Patent Application
20210268087
The present disclosure relates generally to prophylaxis and therapy of cancer, and more specifically to compositions and methods for improving immune responses to cancer.
Tumor antigen-specific CD4+ T cells, CD8+ T cells and B cells play cooperative roles in antitumor immunity. At the tumor site, CD8+ T cells, also known as cytotoxic T cells, are considered to be the main effector cells to destroy cancer cells. CD4+ T cells, also known as helper T cells, help the activation, function and maintenance of CD8+ T cells through activation of antigen-presenting cells and/or secreting cytokines. CD4+ T cells also help activation of B cells to induce antibody secretion by expressing CD40-ligand (CD40L) which binds to CD40 molecule on B cells, and secreting cytokines that induce antibody class-switching. B cells produce tumor antigen-specific antibodies that bind to tumor antigen proteins to form antigen-antibody complex, sometimes referred to as an “immune complex”. Immune complexes are efficiently captured by antigen-presenting cells and at the same time activate antigen-presenting cells (APCs) through binding to Fc receptors. Subsequently, activated antigen-presenting cells cross-present tumor antigen proteins to CD4+ and CD8+ T cells. Because of the distinct and collaborative antitumor functions by CD4+ T cells, CD8+ T cells and B cells, a strategy which would establish integrated CD4+ T cells, CD8+ T cells and antibody-secreting B cells would be a promising immunotherapy for cancer patients.
T cells destroy cancer cells by recognizing tumor antigen protein-derived peptides presented on MHC molecules on cancer cells. However, it is known that some cancer cells escape from T cell-mediated killing by eliminating MHC molecules from their surface. Antibodies that bind on cell surface of cancer cells destroy cancer cells through antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) irrespective of MHC expression (or in a MHC-independent manner).
CD4+ helper T cells are considered to play a central role in inducing integrated antitumor immune response, because they help both CD8+ T cells and B cells. Generally, activation of CD4+ T cells requires antigen-presenting cells that capture and cross-present extracellular proteins such as tumor antigen proteins. Recently, we have discovered a unique CD4+ T-cell subset which directly recognizes MHC class II (MHC-II)-expressing cancer cells. This CD4+ T-cell subset, which we named “tumor-recognizing CD4+ T cells (TR-CD4 cells)”, enhanced function of tumor antigen-specific CD8+ T cells by directly recognizing cancer cells without the need for antigen-presenting cells. Therefore, TR-CD4 cells are expected to efficiently provide help to other immune cells to enhance antitumor immunity at the tumor site. However, there is no presently known method to efficiently induce TR-CD4 cells in the body. Thus, there is an oncoming and unmet need for compositions and methods to improve immune responses to cancer, and other immunogenic agents. The present disclosure is related to these needs.
The present disclosure provides compositions and methods that are useful for stimulating and/or enhancing immune responses, including but not necessarily limited to immune responses to peptide antigens. In embodiments, cell-mediated immunity, humoral immunity, or both are stimulated and/or enhanced by using the compositions and methods of this disclosure.
The disclosure in certain aspects comprises compositions for use in vaccination. In embodiments, the disclosure provides cellular vaccine compositions comprising modified cancer cells that are engineered to overexpress class II trans-activator (CIITA) gene, and an immuno-stimulatory molecule. The immuno-stimulatory molecules described in this disclosure include GM-CSF, CD80, GITR-Ligand, OX-40-ligand, and 4-1BB-Ligand. In one embodiment, CD86 may be used. In embodiments, modified cancer cells express 4-BB-ligand and/or OX40-ligand, as described further below. In alternative embodiments, the disclosure includes using polynucleotides that encode the CIITA protein, and the immune-stimulatory agents, such as in expression vectors, as the agents that are delivered to an individual. In embodiments, as an alternative to the CIITA gene, the disclosure includes engineering cancer cells to increase expression of MHC II alpha and beta chains.
