN-γ, promoted proliferation of natural killer (NK) cells and dendritic cells (DCs), and triggered a strong anti-tumor immune response in mice. The observed effects were much greater than those induced by free G3139. Correspondingly, the G3139-LNPs more effectively inhibited tumor growth and induced complete tumor regression in some mice. In contrast, free G3139 was ineffective in tumor growth inhibition and did not prolong survival of the tumor bearing mice. These results show that G3139-LNPs are a potential immunomodulatory agent and may have applications in cancer therapy.
The LNPs prolonged plasma half-life and tumor accumulation of G3139, showing that intravenously injected G3139-LNPs (rather than free G3139) can effectively activate innate immune system cells in a way that results in a potent anti-tumor immune response and tumor growth inhibition.
Materials. 313-[N,N-(Dimethylaminoethane)-carbamoyl]-cholesterol (DC-Chol), egg yolk phosphatidylcholine (PC), and distearoylphosphatidylethanolamine-N-[methoxy(polyethylene glycol)-2000] (m-PEG2000-DSPE) were purchased from Avanti Polar Lipids (Alabaster, Ala.). Protamine sulfate was purchased from Sigma Chemical Co. (St. Louis, Mo.). 5-Bromo-2′deoxyuridine (BrdU) Flow Cytometry Assay kit was obtained from BD Pharmingen (San Diego, Calif.).
Oligonucleotides G3139 (5′-TCT CCC AGC GTG CGC CAT-3′) [SEQ ID NO:1], G4243 (FAM-G3139, with a 5′-fluorescein label), and control ODNs G4126 (5′-TCT CCC AGC ATG TGC CAT-3′) [SEQ ID NO:5] (2 nucleotides different from G3139 and containing no CpG motifs).
Phycoerythrin (PE)-, fluorescein isothiocyanate (FITC)-, Allophycocyanin (APC)-, and (PE-Cy7)-conjugated monoclonal antibodies (mAbs), including PE-Cy5.5-CD4, APC-CD8, APC-NK-DX5, PE-CD3e, PE-INF-7 were purchased from BD Pharmingen (San Diego, Calif.). Anti-CD112 and anti-CD40 MAbs were purchased from BioExpress (West Lebanon, N.H.).
Cell culture. Human KB cell line, which has been identified as a subline of human cervical cancer HeLa cell line, was obtained as a gift from Dr. Philip Low (Purdue University, West Lafayette, Ind.). L1210, a murine lymphocytic leukemia cell line, were kindly provided by Dr. Manohar Ratnam (University of Toledo, Toledo, Ohio). Cells were cultured in RPMI 1640 medium supplemented with 100 units/mL penicillin, 100 μg/mL streptomycin, and 10% FBS in a humidified atmosphere containing 5% CO2 at 37° C.
Preparation of ODN-Lipid nanoparticles (ODN-LNPs). LNPs, composed of DC-Chollegg PC/mPEG2000-DSPE (35:60:5, mole/mole), protamine and ODN, were prepared by EtOH dilution followed by tangential flow diafiltration (
The particle size of the LNPs was determined by dynamic light scattering via Nicomp model 370 Submicron Particle Sizer (Particle Sizing Systems, Santa Barbara, Calif.). The zeta potential (ξ) of the LNPs was measured on a Brookhaven 90plus Particle Analyzer (Holtsville, N.Y.).
To evaluate ODN encapsulation, FITC labeled G3139 (G4243) was used instead of G3139 to enable fluorometric measurements of ODN concentration. To determine ODN content, LNPs were lysed by 1% SDS at 95° C. for 5 min and were centrifuged at 12,000×g for 5 min. The ODN concentration in the LNPs was determined by measuring fluorescence value obtained from supernatant of LNP lysate with a spectrofluorometer (Perkin-Elmer) at excitation and emission wavelengths of 495 and 520 nm, respectively, based on a pre-established standard curve. Encapsulation efficiency was calculated based on ODN concentration in the lysate divided by ODN concentration added.
Western blot for Bcl-2. The Bcl-2 downregulatory effect of G3139-LNPs was evaluated in KB and L1210 cells. Cells were treated by lysis buffer 72 hr after treatment. From the lysate 100 μg proteins was loaded on a 15% SDS-PAGE gel (Bio-Rad, Hercules, Calif.) and run for 2 hr at 100 V, followed by transferring to a nitrocellulose membrane overnight. After blocking with 5% non-fat milk in Tris-buffered saline/Tween-20 (TBST) for 2 hr, the membranes were incubated with murine anti-human Bcl-2 antibody (Dako, Carpinteria, Calif.) for studies on KB cells or hamster anti-mouse Bcl-2 antibody (BD Pharmingen, San Diego, Calif.) for studies on murine L1210 cells, respectively. After 2 hr of incubation at room temperature, membranes were the treated with horseradish peroxidase-conjugated sheep anti-mouse IgG antibody (GE Health, Piscataway, N.J.) for KB cell or murine anti-hamster IgG antibody (BD Pharmingen, San Diego, Calif.) for L1210 cell for 1 hr at room temperature. Membranes were then developed with Pierce SuperSignal West Dura Extended Duration Substrate (Pierce, Rockford, Ill.) and imaged with Kodak X-OMAT film (Kodak, Rochester, N.Y.). Bcl2 protein expression levels were quantified by ImageJ software (NIH Image, Bethesda, Md.) and normalized to the β-actin levels from the same samples.
In vivo assay for plasma clearance and tumor accumulation of ODN-LNP. Female DBA/2 mice (H-2d), 8 wks old, were purchased from Harlan (Indianapolis, Ind.). To evaluate in vivo plasma clearance and tumor accumulation of ODN-LNPs, G4243 (fluorescein labeled G3139) or G4243-LNPs were administered at 5 mg/kg ODN dose by tail vein injection. At appropriate time points, mice were anesthetized and blood was collected via the tail vein and into heparinized tubes. Plasma was separated from red blood cells via immediate centrifugation at 1000×g for 5 min. Mice were sacrificed by carbon dioxide asphyxiation. Tumors were harvested at various time points and homogenized in microtubes containing 500 μL distilled water. Samples were then treated with 1% SDS, and heated at 95° C. for 5 min, followed by centrifugation at 12,000×g for 5 min. The fluorescence of supernatant was determined by spectrofluorometry to determine sample ODN concentration, as described above. WinNonlin Version 3.2 (Pharsight Co., CA) was used to determine pharmacokinetic parameters, including area under the curve (AUC), total body clearance (CL) and plasma half-life.
Cytokine production and cell proliferation. To determine serum INF-γ and IL-6 levels, blood was collected from the tail vein of mice at various time points after i.v. injection of G3139-LNPs, free G3139, empty LNPs, or non-CpG containing G4126-LNPs. Three mice were used in each treatment group. The blood samples were kept at room temperature for 30 min and then centrifuged at 12000×g to harvest serum. The levels of cytokines were determined by ELISAs using commercial kits (BD Pharmingen, San Diego, Calif.).
In vivo immune cell proliferation was evaluated by BrdU incorporation assay. BrdU (10 mg/mL) was injected i.p. into mice at 1 or 6 days after treatment. Three mice were used in each group. Splenocytes were harvested from the mice 24 hr after the BrdU administration, and were surface-stained using fluorescence-labeled mAbs to CD4, CD8, CD3 and/or CD49b (DX5), followed by intracellular staining with mAb to BrdU as instructed by the manufacturer (BD Biosciences). Then the cells were washed twice in perm/wash solution and were resuspended in 300 μL of FACS buffer for flow cytometry analysis. Data were acquired on a Becton Dickinson FACSCalibur (Becton Dickinson) and analyzed using the FlowJo software (Tree Star, Ashland, Oreg.). In a typical assay, 100,000 events were acquired for analysis.
Histopathological and immunohistochemical (IHC) analyses. For pathological analysis, tumor samples were fixed in 10% phosphate buffered formalin solution. The tissue sections were stained with hematoxylin and eosin (H&E). For IHC analysis, tumor samples were frozen and prepared as described previously. Briefly, samples were fixed and washed with ice-cold PBS (pH 7.4) and stained with rat mAbs against CD4, CD8, or CD122, (2 μg/mL in PBS for 1 hr at 4° C.) followed by staining with horseradish peroxidase-conjugated rabbit anti-rat IgG.
Evaluation of anti-tumor activity. L1210 cells (5×106) were subcutaneously inoculated into the flank of syngeneic DBA/2 mice. Palpable tumors developed within 4-5 days after inoculation. At 7 days post inoculation, the tumor-bearing mice were injected i.v. with PBS (pH 7.4), free ODN (G3139), empty LNPs, G3139-LNPs or non-CpG containing G4126-LNPs (1.5 mg/kg or 5 mg/kg dose of ODN) on every 4th days (Q4D). Five mice were used in each treatment group. Anti-tumor activity was determined by measuring the tumor size (width and length) using a Vernier caliper at a series of time points. Tumor volume was calculated by the formula: tumor volume=(n16)×length (mm)×[width (mm)]2. Mice were sacrificed once the tumor size reached greater than 1500 mm3.
Statistical analysis. Statistical analysis was performed with Analysis of Variance (ANOVA) or Student's t test and by JMPT™ software, where appropriate. Differences in survival of mice among treatment groups were analyzed using the log-rank test. A p value of <0.05 was considered significant.
LNPs showed prolonged plasma half-life and increased G3139 accumulation in tumors. G3139-LNPs and G4243-LNPs were prepared by the EtOH dilution/diafiltration method. At a high EtOH concentration, the lipids form a metastable bilayer structure, which enables efficient ODN loading in the nanoparticle. In the subsequent dilution and diafiltration steps, EtOH concentration is gradually decreased, thus resulting in a “sealing off” of the lipid bilayers. The particle sizes changed with EtOH concentration in each step (
After removal of excess EtOH, the protocol yielded small ODN-LNPs with a mean diameter of 89±45.6 nm, encapsulation efficiency of >95%, and zeta potential of 4.08±0.4 mV. G3139-LNPs and G4243-LNPs had essentially identical characteristics.
The circulation time of LNP-encapsulated ODNs was evaluated by measuring plasma clearance of G4243-LNPs (G4243 is fluorescein-labeled G3139) in L1210 tumor bearing DBA/2 mice. At 24 hr after intravenous administration, ˜25% of the injected G4243-LNPs remained in the plasma, yielding a plasma half-life of about 8 hr (
aData generated by WinNonlin. Standard errors were shown in parenthesis as (CV %)
These data show that the G4243-LNPs had a greatly prolonged blood circulation time and decreased elimination rate. The accumulation of G4243-LNPs in tumor tissue was also significantly enhanced. The G4243-LNPs level in tumor was at 6.9 μg ODN/g tumor tissue at 24 hr after i.v. bolus administration (
G3139-LNPs did not induce Bcl-2 down-regulation in murine L1210 Cells. G3139 is an antisense ODN designed for targeting the human Bcl-2. Against murine Bcl-2, G3139 has a two nucleotides mismatch. The effects of G3139 on Bcl-2 expression were evaluated in human KB and in murine L1210 cells. The cells were incubated with either G3139 or G3139-LNPs for 72 hrs and were harvested for Western-blot analysis of Bcl-2 protein expression. As shown in the
G3139-LNPs inhibited tumor growth. The G3139-LNPs were studied for therapeutic efficacy in mice with established solid tumors. A tumor model was established with DBA/2 mice, which were injected subcutaneously with syngeneic L1210 tumor cells. The mice developed solid tumors of ˜30 mm3 within 7 days, which reached sizes >1500 mm3 within 1 month in the absence of treatment. For the therapeutic study, the mice were injected i.v. with 100 μL of G3139-LNPs every 4 days started from day 7 post inoculation. The mice of control groups were injected i.v. with the same volume of PBS (pH 7.4), empty LNPs, free G3139, or non-CpG containing G4126-LNPs. As shown in
In contrast, the mice treated with free G3139 (1.5 mg/kg) did not respond. For this group, the tumor size were comparable to the mice treated with PBS, empty LNPs, or G4126-LNPs (
To determine whether the antitumor effect of G3139-LNPs was dose-dependent, we treated tumor-bearing mice with either 1.5 mg/kg (low dose) or 5 mg/kg (high dose) of G3139-LNPs or free G3139. Neither dosing levels of free G3139 produced antitumor activities (
G3139-LNPs potently activated innate immune system Cells. Since CpG-ODNs stimulate innate immune responses, we examined cytokine production and innate immune cell proliferation in mice treated with G3139-LNPs. The levels of IL-6 and IFN-γ were evaluated in the peripheral blood because these are important for the induction of Th17 and ml responses, respectively. DBA/2 mice were injected i.v. with 1.5 mg/kg of G3139, G3139-LNPs, non-CpG containing G4126-LNPs or empty LNPs. The serum levels of IL-6 and IFN-γ were determined by ELISA after 4 and 8 hour of injection, respectively (
The splenocytes from the mice treated with G3139-LNPs produced more cytokines, including IFN-γ, IL-2, IL-4 and IL-10, than those treated with free G3139 or empty LNPs, as shown by immunohistochemical staining of spleen (
In addition to cytokine production, G3139-LNPs also promoted immune cell proliferation. LNP-treated mice showed significantly enlarged spleens and increased spleen cells at 7 days after treatment. The effect was much more pronounced compared to in mice treated with G3139 (p=0.0017) or empty LNPs (p<0.0001) (
To verify that the expansion of the spleen cells was associated with proliferation of innate immune cells, such as NK and dendritic cells (DCs), we examined BrdU incorporation by these cells. BrdU, an analog of thymidine, can replace thymidine during cell division, and has been widely used for quantification of cell proliferation, especially in vivo. The mice bearing L1210 tumors were treated with G3139-LNPs, G3139 or LNPs for 2 days, and BrdU was administered i.p. The mice were then sacrificed 24 hrs later and analyzed.
