Patent Application
20200262916
The present invention is directed to the elucidation of the mechanism that human Atg8 protein regulates endolysosomal systems in the cell and the role this protein plays in mediating autophagy. Additional embodiments are directed to making use of these findings to provide therapies, including the use of ATg8, STX16 and/or STX17 modulators (inhibitors or agonists) for the treatment of autophagy mediated disease states and/or conditions.
The autophagy pathway, controlled by a conserved set of ATG genes (Levine & Kroemer, 2019, Mizushima et al., 2011), is a cytoplasmic homeostatic process at an interface between quality control and metabolism. This pathway can be activated by metabolic and stress inputs (Garcia & Shaw, 2017, Marino et al., 2014, Noda & Ohsumi, 1998, Saxton & Sabatini, 2017, Scott et al., 2004) or triggered by cargo recognition leading to in situ assembly of ATG factors via receptor-regulators (Kimura et al., 2016, Lazarou et al., 2015, Mandell et al., 2014). Autophagy can be bulk or selective (Birgisdottir et al., 2013, Randow & Youle, 2014, Stolz et al., 2014), whereas the multiple biological outputs of autophagy depend on its completion and the type of termination of the autophagic pathway, e.g. degradation or secretion (Levine & Kroemer, 2019, Ponpuak et al., 2015). Bulk autophagy, whereby portions of the cytoplasm of heterogeneous composition are sequestered, occurs during starvation, and can be quantified by imaging (An & Harper, 2018) or biochemically (Engedal & Seglen, 2016, Seglen et al., 2015) by following sequestration of the cytosolic enzyme LDH, or ultrastructurally by enumerating partially degraded electron-dense ribosomes (Eskelinen, 2008, Tanaka et al., 2000). Autophagy can be selectively guided to specific cargo via a number of sequestosome l/p62-like receptors (SLRs) (Birgisdottir et al., 2013, Bjorkoy et al., 2005, Stolz et al., 2014) or other classes of receptors besides SLRs (Kimura et al., 2016, Levine & Kroemer, 2019). Autophagy machinery is often recruited to damaged or dysfunctional targets after they are marked for autophagic degradation by ubiquitin and galectin tags that in turn are recognized by cytosolic autophagic receptors such as SLRs (Randow & Youle, 2014, Stolz et al., 2014). Autophagy apparatus can also be directly recruited via receptors resident to organelles if they become exposed following organellar membrane damage or depolarization, or are modified downstream of physiological or developmental signals (Bhujabal et al., 2017, Liu et al., 2012, Sandoval et al., 2008, Wei et al., 2017, Wild et al., 2011).
Degradative autophagy terminates in fusion of autophagosomes with lysosomes whereby the sequestered cargo is degraded. Examples of selective degradative autophagy include autophagy of mitochondria (mitophagy), peroxisomes (pexophagy), intracellular microbes (xenophagy), ribosomes (ribophagy), protein aggregates (aggrephagy), specific intracellular multiprotein complexes (precision autophagy) (An & Harper, 2018, Birgisdottir et al., 2013, Kimura et al., 2016, Randow & Youle, 2014). Given the diversity of cargo, complexity of the protein components and membrane compartments engaged, as well as the exquisite responsiveness to a variety of cargo-triggers (e.g. damaged organelles, aggregates) and stress conditions (e.g. starvation, hypoxia), autophagy is controlled by a collection of subsystems that have to come together in a modular fashion and cooperate in the initiation and execution of autophagy (Mizushima et al., 2011). These include: (i) formation of a complex between the ULK1 kinase, FIP200, ATG13 and ATG101, transducing mTOR inhibition (Ganley et al., 2009, Hosokawa et al., 2009, Jung et al., 2009) and AMPK activation (Kim et al., 2011) to induce autophagy; (ii) generation of PDP by the ATG14-endowed Class in PI3-Kinase Complex VPS34 (Baskaran et al., 2014, Chang et al., 2019, Petiot et al., 2000) that includes Beclin 1 (He & Levine, 2010), which can also be modified by AMPK to specifically activate the ATG14 form of VPS34 (Kim et al., 2013); (iii) the ubiquitin-like conjugation system with ATG5-ATG12/ATG16L1 (Mizushima et al., 1998a, Mizushima et al., 1998b) acting as an E3 ligase to lipidate mammalian homologs of yeast Atg8 (mAtg8s), some of which like LC3B have become key markers for autophagosomal membranes (Kabeya et al., 2000); (iv) the only integral membrane ATG protein, ATG9, and the ATG2-WIPI protein complexes, of still unknown but essential functions (Bakula et al., 2017, Velikkakath et al., 2012, Young et al., 2006). These modules are for the most part interconnected, with FIP200 physically bridging via ATG16L1 the ULK1/2 complex with the mAtg8s conjugation system (Fujita et al, 2013, Gammoh et al., 2013, Nishimura et al., 2013), ATG16L1 and WIPI directly interacting (Dooley et al., 2014), ATG13 connecting the ULK1/2 complex with VPS34 via ATG13's HORMA domain binding to ATG14 of the VPS34 complex (Jao et al., 2013, Park et al., 2016), and PI3P, the product of VPS34 (Petiot et al., 2000), being detected on membranes by WIPIs (Bakula et al., 2017).
hi yeast, a component of the above systems morphologically equated with autophagy is Atg8, with its appearance as a single punctum defining the pre-autophagosomal structure (Kirisako et al., 1999). In mammals, this function is spread over a set of six mAtg8s (Mizushima et al., 2011, Weidberg et al., 2010), LC3A,B,C, GABARAP, -L1, and -L2. Although it is generally accepted that mAtg8s are important for autophagy, and that mAtg8 lipidation and puncta formation herald autophagy induction and isolation membrane formation, tire core function of mAtg8s and possibly a direct role in autophagosomal membrane remodeling remains to be defined. Several models, including a direct role of Atg8/mAtg8s in catalyzing membrane fusion (Nakatogawa et al., 2007, Weidberg et al., 2011, Weidberg et al., 2010) have been considered but later challenged (Nair et al., 2011). Nevertheless, many of the cargos, selective autophagy receptors, and regulatory components (ULK, ATG13, FIP200, ATG14, Beclin 1, VPS34, ATG4) contain LC3-interacting regions (LIRs) and can either recruit cargo (Birgisdottir et al., 2013, Bjorkoy et al., 2005) or organize core autophagy machinery (Alemu et al., 2012, Birgisdottir et al., 2019, Skytte Rasmussen et al., 2017). Furthermore, recent studies show that even in the complete absence of mAtg8s, autophagosome formation proceeds, albeit with a lower sequestration volume, and that mAtg8s are important for autolysosomal formation (Nguyen et al., 2016a). In keeping with the latter findings, depletion of components participating in mAtg8 conjugation delays autophagic flux progression (Tsuboyama et al., 2016). It remains to be understood precisely how mAtg8s control membrane trafficking and remodeling during phagophore formation and elongation (Xie et al., 2008) and during autophagosome-lysosome fusion (Nguyen et al., 2016a, Weidberg et al., 2010).
Degradative aspects of autophagy depend on autophagosomes fusion with organelles of the endolysosomal system, often referred to as autophagic flux or autophagosome-lysosome fusion (Klionsky et al., 2016, Tanaka et al., 2000). Much of the intracellular membrane trafficking and fusion processes are catalyzed by SNARE proteins, which ensure compartment/organelle specificity through pairing of cognate Qa-, Qb-, Qc- and R-SNARE partners (Jahn & Scheller, 2006). SNAREs are often found in compartments where they function but also transit through other membranes, and thus their fusion activities are tightly regulated by tethers, SM (Sec1/Munc18) proteins, Rabs, and additional factors that modulate their recruitment, activation, cycles of reuse, etc., (Hong & Lev, 2014). In the context of autophagy, SNAREs have been studied at different stages along the autophagy pathway (Itakura et al., 2012, Kimura et al., 2017, Moreau et al., 2013, Nair et al, 2011). At the autophagosome-lysosome fusion stage, an initially identified SNARE was the Qa-SNARE Stx17, forming complexes with Qbc-SNARE SNAP29 and R-SNARE VAMP8 (Diao et al., 2015, Guo et al., 2014, Itakura et al., 2012, Takats et al., 2013, Wang et al., 2016). Recent studies have indicated that additional SNAREs may be required or even be dominant in tins process (Matsui et al., 2018, Takats et al., 2018). Thus, redundant, complementary or synergistic SNARE-driven fusion and regulatory events may be at work during auto-lysosomal fusion. We have recently shown that Stx17 interacts via its LIR motif with mAtg8s, which functions in Stx17's recruitment to autophagosomes (Kumar et al., 2018), and that TBK1-phosphorylated Stx17 plays a role in autophagy initiation (Kumar & al., 2019), in keeping with studies by others (Arasaki et al., 2018, Arasaki et al., 2015, Hamasaki et al., 2013). Thus, Stx17 contributes to the autophagy pathway at several stages from initiation to maturation.
A report of direct interaction between mAtg8s and Stx17 (Kumar et al, 2018) has set an unanticipated precedent, and in the present application the inventors explored whether there is a broader range of interactions between mAtg8s and mammalian SNAREs. Using bioinformatics and biochemical approaches, we found additional candidate SNAREs with LIR motifs that bind mAtg8s. Among the candidates, the inventors focused on a cognate set of SNAREs, Stx16, Vti1a and Stx6, previously implicated in retrograde transport between endosomes and the trans-Golgi network (TGN). Through mutational and functional analyses, the inventors unexpectedly found that Stx16 acts synergistically with Stx17 and is important for diverse types of autophagy, including mitophagy, pexophagy, ribophagy, and elimination of intracellular Mycobacterium tuberculosis. The inventors have further found that Stx16 is important for cellular lysosomal content and function, and that mAtg8s modulate Stx16 localization on endolysosomal organelles. This uncovers a mechanism different from the previous views of how mAtg8s help grow autophagosomal and complete autolysosomal membranes. We conclude that mAtg8s control autophagy at least in part by directly binding to SNARE proteins engaged in the biogenesis of the endolysosomal and autolysosomal organelles.
The autophagy pathway terminates in autophagosome fusion with organelles of the endolysosomal pathway to generate autolysosomes where the captured cargo is degraded. Fusion events leading to transformation of autophagosomes into autolysosomes has become a focus of attention; however, a unified understanding of key events is still not fully available. Mammalian homologs of the yeast Atg8 protein (mAtg8s) play a central role in autophagy, but their potential functions in autophagosomal maturation has not been defined.
Our studies on the mechanisms of Stx16 suggest that Stx16 functions in delivery of lysosomal membrane proteins, likely from TGN via late endosomes. Furthermore, mAtg8s proteins control proper localization of Stx16 in late endosome and lysosomes through their interactions mediated by the LIR motif on Stx16. This may partially account for the mechanisms as to how mAtg8s regulate endolysosomal system in the cell.
The present inventors employed peptide arrays and bioinformatics to identify LC3-interacting regions (LIRs) in the SNARE family proteins, which are known to regulate intracellular membrane fusion and trafficking. A Qa SNARE, syntaxin 16 (Stx16), as well as its cognate Qb and Qc SNAREs, Vti1a and Stx6, all bear LIR motifs upstream of their SNARE domains. Using CRISPR/Cas9-mediated knockout, the inventors confirmed that autophagic flux still continues in a panel of STX17-knockout cells, suggesting Stx17 alone is insufficient to drive autophagosome fusion with lysosomes/endosomes. Knockout of both STX16 and STX17 blocked autophagic flux as shown by accumulation of lipidated LC3B, as well as decreased mitophagy. Further analysis of the mechanisms revealed that Stx16 is required for the efficient delivery of lysosomal membrane proteins from the trans-Golgi network; similar effects were observed in cells knocked out for all six mATG8s (hexa KO). These observations suggest that mAtg8s control the Stx16 SNARE complex to regulate autolysosomal biogenesis and endolysosomal homeostasis. Thus, Atg8 or an agonist of Atg8 and/or STX16 and/or STX17 or an agonist thereof may be used to upregulate autophagy and influence disease states and/or conditions in which autophagy mediates the disease slate and/or condition. Likewise, an inhibitor of Atg8 (such as an anti-Atg8 antibody or a short Atg3 peptide) or a related inhibitor as described herein and/or an inhibitor of STX16 and/or STX17 may be used in the treatment of autophagy mediated diseases where autophagy is upregulated and would benefit from inhibition.
The inventors' data and other's data (Nguyen et al. 2016) have shown that knockout of STX17 alone does not block autophagic flux completely, suggesting additional SNARE complexes in mediating autophagosomal fusion with lysosomes/endosomes. Here the inventors identify Stx16/Vti1a/Stx6 complex as additional SNAREs that synergize with Stx17 for autophagosomal maturation. Knockout of both STX16 and STX17 effectively blocks autophagic flux dining starvation-induced bulk autophagy, and inhibits autophagic clearance of damaged mitochondria.