Using relevant mouse models, vaccines described herein are demonstrated to induce potent and long-lasting antitumor CD8+ T cells, compared to cancer cells expressing CIITA or the co-stimulatory ligand alone. Further, cellular vaccines described herein induce production of cytotoxic antibodies against cell surface molecules on cancer cells. Therefore, the vaccines described herein are expected to provide protective immunity against MHC-expressing cancers by T cell-mediated cytotoxicity, but also MHC-loss immune escape variants, by antibody-mediated cytotoxicity.
It will be recognized by those skilled in the art that the term MHC as used herein is extendable to human applications via the MHC human equivalent, referred to in the art as leukocyte antigen gene complex (HLA).
As will be recognized by the non-limiting examples presented with this disclosure, in order to induce TR-CD4 cells, we expressed MHC-II on cell surface of murine cancer cell lines by retrovirally overexpressing MHC class II transactivator (CIITA) gene, which is a master regulator of MHC class II-mediated antigen presentation. To enhance immunogenicity of MHC-II-expressing cancer cells, an immuno-stimulatory gene was also co-overexpressed. In contrast to the parental cancer cells or cells that expressing CIITA-alone, some engineered cancer cell lines co-expressing CIITA and an immuno-stimulatory gene, particularly 4-1BB-ligand (BB-L), induced strong and long-lasting antitumor immune response in syngeneic mice. Cancer cells that co-express CIITA+BB-L, but which do not express BB-L alone, induced circulating antibodies that specifically bind on surface of cancer cells and kill cancer cells. Cancer-specific antibodies induced by CIITA+BB-L-expressing cancer cells protected mice against MHC-loss cancer cell growth. These findings show that engineered cancer cells that co-express CIITA+BB-L are suitable for use as vaccines to induce integrated T-cell and antibody response for protection against MHC-expressing and MHC-loss cancers.
Unless defined otherwise herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
Every numerical range given throughout this specification includes its upper and lower values, as well as every narrower numerical range that falls within it, as if such narrower numerical ranges were all expressly written herein.
The disclosure includes all steps and compositions of matter described herein in the text and figures of this disclosure, including all such steps individually and in all combinations thereof, and includes all compositions of matter including but not necessarily limited to vectors, cloning intermediates, cells, cell cultures, progeny of the cells, and the like.
The disclosure includes but is not limited to engineered immunogenic cancer cells described herein, cancer vaccines made using the immunogenic cancer cells, methods of making the immunogenic cancer cells, immunogenic compositions, polynucleotides, and methods for the treatment of cancer. The disclosure includes all polynucleotides disclosed herein, their complementary sequences, and reverse complementary sequences. For any reference to a polynucleotide or amino acid sequence by way of a database entry, the polynucleotide and amino acid sequence presented in the database entry is incorporated herein as it exists on the effective filing date of this application or patent.
As discussed above, cancer cells express an array of immunogenic antigens that are recognized by T cells and B cells. Therefore, the present disclosure utilizes modified cancer cells as potent vaccines to induce polyvalent immune response.
In embodiments, the disclosure comprises modifying cancer cells as described herein, and comprises the modified cancer cells themselves, and compositions, such as pharmaceutical compositions, comprising the cancer cells. In embodiments, the cancer cells are of any cancer type, including solid and liquid tumors. In embodiments, cancer cells modified according to this disclosure include but are not necessarily limited to breast cancer, prostate cancer, pancreatic cancer, lung cancer, liver cancer, ovarian cancer, cervical cancer, colon cancer, esophageal cancer, stomach cancer, bladder cancer, brain cancer, testicular cancer, head and neck cancer, melanoma, skin cancer, any sarcoma, including but not limited to fibrosarcoma, angiosarcoma, adenocarcinoma, and rhabdomyosarcoma, and any blood cancer, including all types of leukemia, lymphoma, or myeloma.