As shown in
The effect of G3139-LNPs on adaptive anti-tumor immunity. Since activation of innate immune cells can induce adaptive immunity, we further characterized the adaptive immunity in the tumor-bearing mice treated with G3139-LNPs. Since the IFN-γ-mediated adaptive immune response is important for anti-tumor immunity, we examined IFN-γ-production by CD4+ and CD8+T cells in the spleen of the mice at day 2 and 7 after treatment. At day 2 post-treatment, IFN-γ-producing cells among CD4+ and CD8+T cells were scarce in the tumor-bearing mice regardless of the agents used for treatment (up to about 5%). On the day 7 of treatment, IFN-γ-producing cells were significantly increased among CD8+, but not CD4+T cells. Importantly, G3139-LNPs were much more potent in inducing IFN-γ production by CD8+T cells (26.84%), compared to G3139 (19.42%) and empty LNPs (10.38%) (
There was no significant change of the INF-γ expression in CD4+ cells on either day 2 (3.16%) or day 7 (5.73%) after treatment with G3139-LNPs. These findings show that G3139-LNPs can induce an adaptive immune response that shifts to type 1 with an increase in INF-γ-producing CD8+ cytotoxic T cells (CTLs). This was further supported by identification of a large number of CD4+ and CD8+T cells in the tumors. Since tumor regression was observed in the mice treated with G3139-LNPs started from day 4 to 7 post treatment, the frozen tumor sections from the mice treated with G3139-LNPs, G3139, or LNPs for 7 days were analyzed by immunohistochemistry (IHC) for the infiltrated CD4+, CD8+ and CD122+ cells. As shown in
In addition, more CD122+ cells were detected in the tissue sections of tumors from the mice treated with G3139-LNPs than those from the mice treated with G3139 or LNPs, although the number of infiltrating CD122+ cells was much lower than those of CD4. and CD8+ cells in the same group (
The LNPs encapsulating ODN were produced by an EtOH dilution/diafiltration method. The ODN were efficiently loaded into LNPs by EtOH dilution/diafiltration method, and G3139 was encapsulated into LNPs which dramatically changed its plasma clearance profile and enhanced its immunostimulatory effects.
DC-Chol as the cationic lipid and incorporation of PEG-DSPE into the LNPs aided in providing long circulation time and serum stability. DC-Chol has a titratable tertiary amine group with apparent pKa of 7.8. When the external pH is close to neutral pH, DC-Chol is partially deprotonated resulting in reduced surface charge, as confirmed by zeta potential analysis. PEG on the LNP surface can decrease uptake of particle by the RES, resulting in longer in vivo circulation. In addition, DC-Chol served as a steric barrier that minimizes LNP aggregation and fusion during the formulation synthesis and storage. This LNP formulation has enabled high encapsulation efficiency for the ODN and good colloidal stability.
Western blot results showed that the G3139 had Bcl-2 down-regulatory activity in human KB cells, but not in murine L1210 cells (
G3139-LPNs induced a much stronger cytokine response and a much greater therapeutic activity than free-G3139. The increased activity of the nanoparticles is believed to be due to more efficient uptake of the LNPs by tumor resident macrophages and dendritic cells, resulting in greater local immunoactivation, as shown by immunohistochemical staining of the tumor sections (
Increased uptake of G3139-LNPs by phagocytic cells provides greater accessibility for CpG motifs to TLR-9 than free G3139. G3139-LNPs dramatically promoted proliferation of both DCs and NK cells based on BrdU incorporation (
Example B shows that the G3139-LNPs were highly effective therapeutic agents. In fact, 1.5 mg/kg dose was very effective in activating immune responses and inhibit tumor growth in mice. In contrast, both low (1.5 mg/kg) and high (5 mg/kg) dose of free G3139 did not inhibit tumor growth (
Elevated expression of INF-γ as well as high proliferation of innate effector cells, including NK cells and DCs, play pivotal roles in acquired immunity. The CD8+ cells were apparently up-regulated to express elevated levels of INF-γ at 7 days after treatment. In addition, IHC staining of tumor sections clearly demonstrated much higher levels of CD4+and CD8+ cells infiltrating the tumor and greater tumor cell killing in G3139-LNP group than free G3139 or empty LNP treatment groups had (
Rituximab (anti-CD20 antibody) represents a major therapeutic advance for B-cell malignancies including chronic lymphocytic leukemia (CLL). Rituximab was conjugated on cationic liposomes carrying bcl-2 targeted antis-sense oligonucleotides (G3139) or Mcl-1 siRNA for CLL delivery. The rituximab directed immunoliposomes (anti-CD20 ILP) have a sub-100 nm particle size and are slightly positive charged. The nanosize structure was confirmed by Atomic force microscopy. In comparison to non-formulated ODN (free ODN), the formulated ODN anti-CD20 ILP shows selectively and preferential targeting of B-CLL Cell. Effective binding and selective uptake of anti-sense ODN is correlated with the CD20 expression levels on the cells.
Anti-CD20 ILP mediated ODN delivery enhances the intracellular Bcl-2 down-regulation both in Raji B malignant cell line and CLL patient cells, which increase cell apoptosis determined by Annexin V/PI staining. The uptake of ODN loaded anti-CD20 ILP was examined by confocal microscopy analysis. FAM labeled ODNs (FAM-ODNs) are partially intracellular distribution in Raji and B-CLL cells. The application of anti-CD20 ILP was extend to siRNA delivery for CLL. The undesirable immunostimulation by G3139 containing CpG dinucleotides can be significantly inhibited when it was encapsulated into anti-CD20 ILP. Expression of co-stimulatory molecules including CD40, CD80, CD86 and HLA-DR can be remarkably reduced, compared to free G3139 treated B-CLL cells.
CD20 antigen expressed on B-cell malignancies is a well-established B-cell target. The advantages of using such a target exist in that it is a very selective target on CLL cells and the expression level of CD20 is relatively high compared to some other targets. More importantly, high-specific targeting CD20 monoclonal antibodies (mAbs) are commercially available. Rituximab (Rituxan), a chimeric monoclonal antibody against the CD20 cell surface antigen, have been in clinical trials for the treatment of chronic lymphocytic leukemia (CLL). Rituximab affects antitumor activity through complement-mediated cytotoxicity (CDC), and antibody-dependent cell-mediated cytotoxicity (ADCC). The anti-tumor activity of rituximab in CLL can be further increased via the ODNs mediated down-regulation bcl-2 family membrane proteins such as Bcl-2 and Mcl-1. Accordingly, rituximab conjugated lipids-based delivery system hold great promise for efficient delivery of ODNs to CLL. However, since rituximab alone undergoes limited internalization in CLL cells, the main challenge for developing rituximab conjugated nanocarriers is to achieve efficiently intracellular delivery.
Example C presents the use of rituximab conjugated cationic immunoliposomes (Anti-CD20 ILPs) as a safe vehicle for delivering ODNs, achieving high in vitro transfection efficiencies and good targeting specificity to human B-Cell malignancies. The G3139 ODNs were stabilized with a natural cationic polymer-protamine and surrounded by liposomes with a rituximab targeting moiety on the surface. Example C shows whether anti-CD20 ILPs can selectively deliver ODNs to B-cell malignancies and enhance bcl-2 and Mcl-1 down-regulation. This strategy is useful to enhance existing therapeutics for the treatment of CLL disease and other B malignant cell diseases.
Materials. Egg phosphatidylcholine (egg PC) and methoxy-polyethylene glycol (MW=2000 Da)-distearoyl phosphatidylethanolamine (DSPE-PEG) and were obtained from Lipoid (Newark, N.J.). 3β-[N-(N′,N′-Dimethylaminoethane)-carbamoyl]Cholesterol (DC-Chol) and DSPE-PEG-maleimide (DSPE-PEG-Mal) were purchased from Avanti Polar Lipids, Inc (Alabaster, Ala.). 2-Iminothiolane (Traut's reagent) and other chemicals were purchased from Sigma Chemical Co. (St. Louis, Mo.). G3139 (5′-TCT CCC AGC GTG CGC CAT-3′), G3622 (5′-TAC CGC GTG CGA CCC TCT-3′) [SEQ ID NO:6] and a FAM-terminus modified ODN (5′-(6) FAM-TAC CGC GTG CGA CCC TCT-3′), [SEQ ID NO: 7], were phosphorothioate modified and customer synthesized by Alpha DNA Inc. (Montreal, Calif.).
Rituximab (chimeric anti-CD20 Rituxan, IDEC Pharmaceuticals, San Diego, Calif., and Genentech, Inc., South San Francisco, Calif.) was obtained from RX USA (Jamaica, N.Y.). Trastuzumab (Herceptin) and Campath (anti-CD52) were used. Anti-CD37 was purchase from BD Biosciences (San Diego, Calif.).
Cell lines, B-CLL cells and PBMC cells. Raji and Jurkat leukemia cell lines obtained from American Type Culture Collection (Manassas, Va.), were cultured in RPMI 1640 media supplemented with 10% heat-inactivated fetal bovine serum (FBS, Hyclone Laboratories, Logan, Utah), 2 mM L-glutamine (Invitrogen, Carlsbad, Calif.), and penicillin (100 U/mL)/streptomycin (100 ug/ml; Sigma-Aldrich, St. Louis) at 37° C. in an atmosphere of 5% CO2. Blood was obtained from CLL patients with informed consent under a protocol approved by the hospital internal review board. Peripheral blood mononuclear cells (PBMCs) were separated from heparinized venous blood of the B-CLL patients and from leukocyte fractions of the healthy donors by density gradient centrifugation using Ficoll-Paque (Pharmacia LKB Biotechnology, Piscataway, N.J.). B-CLL cells were further isolated by using B cell Isolation Kit II (Miltenyi Biotec, Auburn, Calif.). PBMCs and B-CLL cells were incubated in RPMI 1640 media supplemented with 10% fetal bovine serum.
Preparation of Alexa fluor-488 labeled antibodies. Rituximab was fluorescently conjugated by an amine-reactive compound, Alexa fluor 488 5-SDP ester (Invitrogen, Carlsbad, Calif.). Rituximab solution (1.0 mg/ml) was exchanged to sodium bicarbonate buffer by dialysis with Slide-A-Lyzer Dialysis Unite (Rockford, Ill.) against 0.1 M sodium bicarbonate solution at for 1-2 hr. Then 1.2 μl of Alexa fluor 488 5-SDP ester in DMSO solution of 10 mg/ml was added into rituximab in (NaHCO3, pH=8.3) buffer for 1 hr at room temperature. The resultant solution was put into Slide-A-Lyzer dialysis tube and dialyzed against PBS (pH=7.4) overnight. The resultant Rituximab-Alexa 488 was collected and diluted to certain concentration, sterilized via 200 nM polymer membrane filter and was stored in 4° C. Herceptin-Alexa 488 was synthesized as the same procedures.
