Patent Application
20240252616
This application claims priority of Indian Provisional Patent Application No. 202041030397, filed 16 Jul. 2020, and Indian Provisional Patent Application No. 202041056151, filed 23 Dec. 2020, as well as the associated sequence listings filed on those same dates, the entire contents of which are incorporated herein by reference.
This invention generally relates to a codon deoptimized severe acute respiratory syndrome coronavirus 2 (SARS-COV-2) genome. In particular, embodiments of the invention concern a vaccine comprising live attenuated SARS-COV-2 comprising a partly codon deoptimized viral genome, SARS-COV-2 comprising a partly codon deoptimized viral genome, as well as their use in methods of treatment and prevention of viral infection.
Severe acute respiratory syndrome coronavirus 2 (SARS-COV-2) is a strain of beta-coronavirus that causes respiratory illness and is responsible for the COVID-19 pandemic. Multiple other vaccine formulations are currently under development around the world (e.g. RNA and DNA vaccine, subunit vaccine, inactivated whole virus vaccine, and recombinant virus vaccine). Codon deoptimization technology, applicable for construction of live attenuated vaccine candidates, at the time of filing has not been used to develop a commercially available live attenuated SARS-COV-2 vaccine.
Codon usage bias refers to the redundancy of the genetic code, where amino acids are determined by synonymous codons that occur in different organisms at different frequencies. The process of codon optimization, where each amino acid is encoded by the most abundant codon, is frequently exploited to improve gene expression in heterologous systems, a strategy that is used to increase immune responses to antigens. In contrast, codon deoptimization (CD), where all or a selected number of amino acid residues are encoded by a less or the least abundant codon(s), is used to decrease gene expression leading to reduced viral protein production and consequently reduced replication while the composition of viral antigens remains the same. The approach can also result in additional virus attenuation by removing/altering of RNA secondary structures of functional importance (Song Y, Gorbatsevych O, Liu Y, Mugavero J, Shen S H, Ward C B, Asare E, Jiang P, Paul A V, Mueller S. Wimmer E. Limits of variation, specific infectivity, and genome packaging of massively recoded poliovirus genomes. Proc Natl Acad Sci USA. 2017 Oct. 10; 114(41): E8731-E8740. doi: 10.1073/pnas.1714385114. Epub 2017 Sep. 25).
Described herein, amongst other things, is a vaccine comprising live attenuated severe acute respiratory syndrome coronavirus 2 (SARS-COV-2) comprising a partly codon deoptimized viral genome, SARS-COV-2 comprising a partly codon deoptimized viral genome, as well as their use in methods of treatment and prevention of viral infection.
According to a first embodiment of the present invention, there is provided a live attenuated severe acute respiratory syndrome coronavirus 2 (SARS-COV-2), SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid comprising a partly codon deoptimized SARS-COV-2 genome.
According to a second embodiment of the present invention, there is provided a recombinant, isolated or substantially purified nucleic acid comprising a partly codon deoptimized SARS-COV-2 genome or partly codon deoptimized region thereof.
According to a third embodiment of the present invention, there is provided a vector, plasmid or genetic construct comprising the nucleic acid of the second embodiment.
According to a fourth embodiment of the present invention, there is provided a cell or isolate containing the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment, the nucleic acid of the second embodiment, or the vector, plasmid or genetic construct of the third embodiment.
According to a fifth embodiment of the present invention, there is provided a vaccine comprising the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment, the recombinant, isolated or substantially purified nucleic acid of the second embodiment, the vector, plasmid or genetic construct of the third embodiment, or the cell or isolate of the fourth embodiment.
According to a sixth embodiment of the present invention, there is provided a pharmaceutical preparation comprising the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment, the recombinant, isolated or substantially purified nucleic acid of the second embodiment, the vector, plasmid or genetic construct of the third embodiment, or the cell or isolate of the fourth embodiment.
According to a seventh embodiment of the present invention, there is provided an immunogenic composition comprising the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment, the recombinant, isolated or substantially purified nucleic acid of the second embodiment, the vector, plasmid or genetic construct of the third embodiment, or the cell or isolate of the fourth embodiment.
According to an eighth embodiment of the present invention, there is provided a method of: (1) vaccinating a subject; (2) prophylactically immunizing a subject against SARS-CoV-2 or SARS-COV-2-like virus; (3) preventing a subject from contracting a SARS-COV-2 infection naturally or a SARS-COV-2-like infection naturally; (4) reducing the severity of a natural SARS-COV-2 disease or natural SARS-COV-2-like disease in a subject; or (5) treating a subject having a natural SARS-COV-2 infection or natural SARS-COV-2-like infection, said method comprising the step of administering to the subject: the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment; the recombinant, isolated or substantially purified nucleic acid of the second embodiment; the vector, plasmid or genetic construct of the third embodiment; the cell or isolate of the fourth embodiment; the vaccine of the fifth embodiment; the pharmaceutical preparation of the sixth embodiment; or the immunogenic composition of the seventh embodiment.
According to a ninth embodiment of the present invention, there is provided the use of: the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment; the recombinant, isolated or substantially purified nucleic acid of the second embodiment; the vector, plasmid or genetic construct of the third embodiment; the cell or isolate of the fourth embodiment; the vaccine of the fifth embodiment; the pharmaceutical preparation of the sixth embodiment; or the immunogenic composition of the seventh embodiment, in the preparation of a medicament for: (1) vaccinating a subject; (2) prophylactically immunizing a subject against SARS-COV-2 or SARS-COV-2-like virus; (3) preventing a subject from contracting a SARS-COV-2 infection naturally or a SARS-COV-2-like infection naturally; (4) reducing the severity of a natural SARS-COV-2 disease or natural SARS-COV-2-like disease in a subject; or (5) treating a subject having a natural SARS-COV-2 infection or natural SARS-COV-2-like infection.
According to a tenth embodiment of the present invention, there is provided: a live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment; a recombinant, isolated or substantially purified nucleic acid of the second embodiment; a vector, plasmid or genetic construct of the third embodiment; a cell or isolate of the fourth embodiment; a vaccine of the fifth embodiment; a pharmaceutical preparation of the sixth embodiment; or an immunogenic composition of the seventh embodiment, for use in: (1) vaccinating a subject; (2) prophylactically immunizing a subject against SARS-COV-2 or SARS-COV-2-like virus; (3) preventing a subject from contracting a SARS-COV-2 infection naturally or a SARS-COV-2-like infection naturally; (4) reducing the severity of a natural SARS-COV-2 disease or natural SARS-COV-2-like disease in a subject; or (5) treating a subject having a natural SARS-COV-2 infection or natural SARS-COV-2-like infection.
According to an eleventh embodiment of the present invention, there is provided a method of generating a live attenuated SARS-COV-2 vaccine, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid, or recombinant, isolated or substantially purified nucleic acid comprising a partly codon deoptimized SARS-COV-2 genome or partly codon deoptimized region thereof, comprising the step of partly codon deoptimizing a SARS-COV-2 genome.
According to a twelfth embodiment of the present invention, there is provided a method of preparing a vaccine comprising live attenuated SARS-COV-2, said method comprising the steps of: (1) codon deoptimizing a SARS-COV-2 genome to produce a partly codon deoptimized live attenuated SARS-COV-2; and (2) enabling the partly codon deoptimized live attenuated SARS-COV-2 to replicate.
According to a thirteenth embodiment of the present invention, there is provided a method of preparing a vaccine comprising codon deoptimized SARS-COV-2, said method comprising the steps of: optionally. (1) codon deoptimizing a SARS-COV-2 genome to produce a partly codon deoptimized live attenuated SARS-COV-2; (2) enabling the partly codon deoptimized live attenuated SARS-COV-2 to replicate; and (3) preparing a vaccine dose containing the replicated SARS-COV-2 of step (2).
According to a fourteenth embodiment of the present invention, there is provided a method of eliciting an immune response in a subject, said method comprising the step of administering a live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-CoV-2 nucleic acid of the first embodiment; the recombinant, isolated or substantially purified nucleic acid of the second embodiment; the vector, plasmid or genetic construct of the third embodiment; the cell or isolate of the fourth embodiment; the vaccine of the fifth embodiment; the pharmaceutical preparation of the sixth embodiment; or the immunogenic composition of the seventh embodiment to the subject to thereby elicit an immune response.
For the description of clones below, ‘D’ denotes deoptimized and ‘W’ denotes wildtype and therefore not deoptimized.
SEQ ID NO:1. Clone pCCI-4K-SARS-COV-2-DDDDD. All five sub-fragments were deoptimized.
SEQ ID NO:2. Clone pCCI-4K-SARS-COV-2-DDDDW. The first four sub-fragments were deoptimized.
SEQ ID NO:3. Clone pCCI-4K-SARS-COV-2-DDDWD. Sub-fragments one, two, three, and five were deoptimized.
SEQ ID NO:4. Clone pCCI-4K-SARS-COV-2-DDDWW. The first three sub-fragments were deoptimized.
SEQ ID NO:5. Clone pCCI-4K-SARS-COV-2-DDWDD. Sub-fragments one, two, four, and five were deoptimized.
SEQ ID NO:6. Clone pCCI-4K-SARS-COV-2-DDWDW. Sub-fragments one, two, and four were deoptimized.
SEQ ID NO:7. Clone pCCI-4K-SARS-COV-2-DDWWD. Sub-fragments one, two, and five were deoptimized.
SEQ ID NO:8. Clone pCCI-4K-SARS-COV-2-DDWWW. The first two sub-fragments were deoptimized.
SEQ ID NO:9. Clone pCCI-4K-SARS-COV-2-DWDDD. First, third, fourth, and fifth sub-fragments were deoptimized.
SEQ ID NO:10. Clone pCCI-4K-SARS-COV-2-DWDDW. First, third, and fourth sub-fragments were deoptimized.
SEQ ID NO:11. Clone pCCI-4K-SARS-COV-2-DWDWD. First, third, and fifth sub-fragments were deoptimized.
SEQ ID NO:12. Clone pCCI-4K-SARS-COV-2-DWDWW. First and third sub-fragments were deoptimized.
SEQ ID NO:13. Clone pCCI-4K-SARS-COV-2-DWWDD. The first, fourth, and fifth sub-fragments were deoptimized.
SEQ ID NO:14. Clone pCCI-4K-SARS-COV-2-DWWDW. The first and fourth sub-fragments were deoptimized.
SEQ ID NO:15. Clone pCCI-4K-SARS-COV-2-DWWWD. The first and fifth sub-fragments were deoptimized.
SEQ ID NO:16. Clone pCCI-4K-SARS-COV-2-DWWWW. The first sub-fragment was deoptimized.
SEQ ID NO:17. Clone pCCI-4K-SARS-COV-2-WDDDW. The second, third, and fourth sub-fragments were deoptimized.
SEQ ID NO:18. Clone pCCI-4K-SARS-COV-2-WDDWD. The second, third, and fifth sub-fragments were deoptimized.
SEQ ID NO:19. Clone pCCI-4K-SARS-COV-2-WDDWW. The second and third sub-fragments were deoptimized.
SEQ ID NO:20. Clone pCCI-4K-SARS-COV-2-WDWDD. The second, fourth, and fifth sub-fragments were deoptimized.
SEQ ID NO:21. Clone pCCI-4K-SARS-COV-2-WDWDW. The second and fourth sub-fragments were deoptimized.
SEQ ID NO:22. Clone pCCI-4K-SARS-COV-2-WDWWD. The second and fifth sub-fragments were deoptimized.
SEQ ID NO:23. Clone pCCI-4K-SARS-COV-2-WDWWW. The second sub-fragment was deoptimized.
SEQ ID NO:24. Clone pCCI-4K-SARS-COV-2-WWDDD. The last three sub-fragments were deoptimized.
SEQ ID NO:25. Clone pCCI-4K-SARS-COV-2-WWDDW. The third and fourth sub-fragments were deoptimized.
SEQ ID NO:26. Clone pCCI-4K-SARS-COV-2-WWDWD. The third and fifth sub-fragments were deoptimized.
SEQ ID NO:27. Clone pCCI-4K-SARS-COV-2-WWDWW. The third sub-fragment was deoptimized.
SEQ ID NO:28. Clone pCCI-4K-SARS-COV-2-WWWDD. The last two sub-fragments were deoptimized.
SEQ ID NO:29. Clone pCCI-4K-SARS-COV-2-WWWDW. The fourth sub-fragment was deoptimized.