Accordingly, the present invention is directed to a method of therapy of an autophagy disease state and/or conditions, the method comprising administering to a patient in need an effective amount of at least one Atg8 modulator (e.g. an agonist or inhibitor) in order to treat an autophagy mediated disease state and/or conditions. Additional embodiments are directed to the use of a Syntaxin 16 (Stx16) modulator, alone or preferably in combination with a Syntaxin 17 (Stx17) modulator in order to treat an autophagy disease state and/or condition. Embodiments of the present invention are directed to the unexpected discovery that modulators of Stx 16 and stx 17, when combined and used in therapy (as combined agonists or inhibitors of Stx 16 and Stx17, respectively) can provide a synergistically favorable therapeutic effect on those autophagy-mediated disease states and/or conditions which respond favorable to inhibition and/or upregulation of autophagy. Thus, in those disease states and/or conditions which are mediated through autophagy and which favorably respond to the inhibition of Stx 16 and Stx 17 (and the inhibition of autophagy), there will accompany a synergistic effect when at least one inhibitor of each of Stx 16 and Stx 17 and optionally Atg8 are combined to treat autophagy disease states and conditions, especially cancer and autoimmune diseases such as rheumatoid arthritis, malaria, antiphospholipid antibody syndrome, lupus, chronic urticarial, Sjogren's disease, autoimmune-related Type 1 diabetes, rheumatoid arthritis (RA), psoriasis/psoriatic arthritis, multiple sclerosis, inflammatory bowel disease (IBD) including Crohn's disease and ulcerative colitis, Addison's disease, Grave's disease, Hashimoto's thyroiditis. Myasthenia gravis, autoimmune vasculitis, pernicious anemia and celiac disease, hi those disease states and conditions which are mediated through autophagy and which favorably respond to the upregulation of Stx 16 and Stx 17 (and the upregulation of autophagy), there will accompany a synergistic effect when at least one modulator (preferably, an agonist) of each of Stx 16 and Stx 17 and optionally Atg8 are combined and administered to a patient to treat autophagy disease states and conditions, especially disease states and conditions associated with mitophagy, pexophagy, ribophagy and xenophagy, among numerous other autophagy-mediated disease states and/or conditions.
In embodiments, the present invention is also directed to pharmaceutical compositions comprising an effective amount of at least one ATg8 modulator optionally in combination with a pharmaceutically acceptable carrier, additive or excipient. Additional pharmaceutical compositions comprise a combination of a STX16 and STX17 inhibitor and optionally, an inhibitor of Atg8 in combination with a pharmaceutically acceptable carrier, additive and/or excipient for the treatment of autophagy mediated disease states and conditions which respond favorably to autophagy inhibition, especially including cancer and autoimmune diseases such as rheumatoid arthritis, malaria, antiphospholipid antibody syndrome, lupus, chronic urticarial, Sjogren's disease, autoimmune-related Type 1 diabetes, rheumatoid arthritis (RA), psoriasis/psoriatic arthritis, multiple sclerosis, inflammatory bowel disease (IBD) including Crohn's disease and ulcerative colitis, Addison's disease, Grave's disease, Hashimoto's thyroiditis, Myasthenia gravis, autoimmune vasculitis, pernicious anemia and celiac disease. These compositions show a synergistic therapeutic effect in treating autophagy-mediated disease states and/or conditions which respond to autophagy inhibition. In other embodiments, the present invention is directed to pharmaceutical compositions comprising an effective amount of a combination of a STX 16 and STX 17 agonist and optionally, an agonist of Atg8 in combination with a pharmaceutically acceptable carrier, additive and/or excipient for the treatment of autophagy mediated disease states and/or conditions which respond favorably to autophagy upregulation including disease states associated with mitophagy, pexophagy, ribophagy and xenophagy, among other disease states and/or conditions as otherwise described and identified herein.
In another embodiment, tire present invention is directed to the use of an effective amount of at least one agonist of STX17 for treating coronavirus infections in an infected patient in need. In this embodiment, a patient who has been diagnosed with coronavirus or who is suspected of being infected with coronavirus is administered an effective amount of at least one STX17 agonist, optionally in combination with an effective amount of at least one STX16 agonist and/or ATg8 agonist as described herein. Pharmaceutical compositions useful for the treatment of coronavirus comprise a therapeutically effective amount of at least one STX17 agonist and optionally at least one STX16 agonist and/or at least one ATg8 agonist in combination with a pharmaceutically acceptable carrier, additive and/or excipient.
Additional embodiments of the present invention may be readily gleaned from a review of the detailed description of the invention, including the examples, which follows.
FIGURE SS shows that mAtg8 proteins regulate proper localization of Stx16 and acidification of the endolysosomal system. (A) shows WT, LC3TKO, GABARAPTKO or HexaTKO HeLa cells were grown in full medium or starved in EBSS for 90 min and subjected to HCM analysis of overlaps between LBPA and Stx16. Masks: white, cells identified based on nuclei; green, LBPA puncta; red, Stx16 puncta; yellow, overlap of LBPA and Stx16. Quantifications of the overlaps between LBPA and Stx16 are shown in
It is noted that, as used in this specification and the appended claims, the singular forms “a,” “an,” and “the,” include plural referents unless expressly and unequivocally limited to one referent. Thus, for example, reference to “a compound” includes two or more different compound. As used herein, the term “include” and its grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or other items that can be added to the listed items.
The term “compound” or “agent”, as used herein, unless otherwise indicated, refers to any specific chemical compound or composition (such as an inhibitor or agonist of Atg8, Stx 16, Stx 17, Galectin-8 or Galectin-9, galactose, another mTOR inhibitor and/or a lysosomotropic agent and/or an autophagy modulator agent) disclosed herein and includes tautomers, regioisomers, geometric isomers as applicable, and also where applicable, stereoisomers, including diastereomers, optical isomers (e.g. enantiomers) thereof as well as pharmaceutically acceptable salts or alternative salts thereof. Within its use in context, the term compound generally refers to a single compound, but also may include other compounds such as stereoisomers, regioisomers and/or optical isomers (including racemic mixtures) as well as specific enantiomers or enantiomerically enriched mixtures of disclosed compounds as well as diastereomers and epimers, where applicable in context. The term also refers, in context to prodrug forms of compounds which have been modified to facilitate the administration and delivery of compounds to a site of activity.
The term “patient” or “subject” is used throughout the specification within context to describe an animal, generally a mammal, including a domesticated mammal including a farm animal (dog, cat, horse, cow, pig, sheep, goat, etc.) and preferably a human, to whom treatment, including prophylactic treatment (prophylaxis), with the methods and compositions according to the present invention is provided. For treatment of those conditions or disease states which are specific for a specific animal such as a human patient, the term patient refers to that specific animal, often a human.
The terms “effective” or “pharmaceutically effective” are used herein, unless otherwise indicated, to describe an amount of a compound or composition which, in context, is used to produce or affect an intended result, usually the modulation of autophagy within the context of a particular treatment or alternatively, the effect of a bioactive agent which is coadministered with the autophagy modulator (autotoxin) in the treatment of disease.
The terms “treat”, “treating”, and “treatment”, etc., as used herein, refer to any action providing a benefit to a patient at risk for or afflicted by an autophagy mediated disease state or condition as otherwise described herein. The benefit may be in curing the disease state or condition, inhibiting its progression, or ameliorating, lessening or suppressing one or mare symptom of an autophagy mediated disease state or condition, especially including excessive inflammation caused by the disease state and/or condition. Treatment, as used herein, encompasses therapeutic treatment and in certain instances, prophylactic treatment (i.e., reducing the likelihood of a disease or condition occurring), depending on the context of the administration of the composition and the disease state, disorder and/or condition to be treated.
The term “ATg8” is used to describe autophagy-related protein 8, most often human ATg8. Autophagy-related (“Atg”) proteins are eukaryotic factors participating in various stages of the autophagic process. Autophagy-related protein (Atg) is a ubiquitin-like protein required for the formation of autophagosomal membranes. The transient conjugation of Atg to the autophagosomal membrane through a ubiquitin-like conjugation system is essential for autophagy in eukaryotes. Thus, this protein represents a potential target for influencing autophagy in subjects and for treating autophagy mediated disease states and/or conditions. Atg8 in humans has several proteins which exist in a subfamily of Atg8 proteins. These include GABA Type A receptor associated protein type 2 (GABARAPL1), preferably human (Accession Number CAG38511.1 or its isoform 1, Accession Number NP_001350527.1 or isoform 2, Accession Number NP_113600.1); GABA Type A receptor associated protein type 2 (GABARAPL2), preferably human (Accession Number CAG47013.1), both of which (GABARAPL1 and GABARAPL2) are referred to herein as Atg8 protein. Related proteins include GABARAP (also referred to as Atg8A) and MAP1LC3A (also referred to as LC3 protein).
The term Syntaxin 16 or (“Stx16”) is used to describe a protein which is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. It is a 307 amino acid protein, the sequence for which can be found at Genbank AAC05647.1 and set forth below. Stx 16 is a SNARE protein involved in trans-Golgi network trafficking. The interaction of Stx 16 may be modulated in certain autophagy-mediated disease state pursuant to the present invention to provide a favorable therapeutic effect on numerous diseases. The inventors have found that modulators of Stx16 can be combined with modulators of Stx17 (both agonists or inhibitors of Stx16/Stx17) to provide particularly effective synergistic therapy for a large number autophagy-mediated disease and/or conditions.
The full human Syntaxin 16 (Stx16) sequence is as follows:
The term “Syntaxin 17” or “Stx17” is used to describe an autophagy factor which is phosphorylated by TBK1. The interaction of Stx17 and TBK1 is reflected in phosphorylation of Stx17 by TBK1 and modulation of its function. Surprisingly, these interactions and phosphorylation of Stx17 by TBK1 occur at the earliest stages of autophagy, i.e. at its initiation. The present inventors demonstrate that phosphorylation of Stx17 is important for assembly of the ULK1 complex and that it is critical for autophagy initiation. Pursuant to the present invention, the inventors show that phosphorylated Stx17 and components of the ULK1 complex, localized to the Golgi in the resting state, respond to induction of autophagy by translocating from the Golgi to participate in the formation of mPAS during autophagy initiation. Accordingly, the present invention provides assays and methods for discovering compounds of unknown activity which inhibit phosphorylation of Stx17 and consequently provide activity as inhibitors of autophagy and potential therapeutic agents for the treatment of autophagy diseases and conditions which require phosphorylation of Stx 17 for initiation. Preferably, in the present invention Syntaxin 17 refers to human Syntaxin 17.
The frill human Syntaxin 17 amino acid sequence (Genbank EAW58920.1) is as follows:
The terms “ATg8 modulator” and “autophagy related protein 8 modulator” refer to direct car indirect modulators (agonists or inhibitors of ATg8) which find particular use in the present invention. ATg8 agonists include agonists (which are principally indirect agonists) and include for example, biguanides such as metformin, phenformin, buformin, proguanil, chlorproguanil and other agents such as bromhexine and its metabolite ambroxol, 20-hydroxyecdysone, a copper or cobalt salt (e.g., cupric sulfate, tribasic copper, copper chelates such as copper glycinate or copper triglycinate, cobalt carbonate, cobalt sulfate, cobalt chloride or cobalt glucoheptanoate) or a mixture thereof.
ATg8 inhibitors include, for example, compounds according to the chemical structure:
Or a pharmaceutically acceptable salt thereof or a mixture thereof.
In addition, ATg8 inhibitors include TBK1 inhibitors which are indirect inhibitors of ATG8, as well as STX17 inhibitors. These are described herein below. In addition to the TBK1 antagonists (see below), ATg8 antagonists include an anti-ATg8 antibody, which is polyclonal or monoclonal, preferably a monoclonal antibody which is humanized and detects human ATg8. Examples of anti-ATg8 antibodies which may be used in the present invention include humanized anti-ATg8 (Human) mAb which binds to human ATg8 protein.
The terms “Syntaxin 16 modulator” and STX16 modulator refer to direct or indirect modulators (agonists or inhibitors of STX17) which find particular use in file present invention. STX16 agonists include STX16 agonists (which are principally indirect agonists) and include for example, biguanides such as metformin, phenformin, buformin, proguanil, chlorproguanil and other agents such as bromhexine and its metabolite ambroxol.
STX16 antagonists include for example small interfering RNA (siRNA) of the following sequences:
SiRNA for use as STX16 inhibitors have the following sequences:
In addition to the above STX16 inhibitors, anti-STX16 antibodies, which are polyclonal or monoclonal, preferably a monoclonal antibody which is humanized may be used as an inhibitor of STX16 in the present invention. Examples of anti-Syntaxin 16 antibodies which may be used in the present invention include humanized anti-Syntaxin-16 (Human) mAb which binds to STX16. These antibodies may be delivered into the cell to effect therapy.
The terms “Syntaxin 17 modulator” and “STX17 modulator” refer to direct or indirect modulators (agonists or inhibitors of STX17) which find particular use in the present invention. STX17 agonists for use in the present invention include Dimethhylxanthenone-4-Acetic acid (XAA-5Me): S-Me5thyl-xanthenone-4-Acetic Acid; c-diGMP (cyclic di-GMP) and an Interferon Type I (including IFN-α, IFN-β, IFN-ε IFN-κ, IFN-δ, IFN-τ, IFN-ω and IFN-ν).