Preparation of Rituximab directed cationic immunoliposomes. An ethanol dilution method was modified to prepare the ODN encapsulated liposomal nanoparticles. Briefly, protamine sulfate in citrate acid (20 mM, pH4) was mixed with lipids (DC-Chol:Egg-PC:PEG-DSPE (molar ratio)=28.0:70.0:2.0) at mass ratio of lipids:protamine=12.5:0.3, followed by addition of oligonucleotide in citrate acid (20 mM, pH4) at oligonucleotide:lipids:protamine (weight ratio)=1:12.5:0.3. The complexes were then dialyzed against citrate acid (20 mM, pH4) for 1 hours and then further dialyzed against HBS buffer (145 mM NaCl, 20 mM HEPES pH7.4) overnight, using a DispoDialyzer (Spectrum Labs, Rancho Dominguez, Calif.) with a Molecular Weight Cut-Off of 10,000 dalton. A post-insertion method was adopted to incorporate antibody ligands into preformed liposomes carrying ODNs. Rituximab (anti-CD20) was reacted with 10× Traut's reagent (2 hr, Room temperature) to yield sulfhydryl modified antibodies. The anti-CD20-SH was then reacted to micelles of Mal-PEG-DSPE at a molar ratio of 1:10, and then incubated with ODN loaded liposomes for 1 h at 37° C. Targeted liposomes with anti-CD20 to total lipid ratios of 1:2000 (0.05 mol %) were prepared. Herceptin-targeted control liposomes or anti-CD37 ILPs were prepared by coupling trastuzumab (Herceptin) or anti-CD37 instead of anti CD20 to the liposomes using the same method. For binding study, the post-inserted immunoliposomes carrying FAM-ODN were further separated to remove free PEG conjugated antibodies by CL-4B column.
Characterization of liposomal nanoparticles. The particle sizes of LPs were analyzed on a NICOMP Particle Sizer Model 370 (Particle Sizing Systems, Santa Barbara, Calif.). The volume-weighted Gaussian distribution analysis was used to determine the mean vesicle diameter and the standard deviation. The zeta potential (4) was determined on a ZetaPALS (Brookhaven Instruments Corp., Worcestershire, N.Y.). All measurements were carried out in triplicates. The ODN content in targeted and non-targeted liposomes were determined by electrophoresis in 15% polyacrylamide gel with EtBr staining. The structures of the LPs and anti-CD20 ILPs were investigated by atomic-force microscopy (AFM). A Digital Instruments (Santa Barbara, Calif.) Nanoscope III atomic force microscopy (AFM) was used to image Morphology of performed ODN loaded cationic liposomes (LP) or anti-CD20 ILP. Images were recorded in both height and amplitude modes. Colloidal stability of the ILPs in plasma were determined by incubating the ILPs with 50% human plasma for varying amount of time at 37° C., followed by measuring particle size at various time-points.
Cell surface immunostaining. Cells (0.5×105/ml) were incubated at with PE-labeled anti-CD20, mouse IgGi isotype control antibodies (BD Biosciences, San Diego, Calif.) or Rituximab-Alexa 488, Herceptin-Alexa 488 at 4° C. for 30 minutes. The cells were then spun down at 300 g for 10 minutes and rinsed twice with cold phosphate-buffered saline (PBS, pH=7.4) and analyzed by FACS) for 30 minutes at 4° C. CD20 surface expression levels were analyzed by FACS on a Beckman Coulter EPICS XL (Beckman Coulter). Ten thousand events were collected under list mode.
Immunofluorescence assays of co-stimulatory molecules. At the time points indicated, cells were washed in ice-cold phosphate-buffered saline (PBS) and were stained for surface antigens. Monoclonal antibodies (mAb) against CD40 (5C3), CD80 (L307.4), CD86 (IT2.2), and HLA-DR and appropriate isotype controls were purchased from BD Biosciences (San Diego, Calif.).
Binding study. For the binding study, cells were pre-incubated with 1 uM free FAM-ODN or 1 uM FAM-ODN encapsulated LP, anti-CD20 ILPs and Herceptin ILPs for 60 minutes at 37° C. The incubation and wash procedure was identical to the surface staining protocol. For cell lines, cells were split the night before and fresh cells were used for immunostaining as described for B-CLL cells.
Specificity study. Mixed Raji and Jurkat cells (1:1) were co-cultured for 4 hr ahead. The mixed cells or PBMC cells were pre-incubated with 0.5 uM free FAM-ODN or 0.5 uM FAM-ODN encapsulated anti-CD20 ILPs for 60 minutes at 37° C. The cells were then spun down at 300 g for 10 minutes and rinsed twice with cold PBS (pH=7.4) for FACS analysis.
Laser-scanning confocal microscopy. Binding and uptake of the liposomes in Raji and CLL cells were examined by laser scanning confocal microscopy. Cells were incubated with LP, Her ILP and anti-CD20 ILP liposomes for 4 hrs at 37° C. and washed twice with phosphate-buffered saline (PBS) followed by fixation with 2% paraformaldehyde (PFA) for 30 minutes. Nucleus was stained with 1 ug/ml of DRAQ5™ (Biostatus Limited, Leicestershire, United Kingdom) for 5 minutes at RT. These cells were mounted on a poly-D-lysine coated cover glass slide (Sigma-Aldrich, St. Louis, Mo.). Green fluorescence of FAM-DON and blue fluorescence of DRAQ5 were analyzed, and merged images were produced by using Multi-photon Imaging Systems and LSM Image software.
Evaluation of apoptosis and cell viability by flow cytometry. The apoptosis of cells was measured using Annexin V-FITC/propidium iodide (PI) staining followed by FACS analysis according to manufacture's protocol (BD Pharmingen). Unstained cell sample, and cells stained with Annexin V-FITC or PI only were also processed for compensation. Results were presented as % cytotoxicity, which was defined as (% Annexin V+ and/or PI+ cells of treatment group)−(% Annexin V+ and/or PI+ cells of cells of media control). FACS analysis was performed using a Beckman-Coulter EPICS XL cytometer (Beckman-Coulter, Miami, Fla.). Ten thousand events were collected for each sample and data was acquired in list mode. System II software package (Beckman-Coulter) was used to analyze the data.
Assessment of Bcl-2 down-regulation by Western-blot. The Western blot was carried out to evaluate the Bcl-2 protein level. After the delivery of G3139 and scrambled ODN loaded liposomes, the cells were incubated with a lysis buffer containing a protease inhibitor cocktail (CalBiochem, San Diego, Calif.) on ice for 20 min. The pellets were removed after centrifugation the lysate at 13,000 rpm at 4° C. for 10 min at. The supernatant was collected and the protein concentrations were determined by BCA assay (Pierce, Rockford, Ill.). After the separation of proteins in a 12% SDS-polyacrylamide gel, the proteins transferred to a PVDF membrane and unspecific binding of Bcl-2 to it antibodies was blocked with 5% milk in PBS-buffered saline containing 0.1% Tween-20 (PBST) for 80 mins. The membranes were then incubated with primary anti-human Bcl-2 at 4° C. overnight, followed by incubation with horseradish peroxidase-conjugated goat antimouse IgG. Membrane was then developed with Pierce SuperSignal West Pico or Dura Extended Duration Substrate (Pierce) and imaged with Kodak X-OMAT film (Kodak, Rochester, N.Y.). To normalize the protein loading amount in SDS-PAGE, the membrane was washed by PBST and blotted by polyclonal goat anti-human beta-actin antibody (Santa Cruz, Santa Cruz, Calif.) and secondary antibody rabbit anti-goat IgG (Pierce).
Statistical analysis. Analysis was performed by statisticians in the Center for Biostatistics, the Ohio State University, using SAS software (SAS Institute Inc. Cary, N.C., USA). Comparisons were made using a two-sided α=0.05 level of significance. Mixed effects models were used to account for the dependencies in the cell donor experiments, and analysis of variance (ANOVA) was used for the cell line experiments. Synergy hypotheses were tested using interaction contrasts.
As shown in
Since G3139 containing unmethylated CpG dinucleotides may active B cells and lead to expression of co-stimulatory molecules, expressions of typical surface markers (CD40, CD80, CD86 and HLA-DR) were assessed for immunostimulation by flow cytometry. After treatment by G3139 for 481r, Raji cell didn't show much difference on levels of surface marker expression (
Rituximab is a Good Antibody for Targeting to B Cell Lines and Primary B-CLL Cells.
Rituximab is a chimeric monoclonal antibody directed at CD20, which is an established B-cell target. To examine the exact expression of CD20 directed by rituximab, rituximab antibody was first fluorescently conjugated with Alexa Fluor-488. Assessment of CD20 receptor expression was determined by cytometric analysis after immunostaining six major B cell lines and B-CLL cells using rituximab-Alexa 488 (
Preparation and Characterization of Rituximab (Anti-CD20 Antibody) Conjugated Cationic Immunoliposomes (Anti-CD20 ILPs).
In Example C, cationic liposomes (LPs) were used to achieve high stability and high encapsulation efficiency. The ethanol dilution method was applied to make LPs. The cationic lipid of DC-Chol was chosen for encapsulating the electrostatic self-assembled protamine/ODN complexes. Rituximab and herceptin control were incorporated onto the formed ODN-LPs by post-insertion of the rituximab or herceptin conjugated with PEG-DSPE. As characterized in Table 6, all of the ODN loaded LPs have approximately the same average diameter of 50-70 nm and are slightly positive charged (+2˜0.6 mV).
aLP:DC-Chol/EggPC/DSPE-PEG = 28/70/2 (molar ratio); lipids/ODN//Protamine = 12.5/1/0.3 (weight ratio); 0.05 mol % Herceptin or Rituximab was conjugated on LP. The encapsulation efficiency of ODN was above 90%.
bThe representative data is from the mean of three separate measurements.
The particle size of antibody coated LPs are slightly bigger than that of naked LPs. Atomic force microscopy (AFM) imaging was used to further determine morphologies of ODN-encapsulated LPs and anti-CD20 LPs. As shown in
Anti-CD20 ILP mediated delivery is CD20 antigen-specific and anti-CD20 ILP selectively binds to B malignant Raji cells in mixed populations with Jurkat cells.
The expression of rituximab against CD20 receptor on Raji (B malignant cell line) and Jurkart (T malignant cell line) cells was assessed by direct immunostaining of cells with rituximab-Alexa 488 (
Herceptin-Alexa 488 was used as negative antibody control for immunostaining. According to
A competitive blocking study, in which Raji cells were pre-incubated with extra Rituximab (anti-CD20) or Campath (anti-CD52) from low to high concentrations, showed that Rituximab was able to almost completely block the anti-CD20 mediated binding whereas CD52 antibody had no any blocking effect (
To demonstrate the selectivity of anti-CD20 ILP, the mixed Raji (B cell line) and Jurkat (T cell line) populations were treated by FAM-ODN loaded anti-CD20 ILP and analyzed by flow cytometry. As seen in
Anti-CD20 ILP Carrying G3139 Enhances bcl-2 Down-Regulation and Induces Apoptosis in Cultured Raji Model Cell Line.
The antisense Bcl-2 effect of G3139 in various formulations was evaluated at protein levels on Raji after 48 hr treatment (
Specific Delivery of Anti-CD20 ILP is Correlated with CD20 Expression Level on Primary B-CLL Cells and ODN Loaded Anti-CD20 ILP but not Free ODN Shows B Cell Selectivity in PBMC Cells.
The CD20 antigen specific targeting of rituximab directed cationic liposome was further examined in primary B-CLL cells.
Rituximab directed cationic immunoliposomes showed CD20 antigen specific in B-CLL cells as well. The more CD20 expression, the more strong CD20 specific binding (left panel,
FAM-ODNs were preferentially delivered to B cells in PBMC that were recognized by the second staining of APC labeled CD19. FAM-ODN incorporated anti-CD20 ILPs bind selectively to B cells but not T cells, which were consistent with the specificity study in Raji and Jurkatt mixed cells (
The Innate CpG Immunostimulation of G3139 can be Significantly Inhibited when Encapsulated into Anti-CD20 ILPs.
Due to CpG motifs in G3139 sequence, free G3139 has shown B-cell activation, accompanying with significant up-regulation of surface markers such as CD40, CD80, CD86 and HLA-DR (
Rituximab and bcl-2 anti-sense ODN by rituximab directed cationic immunoliposomes (anti-CD20 ILP) encapsulating G3139 provide B cell-type specific targeting with enhanced cell entrance. The enhanced B cell-type delivery is demonstrated herein both in malignant cell lines and primary B-CLL cells. Moreover, a similar strategy is also useful for the Mcl-1 siRNA delivery for CLL.
Treatments for CLL with anti-sense or RNA interference (RNAi) represent new therapeutic strategies. G3139 is an 18-mer phosphorothioate ODN targeting for bcl-2 down-regulation. Inhibition of bcl-2 expression by G3139 might render bcl-2 overexpressing malignant B cells more susceptible to chemotherapy in CLL.