SEQ ID NO:30. Clone pCCI-4K-SARS-COV-2-WWWWD. The last sub-fragment was deoptimized.
SEQ ID NO:31. Clone pCCI-4K-SARS-COV-2-WDDDD. The last four sub-fragments were deoptimized.
SEQ ID NO:32. Clone pCCI-4K-SARS-COV-2. No sub-fragment was deoptimized (wild-type).
SEQ ID NO:33. Codon deoptimized nucleotide sequence of sub-fragment 2A.
SEQ ID NO:34. Codon deoptimized nucleotide sequence of sub-fragment 2B.
SEQ ID NO:35. Codon deoptimized nucleotide sequence of sub-fragment 2C.
SEQ ID NO:36. Codon deoptimized nucleotide sequence of sub-fragment 3A.
SEQ ID NO:37. Codon deoptimized nucleotide sequence of sub-fragment 3B.
SEQ ID NO:38. Wild-type nucleotide sequence encoding the E protein of the SARS-COV-2 genome.
AATTAA
AGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACAC
TTCTTTAATCTACTCAACCGCGGCGTTAGGTGTTTTAATGTCTAATTTAGGTATGC
CGTCTTACTGTACGGGTTACCGTGAAGGTTATTTGAACTCTACGAATGTCACGAT
TGCGACGTACTGTACGGGTTCTATACCGTGTAGTGTTTGTCTTAGTGGTTTAGATT
CTTTAGACACGTATCCGTCTTTAGAAACGATACAAATTACGATTTCATCTTTTAAA
TGGGATTTAACGGCGTTTGGTTTAGTTGCGGAGTGGTTTTTGGCGTATATTCTTTT
CACGCGTTTTTTCTATGTACTTGGTTTGGCGGCGATCATGCAATTGTTTTTCAGCT
ATTTTGCGGTACATTTTATTAGTAATTCTTGGCTTATGTGGTTAATAATTAATCTT
GTACAAATGGCGCCGATTTCAGCGATGGTTAGAATGTACATCTTCTTTGCGTCAT
TTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAAC
GTGTATGATGTGTTACAAACGTAATAGAGCGACGCGTGTCGAATGTACGACGATT
GTTAATGGTGTTAGACGTTCCTTTTATGTCTATGCGAATGGTGGTAAAGGTTTTTG
CAAACTACACAATTGGAATTGTGTTAATTGTGATACGTTCTGTGCGGGTAGTACG
TTTATTAGTGATGAAGTTGCGCGTGACTTGTCACTACAGTTTAAACGTCCGATAA
ATCCGACGGACCAGTCTTCTTACATCGTTGATAGTGTTACGGTGAAGAATGGTTC
CATCCATCTTTACTTTGATAAAGCGGGTCAAAAGACGTATGAACGTCATTCTCTC
TCTCATTTTGTTAACTTAGACAACCTGCGTGCGAATAACACGAAAGGTTCATTGC
CGATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATCATCTGCGAA
ATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCGATACTGTTACTAGAT
CAGGCGTTAGTGTCTGATGTTGGTGATAGTGCGGAAGTTGCGGTTAAAATGTTTG
ATGCGTACGTTAATACGTTTTCATCAACGTTTAACGTACCGATGGAAAAACTCAA
AACGCTAGTTGCGACGGCGGAAGCGGAACTTGCGAAGAATGTGTCCTTAGACAA
TGTCTTATCTACGTTTATTTCAGCGGCGCGTCAAGGTTTTGTTGATTCAGATGTAG
AAACGAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAATCTGACATAGAAGT
TACGGGTGATAGTTGTAATAACTATATGCTCACGTATAACAAAGTTGAAAACATG
ACGCCGCGTGACCTTGGTGCGTGTATTGACTGTAGTGCGCGTCATATTAATGCGC
AGGTAGCGAAAAGTCACAACATTGCGTTGATATGGAACGTTAAAGATTTCATGTC
ATTGTCTGAACAACTACGTAAACAAATACGTAGTGCGGCGAAAAAGAATAACTT
ACCGTTTAAGTTGACGTGTGCGACGACGCGTCAAGTTGTTAATGTTGTAACGACG
AAGATAGCGCTTAAGGGTGGTAAAATTGTTAATAATTGGTTGAAGCAATTAATT
AA
AGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACCTGTT
C
TGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATT
The present inventors have primarily developed a (partly) codon deoptimized (CD) SARS-COV-2 genome for use as a vaccine. The vaccine can prevent infection with SARS-CoV-2 virus and the complications that arise following infection (acute respiratory distress syndrome).
Using codon deoptimization (CD) technology, the inventors inserted a number of codon changes in the genome of the virus (wild-type SARS-COV-2, Wuhan strain, https://www.ncbi.nlm.nih.gov/nuccore/1798174254) with the objective of decreasing replication efficiency in mammalian cells and rendering the virus attenuated compared to wild-type SARS-COV-2. Using this strategy, the resulting viruses would be strongly attenuated but still produce viral proteins with properties similar to those produced by a wild-type virus. Thus, using CD technology, the inventors are able to generate live attenuated SARS-COV-2 vaccine candidates.
By inserting a substantial number of changes into each vaccine candidate, the chance of reversion to wild-type is negligible, which is a crucial safety feature of the vaccines. This represents a substantial competitive advantage over vaccines with only a small number of mutations.
CD in case of SARS-COV-2 presumably results in slower non-structural polyprotein translation leading to its reduced production, slower replication and, as a result, in attenuation of the virus, compared with wild-type SARS-COV-2. For some embodiments, such vaccine candidates have virtually no risk of de-attenuation (the chance of reversion to wild-type is negligible) because of too many substitutions, all of which have, taken alone, minimal effect on virus, have been made in the coding sequence.
CD, as used herein, involves substituting normal codons in the wild-type SARS-CoV-2 genome with synonymous codons used less frequently in the host (e.g. humans), so that the resulting virus proteins are identical to wild-type virus proteins. Moreover, the resulting virus is highly attenuated, but protein function is not compromised. CD entails genetically engineering the virus.
Non-limiting embodiments of the invention are defined below.
According to a first embodiment of the present invention, there is provided live attenuated severe acute respiratory syndrome coronavirus 2 (SARS-COV-2), SARS-COV-2. SARS-COV-2 particle or SARS-COV-2 nucleic acid comprising a partly codon deoptimized SARS-COV-2 genome.
According to a second embodiment of the present invention, there is provided a recombinant, isolated or substantially purified nucleic acid comprising a partly codon deoptimized SARS-COV-2 genome or partly codon deoptimized region thereof.
According to a third embodiment of the present invention, there is provided a vector, plasmid or genetic construct comprising the nucleic acid of the second embodiment.
According to a fourth embodiment of the present invention, there is provided a cell or isolate containing the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment, the nucleic acid of the second embodiment, or the vector, plasmid or genetic construct of the third embodiment.
According to a fifth embodiment of the present invention, there is provided a vaccine comprising the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment, the recombinant, isolated or substantially purified nucleic acid of the second embodiment, the vector, plasmid or genetic construct of the third embodiment, or the cell or isolate of the fourth embodiment.
According to a sixth embodiment of the present invention, there is provided a pharmaceutical preparation comprising the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment, the recombinant, isolated or substantially purified nucleic acid of the second embodiment, the vector, plasmid or genetic construct of the third embodiment, or the cell or isolate of the fourth embodiment.
According to a seventh embodiment of the present invention, there is provided an immunogenic composition comprising the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment, the recombinant, isolated or substantially purified nucleic acid of the second embodiment, the vector, plasmid or genetic construct of the third embodiment, or the cell or isolate of the fourth embodiment.
According to an eighth embodiment of the present invention, there is provided a method of: (1) vaccinating a subject; (2) prophylactically immunizing a subject against SARS-CoV-2 or SARS-COV-2-like virus; (3) preventing a subject from contracting a SARS-COV-2 infection naturally or a SARS-COV-2-like infection naturally; (4) reducing the severity of a natural SARS-COV-2 disease or natural SARS-COV-2-like disease in a subject; or (5) treating a subject having a natural SARS-COV-2 infection or natural SARS-COV-2-like infection, said method comprising the step of administering to the subject: the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment; the recombinant, isolated or substantially purified nucleic acid of the second embodiment; the vector, plasmid or genetic construct of the third embodiment; the cell or isolate of the fourth embodiment; the vaccine of the fifth embodiment; the pharmaceutical preparation of the sixth embodiment; or the immunogenic composition of the seventh embodiment.
According to a ninth embodiment of the present invention, there is provided use of: the live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment; the recombinant, isolated or substantially purified nucleic acid of the second embodiment; the vector, plasmid or genetic construct of the third embodiment; the cell or isolate of the fourth embodiment; the vaccine of the fifth embodiment; the pharmaceutical preparation of the sixth embodiment; or the immunogenic composition of the seventh embodiment, in the preparation of a medicament for: (1) vaccinating a subject; (2) prophylactically immunizing a subject against SARS-COV-2 or SARS-COV-2-like virus; (3) preventing a subject from contracting a SARS-COV-2 infection naturally or a SARS-COV-2-like infection naturally; (4) reducing the severity of a natural SARS-COV-2 disease or natural SARS-COV-2-like disease in a subject; or (5) treating a subject having a natural SARS-COV-2 infection or natural SARS-COV-2-like infection.
According to a tenth embodiment of the present invention, there is provided: a live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid of the first embodiment; a recombinant, isolated or substantially purified nucleic acid of the second embodiment; a vector, plasmid or genetic construct of the third embodiment; a cell or isolate of the fourth embodiment; a vaccine of the fifth embodiment; a pharmaceutical preparation of the sixth embodiment; or an immunogenic composition of the seventh embodiment, for use in: (1) vaccinating a subject; (2) prophylactically immunizing a subject against SARS-COV-2 or SARS-COV-2-like virus; (3) preventing a subject from contracting a SARS-COV-2 infection naturally or a SARS-COV-2-like infection naturally; (4) reducing the severity of a natural SARS-COV-2 disease or natural SARS-COV-2-like disease in a subject; or (5) treating a subject having a natural SARS-COV-2 infection or natural SARS-COV-2-like infection.
According to an eleventh embodiment of the present invention, there is provided a method of generating a live attenuated SARS-COV-2 vaccine, SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid, or recombinant, isolated or substantially purified nucleic acid comprising a partly codon deoptimized SARS-COV-2 genome or partly codon deoptimized region thereof, comprising the step of partly codon deoptimizing a SARS-COV-2 genome.
According to a twelfth embodiment of the present invention, there is provided a method of preparing a vaccine comprising live attenuated SARS-COV-2, said method comprising the steps of: (1) codon deoptimizing a SARS-COV-2 genome to produce a partly codon deoptimized live attenuated SARS-COV-2; and (2) enabling the partly codon deoptimized live attenuated SARS-COV-2 to replicate.
According to a thirteenth embodiment of the present invention, there is provided a method of preparing a vaccine comprising codon deoptimized SARS-COV-2, said method comprising the steps of: optionally, (1) codon deoptimizing a SARS-COV-2 genome to produce a partly codon deoptimized live attenuated SARS-COV-2; (2) enabling the partly codon deoptimized live attenuated SARS-COV-2 to replicate; and (3) preparing a vaccine dose containing the replicated SARS-COV-2 of step (2).
According to a fourteenth embodiment of the present invention, there is provided a method of eliciting an immune response in a subject, said method comprising the step of administering a live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-CoV-2 nucleic acid of the first embodiment; the recombinant, isolated or substantially purified nucleic acid of the second embodiment; the vector, plasmid or genetic construct of the third embodiment; the cell or isolate of the fourth embodiment; the vaccine of the fifth embodiment; the pharmaceutical preparation of the sixth embodiment; or the immunogenic composition of the seventh embodiment to the subject to thereby elicit an immune response.
It is to be appreciated that, context permitting, features of the above fourteen invention embodiments can be found elsewhere in this specification, including below.
By ‘live attenuated’ it is meant that the virus demonstrates substantially reduced or preferably no clinical signs of disease when administered to a subject, compared with wild-type SARS-COV-2.
‘Wild-type SARS-COV-2’ refers to the Wuhan strain, found at https://www.ncbi.nlm.nih.gov/nuccore/1798174254.