In embodiments, a cellular vaccine composition described herein is administered to an individual who has cancer, or previously had cancer, or is at risk for developing cancer. The cancer can be any of the aforementioned types. In embodiments, modified cancer cells for use as vaccines of this disclosure comprise cancer cells from a cancer cell line. In embodiments, modified cancer cells for use as vaccines of this disclosure comprise cancer cells from an individual, and are modified such that they express or overexpress CIITA and one or more co-stimulatory molecules or immuno-stimulatory cytokines, as described herein, and are provided to the same individual as a cancer therapy. In embodiments, allogenic cancer cells are modified and used in the methods described herein. In embodiments, the modified cancer cells are the same cancer type as a cancer against which a therapeutic immune response is generated in an individual.
In embodiments, the individual may be vaccinated with one or more antigens that are expressed by the modified cancer cells (or the cancer cells that are targeted using polynucleotides, as described herein). In embodiments, a tumor or cancer cell lysate may be used as the vaccination. In embodiments, immunological protection elicited by methods of the present disclosure (with or without subsequent vaccination) can be durable, and last for days, weeks or months, or longer, including but not limited to after vaccination, and such vaccinations can be effective to elicit protection after a single dose, or multiple doses. Booster vaccinations can be used according to schedules that are known in the art and can be adapted for use with methods of this disclosure when provided the benefit of this specification, and include such approaches as a Prime-Boost strategy.
With respect to immune responses that are stimulated and/or enhanced as described herein, for induction of TR-CD4 cells by cancer cell-based vaccines, cancer cells need to express MHC-II (or HLA, in the case of humans). However, not all cancer cells constitutively express cell surface MHC-II. For instance, none of murine cancer cell lines, including but not necessarily limited to EL4 lymphoma, B16F10 melanoma, MC38 colon cancer, and ID8 ovarian cancers, express constitutive MHC-II.
In order to express MHC-II on cell surfaces of murine cancer cell lines, we retrovirally overexpressed MHC class II transactivator (CIITA) gene, which is a master regulator of MHC class II-mediated antigen presentation. Thus, in embodiments, each cancer cell modified for use as a vaccine as described herein will either be modified such that it expresses CIITA if it did not previously express it, or will be modified such that it expresses more CIITA, relative to the amount expressed prior to being modified according to this disclosure. Those skilled in the art will recognize that CIITA is also referred to as C2TA, NLRA, MHC2TA, and CIITAIV.
Instead of using the CIITA gene, overexpression of MHC class II alpha and beta chain genes are expected to induce cell surface MHC class II expression. Thus, in embodiments, engineering of cancer cells using recombinant molecular biology approaches, such as by direction introduction of MHC alpha and beta chain encoding polynucleotides, is considered to be an alternative approach to provide modified cancer cell vaccines that will function in a manner similar to cancer cells modified as otherwise described herein. In certain embodiments, the disclosure provides for increasing MEW or HLA expression by introducing polynucleotides directly, or to produce modified cancer cells, using polynucleotides that encode HLA class II alpha and beta chains. HLA class II alpha and beta chains for any particular individual can be determined using techniques that are well established in the art. In embodiments, preexisting cancer cells that are matched to an individual's HLA type can be used. Alternatively, any biological sample from an individual that comprises nucleated cells can be tested to determine the HLA type of the individual, and suitable polynucleotides encoding the pertinent HLA class II alpha and beta chains can be designed and produced, and used in embodiments of this disclosure. In embodiments, the HLA class II alpha chains are for HLA-DM, HLA-DMA, HLA-DO, HLA-DOA, HLA-DP, HLA-DPA1, HLA-DQ, HLA-DQA1, HLA-DQA2, HLA-DR or HLA-DRA, or any subtype of these HLA types. In embodiments, the HLA class II beta chains are for HLA-DMB, HLA-DOB, HLA-DPB1, HLA-DQB1, HLA-DQB2, HLA-DRB1, HLA-DRB3, HLA-DRB4, or HLA-DRB5, or any subtype of these HLA types.