In general, cationic vectors such as lipofectin and lipofectamine are required to provide sufficient uptake of anti-sense ODNs into cells in vitro. Free G3139 did not show obvious down-regulate bcl-2 expression in Raji cell in the absence of cationic lipid nanoparticles (
Due to polyanionic properties and large molecular weight, ODNs lack cell-type specific targeting and low cellular membrane permeability. Although some naked antisense ODNs are able to bind to certain components in serum, following uptake by cells, the intracellular amount of ODN uptake is limited. Furthermore, free anti-sense ODN can lead to nonspecific knockdown and toxic side effects. These concerns were confirmed in our specificity study of free ODN. FAM labeled ODN can non-specifically get into both B and T cells (
Example C provides a novel strategy for achieving CLL targeted delivery using ligands that selectively bind to B cell surface but not T cell. CD20 represents a unique antigen restricted to cells of B lineage and almost all of the B cell malignancies express CD20 (
In Example C, cationic lipid nanoparticles were chosen to obtain high loading efficiency of anti-sense ODN. Cationic lipid nanoparticle can penetrate the cell membrane, thus facilitating gene/ODN delivery. Thus, rituximab coated cationic immunolipid nanoparticle was designed to enhance binding to B cells, followed by increasing uptake because of its positive-negative electrostatic interaction with cell membranes.
To prepare rituximab and herceptin coated immunolipid nanoparticles, the “post-insertion” method was adopted. The incorporation of rituximab and herceptin on LPs slightly increased the particle size. The particle size of all resultant LPs is sub-100 nm and particle surfaces are positively charged (Table 6). The nanosize structure of LP and anti-CD20 ILP was confirmed by Atomic force microscopy analysis (
Rituximab conjugated cationic immunolipid nanoparticles show the characteristic of CD20 antigen specific targeting both in Raji model cell line and primary B-CLL cells isolated from patients (
The increased fold of bcl-2 down-regulation is not as significant as that was obtained in flow data (
Avoiding the undesirable immunoeffects and taking full advantages of desired gene or protein silencing is essential for the clinical application of these therapeutic agents. Unfortunately, most anti-sense ODNs and siRNAs contain immunostimulatory motifs. Due to the CpG dinucleotide in G3139, it causes significant immunostimulation characteristics of up-regulation of co-stimulatory molecules and bcl-2 protein. The immunolipid nanoparticles such as CD20 ILP and CD37 ILP can inhibit the activation of G3139. Some surface markers like CD86 and HLA-DR can achieve completely inhibition. This finding was further confirmed in study of ODN 2006, a classic CpG ODN (
The rituximab (CD20 antibody) directed cationic immunolipid nanoparticles illustrated B-cell-type selectivity both in B malignant cell lines and CLL cells in vitro. The anti-CD20 ILP can inhibit the CpG immunostimulation of G3139 and take full advantage of its blc-2 antisense design. The improved bcl-2 and Mcl-1 down-regulation were achieved in anti-CD20 ILP. The Example C also provides a strategy for improving the existing antisense clinic trial and RNA interference therapeutics in CLL.
Example D provides a targeted delivery of Ones to malignancy B cells by using antibody directed liposomal immuno-nanoparticles (INP), including delivering G3139, an As-ODN against Bcl-2, via Rituximab (anti-CD20) conjugated INP.
Example D also provides a delivery system for Mcl-1 siRNAs, based on novel anti-CD37 mAb conjugated INP (anti-CD37 INP). Additionally, Example D provides incorporating another antibody such as anti-CD20 or anti-CD19 into anti-CD37 INP to further improve efficiency and specificity of Mcl-1 siRNAs. A combination of anti-CD37 and other antibodies provide highly specific targeting function to individual patient cells. Example D provides, not only development of a novel clinical agent for CLL therapy, but also, technological advances in nanoparticle design and synthesis with broad applications in oligonucleotide therapeutics.
Chronic Lymphocytic Leukemia (CLL).
CLL represents the most common type of adult leukemia and is incurable with standard therapy. In the CLL, chemotherapeutic agents such as fludarabine and chlorambucil have been effective in a subset of patients. However, non-specific effects and even non-response of these drugs obstruct their therapeutic efficacy in the clinic.
In addition to the rituximab, alemtuzumab that targets CD52, an antigen expressed on normal lymphocytes as well as many T- and B-cell neoplasms has been used for first-line treatment for CLL. But the major drawback of alemutuzumab is the damage in T cells of CLL patients.
Bcl-2 or Mcl-1 as a Therapeutic Target in CLL and Other B-Cell Malignancies.
The anti-apoptotic proteins such as Bcl-2 and are important members of the Bcl-2 family that plays critical roles in promoting the survival of lymphocytes and hematopoietic stem cells. Mcl-1 and Bcl-2 preserve the mitochondrial integrity by binding to mitochondrial porin channels, thus inhibiting mitochondrial destabilization and subsequent initiation of apoptosis. Multiple studies have demonstrated that the anti-apoptotic subset (Bcl-2, Bcl-xl, and Mcl-1) is linked to drug resistance and poor treatment outcome in a variety of tumor types.
Down-regulation of Bcl-2 or Mcl-1 by siRNA or antisense molecules is sufficient to initiate apoptosis in some cell lines, while in other cell types, down-regulation of Mcl-1 is insufficient to initiate apoptosis but promotes sensitivity to chemotherapy and radiation. Thus, down-regulation of Mcl-1 or Bcl-2 plays a primary role in the initiation of apoptosis in B-cell leukemia, which provides justification for the development of Bcl-2 or MeI-1-targeted therapies.
Use of Oligonucleotides as Therapeutic Reagents.
Oligonucleotides, including antisense oligonucleotides (As-ODNs) and small interfering RNA (siRNA) are emerging as promising therapeutic agents against a variety of diseases such as cancer and leukemia. AS-ODNs are ˜20 nt in lengths and act by targeting specific mRNAs through heteroduplex formation inside the cell, thereby inducing RNase H activation, translational arrest, or by altering splicing. In vitro activity of AS-ODNs requires delivery via invasive methods, such as electroporation and complexation to a transfection agent. However, clinical trials on AS-ODNs invariably have used free ODNs. Vitravene (formiversen), a phosphorothioate AS-ODN for treatment of CMV retinitis in AIDS patients, was the first ODN to gain approval by the U.S. FDA. Formiversen is somewhat unique in that it is given by direct injection into the vitreous body of the eye. For systemic administration, in order to counter rapid clearance due to renal excretion, the ODNs in clinical trials have been given via prolonged continuous intravenous infusion. Despite these measures, the clinical efficacy of AS-ODNs has been limited in most cases and the expected target down regulation is often not observed. For example, in a clinical trial on an AS-ODN G3139 targeting Bcl-2, a significant fraction of the patients showed up-regulation of Bcl-2, rather than the intended target down regulation.
siRNA is much more efficient for gene silencing both in vitro and in vivo, comparing to AS-ODNs. RNAi takes full advantage of the physiological gene silencing machinery, which can efficiently mediate the cleavage of targeted mRNA molecules. siRNAs consist of duplexes of oligoribonucleotides that are 19- to 23-nt each in length, containing a sense-strand and an antisense strand. siRNAs interact with Argonaute-2 (Ago-2) to form RNA-induced silencing complexes (RISCs), which degrades the sense-strand of the siRNA and then cleaves target mRNAs that are perfectly complementary to the antisense strand. siRNAs also exhibit significant miRNA effect against targets that are not perfectly complementary. This results in off-target effects of siRNA. siRNAs are much more potent in inducing target gene silencing on a per molar basis compared to AS-ODNs. siRNA mediated down-regulation of Mcl-1 can be used to mediate caspase independent apoptosis in acute lymphocytic leukemia cell lines, primary CLL B cells and lymphoma cell lines. In combination with standard chemotherapy, siRNA therapy can also reduce chemo-resistance, suggesting the potential use of siRNA therapy for treating many malignant diseases. However, ODNs therapeutic remains particularly challenging, due to difficulties in transduction of lymphocytes and other primary blood cells. In addition, as siRNAs are often disseminated throughout the body, targeted systemic delivery approaches are warranted. Low transfection efficiency, poor tissue penetration, and nonspecific action on bystander cells and immune activation by siRNAs have posed limitations on the therapeutic application in vivo.
Challenges for ON Delivery.
As polyanionic macromolecules, ODNs face multiple obstacles in reaching their intracellular site of action, thus present a significant problem for drug delivery. In fact, there is no natural mechanism for these highly hydrophilic macromolecules to traverse the cellular membrane and bioavailability of these agents on their own is minuscule. Nevertheless, the delivery of ODNs is somewhat less challenging than delivery of therapeutic genes, which has thus far been the limiting factor for the successful clinical application of gene therapy. This is because ODNs, which are typically less than 30 nt or bp, are significantly smaller in size than therapeutic genes (>7 kb). In addition, ODNs are produced by chemical synthesis, which allows for purity of the materials and introduction of chemical modifications that provides greater metabolic stability or that enables synthesis of derivatives with greater bioavailability.
In particular, for delivery to solid tumor, there are four major barriers for ODNs to gain access to malignant cells and take effect on the intracellular targets. First, the ODNs must avoid rapid degradation by serum nucleases, rapid excretion by renal filtration and/or clearance by the reticuloendothelial system (RES). Second, the ODNs must gain access to the target cells by crossing the capillary endothelium and travel in the extracellular matrix. Third, the ODNs must be taken up by the target cells, typically through an endocytotic process. Finally, the ODNs must be released from the endosomes and reach intracellular targets, such as loading onto dicer/Ago-2 in the case of siRNA. An effective delivery strategy must take into account the need to overcome all of these barriers, as well as avoid introducing tissue toxicity and undesirable immunoactivation.
Choice of Antibody for Targeted Delivery of siRNA or As-ODNs.
To address the delivery issues of ODNs including poor intracellular uptake, limited blood stability, and non-specific immune stimulation, targeted delivery based on cell type-specific ligands such as monoclonal antibodies has been increasingly recognized as a promising strategy for in vivo application of ODNs. Antibody-based therapeutics has been attractive in cancer and leukemia treatment, because of their high specificity and affinity to target antigens. Therapeutic antibodies such as trastuzumab (Herceptin®), rituximab (Rituxan®) and alemtuzumab (Campath®) have been routinely used in the clinical treatment of breast cancer and leukemia.
Compared to intact antibodies, small antibody fragments, such as scFv and Fab, are less bulky and lack a Fc domain, which may interfere with in vivo delivery. Therefore, antibodies or antibody fragments represent an interesting class of molecules for enhancing the delivery of therapeutic reagents to target tumor cells. However, problems including the potential for immunogenicity and the high cost should be taken into account in application of antibody-mediated delivery.
ILNs containing anti-CD20 antibody are useful to efficiently deliver the FAM-ODN into primary CLL B cells and B cell lines selectively. This delivery is further enhanced using pharmacological agents such as lenalidomide (which causes internalization of the CD20 antigen). Since single antigen expression on cell surfaces varies from patient to patient, it is a good strategy to combine these antibodies together to achieve the maximal binding and delivery efficiency for individual patient.
Targeted delivery of Mcl-1 siRNAs using CD37-ILN mediates down-regulation of Mcl-1 protein levels and promotes increased spontaneous apoptosis in CLL B cells.
Anti-CD37 ILN containing FAM-ODN was used for determining the cell type specific binding. Binding to CD19+B cells but not to CD3+T cells in the peripheral blood mononuclear cells from CLL patients is shown in
Dual Antibody Mediated Delivery Via Immuno-Liposomal Nanoparticles (ILNs).
Single antibodies and combined antibodies were incorporated onto ILNs by the post-insertion method. The antibodies were chemically modified with PEG-DSPE, followed by mixing with FAM-ODN loaded lipid nanoparticles. The binding efficiency of immunolipid nanoparticles onto Raji cells were analyzed by conventional flow cytometry. As seen in
Oligonucleotides targeted towards anti-apoptotic protein Bcl-2 or Mcl-1 provide a novel approach for overcoming resistance to biological and chemotherapeutic agents. These results demonstrate that down-regulation of Bcl-2 or Mcl-1 enhanced the apoptosis in Raji model cell line and B-CLL cells. It has been also shown that, when given as free ODN, only very low level of cytoplasmic ODN concentration was achievable, while no cytoplasm-to-nucleus drug trafficking and target down-regulation were observed72. Commercial transfection agents, such as NeoPhectin™ and Lipofectamine™ rely on electrostatic mechanism for cellular uptake. Unfortunately, these agents cannot be used in vivo because they lack selectivity for leukemia cells, are cytotoxic and do not function properly in the plasma environment. Therefore, in order to improve the efficacy and tumor specificity of Mcl-1 siRNA therapy and provide a paradigm for in vivo delivery of siRNAs to down-regulate anti-apoptotic proteins in B cell malignancies in general and CLL in particular, new delivery strategies are needed.