It is to be appreciated that, context permitting, wild-type SARS-COV-2 can include natural variants (present and future) of the Wuhan strain, including: Alpha, Pango lineage B.1.1.7; Beta, Pango lincages B.1.351, B.1.351.2, B.1.351.3; Gamma, Pango lineages P.1, P.1.1, P.1.2; Delta, Pango lincages B.1.617.2, AY.1, AY.2; Eta, Pango lineage B.1.525; Iota, Pango lineage B.1.526; Kappa, Pango lincage B.1.617.1; Lambda, Pango lineage C.37; and, Pango lincages B.1.427, B.1.429, P.2, P.3, R.1, R.2, B.1.466.2, B.1.621, AV.1, B.1.1.318, B.1.1.519, AT.1, C.36.3, C.36.3.1, B.1.214.2.
Any suitable region or regions of the SARS-COV-2 genome can be codon deoptimized. The wild-type Wuhan SARS-COV-2 genome sequence, gene sequences and protein sequences can be found in GenBank as entry NCBI Reference Sequence: NC_045512.2 (Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome). Those sequence are incorporated herein by reference.
In some embodiments the ORF1a region is codon deoptimized. The wild-type ORF1a sequence can be found in GenBank as entry NCBI Reference Sequence: NC_045512.2. The genome sequence, gene sequences and protein sequences are incorporated herein by reference.
In some embodiments the ORF1a region is codon deoptimized, but excluding/truncating the 5′ region by one or more nucleotides. In some embodiments the ORF1a region is codon deoptimized, but excluding/truncating the 3′ region of ORF1a by one or more nucleotides, thereby excluding the ribosomal frameshift region. In some embodiments, this corresponds between about nucleotide position 1534 to about nucleotide position 8586 of the Wuhan virus genome, but this need not be the case. These positions were chosen by the inventors in view of the cloning strategy. Other positions can be readily determined by the skilled person based on NCBI Reference Sequence: NC_045512.2. In some embodiments, only part of the ORF1a region of the viral genome is codon deoptimized or different parts or sub-regions of the ORF1a region of the viral genome are codon deoptimized.
Any suitable number of codon changes can be made. In some embodiments, CD results in no less than about 10 codon changes in ORF1a. In some embodiments, CD results in no more than about 1850 codon changes in ORF1a (with the upper limit for substitution being where the virus does not usually grow at all). In some embodiments, codon deoptimization results in between about 10 and about 1850 codon changes in ORF1a and all sub-ranges there between. This 10 to 1850 codon change range includes all integers between 10 and 1850 including 11, 12 . . . 1849 codon changes. In some embodiments, some or all of the codon changes can be situated immediately next to one another, in sequence. In some embodiments, some or all of the codon changes can be spaced apart from each other such that they are not situated immediately next to one another, in sequence—e.g. 3 to 4 codon (triplet) spacing. In some embodiments, some of the codon changes can be spaced apart from each other and some of the codon changes can be situated immediately next to one another.
In some embodiments, CD occurs in no more than about a 12 kbp nucleotide region of ORF1a. This can include an about 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5 or 12 kbp nucleotide codon deoptimized region. The region can be continuous/contiguous or not. In some embodiments, CD occurs in a continuous ORF1a region with a length of about 12 kbp. In some embodiments, CD results in about an 11,186 nucleotide region of ORF1a, preferably with no less than about 10 codon changes within that nucleotide region. In some embodiments, about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50% of ORF1a is codon deoptimized. In some embodiments, about 35% of ORF1a is codon deoptimized. In some embodiments, every 3rd or 4th codon is deoptimized along ORF1a.
Most amino acids are encoded by more than one codon. For instance, leucine, serine and arginine are encoded by six different codons, while only tryptophan and methionine have unique codons. ‘Synonymous’ codons are codons that encode the same amino acid. For example, CTT, CTC, CTA, CTG, TTA and TTG are synonymous codons that code for leucine. Synonymous codons are not used with equal frequency. In generally, the most frequently used codons in a particular organism are those for which the cognate tRNA is abundant, and the use of these codons enhances the rate and/or accuracy of protein translation. Conversely, tRNAs for the rarely used codons are found at relatively low levels, and the use of rare codons is thought to reduce translation rate and/or accuracy.
As used herein, a ‘rare’ codon is one of at least two synonymous codons encoding a particular amino acid that is present in an mRNA at a significantly lower frequency that the most frequently used codon for that amino acid. Conversely, a ‘frequent’ codon is one of at least two synonymous codons encoding a particular amino acid that is present in an mRNA at a significantly higher frequency that the least frequently used codon for that amino acid. For example, human genes use the leucine codon CTG 3.9% of the time, but use the synonymous codon CTA only 0.7% of the time. See Table 1a. Thus, CTG is a frequent codon, whereas CTA is a rare codon.
‘Rare codons’ have a frequency of less than 0.5%. For example, TAA, TGA, TCG and CGT are rare codons. ‘Less rare’ codons have a frequency of less than 0.8%. For example, AUA, ACG, CGA, CCG, CTA, CTA, GCG, ATA, TTA are less rare codons. ‘Moderate codons’ have a frequency of less than 2%. For example, CGC, TGT, GGT, CAT, GTT, CGG, AGG, AGT, AGA, TAT, TCA, CAA, TGC, TTG, ACT, TGG, CTT, GTC, CAC, ACA, TCT, TAC, GCA, ATT, GGG, GGA, CCA, AAT, CCT, TTT, TCC, GCT, ACC, AAC, AGC, CTC and CCC are moderate codons. ‘Frequent codons’ have a frequency of more than 2%. For example, TTC, ATC, GAT, ATG, GGC, AAA, GAC, GCC, GTG, GAA, AAG, CAG, GAG and CTG are frequent codons.
The propensity for highly expressed genes to use frequent codons is called ‘codon bias’. A gene for a ribosomal protein might use only the 20 to 25 most frequent of the 61 codons, and have a high codon bias (a codon bias close to 1), while a poorly expressed gene might use all 61 codons, and have little or no codon bias (a codon bias close to 0). It is thought that the frequently used codons are codons where larger amounts of the cognate tRNA are expressed, and that use of these codons allows translation to proceed more rapidly, or more accurately, or both.
In some embodiments, the CD results in slower non-structural polyprotein translation leading to slower replication and, as a result, in attenuation of the virus. In some embodiments, every codon in the wild-type ORF1a or region thereof was analysed in terms of its usage frequency in Homo sapiens, and if the codon was frequent then it was changed in the viral genome to a least frequently or less frequently used synonymous codon. In some embodiments, a codon for an amino acid with codon degeneracy was changed only if the synonymous codons for that amino acid occurred in significantly different frequencies of usage in the genome of Homo sapiens. In some embodiments, Asp, and Asn codons of the viral genome are left unchanged. In some embodiments, a codon for an amino acid with high codon degeneracy was changed to a synonymous codon that was rarely, less rarely or moderately used in the genome of Homo sapiens. In some embodiments, a viral region most rich in codons that can be substituted for rare codon variants is CD.
In some embodiments, CD results in replacement with one or more rare codons.
In some embodiments, CD results in replacement with one or more less rare codons.
In some embodiments, CD results in replacement with one or more moderate codons.
In some embodiments, CD results in replacement with one or more rare codons, one or more less rare codons, or one or more moderate codons, or any combination of these.
In some embodiments, CD results in replacement with one or more CpG dinucleotides (CpG elements).
In some embodiments, CD results in replacement with one or more UpA (TA) dinucleotides (UpA elements).
In some embodiments, CD results in replacement with one or more CpG and one or more UpA dinucleotides/elements, or any combination of these.
In some embodiments, CD results in replacement with one or more rare codons, one or more less rare codons, or one or more moderate codons, one or more CpG dinucleotides/elements, one or more UpA dinucleotides/elements, or any combination of these.
UpA and CpG dinucleotides can act as a vaccine adjuvant as they are important immunoregulators for the RNA virus immune response. In some embodiments, CpG and/or UpA improve the function of antigen-presenting cells, boost the generation of a vaccine-specific immune response and increase the immunogenicity of administered vaccines. Rare serine codon TCG contains a CpG dinucleotide. Less rare codons CTA, CCG, ACG, GTA, ATA and GCG contain UpA or CpG dinucleotides/elements.
In some embodiments, one or more serine codons are changed. In some embodiments, one or more serine codons are changed to the rare TCG codon. (This codon has the CpG element.)
In some embodiments, one or more proline codons are changed. In some embodiments, one or more proline codons are changed to the less rare CCG codon. (This codon has the CpG element.)
In some embodiments, one or more threonine codons are changed. In some embodiments, one or more threonine codons are changed to the less rare ACG codon. (This codon has the CpG element.)
In some embodiments, one or more isoleucine codons are changed. In some embodiments, one or more isoleucine codons are changed to the less rare ATA codon. (This codon has the UpA element.)
In some embodiments, one or more alanine codons are changed. In some embodiments, one or more alanine codons are changed to the less rare GCG codon. (This codon has the CpG element.)
In some embodiments, one or more arginine codons are changed. In some embodiments, one or more arginine codons are changed to the rare CGT codon or less rare CGA codon. (These codons have the CpG elements.)
In some embodiments, one or more serine codons are changed, one or more proline codons are changed, one or more threonine codons are changed, one or more isoleucine codons are changed, one or more alanine codons are changed, one or more arginine codons are changed, or any combination of these.
In some embodiments, a region between about nucleotide positions 1534 and 8586 of the SARS-COV-2 wild-type genome (the ORF1a region) can be codon deoptimized, or any subrange/subregion located between 1534 and 8586. Any suitable number of amino acid codon changes can be made. In some embodiments, a total of at least about 24 codons are changed. In some embodiments, a total of up to about 546 codons are changed. This includes all whole numbers between 24 and 546, including 24, 25 etc. This also includes all subranges between 24-546, such as 24-50, 50-75, 75-100, etc.
For example, one or more of the amino acid codons shown in Table 11 can be changed/mutated—either individually or in any suitable combination with each other. For example, one or more of the following amino acid codons shown in Table 1b below can be changed/mutated—either individually or in any suitable combination with each other (including different codons for the same amino acid and/or with codons for different amino acids).
For example, in some embodiments, the 1534-8586 region can have about 24, 28, 25, 48, 53, 59, 77 or 160 Ser changes to Ser TCG.
For example, in some embodiments, the 1534-8586 region can have about 97 codon changes comprising: about 19 Ile changes to Ile ATA, about 10 Pro changes to Pro CCG, about 34 Thr changes to Thr ACG, and about 34 Ala changes to Ala GCG.
For example, in some embodiments, the codon deoptimized genome can have the deoptimized codons of the fragments/clones/vaccine candidates as shown or as substantially shown in any one of SEQ ID NO:1-31, 33-37 and 39-68, and as shown or as substantially shown in any one of
For example, in some embodiments, the codon deoptimized genome can have at least the deoptimized codons of the fragments/clones/vaccine candidates as shown in any one of SEQ ID NO:1-31, 33-37 and 39-68, and as shown or as substantially shown in any one of
For example, in some embodiments, the codon deoptimized genome can have fewer than the deoptimized codons of the fragments/clones/vaccine candidates as shown in any one of SEQ ID NO: 1-31, 33-37 and 39-68, and as shown or as substantially shown in any one of
For example, in some embodiments, the codon deoptimized genome can have anywhere between about 10% and about 100% of the deoptimized codons of the fragments/clones/vaccine candidates as shown in any one of SEQ ID NO: 1-31, 33-37 and 39-68, and as shown in any one of
In some embodiments, the codon deoptimized genome has the deoptimized region or genomic sequence or substantially the same deoptimized region or genomic sequence of clone SARS-COV-2-77-1, SARS-COV-2-77-2, SARS-COV-2-77-3, SARS-COV-2-77-4, SARS-COV-2-77-5, SARS-COV-2-77-6, SARS-COV-2-77-7, SARS-COV-2-160-1, SARS-COV-2-160-2, SARS-COV-2-160-3, SARS-COV-2-160-4, SARS-COV-2-160-5, SARS-COV-2-160-6, SARS-COV-2-160-7, SARS-COV-2-4N-1 or SARS-COV-2-7N-1, or variant thereof.
In some embodiments, the codon deoptimized genome has the deoptimized region or genomic sequence of clone SARS-COV-2-4N-1, SARS-COV-2-7N-1, SARS-COV-2-77-7, SARS-COV-2-160-4 or SARS-COV-2-160-7, or substantially the same deoptimized region or genomic sequence as clone SARS-COV-2-4N-1, SARS-COV-2-7N-1, SARS-COV-2-77-7, SARS-COV-2-160-4 or SARS-COV-2-160-7, or variant thereof.