STX17 antagonists for use in the present invention include STX17 antagonists (direct or indirect inhibitors, including TBK1 inhibitors) BX795 or MRT67307 (from InvivoGen Corporation), B1-B206, D1-D100, F1-F-160, amlexanox and the compounds listed in columns 249-265 of U.S. Pat. No. 8,569,294, issued Oct. 29, 2013, or a TBK1 inhibitor of US Application Publication No. 2015/0224089, each of which is incorporated by reference in its entirety herein. Note that these TBK1 inhibitors also have an indirect inhibitory effect on ATg8 proteins.
Preferred STX17 (TBK1) Inhibitors from U.S. Pat. No. 8,569,294 include:
Additional STX17 (TBK1) inhibitors for use in the present invention include compounds according to the chemical structure:
Where R1 is hydrogen, C1-C6 alkyl, phenyl, carboxyl, hydroxyl, O—C1-C3 alkyl or amino which is optionally substituted with one C1-C3 alkyl group;
m is 0, 1 or 2; and
R2 is H, C1-C6 alkyl, halogen, nitro, hydroxyl, carboxyl, O—C1-C3 alkyl, or a butadienylene (—C═C—C═C—) group which forms an unsaturated cyclic ring with any adjacent carbon atoms or nitrogen atom which may be unsubstituted or substituted with at least one C1-C3 alkyl group, or
a pharmaceutically acceptable salt thereof.
In alternative embodiments, the inhibitor of Syntaxin 17 is a small molecule compound or antibody which inhibits the phosphorylation of Syntaxin 17. In these embodiments, the preferred inhibitors of Syntaxin 17 phosphorylation include AG1478 (Tyrphostin AG1478) and AG1024 (Tyrphostin AG1024). In embodiments, the inhibitor of Syntaxin 17 is an anti-Syntaxin 17 antibody, which is polyclonal or monoclonal, preferably a monoclonal antibody which is humanized. Examples of anti-Syntaxin 17 antibodies which may be used in the present invention include humanized anti-Syntaxin-17 (Human) mAb which binds to STX17 and prevents phosphorylation of Syntaxin 17. These antibodies may be delivered into the cell to effect therapy.
As used herein, the term “autophagy mediated disease stale or condition” refers to a disease state or condition that results from disruption in autophagy or cellular self-digestion. Autophagy is a cellular pathway involved in protein and organelle degradation, and has a large number of connections to human disease. Autophagic dysfunction which causes disease is associated with metabolic disorders, neurodegeneration, autoimmune diseases, microbial (especially bacterial and viral) infections (especially HIV, HAV, HBV and/or HCV), cancer, aging, cardiovascular diseases and metabolic diseases including diabetes mellitus, among numerous other disease states and/or conditions. Although autophagy plays a principal role as a protective process for fee cell, it also plays a role in cell death. Disease states and/or conditions which are mediated through autophagy (which refers to the feet that fee disease state or condition may manifest itself as a inaction of the increase or decrease in autophagy in the patient or subject to be treated and treatment requires administration of an inhibitor or agonist of autophagy in the patient or subject) include, for example, lysosomal storage diseases (discussed hereinbelow), neurodegeneration (including, for example, Alzheimer's disease, Parkinson's disease, Huntington's disease; other ataxias), immune response (T cell maturation, B cell and T cell homeostasis, counters damaging inflammation), autoimmune diseases and chronic inflammatory diseases resulting in excessive inflammation (these disease states may promote excessive cytokines when autophagy is defective), including, for example, inflammatory bowel disease, including Crohn's disease, rheumatoid arthritis, lupus, multiple sclerosis, chronic obstructive pulmony disease/COPD, pulmonary fibrosis, cystic fibrosis, Sjogren's disease; hyperglycemic disorders, diabetes (I and II), affecting lipid metabolism islet function and/or structure, excessive autophagy may lead to pancreatic β-cell death and related hyperglycemic disorders, including severe insulin resistance, hyperinsulinemia, insulin-resistant diabetes (e.g. Mendenhall's Syndrome, Werner Syndrome, leprechaunism, and lipoatrophic diabetes) and dyslipidemia (e.g. hyperlipidemia as expressed by obese subjects, elevated low-density lipoprotein (LDL), depressed high-density lipoprotein (HDL), and elevated triglycerides) and metabolic syndrome, liver disease (excessive autophagic removal of cellular entities-endoplasmic reticulum), renal disease (apoptosis in plaques, glomerular disease), cardiovascular disease (especially including infarction, ischemia, stroke, pressure overload and complications during reperfusion), muscle degeneration and atrophy, symptoms of aging (including amelioration or the delay in onset or severity or frequency of aging-related symptoms and chronic conditions including muscle atrophy, frailty, metabolic disorders, low grade inflammation, gout, silicosis, atherosclerosis and associated conditions such as cardiac and neurological both central and peripheral manifestations including stroke, age-associated dementia and sporadic form of Alzheimer's disease, and psychiatric conditions including depression), stroke and spinal cord injury, arteriosclerosis, infectious diseases (microbial infections, removes microbes, provides a protective inflammatory response to microbial products, limits adapation of autophagy of host by microbe for enhancement of microbial growth, regulation of innate immunity) including bacterial, fungal, cellular and viral (including secondary disease states or conditions associated wife infectious diseases especially including Mycobacterial infections such as M. tuberculosis, and viral infections such as coronavirus, hepatitis A, B and C and HIV I and II), including AIDS, among numerous others.
In addition, an autophagy disease state or condition includes autoimmune diseases such as myocarditis, Anti-glomercular Base Membrane Nephritis, lupus erythematosus, lupus nephritis, autoimmune hepatitis, primary biliary cirrhosis, alopecia areata, autoimmune urticaria, bullous pemphagoid, dermatitis herpetiformis, epidermolysis bullosa acquisita, linear IgA disease (LAD), pemphigus vulgaris, psoriasis, Addison's disease, autoimmune polyendocrine syndrome I, II and III (APS I, APS II, APS III), autoimmune pancreatitis, type I diabetes, autoimmune thyroiditis, Ord's thyroiditis, Grave's disease, autoimmune oophoritis, Sjogren's syndrome, autoimmune enteropathy, Coeliac disease, Crohn's disease, autoimmune hemolytic anemia, autoimmune lymphoproliferative syndrome, autoimmune neutropenia, autoimmune thrombocytopenic purpura, Cold agglutinin disease, Evans syndrome, pernicious anemia, Adult-onset Still's disease, Felty syndrome, juvenile arthritis, psoriatic arthritis, relapsing polychondritis, rheumatic fever, rheumatoid arthritis, myasthenia gravis, acute disseminated encephalomyelitis (ADEM), balo concentric sclerosis, Guillain-Barré syndrome, Hashimoto's encephalopathy, chronic inflammatory demyelinating polyneuropathy, Lambert-Eaton myasthenic syndrome, multiple sclerosis, autoimmune uveitis, Graves opthalmopathy, Granulomatosis with polyangitis (GPA), Kawasaki's disease, vasculitis and chronic fatigue syndrome, among others.
As used herein, the term “autophagy mediated disease state or condition” refers to a disease state or condition that results from disruption in autophagy or cellular self-digestion. Autophagy is a cellular pathway involved in protein and organelle degradation, and has a large number of connections to human disease. Autophagic dysfunction is associated with cancer, neurodegeneration, microbial infection and ageing, among numerous other disease states and/or conditions. Although autophagy plays a principal role as a protective process for the cell, it also plays a role in cell death. Disease states and/or conditions which are mediated through autophagy (which refers to the fact that the disease state or condition may manifest itself as a function of the increase or decrease in autophagy in the patient or subject to be treated and treatment requires administration of an inhibitor or agonist of autophagy in the patient or subject) include, for example, cancer, including metastasis of cancer, lysosomal storage diseases (discussed hereinbelow), neurodegeneration (including, for example, Alzheimer's disease, Parkinson's disease, Huntington's disease; other ataxias), immune response (T cell maturation, B cell and T cell homeostasis, counters damaging inflammation) and chronic inflammatory diseases (may promote excessive cytokines when autophagy is defective), including, for example, inflammatory bowel disease, including Crohn's disease, rheumatoid arthritis, lupus, multiple sclerosis, chronic obstructive pulmony disease/COPD, pulmonary fibrosis, cystic fibrosis, Sjogren's disease; hyperglycemic disorders, diabetes (T and B), affecting lipid metabolism islet function and/or structure, excessive autophagy may lead to pancreatic β-cell death and related hyperglycemic disorders, including severe insulin resistance, hyperinsulinemia, insulin-resistant diabetes (e.g. Mendenhall's Syndrome, Werner Syndrome, leprechaunism, and lipoatrophic diabetes) and dyslipidemia (e.g. hyperlipidemia as expressed by obese subjects, elevated low-density lipoprotein (LDL), depressed high-density lipoprotein (HDL), and elevated triglycerides) and metabolic syndrome, liver disease (excessive autophagic removal of cellular entities-endoplasmic reticulum), renal disease (apoptosis in plaques, glomerular disease), cardiovascular disease (especially including ischemia, stroke, pressure overload and complications during reperfusion), muscle degeneration and atrophy, symptoms of aging (including amelioration or the delay in onset or severity or frequency of aging-related symptoms and chronic conditions including muscle atrophy, frailty, metabolic disorders, low grade inflammation, atherosclerosis and associated conditions such as cardiac and neurological both central and peripheral manifestations including stroke, age-associated dementia and sporadic form of Alzheimer's disease, pre-cancerous states, and psychiatric conditions including depression), stroke and spinal cord injury, arteriosclerosis, infectious diseases (microbial infections, removes microbes, provides a protective inflammatory response to microbial products, limits adapation of autophagy of host by microbe for enhancement of microbial growth, regulation of innate immunity) including bacterial, fungal, cellular and viral (including secondary disease states or conditions associated with infectious diseases), including AIDS and tuberculosis, among others, development (including erythrocyte differentiation), embryogenesis/fertility/infertility (embryo implantation and neonate survival after termination of transplacental supply of nutrients, removal of dead cells during programmed cell death) and ageing (increased autophagy leads to the removal of damaged organelles or aggregated macromolecules to increase health and prolong lire, but increased levels of autophagy in children/young adults may lead to muscle and organ wasting resulting in ageing/progeria).
The term “lysosomal storage disorder” refers to a disease state or condition that results from a defect in lysosomomal storage. These disease states or conditions generally occur when the lysosome malfunctions. Lysosomal storage disorders are caused by lysosomal dysfunction usually as a consequence of deficiency of a single enzyme required for the metabolism of lipids, glycoproteins or mucopolysaccharides. The incidence of lysosomal storage disorder (collectively) occurs at an incidence of about about 1:5,000-1:10,000. The lysosome is commonly referred to as the cell's recycling center because it processes unwanted material into substances that the cell can utilize. Lysosomes break down this unwanted matter via high specialized enzymes. Lysosomal disorders generally are triggered when a particular enzyme exists in too small an amount or is missing altogether. When this happens, substances accumulate in the cell. In other words, when the lysosome doesn't function normally, excess products destined for breakdown and recycling are stored in the cell. Lysosomal storage disorders are genetic diseases, but these may be treated using autophagy modulators (autostatins) as described herein. All of these diseases share a common biochemical characteristic, i.e., that all lysosomal disorders originate from an abnormal accumulation of substances inside the lysosome. Lysosomal storage diseases mostly affect children who often die as a consequence at an early stage of life, many within a few months or years of birth. Many other children die of this disease following years of suffering from various symptoms of their particular disorder.
Examples of lysosomal storage diseases include, for example, activator deficiency/GM2 gangliosidosis, alpha-mannosidosis, aspartylflucoaminuria, cholesteryl ester storage disease, chronic hexosaminidase A deficiency, cystinosis, Danon disease, Fabry disease, Farber disease, fucosidosis, galactosialidosis, Gaucher Disease (Types I, II and III), GM? Ganliosidosis, including infantile, late infantile/juvenile and adult/chronic), Hunter syndrome (MPS II), I-Cell disease/Mucolipidosis n, Infantile Free Sialic Acid Storage Disease (ISSD), Juvenile Hexosaminidase A Deficiency, Krabbe disease, Lysosomal acid lipase deficiency, Metachromatic Leukodystrophy, Hurler syndrome, Scheie syndrome, Hurler-Scheie syndrome, Sanfilippo syndrome, Morquio Type A and B, Maroteaux-Lamy, Sly syndrome, mucolipidosis, multiple sulfate deficiency, Niemann-Pick disease, Neuronal ceroid lipofuscinoses, CLN6 disease, Jansky-Bielschowsky disease, Pompe disease, pycnodysostosis, Sandhoff disease, Schindler disease, Tay-Sachs and Wolman disease, among others.