Representative and non-limiting examples of murine and human amino acid sequences of CIITA, and co-expressed proteins, as well as DNA sequences encoding them, are provided below. The disclosure includes using nucleotide and amino acid sequences that are different from those provided here, so long as the modified cancer cells function to enhance immune responses relative to unmodified cancer cells. In embodiments, the cancer cells express CIITA and co-stimulatory molecules or immuno-stimulatory cytokines described herein that are identical to the amino acid sequences described below, or have at from 70-99% amino acid identity with the pertinent sequences. The disclosure includes using proteins with amino acid insertions, deletions, and substitutions, provided they retain their intended function. All polynucleotide sequences encoding the proteins described herein are encompassed by this disclosure, and are not to be limited by those presented below.
Examples of this disclosure combine engineered expression or overexpression of CIITA with one or a combination of G-CSF, CD80, GITR-Ligand, OX-40-ligand, and 4-1BB-Ligand. However, it is demonstrated that co-expression of CIITA with 4-1BB-L is superior to the other co-expressed proteins. Thus, in embodiments, the disclosure provides compositions and methods for use as cancer vaccines that comprise modified cancer cells that are engineered by recombinant molecular biology approaches to express CIITA and an immuno-stimulatory that is preferably 4-1BB-L, although the other immuno-stimulatory factors are included within the scope of this disclosure.
In embodiments, use of a cellular cancer vaccine described herein comprises a cancer therapy. In embodiments, use of a cellular cancer vaccine described herein produces a durable memory response, including but not necessarily limited to a durable CD8+ T cell memory response. In embodiments, a single administration of a cellular vaccine composition described herein produced an immune response that lasts at least from at least one month, to at least one year, or for at least one year, or will provide life-long protection, and thus for use in humans or non-human animals can last for decades. Thus, human and veterinary uses are included.
In embodiments, use of a cellular cancer vaccine or related polynucleotide as described herein produces any one or any combination of results, which can be compared to any suitable reference: improved activation of T cells, increase of TR-CD4+ T cells, improved CD8+ memory cell production and/or persistence, improved production of anti-cancer antibodies, improved inhibition of tumor growth, and improved survival time. In embodiments, a vaccination of this disclosure prevents formation of tumors, or limits growth of an existing tumor, or eradicates existing tumors. In embodiments, the reference is obtained by cancer cells that express a different immune-stimulatory molecule than the immune-stimulatory molecule that was a component of an improved immune response. In embodiments, the ability of a vaccine described herein to improve response to rechallenge with cancer cells is improved.
Vectors encoding the CIITA and or the co-stimulatory molecules can be any suitable vector or other polynucleotide. One or more vectors or polynucleotides can be used. In non-limiting embodiments, retroviral vectors may be used.
In embodiments, the cancer cell vaccines, or polynucleotides encoding the proteins described herein, are used concurrently or sequentially with conventional chemotherapy, or radiotherapy, or another immunotherapy, or before or after a surgical intervention, such as a tumor resection. In embodiments, the cancer cell vaccines, or polynucleotides encoding the proteins that are recombinantly expressed by the cancer cell vaccines, are used in single, or multiple doses. In embodiments, the cancer vaccines are provided only once, or weekly, monthly, every 3 months, every 6 months, yearly, or in a pre-determined interval of years.