In some embodiments, the codon deoptimized genome has the deoptimized region or genomic sequence of clone SARS-COV-2-7N-1 or substantially the same deoptimized region or genomic sequence as clone SARS-COV-2-7N-1, or variant thereof.
In some embodiments, apart from the deoptimized region, a genomic remainder, or part thereof, of the live attenuated severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid etc can comprise a sequence identical to, substantially identical to or similar to wild-type SARS-COV-2—i.e. the Wuhan isolate or variant thereof. Suitable variants include present and future variants of the Wuhan strain, including: Alpha, Pango lineage B.1.1.7; Beta, Pango lineages B.1.351, B.1.351.2, B.1.351.3; Gamma, Pango lincages P.1, P.1.1, P.1.2; Delta, Pango lineages B.1.617.2, AY.1, AY.2; Eta, Pango lineage B.1.525; Iota, Pango lineage B.1.526; Kappa, Pango lineage B.1.617.1; Lambda, Pango lineage C.37; and, Pango lineages B.1.427, B.1.429, P.2, P.3, R.1, R.2, B.1.466.2, B.1.621, AV.1, B.1.1.318, B.1.1.519, AT.1, C.36.3, C.36.3.1, B.1.214.2. Typically, a variant will include a mutated Spike gene.
In some embodiments of the genomic remainder, for example, for the live attenuated severe acute respiratory syndrome coronavirus 2 (SARS-COV-2), SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid etc, the Spike gene (or part thereof) of the Wuhan strain can be replaced with the Spike gene of Alpha, Beta, Gamma or Delta variants. All of these can have the Wuhan isolate backbone with the only changes being in the sequence of the Spike gene.
In some embodiments, apart from the deoptimized region, a genomic remainder, or part thereof, of the live attenuated severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), SARS-COV-2, SARS-COV-2 particle or SARS-COV-2 nucleic acid etc can comprise a sequence of a genetically modified, recombinant or manufactured SARS-COV-2 genome.
In some embodiments, the chance of deattenuation to wild-type SARS-COV-2 is negligible.
In some embodiments, a recombinant/recombined ORF1a region can be used. In some embodiments, the ORF1a region can be cleaved into at least two, three, four, five, six, seven, eight, nine, ten or more fragments. Preferably, the ORF1a region can be cleaved into at least about three fragments. These ORF1a fragments can be generated using, for example, restriction enzymes. Suitable restriction enzymes include, for example, SanDI, SmaI, AvrII, PacI, SphI and PshAI. Deoptimized fragments can be generated using gene synthesis and restriction enzyme sites as described in
Any one or more of the ORF1a fragments can be codon deoptimized to any suitable degree. ORF1a can be codon deoptimized prior to being fragmented. Alternatively, ORF1a can be codon deoptimized after being fragmented (or sub-fragmented). A suitable fragment or sub-fragment of ORF1a or fragments or sub-fragments of ORF1a that can be codon deoptimized are shown in
The wild-type fragments and/codon deoptimized fragments can be assembled/ligated together in their natural five to three prime order to create a recombinant/genetically engineered ORF1a having 1, 2, 3 or more codon deoptimized fragment regions. For example, three wild-type and three codon deoptimized fragments can be assembled in different combinations to generate 7 different ORF1a fragment combinations (in addition to wildtype).
In some embodiments, the vaccine can comprise a single clone/vaccine candidate, for example, having the sequence shown in any one of SEQ ID NOs:39-68. In some embodiments, the vaccine can comprise a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 clones/vaccine candidates having, for example, sequences shown in any one of SEQ ID NOs:39-68.
In some embodiments, the vaccine can comprise, for example, one or more of clones SARS-COV-2-77-1, SARS-COV-2-77-2, SARS-COV-2-77-3, SARS-COV-2-77-4, SARS-COV-2-77-5, SARS-COV-2-77-6, SARS-COV-2-77-7, SARS-COV-2-160-1, SARS-COV-2-160-2. SARS-COV-2-160-3, SARS-COV-2-160-4, SARS-COV-2-160-5, SARS-COV-2-160-6, SARS-COV-2-160-7. SARS-COV-2-4N-1 and SARS-COV-2-7N-1, or variant thereof.
In some embodiments, the vaccine can comprise one or more of clones SARS-CoV-2-4N-1 and SARS-COV-2-7N-1, or variant thereof.
As mentioned, any suitable region or regions of the SARS-COV-2 genome can be codon deoptimized. In some embodiments, the region of the SARS-COV-2 genome encoding the envelope structural protein (E protein) is codon deoptimized. (Wild type E protein is shown as SEQ ID NO:38.) In some embodiments, both E protein and ORF1a are codon deoptimized. In some embodiments, only part of E protein or all of E protein of the viral genome is codon deoptimized or different parts or sub-regions of E protein of the viral genome are codon deoptimized.
In some embodiments, the E protein putative transmembrane domain is codon deoptimized. In some embodiments, the E protein putative C-terminal protein-protein interaction motif is codon deoptimized. In some embodiments, both the E protein putative transmembrane domain and putative C-terminal protein-protein interaction motif are codon deoptimized.
In some embodiments, CD results in between about 1 and about 75 codon changes in E protein. The 1 to 75 codon change range includes all integers between 1 and 75 including 2, 3 . . . 74 codon changes. In some embodiments, some or all of the codon changes can be situated immediately next to one another, in sequence. In some embodiments, some or all of the codon changes can be spaced apart from each other such that they are not situated immediately next to one another, in sequence—e.g. 3 to 4 codon (triplet) spacing. In some embodiments, some of the codon changes can be spaced apart from each other and some of the codon changes can be situated immediately next to one another.
In some embodiments, CD results in between 1 and about 160 codon changes in E protein. The 1 to 160 codon change range includes all integers between 1 and 160 including 2. 3 . . . 159 codon changes. In some embodiments, some or all of the codon changes are of serine to TCG. Preferably there are 77 codon or 160 codon changes of serine to TCG.
In some embodiments, CD results in between 1 and about 496 codon changes in E protein. The 1 to 496 codon change range includes all integers between 1 and 496 including 2, 3 . . . 495 codon changes. In some embodiments, some of the codon changes are of proline to CCG, and preferably there are 81 proline codons deoptimized to CCG. In some embodiments, some of the codon changes are of threonine to ACG, and preferably there are 186 threonine codons deoptimized to ACG. In some embodiments, some of the codon changes are of isoleucine to ATA, and preferably there are 82 isoleucine codons deoptimized to ATA. In some embodiments, some of the codon changes are of alanine to GCG, and preferably there are 147 alanine codons deoptimized to GCG. In some embodiments, the codon changes are any combination thereof.
In some embodiments, CD results in between 1 and about 546 codon changes in E protein. The 1 to 546 codon change range includes all integers between 1 and 546 including 2. 3 . . . 545 codon changes. In some embodiments, some of the codon changes are of proline to CCG, and preferably there are 82 proline codons deoptimized to CCG. In some embodiments, some of the codon changes are of threonine to ACG, and preferably there are 178 threonine codons deoptimized to ACG. In some embodiments, some of the codon changes are of isoleucine to ATA, and preferably there are 44 isoleucine codons deoptimized to ATA. In some embodiments, some of the codon changes are of alanine to GCG, and preferably there are 147 alanine codons deoptimized to GCG. In some embodiments, some of the codon changes are of arginine to CGT, and preferably there are 40 arginine codons deoptimized to CGT. In some embodiments, some of the codon changes are of glycine to GGT, and preferably there are 41 glycine codons deoptimized to GGT. In some embodiments, some of the codon changes are of glutamine to CAA, and preferably there are 14 glutamine codons deoptimized to CAA. In some embodiments, the codon changes are any combination thereof.
In some embodiments, CD of E protein results in reduced neurovirulence.
The live attenuated SARS-COV-2, SARS-COV-2, SARS-COV-2 particle or SARS-CoV-2 nucleic acid comprising a partly codon deoptimized SARS-COV-2 genome can be of any suitable form and can be prepared in any suitable way. Likewise, the recombinant, isolated or substantially purified nucleic acid comprising a partly codon deoptimized SARS-COV-2 genome or partly codon deoptimized region thereof can be prepared in any suitable way. Such techniques are described elsewhere in this specification (e.g. see below), the entire contents of which are incorporated herein by way of reference.
Likewise, a vaccine, vaccination dose, pharmaceutical preparation or immunogenic composition comprising the above can be of any suitable form and can be prepared in any suitable way. Such techniques are described elsewhere in this specification, the entire contents of which are incorporated herein by way of reference.
In addition to a live attenuated SARS-COV-2 vaccine, pharmaceutical preparation or immunogenic composition, the present invention encompasses SARS-COV-2 particles, nucleic acid and genetic vaccines that comprise a partly codon deoptimized SARS-COV-2 genome in the form of a nucleic acid. The nucleic acid can be DNA or RNA that is self-replicating/self-amplifying once used for vaccination. The nucleic acid can relate to the SARS-CoV-2 genome or SARS-COV-2 anti-genome. The nucleic acid can relate to positive-sense genomic RNA, negative-strand genomic RNA, or cDNA encoding the SARS-COV-2 genome. Such techniques are described in the following references, the entire contents of which are incorporated herein by way of cross-reference: (Karl Ljungberg & Peter Liljeström (2015) Self-replicating alphavirus RNA vaccines, Expert Review of Vaccines, 14:2, 177-194, DOI: 10.1586/14760584.2015.965690; Rodríguez-Gascón A, del Pozo-Rodríguez A, Solinís MA (2014) Development of nucleic acid vaccines: use of self-amplifying RNA in lipid nanoparticles. Int J Nanomedicine. 9: 1833-1843; US 2014/0112979 A1.
The vaccine, pharmaceutical preparation or immunogenic composition can comprise live virus or temporarily inactivated virus, provided that it is self-replicating/self-amplifying after vaccination. If inactivated, it can be inactivated in any suitable way (e.g. using high or low temperatures, radiation or chemically).
The vaccine, pharmaceutical preparation or immunogenic composition can comprise a delivery system or carrier or aid, and these can be of any suitable form and can be prepared in any suitable way. Suitable examples include a plasmid, genetic construct or vector to assist with self-replication/self-amplification, an RNA nanocarrier for RNA delivery, and lipid-based formulations for delivery, including liposomes, nanoemulsions and solid lipid nanoparticles.
In some embodiments, the vaccine can be prepared by way of passing SARS-COV-2 through a filter, such as a 0.22 μm hydrophilic PVDF membrane or hydrophilic Polyethersulfone membrane.
Manufacturing a vaccine can comprise growing/propagating the virus in Vero cells or Vero E6 cells. These cells can be used in large-scale bioreactors. However, it may be possible to grow the virus using other cell types, tissue culture methods and mediums.
In some embodiments, the vaccine can be stored long term and remain viable at a temperature of between about 2° C. and about −80° C. (including all 1 degree increments between 2 and −80, including 1, 0, −1, −2 . . . −79). By “long-term” it is meant that the vaccine can remain viable for at least 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 days. In some embodiments, it is possible that the vaccine can remain viable for more than 60 days. In some embodiments, it is possible that the vaccine can remain viable for 1 year, 2 years or more, especially if freeze dried and stored at 2-8 degrees Celsius.
The live attenuated virus can be in the form of an isolate. The isolate may comprise cells, such as mammalian or other types of cells—e.g. Vero cells.
The method of preventing the subject from contracting a viral infection, treating a subject having a viral infection, or reducing the severity of a viral disease, can be carried out in any suitable way.
A ‘SARS-COV-2-like virus’ as used herein refers to a virus closely related to SARS-COV-2. SARS-COV-2 natural variants, SARS COV 1, MERS-COV and other human coronaviruses, especially betacoronaviruses, may be closely related viruses.
A ‘SARS-COV-2-like infection’ as used herein refers to an infection caused by a virus closely related to SARS-COV-2.
A ‘SARS-COV-2-like disease’ as used herein refers to a disease caused by a virus closely related to SARS-COV-2, including betacoronaviruses. Severe acute respiratory syndrome 1 (SARS 1) and Middle-East respiratory syndrome (MERS) are examples of SARS-CoV-2-like diseases.
The vaccine, live attenuated virus, pharmaceutical preparation and immunogenic composition (described hereafter as “the compositions”) can be administered independently, either systemically or locally, by any method standard in the art, for example, subcutaneously, intravenously, parenterally, intraperitoneally, intradermally, intramuscularly, topically, orally or nasally. The compositions are preferably administered subcutaneously.