An “inflammation-associated metabolic disorder” includes, but is not limited to, lung diseases, hyperglycemic disorders including diabetes and disorders resulting from insulin resistance, such as Type I and Type II diabetes, as well as severe insulin resistance, hyperinsulinemia, and dyslipidemia or a lipid-related metabolic disorder (e.g. hyperlipidemia (e.g., as expressed by obese subjects), elevated low-density lipoprotein (LDL), depressed high-density lipoprotein (HDL), and elevated triglycerides) and insulin-resistant diabetes, such as Mendenhall's Syndrome, Werner Syndrome, leprechaunism, and lipoatrophic diabetes, renal disorders, such as acute and chronic renal insufficiency, end-stage chronic renal failure, glomerulonephritis, interstitial nephritis, pyelonephritis, glomerulosclerosis, e.g., Kimmelstiel-Wilson in diabetic patients and kidney failure after kidney transplantation, obesity, GH-deficiency, GH resistance, Turner's syndrome, Laron's syndrome, short stature, increased fat mass-to-lean ratios, immunodeficiencies including decreased CD4+ T cell counts and decreased immune tolerance or chemotherapy-induced tissue damage, bone marrow transplantation, diseases or insufficiencies of cardiac structure or function such as heart dysfunctions and congestive heart failure, neuronal, neurological, or neuromuscular disorders, e.g., diseases of the central nervous system including Alzheimer's disease, or Parkinson's disease or multiple sclerosis, and diseases of the peripheral nervous system and musculature including peripheral neuropathy, muscular dystrophy, or myotonic dystrophy, and catabolic states, including those associated with wasting caused by any condition, including, e.g. mental health condition (e.g., anorexia nervosa), trauma or wounding or infection such as with a bacterium or human virus such as HIV, wounds, skin disorders, gut structure and function that need restoration, and so forth.
An “inflammation-associated metabolic disorder” also includes a cancer and an “infectious disease” as defined herein, as well as disorders of bone or cartilage growth in children, including short stature, and in children and adults disorders of cartilage and bone in children and adults, including arthritis and osteoporosis. An “inflammation-associated metabolic disorder” includes a combination of two or more of the above disorders (e.g., osteoporosis that is a sequela of a catabolic state). Specific disorders of particular interest targeted for treatment herein are diabetes and obesity, heart dysfunctions, kidney disorders, neurological disorders, bone disorders, whole body growth disorders, and immunological disorders.
In one embodiment, “inflammation-associated metabolic disorder” includes: central obesity, dyslipidemia including particularly hypertriglyceridemia, low HDL cholesterol, small dense LDL particles and postpranial lipemia; glucose intolerance such as impaired fasting glucose; insulin resistance and hypertension, and diabetes. The term “diabetes” is used to describe diabetes mellitus type I or type II. The present invention relates to a method for improving renal function and symptoms, conditions and disease states which occur secondary to impaired renal function in patients or subjects with diabetes as otherwise described herein. It is noted that in diabetes mellitus type I and II, renal function is impaired from collagen deposits, and not from cysts in the other disease states treated by the present invention.
Mycobacterial infections often manifest as diseases such as tuberculosis. Human infections caused by mycobacteria have been widespread since ancient times, and tuberculosis remains a leading cause of death today. Although the incidence of the disease declined, in parallel with advancing standards of living, since the mid-nineteenth century, mycobacterial diseases still constitute a leading cause of morbidity and mortality in countries with limited medical resources. Additionally, mycobacterial diseases can cause overwhelming, disseminated disease in immunocompromised patients, hi spite of the efforts of numerous health organizations worldwide, the eradication of mycobacterial diseases has never been achieved, nor is eradication imminent Nearly one third of the world's population is infected with Mycobacterium tuberculosis complex, commonly referred to as tuberculosis (TB), with approximately 8 million new cases, and two to three million deaths attributable to TB yearly. Tuberculosis (TB) is the cause of the largest number of human deaths attributable to a single etiologic agent (see Dye et al., J. Am. Med. Association, 282, 677-686, (1999); and 2000 WHO/OMS Press Release).
Mycobacteria other than M. tuberculosis are increasingly found in opportunistic infections that plague the AIDS patient Organisms from the M. avium-intracellulare complex (MAC), especially serotypes four and eight, account for 68% of the mycobacterial isolates from AIDS patients. Enormous numbers of MAC are found (up to 1010 acid-fast bacilli per gram of tissue), and consequently, the prognosis for the infected AIDS patient is poor.
In many countries the only measure for TB control has been vaccination with M. bovis bacille Calmette-Guerin (BCG). The overall vaccine efficacy of BCG against TB, however, is about 50% with extreme variations ranging from 0% to 80% between different field trials. The widespread emergence of multiple drug-resistant M. tuberculosis strains is also a concern.
M. tuberculosis belongs to the group of intracellular bacteria that replicate within the phagosomal vacuoles of resting macrophages, thus protection against TB depends on T cell-mediated immunity. Several studies in mice and humans, however, have shown that Mycobacteria stimulate antigen-specific, major histocompatibility complex (MHC) class II- or class I-restricted CD4 and CD8 T cells, respectively. The important role of MHC class I-restricted CD8 T cells was convincingly demonstrated by the failure of β2-microglobulin) deficient mice to control experimental M. tuberculosis infection.
As used herein, the term “tuberculosis” comprises disease states usually associated with infectious caused by mycobacteria species comprising M. tuberculosis complex. The term “tuberculosis” is also associated with mycobacterial infections caused by mycobacteria other than M. tuberculosis. Other mycobacterial species include M. avium-intracellulare, M. kansarii, M. fortutium, M. chelonae, M. leprae, M. africanum, and M. microti, M. avium paratuberculosis, M. intracellulare, M. scrofulaceum, M. xenopi, M. marinum, M. ulcerans.
An “infectious disease” includes but is limited to those caused by bacterial, mycological, parasitic, and viral agents. Examples of such infectious agents include the following: staphylococcus, streptococcaceae, neisseriaaceae, cocci, enterobacteriaceae, pseudomonadaceae, vibrionaceae, Campylobacter, pasteurellaceae, bordetella, francisella, brucella, legionellaceae, bacteroidaceae, gram-negative bacilli, clostridium, corynebacterium, propionibacterium, gram-positive bacilli, anthrax, actinomyces, nocardia, mycobacterium, treponema, borrelia, leptospira, mycoplasma, ureaplasma, rickettsia, chlamydiae, systemic mycoses, opportunistic mycoses, protozoa, nematodes, trematodes, cestodes, adenoviruses, herpesviruses, poxviruses, papovaviruses, hepatitis viruses, orthomyxoviruses, paramyxoviruses, coronaviruses, picornaviruses, reoviruses, togaviruses, flaviviruses, bunyaviridae, rhabdoviruses, coronavirus, human immunodeficiency virus and retroviruses, hi embodiments of the invention, it has been discovered that coronavirus is susceptible to STX17 agonists as otherwise described herein, especially when combined with STX16 agonists and optionally ATg8 agonists.
In certain embodiments, an “infectious disease” is selected from the group consisting of tuberculosis, leprosy, Crohn's Disease, acquired immunodeficiency syndrome, Lyme disease, cat-scratch disease, Rocky Mountain spotted fever and influenza or a viral infection selected from HIV (I and/or II), hepatitis B virus (HBV) or hepatitis C virus (HCV).
The term “mitophagy” refers to an autophagy-mediated disease state or condition where the patient evidences mitochondrial dysfunction. These disease states include, for example, hepatic encephalopathy, liver toxicity (heavy metals, especially cadmium), Alzheimer's disease, Parkinson's disease, mild cognitive impairment, autism, mitochondrial lymphoblast dysfunction, mitochondrial fibroblast dysfunction, mitochondrial neuronal dysfunction, mitochondrial cardiac dysfunction, cardiac hypertrophy and mitochondrial adrenocortical dysfunction, among numerous others.
The term “pexophagy” refers to an autophagy-mediated disease state or condition where the patient evidences peroxisome dysfunction. Disease states and/or conditions related to pexophagy include Zellweger syndrome, rhizomelic chondrodysplasia punctata and infantile refsum disease, among others.
The term “ribophagy” refers to an autophagy-mediated disease state or condition where the patient evidences dysfunction in the balance of ribosome biogenesis and the breakdown of ribosomes. Disease states and/or conditions related to ribophagy include Tuberculosis, Alzheimer's disease, gastric cancer, Diamond-Blackfan anemia, Treacher-Collins Syndrome (TCS), Native American Indian childhood Cirrhosis (NAICC), male infertility, Bowen-Conradi syndrome (BCS), alopecia-neurological defects-endocrinopathy syndrome (AWE syndrome), Schwachman-Diamond Syndrome, primary open angle glaucoma (POAG), neurofibromatosis type 1 (NFI), sever macrocytic anemia, myelodysplastic syndrome and predisposition to cancer.
The term “xenophagy” refers to an autophagy-mediated disease state or condition where the patient evidences dysfunction associated with infectious, including Mycoplasma infections such as M. tuberculosis.
The term “autophagy modulator agent” or “additional autophagy modulator” is used to describe an optional agent which is used in the compositions and/or methods according to the present invention in order to enhance or inhibit an autophagy response in an autophagy mediated disease state which is otherwise treated, ameliorated, inhibited and/or resolved by another agent other than a ATG8 inhibitor or agonist and/or a STX16 and/or STX17 inhibitor or agonist such as for example, Galectin-8 and/or Galectin-9, a modulator/upregulator of Galectin-8 and/or Galectin-9, or an agent which acts similar to Galectin-8 as an inhibitor of mTOR and/or Galectin-9 as a modulator (upregulator) of AMPKinase or a mixture thereof, optionally in combination with a lysosomotropic agent. Additional autophagy modulators include, but are not limited to, autophagy agonists (such as flubendazole, hexachlorophane, propidium iodide, bepridil, clomiphene citrate (Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine, ambroxol, norcyclobenzaprine, diperodon, nortriptyline or a mixture thereof or their pharmaceutically acceptable salts). Additional autophagy modulators which may be used in the present invention to inhibit, prevent and/or treat an autophagy mediated disease state and/or condition include one or more of benzethonium, niclosamide, monensin, bromperidol, levobunolol, dehydroisoandosterone 3-acetate, sertraline, tamoxifen, reserpine, hexachlorophene, dipyridamole, harmaline, prazosin, lidoflazine, thiethylperazine, dextromethorphan, desipramine, mebendazole, canrenone, chlorprothixene, maprotiline, homochlorcyclizine, loperamide, nicardipine, dexfenfluramine, nilvadipine, dosulepin, biperiden, denatonium, etomidate, toremifene, tomoxetine, clorgyline, zotepine, beta-escin, tridihexethyl, ceftazidime, methoxy-6-harmalan, melengestrol, albendazole, rimantadine, chlorpromazine, pergolide, cloperastine, prednicarbate, haloperidol, clotrimazole, nitrofural, iopanoic acid, naftopidil, Methimazole, Trimeprazine, Ethoxyquin, Clocortolone, Doxycycline, Pirlindole mesylate, Doxazosin, Deptropine, Nocodazole, Scopolamine, Oxybenzone, Halcinonide, Oxybutynin, Miconazole, Clomipramine, Cyproheptadine, Doxepin, Dyclonine, Salbutamol, Flavoxate, Amoxapine, Fenofibrate, Pimethixene and mixtures thereof. The autophagy modulator may be included as optional agents in compositions according to the present invention or used in conjugation with therapies as otherwise described herein to treat an autophagy mediated disease state or condition.
The term “co-administration” or “combination therapy” is used to describe a therapy in which at least two active compounds in effective amounts are used to treat an autophagy mediated disease state or condition as otherwise described herein, either at the same time or within dosing or administration schedules defined further herein or ascertainable by those of ordinary skill in the art. Although the term co-administration preferably includes the administration of two active compounds to the patient at the same time, it is not necessary that the compounds be administered to the patient at the same time, although effective amounts of the individual compounds will be present in the patient at the same time. In addition, in certain embodiments, co-administration will refer to the feet that two compounds are administered at significantly different times, but the effects of the two compounds are present at the same time. Thus, the term co-administration includes an administration in which one active agent is administered at approximately the same time (contemporaneously), or from about one to several minutes to about 24 hours or more after or before the other active agent is administered.