Due to relatively high expressions of CD20 and CD37 antigens on B-CLL cells, rituximab and CD37 antibody were used as targeting molecules for delivering ODNs. Using anti-CD37 INP of siRNA as an example, the basic rationale and principle for using INP-mediated As-ODN and siRNA delivery is shown in
The strategy described herein is useful to form compounds that modulate the critical Mcl-1 protein which has been shown to render resistance to apoptosis. This strategy is also useful for making therapeutic approaches for B cell leukemia. In addition, the novel strategy described herein is useful to advance the technologies of nanoparticle synthesis and oligonucleotide therapeutic delivery.
Non-limiting examples of uses of such strategies include:
i) CD20-ILN formulations for targeted delivery of G3139 to B-CLL cells having increased sensitivity of B-CLL cells to fludarabine after Bc-2 down-regulation;
ii) CD37-ILN formulations for targeted delivery of Mcl-1 siRNA to B-CLL cells having increased sensitivity of B-CLL cells to fludarabine and/or Rituximab after Mcl-1 down-regulation;
iii) CD37-ILN formulations in combination with one or more antibodies for dual- or multi-Ab targeted delivery of Mcl-1 siRNA to B-CLL cells;
iv) RIT-INP formulation where the formulation of anti-CD37 INP is altered ofr modulated sensitivies;
v) dual targeting strategies based on Anti-CD37; and
vi) INP formulations having enhanced binding and/or down-regulation efficacy.
For example, a schematic illustration of a Protein A based immunolipid nanoparticles for formulating dual or multi Ab targeted delivery is shown in
It is to be noted that similar results were achieved with Dual-Ab ILPs of Anti-CD19+Anti-CD 37 ILPs; and Anti-CD20+Anti-CD 37 in B-CLL cells (data not shown).
GTI-2040, an antisense oligodeoxyribonucleotide (ODN) against the R2 subunit of ribonucleotide reductase, is a promising agent for overcoming chemoresistance in acute myeloid leukemia (AML).
Example E shows that the strategy described herein also enhances the clinical efficacy of GTI-2040, where formulations capable of promoting targeted delivery of ODNs into AML cells are used.
In Example E, transferrin (Tf) conjugated pH-sensitive lipopolyplex nanoparticles (LPs) were developed. These nanoparticles can release ODNs at acidic endosomal pH and facilitate the cytoplasmic delivery of ODNs after endocytosis. In addition, Tf-mediated targeted delivery of GTI-2040 was achieved. R2 downregulation at both mRNA and protein levels was improved by 8-fold in Kasumi-1 cells and 2-20 fold in AML patient cells treated with GTI-2040-Tf-LPs, compared to free GTI-2040 treatment. Moreover, Tf-LPs were more effective than non-targeted LPs, with 10-100% improvement at various concentrations in Kasumi-1 cells and an average of 45% improvement at 3 μM concentration in AML patient primary cells. Treatment with 1 μM GTI-2040-Tf-LPs sensitized AML cells to the chemotherapy agent cytarabine, by decreasing its IC50 value from 47.69 nM to 9.05 nM. LPs had an average particle size around 110 nm and a moderately positive zeta potential at ˜10 mV. The ODN encapsulation efficiency of LPs was >90%. The LP structure was studied by Cryo-TEM, indicating several coexisting structures. This study suggests that the combination of pH sensitive LP formulation and Tf mediated targeting is a promising strategy for antisense ODN delivery in leukemia therapy.
In Example E, we synthesized transferrin (Tf)-conjugated PEGylated lipopolyplex nanoparticles (Tf-LPs) that incorporate protamine as a DNA condensing agent, pH-sensitive fusogenic lipids to improve cytoplasmic delivery, and Tf as the targeting ligand. We show that R2 downregulation at both mRNA and protein levels was significantly improved in AML cells treated with GTI-2040-Tf-LPs, compared to free GTI-2040 treatment.
Materials. Dioleoyl phosphatidylethanolamine (DOPE) and distearoyl phosphatidylethanolamine-N-[maleimide-polyethylene glycol, M.W. 2000] (Mal-PEG2000-DSPE) were purchased from Avanti Polar Lipids (Alabaster, Ala.). Methoxy-PEG2000-DSPE was purchased from Genzyme Corporation (Cambridge, Mass.). Human holo-Tf, 2-iminothiolane (Traut's reagent), protamine sulfate, cholesteryl hemisuccinate (CHEMS), and other chemicals and reagents were purchased from Sigma Chemical Co. (St. Louis, Mo.). All tissue culture media and supplies were purchased from Invitrogen (Carlsbad, Calif.). All ODNs used in this study were fully phosphorothioated. GTI-2040 (sequence 5′-GGCTAAATCGCTCCACCAAG-3′) [SEQ ID NO: 8] was generously supplied by Lorus Therapeutics Inc. (Toronto, Ontario, Canada). ODN with scrambled sequence (5′-ACGCACTCAGCTAGTGACAC-3′) [SEQ ID NO: 9] and carboxyfluorescein (FAM)-labeled GTI-2040 were purchased from Alpha DNA (Montreal, Quebec, Canada).
Cell lines, patient samples and cell culture. Kasumi-1 and K562 cells were obtained from ATCC (Manassas, Va.). Cells were grown in RPMI medium supplemented with 10% (K562) or 15% (Kasumi-1) fetal bovine serum at 37° C. Pre-treatment unselected bone marrow blasts from AML patients were obtained from The Ohio State University (OSU) Leukemia Tissue Bank. Each of the patients signed an informed consent to storing and using his/her leukemia tissue for discovery studies according to institutional guidelines from OSU. Fresh AML primary bone marrow samples were fractionated by Ficoll-Hypaque (Nygaard) gradient centrifugation and grown in RPMI 1640 media supplemented with 15% of human serum and GM-CSF plus Cytokine Cocktail (R&D Systems, MN) at 37° C.
Preparation of Tf-LPs. As shown in
Cryogenic transmission electron microscopy (Cryo-TEM). Cryo-TEM imaging was performed as previously described (16). Briefly, samples were examined in a Philips CM120 microscope (Eindhoven, The Netherlands) at 120 kV, using an Oxford CT-3500 cooling holder and transfer station (Abingdon, England). Specimens were equilibrated in the microscope below −178° C., then examined in the low-dose imaging mode to minimize electron beam radiation damage, and recorded at a nominal underfocus of 1-2 μm to enhance phase contrast. Images were acquired digitally by a Gatan MultiScan 791 cooled charge-coupled device camera (Pleasanton, Calif.) using the Digital Micrograph 3.1 software package. Cryo-TEM study was performed at Technion-Israel Institute of Technology, Haifa, Israel.
Characterization of LPs and evaluation of ODN encapsulation efficiency. The particle size of LPs was analyzed on a NICOMP Particle Sizer Model 370 (Particle Sizing Systems, Santa Barbara, Calif.). The volume-weighted Gaussian distribution analysis was used to determine the mean vesicle diameter. The zeta potential was determined on a ZetaPALS (Brookhaven Instruments Corp., Worcestershire, N.Y.). All measurements were carried out in triplicates. The concentration of encapsulated ODN was determined by lysing LPs using 0.5% SDS and 1% Triton X-100, followed by agarose gel electrophoresis to separate SDS, Triton, and ODNs. The density of each ODN band after ethidium bromide staining was measured, and the amount of ODN was estimated by comparing to a series of ODN standards. Encapsulation efficiency was calculated based on the ratio of ODNs in LPs versus the initial amount of ODNs applied.
Study of Tf receptors (TfR) expression. The expression levels of TfR (also known as CD71) on the surface of AML cells were evaluated by surface staining with PE-labeled anti-TfR (anti-CD71) monoclonal antibody (BD Biosciences, San Jose, Calif.) followed by flow cytometry analysis as previously described (13).
Transfection studies. Kasumi-1 and K562 cells were seeded at 5×105/mL density 24 hr before transfection, while patient primary cells were seeded at 3×106/mL density right after they were separated from patient bone marrow. During the transfection, cells were exposed to LPs, Tf-LPs or free ODNs at a final concentration of 1 μM or 3 μM at 37° C. in a CO2 incubator. In Mock, cells were treated with 10 mM HEPES buffer. After 48 hr, cells were collected and analyzed for R2 mRNA level by real-time qRT-PCR and for R2 protein level by western blot.
Laser-scanning confocal microscopy. Binding and internalization of FAM-GTI-2040-Tf-LPs in AML cells were examined by laser scanning confocal microscopy. Cells were incubated with FAM-GTI-2040-Tf-LPs for 0 hr. and 4 hr respectively at 37° C. and washed twice with PBS followed by fixation with 2% para-formaldehyde for 30 minutes. Nuclei were stained with 20 μM of DRAQ5™ (Biostatus Limited, Leicestershire, United Kingdom) for 5 minutes at room temperature. The cells were mounted on a poly-D-lysine coated cover glass slide (Sigma-Aldrich, St. Louis, Mo.). Green fluorescence of FAM-GTI-2040 and blue fluorescence of DRAQ5 were analyzed, and merged images were produced by using Zeiss 510 META Laser Scanning Confocal Imaging Systems and LSM Image software (Carl Zeiss Microlmaging, Inc., NY, USA).
Quantitative RT-PCR (qRT-PCR). The R2 mRNA level in leukemia cells was evaluated using qRT-PCR as previously described (17). Primer sequences for R2 and ABL, and qRT-PCR conditions are reported in Supplementary section.
Western blot analysis. The R2 protein expression was measured by western blot as previously described (18). Anti-R2 and anti-GAPDH antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.) (9). Equivalent gel loading was confirmed by probing with antibodies against GAPDH.
Cell survival studies by MTS assay. Kasumi-1 cells were treated with HEPES buffer (as Mock), GTI-2040-Tf-LP, free GTI-2040 or Scrambled-Tf-LP at 1 μM concentration for 4 hr and then incubated with various concentration of Ara-C (0.0001-10 μM) for 48 hr. Cell survival was then determined by the MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfopheyl)-2H-tetrazolium), which is reduced by cells into a formazan product that is soluble in tissue culture medium. Briefly, 20 μL of MTS/PMS (phenazine methosulfate) (ratio 20:1) mixture was added into each well and then incubated for 1-4 hr at 37° C. Absorbance was read at 490 nm on a microplate reader Germini XS (Molecular devices, CA). Three replicates were used at each drug concentration. Data were plotted and IC50 values were calculated using WinNonLin software (version 4.0, Pharsight, Mountain View, Calif.).
Statistical analysis. Data were represented as mean±standard deviations and analyzed by 2-tailed Student's t-test using MiniTAB Program (Minitab Inc., State College, Pa.). p<0.05 was considered statistically significant.
Preparation and characterization of LP and Tf-LP nanoparticles.
Detailed nanostructures of polyplexes and LPs were studied by direct nanoscale imaging via Cryo-TEM (
In
In
Another structure is indicated by a white arrowhead in
LPs had an average particle size as 108.5±5.4 nm and a zeta potential as 12.12±0.82 mV. The GTI-2040 encapsulation efficiency was determined by agarose gel electrophoresis and found to be over 90%.
TfR expression on AML cells and patient primary blasts. Tf is the targeting molecule on LPs, which can be efficiently uptaken by cells expressing TfR via TfR-mediated endocytosis (19, 20). TfR is a dimeric transmembrane glycoprotein (180 kea) commonly overexpressed on proliferating cells including most tumor cells, such as leukemia (21, 22). TfR expression on the surface of AML cells was studied using PE-labeled anti-TfR monoclonal antibodies. Kasumi-1 cells, K562 cells and AML patient cells used in this study demonstrated a relatively high level expression of TfR (
Cellular uptake of GTI-2040-Tf-LPs in AML cells. In order to study the uptake of GTI-2040-Tf-LPs, AML cells were treated with Tf-LPs containing FAM-labeled GTI-2040. The treated AML cells were collected at various time points and washed twice with PBS before analysis. Flow cytometry analysis of these AML cells showed a time-dependent increase in fluorescence signals (
R2 downregulation by GTI-2040-Tf-LPs in AML cells. The efficiency of targeted delivery of GTI-2040 by Tf-LPs was further evaluated based on changes in R2 expression at the mRNA and protein levels in various AML cell lines, such as Kasumi-1 and K562. In Kasumi-1 cells, 25±1% of R2 protein reduction was achieved in cells treated with 1 μM of GTI-2040-Tf-LPs compared to buffer-treated controls. In contrast R2 protein reduction was only 11±6% in cells treated with the non-targeted GTI-2040-LPs. Treatments with 1 μM free GTI-2040, LPs (scrambled ODNs) or Tf-LPs (scrambled ODNs) did not result in any R2 downregulation (data not shown). When the ODN concentration was increased to 3 μM, R2 was further downregulated in cells treated with GTI-2040-Tf-LPs (90±2%) (
Delivery of GTI-2040 by Tf-LPs was further enhanced by pre-treating the cells with 30 μM DFO for 18 hr (
R2 downregulation by GTI-2040-Tf-LPs in AML patient primary cells. Dose-dependent enhancement in R2 downregulation was observed in all the AML patient primary cells tested (
GTI-2040-Tf-LPs improved the chemosensitivity of AML cells to Ara-C. AML cells were treated with GTI-2040-Tf-LPs, free GTI-2040 or Scrambled-Tf-LPs, and then challenged the cells with Ara-C at various concentrations. Cell survival was evaluated by MTS assay. As shown in
Example E provides show non-limiting examples of formulations capable of promoting targeted delivery of ODNs, thereby enhancing their clinical efficacy and reduce their side effects. Example E shows that Tf-LPs efficiently delivered GTI-2040 into AML cells, downregulated R2, and chemosensitized the cells to chemotherapy agent Ara-C. These effects were highly sequence specific and formulation dependent, as Tf-LPs containing scrambled ODN and free GTI-2040 barely showed any effect. No significant cytotoxicity due to the LP formulation was observed at the concentrations used in Example E.