The compositions can comprise conventional non-toxic, physiologically or pharmaceutically acceptable ingredients or vehicles suitable for the method of administration and are well known to an individual having ordinary skill in this art. If required, the compositions can, for example, comprise an adjuvant. The adjuvant can be, for example, an aluminium salt (e.g. aluminium hydroxide), monophosphoryl lipid A, or emulsion of water and oil (e.g. MF59). In some embodiments, no adjuvant is required. The term “pharmaceutically acceptable carrier” as used herein is intended to include diluents such as saline and aqueous buffer solutions. The compositions can be in aqueous, lyophilized, freeze-dried or frozen form. If freeze-dried, the composition can be reconstituted with diluent.
A variety of devices are known in the art for delivery of the compositions including, but not limited to, syringe and needle injection, bifurcated needle administration, administration by intradermal patches or pumps, intradermal needle-free jet delivery (intradermal etc.), intradermal particle delivery, or aerosol powder delivery.
The compositions can be administered independently one or more times to achieve, maintain or improve upon a desired effect/result. It is well within the skill of an artisan to determine dosage or whether a suitable dosage of the composition comprises a single administered dose or multiple administered doses. An appropriate dosage depends on the subject's health, the induction of immune response and/or prevention of infection caused by the SARS-COV-2, the route of administration and the formulation used. For example, a therapeutically active amount of the compound may vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of the composition to elicit a desired response in the subject. Dosage regime may be adjusted to provide the optimum therapeutic response. For example, a subject may be administered a ‘booster’ vaccination one, two, three, four or more weeks following the initial administration. For example, a subject may be administered a titre of 104 PFU attenuated virus per dose.
The vector, plasmid or genetic construct can also be prepared in any suitable way. Suitably, the genetic construct is in the form of, or comprises genetic components of, a plasmid, bacteriophage, a cosmid, a yeast or bacterial artificial chromosome as are well understood in the art. Genetic constructs may also be suitable for maintenance and propagation of the nucleic acid in bacteria or other host cells, for manipulation by recombinant DNA technology. For the purposes of protein expression, the genetic construct is an expression construct. Suitably, the expression construct comprises the one or more nucleic acids operably linked to one or more additional sequences, such as heterologous sequences, in an expression vector. An “expression vector” may be either a self-replicating extra-chromosomal vector such as a plasmid, or a vector that integrates into a host genome. By “operably linked” is meant that said additional nucleotide sequence(s) is/are positioned relative to the nucleic acid of the invention preferably to initiate, regulate or otherwise control transcription. Regulatory nucleotide sequences will generally be appropriate for the host cell or tissue where expression is required. Numerous types of appropriate expression vectors and suitable regulatory sequences are known in the art for a variety of host cells. Typically, said one or more regulatory nucleotide sequences may include, but are not limited to, promoter sequences, leader or signal sequences, ribosomal binding sites, transcriptional start and termination sequences, translational start and termination sequences, and enhancer or activator sequences. Constitutive or inducible promoters as known in the art are contemplated by the invention. The expression construct may also include an additional nucleotide sequence encoding a fusion partner (typically provided by the expression vector) so that the recombinant protein of the invention is expressed as a fusion protein. In some embodiments the genetic construct is suitable for virus production and in other embodiments for DNA vaccination of a mammal, such as a human.
The cell (mammalian or other) or isolate comprising the vector, plasmid, genetic construct or virus can be prepared in any suitable way.
Suitable protocols for carrying out one or more of the above-mentioned techniques can be found in “Current Protocols in Molecular Biology”. July 2008, JOHN WILEY AND SONS; D. M. WEIR ANDCC BLACKWELL, “Handbook Of Experimental Immunology”, vol. I-IV. 1986; JOHN E. COLIGAN, ADA M. KRUISBEEK, DAVID H. MARGULIES, ETHAN M. SHEVACH, WARREN STROBER, “Current Protocols in Immunology”, 2001, JOHN WILEY & SONS; “Immunochemical Methods In Cell And Molecular Biology”, 1987, ACADEMIC PRESS; SAMBROOK ET AL., “Molecular Cloning: A Laboratory Manual, 3d cd.,”, 2001, COLD SPRING HARBOR LABORATORY PRESS; “Vaccine Design, Methods and Protocols”, Volume 2, Vaccines for Veterinary Diseases, Sunil Thomas in Methods in Molecular Biology (2016); and, “Vaccine Design, Methods and Protocols”, Volume 1: Vaccines for Human Diseases, Sunil Thomas in Methods in Molecular Biology (2016), the entire contents of which are incorporated herein by way of reference.
Any suitable type of subject can be used. The subject can be any suitable mammal. Mammals include humans, primates, livestock and farm animals (e.g. horses, sheep and pigs), companion animals (e.g. dogs and cats), and laboratory test animals including rats, mice, rabbits, hamsters and ferrets, including transgenic animals (e.g. human ACE2 receptor transgenic mice). The subject can be a bat, pangolin or other wild animal that could be a host for the coronavirus. The subject is preferably human.
‘Nucleic acid’ as used herein includes ‘polynucleotide’, ‘oligonucleotide’, and ‘nucleic acid molecule’, and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g. isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide.
As used herein, context permitting, the term ‘recombinant’ refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication. As used herein, context permitting, the term ‘recombinant’ refers to the condition of having been genetically modified. That is, a ‘recombinant virus genome’ means that the virus genome has been genetically engineered. In this sense: live attenuated SARS-COV-2 (comprising a partly codon deoptimized SARS-COV-2 genome) can be called recombinant live attenuated SARS-COV-2; SARS-COV-2 can be called recombinant SARS-COV-2; SARS-COV-2 particle can be called recombinant SARS-CoV-2 particle; and SARS-COV-2 nucleic acid can be called recombinant SARS-COV-2 nucleic acid.
The terms ‘isolated’ or ‘purified’ as used herein mean essentially free of association with other biological components/contaminants, e.g. as a naturally occurring protein that has been separated from cellular and other contaminants by the use of antibodies or other methods or as a purification product of a recombinant host cell culture. By ‘substantially the same’ or ‘substantially as shown’, it is meant that it is different yet essentially the same, differing in a minor way to make no significant practical or functional difference.
Amino acids are referred to herein interchangably by their name, IUPAC code or three letter code. See Table 1C.
Preferred embodiments of the invention are defined in the following numbered paragraphs:
Yet further preferred embodiments of the invention are defined in the following numbered paragraphs:
Any of the features described herein can be combined in any combination with any one or more of the other features described herein within the scope of the invention.
The experimental steps described in Examples 1-5 are summarised in the flowchart of
We are using codon deoptimization technology to make multiple mutations in the non-structural proteins (ORF1a region, N-terminal part of replicase) of SARS-COV-2, representing the virus isolate from Wuhan. See
The ORF1a region was chosen because its deoptimization automatically results in the reduction of ORF1b expression as well while at the same time there is no change in the ratio of ORF1a/ORF1b products.
Regions required for known RNA based replication and expression (e.g. packaging, frame shift) are protected or excluded from deoptimization as this may hamper vital functions of the virus. Proteins expressed via subgenomic RNAs were considered as bad targets for deoptimization due to possible misfolding of protein (e.g. Spike-protein) and possibility of compensation of translation defect by increase of corresponding subgenomic RNA synthesis. The packaging signal of coronaviruses is outside ORF1a (in the 3′ of ORF1b), so it is not affected by this approach. The region encoding major antigens and structural protein has a complex expression pattern, which is a characteristic of the order Nidovirales. Codon deoptimization in this region is a possibility, but is not the first option as this region may not tolerate such modifications.
We are using a compact strategy (deoptimized codons in regions close to each other and not scattered over a large region) as this is technically the most straightforward approach.
We have designed clones/vaccine candidates to allow for substitution of the Spike-protein region, which is the main viral antigen. For design of deoptimized fragments, we know from our previous experience with Zika virus (Mutso M, Saul S, Rausalu K, et al. Reverse genetic system, genetically stable reporter viruses and packaged subgenomic replicon based on a Brazilian Zika virus isolate. J Gen Virol. 2017; 98(11):2712-2724. doi: 10.1099/jgv.0.000938) that deoptimization of 35% of the viral genome resulted in severely attenuated virus. Based on this experience, for SARS-COV-2 the deoptimized region should be approximately 12 kbp. We have prepared clones/vaccine candidates with deoptimized regions of about 2, 4, 6, 8 and 12 kb regions in length.
In contrast to an optimization process, which can be done using free software or online tools, there is no publicly available program for CD. Therefore, it was done manually. Every codon in ORF1a was analyzed in terms of its usage frequency in Homo sapiens. If the codon was frequent it was manually changed to a synonymous but the less used one. For instance, amino acid Leucine (Leu) can be encoded by six different codons with the following frequencies: UUA—15%, UUG—12%, CUU—12%, CUC—10%, CUA—5%, and CUG —46%. If the Leu codon in the original sequence was represented by highly abundant CUG (46%), it was changed to rare CUA (5%). Some codons were left unchanged: Methionine (Met) and Tryptophan (Trp) as both of them are encoded by only one codon; and, Asparagine (Asn) and Aspartic acid (Asn) as their codons are used at almost the same frequency.
The positions of nucleotides changed due to the deoptimization of ORF1a are seen in SEQ ID NOS: 1-31 as well as in the
See
The ORF1a region was selected for codon deoptimization, but excluding the 5′ and 3′ regions (ribosomal frameshift region). Fragment 2 and the 5′ region of fragment 3 were codon deoptimized. See
As it is not known how much deoptimization the virus can tolerate and how much is necessary for attenuation, the ORF1a region was split into 5 sub-fragments. Deoptimized and wild-type/non-deoptimized sub-fragments alike can be directionally joined/assembled in different combinations using enzymes SmaII (position 4254), AvrII (position 6982), PacI (position 8586), SphI (position 11165) and PshAI (position 12718) cleavage sites. See
See
That is, we are using two ways to generate infectious virus or vaccine candidates: i) assemble all 5 sub-fragments into a single clone/genetic construct/vector (containing all fragments of the SARS-COV-2 genome) and use it for transfection (this is the preferred option); or, ii) ligate all 5 sub-fragments into a single clone (containing all fragments of the SARS-CoV-2 genome) and use the ligated product for transfection without cloning (this is the backup option). For option i) a full-length infectious clone of SARS-COV-2 was assembled in a bacterial artificial chromosome as previously described for SARS-COV-1 (Enjuanes L, Zuñiga S, Castaño-Rodriguez C, Gutierrez-Alvarez J, Canton J, Sola I. Molecular Basis of Coronavirus Virulence and Vaccine Development. Adv Virus Res. 2016; 96:245-286. doi: 10.1016/bs.aivir.2016.08.003) and for Zika virus (Mutso M. Saul S, Rausalu K. et al. Reverse genetic system, genetically stable reporter viruses and packaged subgenomic replicon based on a Brazilian Zika virus isolate. J Gen Virol. 2017; 98(11):2712-2724. doi: 10.1099/jgv.0.000938). For option ii) a split system as described by Scobey and colleagues (Scobey T, Yount B L, Sims A C, et al. Reverse genetics with a full-length infectious cDNA of the Middle East respiratory syndrome coronavirus. Proc Natl Acad Sci USA. 2013; 110(40): 16157-16162. doi: 10.1073/pnas. 1311542110) was used.
Minimising the passaging (viral production in cells) of mutant virus will reduce the chances of reversions. Genetic stability testing can be carried out, for example, by testing the phenotype of the mutant virus after 10 rounds of passage in vitro. Sequencing also will demonstrate the base changes in the virus genome over this time. We have inserted multiple mutations into the vaccine candidate, which means that the chance of complete reversion is negligible.
The deoptimized SARS-COV-2 infectious first generation vaccine candidate clones of the earlier Example were respectively transfected into BHK21 cells using lipofectamine LTX according to manufacturer's instructions. The BHK21 cells were cultured overnight at 37° C. with 5% CO2 for 1 hour and then transferred to Vero E6 cells. However, no viruses could be rescued from any of the deoptimized infectious clones, suggesting the infectious clones were over deoptimized. For this reason, further vaccine CD candidates were constructed.
The experimental results of Example 4 showed that the virus cannot tolerate a certain degree or type of deoptimization. In view of the failure of these first generation candidates, further second generation clones/vaccine candidates were constructed and tested using four different CD strategies. See
The experimental steps described in the following Examples are summarised in the flowchart of
See
The ORF1a region was selected for codon deoptimization, but excluding the 5′ and 3′ regions (ribosomal frameshift region).