In yet additional embodiments, additional bioactive agents may be further included in compositions according to the present invention in combination with agents which control mTor response to endomembrane damage (e.g. Galectin-8 and/or Galectin-9, a modulator/upregulator of Galectin-8 and/or Galectin-9, or an agent which acts similar to Galectin-8 as an inhibitor of mTOR and/or Galectin-9 as a modulator (upregulator) of AMPKinase or a mixture thereof which may optionally be combined with a lysosomotropic agent and/or an autophagy modulator) and may be any bioactive agent such as an additional mTOR inhibitor (i.e., other than Galectin-8) such as Dactolisib (BEZ23S, NVP-BEX235, rapamycin, everolimis, AZD8055, Temsilolimus, PI-103, KU0063794, Torkinib (PP242), tacrolimus (FK506), ridaforolimus (deforolimus, MK-8669), Sapanisertib (INK 128), Voxtalisib (XL765), Torin 1, Torin 2, Omipalisib (GSK458), OSI-027, PF-04691502, Apitolisib (RG7422), GSK1059615, Gadatolisib (PKI-587), WYE-354, Vistusertib (AZD2014), WYE-132, BGT226, Palomid 529 (P529), PP121, WYE-687, WAY-600, ETP-46464, GDC-0349, XL-388, CC-115, Zotarolimus (ABT-578), GDC-0084, CZ415, 3DBO, SF2523, MHY1485, Chrysophanic Acid, CC-223, LY3023414, among others, with Torin1, Torin 2, pp242, rapamycin/serolimus (which also may function as an autophagy modulator), everolimus, temsirolomis, ridaforolimis, zotarolimis, 32-dexoy-rapamycin, among others being preferred. mTorr inhibitors also include for example, epigallocatechin gallate (EGCG), caffeine, curcumin or reseveratrol (which mTOR inhibitors find particular use as enhancers of autophagy using the compounds disclosed herein), hi certain embodiments, an additional mTOR inhibitor as described above, or more often selected from the group consisting of Torin, pp242, rapamycin/serolimus, everolimus, temsirolomis, ridaforolimis, zotarolimis, 32-dexoy-rapamycin, epigallocatechin gallate (EGCG), caffeine, curcumin or reseveratrol and mixtures thereof may be combined with at least one agent selected from the group consisting of digoxin, xylazine, hexetidine and sertindole, the combination of such agents being effective as autophagy modulators in combination.
The terms “cancer” and “neoplasia” are used throughout the specification to refer to the pathological process that results in the formation and growth of a cancerous or malignant neoplasm, i.e., abnormal tissue that grows by cellular proliferation, often more rapidly than normal and continues to grow after the stimuli that initiated the new growth cease. Malignant neoplasms show partial or complete lack of structural organization and functional coordination with the normal tissue and most invade surrounding tissues, metastasize to several sites, and are likely to recur after attempted removal and to cause the death of the patient unless adequately treated.
As used herein, the terms malignant neoplasia and cancer are used synonymously to describe all cancerous disease states and embraces or encompasses the pathological process associated with malignant hematogenous, ascitic and solid tumors. Representative cancers include, for example, stomach, colon, rectal, liver, pancreatic, lung, breast, cervix uteri, corpus uteri, ovary, prostate, testis, bladder, renal, brain/CNS, head and neck, throat, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, leukemia, melanoma, non-melanoma skin cancer (especially basal cell carcinoma or squamous cell carcinoma), acute lymphocytic leukemia, acute myelogenous leukemia, Ewing's sarcoma, small cell lung cancer, choriocarcinoma, rhabdomyosarcoma, Wilms' tumor, neuroblastoma, hairy cell leukemia, mouth/pharynx, oesophagus, larynx, kidney cancer and lymphoma, among others, which may be treated by one or more compounds according to the present invention. In certain aspects, the cancer which is treated is lung cancer, breast cancer, ovarian cancer and/or prostate cancer.
Neoplasms include, without limitation, morphological irregularities in cells in tissue of a subject or host, as well as pathologic proliferation of cells in tissue of a subject, as compared with normal proliferation in the same type of tissue. Additionally, neoplasms include benign tumors and malignant tumors (e.g., colon tumors) that are either invasive or noninvasive. Malignant neoplasms (cancer) are distinguished from benign neoplasms in that the former show a greater degree of anaplasia, or loss of differentiation and orientation of cells, and have the properties of invasion and metastasis. Examples of neoplasms or neoplasias from which the target cell of the present invention may be derived include, without limitation, carcinomas (e.g., squamous-cell carcinomas, adenocarcinomas, hepatocellular carcinomas, and renal cell carcinomas), particularly diose of the bladder, bowel, breast, cervix, colon, esophagus, head, kidney, liver, long, neck, ovary, pancreas, prostate, stomach and thyroid; leukemias; benign and malignant lymphomas, particularly Burkitt's lymphoma and Non-Hodgkin's lymphoma; benign and malignant melanomas; myeloproliferative diseases; sarcomas, particularly Ewing's sarcoma, hemangiosarcoma, Kaposi's sarcoma, liposarcoma, myosarcomas, peripheral neuroepithelioma, and synovial sarcoma; tumors of the central nervous system (e.g., gliomas, astrocytomas, oligodendrogliomas, ependymomas, gliobastomas, neuroblastomas, ganglioneuromas, gangliogliomas, medulloblastomas, pineal cell tumors, meningiomas, meningeal sarcomas, neurofibromas, and Schwannomas); germ-line tumors (e.g., bowel cancer, breast cancer, prostate cancer, cervical cancer, uterine cancer, lung cancer, ovarian cancer, testicular cancer, thyroid cancer, astrocytoma, esophageal cancer, pancreatic cancer, stomach cancer, liver cancer, colon cancer, and melanoma); mixed types of neoplasias, particularly carcinosarcoma and Hodgkin's disease; and tumors of mixed origin, such as Wilms' tumor and teratocarcinomas (Beers and Berkow (eds.). The Merck Manual of Diagnosis and Therapy, 17.sup.th ed. (Whitehouse Station, N.J.: Merck Research Laboratories, 1999) 973-74, 976, 986, 988, 991). All of these neoplasms may be treated using compounds according to the present invention.
Representative common cancers to be treated with compounds according to the present invention include, for example, prostate cancer, metastatic prostate cancer, stomach, colon, rectal, liver, pancreatic, lung, breast, cervix uteri, corpus uteri, ovary, testis, bladder, renal, brain/CNS, head and neck, throat, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, leukemia, melanoma, non-melanoma skin cancer, acute lymphocytic leukemia, acute myelogenous leukemia, Ewing's sarcoma, small cell lung cancer, choriocarcinoma, rhabdomyosarcoma, Wilms' tumor, neuroblastoma, hairy cell leukemia, mouth/pharynx, oesophagus, larynx, kidney cancer and lymphoma, among others, which may be treated by one or more compounds according to the present invention. Because of the activity of the present compounds, the present invention has general applicability treating virtually any cancer in any tissue, thus the compounds, compositions and methods of the present invention are generally applicable to the treatment of cancer and in reducing the likelihood of development of cancer and/or the metastasis of an existing cancer.
In certain particular aspects of the present invention, the cancer which is treated is metastatic cancer, a recurrent cancer or a drug resistant cancer, especially including a drug resistant cancer. Separately, metastatic cancer may be found in virtually all tissues of a cancer patient in late stages of the disease, typically metastatic cancer is found in lymph system/nodes (lymphoma), in bones, in lungs, in bladder tissue, in kidney tissue, liver tissue and in virtually any tissue, including brain (brain cancer/tumor). Thus, the present invention is generally applicable and may be used to treat any cancer in any tissue, regardless of etiology.
The term “tumor” is used to describe a malignant or benign growth or tumefacent.
The term “additional anti-cancer compound”, “additional anti-cancer drug” or “additional anti-cancer agent” is used to describe any compound (including its derivatives) which may be used to treat cancer. The “additional anti-cancer compound”, “additional anti-cancer drug” or “additional anti-cancer agent” can be an anticancer agent which is distinguishable from a CIAE-inducing anticancer ingredient such as a taxane, vinca alkaloid and/or radiation sensitizing agent otherwise used as chemotherapy/cancer therapy agents herein. In many instances, the co-administration of another anti-cancer compound according to the present invention results in a synergistic anti-cancer effect. Exemplary anti-cancer compounds for co-administration with formulations according to the present invention include anti-metabolites agents which are broadly characterized as antimetabolites, inhibitors of topoisomerase I and II, alkylating agents and microtubule inhibitors (e.g., taxol), as well as tyrosine kinase inhibitors (e.g., surafenib), EGF kinase inhibitors (e.g., tarceva or erlotinib) and tyrosine kinase inhibitors or ABL kinase inhibitors (e.g. imatinib).
Anti-cancer compounds for co-administration include, for example, agent(s) which may be co-administered with compounds according to the present invention in the treatment of cancer. These agents include chemotherapeutic agents and include one or more members selected from the group consisting of everolimus, trabectedin, abraxane, TLK 286, AV-299, DN-101, pazopanib, GSK690693, RTA 744, ON 0910.Na, AZO 6244 (ARRY-142886), AMN-107, TKI-258, GSK461364, AZD 1152, enzastaurin, vandetanib, ARQ-197, MK-0457, MLN8054, PHA-739358, R-763, AT-9263, a FLT-3 inhibitor, a VEGFR inhibitor, an EGFR TK inhibitor, an aurora kinase inhibitor, a PDC-1 modulator, a Bcl-2 inhibitor, an HDAC inhibitor, a c-MET inhibitor, a PARP inhibitor, a Cdk inhibitor, an EGFR TK inhibitor, an IGFR-TK inhibitor, an anti-HGF antibody, a PI3 kinase inhibitors, an AKT inhibitor, a JAK/STAT inhibitor, a checkpoint-1 or 2 inhibitor, a focal adhesion kinase inhibitor, a Map kinase kinase (rack) inhibitor, a VEGF trap antibody, pemetrexed, erlotinib, dasatanib, nilotinib, decatanib, panitumumab, amrubicin, oregovomab, Lep-etu, nolatrexed, azd2171, batabulin, ofatumumab, zanolimumab, edotecarin, tetrandrine, rubitecan, tesmilifene, oblimersen, ticilimumab, ipilimumab, gossypol, Bio 111, 131-I-TM-601, ALT-110, BIO 140, CC 8490, cilengitide, gimatecan, IL13-PE38QQR, INO 1001, IPdR1 KRX-0402, lucanthone, LY 317615, neuradiab, vitespan, Rta 744, Sdx 102, talampanel, atrasentan, Xr 311, romidepsin, ADS-100380, sunitinib, 5-fluorouracil, vorinostat, etoposide, gemcitabine, doxorubicin, liposomal doxorubicin, 5′-deoxy-5-fluorouridine, vincristine, temozolomide, ZK-304709, seliciclib; PD0325901, AZD-6244, capecitabine, L-Glutamic acid,N-4-[2-(2-amino-4,7-dihydro-4-oxo-1H-pyrrolo[2,3-d 3pyrimidin-5-yl)ethyl]benzoyl]-, disodium salt, heptahydrate, camptothecin, PEG-labeled irinotecan, tamoxifen, toremifene citrate, anastrazole, exemestane, letrozole, DES(diethylstilbestrol), estradiol, estrogen, conjugated estrogen, bevacizumab, IMC-1C11, CHIR-258,); 3-[5-(methylsulfonylpiperadinemethyl)-indolyl]-quinolone, vatalanib, AG-013736, AVE-0005, the acetate salt of [D-Ser(Bu t) 6,Azgly 10] (pyro-Glu-His-Tip-Ser-Tyr-D-Ser(Bu t)-Leu-Arg-Pro-Azgly-NH2 acetate [C59H84N18Oi4-(C2H4O2)x where x=1 to 2.4], goserelin acetate, leuprolide acetate, triptorelin pamoate, medroxyprogesterone acetate, hydroxyprogesterone caproate, megestrol acetate, raloxifene, bicalutamide, flutamide, nilutamide, megestrol acetate, CP-724714; TAK-165, HKI-272, erlotinib, lapatanib, canertinib, ABX-EGF antibody, erbitux, EKB-569, PKI-166, GW-572016, Ionafarnib, BMS-214662, tipifarnib; amifostine, NVP-LAQ824, suberoyl analide hydroxamic acid, valproic acid, trichostatin A, FK-228, SU11248, sorafenib, KRN951, aminoglutethimide, amsacrine, anagrelide, L-asparaginase, Bacillus Calmette-Guerin (BCG) vaccine, bleomycin, buserelin, busulfan, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, clodronate, cyproterone, cytarabine, dacarbazine, dactinomycin, daunorubicin, diethyistilbestrol, epirubicin, fludarabine, fludrocortisone, fluoxymesterone, flutamide, gemcitabine, hydroxyurea, idarubicin, ifosfamide, imatinib, leuprolide, levamisole, lomustine, mechlorethamine, melphalan, 6-mercaptopurine, mesna, methotrexate, mitomycin, mitotane, mitoxantrone, nilutamide, octreotide, oxaliplatin, pamidronate, pentostatin, plicamycin, porfimer, procarbazine, raltitrexed, rituximab, streptozocin, teniposide, testosterone, thalidomide, thioguanine, thiotepa, tretinoin, Vindesine, 13-cis-retinoic acid, phenylalanine mustard, uracil mustard, estramustine, altretamine, floxuridine, 5-deooxyuridine, cytosine arabinoside, 6-mecaptopurine, deoxycoformycin, calcitriol, valrubicin, mithramycin, vinblastine, vinorelbine, topotecan, razoxin, marimastat, COL-3, neovastat, BMS-275291, squalamine, endostatin, SU5416, SU6668, EMD121974, interleukin-12, IM862, angiostatin, vitaxin, droloxifene, idoxyfene, spironolactone, finasteride, cimitidine, trastuzumab, denileukin diftitox, gefitinib, bortezimib, paclitaxel, cremophor-fiee paclitaxel, docetaxel, epithilone B, BMS-247550, BMS-310705, droloxifene, 4-hydroxytamoxifen, pipendoxifene, ERA-923, arzoxifene, fulvestrant, acolbifene, lasofoxifene, idoxifene, TSE-424, HMR-3339, ZK186619, topotecan, PTK787/ZK 222584, VX-745, PD 184352, rapamycin, 40-O-(2-hydroxyethyl)-rapamycin, temsirolinuis, AP-23573, RAD001, ABT-578, BC-210, LY294002, LY292223, LY292696, LY293684, LY293646, wortmannin, ZM336372, L-779,450, PEG-filgrastim, darbepoetin, erythropoietin, granulocyte colony-stimulating factor, zolendranate, prednisone, cetuximab, granulocyte macrophage colony-stimulating factor, histrelin, pegylated interferon alfa-2a, interferon alfa-2a, pegylated interferon alfa-2b, interferon alfa-2b, azacitidine, PEG-L-asparaginase, lenalidomide, gemtuzumab, hydrocortisone, interleukin-11, dexrazoxane, alemtuzumab, all-transretinoic acid, ketoconazole, interleukin-2, megestrol, immune globulin, nitrogen mustard, methylprednisolone, ibritgumomab tiuxetan, androgens, decitabine, hexamethylmelamine, bexarotene, tositumomab, arsenic trioxide, cortisone, editronate, mitotane, cyclosporine, liposomal daunorubicin, Edwina-asparaginase, strontium 89, casopitant, netupitaut, an NK-1 receptor antagonists, palonosetron, aprepitant, diphenhydramine, hydroxyzine, metoclopramide, lorazepam, alprazolam, haloperidol, droperidol, dronabinol, dexamethasone, methylprednisolone, prochlorperazine, granisetron, ondansetron, dolasetron, tropisetron, pegfilgrastim, erythropoietin, epoetin alfa, darbepoetin alfa, ipilimumab, nivolomuab, pembrolizumab, dabrafenib, trametinib and vemurafenib among others.