Cancer cell vaccines described herein can be administered to an individual in need thereof using any suitable route, including parenteral, subcutaneous, intraperitoneal, intrapulmonary, and intranasal. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In embodiments, an amount of cancer cells administered comprises an effective dose. In embodiments, an effective dose comprises sufficient cells to produce one or more effects described herein, including any cell-mediated response, or humoral response, or a combination thereof, which is effective to inhibit growth of cancer, and/or generate an anti-cancer memory response. In embodiments, 104 to 109 modified cancer cells are introduced. In embodiments, a cancer cell composition of this disclosure for use as a vaccine comprises isolated cells modified as described herein, wherein all or some of the cancer cells are modified. In embodiments, the disclosure includes compositions comprising cells, wherein from 1-100% of the cells are modified cancer cells. In embodiments, the disclosure provides compositions comprising cancer cells, wherein 1-100% of the cancer cells are modified cancer cells. Those skilled in the art will recognize that retention of cancer cell morphology is a solution is pertinent to the modified cancer cell phenotype. In embodiments, modified cancer cells can be included in a pharmaceutical composition. Modified cancer cells and/or polynucleotides of the present disclosure can be provided in pharmaceutical compositions by combining them with any suitable pharmaceutically acceptable carriers, excipients and/or stabilizers. Examples of pharmaceutically acceptable carriers, excipients and stabilizer can be found in Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, Pa. Lippincott Williams & Wilkins, the disclosure of which is incorporated herein by reference.
In embodiments, one or more recombinant polynucleotide described herein for use in making the cellular vaccine formulations, or another therapeutic polynucleotide, can be used as the agent that is delivered to the individual, and thus the polynucleotides themselves may comprise a therapeutic agent. In embodiments, a composition delivered to an individual according to this disclosure can be a cell-free composition. In embodiments, a combination of modified cancer cells, and polynucleotides that are not in cells, can be used.
In embodiments, if a therapeutic agent used in a method of this disclosure is a polynucleotide, it can be administered to the individual as a naked polynucleotide, in combination with a delivery reagent, or as a recombinant plasmid or viral vector which comprises and/or expresses the polynucleotide agent. In one embodiment, the proteins are encoded by a recombinant oncolytic virus, which can specifically target cancer cells, and which may be non-infective to non-cancer cells, and/or are eliminated from non-cancer cells if the oncolytic virus enters the non-cancer cells. Examples of recombinant oncolytic viruses that can be used with this disclosure include but are not limited to recombinant vaccinia virus (rOVV). In embodiments, one or more polynucleotides described herein can be delivered via a modified virus comprising a modified viral capsid or other protein that is targeted to, and thus will bind with specificity, to one or more ligands that are preferentially or exclusively expressed by cancer cells. In embodiments, separate polynucleotides encoding distinct proteins described herein can be used. In embodiments, one or more polynucleotides described herein can be injected directly into a tumor.
Polynucleotide therapeutic agents of this disclosure can be combined if desired with a delivery agent. Suitable delivery reagents for administration include but are not limited to Minis Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), liposomes, or combinations thereof.
Therapy or inhibition of cancer as described herein may be combined with any other anti-cancer approach, such as surgical interventions and conventional chemotherapeutic agents. In embodiments, cancer treatment according to this disclosure can be combined with administration of one or more immune checkpoint inhibitors. In embodiments, the checkpoint inhibitors comprise an anti-programmed cell death protein 1 (anti-PD-1) checkpoint inhibitor, or an anti-Cytotoxic T-lymphocyte-associated protein 4 (anti-CTLA-4) checkpoint inhibitor. There are numerous such checkpoint inhibitors known in the art. For example, anti-PD-1 agents include Pembrolizumab and Nivolumab. An anti-PD-L1 example is Avelumab. An anti-CTLA-4 example is Ipilimumab.
In certain non-limiting demonstrations in the examples below, immunogenicity of engineered cancer cells is analyzed using syngeneic C57BL/6 mice in with modified lymphoma, colon cancer cells, melanoma and ovarian cancer cell lines, all of which demonstrate co-expression of CIITA and 4-1BB-L is an effective approach to stimulating potent anticancer responses. Thus, and without intending to be bound by any particular theory, it is expected that the approaches described herein, and particularly co-expression of CIITA with 4-1BB-L, will be broadly applicable to a wide variety of cancer types, and will function with the same or similar efficacy in humans, given that clinically relevant mouse models are used to demonstrate aspects of the disclosure.