Deoptimized and wild-type/non-deoptimized fragments alike can be directionally joined/assembled in different combinations using enzymes SmaI (position 4254) and AvrII (position 6982) cleavage sites. See
This deoptimization strategy was used to bring in the rarest codon in Homo species, and increase the CpG element that was shown to be an important immunoregulator for RNA virus immune response.
About half of the serine amino acids present in the deoptimization region were targeted to replace with the rare serine codon TCG. 77 (of 160) codons of serine were selected to be deoptimized to TCG. TCG codons have a CpG element that is known to be an important immunoregulator for RNA virus immune response. Thus, the deoptimization of serine to TCG also increased the frequency of the CpG element in the fragment.
This resulted in the generation of 7 recombinant clones/vaccine candidates:
This deoptimization strategy was used to bring in the rarest codon in Homo species, and increase the CpG element that was shown to be an important immunoregulator for RNA virus immune response.
All of the serine amino acids present in the deoptimization region were targeted to replace with the rare codon TCG. 160 codons of serine were selected to be deoptimized to TCG.
This resulted in the generation of 7 recombinant clones/vaccine candidates:
This deoptimization strategy was used to bring in the less rare codons in Homo species, and increase the CpG element that was shown to be important immunoregulators for RNA virus immune response.
The amino acids isoleucine, proline, threonine and alanine present in the deoptimization region were targeted to replace with less rare codons. 81 codons for proline were selected to be deoptimized to CCG. 186 codons for threonine were selected to be deoptimized to ACG. 82 codons for isoleucine were selected to be deoptimized to ATA. 147 codons for alanine were selected to be deoptimized to GCG.
If all 3 fragments were deoptimized there would be a total of 496 codon changes. This resulted in the generation of 7 recombinant clones/vaccine candidates:
However, only one candidate could be rescued using this strategy, being SARS-CoV-2-4N-1 (‘4N-1’) (SEQ ID NO:53) The remaining 6 were dead clones. Only fragment 3 of SARS-COV-2-4N-1 has been deoptimized, there were 97 codon changes.
This deoptimization strategy was used to selectively bring in less rare codons in Homo species, and increase the CpG element that was shown to be an important immunoregulator for RNA virus immune response.
The amino acids isoleucine, proline, threonine, alanine, arginine, glycine and glutamine present in the deoptimization region were targeted to replace with moderate codons. 82 codons for proline were selected to be deoptimized to CCG. 178 codons for threonine were selected to be deoptimized to ACG. 44 codons for isoleucine were selected to be deoptimized to ATA. 147 codons for alanine were selected to be deoptimized to GCG. 40 codons of arginine were selected to be deoptimized to CGT. 41 codons of glycine were selected to be deoptimized to GGT. 14 codons of glutamine were selected to be deoptimized to CAA.
If all 3 fragments were deoptimized there would be a total of 546 codon changes. This resulted in the generation of 7 recombinant clones/vaccine candidates:
However, only one candidate could be rescued using this strategy, being SARS-CoV-2-7N-1 (‘7N-1’) (SEQ ID NO:60). The remaining 6 were dead clones. Only fragment 3 of SARS-COV-2-7N-1 has been deoptimized; there being 97 codon changes.
The clones were prepared as generally depicted in
The full-length infectious clone of SARS-COV-2 was assembled in a bacterial artificial chromosome as previously described for SARS-COV-1 (Enjuanes L, Zuñiga S. Castaño-Rodriguez C, Gutierrez-Alvarez J, Canton J, Sola I. Molecular Basis of Coronavirus Virulence and Vaccine Development. Adv Virus Res. 2016; 96:245-286. doi: 10.1016/bs.aivir.2016.08.003) and for Zika virus (Mutso M, Saul S, Rausalu K, et al. Reverse genetic system, genetically stable reporter viruses and packaged subgenomic replicon based on a Brazilian Zika virus isolate. J Gen Virol. 2017; 98(11):2712-2724. doi: 10.1099/jgv.0.000938). Alternatively, a split system as described by Scobey and colleagues (Scobey T. Yount B L, Sims A C, et al. Reverse genetics with a full-length infectious cDNA of the Middle East respiratory syndrome coronavirus. Proc Natl Acad Sci USA. 2013; 110(40): 16157-16162. doi: 10.1073/pnas.1311542110) was used.
This Example describes the transformation and purification of SARS-COV-2 infectious clones from EPI300 bacterial cells (TransforMax™ EPI300™ E. coli).
Prepare 250 μl of SOC medium without antibiotic for each transformation to be performed. Maintain the medium at room temperature. Pre-chill 1.5 ml tubes on ice/at 4° C. and heat a water bath to 42° C. Thaw TransforMax EPI300 Chemically Competent E. coli cells on ice. Mix by gentle tapping. Use the cells immediately. Transfer 1-5 μl of DNA and 50 μl of cells to a pre-chilled 1.5 ml tube and incubate on ice for 30 minutes. Transfer the tubes to the water bath at 42° C. and heat shock for 30 seconds. Transfer the cells back to ice and cool for 2 minutes. Add 250 μl of SOC medium to each tube. Allow cells to recover by incubating at 37° C. for 60 minutes in a shaking incubator at 220-230 rpm. Plate the cells on LB agar plate with 12.5 μg/ml chloramphenicol and culture overnight at 37° C. Pick single E. coli colony from the plate and culture in LB medium with 12.5 μg/ml chloramphenicol overnight at 37° C. in a shaking incubator at 220-230 rpm. Preserve the transformed E. coli culture by mixing with sterile glycerol to obtain a final concentration of 20% glycerol. Store glycerol stocks at −80° C.
Inoculate 0.5 ml of E. coli stock in 250 ml SOY medium and culture overnight at 37° C. in a shaking incubator at 220-230 rpm. Add 750 ml of fresh SOY medium with 12.5 μg/ml chloramphenicol and 1 ml of the Copy Control Induction Solution. Incubate the culture at 37° C. in a shaking incubator with vigorous shaking for 5 hours. Collect cells by centrifugation at 2000 g for 10 min at 4° C. Resuspend the cells in 100 ml Resuspension Buffer RES-EF. Add 100 ml Lysis Buffer LYS-EF, mix carefully by inverting the tube for 4-5 times, incubate for 5 min at room temperature. Add 100 ml Neutralization Buffer NEU-EF, mix thoroughly by inverting the tube for 4-5 times. Centrifuge at 5000 g for 5 min at 4° C. to pellet cell debris. Filter the supernatant through 70 μm mesh cell strainer. Add 300 ml isopropanol to the filtered supernatant and mix well. Centrifuge at 6000 g for 15 min at 4° C. Discard the supernatant. Treat the white pellet as bacterial pellet and follow purification method according the instructions of NucleoBond Xtra Midi EF, Midi kit for endotoxin-free plasmid DNA.
Twenty-eight recombinant clones/vaccine candidates were constructed (SEQ ID NOs:39-66) and 16 recombinant clones/vaccine candidates were rescued. These were: SARS-COV-2-77-1. SARS-COV-2-77-2, SARS-COV-2-77-3, SARS-COV-2-77-4, SARS-COV-2-77-5, SARS-COV-2-77-6, SARS-COV-2-77-7 (‘Vaccine 77-7’), SARS-COV-2-160-1, SARS-COV-2-160-2, SARS-COV-2-160-3. SARS-COV-2-160-4 (‘Vaccine 160-4’), SARS-COV-2-160-5, SARS-COV-2-160-6, SARS-COV-2-160-7 (‘Vaccine 160-7’), SARS-COV-2-4N-1 (‘Vaccine 4N-1’) and SARS-COV-2-7N-1 (‘Vaccine 7N-1’).
The Example describes the generation of passage 0 (zero) SARS-COV-2 stocks from a full-length DNA infectious clone as described in Example 7.
Seed BHK cells in a T25 flask(s) at ˜1.5-2×106 cells in DMEM growth medium (DMEM+5% FCS) and incubate overnight at 37° C. with 5% CO2.
Measure the concentration of the DNA infectious clone plasmid on a Nanodrop spectrophotometer instrument. Approximately 10 μg of DNA is sufficient to perform the transfection. Set up tubes with 5-10 ml of F10SC disinfectant for liquid waste and pipette tip decontamination. In a sterile 1.5 ml tube dilute 20 μl Lipofectamine LTX Reagent in 500 μl Opti-MEM medium. In a separate sterile 1.5 ml tube dilute 10 μl PLUS Reagent in 500 μl Opti-MEM medium. Add 10 μg DNA into the tube with diluted PLUS reagent and mix gently. Add the diluted Lipofectamine LTX to the tube with diluted PLUS reagent/DNA and mix gently. Incubate for 20 minutes at room temperature. After incubation, remove the media from the BHK flask(s). Add the Lipofectamine LTX/PLUS reagent/DNA mixture drop-wise to the flask of BHK cells (˜1 ml). Add 4 ml DMEM transfection medium (DMEM+1% FCS) to the flask(s) and mix gently. Incubate the flask(s) at 37° C. with 5% CO2 for 24 hours. Seed Vero E6 cells in a T25 flask(s) at ˜1.5-2×106 cells in DMEM growth medium (DMEM+5% FCS) and incubate overnight at 37° C. with 5% CO2.
Discard the media from the Vero E6 cells. Flush/scrape the transfected BHK cells from the flask and directly transfer the cell/media suspension into the flask of Vero E6 cells. Incubate the Vero E6/BHK cells at 37° C. with 5% CO2. Monitor the cells for cytopathic effect (CPE) daily. Once sufficient signs of CPE are evident (for wild type virus this is usually between 48-72 hours post-transfer of BHK cells onto Vero E6 cells) freeze the flask(s) for 1 hr-overnight. Thaw frozen cell culture flask(s) and collect the thawed cell suspension(s) into a 15 ml tube(s). Centrifuge cell suspension(s) at ˜2000 g for 5 min to pellet the cell debris. Collect clarified supernatant(s) and filter through a 0.22 μm syringe filters and aliquot into sterile 2 mL screw-cap cryo tubes. Transfer viral aliquot cryo tubes into 5 ml tubes (samples are now double contained). Store virus aliquots at −80° C. until ready to perform SARS-COV-2 plaque assay.
Thaw an aliquot of passage 0 virus. Remove the media from a T75 flask(s) of Vero E6 cells with ˜7-8×106 cells and wash once with sterile PBS. Infect Vero E6 cells with passage 0 virus at MOI 0.1-1 diluted in 3-5 ml serum free DMEM. Incubate Vero E6 flask at 37° C. with 5% CO2 for 1 hour with periodic rocking to ensure the cells are in contact with the infection mixture. After 1 hour top up the Vero E6 flask with 3-5 ml DMEM+2% FCS and incubate at 37° C. with 5% CO2. Monitor the cells for cytopathic effect (CPE) daily. Once sufficient signs of CPE are evident freeze the flask(s) for 1 hr-overnight. Thaw frozen cell culture flask(s) and collect the thawed cell suspension(s) into a 15 ml tube(s). Centrifuge cell suspension(s) at ˜2000 g for 5 min to pellet the cell debris. Collect clarified supernatant(s) and filter through a 0.22 μm syringe filters and aliquot into sterile 2 mL screw-cap cryo tubes. Transfer viral aliquot cryo tubes into 5 ml tubes (samples are now double contained). Store virus aliquots at −80° C. until ready to perform SARS-COV-2 plaque assay.
As shown in
At day 2 (48h) post infection, SARS-COV-2, SARS-COV-2-160-7 and SARS-COV-2-4N-1 all grew to approx. 1×106 PFU/ml, while SARS-COV-2-7N-1 reached approx. 6× 104 PFU/ml.
At day 3 (72h) post infection, all the four strains showed reduced titer compared to day 2 post infection, which may be due to the excessive cell death.
Mock: no sign of CPE (
Mock: no sign of CPE (
Mock: no sign of CPE (
All clones based on SARS-COV-2-77 showed CPE in Vero E6 cells, but growth curve kinetic studies were not undertaken.
This Example describes determining the viral titre of SARS-COV-2 samples using the plaque assay technique.
Seed Vero E6 cells in 12-well tissue culture plate(s) at ˜2×105 cells per well in DMEM growth medium (DMEM+5% FCS) and incubate overnight at 37° C. with 5% CO2 in PC2.