Co-administration of one of the formulations of the invention with another anticancer agent will often result in a synergistic enhancement of the anticancer activity of the other anticancer agent, an unexpected result. One or more of the present formulations comprising a ATg8 modulator and/or a STX16 modulator and/or a STX17 modulator optionally in combination with an autophagy modulator (autostatin) as described herein may also be co-administered with another bioactive agent (e.g., antiviral agent, antihyperproliferative disease agent, agents which treat chronic inflammatory disease, among others as otherwise described herein).
The term “antiviral agent” refers to an agent which may be used in combination with autophagy modulators (autostatins) as otherwise described herein to treat viral infections, especially including HIV infections, HBV infections and/or HCV infections. Exemplary anti-HIV agents include, for example, nucleoside reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI), protease inhibitors, fusion inhibitors, among others, exemplary compounds of which may include, for example, 3TC (Lamivudine), AZT (Zidovudine), (−)-FTC, ddI (Didanosine), ddC (zalcitabine), abacavir (ABC), tenofovir (PMPA), D-D4FC (Reverset), D4T (Stavudine), Racivir, L-FddC, L-FD4C, NVP (Nevirapine), DLV (Delavirdine), EFV (Efavirenz), SQVM (Saquinavir mesylate), RTV (Ritonavir), IDV (Indinavir), SQV (Saquinavir), NFV (Nelfinavir), APV (Anprenavir), LPV (Lopinavir), fusion inhibitors such as T20, among others, fuseon and mixtures thereof including anti-HIV compounds presently in clinical trials or in development. Exemplary anti-HBV agents include, for example, hepsera (adefovir dipivoxil), lamivudine, entecavir, telbivudine, tenofovir, emtricitabine, clevudine, valtoricitabine, amdoxovir, pradefovir, racivir, BAM 205, nitazoxanide, UT 231-B, Bay 41-4109, EHT899, zadaxin (thymosin alpha-1) and mixtures thereof. Anti-HCV agents include, for example, interferon, pegylated intergeron, ribavirin, NM 283, VX-950 (telaprevir), SCH 50304, TMC435, VX-500, BX-813, SCH503034, R1626, ITMN-191 (R7227), R7128, PF-868554, TT033, CGH-759, GI 5005, MK-7009, SIRNA-034, MK-0608, A-837093, GS 9190, ACH-1095, GSK625433, TG4040 (MVA-HCV), A-831, F351, NS5A, NS4B, ANA598, A-689, GNI-104, IDX102, ADX184, GL59728, GL60667, PSI-7851, TLR9 Agonist, PHX1766, SP-30 and mixtures thereof.
The term “anti-mycobacterial agent” or “anti-tuberculosis agent” shall refer to traditional agents which are used in the art for the treatment of mycobacterial infections, especially including tuberculosis agents. These agents include, for example, one or more of aminosalicyclic acid/aminosalicylate sodium, capreomycin sulfate, clofazimine, cycloserine, ethambutol hydrochloride (myambutol), kanamycin sulfate, pyrazinamide, rifabutin, rifampin, rifapentine, streptomycin sulfate, gatifloxacin and mixtures thereof, all in therapeutically effective amounts, which may be used in conjunction with other agents described herein in the treatment of mycobacterial infections, especially including Mycobacterium tuberculosis (“tuberculosis”) infections.
According to various embodiments, the combination of compositions and/or compounds according to the present invention may be used for treatment or prevention purposes in the form of a pharmaceutical composition. This pharmaceutical composition may comprise one or more of an active ingredient as described herein.
As indicated, the pharmaceutical composition may also comprise a pharmaceutically acceptable excipient, additive or inert carrier. The pharmaceutically acceptable excipient, additive or inert carrier may be in a form chosen from a solid, semi-solid, and liquid. The pharmaceutically acceptable excipient or additive may be chosen from a starch, crystalline cellulose, sodium starch glycolate, polyvinylpyrolidone, polyvinylpolypyrolidone, sodium acetate, magnesium stearate, sodium laurylsulfate, sucrose, gelatin, silicic acid, polyethylene glycol, water, alcohol, propylene glycol, vegetable oil, corn oil, peanut oil, olive oil, surfactants, lubricants, disintegrating agents, preservative agents, flavoring agents, pigments, and other conventional additives. The pharmaceutical composition may be formulated by admixing the active with a pharmaceutically acceptable excipient or additive.
The pharmaceutical composition may be in a form chosen from sterile isotonic aqueous solutions, pulls, drops, pastes, cream, quay (including aerosols), capsules, tablets, sugar coating tablets, granules, suppositories, liquid, lotion, suspension, emulsion, ointment, gel, and the like. Administration route may be chosen from subcutaneous, intravenous, intrathecal, intestinal, parenteral, oral, buccal, nasal, intramuscular, transcutaneous, transdermal, intranasal, intraperitoneal, and topical. The pharmaceutical compositions may be immediate release, sustained/controlled release, or a combination of immediate release and sustained/controlled release depending upon the compound(s) to be delivered, the compound(s), if any, to be coadministered, as well as the disease state and/or condition to be treated with the pharmaceutical composition. A pharmaceutical composition may be formulated with differing compartments or layers in order to facilitate effective administration of any variety consistent with good pharmaceutical practice.
The subject or patient may be chosen from, for example, a human, a mammal such as domesticated animal, or other animal. The subject may have one or more of the disease states, conditions or symptoms associated with autophagy as otherwise described herein.
The compounds according to the present invention may be administered in an effective amount to treat or reduce the likelihood of an autophagy-mediated disease and/or condition as well one or more symptoms associated with the disease state or condition. One of ordinary skill in the art would be readily able to determine an effective amount of active ingredient by taking into consideration several variables including, but not limited to, the animal subject, age, sex, weight, site of the disease state or condition in the patient, previous medical history, other medications, etc.
For example, the dose of an active ingredient which is useful in the treatment of an autophagy mediated disease state, condition and/or symptom for a human patient is that which is an effective amount and may range from as little as 100 μg or even less to at least about 1,000 mg or more, often 1 mg, to 500 mg or more, which may be administered in a manner consistent with the delivery of the drug and the disease state or condition to be treated. In the case of oral administration, active is generally administered from one to four times or more daily. Transdermal patches or other topical administration may administer drugs continuously, one or more times a day or less frequently than daily, depending upon the absorptivity of the active and delivery to the patient's skin. Of course, in certain instances where parenteral administration represents a favorable treatment option, intramuscular administration or slow IV drip may be used to administer active. The amount of active ingredient which is administered to a human patient is an effective amount and preferably ranges from about 0.05 mg/kg to about 20 mg/kg, about 0.1 mg/kg to about 7.5 mg/kg, about 0.25 mg/kg to about 6 mg/kg, about 1.25 to about 5.7 mg/kg.
The dose of a compound according to the present invention may be administered at the first signs of the onset of an autophagy mediated disease state, condition or symptom. For example, the dose may be administered for the purpose of lung or heart function and/or treating or reducing the likelihood of any one or more of the disease states or conditions which become manifest during an inflammation-associated metabolic disorder or tuberculosis or associated disease states or conditions, including pain, high blood pressure, renal failure, or lung failure. The dose of active ingredient may be administered at the first sign of relevant symptoms prior to diagnosis, but in anticipation of the disease or disorder or in anticipation of decreased bodily function or any one or more of the other symptoms or secondary disease states or conditions associated with an autophagy mediated disorder to condition.
Mammalian homologs of the yeast Atg8 protein (mAtg8s) are important in autophagy, but their exact mode of action remains to be defined. Recently, syntaxin 17 (Stx17), a SNARE with major roles in autophagy, was shown to bind mAtg8s. Here we broadened the analysis of potential mAtg8-SNARE interactions and identified LC3-interacting regions (LIRs) in several SNAREs. Syntaxin 16 (Stx16), and its cognate SNARE partners all have LIR motifs and bind mAtg8s. A knockout in STX16 caused defects in lysosome biogenesis whereas a double STX16 and STX17 knockout completely blocked autophagic flux and decreased mitophagy, pexophagy, xenophagy, and ribophagy. Mechanistic analyses revealed that mAtg8s and Stx16 maintained several aspects of lysosomal compartments including their functionality as platforms for active mTOR. These findings reveal a broad direct interaction of mAtg8s with SNAREs with impact on membrane remodeling in eukaryotic cells and expand the roles of mAtg8s to lysosome biogenesis.
A report of direct interaction between mAtg8s and Stx17 (Kumar et al., 2018) has set an unanticipated precedent, and here we explored whether there is a broader range of interactions between mAtg8s and mammalian SNAREs. Using bioinformatics and biochemical approaches, we found additional candidate SNAREs with LIR motifs that bind mAtg8s. Among the candidates, we focused on a cognate set of SNAREs, Stx16, Vti1a and Stx6, previously implicated in retrograde transport between endosomes and the trans-Golgi network (TGN). Through mutational and functional analyses, we found that Stx16 acts synergistically with Stx17 and is important for diverse types of autophagy, including mitophagy, pexophagy, ribophagy, and elimination of intracellular Mycobacterium tuberculosis. We have further found that Stx16 is important for cellular lysosomal content and function, and that mAtg8s modulate Stx16 localization on endolysosomal organelles. This uncovers a mechanism different from the previous views of how mAtg8s help grow autophagosomal and complete autolysosomal membranes. The inventors conclude that mAtg8s control autophagy at least in part by directly binding to SNARE proteins engaged in the biogenesis of the endolysosomal and autolysosomal organelles.
Antibodies: rabbit anti-LC3B (L7543, for WB), rabbit anti-STX17 (HPA001204), and mouse anti-FLAG (F1804, for WB and IP) were from Sigma-Aldrich; mouse anti-LC3 (M152-3, for WB and IP) and rabbit anti-LC3 (PM036, for IF) were from MBL International; mouse anti-p62 (#610833) and mouse anti-GM130 (#610823) were from BD Biosciences; rabbit anti-STX16 (NBP1-92467), rabbit anti-VAMP3 (NB300-510), rabbit anti-VAMP4 (NBP2-13512), rabbit anti-VPS33A (NBP2-20872) and rabbit anti-TGN46 (NBP1-49643) were from Novus Biologicals; mouse anti-STX6 (H00010228-M01, for WB and IP) was from Abnova; mouse anti-Vti1a (sc-136117), mouse anti-VAMP8 (sc-166820) mouse anti-ATG3 (sc-393660) and mouse anti-β-actin (sc-47778) were from Santa Cruz Biotechnology, rabbit anti-VPS41 (ab181078), rabbit anti-PEX14 (ab183885), rabbit anti-PMP70 (ab85550), rabbit anti-GFP (ab290) and rabbit anti-β-tubulin (ab18251) were from Abeam; rabbit anti-LAMP1 (D2D11) (#9091), Phospho-AMPKα (Thr172) (#2531), AMPKα (#2532), Phospho-ULK1 (Ser757) (#6888), ULK1 (D8H5) (#8054), Phospho-4EBP1 (Thr37/46) (#2855), 4E-BP1 (#9452), Phospho-mTOR (Ser2448) (#2971), rabbit anti-mTOR (7C10) (#2981), rabbit anti-LKB1 (27D10) (#3050), and Autophagy Atg8 Family Antibody Sampler Kit (#64459) were from Cell Signaling Technology, mouse anti-LBPA (C64) (MABT837) was from EMD Millipore; mouse anti-DNA antibody (#61014) was from Progen; mouse anti-LAMP2 (H4B4) and mouse anti-M6PR (22d4) were from Developmental Studies Hybridoma Bank (DSHB) at the University of Iowa.