Overcoming the delivery obstacle is the greatest challenge for ODNs in clinical application (24, 25). A variety of vehicles have been developed to facilitate delivery of ODNs (26). Polymers and lipids are two major classes of materials commonly used for condensing DNA/ODN into nanoparticles by forming polymer-DNA complexes (polyplexes) (27-31), lipid-DNA/ODN complexes (lipoplexes) (32-35), and lipid-polymer-DNA/ODN ternary complexes (LPs) (36-38), respectively.
In Example E, we developed LP nanoparticles for GTI-2040 ODN delivery. The advantage of LPs is that DNA/ODN is optimally stabilized via complex with the cationic polymer which has high charge density. Furthermore, LPs are stabilized with a lipid coating that enables flexible surface modifications such as PEGylation to promote colloidal stability, long plasma half-life, and enhanced permeability and retention (EPR) effect-mediated delivery. Also, targeting ligands such as antibodies (e.g., anti-CD52) (12, 13, 39), Tf (15), and folate (40) have been conjugated to LPs to achieve specific delivery in tumor tissue expressing the corresponding antigens or receptors. The LP formulation platform provides a useful strategy for engineering of targeted multifunctional nanoparticles for ODN delivery, such as GTI-2040, and overcome the delivery problems hitherto faced by these compounds.
Protamine sulfate, a polycationic peptide, was used as a good candidate of biodegradable cationic polymers. It can bind ODNs to form a compact structure via electrostatic interactions, and has been shown to facilitate DNA delivery (41). Lipid bilayers composed of CHEMS, a pH-sensitive lipids, and DOPE (a fusogenic lipid) undergoes a transition from lamellar to hexagonal II phase at low pH, which can destabilize endosomes through proximity following endocytosis (25). Therefore, LPs with these lipids are capable of releasing their contents in response to acidic pH within the endosomal system while remaining stable in plasma, thus improving the cytoplasmic delivery of ODNs after endocytosis. Tf, an 80 kDa iron-transporting glycoprotein, can be efficiently taken up by cells via TfR-mediated endocytosis (19, 20). TfR is considered a good target for cancer-specific delivery, as it is commonly overexpressed in cancer cells including AML (21, 22) compared to normal cells. This was confirmed (
The detailed structure of LP nanoparticles was studied with Cryo-TEM, indicating several coexisting structures.
Because of early onset of mechanisms of resistance, AML patients are commonly treated with multidrug chemotherapy regimen. GTI-2040 was combined with Ara-C, which represent the backbone for both upfront and salvage regimen in AML. The rationale for this combination is that the metabolite of Ara-C, Ara-CTP, incorporates into DNA and terminates DNA chain elongation by competing with the endogenous dCTP derived from RNR-mediated nucleotide reduction (43-46). It is believed that downregulation of the R2 subunit of RNR by GTI-2040 decreases the endogenous levels of dCTP and further increases the Ara-CTP/dNTP ratio thereby augmenting DNA incorporation of Ara-CTP (8). This combination has been studied in the phase I clinical trial at OSU, leading to promising results (7). However, the in vivo downregulation of R2 in patients treated on this trial was only approximately 20-30%. Therefore, to attain a more efficient R2 downregulation and further enhance the therapeutic efficacy of GTI-Ara-C combination, we improved the intracellular delivery of GTI-2040 by Tf-LPs. At the concentration of GTI-2040-Tf-LP as low as 1 μM, it could sensitize AML cells to Ara-C, with the IC50 of Ara-C decreased by 5 fold, thereby further showing that this combination is effective.
Targeted Delivery of GTI-2501 to KB Cells Using Cationic Lipid nanoparticle. GTI-2501 is a 20-mer oligonucleotide that is complementary to a coding region in the mRNA of R1, the large subunit of ribonucleotide reductase (RNR). RNR is a protein that is essential for DNA synthesis and cell growth in normal cells, where expression of RNR is tightly controlled. Cancer cells, however, highly overexpress RNR, which then contributes to tumor growth and malignancy. Overexpression of RNR also promotes resistance to certain chemotherapy drugs, and RNR cooperates with a variety of cancer-causing oncogenes to further promote cancer progression and metastasis. Current results provide evidence that GTI-2501 acts in a sequence-specific, dose-dependent manner to downregulate R1 with a concomitant decrease in proliferation, tumor growth and metastasis. Despite the exciting opportunities, the clinical application of ODNs has been slow due to several major challenges: rapid clearance in blood circulation, poor cellular uptake, and lack of specific targeting.
In Example F, the in vitro experiment supports that GTI-2501 can efficiently decrease R1 gene expression by this kind of lipid nanoparticle. This provides a new approach to improve the clinical efficacy of both ODNs and cationic lipid nanoparticle-mediated therapy.
Characterization of Cationic Lipid nanoparticle. Cationic lipid nanoparticle size distribution was analyzed by particle sizing systems (Santa Barbara, Calif., USA). Particles without transferrin were 111.8 nm in mean diameter. Particles with transferrin were 277.8 nm in mean diameter. Cationic lipid nanoparticle nanoparticles stayed stable for several weeks in cell culture media containing 50% serum.
Cryo-TEM examination of thin films of vitrified samples showed that lipid suspensions, at all cholesterol ratios, contained solely lipid nanoparticles. The lipid nanoparticles were unilamellar or oligolamellar, and heterogenous in shape and size.
Primers Design and Cell Culture. Reverse transcription was performed by using Superscript III first strand synthesis system for RT-PCR (Invitrogen, Carlsbad, Calif.). The housekeeping gene β-actin was used as positive control. The primers used correspond to the following cDNA sequences (the data presented in Table 7 indicate Genebank accession number). The primers were designed by Primer3 tool (v. 0.4.0).
KB cells are cultured in 6 mm wells and divided into 5 groups according to different culture conditions (Table 8).
Evaluation of R1 Gene Expression by Cationic Lipid nanoparticle-Mediated GTI-2501 Delivery. Realtime PCR results displayed that treatment with GTI-2501 caused a significant decrease in R1 mRNA, especially when lipid nanoparticle combined with holo-transferrin (
Example F shows that the strategy described herein is useful to improve the ability of cationic lipid nanoparticle carrier to target cancer cells. Example F also shows that GTI-2501 can inhibit R1 gene expression using the nanocarrier described herein in in vitro experiments. Further, this lipid nanoparticle is determined to be less toxic by realtime PCR. The nanocarriers are also useful to significantly improve the clinic efficacy of anti-cancer therapy, leading to decreased drug dosage and related side-effects.
A study of the biological function of LPN-siRNA was conducted in primary chronic lymphocytic leukemia (CLL) B cells.
A study of liposomal nanoparticle containing cholesterol-modified oligonucleotides by using neutral lipids was conducted.
A study of liposomal nanoparticle containing cholesterol-modified oligonucleotides by using neutral lipids was conducted.
Analysis of bcl-2 protein down-regulation by free G3139 (Bcl-2 anti-sense ODN) and LNP-G3139 on K562 human leukemia cells. K562 cells were treated with free 1 uM G3139 or LNP formulated G3139 for 48 hrs.
The therapeutic efficacy of antibody-targeted nanoparticles (ILPs) is shown in
In another non-limiting Example, the LP are synthesized by a microfluidic focusing method which is useful to improve the uniformity of the nanoparticle size and structure, as well as increase ODN loading with less lipids and condensing agents for better transfection efficiency and less cytotoxicity.
A microfluidic hydrodynamic focusing (MF) system to prepare lipopolyplex (LP) containing antisense deoxyoligonucleotide (G3139, oblimerson sodium, or Genasense™), for targeting Bcl-2, an antiapoptotic protein commonly overexpressed in numerous cancers was developed. The lipopolyplex consist of ODN:protamine:lipids (1:0.3:12.5 wt/wt ratio) and the lipids included DC-Chol:egg PC:PEG-DSPE (40:58:2 mol/mol %). Using k562 human erythroleukemia cells, which contain an abundance of Bcl-2 and overexpression of transferrin receptors (TfR), and G3139 as a model cell line and drug, respectively, the Bcl-2 downregulation at the mRNA and protein levels were compared between conventional bulk mixing (BM) method and microfluidic hydrodynamic focusing (MF) method, in addition to cellular uptake and apoptosis. The lipopolyplex size and surface charge was characterized by dynamic light scattering (DLS) and zeta potential (ξ) measurement while the ODN encapsulation efficiency was determined by gel electrophoresis. Cryogenic transmission electron microscopy (Cryo-TEM) was used to determine the morphology of the LPs. These results demonstrated that MF produced LP nanoparticles had smaller size and size distribution but with similar morphology. Furthermore, MF LP nanoparticles more efficiently downregulated Bcl-2 protein level than BM LP nanoparticles with or without conjugating LPs with transferrin.
The in vivo application of therapeutic molecules (free/naked plasmids or ODNs) are limited by rapid clearance from blood circulation, lack of selectivity for target cells, low permeability through the cell membrane, and degradation by serum nucleases. To overcome these limitations, plasmids or ODNs have been complexed with polymers or lipid nanoparticles. Lipid nanoparticles are self-assembling vesicles that can encapsulate hydrophilic drugs in their interior aqueous core, whereas lipophilic and amphiphilic drugs can be embedded in the lipid bilayers.
In Example L, we demonstrate strategy for nanoparticle manufacturing based on microfluidic technology. By precisely controlling the flow conditions and mixing process of the reagents at the micrometer scale, nanoparticles with uniform and well-defined size, structure, and pharmacological functions are synthesized. These nanoparticles are especially useful for efficient delivery of DNA oligonucleotide compounds to cancer cells.
In one embodiment, one or more of the following are incorporated into the nanoparticles: protamine, which stabilizes ODN in serum and increases delivery efficiency; transferrin which shields LPs from the serum proteins and for targeting transferrin receptors (TfR); and PEG-DSPE which further stabilizes the LPs against plasma protein adsorption and clearance by the RES. The method provides a stable lipopolyplex (LP) formulation that yields nanoparticles of sizes less than about 150 nm, high ODN entrapment efficiency, colloidal stability, long circulation time, and specific targeting to cancerous cells.
The lipopolyplex (LP) nanoparticles, i.e. lipid nanoparticles containing DNA, are assembled in the microdevice specifically for delivery into cancer cells.
Materials and Methods.
Egg phosphatidylcholine (egg PC), 3β-[N-(N′,N-dimethylaminoethane)-carbamoyl] cholesterol (DC-Chol) and distearoyl phosphatidylethanolamine-N-[maleimide-polyethylene glycol, M.W. 2000] (Mal-PEG-DSPE) were purchased from Avanti Polar Lipids (Alabaster, Ala.). Methoxy-PEG2000-DSPE (PEG-DSPE) was purchased from Genzyme Corporation (Cambridge, Mass.). Human holo-transferrin (Tf), 2-iminothiolane (Traut's reagent), protamine sulfate, and other chemicals and reagents were purchased from Sigma (St. Louis, Mo.). All tissue culture media and supplies and M-murine leukemia virus reverse transcriptase were purchased from Invitrogen (Carlsbad, Calif.). RNeasy mini kit, RNAse inhibitor, and Float-A-Lyzer were purchased from Qiagen (Valencia, Calif.), Promega (Madison, Wis.), and Spectrum Labs (Rancho Dominguez, Calif.), respectively.
Antisense oligonucleotides. All ODNs used in this study were fully phosphorothioated. Antisense ODN G3139 (5′-TCT CCC AGC GTG CGC CAT-3′) [SEQ ID NO:1] and its fluorescence-labeled derivative, FITC-03139 (G4243).