Thaw virus sample(s) and make 10-fold serial dilutions of sample(s) using DMEM dilution/infection medium (DMEM serum free) in a sterile 96-well U-bottom plate(s). Prepare enough diluted virus to do each dilution in duplicate. Remove the media from the cell culture wells and wash cells once with sterile PBS. Remove the PBS from the cells and inoculate the appropriate wells with 200 μl of diluted viral solutions. Incubate the plate(s) at 37° C. 5% CO2 for 1 hour with periodic rocking to ensure the cells are in contact with the infection mixture. During the incubation period prepare Avicel overlay by mixing 2.4% Avicel RC-581 with 2× overlay medium (2× DMEM+2% FCS) at a 1:1 ratio. Final concentration=1.2% Avicel+DMEM+1% FCS. After 1 hr incubation remove the viral inocula from the wells using a pipette then discard the liquid waste into the tube with F10SC. Overlay cells with 1 mL of 1.2% Avicel overlay mixture. Incubate cells for 72 hours at 37° C., 5% CO2.
Fix plates by working with one plate at a time, manually remove the 1.2% Avicel overlay from monolayers using a pipette then discard the waste into the tube with F10SC. Immediately rinse plates with PBS. Repeat this rinse one to two more times if a lot of residual Avicel is still present. Immediately fix and stain the cells with 0.1% Crystal Violet: 3.7% Formaldehyde (CV:FA) for at least 30 minutes at room temperature. Following staining and fixation, remove stain solution from the wells and rinse any remaining CV:FA with water. Allow plates to air dry in a BSL2 cabinet. Count the number of plaques in the wells and then calculate the number of plaque forming units per ml (pfu/ml) using the following formula:
SARS-COV-2 formed plaques of a similar size with a round shape. Compared to the de-optimized strains/candidates, the plaques are bigger and have clearer boundaries (
SARS-COV-2-160-7 formed plaques of two sizes. Approximately 85% of the plaques are small plaques that have blur boundaries and irregular shapes. Approximately 15% of the plaques are bigger and similar to the WT strains (
SARS-COV-2-4N-1 had plaques of similar sizes in irregular shapes. When compared to the WT stain, the plaques are much smaller and have blurred boundaries (
SARS-COV-2-7N-1 had plaques of similar sizes in irregular shapes. When compared to the WT stain, the plaques are much smaller and have blurred boundaries and are similar in phenotypes to SARS-COV-2-4N-1 (
We tested the safety of the vaccine candidates in a hamster model. Hamsters were infected intranasally with 105 PFU of vaccine candidates and wild-type SARS-COV-2. Lung pathology was assessed in infected hamsters, for cell and tissue damage and reactive inflammation. See
A discussion of the results follows.
We tested the safety of the vaccine in a hamster model. Hamsters were infected intranasally with 105 PFU of vaccine candidates and wild-type SARS-COV-2. Lung pathology was assessed in infected hamsters, for distribution of lesions, bronchial and peribronchial distribution of inflammatory cells. See
A discussion of the results follows.
At days 3, 5, 7 and 14 there was marked bronchial and peribronchial distribution of inflammatory cells, with a slight reduction in the extent and intensity of inflammation at day 14 compared to the earlier time points. At days 3, 5 and 7 there was a patchy distribution of inflammatory cells throughout the lungs.
Histopathological changes were observed in wildtype SARS-COV-2-infected groups on 3 day post infection (dpi) and time-dependent increase in severity of % lungs affected was observed on 5 dpi and 7 dpi. However, there was decrease in severity on 14 dpi. The % lungs affected was higher in wildtype SARS-COV-2-infected groups (55%) on 7 dpi which was well correlated with the distribution of lesions, cellular and tissue damage, circular changes, vascular lesions and reactive inflammatory patterns. Minimal to mild patchy lesions around bronchial and peribronchial were recorded in lungs of all SARS-COV-2-infected animals.
Histopathological changes were observed in all SARS-COV-2-infected groups on 3 dpi and time-dependent increase in severity of % lungs affected was observed on 5 dpi and 7 dpi. However, there was decrease in severity in all the groups on 14 dpi except marginal decrease in candidate 160-4. The % lungs affected was higher in candidate 4N-1 (31.25%) followed candidates 77-7 (28.75%), 160-7 (21.75%), 160-4 (14.00%) and 7N-1 (4.75%) on 7 dpi which was well correlated with the distribution of lesions, cellular and tissue damage, circular changes, vascular lesions and reactive inflammatory patterns. Minimal to mild patchy lesions around bronchial and peribronchial were recorded in lungs of all SARS-COV-2-infected animals.
We tested the safety of the vaccine candidates in a hamster model. Hamsters were infected intranasally with 105 PFU of vaccine candidates and wild-type SARS-COV-2. Lung pathology was assessed in infected hamsters, for circulatory and vascular lesions, including perivascular edema, desquamation of endothelial cells and endothelialitis. See
A discussion of the results follows.
Vascular lesions were prominent at day 3, day 5 and day 7 but had improved markedly by day 14. Circulatory changes and vascular lesions characterized by alveolar haemorrhage, alveolar edema, perivascular/interstitial edema, vascular endothelialitis and necrosis and desquamation of vascular endothelial cells were recorded in SARS-COV-2-infected lungs of all wild-type SARS-COV-2 animals and the severity of lesions was mild to marked.
Overall conclusion: Circulatory changes and vascular lesions characterized by alveolar haemorrhage, alveolar edema, perivascular/interstitial edema, vascular endothelialitis and necrosis and desquamation of vascular endothelial cells were recorded in lungs of all vaccine-infected animals. The severity of lesions was minimal to mild in candidates 77-7, 4N-1 and 160-4 and minimal in candidates 7N-1 and 160-7.
We tested the safety of the vaccine in a hamster model. Hamsters were infected intranasally with 105 PFU of vaccine candidates and wild-type SARS-COV-2. Lung pathology was assessed in infected hamsters, for regeneration and repair. See
A discussion of the results follows.
Minimal hyperplasia of alveolar epithelial cells was observed at day 3. There was significant hyperplasia of alveolar epithelial cells at day 5 and day 7, with a slight reduction of hyperplasia at day 14. Taken together, these results provide clear indication of the virulence of wild-type SARS-COV-2 in the hamster model, with massive lung pathology.
Regeneration and repair characterized by hyperplasia of BEC, hyperplasia of AEC-II, multinucleated or otherwise atypical epithelial cells and pleural fibroblastic proliferation/fibrosis was recorded from day 5 in wildtype SARS-COV-2. No histopathological changes were observed in uninfected group.
Regeneration and repair characterized by hyperplasia of BEC, hyperplasia of AEC-II, multinucleated or otherwise atypical epithelial cells and pleural fibroblastic proliferation/fibrosis was recorded from day 3 dpi in candidates 4N-1 and 160-7; day 5 in 77-7 and day 7 in 7N-1 and 160-4. No histopathological changes were observed in uninfected group.
To test the efficacy of candidate 7N-1 as a COVID-19 vaccine, we established a challenge experiment using the following immunisation groups: 103 PFU 7N-1 intranasal (7N-1 IN); 105 PFU 7N-1 subcutaneous (7N-1 SC); 103 PFU wild-type mouse-adapted SARS-COV-2 (SARS-COV-2 MA10) intranasal (WT nCOV); and unimmunised (PBS treated). HFH4-hACE2 mice were used in this study. HFH4-hACE2 mice expressed high levels of hACE2 in the lung, but varying expression levels in other tissues. See
In the first 7 days post-immunisation: (i) we did not see any disease in mice given 103 PFU 7N-1 intranasal; 105 PFU 7N-1 subcutaneous; and unimmunised (PBS treated); (ii) severe disease and death was observed in 1 mouse given 103 PFU wild-type mouse-adapted SARS-COV-2 (SARS-COV-2 MA10) intranasal.
Three weeks later, the mice were challenged with 105 PFU intranasal wild-type mouse-adapted SARS-COV-2 (SARS-COV-2 MA10) and monitored over a 12-day period. 7N-1 vaccination provided strong protection from SARS-COV-2 challenge, with 100% survival in the intranasal group (green line—triangle symbol) and 65% survival in the subcutaneous group (red line—square symbol). Two mice in the 7N-1 subcutaneous vaccinated group die, although later than the unimmunised group. Death in this group is likely related to the reduced receptor expression in the periphery. All unimmunised mice died from challenge with SARS-COV-2 MA10 (blue line—PBS). Immunisation with wild-type mouse-adapted SARS-COV-2 (SARS-CoV-2 MA10—inverted triangle symbol) provided partial protection (25% survival).
Hamsters were immunised intranasally with 105 PFU with 7N-1, 4N-1, 77-7, 160-4 or 160-7 vaccine candidates. The mean neutralizing antibody titers (PRNT100) at day 14 following immunization were determined and are shown in Table 6. Vaccine candidates 7N1, 160/7 and 160/4 were all highly immunogenic in the hamster model of infection, inducing a strong neutralizing antibody response.
The two candidates 7N-1 and 160-7 were highly immunogenic in the hamster model of infection, inducing a strong neutralizing antibody response. Hamsters were immunised subcutaneously with 104 PFU 7N-1 or 160-7 vaccine candidates. At day 14 following immunization, blood was collected to determine neutralization titres. Mean PRNT50 was 1280 for both vaccine candidates and mean PRNT90 was 640 for 7N-1 and 640 for 160-7. Sec Table 7. Based on its high level of attenuation and safety in the mouse and hamster infection models, we selected 7N1 as our lead candidate for further analysis.
Hamsters were given single dose of 104 PFU of live attenuated virus candidates 160-7 or 7N-1 subcutaneously. Neutralizing antibody titres were determined on day 14 after immunisation with live attenuated virus. The results are shown in
Vaccine candidates 7N-1, 77-7, 4N-1, 160-4 and 160-7 were passaged 4 times in Vero GMP cells at multiplicity of infection of 0.01 PFU/cell. Each dot represents one plaque. Vaccine candidates 4N-1 (
Small plaques demonstrate a reduced ability of the vaccine to spread from the initial site of infection. This serves as useful marker of vaccine attenuation. To determine the phenotypic stability of vaccine attenuation extended in vitro passage of vaccine candidates and wildtype SARS-COV-2 was performed four times in Vero GMP cells. The plaque size of 4N-1 (
The live attenuated SARS-COV-2 (COVID 19) vaccine described herein is based on codon de-optimization technology, which is a promising approach for achieving an enhanced safety profile (cannot revert to virulent strain), and is designed as a prophylactic, active, single dose immunization against coronavirus in humans. The vaccine should provide long-lasting protection, probably with single dose administration, and an anticipated safety profile similar to licensed vaccines for active immunization.
Live attenuated vaccines are well-known to induce a very strong immune response and to elicit both cell-mediated and humoral immune responses. To overcome the risk of reversion associated with ‘live attenuated’ vaccines we have developed the ‘live attenuated SARS-COV-2’ vaccine using codon de-optimisation technology. Using this approach, the whole virus (Wuhan isolate) is synthetically created by varying its nucleotide sequences (codons) such that all the structural proteins that generate immune response remain unaltered, while the number of non-structural proteins required for replication are altered thereby attenuating the virus. While live attenuated vaccines are well known to induce a strong immune response there is also a risk of reversion of mutation, generally this risk exists when the attenuated virus has a limited number of mutations. To address this risk, we have created a large number of mutations, thereby virtually eliminating this risk.