Earle's Balanced Salt Solution (EBSS) (E3024) and hydrogen peroxide solution (H1009) were from Sigma-Aldrich. Bafilomycin A1 was from InvivoGen (Cat Code: tlr1-baf1), CCCP (C2759), oligomycin A (#75351) and antimycin A (A8674) were from Sigma-Aldrich. LysoTracker™ Red DND-99 (L7528) and LysoTracker™ Green DND-26 (L7526) were from Thermo Fisher Scientific and used at 100 nM final concentration for 30 min.
HeLa, HEK293T, U2OS and THP-1 cells wore from the American Type Culture Collection (ATCC). HeLa, HEK293T and U2OS cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 10 mM HEPES, 1.0 mM sodium pyruvate, and 1×penicillin-streptomycin (Thermo Fisher Scientific) at 37° C. in a 5% CO2 atmosphere. THP-1 cells were grown in RPMI 1640 with 2 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES and 1.0 mM sodium pyruvate and supplemented with 0.05 mM β-mercaptoethanol (M6250, Sigma-Aldrich) and 10% FBS. The Huh7 cell line was from Rocky Mountain Laboratory. Keima reporter cell lines HEK293 RPS3-Keima and HCT116 RPL28-Keima were from J. Wade Harper, Harvard University (An and Harper, 2018).
For Co-IP analysis of the interactions between over-expressed Stx16/Vti1a/Stx6 and mAtg8s, HEK293T cells in 10 cm petri dishes were transfected with corresponding plasmids via the ProFection Mammalian Transfection System (E1200, Promega). For other experiments, cells were transfected with Lipofectamine 2000 Transfection Reagent (#11668-019, Thermo Fisher Scientific) according to the manufacturer's manual.
STX16 plasmid was from DNASU (# HsCD00396980); STX6 was from Addgene (#31581); VT11A DNA was PCR amplified from cDNA reverse transcribed from total RNAs isolated from HeLa cells. All constructs were transferred into pDEST-EGFP or pDEST-3×FLAG vectors using Gateway cloning system (#12535-019, Thermo Fisher Scientific), and verified by sequencing at GENEWIZ. EGFP-tagged LC3B and GABARAP constructed in pDEST vector were described before (Alemu et al., 2012). LIR-mutants of STX16 were generated with QuikChange Lightning Site-Directed Mutagenesis Kit (#210519, Agilent).
Recombinant GST and GST-fusion proteins were expressed in competent Escherichia coli SoluBL21 (Genlantis, # C700200) by inducing overnight bacterial cultures with 50-75 μg/mL isopropyl β-D-1-thiogalactopyranoside (IPTG). Expressed proteins were purified by immobilization on Glutathione Sepharose 4 Fast Flow beads (GE Healthcare, #17-5132-01). For GST pull-down assays, myc-tagged proteins were m vitro translated in the presence of radioactive methionine (35S-methionine) using the TNT T7 Reticulocyte Lysate System (Promega, #14610). 10 μL of in vitro translated proteins were first precleared to remove unspecific binding with 10 μL of empty Glutathione Sepharose beads in 100 μL of NETN buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40) supplemented with cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche, #1183617001) for 30 min at 4° C. This was followed by incubation of the precleared mixture with purified GST or GST-fusion proteins for 1-2 h at 4° C. The mixture was washed five times with NETN buffer by centrifugation at 2500×g for 2 minutes followed by addition of 2×SDS gel-loading buffer (100 mM Tris pH 7.4, 4% SDS, 20% Glycerol, 0.2% Bromophenol blue and 200 mM dithiothreitol (DTT) (Sigma, # D0632) and heating for 10 minutes. The reaction was then resolved by SDS-PAGE and the gel stained with Coomassie Brilliant Blue R-250 Dye (Thermo Fisher Scientific, #20278) to visualize the GST and GST-fusion proteins. The gel was then vacuum-dried and radioactive signal detected by Bioimaging analyzer BAS-5000 (Fujifilm).
Peptide arrays of 20-mer amino acids of each SNARE protein were synthesized and immobilized on a membrane with the MultiPrep peptide synthesizer (Intavis Bioanalytical Instruments AG). The membrane was first blocked with 5% non-fat dry milk and then incubated with GST-GABARAP for 24 h. The membrane was washed three times and visualized by immunoblotting with anti-GST antibody as described (Rasmussen et al., 2019).
Generation of Knockout Cells with CRISPR/Cas9 gRNA
Sequences of gRNAs targeting STX16 and STX17 are shown in Fig. EV2A. ATG3 gRNA target sequence: TAGTCCACCACTGTCCAACA; STX6 gRNA target sequence: ACATGTCCCAGCGCATCGGA; VT11A gRNA target sequence: AGATACCACCCCAAAGTCGA. All the single KO and STX16/STX17 DKO HeLa, Huh7, U2GS, THP1 and HeLa-YFP-Parkin cells were generated by infecting target cells with single guide RNA (sgRNA) lentiviral vectors, lentiCRISPRv2, as described in (Sanjana et al., 2014). Briefly, HEK293T cells were transfected with lentiCRISPRv2 sgRNA vectors together with psPAX2 and pMD2.G at the ratio of 4 μg, 2.5 μg, 1.5 μg/6-cm dish. 60 hours later, the supernatants containing lentiviruses were collected and spun down at 1250 rpm for 5 min to clear cell debris. Lentiviruses were diluted with DMEM frill medium at 1:2 ratio and used to infect target cells overnight with the presence of 8 μg/mL of polybrene (Hexadimethrine bromide, H9268, Sigma-Aldrich) in 12-well plates. Then the medium with lentivirus was removed and changed to fresh medium for another 24 hours. Cells were selected with puromycin (1 μg/mL) for 5 days before validation of the knockout. Single clones of HeLa, Huh7 and U2GS KO cells were isolated by seeding single cells in 96-well plates after serial dilutions. For THP1 KO cells, it is impossible to isolate single clones due to their suspension nature, and thus depletion of Stx16 and Stx17 was not complete. Data is shown in Fig EV3C. Generation of LC3 TKO, GABARAP TKO and Hexa KO HeLa cells was described as before (Nguyen et al., 2016b).
Cell lysates were prepared with a standard procedure using RIPA buffer (Pierce, #89900) supplemented with cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche, #1183617001). Protein concentrations were determined using Pierce™ BCA Protein Assay Kit (#23225). Protein electrophoresis was carried out using TGX™ SDS Gels (Bio-Rad, #4561091), followed by blotting to a nitrocellulose membrane (Bio-Rad, #1620112). Membranes were incubated with primary antibodies diluted in blocking buffer (3% BSA diluted in 1×TBS buffer plus 0.05% Tween-20) overnight at 4° C. After incubation with fluorescently labeled secondary antibodies goat-anti-mouse IRDye 680LT or goat-anti-rabbit IRDye 800CW (LI-COR Biosciences) diluted 1:10 000 in blocking buffer, membranes were scanned using a fluorescence scanner Odyssey (LI-COR Biosciences).
For Co-IP of overexpressed proteins, HEK293T cells cultured in 10-cm dishes were lysed with 1 mL NP-40 cell lysis buffer (Invitrogen, FNN0021). Cell lysates were spun down at top speed for 10 min at 4° C. to clear cell debris. The supernatants were collected and incubated with 2.5 μL anti-FLAG antibody (M2) for 4 hours, followed by incubation with Dynabeads® Protein G for 1 hour, and precipitated proteins were subjected to Western blot analysis with rabbit anti-GFP antibody. For endogenous Co-IP analysis, cell lysates were prepared from cells cultured in 15-cm dishes, and incubated with 2.5 μg mouse anti-Stx6 or mouse anti-LC3 antibody overnight at 4° C., followed by Dynabeads® Protein G (Thermo Fisher Scientific, #10004D) binding and Western blot analysis of bound proteins.
For HCM, cells were seeded in 96-well plates. After treatments, cells were washed once with 1×PBS, followed by fixation with 4% paraformaldehyde (PFA) for 5 min at room temperature. Cells were then permeabilized with 0.2% Triton X-100 for 10 min at room temperature. After incubation with blocking buffer (3% goat serum in 1×PBS), cells were stained with primary antibodies in blocking buffer for 1 h at room temperature or overnight at 4° C., followed by staining with secondary antibodies (Alexa Fluro conjugates. Thermo Fisher Scientific) diluted 1:1000 in blocking buffer for 1 h at room temperature. For LysoTracker Red DND-99, cells in 96-well plates were cultured in full medium or starved for 1 h in EBSS, followed by adding LTR for another 30 min at the final concentration of 100 nM. For ImageStream flow cytometry analysis of LysoTracker Green DND-26, cells in 6-cm dishes were starved in EBSS for 1 h, followed by adding LTG for another 30 min at the final concentration of 100 nM. Cells were collected by trypsinization and resuspended in 200 μL 1×PBS for Amnis analysis.
High-content microscopy with automated image acquisition and quantification was carried out using a Cellomics ArrayScan VTI platform (Thermo Fisher Scientific). A minimum of 500 primary objects (valid cells) per well were imaged for the quantifications of intracellular targets (regions of interest, ROI). Scanning parameters and object masks were preset with HCS Studio Scan software for algorithm-defined automated image acquisition and analysis. The images were viewed, and ROI quantified with HCS View software iDEV provided with the Cellomics (Mandell et al, 2014).
ImageStreamX Mark II flow cytometer Amnis® (EMD Millipore) was used to analyze LysoTracker Green DND-26 (LTG) staining after autophagy induction by starvation. The 488 nm laser was used for excitation. Debris and doublets were gated out. Bright field (430-480 nm, Channel 01) and LTG (505-560 nm, Channel 02) channels were measured and at least 8,000 events of single cells per sample were collected. For analysis, the IDEAS version 6.0 software was used. Gating was applied to focused single cells using gradient root mean square of the bright field image then bright field area and aspect ratio, respectively, 50 cells with low/no fluorescent intensity and 50 cells with high fluorescent intensity and verified punctuate LTG staining by image collection from WT cells were selected to create a template. The template was then applied to all other samples in the same experiment to generate quantifications (counts of LTG/cell) for each sample.
Wild type or STX16/STX17DKO HeLa cells were grown in 6-cm dishes until they became semi-confluent. The cells were starved for 2 hours in EBSS, followed by fixation with 2% glutaraldehyde (EM grade) in 0.2 M HEPES, pH 7.4. After 30 min initial incubation, cells were scraped under a small volume of fixative and transferred to Eppendorf tubes. The tubes were spun at full speed for 10 min at room temperature to get a firm pellet. The pellets were continued being fixed until total fixation time is 2 h. Thin sections were cut using an ultramicrotome, collected onto electron microscopy grids and stained with uranyl acetate and lead citrate. In order to count autophagic compartments or Golgi apparatus, 47 images for each sample were taken at primary magnification of 5000×, using the principles of uniform random sampling. The images were zoomed on computer screen. Autophagic compartments and the Golgi apparatus were counted, and the cytoplasmic area was estimated by point counting (Eskelinen, 2008).
M. tuberculosis Killing Assay
M. tuberculosis killing assay was carried out according to previously described (Kumar et al., 2018). Briefly, Mycobacterium tuberculosis Erdman (Erdman) culture was prepared by thawing frozen stock aliquot and grown in 7H9 Middlebrook liquid medium supplemented with oleic acid, albumin, dextrose and catalase (OADC, Becton Dickinson, Inc., Sparks, M D, USA), 0.5% glycerol and 0.05% Tween 80. Cultures were grown at 37° C. WT, STX16KO, STX17KO, and STX16/STX17DKO THP1 cells (Fig. EV3) were infected with Erdman at MOI 10 and incubated with full medium for 18 h or 16 h followed by starvation in EBSS for 2 h to induce autophagy, lysed, and plated on 7H11 agar plates. CFU was enumerated 3 weeks later.
Data, means±SEM (n≥3), were analyzed with paired and unpaired two-tailed Student's/-test, or by one-way or two-way ANOVA (analysis of variance) followed by post hoc Tukey's test. Statistical significance was defined as: †, p≥0.05; *, p<0.05: **, p≤0.01.