Microfluidic devices design and fabrication. Plastic microfluidic devices were fabricated. The microfluidic hydrodynamic focusing (MF) devices were designed in AutoCAD (Autodesk, San Rafael, Calif.) and a g-code program was generated and then transferred into a high precision computer numerically controlled (CNC) machine (Aerotech, Inc.) which was used to machine the patterns on a poly(methyl methacrylate) (PMMA) plate. The channel widths were varied by using the appropriate end mill sizes. A 45 μm thick PMMA film was thermally laminated to form the closed channels by passing the PMMA/film sandwich through a thermal laminator (GBC, Inc.). Prior to thermal bonding, the microchannels were gently brushed to remove any debris and then the PMMA plates were sonicated in IPA/DI H2O (1:10) for 5-10 min to remove grease and then blown dry. After lamination, fluidic connectors were bonded onto the PMMA plate by applying a UV curing adhesive around the perimeter of the connectors. The connectors were aligned over the inlet/outlet openings and the adhesive was cured by exposure to UV irradiation (Novacure 2100, EFXO Corp., Quebec, Canada) for 10 sec. The assembled devices were sterilized overnight under UV light in a cell culture hood prior to experimentation.
The MF device consists of three inlet ports and one outlet port. The inlet ports are each connected to sterile syringes containing protamine or lipids or protamine/lipids or ODN solution. At inlet port 1 or 2, a fluid stream was introduced into each port that split into 2 side microchannel streams (microchannels a and c or e and f) while at inlet port 3, a fluid stream was introduced in the center microchannel (microchannel b). The products stream was collected at the outlet port (microchannel g). Two flow configurations were used to produce LPs as shown in Table 9. The protamine (microchannels a and c) and lipids (microchannels e and f) or protamine/lipids streams (microchannels a and c or e and f) would be injected first and then the ODN stream. After the ODN stream has entered and the hydrodynamic focusing established, the products were flowed for a further 3-5 min to allow for steady state before being collected in sterile tubes at the outlet port (microchannel g). The magnitude of the hydrodynamic focusing was controlled by altering the flow rate ratio (FR) of the side streams to the middle stream. FR is the ratio of total flow rate to the middle stream flow rate. Two programmable syringe pumps (Pump 33, Harvard Apparatus, Holliston, Mass.) were used to control the fluid flow rates independently. For flow visualization, the MF device was mounted on an inverted microscope stage (Nikon Eclipse 2000U) with a 10× Nikon Plan Fluoro objective.
Cell culture. All cells, purchased from American Type Culture Collection (ATCC) (Manassas, Va.), were cultured in RPMI 1640 media supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, 100 μg/mL streptomycin, and L-glutamine at 37° C. in a humidified atmosphere containing 5% CO2.
Preparation of transferrin conjugated PEG-DSPE (Tf-PEG-DSPE) and Tf-receptor targeted G3139-containing LPs (Tf-LP). Transferrin was conjugated to PEG-DSPE. Briefly, holo (diferric)-transferrin (holo-Tf) in 1× phosphate-buffered saline (PBS, pH=8) was reacted with 5× Traut's reagent to yield thiolated Tf (holo-Tf-SH). Free Traut's reagent was removed through column separation with 1× phosphate-buffered saline (PBS, pH=6.5) using protein assay (Bio-Rad) to detect Tf in the elution. Holo-Tf-SH was then reacted with micelles of Mal-PEG-DSPE at a molar ratio of protein-to-lipid of 1:10 for 2 h at room temperature in 1×PBS (pH=6.5) and dialyzed using a SpectraPor Float-A-Lyzer MWCO 5,000 Dalton (Spectrum Labs, Rancho Dominguez, Calif.) against 1×PBS (pH=7.4) to form Tf-PEG-DSPE as shown in
A post-insertion method was adopted to incorporate Tf ligand into ODN-loaded LPs. ODN-loaded LPs were incubated with Tf-PEG-DSPE for 1 hour at 37° C. at Tf-PEG-DSPE-to-LP lipid ratio of 1:100 (1 mol % based on DSPE-PEG) to form Tf-LPs.
Preparation of G3139-containing LPs by bulk mixing (BM) and microfluidic hydrodynamic focusing (MF) methods. An ethanol dilution method was used to prepare the LPs containing G3139. For the BM method as shown in
For the MF method, as shown in
For the first configuration, at junction I, an ODN solution stream was introduced in the center microchannel, b, while two protamine sulfate solution streams were introduced in the side microchannels, a and c, to hydrodynamically focus the ODN into a narrow stream to form ODN/protamine nanoparticles or “proticles” via electrostatic interaction between negatively charged ODN and positively charged protamine sulfate. Immediately downstream (˜200 μm) at junction II, another two lipids streams were introduced in the side microchannels, e and f, to further sandwich and squeeze the ODN/protamine streams to form ODN/protamine/lipids nanoparticles or lipopolyplexes. The final weight ratio of ODN:protamine:lipids was 1:0.3:12.5 and the ethanol concentration was 40%. The flow rates for ODN, protamine, and lipids streams were 20, 20, and 450 μL/min, respectively, and were controlled independently by two syringe pumps (Pump33, Harvard Apparatus, Holliston, Mass.). Both ODN and protamine were prepared in sodium citrate buffer (20 mM, pH 4) whereas the lipids mixture was in 100% ethanol.
For the second flow configuration, at junction I, a protamine/lipids mixture stream was introduced in the center microchannel, b, and sandwiched by two ODN side streams, a and c; and immediately downstream (˜200 μm) at junction II, another two protamine/lipids streams, e and f, were introduced to further sandwich and squeeze the ODN/protamine/lipids streams. Again, the final weight ratio of ODN:protamine:lipids was 1:0.3:12.5 and the ethanol concentration was 40%. The flow rates for protamine/lipids, ODN, and protamine/lipids streams were 200, 20, and 200 μL/min, respectively, and were controlled independently by two syringe pumps (Pump33, Harvard Apparatus, Holliston, Mass.).
The pre-LPs produced by both methods vortexed for 30 sec and then sonicated for 20 min followed by dialyzing against sodium citrate buffer (20 mM, pH=4) for 1-2 hour and then in 1×PBS (pH=7.4) overnight at room temperature, using a SpectraPor Float-A-Lyzer MWCO 10,000 Dalton to raise the pH to neutral in order to remove unbound ODN, reduce ethanol, and to partially neutralize the cationic DC-Chol.
For LPs and Tf-LPs containing FITC-labeled ODN (G4243) was used in the preparation of LPs. After dialysis, the LPs were sterilized by filtering through 0.2 μm PVDF filter and stored at 4° C. until further use.
Particle sizes and zeta potentials (ξ). The particle sizes and zeta potentials (ξ) of non-targeted and targeted LPs were analyzed on BI-200SM and ZetaPALS (Brookhaven Instruments Corp., Holtsville, N.Y.), respectively. Volume-weighted Gaussian distribution analysis was used to determine the mean LP diameter and the standard deviation. Each data represents mean±standard deviation of four separate experiments.
ODN encapsulation efficiency. To determine ODN encapsulation, ODN-LP after dialysis was diluted in 1×TE or lysed in 1% sodium dodecyl sulfate (SDS), heated at 95° C. for 5 min in a thermal cycler, then mixed with gel-loading solution at a ratio of 1:5 (Sigma), and loaded on 3% ReadyAgarose gel plus ethidium bromide (Bio-Rad Laboratories, Hercules, Calif.). Electrophoresis was carried out at 100 V for 45-60 min in a 1×TAE running buffer (Invitrogen). A digital image of the gel was captured under UV light using ChemiDoc XRS system (Bio-Rad). The encapsulation efficiency of ODN in the LP was calculated based on the ratio of the amount of ODN before and after SDS treatment and against a standard curve of ODN concentrations.
Cryogenic transmission electron microscopy (cryo-TEM) of LPs. Cryogenic transmission electron microscopy (cryo-TEM) imaging was performed. Briefly, samples were examined in a Philips CM120 microscope (Eindhoven, The Netherlands) operated at 120 kV, using an Oxford CT-3500 cooling holder and transfer station (Abingdon, England). Specimens were equilibrated in the microscope below −178° C., then examined in the low-dose imaging mode to minimize electron beam radiation damage, and recorded at a nominal underfocus of 2-4 μm to enhance phase contrast. Images were acquired digitally by a Gatan MultiScan 791 cooled charge-coupled device camera (Pleasanton, Calif.) using the Digital Micrograph 3.1 software package. Cryo-TEM analysis was performed at Technion-Israel Institute of Technology, Haifa, Israel.
Transfection studies. Leukemia cells were plated in 6-well tissue culture plates at 106/well in 1.2 mL RPMI1640 medium containing 10% FBS. An appropriate amount of Tf-LPs or one of the other formulations was added into each well to yield a final ODN concentration of 1 μM. The cells were then incubated at 37° C. in a CO2 incubator for 6 hours. The cells were washed, transferred to fresh medium, incubated for another 24 to 48 hours, and then analyzed for bcl-2 mRNA level and Bcl-2 protein level by real-time RT-PCR and Western blot, respectively. All transfection experiments were performed in RPMI1640 medium containing 10% FBS.
Quantification of bcl-2 mRNA level by real-time RT-PCR. The bcl-2 mRNA level in leukemia cells was evaluated using real-time RT-PCR as follows. Total RNA was extracted using RNeasy Mini kit (Qiagen) in accordance to the manufacturer's protocol and concentrations were measured at O.D. 260 nm using a spectrophotometer (Thermo Fisher Scientific, Waltham, Mass.). For cDNA synthesis, 2 μg of total mRNA from each sample was mixed with 1.5 μL, of 20 μM random hexamer and nuclease free water to a total volume of 17 μL. and heated to 70° C. for 5 minutes followed by cooling on ice for at least 5 minutes. 12.9 μL, of master mixture containing 5× reaction buffer, 100 mM dithiothreitol, 10 mM of each dNTP, M-murine leukemia virus reverse transcriptase, and RNAse inhibitor was added into each sample and the samples were then incubated in a thermal cycler (Bio-Rad Laboratories, Hercules, Calif.) at 42° C. for 60 minutes followed by 94° C. for 5 minutes. The resulting cDNA was amplified by real-time PCR iQ5 (Bio-Rad Laboratories, Hercules, Calif.). The following oligonucleotides primers designed by the Primer Express program (Applied Biosystems) were used: Bcl-2, forward and reverse primers were CCCTGTGGATGACTGAGTACCTG [SEQ ID NO:2] and CCAGCCTCCGTTATCCTGG [SEQ ID NO:3], respectively.
Each cDNA sample was used as a template in two separate PCR amplification reactions prepared in a SYBR Green (BioRad) mastermix: (a) a set of primers for Bcl-2 transcripts, and (b) primers for a housekeeping gene ABL. The housekeeping gene ABL mRNA was used as an internal control. bcl-2 mRNA was normalized to ABL mRNA levels.
Quantification of Bcl-2 protein by Western blot. Western blot was carried out to evaluate the Bcl-2 protein level. Untreated and ODN-treated cells were incubated with a lysis buffer containing a protease inhibitor cocktail III (CalBiochem, San Diego, Calif.) on ice for 20 min followed by sonication and centrifugation of the cell lysate at 13,200 rpm and 4° C. for 10 min. Then the supernatant was collected and the protein concentrations were determined by BCA assay (Pierce, Rockford, Ill.) on a spectrophotometer. An aliquot of 100 protein from each sample was loaded onto a 15% Ready Gel Tris-HCl polyacrylamide gel (Bio-Rad, Hercules, Calif.) for 2 hr at 100 V, followed by transfer of the proteins to a PVDF membrane overnight. After blocking with 5% non-fat dry milk in 1× Tris-buffered saline/Tween-20 (TBST) for 1 h, the membranes were incubated with monoclonal mouse anti-human Bcl-2 (Dako, Carpinteria, Calif.) or polyclonal goat anti-human actin antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.) also in 5% non-fat dry milk in TBST. After 2 h of incubation at room temperature (or at 4° C. overnight), membranes were washed 4 times (15 min each) with TBST, followed by incubation with horseradish peroxidase-conjugated sheep antimouse IgG (Amersham Biosciences, Piscataway, N.J.) or rabbit antigoat IgG (Pierce, Rockford, Ill.) in 2.5% non-fat dry milk in TBST for 1 h at room temperature. Membrane was then developed with ECL (GE Healthcare, United Kingdom) or Pierce SuperSignal West Dura Extended Duration Substrate (Pierce, Rockford, Ill.) and imaged with Kodak X-OMAT film (Kodak, Rochester, N.Y.). Bcl-2 protein expression levels were quantified by ImageJ software (NIH Image, Bethesda, Md.) and normalized to the β-actin level from the same sample.