We first generated a synthetic SARS-COV-2 infectious clone based on the Wuhan strain. Next, we designed and constructed attenuated COVID-19 vaccine candidates using codon de-optimisation. For our leading vaccine candidate 7N-1, we introduced a large number of silent mutations (a total of 97 codon changes in the non-structural proteins 3 [nsP3] and 4 [nsP4]) in the replicative genes, but not in the structural proteins of the virus. There is essentially no risk of reversion to virulence due to the large number of substitutions in the gene sequences. The lead candidate, 7N-1, is highly attenuated, replicating to very low levels in mammalian cells and exhibiting a classic ‘small plaque phenotype’ indicative of a high level of attenuation (see
Mice infected with live attenuated vaccine 7N-1 show no signs of disease. Infection of mice with wildtype SARS-COV-2 results in substantial weight loss and disease followed by death by 7-8 days post-infection. To determine vaccine safety human ACE2 (hACE-2) transgenic mice were infected intranasally with high dose (105 PFU) 7N-1 and monitored over a 10-day period. The mice exhibited no weight loss or any other disease signs. In contrast, mice infected with 105 PFU wild-type SARS-COV-2 suffered substantial weight loss and died within 8 days (see
Vaccinated mice show no signs of disease after challenge with wildtype SARS-CoV-2. To test whether the vaccine protects against lethal infection with wildtype SARS-COV-2, hACE-2 transgenic mice were immunised with 103 PFU 7N-1 intranasally followed by challenge three weeks later with 105 PFU wild-type SARS-COV-2 intranasally. Infection of unimmunised mice with wild-type SARS-COV-2 resulted in 100% mortality within seven days. In contrast, immunised mice were completely protected, with no mortality (see
Hamsters infected with live attenuated vaccine show no signs of disease. To further evaluate vaccine safety, hamsters were infected intranasally with a high dose (105 PFU) of vaccine candidate 7N-1 or wild-type SARS-COV-2. At days 3, 5, 7 and 14 post-infection, groups of hamsters were sacrificed for histological evaluation of lung pathology. Lung tissue sections were evaluated in a blinded fashion by experienced histopathologists at Vimta Labs Ltd (Hyderabad). Hamsters given candidate 7N-1 showed minimal lung pathology, with pathology readout scores of 3-4.5% on days 5 and 7 (days when peak inflammation is expected) while uninfected hamsters scored 0%. See Table 8 below for scores from individual animal.
In contrast, hamsters infected with wild-type SARS-COV-2 had pathology scores greater than 50% at the same time points. See Table 9 below for scores from individual animals.
For all the specific pathology readouts, such as cellular infiltration, tissue damage and epithelial hyperplasia, the scores for candidate 7N-1 were dramatically lower than for wild-type virus. Histopathological changes were observed in wildtype SARS-COV-2-infected groups with increase in severity of % lungs affected was observed on 7-day post infection (see
The route of live attenuated vaccine immunisation in humans is subcutaneous. Therefore, we determined the immunogenicity of the vaccine in hamsters when given subcutaneously. To assess immunogenicity, hamsters were immunised subcutaneously with 104 PFU candidate 7N-1. Serum samples were collected two weeks later to measure PRNT50 (50% of virus neutralized), PRNT90 (90% of virus neutralized) and PRNT100 (100% of virus neutralized) neutralising antibody titers (see Table 7 of an earlier Example). The neutralising antibody titers elicited by immunisation with candidate 7N-1 were very high, demonstrating the vaccine's strong immunogenicity.
We designed, constructed and tested various attenuated COVID-19 vaccine candidates using codon de-optimisation (CD) of the ORF1a region of the genome, from SanD11534 to PacI8586, which we call the deoptimised region—‘DO region’. Various combinations of CD fragments 1-3 were used to generate the candidates: Fragment 1: SanD11534 to SmaI4254; Fragment 2: SmaI4254 to AvrII6982; and, Fragment 3:AvrII6982 to PacI8586. Fragment 3 is the shortest fragment. The numbers 1534, 8586 etc. indicate the genomic positions of the Wuhan strain. The codon changes per fragment and for the DO region are summarised in Table 10 below.
For the entire SanD11534 to PacI8586 genomic DO region. Table 11 below covers all of the amino acids (‘Aa’) throughout the entire DO region. Note, this table is looking at the entire DO region; all the numbers are for codons, rather than nucleotides.
4.4 (1st group)
17 (4th group)
22 (4th group)
29 (4th group)
Although we do not have experimental data for each and every amino acid change in Table 11, it is reasonable to expect that the stated percentage and number of codon changes within the DO region will result in potentially rescuable and efficacious vaccine candidates/clones. Codon frequency can be divided into 4 groups: under 5% (1st group), 5-10% (2nd group), 10-15% (3rd group), over 15% (4th group). See the group numbering in Column #4. We have experimental data representing codon changes for the first 3 groups, and the percentage of the codon change in our designs is quite wide (see Column #9 and #11). However, we do not have experimental data for the 4th group (frequency over 15%), but we believe that the number and percentage of codon changes is reasonable and should result in potentially rescuable and efficacious vaccine candidates/clones. Our reasons are: Ser and Arg are representative for the Aa that have rare codons (frequency under 5%); Thr, Pro, Ala and Ile are representative for the Aa that have less rare codons (frequency 5-10%); and, Gly and Gln are representative for the Aa that don't have rare codons (frequency 10-15%). We do not have experimental data to support the coverage of the Aa with codon frequency over 15%. Asn, Phe, Asp, Lys and Glu. We probably do not need to cover those Aa, as the frequency of these Aa is very high (we want to de-optimize, not optimize). Met and Trp have only one synonymous codon and cannot be changed.
Further testing of vaccine candidates can be carried out as depicted in
Live attenuated SARS-COV-2 vaccine candidates can be further tested in the NHP model of SARS-COV 2 infection. Antibody and cellular responses can be determined in immunised macaque. Viremia in the sera, lung and/or nasal/oral secretions can be measured. Anti-SARS-COV-2 specific antibody levels, neutralisation titres and cellular immune response can be measured post-immunisation. We can also evaluate vaccine efficacy by a challenge with a wild type SARS-COV-2. Immunised macaque can be challenged several weeks after immunisation. Clinical symptoms can be observed in all groups. Viral titres can be measured in the sera, lung and/or nasal/oral secretions post-challenge. Antibody titres, neutralisation titres and cellular immune response can be measured post-challenge. Histological analysis of lung tissue can be performed post-challenge.
Total of five groups (each group can have five animals each). Total animals: 25.
The Nab titer (neutralizing antibodies) and the S-specific binding antibodies can be evaluated before challenge to determine vaccination efficacy. If it is too early to challenge at week 4 as the immune response after vaccination may be slow/delayed, challenge in week 9 can be undertaken.
Various viral and immune parameters can be measured as described in
This Example briefly describes a study for evaluating the safety, the degree of immune response and the efficacy of vaccine candidate 7N-1 in the cynomolgus non-human primate (NHP) model after one or two immunizations.
The protocol is summarised in Table 12 below.
As described in Table 12, fifteen cynomolgus macaques are included in this study and divided into 3 groups. Animals of groups 1 and 2 will be immunized with the 7N-1 vaccine (104 PFU) by subcutaneous (s.c.) route. Animals from group 1 (n=5) will receive only one dose of the vaccine on day 0 and a placebo dose on week 4. The animals of group 2 (n=5) will be immunized both on day 0 while animals in group 2 will receive a prime and a boost on days 0 and 28 (4 weeks). Animals of control group (n=5) will receive the vehicle as placebo by s.c. route on day 0 and day 28.
All animals will then be exposed at week 8 post first immunization to SARS-COV-2 P1 variant (Brazilian strain) by intranasal (i.n.) and intratracheal (i.t.) routes simultaneously, with a 1.105 TCID50 challenge dose. Animals will be euthanized at day 14 post challenge. Samples will be collected and analyzed.
The 7N-1 vaccine is a highly-purified, whole virus, SARS-COV-2 vaccine produced on Vero cells and attenuated by codon de-optimisation technology to make multiple mutations in the non-structural proteins of SARS-COV-2.
The composition of the vaccine (0.5 mL) is shown in Table 13.
SARS-COV-2 P1 variant virus doses will be purchased from BEI Resources Repository (National Instituted of Health, USA).
The vaccine will be provided in two formulations—liquid form and freeze-dried form. For the liquid form, the vaccine will be provided in vials containing 1 mL of attenuated SARS-COV-2 strain 7N-1. For the freeze-dried form, the vaccine will be provided in vials containing lyophilized powder of attenuated SARS-COV-2 strain 7N-1. The vaccine will be stored in a freezer at −80° C. SARS-Cov-2 virus strain 7N-1 (1×105 PFU/ml/Vial). Freeze dried SARS-Cov-2 virus strain 7N-1 (1×105 PFU/Vial).
This Example describes a protocol for successfully transfecting vaccine constructs, being an alternative to the method described in Example 8. We are able to rescue candidate viruses by directly transfecting Vero GMP cells without the need to use BHK cells.
To rescue a recombinant SARS COV-2 virus from a full-length DNA infectious clone(s).
Nuclease free tips, Nuclease free tubes, Cell culture incubator, Nanodrop instrument, Microfuge, 12 well tissue culture plate, Light microscope, Sterile 1.5 mL Eppendorf tubes, SARS-COV-2 infectious clone plasmid(s), Vero-GMP cells, HEK-293 TT cells, BHK-21 cells, Vero E6 cells, Lipofectamine 2000 reagent (Thermo Fisher Scientific-11668019), Polyethyleneimine MAX (Polysciences Inc, 24765), Opti-MEM medium, HMEM, DMEM growth medium, and Fetal bovine serum.
Seed the cells at a recommended seed rate following Table 14 below.
Incubate the plates at 37° C. with 5% CO2 overnight or until the monolayer reaches to 70-80% confluency.
Prepare the transfection reagent and the DNA as provided in Table 15 below.
Wait for 5 minutes at room temperature.
Mix the transfection reagent (Vial A) and DNA (Vial B) and incubate at room temperature for 20 minutes.
Transfer the lipofectamine/PEI MAX and DNA complex into the cells.
Gently mix and incubate the plates at 37° C. at 5% CO2 up to 72-96 hours and observe the plates for every 12-24 hours.
After incubation, harvest the contents of the wells in to 15 ml centrifuge tube.
Freeze the tubes in −80° C. and quickly thaw the tubes in a 25° C. water bath. Repeat this step twice and clarify the sample by centrifugation at 1500 rpm for 10 minutes and store at −80° C. until further process.
Seed Vero-GMP cells at 3×105 cells per/ml in a 12 well plate and incubate the plates at 37° C. at 5% CO2.
Infect the Vero-GMP monolayer (1 ml/well in 12 well plate) with the clarified transfected supernatant.
Incubate the plates at 37° C. at 5% CO2 overnight (˜16 hours).
After incubation, replace the medium with fresh HMEM supplemented with 1% FBS and continue incubating the plates at 37° C. at 5% CO2 for 60 hours.
After incubation, harvest the virus (supernatant and cells) and store at −80° C. until further process.
Propagation of the rescued virus (Blind passage-II)
If required (if the CPE is not evident), repeat the passage once again in Vero-GMP cells as described above before further scale up.
Titrate the virus following standard protocol.
Scale up the virus as required at a preferred MOI.
To test the efficacy of candidate 7N-1 as a COVID-19 vaccine, we established a challenge experiment using the following immunisation groups: 103 PFU 7N-1 intranasal; 105 PFU 7N-1 subcutaneous; 103 PFU wild-type mouse-adapted SARS-COV-2 (SARS-COV-2 MA10) intranasal; and unimmunised (PBS treated). See
HFH4-hACE2 mice were used in this study. Three weeks later, the mice were challenged with 105 PFU intranasal wild-type mouse-adapted SARS-COV-2 (SARS-COV-2 MA10) and monitored over a 7-day period. All mice in the unvaccinated group were moribund by day 7 post-infection and were euthanised. Mice given 7N-1 vaccination showed strong protection from SARS-COV-2 challenge, with 100% survival in the intranasal group and 80% survival in the subcutaneous group (death in mice given 7N-1 subcutaneous is likely related to the reduced receptor expression in the periphery). Immunisation with wild-type mouse-adapted SARS-COV-2 (SARS-COV-2 MA10) provided partial protection.
Live attenuated SARS-COV-2 vaccine/vaccine dose can comprise freeze-dried/lyophilized infectious virus as produced in the earlier Examples. The freeze-dried/lyophilized infectious virus can be reconstituted and administered by subcutaneous injection, inhalation or oral route. In preferred embodiments, the vaccine is administered by subcutaneous injection, intranasally or orally. The vaccine can be used for prophylactic, active, single-dose immunization against SARS-COV-2 in humans. A subject may be administered, for example, a titre of approximately 104 PFU attenuated virus per vaccine dose.
There are a number of key features of the codon-deoptimized SARS-COV-2 vaccine that make it very attractive as a commercial candidate.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention.
In the present specification and claims (if any), the word ‘comprising’ and its derivatives including ‘comprises’ and ‘comprise’ include each of the stated integers but does not exclude the inclusion of one or more further integers.
The reference to any prior art in this specification is not, and should not be taken as an acknowledgement or any form of suggestion that the prior art forms part of the common general knowledge.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202041030397 | Jul 2020 | IN | national |
| 202041056151 | Dec 2020 | IN | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/AU2021/050763 | 7/16/2021 | WO |