Previous studies have indicated that at least one SNARE involved in autophagy, Stx17, harbors a LIR motif that affects its distribution (Kumar et al., 2018). Here we carried out a broader analysis of all SNAREs for presence of putative LIR motifs using bioinformatics and conventional LIR motif consensus (Birgisdottir et al., 2013) followed up by biochemical assays (
Syntaxin 16 Directly Binds mAtg8s Through its LIR Motif
From the panel of SNAREs showing positive signals with GST-GABARAP in peptide arrays, we focused on a set of three cognate SNAREs, Stx16, Vti1a, and Stx6, known to form a complex (Malsam & Söllner, 2011). Co-immunoprecipitation (Co-IP) analyses of over-expressed fusion proteins confirmed that Stx16, Vti1a and Stx6 interact with LC3B and GABARAP (
Complementary to the above experiments with LIR mutations, we tested whether the previously defined LIR-docking site (LDS) in GABARAP (Behrends et al., 2010, Birgisdottir et al., 2013) was responsible for binding to Stx16. Two conserved hydrophobic pockets (HP1 and HP2) are known to define the LIR-docking site of GABARAP (Behrends et al., 2010). The Y49A mutation in the HP1 pocket of GABARAP reduced its interaction with Stx16, whereas the complete LDS mutant (double HP1 and HP2 Y49A/F104A mutation) abrogated GABARAP's binding to Stx16 in GST pull-down assays (
Stx17 has been implicated in mammalian autophagosome-lysosome fusion (Itakura et al., 2012). However, additional SNAREs have now been shown to contribute to this process (Matsui et al., 2018), but relative contributions remain to be fully defined. We generated CRISPR/Cas9-mediated STX17 knockout (KO) in different cell lines (HeLa and Huh7;
When we knocked out STX16 in HeLa cells, this too had no major effects on LC3-II flux (
Mitophagy is a very well-studied process of selective autophagy and is often used as an example to study elimination of defunct organelles (Youle & Narendra, 2011). To further characterize effects of STX16/STX17 double knockout, we employed HCM quantification of mitochondrial DNA (mtDNA) as a measure of cellular mitochondrial content often used in mitophagy studies (Lazarou et al., 2015, Nguyen et al., 2016b). We generated STX16/STX17 DKO in HeLa cells stably expressing YFP-Parkin (Lazarou et al., 2015) (
Pexophagy is another classical example of selective autophagy (Gatica et al., 2018, Manjithaya et al., 2010). We monitored pexophagy in cells treated with H2O2 (Zhang et al., 2015) using liver cell line Huh7, which expresses wild type LKB1 that can activate AMPK (Tan et al., 2018) (
Autophagic defense against intracellular microbes, such as Mycobacterium tuberculosis (Mtb) (Gutierrez et al., 2004), sometimes referred to as xenophagy, is considered to be another form of selective autophagy. We tested the survival of M. tuberculosis in macrophage-like cell line THP1 and compared the effects of Mtb killing in WT, single STX16KO or STX17KO and STX16/STX17DKO cells (
Taken together, these data indicate that STX16/STX17 DKO significantly reduces mitochondrial (Lazarou et al., 2015), peroxisomal (Manjithaya et al., 2010), and bacterial (Mtb) (Gutierrez et al., 2004) clearance under conditions known to induce autophagy (
Keima fluorescent protein has become an important tool for detection of the arrival of autophagy substrates to autolysosomes (Katayama et al., 2011). In functional autolysosomes, despite being in a degradative compartment, Keima protein is stable but changes its spectral properties (illustrated in
When the inventors tested autophagy response by monitoring endogenous LC3 puncta, we found an increase in LC3 dots in STX16 knockout cells (HeLa STX16KO) relative to WT cells, under basal conditions and in EBSS-starved cells (
Prior ultrastructure studies have implicated HOPS component VPS41 in LAMP1 and LAMP2 transport from the TGN to late endosomal compartments (Pols et al., 2013). In STX16KO HeLa cells, there was increased colocalization of detectable LAMP2 with the TGN marker TGN46, normalized for LAMP puncta in HCM quantifications (
Starvation Increases Interactions of Stx16 with the Lysosomal R-SNARE VAMP8
The inventors found that Stx16 interacts with VAMP3 and VAMP4 (Fig. EV3F), consistent with the known literature regarding VAMP3 and VAMP4 as cognate R-SNAREs during retrograde transport from endosomes to TGN (Ganley et al., 2008, Mallard et al., 2002). However, upon starvation another R-SNARE, VAMP8, increased its presence in Stx16 complexes (Fig. EV3F). The lysosomal SNARE VAMP8 (Jahn & Scheller, 2006) has not been previously implicated in Stx16-dependent trafficking, and our findings suggest a new relationship detected only under starvation conditions. Similarly, Stx6, a Qc-SNARE working together with Stx16, showed increased interactions with VAMP8 in starved cells (Fig. EV3F). Thus, similar relationship to VAMP8 was observed with both Stx16 and Stx6. We also noticed increased Stx6-VAMP3 interactions in starved cells (Fig. EV3F), and interpret this as an overall increase in trafficking between TGN and the lysosomal/endosomal pathway.
Stx16 Affects mTOR Regulation
Lysosomes are not only digestive organelles but also serve as a principal cytoplasmic location for active mTOR (Betz & Hall, 2013, Lawrence & Zoncu, 2019, Saxton & Sabatini, 2017). Given that the inventors detected defects in LAMP1/2 levels and profiles (
In resting cells, active mTOR forms cytoplasmic puncta and localizes to lysosomes (Betz & Hall, 2013, Saxton & Sabatini, 2017), but in starved cells mTOR is less punctate and translocates from lysosomes into the cytoplasm (Sancak et al., 2010). Under resting conditions (full medium), mTOR puncta (quantified by HCM) were not reduced in STX16KO vs WT cells (
Since STX16 knockout resulted in reduced cellular content of LAMP1/2, which is in lysosomal and additional acidified endosomal compartments (Lippincott-Schwartz & Fambrough, 1987) (Cheng et al., 2018), we anticipated that the cells might have diminished content of acidified organelles. We used LysoTracker Red DND-99 (LTR) as a standard cell biological probe for acidification of intracellular compartments (Wubbolts et al., 1996). Surprisingly, we found no change in total LTR fluorescence by number of profiles/cell or total area/cell (
Since Stx16 is an mAtg8-binding SNARE (
Endogenous Co-IP analyses showed reduced interactions between components of the Stx16/Vti1a/Stx6 SNARE complex in Tri-GBRPKO and HexaKO cells (
Pursuant to the present invention, the inventors uncovered a broad potential for interactions between the core autophagy components, mAtg8s, and the core membrane fusion system composed of SNAREs. The bioinformatics analyses and follow-up biochemical experiments indicate that mAtg8s and several SNAREs work together in membrane trafficking and organelle biogenesis. One subset of SNAREs interacting with mAtg8s, Stx16-Vti1a-Stx6, was examined in detail, and Stx16 was fully characterized for mAtg8 binding, as has been done for Stx17 (Kumar et al., 2018). This leads us to propose a model departing from the conventional views of how LC3 or other mAtg8s work in autophagy, suggesting a new mechanism of control of membrane trafficking/fusion through direct action of mAtg8s on SNARE molecules (
The inventors' findings with Stx16 indicate a function for mAtg8s in the maintenance of lysosomal compartments (
Human cells have 6 mAtg8s, with proposed but not hilly delineated specialized functions (Shpilka et al., 2011). Their role has been established in the recruitment of several important ancillary factors facilitating membrane fusion at the autophagosome-lysosome fusion stage of the autophagic pathway (Nakamura & Yoshimori, 2017). An early study has shown GABARAPL2/GATE-16 interaction with NSF enhancing its ATPase activity thus implicating it in activation of the Golgi SNARE GOS-28/GOSR1 (Sagiv et al., 2000), of consequence for post-mitotic Golgi reformation (Muller et al., 2002) and intra-Golgi transport (Sagiv et al., 2000). This is in keeping with the results of our screen of mAtg8-interacting SNAREs and is compatible with the concept of mAtg8s directly acting on SNAREs.
Stx16 and its cognate SNAREs have been shown to play a role in retrograde trafficking from endosomal compartments to TGN with two distinct pairings of Qa-, Qb-, and Qc-SNAREs: (i) Stx16, Vti1a, Stx10, required specifically for M6PR transport (we did not observe effects on M6PR relative to TGN46 in our studies), which impacts trafficking of lysosomal hydrolases (Ganiev et al., 2008); and (ii) Stx16, Vti1a, and Stx6, which is independent of the Stx10/M6PR pathway and controls trafficking to TGN of endocytosed incoming toxins bound to membrane glycoconjugates (Mallard et al., 2002). There is also a Stx16-independent retrograde pathway that instead depends on GOS-28/GOSR1 (Tai et al., 2004), another SNARE that incidentally binds mAtg8s (see
Trafficking of various components that make up functional lysosomes is only partially understood (Bright et al., 2016, Luzio et al, 2000, Saftig & Klumpennan, 2009) especially regarding anterograde pathways to lysosomes of integral membrane proteins such as LAMP1/2 and trafficking to and assembly at the lysosome of the V1V0 holoenzyme vacuolar H+-ATPase (Saftig & Klumperman, 2009). Our findings suggest that Stx16 is responsible for LAMP1/2 trafficking to lysosomes with secondary consequences on the overall levels of LAMPs when this delivery is disrupted. It is likely that Six 16 does not affect vacuolar H+-ATPase's ability to function but these acidified compartments may be displaced due to a lack of clearly defined lysosomal destination. Some of STX16KO phenotypes (perturbation of acidified compartments) are echoed in mAtg8s null HexaKO cells, which show diminished overall content of acidified organelles. These phenomena can in part be explained by mAtg8s affecting Stx16 localization. Since HexaKO effects on acidification are more pronounced than the effects of STX16KO, this indicates additional functions for mAtg8s, specifically in H+-ATPase function. For example, it has recently been shown that LC3 affects ATP6V1E1 subunit of the V1 domain of vacuolar H+-ATPase (Guo et al., 2017). Although mAtg8s do not phenocopy in full the Stx16 phenotype, they do affect Stx16 distribution and mTOR activity. Thus, mAtg8s and Stx16 have only partially overlapping effects on the endolysosomal system most likely due to mAtg8 action exceeding the reach of the Stx16 function.
Since lysosomes are the location of active mTOR (Betz & Hall, 2013, Saxton & Sabatini, 2017), we used mTOR activity as another readout of Stx16 effects on the lysosomal function. Somewhat surprisingly, given the strong reduction of LAMP1/2 levels and diminished number of LAMP+ organelles, STX16KO did not show effects on basal mTOR activity. However, during starvation, which inactivates mTOR and triggers its translocation from the lysosomes. mTOR was inhibited far more prominently in STX16KO cells and this was also reflected in fewer mTOR+ cytoplasmic puncta. One interpretation is that the reduced LAMP1/2 content differentially affects subpopulations of lysosomes (Bright et al., 2016) and that the ones that are platforms for active mTOR are preferentially preserved/maintained. Nevertheless, upon stress and perturbance, inactivation of mTOR is more effective and more durable in STX16KO cells. This could be a reflection of altered trigger thresholds dependent on diminished lysosomal sources of nutrients and/or difficulties in re-establishing nutrient equilibrium and mTOR activity. Alternatively, Stx16 may be important in transport to lysosomes of additional mTOR regulatory components important for its reactivation.
The Qa-SNARE Stx17 was first appreciated as a key SNARE in autophagosome-lysosome fusion (Diao et al., 2015, Guo et al., 2014, Itakura et al., 2012, Takats et al., 2013, Wang et al., 2016). Recent studies have uncovered the yeast SNARE, Ykt6, as important in autophagosome-vacuole/lysosome fusion in yeast (Bas et al., 2018, Gao et al., 2018), and that mammalian Ykt6 ortholog (Matsui et al., 2018, Takats et al., 2018) plays a potentially dominant (over Stx17) role in mammalian autophagosome-lysosome fusion. Whereas the exact mechanism of Ykt6 in maturation has not been agreed upon, with differences in proposed models (Matsui et al., 2018, Takats et al., 2018), it is worth noting that Ykt6 is also part of one of retrograde trafficking routes from endosomes to TGN that includes GOS-28/GOSR1 (Tai et al., 2004), an mAtg8-binding SNARE as discussed above. Nevertheless, our data here suggest that Stx17 still plays a very important role in autophagosomal flux, revealed in the requirement for a STX16/STX17 double KO to block autophagic flux using the conventional and well accepted LC3 flux assay (Klionsky et al., 2008), and reflected in autophagic degradation of a diverse panel of substrates: mitochondria, peroxisomes, M. tuberculosis, and ribosomes.
Stx17 interacts via its LIR motif with mAtg8s, and this may play a role in its recruitment to autophagosomes as a prelude to fusion with the lysosomes (Kumar et al., 2018). However, Stx17's role in autophagy begins much earlier, during initiation (Arasaki et al., 2018, Arasaki et al., 2015, Hamasaki et al., 2013, Kumar & al., 2019) ensuring drat once autophagosomes are formed they are enabled for fusion with endolysosomal compartments. The present screen for other SNAREs that bind mAtg8s yielded a number of candidates in addition to Stx16, such as Vti1a and Stx6, which partner with Stx16, and Stx3 and Stx4, SNAREs that are engaged in secretory autophagy (Kimura et al., 2017). This prompts us to suggest that mAtg8s' function in autophagy should be reconsidered and some of its mechanistic principles revisited. We propose that mAtg8s act by reshaping overall membrane trafficking in the cell through direct interactions and effects on specific SNAREs and redirect membrane flow toward autophagy at its initiation and termination stages.
This application claims the benefit of priority of priority of U.S. provisional application No. 62/806,004, filed Feb. 15, 2019 of identical title, the entire contents of which application is incorporated by reference in this application.
This invention was made with government support under R37AI042999, R0IA142999 and P20GM121176 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62806004 | Feb 2019 | US |