Aspects of the disclosure are demonstrated by the following examples, which are intended to illustrate but not limit the disclosure.
Immunogenicity of the engineered cancer cells was investigated by introducing them into syngeneic C57BL/6 mice.
In an EL4 lymphoma model, overexpression of CIITA alone did not change tumor growth as compared to the parental EL4. In contrast, co-expression of CIITA and immuno-stimulatory molecules significantly delayed tumor growth. In particular, EL4 co-expressing OX40-L+CIITA or 4-1BB-L+CIITA was completely rejected. In this model, 3 groups that received EL4 overexpressing OX40-L+CIITA, 4-1BB-L+CIITA, and 4-1BB-L alone showed complete tumor elimination in all mice (
In order to evaluate induction of long-term memory T-cell response by the engineered cancer cells, mice that rejected EL4 overexpressing OX40-L+CIITA, 4-1BB-L+CIITA, or 4-1BB-L alone were rechallenged with the parental EL4 (
In order to determine if the engineered cancer cells induce antitumor antibodies, mice that rejected EL4 overexpressing OX40-L+CIITA, 4-1BB-L+CIITA, and 4-1BB-L alone were rechallenged with EL4 that were engineered by CRISPR/Cas9 gene-editing to silence (32m gene and thus express no MHC molecule (MHC-loss EL4) (
The therapeutic potential of engineered cancer cells was analyzed using a therapeutic vaccine model. In this model, CIITA overexpressing EL4 cells that express both MHC class I and MHC-II or MHC-loss EL4 were inoculated in C57BL/6 mice, and mice were vaccinated by irradiated engineered EL4 (
The effect of engineered cancer cells was tested in other tumor models. In both MC38 colon cancer and B16F10 melanoma models, 4-1BB-L+CIITA expressing cancer cells were spontaneously rejected in all mice (
The following representative murine sequences were used to demonstrate embodiments of this disclosure. Those skilled in the art will recognize, given the benefit of this disclosure that the human sequences provide below the murine sequences, can be adapted for use in human cancer vaccines, and other therapeutic approaches based on the present disclosure.
ATGAACCACTTCCAGGCCATCCTGGCCCAAGTACAGACACTGCTCTCCAGCCAG
ATG
GACCAGCACACACTTGATGTGGAGGATACCGCGGATGCCAGACATCCAGCA
ATGGAAGGGGAAGGGGTTCAACCCCTGGATGAGAATCTGGAAAACGGATCAAG
ATGGAGGAAATGCCTTTGAGAGAATCAAGTCCTCAAAGGGCAGAGAGGTGCAA
ATGGCTTGCAATTGTCAGTTGATGCAGGATACACCACTCCTCAAGTTTCCATGTC
ATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCAC
ATGCGTTGCCTGGCTCCACGCCCTGCTGGGTCCTACCTGTCAGAGCCCCAAGGCA
ATGGAATACGCCTCTGACGCTTCACTGGACCCCGAAGCCCCGTGGCCTCCCGCGC
ATGGAAAGGGTCCAACCCCTGGAAGAGAATGTGGGAAATGCAGCCAGGCCAAG
ATGACATTGCATCCTTCACCCATCACTTGTGAATTTTTGTTTTCCACAGCTCTCAT
ATGGATCCCCAGTGCACTATGGGACTGAGTAACATTCTCTTTGTGATGGCCTTCC
A
ATGTGGCTGCAGAGCCTGCTGCTCTTGGGCACTGTGGCCTGCAGCATCTCTGCAC
The foregoing description of specific embodiments is for the purpose of illustration and is not to be construed as restrictive. From the teachings of the present invention, those skilled in the art will recognize that various modifications and changes may be made without departing from the spirit of the invention.
This application claims priority to U.S. provisional application No. 62/701,791, filed Jul. 22, 2018, the disclosure of which is incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2019/042764 | 7/22/2019 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62701791 | Jul 2018 | US |