Cellular uptake of FITC-labeled ODN containing LPs analyze by flow cytometry (FCM). Cellular uptake of FITC-labeled ODN (G4243) LPs and Tf-LP was evaluated by incubating 3×105 cells with 0.5 μM FITC-ODN LPs or Tf-LPs in RPMI1640 medium containing 10% FBS for 6, 24, and 48 h at 37° C. and 5% CO2 in an incubator. The cells were collected by centrifugation, washed twice with cold 1×PBS (pH=7.4), and fixed in 4% paraformaldehyde. As negative control, cells were treated with 1×PBS (pH=7.4). The uptake of FITC-ODNs was observed by fluorescence microscope and quantified by flow cytometry. All measurements were carried out in triplicates to determine the mean fluorescence intensity and the standard deviation (MFI±SD).
Annexin V-FITC staining analyze by flow cytometry (FCM). K562 cells (1×106) were treated with different formulations at a concentration of 1 μM in serum containing medium at 37° C. for 72 h. Cells were washed once with PBS and resuspended in PBS. Cells were then stained with Annexin V-FITC using a kit (BD Biosciences Pharmingen, San Jose, Calif.). Early apoptotic cells bound to Annexin V-FITC but excluded propidium iodide (PI). Cells in late apoptotic stages were labeled with both Annexin V-FITC and propidium iodide. Cells stained with Annexin V-FITC and PI were detected and quantified by flow cytometry (Becton-Dickinson, Heidelberg, Germany) (Ex=488 nm, Em=530 nm) using FITC signal detector (FL1) and PE emission signal detector (FL2), respectively. Results were processed using the Cellquest software (Becton-Dickinson) based on a percentage of total gated cells (104 cells).
Statistical analysis. Data were represented as mean±standard deviations (S.D.) and analyzed by two-tailed Student's t-test using JMP software (Cary, N.C.). p<0.05 was considered statistically significant.
Microfluidic device, LP production setup, and flow pattern. A 5-inlet polymeric MF system to produce LP nanoparticles was designed and fabricated as shown in
LP nanoparticles size, zeta potential, and morphology. The average particle size was measured by dynamic light scattering (DLS). For BM method, mixing ODN and protamine in sodium citrate buffer resulted in large aggregates (data not shown).
For the first flow configuration, the flow rates of ODN, protamine sulfate, and lipids were 20, 20, and 450 μL/min (FRR=24.5), respectively. The LP nanoparticle size was 236.9±2.5 nm. Increasing the lipids stream flow rate to 600 μL/min (FRR=32) resulted in only a slight decrease in the particle size to 205.0±5.6 nm.
For the second flow configuration, the average particle size was also measured by dynamic light scattering (DLS) at each step in the LP synthesis process by BM and MF methods as shown in
Table 10 shows the particle size and zeta potential of the LP. The average particle size for BM and MF lipopolyplex before and after post insertion of Tf-PEG-DSPE were 131.0±21.0 nm and 126.7±18.5 and 106.8±5.5 nm and 107.1±8.0 nm, respectively. The zeta potential of the BM and MF LP nanoparticles before and after post insertion were +11.6±3.6 mV and +7.9±1.3 mV and +3.6±2.9 mV and +2.5±4.2 mV, respectively. The decrease in zeta potential indicated that the Tf-DSPE-PEG was successfully incorporated into the LP nanoparticles. Each data represents mean±standard deviation of four separate experiments and p<0.05 is indicated by * symbol.
The morphology of LP cannot be easily visualized by optical microscopy and atomic force microscopy (AFM). Therefore, the LP morphology was characterized using cryogenic transmission electron microscopy (Cryo-TEM) where the frozen hydrated samples can be imaged directly with high spatial resolution in their native morphology since the LPs are embedded in a thin film of vitreous ice. The samples were vitrified within 96 hrs after preparation and imaged within 14 days.
As shown in
After production, the solution was dialyzed twice, filtered using 0.2 μm PVDF filter, and stored at 4° C. We tested both nylon and PVDF filters for sample sterilization and found that more than 90% of ODN was lost after filtering with the nylon filter as compared to approximately 20% of ODN lost when using the PVDF filter (data not shown).
Analysis of ODN encapsulated in LPs. After LP nanoparticles production by BM and MF methods, the solutions were dialyzed twice, filtered using 0.2 μm PVDF filter, and stored at 4° C. In certain embodiments, the type of membrane material used for filtering and sterilizing the samples was important to retain ODN in the samples. We tested both nylon and PVDF filters for sample sterilization and found that more than 90% of ODN was lost after filtering with the nylon filter as compared to approximately 20% of ODN lost when using the PVDF filter (data not shown). After PVDF filtering, the ODN encapsulation efficiency of BM and MF produced LPs were analyzed by electrophoresis in 3% agarose gel at 100V for 45-60 min. As shown in
In vitro Bcl-2 downregulation. The effect of G3139 in the BM and MF LPs on downregulation of Bcl-2 at both protein and mRNA levels in K562 cells was evaluated by western blot and real-time RT-PCR, respectively. K562 cells were treated with free G3139, Tf conjugated G3139-containing lipid nanoparticles produced by BM (BM Tf-LP), non-targeted G3139-containing lipid nanoparticles produced by MF (MF LP), and Tf conjugated G3139-containing lipid nanoparticles produced by MF (MF Tf-LP). G3139 concentration in the free group was 1 μM in all experiments. From
From
The effect of G3139 concentration in the Tf conjugated BM and MF LPs on downregulation of Bcl-2 protein level was also evaluated.
As shown in
Cellular uptake of FITC-labeled G3139 analyzed with FCM. The relative uptake of LPs might play a significant role in Bcl-2 downregulation in the IC562 cells. Flow cytometry was used to analyze the uptake of non targeted and targeted LPs containing FITC-labeled G3139 produced by BM and MF methods as shown in
In
Induction of apoptosis by G3139 analyzed with FCM. For healthy cells, phosphatidylserine (PS) is located in the inner leaflet of the cell membrane. However, when cells are in the early apoptotic pathway, PS, translocates from the interior to the exterior of the cell membrane and can be recognized by Annexin V-FITC. The cells were simultaneously stained with viability dye propidium iodide (PI) where viable cells will exclude both the PI and the AV-FITC from the interior of the cell. In this analysis, the cell debris was excluded by gating the region believed to be containing cells in the Forward versus Side Scatter dot plot.
Table 10 shows the flow cytometry analysis of Annexin V-FITC stained k562 cells after treatment with G3139 and LP formulations. At 24 hr post transfection, the percentage of untreated control, free G3139, BM Tf-LP, MF LP, and MF Tf-LP treated cells in early stages of apoptosis were 18.1%, 25.5%, 9.7%, 6.0%, and 7.0%, respectively, and in late stages of apoptosis were 6.0%, 6.8%, 13.4%, 12.5%, and 19.5%, respectively. At 48 hr post transfection the percentage of cells in early stages of apoptosis were 24.1%, 18.0%, 18.4%, 12.3%, and 11.9%, and in late stages of apoptosis were 18.1%, 25.5%, 9.7%, 6.0%, and 7.0%, respectively.
The 5-inlet polymeric microfluidic hydrodynamic focusing (MF) system is useful for producing lipid-polymer-DNA nanoparticles (lipopolyplex or LP) of controlled size, size distribution, and uniform morphology. The MF system can precisely control the flow conditions and mixing process of reagents at the micrometer scale by using syringe pumps to independently control the flow rate of the fluid streams. Since the Reynolds number in the microchannel is typically less than 1, the flow is strictly laminar which allows well-defined mixing to be controlled solely by interfacial diffusion between the multiple flow streams in a single microchannel. In certain embodiments, this is important since BM is a heterogeneous and uncontrolled chemical and/or mechanical process which can result in a heterogeneous population of LPs.
There are a few factors that govern the successful application of LPs in vitro and in vivo such as particle size and size distribution, surface charge or zeta potential, ODN encapsulation efficiency, colloidal stability, etc.
In Example L, the lipids used in the formulation included DC-Chol, egg PC, and PEG-DSPE. DC-Chol is a cationic lipid with a tertiary amine headgroup. This allows for assembly of LPs at pH 4, where DC-Chol is fully ionized, and reduction of positive charge of the LPs upon returning the pH to 7.4, where DC-Chol is partially deprotonated
The amount of cationic lipid (DC-Chol) was kept relatively low to produce a zeta potential close to zero. PEG-DSPE was added to the bilayer to reduce plasma protein binding and to provide enhanced particle colloidal stability. For targeting, transferrin (Tf) was used and incorporated into Tf-DSPE-PEG micelles for post insertion. Tf was an iron transport protein that, when associated with ferric ion binds with high affinity to transferrin receptor (TfR), which is overexpressed frequently on leukemia cells. Transferrin receptor (TfR) targeted lipoplexes have been shown to improve the delivery of G3139 to human erythroleukemia K562 cells, which overexpress TfR. Both the non-targeted and transferrin-receptor targeted nanoparticles carrying G3139 produced by BM (BM Tf-LP) and MF (MF Tf-LP) were applied to the K562 leukemia cells to evaluate efficacy of Bcl-2 downregulation.
We have characterized particle size and zeta potential of the nanoparticles prepared by the MF and BM methods. For the first flow configuration, the protamine binds to the ODN via electrostatic interaction between negatively charged ODN and positively charged protamine to form a compact ODN/protamine nanoparticles or “proticles”. The lipids streams which were introduced sequentially would then sandwich the proticles. However, since the proticles have a solid core and are negatively charge (−29.8 mV) at ODN/protamine of 1/0.3 (wt/wt), their sizes are dominated by their solid cores. In fact, increasing the flow rate of the lipids stream did not significantly decrease the size of the proticles even though; a higher FRR results in a narrower ODN/protamine streams width, i.e. a shorter diffusion length. Proticles have a size range of 100-300 nm when mixed in DI water, however, when mixed in sodium citrate buffer, proticles tend to aggregate almost instantly. Therefore, protamine was premixed with lipids before addition of the ODN solution.
As shown in
The surface charge (zeta potential) of the nanoparticles can influence the stability and cellular uptake of the nanoparticles. The zeta potential of the MF LP nanoparticles was also slightly lower than the BM particles probably due to more Tf-DSPE-PEG incorporation into the MF LPs. To enhance cellular uptake of LPs, the zeta potential is typically greater than 25 mV. Since moderate zeta potentials were obtained for both BM and MF Tf-LPs, this indicates that the enhance cellular uptake of the MF LP nanoparticles is due to their smaller size and size distribution in addition to the transferrin receptor (TfR) targeting.
The encapsulation efficiency of the two types of LPs was analyzed by electrophoresis in 3% agarose gel at 100V for 45 min. As shown in
For targeting, transferrin (Tf) was used and incorporated into Tf-DSPE-PEG micelles for post insertion. Transferrin receptor (TfR) targeted lipopolyplexes (LPs) have been shown to improve the delivery of G3139 to human erythroleukemia K562 cells, which overexpress TfR.
In Example L, both the non-targeted and transferrin-receptor targeted nanoparticles carrying G3139 produced by BM (BM Tf-LP) and MF (MF Tf-LP) were applied to K562 leukemia cells. As shown in
Apoptosis is the programmed cell death in the cell's life cycle. G3139 has been shown to enhance apoptosis, however, in Example L the percentage of cells undergoing apoptosis were similar between free, BM Tf-LP, MF LP, and MF Tf-LP treated cells. Therefore, apoptosis induced by G3139 might not have played a significant role in Bcl-2 downregulation. As such, Example L shows a novel 5-inlet MF system and produced LP nanoparticles with smaller size and size distribution, moderate zeta potential, and high ODN encapsulation efficiency. The MF G3139 Tf-LP nanoparticles exerted greater downregulation effect on Bcl-2 in K562 cells than the particles produced by the conventional BM method, indicating that MF produced LP improved ODN delivery via better size control during the particle assembly.
Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents and published patent specifications are hereby incorporated by reference into the present disclosure to more fully describe the state of the art to which this invention pertains.
While the invention has been described with reference to various and preferred embodiments, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the essential scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed herein contemplated for carrying out this invention, but that the invention will include all embodiments falling within the scope of the claims.
This application claims the benefit of U.S. Provisional Application No. 61/009,268 filed Dec. 27, 2007, the disclosure of which is incorporated herein by reference.
This invention was made with Government support and the Government has rights in this invention under the grant under the National Science Foundation Grant NSEC (EEC-0425626) Sponsored Research Project Number 60003575.
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/US08/88168 | 12/23/2008 | WO | 00 | 8/23/2010 |
Number | Date | Country | |
---|---|---|---|
61009268 | Dec 2007 | US |